Sample records for encoding lipoic acid

  1. Increased flexibility in the use of exogenous lipoic acid by Staphylococcus aureus.

    PubMed

    Laczkovich, Irina; Teoh, Wei Ping; Flury, Sarah; Grayczyk, James P; Zorzoli, Azul; Alonzo, Francis

    2018-04-16

    Lipoic acid is a cofactor required for intermediary metabolism that is either synthesized de novo or acquired from environmental sources. The bacterial pathogen Staphylococcus aureus encodes enzymes required for de novo biosynthesis, but also encodes two ligases, LplA1 and LplA2, that are sufficient for lipoic acid salvage during infection. S. aureus also encodes two H proteins, GcvH of the glycine cleavage system and the homologous GcvH-L encoded in an operon with LplA2. GcvH is a recognized conduit for lipoyl transfer to α-ketoacid dehydrogenase E2 subunits, while the function of GcvH-L remains unclear. The potential to produce two ligases and two H proteins is an unusual characteristic of S. aureus that is unlike most other Gram positive Firmicutes and might allude to an expanded pathway of lipoic acid acquisition in this microorganism. Here, we demonstrate that LplA1 and LplA2 facilitate lipoic acid salvage by differentially targeting lipoyl domain-containing proteins; LplA1 targets H proteins and LplA2 targets α-ketoacid dehydrogenase E2 subunits. Furthermore, GcvH and GcvH-L both facilitate lipoyl relay to E2 subunits. Altogether, these studies identify an expanded mode of lipoic acid salvage used by S. aureus and more broadly underscore the importance of bacterial adaptations when faced with nutritional limitation. © 2018 John Wiley & Sons Ltd.

  2. Mutations in human lipoyltransferase gene LIPT1 cause a Leigh disease with secondary deficiency for pyruvate and alpha-ketoglutarate dehydrogenase.

    PubMed

    Soreze, Yohan; Boutron, Audrey; Habarou, Florence; Barnerias, Christine; Nonnenmacher, Luc; Delpech, Hélène; Mamoune, Asmaa; Chrétien, Dominique; Hubert, Laurence; Bole-Feysot, Christine; Nitschke, Patrick; Correia, Isabelle; Sardet, Claude; Boddaert, Nathalie; Hamel, Yamina; Delahodde, Agnès; Ottolenghi, Chris; de Lonlay, Pascale

    2013-12-17

    Synthesis and apoenzyme attachment of lipoic acid have emerged as a new complex metabolic pathway. Mutations in several genes involved in the lipoic acid de novo pathway have recently been described (i.e., LIAS, NFU1, BOLA3, IBA57), but no mutation was found so far in genes involved in the specific process of attachment of lipoic acid to apoenzymes pyruvate dehydrogenase (PDHc), α-ketoglutarate dehydrogenase (α-KGDHc) and branched chain α-keto acid dehydrogenase (BCKDHc) complexes. Exome capture was performed in a boy who developed Leigh disease following a gastroenteritis and had combined PDH and α-KGDH deficiency with a unique amino acid profile that partly ressembled E3 subunit (dihydrolipoamide dehydrogenase / DLD) deficiency. Functional studies on patient fibroblasts were performed. Lipoic acid administration was tested on the LIPT1 ortholog lip3 deletion strain yeast and on patient fibroblasts. Exome sequencing identified two heterozygous mutations (c.875C > G and c.535A > G) in the LIPT1 gene that encodes a mitochondrial lipoyltransferase which is thought to catalyze the attachment of lipoic acid on PDHc, α-KGDHc, and BCKDHc. Anti-lipoic acid antibodies revealed absent expression of PDH E2, BCKDH E2 and α-KGDH E2 subunits. Accordingly, the production of 14CO2 by patient fibroblasts after incubation with 14Cglucose, 14Cbutyrate or 14C3OHbutyrate was very low compared to controls. cDNA transfection experiments on patient fibroblasts rescued PDH and α-KGDH activities and normalized the levels of pyruvate and 3OHbutyrate in cell supernatants. The yeast lip3 deletion strain showed improved growth on ethanol medium after lipoic acid supplementation and incubation of the patient fibroblasts with lipoic acid decreased lactate level in cell supernatants. We report here a putative case of impaired free or H protein-derived lipoic acid attachment due to LIPT1 mutations as a cause of PDH and α-KGDH deficiencies. Our study calls for renewed efforts to understand the mechanisms of pathology of lipoic acid-related defects and their heterogeneous biochemical expression, in order to devise efficient diagnostic procedures and possible therapies.

  3. Mutations in human lipoyltransferase gene LIPT1 cause a Leigh disease with secondary deficiency for pyruvate and alpha-ketoglutarate dehydrogenase

    PubMed Central

    2013-01-01

    Background Synthesis and apoenzyme attachment of lipoic acid have emerged as a new complex metabolic pathway. Mutations in several genes involved in the lipoic acid de novo pathway have recently been described (i.e., LIAS, NFU1, BOLA3, IBA57), but no mutation was found so far in genes involved in the specific process of attachment of lipoic acid to apoenzymes pyruvate dehydrogenase (PDHc), α-ketoglutarate dehydrogenase (α-KGDHc) and branched chain α-keto acid dehydrogenase (BCKDHc) complexes. Methods Exome capture was performed in a boy who developed Leigh disease following a gastroenteritis and had combined PDH and α-KGDH deficiency with a unique amino acid profile that partly ressembled E3 subunit (dihydrolipoamide dehydrogenase / DLD) deficiency. Functional studies on patient fibroblasts were performed. Lipoic acid administration was tested on the LIPT1 ortholog lip3 deletion strain yeast and on patient fibroblasts. Results Exome sequencing identified two heterozygous mutations (c.875C > G and c.535A > G) in the LIPT1 gene that encodes a mitochondrial lipoyltransferase which is thought to catalyze the attachment of lipoic acid on PDHc, α-KGDHc, and BCKDHc. Anti-lipoic acid antibodies revealed absent expression of PDH E2, BCKDH E2 and α-KGDH E2 subunits. Accordingly, the production of 14CO2 by patient fibroblasts after incubation with 14Cglucose, 14Cbutyrate or 14C3OHbutyrate was very low compared to controls. cDNA transfection experiments on patient fibroblasts rescued PDH and α-KGDH activities and normalized the levels of pyruvate and 3OHbutyrate in cell supernatants. The yeast lip3 deletion strain showed improved growth on ethanol medium after lipoic acid supplementation and incubation of the patient fibroblasts with lipoic acid decreased lactate level in cell supernatants. Conclusion We report here a putative case of impaired free or H protein-derived lipoic acid attachment due to LIPT1 mutations as a cause of PDH and α-KGDH deficiencies. Our study calls for renewed efforts to understand the mechanisms of pathology of lipoic acid-related defects and their heterogeneous biochemical expression, in order to devise efficient diagnostic procedures and possible therapies. PMID:24341803

  4. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

  5. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  6. Overproduction of α-Lipoic Acid by Gene Manipulated Escherichia coli

    PubMed Central

    Sun, Yirong; Zhang, Wenbin; Ma, Jincheng; Pang, Hongshen; Wang, Haihong

    2017-01-01

    Alpha-lipoic acid (LA) is an important enzyme cofactor widely used by organisms and is also a natural antioxidant for the treatment of pathologies driven by low levels of endogenous antioxidants. In order to establish a safer and more efficient process for LA production, we developed a new biological method for LA synthesis based on the emerging knowledge of lipoic acid biosynthesis. We first cloned the lipD gene, which encodes the lipoyl domain of the E2 subunit of pyruvate dehydrogenase, allowing high levels of LipD production. Plasmids containing genes for the biosynthesis of LA were subsequently constructed utilizing various vectors and promotors to produce high levels of LA. These plasmids were transformed into the Escherichia coli strain BL21. Octanoic acid (OA) was used as the substrate for LA synthesis. One transformant, YS61, which carried lipD, lplA, and lipA, produced LA at levels over 200-fold greater than the wild-type strain, showing that LA could be produced efficiently in E. coli using genetic engineering methods. PMID:28068366

  7. Evaluation of lipoic acid topical application on rats skin wound healing.

    PubMed

    Külkamp-Guerreiro, Irene Clemes; Souza, Marielly Nunes; Bianchin, Mariana Domingues; Isoppo, Mateus; Freitas, Joana Sachetti; Alves, João Alex; Piovezan, Anna Paula; Pohlmann, Adriana Raffin; Guterres, Sílvia Stanisçuaski

    2013-10-01

    To evaluate the effects of lipoic acid (thioctic acid) topical application on wound healing on rats skin, and the consequences of lipoic acid nanoencapsulation on this process. The model used was the healing activity on wounds induced by surgical incision on rats skin (n = 44). The parameters analyzed (11 days) were wound healing rate and histology (vascular proliferation, polymorphonuclear or mononuclear cells, and collagen synthesis or reepithelialization), after application of free lipoic acid or lipoic acid- loaded nanocapsules. The antioxidant activity of these formulations was evaluated by lipid peroxidation test. It was demonstrated for the first time that the topical application of lipoic acid improves wound healing. On the seventh day after surgery, the animals treated with lipoic acid showed increased healing rate (60.7 ± 8.4%) compared to the negative control group (43.0 ± 17.4%), as so improvement of histological parameters. The nanoencapsulation reverted the pro-oxidant activity presented in vitro by lipoic acid, whereas diminished wound repair. The topical application of lipoic acid produced an increase in the skin wound healing, which may be related to its pro-oxidant activity. On the other hand, the nanoencapsulation of the lipoic acid reversed the pro-oxidant activity, although presented minor healing activity.

  8. Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

    PubMed Central

    Yasuno, Rie; Wada, Hajime

    1998-01-01

    Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

  9. Cytochrome c oxidase rather than cytochrome c is a major determinant of mitochondrial respiratory capacity in skeletal muscle of aged rats: role of carnitine and lipoic acid.

    PubMed

    Tamilselvan, Jayavelu; Sivarajan, Kumarasamy; Anusuyadevi, Muthuswamy; Panneerselvam, Chinnakkannu

    2007-09-01

    The release of mitochondrial cytochrome c followed by activation of caspase cascade has been reported with aging in various tissues, whereas little is known about the caspase-independent pathway involved in mitochondrial dysfunction. To determine the functional impact of cytochrome c loss on mitochondrial respiratory capacity, we monitored NADH redox transitions and oxygen consumption in isolated skeletal muscle mitochondria of 4- and 24-month-old rats in the presence and absence of exogenous cytochrome c; and assessed the efficacy of cosupplementation of carnitine and lipoic acid on age-related alteration in mitochondrial respiration. The loss of mitochondrial cytochrome c with age was accompanied with alteration in respiratory transition, which in turn was not rescued by exogenous addition of cytochrome c to isolated mitochondria. The analysis of mitochondrial and nuclear-encoded cytochrome c oxidase subunits suggests that the decreased levels of cytochrome c oxidase may be attributed for the irresponsiveness to exogenously added cytochrome c on mitochondrial respiratory transitions, possibly through reduction of upstream electron carriers. Oral supplementation of carnitine and lipoic acid to aged rats help to maintaining the mitochondrial oxidative capacity by regulating the release of cytochrome c and improves cytochrome c oxidase transcript levels. Thus, carnitine and lipoic acid supplementation prevents the loss of cytochrome c and their associated decline in cytochrome c oxidase activity; thereby, effectively attenuating any putative decrease in cellular energy and redox status with age.

  10. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Gowelli, Hanan M., E-mail: dr_Hanan_el_gowali@hotmail.com; Saad, Evan I.; Abdel-Galil, Abdel-Galil A.

    In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5 mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associatedmore » with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients. - Highlights: • Lipoic acid is more effective than cyclosporine in protection against colitis. • Lipoic acid elevates colon antioxidant defensive mechanism and reduces inflammation. • Co-administration of lipoic acid and cyclosporine aggravates colon damage. • NO/COX-2/miR-210 elevations mediate cyclosporine–lipoic acid interaction.« less

  11. α-Lipoic acid ameliorated oxidative stress induced by perilla oil, but the combination of these dietary factors was ineffective to cause marked deceases in serum lipid levels in rats.

    PubMed

    Ide, Takashi; Tanaka, Ai

    2017-12-01

    Dietary perilla oil rich in α-linolenic acid and α-lipoic acid lowers the serum lipid level through changes in hepatic fatty acid metabolism. We therefore hypothesized that the combination of these dietary factors may ameliorate lipid metabolism more than the factors individually. Moreover, α-lipoic acid exerts strong anti-oxidative activity. Hence, we also hypothesized that α-lipoic acid may attenuate perilla oil-mediated oxidative stress. We therefore studied the combined effects of perilla oil and α-lipoic acid on lipid metabolism and parameters of oxidative stress. Male rats were fed diets supplemented with 0 or 2.0 g/kg R-α-lipoic acid and containing 120 g/kg of palm (saturated fat), corn (linoleic acid), or perilla oil (α-linolenic acid) for 23 days. Perilla oil compared with other fats decreased serum lipid concentrations in rats fed α-lipoic acid-free diets; however, the combination of perilla oil with α-lipoic acid was ineffective for observing more marked decreases in serum lipid levels. Alterations in hepatic fatty acid synthesis and oxidation may account for the observed changes. Perilla oil, compared with palm and corn oils, strongly increased the malondialdehyde level in the serum and liver. α-Lipoic acid counteracted the increases in these parameters even though the effects were attenuated in the liver. α-Lipoic acid increased the parameters of the anti-oxidant system. The results suggested that α-lipoic acid can ameliorate oxidative stress induced by perilla oil, but the combination of these dietary factors was ineffective for additionally reducing serum lipid levels. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Physiological activities of the combination of fish oil and α-lipoic acid affecting hepatic lipogenesis and parameters related to oxidative stress in rats.

    PubMed

    Ide, Takashi

    2018-06-01

    We studied the combined effect of fish oil and α-lipoic acid on hepatic lipogenesis and fatty acid oxidation and parameters of oxidative stress in rats fed lipogenic diets high in sucrose. A control diet contained a saturated fat (palm oil) that gives high rate of hepatic lipogenesis. Male Sprague-Dawley rats were fed diets supplemented with 0 or 2.5 g/kg α-lipoic acid and containing 0, 20, or 100 g/kg fish oil, for 21 days. α-Lipoic acid significantly reduced food intake during 0-8 days but not the later period of the experiment. Fish oil and α-lipoic acid decreased serum lipid concentrations and their combination further decreased the parameters in an additive fashion. The combination of fish oil and α-lipoic acid decreased the activity and mRNA levels of hepatic lipogenic enzymes in an additive fashion. Fish oil increased the parameters of hepatic fatty acid oxidation enzymes. α-Lipoic acid appeared to antagonize the stimulating effects of fish oil of fatty acid oxidation through reductions in the activity of some fatty acid oxidation enzymes. α-Lipoic acid attenuated fish oil-dependent increases in serum and liver malondialdehyde levels, and this compound also reduced the serum 8-hydroxy-2'-deoxyguanosine level. α-Lipoic acid affected various parameters related to the antioxidant system; fish oil also affected some of the parameters. The combination of fish oil and α-lipoic acid effectively reduced serum lipid levels through the additive down-regulation of hepatic lipogenesis. α-Lipoic acid was effective in attenuating fish oil-mediated oxidative stress.

  13. Physiological effect and therapeutic application of alpha lipoic acid.

    PubMed

    Park, Sungmi; Karunakaran, Udayakumar; Jeoung, Nam Ho; Jeon, Jae-Han; Lee, In-Kyu

    2014-01-01

    Reactive oxygen species and reactive nitrogen species promote endothelial dysfunction in old age and contribute to the development of cardiovascular diseases such as atherosclerosis, diabetes, and hypertension. α-Lipoic acid was identified as a catalytic agent for oxidative decarboxylation of pyruvate and α-ketoglutarate in 1951, and it has been studied intensively by chemists, biologists, and clinicians who have been interested in its role in energetic metabolism and protection from reactive oxygen species-induced mitochondrial dysfunction. Consequently, many biological effects of α-lipoic acid supplementation can be attributed to the potent antioxidant properties of α-lipoic acid and dihydro α-lipoic acid. The reducing environments inside the cell help to protect from oxidative damage and the reduction-oxidation status of α-lipoic acid is dependent upon the degree to which the cellular components are found in the oxidized state. Although healthy young humans can synthesize enough α-lipoic acid to scavenge reactive oxygen species and enhance endogenous antioxidants like glutathione and vitamins C and E, the level of α-lipoic acid significantly declines with age and this may lead to endothelial dysfunction. Furthermore, many studies have reported α-lipoic acid can regulate the transcription of genes associated with anti-oxidant and anti-inflammatory pathways. In this review, we will discuss recent clinical studies that have investigated the beneficial effects of α-lipoic acid on endothelial dysfunction and propose possible mechanisms involved.

  14. Alpha lipoic acid selectively inhibits proliferation and adhesion to fibronectin of v-H-ras-transformed 3Y1 cells.

    PubMed

    Yamasaki, Masao; Iwase, Masahiro; Kawano, Kazuo; Sakakibara, Yoichi; Suiko, Masahito; Nishiyama, Kazuo

    2012-05-01

    Here, we focused on the effects of racemic α-lipoic acid on proliferation and adhesion properties of 3Y1 rat fibroblasts and the v-H-ras-transformed derivative, HR-3Y1-2 cells. Racemic α-lipoic acid inhibited proliferation of HR-3Y1-2 but not 3Y1 cells at 0.3 and 1.0 mM. R-(+)-α-lipoic acid also inhibited proliferation of HR-3Y1-2 cells equivalent to that of racemic α-lipoic acid. In addition, racemic α-lipoic acid decreased intracellular reactive oxygen species levels in HR-3Y1 cells but not 3Y1 cells. Next, we evaluated the effects of racemic α-lipoic acid on cell adhesion to fibronectin. The results indicated that racemic α-lipoic acid decreased adhesive ability of HR-3Y1-2 cells to fibronectin-coated plates. As blocking antibody experiment revealed that β1-integrin plays a key role in cell adhesion in this experimental system, the effects of racemic α-lipoic acid on the expression of β1-integrin were examined. The results indicated that racemic α-lipoic acid selectively downregulated the expression of cell surface β1-integrin expression in HR-3Y1-2 cells. Intriguingly, exogenous hydrogen peroxide upregulated cell surface β1-integrin expression in 3Y1 cells. Taken together, these data suggest that reduction of intracellular reactive oxygen species levels by α-lipoic acid could be an effective means of ameliorating abnormal growth and adhesive properties in v-H-ras transformed cells.

  15. Hypotensive effect of alpha-lipoic acid after a single administration in rats.

    PubMed

    Dudek, Magdalena; Razny, Katarzyna; Bilska-Wilkosz, Anna; Iciek, Malgorzata; Sapa, Jacek; Wlodek, Lidia; Filipek, Barbara

    2016-05-01

    The effect of alpha-lipoic acid on blood pressure was investigated many times in chronic studies, but there are no studies on the effect of this compound after a single administration. Alpha-lipoic acid is a drug used in diabetic neuropathy, often in obese patients, to treat hypertension. Therefore, knowledge of the potential antihypertensive effect of alpha-lipoic acid even after a single dose and possibly too much pressure reduction is interesting and useful. The mechanism of the hypotensive effect of alpha-lipoic acid was examined in normotensive rats in vivo after a single intraperitoneal administration, blood pressure in the left carotid artery of the rats was measured prior to the administration of the compounds (alpha- lipoic acid and/or glibenclamide) and 80 min thereafter. Alpha-lipoic acid at a dosage of 50 mg/kg b.w. i.p. significantly decreased the blood pressure from the 50th min after drug administration. This cardiovascular effect of this compound was reversed by glibenclamide, a selective KATP blocker. Glibenclamide alone at this dose did not significantly affect the blood pressure. Statistical significance was evaluated using two-way ANOVA. This suggests that alpha-lipoic acid affects ATP-dependent potassium channels. It is possible that this is an indirect effect of hydrogen sulfide because alpha-lipoic acid can increase its concentration. The results obtained in this study are very important because the patients taking alpha-lipoic acid may be treated for co-existing hypertension. Therefore, the possibility of blood pressure lowering by alpha-lipoic acid should be taken into account, although it does not lead to excessive orthostatic hypotension.

  16. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid.

    PubMed

    Zorzoli, Azul; Grayczyk, James P; Alonzo, Francis

    2016-10-01

    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental in dictating pathogen proclivity for an infectious niche.

  17. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis

    2016-01-01

    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental in dictating pathogen proclivity for an infectious niche. PMID:27701474

  18. PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

    PubMed

    Feng, Youjun; Cronan, John E

    2014-01-01

    Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  19. Lipoic Acid Exerts Antioxidant and Anti-inflammatory Effects in Response to Heat Shock in C2C12 Myotubes.

    PubMed

    Lee, Cheng-Tse; Chang, Li-Ching; Wu, Pei-Fung

    2016-06-01

    This study explored that lipoic acid treatment for 24 h significantly upregulated and promoted heat shock-induced catalase expression and downregulated GPx1 messenger RNA (mRNA) expression, indicating that lipoic acid exhibits antioxidant activity in the decomposition of hydrogen peroxide by upregulating catalase expression. Moreover, lipoic acid treatment for 3 h increased and promoted heat shock-induced interleukin (IL)-6 mRNA and protein levels and that for 24 h downregulated IL-6 mRNA expression, suggesting a dual effect of lipoic acid on IL-6 regulation. Lipoic acid alone failed to increase or reduce tumor necrosis factor (TNF)-α mRNA and protein levels, whereas heat shock alone downregulated TNF-α mRNA and protein expression. These data suggest that lipoic acid does not have a proinflammatory role and that heat shock acts as an anti-inflammatory agent by downregulating TNF-α expression in C2C12 myotubes. Moreover, lipoic acid or heat shock alone upregulated the IL-6 receptor (IL-6R-α) and glycoprotein 130 (gp130) mRNA expression followed by IL-6 expression; these data indicate that the regulation of lipoic acid or heat shock is mediated by IL-6R signaling, thus suggesting that C2C12 myotubes possesses a mechanism for regulating IL-6R and gp130 expression following lipoic acid treatment or heat shock.

  20. α-Lipoic acid inhibits the migration and invasion of breast cancer cells through inhibition of TGFβ signaling.

    PubMed

    Tripathy, Joytirmay; Tripathy, Anindita; Thangaraju, Muthusamy; Suar, Mrutyunjay; Elangovan, Selvakumar

    2018-05-23

    Invasion and metastasis are the main cause of mortality in breast cancer. Hence, novel therapeutic interventions with high specificity toward invasion and metastasis are necessary. α-Lipoic acid showed antiproliferative and cytotoxic effects on several cancers including breast cancer. However, the effect of lipoic acid on breast cancer metastasis remains unclear. In the present study, we examined the effects of lipoic acid on the migration and invasion of MDA-MB-231 and 4 T1 breast cancer cells. Our data showed that lipoic acid effectively inhibited the colony forming ability of highly invasive MDA-MB-231 and 4 T1 cells. Moreover, the nontoxic concentrations of lipoic acid significantly reduced the migration of breast cancer cells. Lipoic acid also inhibited the TGFβ-induced angiopoietin-like 4 (ANGPTL4) expression and reduced the activity of matrix metalloproteinase-9 (MMP-9), an enzyme involved in invasion and metastasis, in both the cell lines. The inhibition of cell migration by lipoic acid is accompanied by the downregulation of FAK, ERK1/2 and AKT phosphorylation, and inhibition of nuclear translocation of β-catenin. Our data demonstrated that lipoic acid inhibited the migration and invasion of metastatic breast cancer cells at least in part through inhibiting ERK1/2 and AKT signaling. Thus, our findings show that the inhibition of TGFβ signaling is a potential mechanism for the anti-invasive effects of lipoic acid. Copyright © 2017. Published by Elsevier Inc.

  1. Effect of Lipoic Acid on Serum Paraoxonase-1 and Paraoxonase-3 Protein Levels and Activities in Diabetic Rats.

    PubMed

    Ozgun, E; Ozgun, G S; Gokmen, S S; Eskıocak, S; Sut, N; Akıncı, M; Goncu, E; Cakır, E

    2016-02-05

    The aim of the present study was to investigate the effect of streptozotocin-induced diabetes mellitus and lipoic acid treatment on serum paraoxonase-1 and paraoxonase-3 protein levels and paraoxonase, arylesterase and lactonase activities.36 rats were equally and randomly divided into 4 groups as control, lipoic acid, diabetes and diabetes+lipoic acid. To induce diabetes, a single dose of streptozotocin (40 mg/kg) was injected intraperitoneally to diabetes and diabetes+lipoic acid groups. Lipoic acid (10 mg/kg/day) was injected intraperitoneally for 14 days to lipoic acid and diabetes+lipoic acid groups. Serum PON1 and PON3 protein levels were measured by western blotting. Serum paraoxonase, arylesterase and lactonase activities were determined by the measuring initial rate of substrate (paraoxon, phenylacetate and dihydrocoumarin) hydrolysis.Streptozotocin-induced diabetes mellitus caused a significant decrease whereas lipoic acid treatment caused a significant increase in serum PON1 and PON3 protein levels and paraoxonase, arylesterase and lactonase activities. The increase percent of serum PON3 protein was higher than that of serum PON1 protein and the increase percent of serum lactonase activity was higher than that of serum paraoxonase and arylesterase activities in diabetes+lipoic acid group.We can report that, like PON1 protein, PON3 protein and actually its lactonase activity may also have a role as an antioxidant in diabetes mellitus and lipoic acid treatment may be useful for the prevention of the atherosclerotic complications of diabetes by increasing serum PON1 and PON3 protein levels and serum enzyme activities. © Georg Thieme Verlag KG Stuttgart · New York.

  2. Combined effect of sesamin and α-lipoic acid on hepatic fatty acid metabolism in rats.

    PubMed

    Ide, Takashi; Azechi, Ayana; Kitade, Sayaka; Kunimatsu, Yoko; Suzuki, Natsuko; Nakajima, Chihiro

    2013-04-01

    Dietary sesamin (1:1 mixture of sesamin and episesamin) decreases fatty acid synthesis but increases fatty acid oxidation in rat liver. Dietary α-lipoic acid lowers hepatic fatty acid synthesis. These changes can account for the serum lipid-lowering effect of sesamin and α-lipoic acid. It is expected that the combination of these compounds in the diet potentially ameliorates lipid metabolism more than the individual compounds. We therefore studied the combined effect of sesamin and α-lipoic acid on lipid metabolism in rats. Male Sprague-Dawley rats were fed diets supplemented with 0 or 2 g/kg sesamin and containing 0 or 2.5 g/kg α-lipoic acid for 22 days. Sesamin and α-lipoic acid decreased serum lipid concentrations and the combination of these compounds further decreased the parameters in an additive fashion. These compounds reduced the hepatic concentration of triacylglycerol, the lignan being less effective in decreasing this value. The combination failed to cause a stronger decrease in hepatic triacylglycerol concentration. The combination of sesamin and α-lipoic acid decreased the activity and mRNA levels of hepatic lipogenic enzymes in an additive fashion. Sesamin strongly increased the parameters of hepatic fatty acid oxidation enzymes. α-Lipoic acid antagonized the stimulating effect of sesamin of fatty acid oxidation through reductions in the activity of some fatty acid oxidation enzymes and carnitine concentration in the liver. This may account for the failure to observe strong reductions in hepatic triacylglycerol concentration in rats given a diet containing both sesamin and α-lipoic acid.

  3. Anti-inflammatory and anti-oxidative effects of alpha-lipoic acid in experimentally induced acute otitis media.

    PubMed

    Tatar, A; Korkmaz, M; Yayla, M; Gozeler, M S; Mutlu, V; Halici, Z; Uslu, H; Korkmaz, H; Selli, J

    2016-07-01

    To investigate the anti-inflammatory, anti-oxidative and tissue protective effects, as well as the potential therapeutic role, of alpha-lipoic acid in experimentally induced acute otitis media. Twenty-five guinea pigs were assigned to one of five groups: a control (non-otitis) group, and otitis-induced groups treated with saline, penicillin G, alpha-lipoic acid, or alpha-lipoic acid plus penicillin G. Tissue samples were histologically analysed, and oxidative parameters in tissue samples were measured and compared between groups. The epithelial integrity was better preserved, and histological signs of inflammation and secretory metaplasia were decreased, in all groups compared to the saline treated otitis group. In the alpha-lipoic acid plus penicillin G treated otitis group, epithelial integrity was well preserved and histological findings of inflammation were significantly decreased compared to the saline, penicillin G and alpha-lipoic acid treated otitis groups. The most favourable oxidative parameters were observed in the control group, followed by the alpha-lipoic acid plus penicillin G treated otitis group. Alpha-lipoic acid, with its antioxidant, anti-inflammatory and tissue protective properties, may decrease the clinical sequelae and morbidity associated with acute otitis media.

  4. Effects of two antioxidants; α-lipoic acid and fisetin against diabetic cataract in mice.

    PubMed

    Kan, Emrah; Kiliçkan, Elif; Ayar, Ahmet; Çolak, Ramis

    2015-02-01

    The purpose of this study was to determine whether α-lipoic acid and fisetin have protective effects against cataract in a streptozotocin-induced experimental cataract model. Twenty-eight male BALB/C mice were made diabetic by the intraperitoneal administration of streptozotocin (200 mg/kg). Three weeks after induction of diabetes, mice were divided randomly into 4 groups in which each group contained 7 mice; fisetin-treated group (group 1), α-lipoic acid-treated group (group 2), fisetin placebo group (group 3), α-lipoic acid placebo group (group 4). Fisetin and α-lipoic acid were administered intraperitoneally weekly for 5 weeks. Cataract development was assessed at the end of 8 weeks by slit lamp examination, and cataract formation was graded using a scale. All groups developed at least grade 1 cataract formation. In the fisetin-treated group, the cataract stages were significantly lower than in the placebo group (p = 0.02). In the α-lipoic acid-treated group, the cataract stages were lower than in the placebo group but it did not reach to a significant value. Both fisetin and α-lipoic acid had a protective effect on cataract development in a streptozotocin-induced experimental cataract model. The protective effect of fisetin appears as though more effective than α-lipoic acid.

  5. Effects of lipoic Acid on acrylamide induced testicular damage.

    PubMed

    Lebda, Mohamed; Gad, Shereen; Gaafar, Hossam

    2014-06-01

    Acrylamide is very toxic to various organs and associated with significant increase of oxidative stress and depletion of antioxidants. Alpha-lipoic acid enhances cellular antioxidant defense capacity, thereby protecting cells from oxidative stress. This study aimed to evaluate the protective role of alpha-lipoic acid on the oxidative damage induced by acrylamide in testicular and epididymal tissues. Forty adult male rats were divided into four groups (10 rats each). Control group; acrylamide treated group administered acrylamide 0.05% (w/v) in drinking water for 21 days; alpha-lipoic acid group received basal diet supplemented with 1% alpha-lipoic acid and forth group was exposed to acrylamide and treated with alpha-lipoic acid at the same doses and treatment regimen mentioned before. The administration of acrylamide resulted in significant elevation in testicular and epididymal malondialdehyde level (MDA) and significant reduction in the level of reduced glutathione (GSH) and the activities of glutathione-S-transferase (GST), glutathione peroxidase (GPX) and glutathione reductase (GR). Also, acrylamide significantly reduced serum total testosterone and progesterone but increased estradiol (E2) levels. Treatment with alpha-lipoic acid prior to acrylamide induced protective effects and attenuated these biochemical changes. Alpha-lipoic acid has been shown to possess antioxidant properties offering promising efficacy against oxidative stress induced by acrylamide administration.

  6. Effect of lipoic acid combined with paclitaxel on breast cancer cells.

    PubMed

    Li, B J; Hao, X Y; Ren, G H; Gong, Y

    2015-12-22

    Breast cancer is the most common gynecologic tumor globally that threatens women's health. Lipoic acid is a type of antioxidant that can alleviate oxidative stress damage. Studies showed that lipoic acid could inhibit the proliferation of tumor cells in cervical cancer and colon cancer. This paper intends to explore the combined effect of lipoic acid and paclitaxel on breast cancer cells. Breast cancer MCF-7 cells were divided into four groups: control group, lipoic acid group, paclitaxel group, and a combination group. MTT was applied to detect the drugs' influence on breast cancer cell proliferation. A colony formation test was used to determine the effects on breast cancer cell clone formation rate. Western blot was performed to detect the effects on nuclear factor (NF)-κB. Lipoic acid alone can inhibit tumor cell proliferation and clone formation with time dependence. Compared with the control, paclitaxel alone can significantly suppress tumor cell proliferation and clone formation (P < 0.05). Lipoic acid and paclitaxel in combination obviously strengthened their individual inhibitory effects on tumor cells (P < 0.05). Compared with the paclitaxel alone group, the combination group exhibited more remarkable inhibitory effect (P < 0.05). Lipoic acid alone or combined with paclitaxel can inhibit NF-κB expression and inhibit breast cancer cell proliferation.

  7. Alteration of fatty acid profile and nucleotide-related substances in post-mortem breast meat of α-lipoic acid-fed broiler chickens.

    PubMed

    Hamano, Y

    2016-08-01

    The present study was conducted to determine the effects of α-lipoic acid supplementation on post-mortem changes in the fatty acid profile and concentrations of nucleotide-related substances, especially those of a taste-active compound, inosine 5'-monophosphate, in chicken meat. Mixed-sex broiler chicks aged 14 d were divided into three groups of 16 birds each and were fed on diets supplemented with α-lipoic acid at levels of 0, 100 or 200 mg/kg for 4 weeks. Blood and breast muscle samples were taken at 42 d of age under the fed condition and then after fasting for 18 h. The breast muscle obtained from fasted chickens was subsequently refrigerated at 2°C for one and 3 d. α-Lipoic acid supplementation did not affect any plasma metabolite concentration independently of feeding condition, while a slight increase in plasma glucose concentration was shown with both administration levels of α-lipoic acid. In early post-mortem breast muscle under the fed condition, α-lipoic acid had no effect on concentrations of fatty acids or nucleotides of ATP, ADP, and AMP. In post-mortem breast tissues obtained from fasted chickens, total fatty acid concentrations were markedly increased by α-lipoic acid feeding at 200 mg/kg irrespective of length of refrigeration. This effect was dependent on stearic acid, oleic acid, linoleic acid and linolenic acid. However, among fatty acids, the only predominantly increased unsaturated fatty acid was oleic acid. Dietary supplementation with α-lipoic acid at 200 mg/kg increased the inosine 5'-monophosphate concentration in breast meat and, in contrast, reduced the subsequent catabolites, inosine and xanthine, regardless of the length of refrigeration. Therefore, the present study suggests that α-lipoic acid administration altered the fatty acid profile and improved meat quality by increasing taste-active substances in the post-mortem meat obtained from fasted chickens.

  8. Lipoic Acid Combined with Epalrestat versus Lipoic Acid in Treating Diabetic Peripheral Neuropathy:A Meta-analysis.

    PubMed

    Wang, Xiao-Tong; Lin, Hai-Xiong; Xu, Shu-Ai; Lu, Ying-Kun

    2017-10-30

    Objective To compare the clinical effectiveness of lipoic acid combined with epalrestat versus lipoic acid in treating diabetic peripheral neuropathy(DPN). Methods Randomized controlled trials(RCTs) and clinical controlled trials on lipoic acid versus epalrestat for DPN before February 2016 were searched through five databases:CNKI,CBM,VIP,Wanfang,and PubMed. The quality of the included trials were assessed using Cochrane software and Jadad scores. Data were analyzed with Review Manager 5.3 software. Results Nine studies were included in the analysis. Meta analysis showed that the lipoic aid monotherapy was significantly inferior to lipoic acid-epalerestat combination therapy [RR=0.58,95%Cl(0.47,0.71),P<0.00001]. Inferiority of the lipoic acid monotherapy was also shown in nerve conduction velocity with WMDs of-4.94 [95%Cl(-7.41,-2.46),P<0.0001] for median motor nerve conduction velocity(MNCV),-5.08 [95%Cl(-7.68,-2.49),P=0.0001] for peroneal MNCV,-4.24 [95%Cl(-6.20,-2.29),P<0.0001] for median sensory nerve conduction velocity(SNCV),and-3.66 [95%Cl(-5.02,-2.31),P<0.00001] for peroneal SNCV. Sensitivity analysis showed that the results were robust. However,the included trials were limited by simple design,few subjective indicators,and short follow-up time. Conclusions Lipoic acid combined with epalrestat is better than lipoic acid alone in the treatment of DPN,as well as the MNCV and SNCV of median or peroneal nerve. Due to the low quality of the included studies,high-quality RCTs are warranted to validate the results.

  9. In vitro evaluation of α-lipoic acid-loaded lipid nanocapsules for topical delivery.

    PubMed

    Xia, Nan; Liu, Tian; Wang, Qiang; Xia, Qiang; Bian, Xiaoli

    2017-09-01

    This study aimed at in vitro evaluation of α-lipoic acid-loaded lipid nanocapsules for topical delivery, which was prepared by hot high-pressure homogenisation. Stable particles could be formed and particle size was 148.54 ± 2.31 nm with polydispersity index below 0.15. Encapsulation efficiency and drug loading of α-lipoic acid were 95.23 ± 0.45% and 2.81 ± 0.37%. Antioxidant study showed α-lipoic acid could be protected by lipid nanocapsules without loss of antioxidant activity. Sustained release of α-lipoic acid from lipid nanocapsules was obtained and cumulative release was 62.18 ± 1.51%. In vitro percutaneous study showed the amount of α-lipoic acid distributed in skin was 1.7-fold than permeated. Cytotoxicity assay and antioxidant activity on L929 cells indicated this formulation had low cytotoxicity and ability of protecting cells from oxidative damage within specific concentration. These studies suggested α-lipoic acid-loaded lipid nanocapsules could be potential formulation for topical delivery.

  10. The effect of alpha-lipoic acid on mitochondrial superoxide and glucocorticoid-induced hypertension.

    PubMed

    Ong, Sharon L H; Vohra, Harpreet; Zhang, Yi; Sutton, Matthew; Whitworth, Judith A

    2013-01-01

    To examine the effect of alpha-lipoic acid, an antioxidant with mitochondrial superoxide inhibitory properties, on adrenocorticotrophic hormone- (ACTH-HT) and dexamethasone-induced hypertensions (DEX-HT) in rats and if any antihypertensive effect is mediated via mitochondrial superoxide inhibition. In a prevention study, rats received ground food or alpha-lipoic-acid-laced food (10 mg/rat/day) for 15 nights. Saline, adrenocorticotrophic hormone (ACTH, 0.2 mg/kg/day), or dexamethasone (DEX, 10  μ g/rat/day) was injected subcutaneously from day 5 to day 11. In a reversal study, rats received alpha-lipoic-acid-laced food 4 days after commencement of saline or DEX. Tail-cuff systolic blood pressure (SBP) was measured second daily. Kidney mitochondrial superoxide was examined using (MitoSOX) Red (MitoSOX) via flow cytometry. SBP was increased by ACTH (P < 0.0005) and DEX (P < 0.0005). Alpha-lipoic acid alone did not alter SBP. With alpha-lipoic acid pretreatment, SBP was increased by ACTH (P' < 0.005) but not by DEX. Alpha-lipoic partially prevented ACTH-HT (P' < 0.0005) and fully prevented DEX-HT (P' < 0.0005) but failed to reverse DEX-HT. ACTH and DEX did not increase MitoSOX signal. In ACTH-hypertensive rats, high-dose alpha-lipoic acid (100 mg/rat/day) did not decrease SBP further but raised MitoSOX signal (P < 0.001), suggesting prooxidant activity. Glucocorticoid-induced hypertension in rats is prevented by alpha-lipoic acid via mechanisms other than mitochondrial superoxide reduction.

  11. Antioxidant capacity and stability of liposomes containing a triglyceride derivative of lipoic acid

    USDA-ARS?s Scientific Manuscript database

    The multi-functional nutritional agent lipoic acid offers numerous beneficial effects to oxidatively stressed tissues. Lipoic acid was enzymatically incorporated into a triglyceride in conjunction with oleic acid, creating lipoyl dioleoylglycerol, and then chemically reduced to form dihydrolipoyl d...

  12. Effect of lipoic acid on paraoxonase-1 and paraoxonase-3 protein levels, mRNA expression and arylesterase activity in liver hepatoma cells.

    PubMed

    Ozgun, Eray; Sayilan Ozgun, Gulben; Tabakcioglu, Kiymet; Suer Gokmen, Selma; Sut, Necdet; Eskiocak, Sevgi

    2017-10-01

    Paraoxonase-1 (PON1) and PON3 (PON3) are anti-atherosclerotic enzymes, synthesized primarily in liver and bound to HDL in circulation. The aim of the present study was to investigate the effects of therapeutic doses of lipoic acid on PON1 and PON3 protein levels, mRNA expression and arylesterase activity in liver. We treated HepG2 cells with 10, 40 and 200 μM lipoic acid for 72 h. Cell viability was evaluated by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide assay. PON1 and PON3 protein levels were measured by Western blotting, their mRNA expression was measured by quantitative PCR and arylesterase activity was measured spectrophotometrically. 200 µM lipoic acid caused a significant increase on PON1 and PON3 protein levels and arylesterase activity as compared with control, 10 µM and 40 µM lipoic acid-treated cells. 200 µM lipoic acid also caused a significant decrease on PON1 mRNA expression whereas on a significant increase PON3 mRNA expression as compared with control, 10 µM and 40 µM lipoic acid-treated cells. Our study showed that although lipoic acid up-regulates PON3 but down-regulates PON1 mRNA expression, it increases both PON1 and PON3 protein levels and arylesterase activity in HepG2 cells. We can report that lipoic acid may be useful for preventing atherosclerosis at therapeutic doses.

  13. Evaluation of the protective effect of α-lipoic acid on cisplatin ototoxicity using distortion-product otoacoustic emission measurements: an experimental animal study.

    PubMed

    Ozkul, Yilmaz; Songu, Murat; Basoglu, Mehmet Sinan; Ozturkcan, Sedat; Katilmis, Huseyin

    2014-07-01

    The aim of our study was to determine the effectiveness of intratympanic α-lipoic acid injection as an otoprotective agent against cisplatin-induced ototoxicity in guinea pigs. Twenty-four adult male albino guinea pigs with normal hearing were divided into 4 groups. The guinea pigs received intraperitoneal cisplatin in group 1, intraperitoneal cisplatin and intratympanic α-lipoic acid in group 2, intratympanic α-lipoic acid in group 3, as well as intraperitoneal cisplatin and intratympanic saline in group 4. Distortion-product otoacoustic emission measurements were obtained for both ears at the following time points: before administration (baseline recording) and on day 3 (72 h later). In group 1 (cisplatin), significant deterioration was observed at all frequencies on day 3 (P < 0.05). In group 2 (cisplatin + α-lipoic acid), deterioration was observed at all frequencies on day 3; however, this deterioration did not reach a statistical significance (P > 0.05). In group 3 (α-lipoic acid), no significant difference was observed between baseline and day 3 (P > 0.05). In group 4 (cisplatin + saline), deterioration was observed at all frequencies on day 3; however, this deterioration did not reach a statistical significance (P > 0.05). Cisplatin-induced hearing loss in the guinea pigs may be limited to some extent by the concomitant use of α-lipoic acid. Dose-dependent changes in the possible effects of α-lipoic acid need further investigation. Future morphologic studies may contribute to expose clearly the protective effect of α-lipoic acid.

  14. α-Lipoic acid reduced weight gain and improved the lipid profile in rats fed with high fat diet.

    PubMed

    Seo, Eun Young; Ha, Ae Wha; Kim, Woo Kyoung

    2012-06-01

    The purpose of this study was to investigate the effects of α-lipoic acid on body weight and lipid profiles in Sprague-Dawley rats fed a high fat diet (HFD). After 4 weeks of feeding, rats on the HFD were divided into three groups by randomized block design; the first group received the high-fat-diet (n = 10), and the second group received the HFD administered with 0.25% α-lipoic acid (0.25LA), and the third group received the high-fat diet with 0.5% α-lipoic acid (0.5LA). The high fat diet with α-lipoic acid supplemented groups had significantly inhibited body weight gain, compared to that in the HFD group (P < 0.05). Organ weights of rats were also significantly reduced in liver, kidney, spleen, and visible fat tissues in rats supplemented with α-lipoic acid (P < 0.05). Significant differences in plasma lipid profiles, such as total lipids, total cholesterol, triglycerides, low-density lipoprotein, and high-density lipoprotein, were observed between the HFD and 0.5LA groups. The atherogenic index and the plasma high density lipoprotein-cholesterol/total cholesterol ratio improved significantly with α-lipoic acid supplementation in a dose-dependent manner (P < 0.05). Total hepatic cholesterol and total lipid concentration decreased significantly in high fat fed rats supplemented with α-lipoic acid in a dose-dependent manner (P < 0.05), whereas liver triglyceride content was not affected. In conclusion, α-lipoic acid supplementation had a positive effect on weight gain and plasma and liver lipid profiles in rats.

  15. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade.

    PubMed

    El-Gowelli, Hanan M; Saad, Evan I; Abdel-Galil, Abdel-Galil A; Ibrahim, Einas R

    2015-11-01

    In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associated with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  17. The α-lipoic acid improves high-fat diet-induced cerebral damage through inhibition of oxidative stress and inflammatory reaction.

    PubMed

    Liu, Yang; Zhang, Qinghua; Wang, Li; Wang, Hui; Sun, Tao; Xia, Hechun; Yang, Yi; Zhang, Li

    2017-12-01

    This study is to clarify the protective role of α-lipoic acid in high-fat diet-induced cerebral damage mice. The mice were divided into 5 groups: normal control group, high-fat diet (HFD) group, low-dose α-lipoic acid group for prevention, high-dose α-lipoic acid group for prevention, and high-dose α-lipoic acid group for treatment. The groups' weights and blood glucose changes were monitored. We used HE staining to observe morphological changes in the cerebral cortex. The expression levels of the oxidative stress proteins SOD2, catalase, and the inflammatory pathway proteins p-JNK, p-ERK were measured by western blot and immunochemistry. Compared with the control group, the quantity of cortical neurons in the HFD group was decreased, and the samples exhibited retrogression. However, the lipoic acid significantly protected and promoted the cortical neurons survival. Moreover, compared with the HFD group, the expression levels of SOD2 and catalase in the three α-lipoic acid obtained groups were significantly increased. However, the expression levels of the inflammatory pathway proteins p-JNK and p-ERK were significantly decreased. These results indicate that theα-lipoic acid greatly protects the cortical neurons, and inhibited the oxidative stress and inflammatory reactions in the high-fat diet mice. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Comparison of the Protective Effects of Radix Astragali, α-Lipoic Acid, and Vitamin E on Acute Acoustic Trauma.

    PubMed

    Xiong, Min; Lai, Huangwen; Yang, Chuanhong; Huang, Weiyi; Wang, Jian; Fu, Xiaoyan; He, Qinglian

    2012-01-01

    Oxidative damage is a critical role which involves hearing loss induced by impulse noise. That exogenous antioxidant agents reduce noise induced hearing loss (NIHL) has been well demonstrated in both animal studies and clinical practices. Choosing a stronger and more effective antioxidant is very important for treatment of NIHL. Vitamin E, α-lipoic acid, and radix astragali are the most commonly used anti-oxidants for cochlear oxidative damage from acoustic trauma. In this study, the protective effects of radix astragali, α-lipoic acid, and vitamin E on acute acoustic trauma are investigated. Guinea pigs in the experimental groups were intragastrically administered vitamin E, α-lipoic acid, and radix astragali. Auditory thresholds were assessed by sound-evoked auditory brainstem response (ABR) at click and tone bursts of 8, 16 and 32 kHz, 24 hours before and 72 hours after exposure to impulse noise. Cochlear malondialdehyde (MDA) concentrations were detected. Hair cell damage was analyzed by scanning electron microscopy. Vitamin E, α-lipoic acid, and radix astragali significantly reduced ABR deficits, reduced hair cell damage, and decreased the concentrations of MDA. α-lipoic acid and radix astragali were better than vitamin E, and there were no significant differences between α-lipoic acid and radix astragali. α-lipoic acid or radix astragali are recommended for treatment of NIHL.

  19. Glutathionylation of α-ketoglutarate dehydrogenase: the chemical nature and relative susceptibility of the cofactor lipoic acid to modification.

    PubMed

    McLain, Aaron L; Cormier, Peter J; Kinter, Michael; Szweda, Luke I

    2013-08-01

    α-Ketoglutarate dehydrogenase (KGDH) is reversibly inhibited when rat heart mitochondria are exposed to hydrogen peroxide (H2O2). H2O2-induced inhibition occurs through the formation of a mixed disulfide between a protein sulfhydryl and glutathione. Upon consumption of H2O2, glutaredoxin can rapidly remove glutathione, resulting in regeneration of enzyme activity. KGDH is a key regulatory site within the Krebs cycle. Glutathionylation of the enzyme may therefore represent an important means to control mitochondrial function in response to oxidative stress. We have previously provided indirect evidence that glutathionylation occurs on lipoic acid, a cofactor covalently bound to the E2 subunit of KGDH. However, lipoic acid contains two vicinal sulfhydryls and rapid disulfide exchange might be predicted to preclude stable glutathionylation. The current study sought conclusive identification of the site and chemistry of KGDH glutathionylation and factors that control the degree and rate of enzyme inhibition. We present evidence that, upon reaction of free lipoic acid with oxidized glutathione in solution, disulfide exchange occurs rapidly, producing oxidized lipoic acid and reduced glutathione. This prevents the stable formation of a glutathione-lipoic acid adduct. Nevertheless, 1:1 lipoic acid-glutathione adducts are formed on KGDH because the second sulfhydryl on lipoic acid is unable to participate in disulfide exchange in the enzyme's native conformation. The maximum degree of KGDH inhibition that can be achieved by treatment of mitochondria with H2O2 is 50%. Results indicate that this is not due to glutathionylation of a subpopulation of the enzyme but, rather, the unique susceptibility of lipoic acid on a subset of E2 subunits within each enzyme complex. Calcium enhances the rate of glutathionylation by increasing the half-life of reduced lipoic acid during enzyme catalysis. This does not, however, alter the maximal level of inhibition, providing further evidence that specific lipoic acid residues within the E2 complex are susceptible to glutathionylation. These findings offer chemical information necessary for the identification of mechanisms and physiological implications of KGDH glutathionylation. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Alpha-lipoic acid improves high-fat diet-induced hepatic steatosis by modulating the transcription factors SREBP-1, FoxO1 and Nrf2 via the SIRT1/LKB1/AMPK pathway.

    PubMed

    Yang, Yi; Li, Wang; Liu, Yang; Sun, Yuning; Li, Yan; Yao, Qing; Li, Jianning; Zhang, Qian; Gao, Yujing; Gao, Ling; Zhao, Jiajun

    2014-11-01

    Understanding the mechanism by which alpha-lipoic acid supplementation has a protective effect upon nonalcoholic fatty liver disease in vivo and in vitro may lead to targets for preventing hepatic steatosis. Male C57BL/6J mice were fed a normal diet, high-fat diet or high-fat diet supplemented with alpha-lipoic acid for 24 weeks. HepG2 cells were incubated with normal medium, palmitate or alpha-lipoic acid. The lipid-lowering effects were measured. The protein expression and distribution were analyzed by Western blot, immunoprecipitation and immunofluorescence, respectively. We found that alpha-lipoic acid enhanced sirtuin 1 deacetylase activity through liver kinase B1 and stimulated AMP-activated protein kinase. By activating the sirtuin 1/liver kinase B1/AMP-activated protein kinase pathway, the translocation of sterol regulatory element-binding protein-1 into the nucleus and forkhead box O1 into the cytoplasm was prevented. Alpha-lipoic acid increased adipose triacylglycerol lipase expression and decreased fatty acid synthase abundance. In in vivo and in vitro studies, alpha-lipoic acid also increased nuclear NF-E2-related factor 2 levels and downstream target amounts via the sirtuin 1 pathway. Alpha-lipoic acid eventually reduced intrahepatic and serum triglyceride content. The protective effects of alpha-lipoic acid on hepatic steatosis appear to be associated with the transcription factors sterol regulatory element-binding protein-1, forkhead box O1 and NF-E2-related factor 2. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2'-bipyridyl, lipoic, kojic and picolinic acids.

    PubMed

    Çevik, Kübra; Ulusoy, Seyhan

    2015-08-01

    The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. The inhibitory activity of 2,2'-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation.

  2. The Effect of Alpha-Lipoic Acid on Mitochondrial Superoxide and Glucocorticoid-Induced Hypertension

    PubMed Central

    Ong, Sharon L. H.; Vohra, Harpreet; Zhang, Yi; Sutton, Matthew; Whitworth, Judith A.

    2013-01-01

    Aims. To examine the effect of alpha-lipoic acid, an antioxidant with mitochondrial superoxide inhibitory properties, on adrenocorticotrophic hormone- (ACTH-HT) and dexamethasone-induced hypertensions (DEX-HT) in rats and if any antihypertensive effect is mediated via mitochondrial superoxide inhibition. Methods. In a prevention study, rats received ground food or alpha-lipoic-acid-laced food (10 mg/rat/day) for 15 nights. Saline, adrenocorticotrophic hormone (ACTH, 0.2 mg/kg/day), or dexamethasone (DEX, 10 μg/rat/day) was injected subcutaneously from day 5 to day 11. In a reversal study, rats received alpha-lipoic-acid-laced food 4 days after commencement of saline or DEX. Tail-cuff systolic blood pressure (SBP) was measured second daily. Kidney mitochondrial superoxide was examined using (MitoSOX) Red (MitoSOX) via flow cytometry. Results. SBP was increased by ACTH (P < 0.0005) and DEX (P < 0.0005). Alpha-lipoic acid alone did not alter SBP. With alpha-lipoic acid pretreatment, SBP was increased by ACTH (P′ < 0.005) but not by DEX. Alpha-lipoic partially prevented ACTH-HT (P′ < 0.0005) and fully prevented DEX-HT (P′ < 0.0005) but failed to reverse DEX-HT. ACTH and DEX did not increase MitoSOX signal. In ACTH-hypertensive rats, high-dose alpha-lipoic acid (100 mg/rat/day) did not decrease SBP further but raised MitoSOX signal (P < 0.001), suggesting prooxidant activity. Conclusion. Glucocorticoid-induced hypertension in rats is prevented by alpha-lipoic acid via mechanisms other than mitochondrial superoxide reduction. PMID:23533693

  3. Effect of lipoic acid and α-glyceryl-phosphoryl-choline on astroglial cell proliferation and differentiation in primary culture.

    PubMed

    Grasso, S; Bramanti, V; Tomassoni, D; Bronzi, D; Malfa, G; Traini, E; Napoli, M; Renis, M; Amenta, F; Avola, R

    2014-01-01

    Lipoic acid plays a crucial role as antioxidant and metabolic component of enzymes involved in glucose metabolism of different cell types. Choline alphoscerate (α-glyceryl-phosphoryl-choline [αGPC]) is a semisynthetic derivative of phosphatidylcholines representing, among acetilcholine precursors, a cholinergic drug. In the present study, we evaluated the expression of some proliferation and differentiation markers in 15 or 21 DIV astrocyte cultures treated with 50 μM (+)lipoic acid or (+/-)lipoic acid and/or 10 mM αGPC for 24 hr. In addition, we evaluated the possible genoprotective effect by analysis of DNA status detected by alkaline comet assay. The addition of single drugs [(+)lipoic acid, (+/-)lipoic acid, or αGPC] induced an "upward modulation" of the expression of biomarkers used in our study. On the contrary, the cotreatment with either (+)lipoic acid + αGPC or (+/-)lipoic + αGPC surprisingly showed no significant modification or even a downregulation of the above-mentioned biomarkers. This latter finding demonstrated no additional effect after the cotreatment with both drugs with respect to the single treatments alone. Further studies are necessary to clarify the specific mechanism evoked by the processing of these neuroprotective agents in our in vitro models. Finally, these preliminary findings may represent a good tool with which to clarify the antioxidant and metabolic roles played by lipoic acid in proliferating and differentiating astroglial cell cultures, during an interactive cross-talk between glial and neuronal cells, after brain lesions or damage correlated with oxidative stress that may occur in some degenerative diseases. Copyright © 2013 Wiley Periodicals, Inc.

  4. Antidiabetic effect of the α-lipoic acid γ-cyclodextrin complex.

    PubMed

    Naito, Yuki; Ikuta, Naoko; Nakata, Daisuke; Terao, Keiji; Matsumoto, Kinuyo; Kajiwara, Naemi; Okano, Ayaka; Yasui, Hiroyuki; Yoshikawa, Yutaka

    2014-09-01

    In recent years, the number of patients suffering from diabetes mellitus has been increasing worldwide. In particular, type 2 diabetes mellitus, a lifestyle-related disease, is recognized as a serious disease with various complications. Many types of pharmaceutics or specific health foods have been used for the management of diabetes mellitus. At the same time, the relationship between diabetes mellitus and α-lipoic acid has been recognized for many years. In this study, we found that the α-lipoic acid γ-cyclodextrin complex exhibited an HbA1c lowering effect for treating type 2 diabetes mellitus in animal models. Moreover, in this study, we investigated the activation of phosphorylation of AMP-activated protein kinase, which plays a role in cellular energy homeostasis, in the liver of KKA(y) mice by using α-lipoic acid and the α-lipoic acid γ-cyclodextrin complex. Our results show that the α-lipoic acid γ-cyclodextrin complex strongly induced the phosphorylation of AMP-activated protein kinase. Thus, we concluded that intake of the α-lipoic acid γ-cyclodextrin complex exerted an antidiabetic effect by suppressing the elevation of postprandial hyperglycemia as well as doing exercise.

  5. Nonlinear Optical Properties of Au-Nanoparticles Conjugated with Lipoic Acid in Water

    NASA Astrophysics Data System (ADS)

    Trejo-Durán, M.; Cornejo-Monroy, D.; Alvarado-Méndez, E.; Olivares-Vargas, A.; Castano, V. M.

    2014-08-01

    Gold nanoparticles were chemically conjugated with lipoic acid to control their optical properties. Z-scan and other optical techniques were used to characterize the non-linear behavior of the resulting nanostructured materials. The results show that the nonlinearity is of thermal origin, which can be controlled by the use of lipoic acid as well as other organic molecules conjugated onto metal nanoparticles. In particular, the presence of lipoic acid increases n_2 and dn/dT.

  6. Glutathionylation of α-ketoglutarate dehydrogenase: The chemical nature and relative susceptibility of the cofactor lipoic acid to modification

    PubMed Central

    McLain, Aaron L.; Cormier, Peter J.; Kinter, Michael; Szweda, Luke I.

    2013-01-01

    α-Ketoglutarate dehydrogenase (KGDH) is reversibly inhibited when rat heart mitochondria are exposed to hydrogen peroxide (H2O2). H2O2-induced inhibition occurs through the formation of a mixed disulfide between a protein sulfhydryl and glutathione. Upon consumption of H2O2, glutaredoxin can rapidly remove glutathione, resulting in regeneration of enzyme activity. KGDH is a key regulatory site within the Krebs cycle. Glutathionylation of the enzyme may therefore represent an important means to control mitochondrial function in response to oxidative stress. We have previously provided indirect evidence that glutathionylation occurs on lipoic acid, a cofactor covalently bound to the E2 subunit of KGDH. However, lipoic acid contains two vicinal sulfhydryls and rapid disulfide exchange might be predicted to preclude stable glutathionylation. The current study sought conclusive identification of the site and chemistry of KGDH glutathionylation and factors that control the degree and rate of enzyme inhibition. We present evidence that, upon reaction of free lipoic acid with oxidized glutathione in solution, disulfide exchange occurs rapidly, producing oxidized lipoic acid and reduced glutathione. This prevents the stable formation of a glutathione–lipoic acid adduct. Nevertheless, 1:1 lipoic acid–glutathione adducts are formed on KGDH because the second sulfhydryl on lipoic acid is unable to participate in disulfide exchange in the enzyme’s native conformation. The maximum degree of KGDH inhibition that can be achieved by treatment of mitochondria with H2O2 is 50%. Results indicate that this is not due to glutathionylation of a subpopulation of the enzyme but, rather, the unique susceptibility of lipoic acid on a subset of E2 subunits within each enzyme complex. Calcium enhances the rate of glutathionylation by increasing the half-life of reduced lipoic acid during enzyme catalysis. This does not, however, alter the maximal level of inhibition, providing further evidence that specific lipoic acid residues within the E2 complex are susceptible to glutathionylation. These findings offer chemical information necessary for the identification of mechanisms and physiological implications of KGDH glutathionylation. PMID:23567190

  7. The effects of α-lipoic acid on aortic injury and hypertension in the rat remnant kidney (5/6 nephrectomy) model.

    PubMed

    Ergür, Bekir Uğur; Çilaker Mıcılı, Serap; Yılmaz, Osman; Akokay, Pınar

    2015-06-01

    The present study was designed to investigate the effects of α-lipoic acid on the abdominal aorta and hypertension in a remnant kidney model histomorphometrically, immunohistochemically, and ultrastructurally. We surgically reduced the renal tissue mass to 5/6 by applying a remnant kidney model. The rats were divided into 4 groups: Group 1- control group, Group 2- lipoic acid group, Group 3- 5/6 nephrectomy group, and Group IV: 5/6 nephrectomy+lipoic acid-treated group. Lipoic acid solution 100 mg/kg was administered by oral gavage for 8 weeks to Groups II and IV. At the end of the experiment, systemic mean blood pressure was monitored. Then, aortic tissues were removed and fixed. After routine histological procedures, tissue sections were examined histochemically, immunohistochemically (type I angiotensin receptor, vascular endothelial growth factor, alpha-smooth muscle actin), and ultrastructurally. The blood pressure measurements in 5/6 nephrectomy group were significantly higher compared to other groups. In the 5/6 nephrectomy+lipoic acid group, measured blood pressure values and tunica media thickness were significantly lower than in the 5/6 nephrectomy group. In the 5/6 nephrectomy+lipoic acid group, decreased aortic wall thickness, regularity in the structure of elastic fibrils, and more organized elastic lamellae were seen. The expression of type I angiotensin receptor, vascular endothelial growth factor, alpha-smooth muscle actin in the 5/6 nephrectomy+lipoic acid group was decreased compared to the 5/6 nephrectomy group. In the present study, we found that α-lipoic acid could be a favorable agent for the target organ effects of secondary hypertension.

  8. The effect of systemic lipoic acid on hearing preservation after cochlear implantation via the round window approach: A guinea pig model.

    PubMed

    Chang, Mun Young; Gwon, Tae Mok; Lee, Ho Sun; Lee, Jun Ho; Oh, Seung Ha; Kim, Sung June; Park, Min-Hyun

    2017-03-15

    The present study aimed to evaluate the effects of systemic lipoic acid on hearing preservation after cochlear implantation. Twelve Dunkin-Hartley guinea pigs were randomly divided into two groups: the control group and the lipoic acid group. Animals in the lipoic acid group received lipoic acid intraperitoneally for 4 weeks. A sterilised silicone electrode-dummy was inserted through the round window to a depth of approximately 5 mm. The hearing level was measured using auditory brainstem responses (ABRs) prior to electrode-dummy insertion, and at 4 days and 1, 2, 3 and 4 weeks after electrode-dummy insertion. The threshold shift was defined as the difference between the pre-operative threshold and each of the post-operative thresholds. The cochleae were examined histologically 4 weeks after electrode-dummy insertion. Threshold shifts changed with frequency but not time. At 2kHz, ABR threshold shifts were statistically significantly lower in the lipoic acid group than the control group. At 8, 16 and 32kHz, there was no significant difference in the ABR threshold shift between the two groups. Histologic review revealed less intracochlear fibrosis along the electrode-dummy insertion site in the lipoic acid group than in the control group. The spiral ganglion cell densities of the basal, middle and apical turns were significantly higher in the lipoic acid group compared with the control group. Therefore, systemic lipoic acid administration appears to effectively preserve hearing at low frequencies in patients undergoing cochlear implantation. These effects may be attributed to the protection of spiral ganglion cells and prevention of intracochlear fibrosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Radiation-induced cognitive dysfunction and cerebellar oxidative stress in mice: protective effect of alpha-lipoic acid.

    PubMed

    Manda, Kailash; Ueno, Megumi; Moritake, Takashi; Anzai, Kazunori

    2007-02-12

    Reactive oxygen species are implicated in neurodegeneration and cognitive disorders due to higher vulnerability of neuronal tissues. The cerebellum is recently reported to be involved in cognitive function. Therefore, present study aimed at investigating the role alpha-lipoic acid against radiation-induced oxidative stress and antioxidant status in cerebellum and its correlation with cognitive dysfunction. We observed spontaneous motor activities and spatial memory task of mice using pyroelectric infrared sensor and programmed video tracking system, respectively. Whole body X-irradiation (6 Gy) of mice substantially impaired the reference memory and motor activities of mice. However, acute intraperitoneal treatment of mice with alpha-lipoic acid prior to irradiation significantly attenuated such cognitive dysfunction. Alpha-lipoic acid pretreatment exerted a very high magnitude of protection against radiation-induced augmentation of protein carbonyls and thiobarbituric acid reactive substance (TBARS) in mice cerebellum. Further, radiation-induced deficit of total, nonprotein and protein-bound sulfhydryl (T-SH, NP-SH, PB-SH) contents of cerebellum and plasma ferric reducing power (FRAP) was also inhibited by alpha-lipoic acid pre-treatment. Moreover, alpha-lipoic acid treated mice showed an intact cytoarchitecture of cerebellum, higher counts of intact Purkinje cells and granular cells in comparison to untreated irradiated mice. Results clearly indicate that alpha-lipoic acid is potent neuroprotective antioxidant.

  10. Alleviative effects of α-lipoic acid supplementation on acute heat stress-induced thermal panting and the level of plasma nonesterified fatty acids in hypothyroid broiler chickens.

    PubMed

    Hamano, Y

    2012-01-01

    1. The present study was conducted to examine the effects of α-lipoic acid on hypothyroidism-induced negative growth performance and whether α-lipoic acid alleviates acute heat stress in relation to hypothyroid status. 2. Female broiler chickens (14 d-old) were fed diets supplemented with α-lipoic acid (100 mg/kg) and an antithyroid substance, propylthiouracil (200 mg/kg), for 20 d under thermoneutral conditions (25°C). At 42 d of age, chickens were exposed to a high ambient temperature (36°C, 60% RH) for 4 h. 3. Under the thermoneutral condition, propylthiouracil administration decreased feed efficiency and concomitantly increased adipose tissue and thyroid gland weights. Plasma nonesterified fatty acids and triacylglycerol were also increased by propylthiouracil administration. However, α-lipoic acid supplementation did not affect the hypothyroidism-induced effects. 4. In hypothyroid chickens, the rise in respiratory rate induced by heat exposure was greatly inhibited by α-lipoic acid administration at 1 h, but this effect had disappeared at 4 h. In addition, a similar inhibitory effect on the concentrations of plasma nonesterified fatty acids was subsequently observed at 4 h. 5. Therefore, the present study suggested that α-lipoic acid alleviates acute heat stress if chickens are in a hypothyroid status.

  11. Effects of α-lipoic acid supplementation on sexual difference of growth performance, heat exposure-induced metabolic response and lipid peroxidation of raw meat in broiler chickens.

    PubMed

    Hamano, Y

    2014-01-01

    1. The effects of α-lipoic acid administration on sexual differences in growth performance, heat exposure-induced metabolic response and lipid peroxidation of raw meat in broiler chickens were studied. 2. Two-week-old male and female broiler chicks were divided into two groups each, as a 2 × 2 factorial arrangement. Half the birds were fed on a diet supplemented with α-lipoic acid (100 mg/kg) and half on a control diet. All groups were reared to 6 weeks of age at 25°C and, thereafter, exposed to 33°C for 8 h per day for 3 d. 3. Under thermo-neutral conditions, α-lipoic acid decreased feed consumption and body weight gain of male chickens. However, the feed conversion rate and tissue mass of breast muscle and abdominal fat were unchanged. 4. In plasma metabolites, α-lipoic acid increased the molar ratio of non-esterified fatty acids to free glycerol, regardless of sex and heat exposure. A decrease in β-hydroxybutyrate was observed in the α-lipoic acid-fed male chickens. In the heat-exposed chickens, α-lipoic acid lowered the molar ratio of plasma lactate to pyruvate in relation to the enhanced concentrations of plasma pyruvate. However, no sexual difference was observed. 5. The value of thiobarbituric acid reactive substances in breast meat of heat-stressed chickens that was refrigerated for 3 or 7 d was higher in males than in females. An antioxidative effect of α-lipoic acid was observed in the meat of male chickens. 6. The present study suggests that the α-lipoic acid-inducing fatty acid metabolism and antioxidative effect persisted during the heat stress, even though a sexual difference in the responsiveness was seen in broiler chickens.

  12. Dispersive liquid-liquid microextraction combined with microwave-assisted derivatization for determining lipoic acid and its metabolites in human urine.

    PubMed

    Tsai, Chia-Ju; Chen, Yen-Ling; Feng, Chia-Hsien

    2013-10-04

    This study explored dispersive liquid-liquid microextraction for extraction and concentration of lipoic acid in human urine. To improve the detection of lipoic acid by both capillary liquid chromatography (CapLC) with UV detection and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), microwave-assisted derivatization with 4-bromomethyl-6,7-dimethoxycoumarin was performed to render lipoic acid chromophores for UV detection and also high ionization efficiency in MALDI. All parameters that affected lipoic acid extraction and derivatization from urine were investigated and optimized. In the analyses of human urine samples, the two methods had a linear range of 0.1-20 μM with a correlation coefficient of 0.999. The detection limits of CapLC-UV and MALDI-TOF MS were 0.03 and 0.02 μM (S/N ≧ 3), respectively. The major metabolites of lipoic acid, including 6,8-bismethylthio-octanoic acid, 4,6-bismethylthio-hexanoic acid, and 2,4-bismethylthio-butanoic acid were also extracted by dispersive liquid-liquid microextraction and detected by MALDI-TOF MS. The minor metabolites (undetectable by MALDI-TOF MS), bisnorlipoic acid and tetranorlipoic acid were also extracted by dispersive liquid-liquid microextraction and identified with an LTQ Orbitrap mass spectrometer. After dispersive liquid-liquid microextraction and microwave-assisted derivatization, all lipoic acid derivatizations and metabolites were structurally confirmed by LTQ Orbitrap. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Lipoic acid metabolism and mitochondrial redox regulation.

    PubMed

    Solmonson, Ashley D; DeBerardinis, Ralph J

    2017-11-30

    Lipoic acid is an essential cofactor for mitochondrial metabolism and is synthesized de novo using intermediates from mitochondrial fatty acid synthesis type II, S-adenosylmethionine and iron-sulfur clusters. This cofactor is required for catalysis by multiple mitochondrial 2-ketoacid dehydrogenase complexes, including pyruvate dehydrogenase, alpha-ketoglutarate dehydrogenase, and branched-chain ketoacid dehydrogenase. Lipoic acid also plays a critical role in stabilizing and regulating these multi-enzyme complexes.  Many of these dehydrogenases are regulated by reactive oxygen species, mediated through the disulfide bond of the prosthetic lipoyl moiety.  Collectively, its functions explain why lipoic acid is required for cell growth, mitochondrial activity and coordination of fuel metabolism. Lipoic acid is an essential cofactor for mitochondrial metabolism and is synthesized de novo using intermediates from mitochondrial fatty acid synthesis type II, S-adenosylmethionine and iron-sulfur clusters. This cofactor is required for catalysis by multiple mitochondrial 2-ketoacid dehydrogenase complexes, including pyruvate dehydrogenase, alpha-ketoglutarate dehydrogenase, and branched-chain ketoacid dehydrogenase. Lipoic acid also plays a critical role in stabilizing and regulating these multi-enzyme complexes.  Many of these dehydrogenases are regulated by reactive oxygen species, mediated through the disulfide bond of the prosthetic lipoyl moiety.  Collectively, its functions explain why lipoic acid is required for cell growth, mitochondrial activity and coordination of fuel metabolism. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  14. Therapeutic efficacy of DL-alpha-lipoic acid on cyclosporine A induced renal alterations.

    PubMed

    Amudha, Ganapathy; Josephine, Anthony; Mythili, Yenjerla; Sundarapandiyan, Rajaguru; Varalakshmi, Palaninathan

    2007-10-01

    The present study was designed to evaluate the possible beneficial effect of lipoic acid in preventing the renal damage induced by cyclosporine A in rats. Male albino rats of Wistar strain were divided into four groups and treated as follows. Two groups received cyclosporine A by oral gavage (25 mg/kg/body weight) for 21 days to induce nephrotoxicity, one of which simultaneously received lipoic acid treatment (20 mg/kg body weight) for 21 days. A vehicle (olive oil) and a lipoic acid drug control were also included. Cyclosporine A induced renal damage was evident from the decreased activities of tissue marker enzymes (alkaline phosphatase, acid phosphatase, lactate dehydrogenase, aspartate transaminase and alanine transaminase) and decreased activities of ATPases (Na+, K+-ATPase, Ca2+-ATPase and Mg2+ ATPase). An apparent increase in the levels of serum constituents (urea, uric acid and creatinine) and urinary marker enzymes (N-acetyl-beta-D-glucosaminidase, beta-glucosidase, beta-galactosidase, cathepsin-D and gamma-glutamyl transpeptidase) along with significant decline in creatinine clearance were seen in the cyclosporine treated rats, which was reversed upon treatment with lipoic acid. Ultrastructural observations were also in agreement with the above abnormal changes. Lipoic acid effectively reverted these abnormal biochemical changes and minimized the morphological lesions in renal tissue. Hence, this study clearly exemplifies that lipoic acid might be an ideal choice against cyclosporine A induced cellular abnormalities.

  15. Safety of oral alpha-lipoic acid treatment in pregnant women: a retrospective observational study.

    PubMed

    Parente, E; Colannino, G; Picconi, O; Monastra, G

    2017-09-01

    Alpha-lipoic acid is a natural molecule, which directly or by means of its reduced form, dihydrolipoic acid, exerts antioxidant, anti-inflammatory and immunomodulatory activities, very helpful also in preventing miscarriage and preterm delivery. Used as dietary supplement alpha-lipoic acid was demonstrated to be safe for living organisms even when administered at high doses. However, no study was made so far to verify the safety of its continuous administration on a substantial number of pregnant women. The present investigation was performed to answer this issue. An observational retrospective study was carried out analyzing 610 expectant mothers. They had been treated daily by oral route with 600 mg alpha-lipoic acid, for at least 7 weeks during gestation. The primary outcome was to verify alpha-lipoic acid safety in the mother and infant. Maternal safety was assessed by monitoring for adverse reactions, physical and clinical examination, including a morbidity assessment. Laboratory and clinical examinations were performed monthly. Neonatal safety was assessed by the evaluation of birth weight, gestational age, Apgar scores, neonatal death with the related cause of death. Data collected from the Birth Registry of Campania Region were used as control. This study provided a very clear and reassuring picture about the safety of alpha-lipoic acid oral treatment during pregnancy. No adverse effect was noticed in mothers or newborns. The two sets of monitored data, from treated and controls, were completely superimposable or, in some cases, better in alpha-lipoic acid group. Our results open a reassuring scenario regarding the administration of alpha-lipoic acid during pregnancy.

  16. Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2’-bipyridyl, lipoic, kojic and picolinic acids

    PubMed Central

    Çevik, Kübra; Ulusoy, Seyhan

    2015-01-01

    Objective(s): The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. Materials and Methods: The inhibitory activity of 2,2’-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. Results: The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. Conclusion: It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation. PMID:26557964

  17. Effect of lipoic acid consumption on oxidative stress among multiple sclerosis patients: a randomized controlled clinical trial.

    PubMed

    Khalili, Mohammad; Eghtesadi, Shahryar; Mirshafiey, Abbas; Eskandari, Ghazaleh; Sanoobar, Meisam; Sahraian, Mohamad Ali; Motevalian, Abbas; Norouzi, Abbas; Moftakhar, Shirin; Azimi, Amirreza

    2014-01-01

    Multiple sclerosis is a neurodegenerative and demyelinating disease of central nervous system. High levels of oxidative stress are associated with inflammation and play an important role in pathogenesis of multiple sclerosis. This double-blind, randomized controlled clinical study was carried out to determine the effect of daily consumption of lipoic acid on oxidative stress among multiple sclerosis patients. A total of 52 relapsing-remitting multiple sclerosis patients, aged 18-50 years with Expanded Disability Status Scale ≤5.5 were assigned to consume either lipoic acid (1200 mg/day) or placebo capsules for 12 weeks. Fasting blood samples were collected before the first dose taken and 12 hours after the last. Dietary intakes were obtained by using 3-day dietary records. Consumption of lipoic acid resulted in a significant improvement of total antioxidant capacity (TAC) in comparison to the placebo group (P = 0.004). Although a significant change of TAC (-1511 mmol/L, P = 0.001) was found within lipoic acid group, other markers of oxidative stress including superoxide dismutase activity, glutathione peroxidase activity, and malondialdehyde levels were not affected by lipoic acid consumption. These results suggest that 1200 mg of lipoic acid improves serum TAC among multiple sclerosis patients but does not affect other markers of oxidative stress.

  18. Inhibition of Human Amylin Aggregation and Cellular Toxicity by Lipoic Acid and Ascorbic Acid.

    PubMed

    Azzam, Sarah Kassem; Jang, Hyunwoo; Choi, Myung Chul; Alsafar, Habiba; Lukman, Suryani; Lee, Sungmun

    2018-04-30

    More than 30 human degenerative diseases result from protein aggregation such as Alzheimer's disease (AD) and type 2 diabetes mellitus (T2DM). Islet amyloid deposits, a hallmark in T2DM, are found in pancreatic islets of more than 90 % of T2DM patients. An association between amylin aggregation and reduction in β-cell mass was also established by post-mortem studies. A strategy in preventing protein aggregation-related disorders is to inhibit the protein aggregation and associated toxicity. In this study we demonstrated that two inhibitors, lipoic acid and ascorbic acid, significantly inhibited amylin aggregation. Compared to amylin (15 μM) as 100 %, lipoic acid and ascorbic acid reduced amylin fibril formation to 42.1 ± 17.2 % and 42.9 ± 12.8 % respectively, which is confirmed by fluorescence and TEM images. In cell viability tests, both inhibitors protected RIN-m5f β-cells from the toxicity of amylin aggregates. At 10:1 molar ratio of lipoic acid to amylin, lipoic acid with amylin increased the cell viability to 70.3 %, whereas only 42.8 % RIN-m5f β-cells survived in amylin aggregates. For ascorbic acid, an equimolar ratio achieved the highest cell viability of 63.3 % as compared to 42.8 % with amylin aggregates only. Docking results showed that lipoic acid and ascorbic acid physically interact with amylin amyloidogenic region (residues Ser20-Ser29) via hydrophobic interactions; hence reducing aggregation levels. Therefore, lipoic acid and ascorbic acid prevented amylin aggregation via hydrophobic interactions, which resulted in the prevention of cell toxicity in vitro.

  19. Protective effect of lipoic acid on cyclophosphamide-induced testicular toxicity.

    PubMed

    Selvakumar, Elangovan; Prahalathan, Chidambaram; Sudharsan, Periyasamy Thandavan; Varalakshmi, Palaninathan

    2006-05-01

    Cyclophosphamide (CP), a widely used anticancer and immunosuppressive drug causes severe testicular toxicity. We investigated the protective effect of lipoic acid in CP-induced testicular toxicity. Two groups of male Wistar rats (140+/-20 g) were administered CP (15 mg/kg body weight, oral gavage) once a week for 10 weeks to induce testicular toxicity; one of these groups received lipoic acid treatment (35 mg/kg body weight, i.p., 24 h prior to CP administration) once a week for 10 weeks. A vehicle treated control and a lipoic acid control groups were also included. The untreated CP exposed rats showed a significant increase in testicular reactive oxygen species (ROS) level, along with a significant decrease in cellular thiol levels. The activities of testicular marker enzymes such as gamma-glutamyl transferase, beta-glucuronidase, acid phosphatase and alkaline phosphatase were increased whereas the activities of sorbitol dehydrogenase and lactate dehydrogenase-X were decreased significantly in the animals treated with CP. In contrast, rats pretreated with lipoic acid showed normal marker enzymic patterns and normal levels of ROS and thiols. Testicular protection by lipoic acid is further substantiated by the normal histologic findings as against shrunken seminiferous tubules with impaired spermatogenesis in the CP administered rats. By the reversal of biochemical and morphological changes towards normalcy, the cytoprotective role of lipoic acid is illuminated in CP-induced testicular toxicity.

  20. Pharmacokinetics of orally administered DL-α-lipoic acid in dogs.

    PubMed

    Zicker, Steven C; Avila, Albert; Joshi, Dinesh K; Gross, Kathy L

    2010-11-01

    To determine the pharmacokinetics of DL-α-lipoic acid in dogs when administered at 3 dosages via 3 methods of delivery. 27 clinically normal Beagles. In a 3 × 3 factorial Latin square design, 3 dosages (2.5, 12.5, and 25 mg/kg) of DL-α-lipoic acid were administered orally in a capsule form and provided without a meal, in a capsule form and provided with a meal, and as an ingredient included in an extruded dog food. Food was withheld for 12 hours prior to DL-α-lipoic acid administration. Blood samples were collected before (0 minutes) and at 15, 30, 45, 60, and 120 minutes after administration. Plasma concentrations of DL-α-lipoic acid were determined via high-performance liquid chromatography. A generalized linear models procedure was used to evaluate the effects of method of delivery and dosage. Noncompartmental analysis was used to determine pharmacokinetic parameters of DL-α-lipoic acid. Nonparametric tests were used to detect significant differences between pharmacokinetic parameters among treatment groups. A significant effect of dosage was observed regardless of delivery method. Method of delivery also significantly affected plasma concentrations of DL-α-lipoic acid, with extruded foods resulting in lowest concentration for each dosage administered. Maximum plasma concentration was significantly affected by method of delivery at each dosage administered. Other significant changes in pharmacokinetic parameters were variable and dependent on dosage and method of delivery. Values for pharmacokinetic parameters of orally administered DL-α-lipoic acid may differ significantly when there are changes in dosage, method of administration, and fed status.

  1. Effect of alpha lipoic acid on intracerebroventricular streptozotocin model of cognitive impairment in rats.

    PubMed

    Sharma, Monisha; Gupta, Y K

    2003-08-01

    In the present study, the effect of alpha lipoic acid, a potent free radical scavenger, was investigated against the intracerebroventricular streptozotocin model of cognitive impairment in rats, which is characterized by a progressive deterioration of memory, cerebral glucose and energy metabolism, and oxidative stress. Wistar rats were injected with intracerebroventricular streptozotocin bilaterally. The rats were treated chronically with alpha lipoic acid (50, 100 and 200 mg/kg) orally for 21 days starting from day 1 of streptozotocin injection in separate groups. The learning and memory behavior was evaluated and the rats were sacrificed for estimation of oxidative stress. The intracerebroventricular streptozotocin rats treated with alpha lipoic acid (200 mg/kg, p.o.) showed significantly less cognitive impairment as compared to the vehicle treated rats. There was also an insignificant increase in oxidative stress in the alpha lipoic acid treated groups. The study demonstrated the effectiveness of alpha lipoic acid in preventing cognitive impairment and oxidative stress induced by intracerebroventricular streptozotocin and its potential in dementia associated with age and age related neurodegenerative disorders where oxidative stress is involved such as Alzheimer's disease.

  2. Conditional knock-out of lipoic acid protein ligase 1 reveals redundancy pathway for lipoic acid metabolism in Plasmodium berghei malaria parasite.

    PubMed

    Wang, Min; Wang, Qiong; Gao, Xiang; Su, Zhong

    2017-06-27

    Lipoic acid is a cofactor for α-keto acid dehydrogenase system that is involved in the central energy metabolism. In the apicomplexan parasite, Plasmodium, lipoic acid protein ligase 1 (LplA1) and LplA2 catalyse the ligation of acquired lipoic acid to the dehydrogenase complexes in the mitochondrion. The enzymes LipB and LipA mediate lipoic acid synthesis and ligation to the enzymes in the apicoplast. These enzymes in the lipoic acid metabolism machinery have been shown to play important roles in the biology of Plasmodium parasites, but the relationship between the enzymes is not fully elucidated. We used an anhydrotetracycline (ATc)-inducible transcription system to generate transgenic P. berghei parasites in which the lplA1 gene was conditionally knocked out (LplA1-cKO). Phenotypic changes and the lplA1 and lplA2 gene expression profiles of cloned LplA1-cKO parasites were analysed. LplA1-cKO parasites showed severely impaired growth in vivo in the first 8 days of infection, and retarded blood-stage development in vitro, in the absence of ATc. However, these parasites resumed viability in the late stage of infection and mounted high levels of parasitemia leading to the death of the hosts. Although lplA1 mRNA expression was regulated tightly by ATc during the whole course of infection, lplA2 mRNA expression was significantly increased in the late stage of infection only in the LplA1-cKO parasites that were not exposed to ATc. The lplA2 gene can be activated as an alternative pathway to compensate for the loss of LplA1 activity and to maintain lipoic acid metabolism.

  3. Alpha-lipoic acid as a pleiotropic compound with potential therapeutic use in diabetes and other chronic diseases.

    PubMed

    Gomes, Marilia Brito; Negrato, Carlos Antonio

    2014-01-01

    Alpha-lipoic acid is a naturally occurring substance, essential for the function of different enzymes that take part in mitochondria's oxidative metabolism. It is believed that alpha-lipoic acid or its reduced form, dihydrolipoic acid have many biochemical functions acting as biological antioxidants, as metal chelators, reducers of the oxidized forms of other antioxidant agents such as vitamin C and E, and modulator of the signaling transduction of several pathways. These above-mentioned actions have been shown in experimental studies emphasizing the use of alpha-lipoic acid as a potential therapeutic agent for many chronic diseases with great epidemiological as well economic and social impact such as brain diseases and cognitive dysfunctions like Alzheimer disease, obesity, nonalcoholic fatty liver disease, burning mouth syndrome, cardiovascular disease, hypertension, some types of cancer, glaucoma and osteoporosis. Many conflicting data have been found concerning the clinical use of alpha-lipoic acid in the treatment of diabetes and of diabetes-related chronic complications such as retinopathy, nephropathy, neuropathy, wound healing and diabetic cardiovascular autonomic neuropathy. The most frequent clinical condition in which alpha-lipoic acid has been studied was in the management of diabetic peripheral neuropathy in patients with type 1 as well type 2 diabetes. Considering that oxidative stress, a imbalance between pro and antioxidants with excessive production of reactive oxygen species, is a factor in the development of many diseases and that alpha-lipoic acid, a natural thiol antioxidant, has been shown to have beneficial effects on oxidative stress parameters in various tissues we wrote this article in order to make an up-to-date review of current thinking regarding alpha-lipoic acid and its use as an antioxidant drug therapy for a myriad of diseases that could have potential benefits from its use.

  4. Effect of dietary α-lipoic acid on the mRNA expression of genes involved in drug metabolism and antioxidation system in rat liver.

    PubMed

    Ide, Takashi

    2014-08-14

    In the present study, the mRNA levels of hepatic proteins involved in the drug metabolism of rats fed α-lipoic acid were evaluated by DNA microarray and real-time PCR analyses. Experimental diets containing 0, 0·1, 0·25 and 0·5 % (w/w) α-lipoic acid were fed to four groups of rats consisting of seven animals each for 21 d. DNA microarray analysis revealed that the diet containing 0·5 % α-lipoic acid significantly (P< 0·05) increased the mRNA levels of various phase I drug-metabolising enzymes up to 15-fold and phase II enzymes up to 52-fold in an isoenzyme-specific manner. α-Lipoic acid also up-regulated the mRNA levels of some members of the ATP-binding cassette transporter superfamily, presumed to be involved in the exportation of xenobiotics, up to 6·6-fold. In addition, we observed that α-lipoic acid increased the mRNA levels of many proteins involved in antioxidation, such as members of the thiol redox system (up to 5·5-fold), metallothioneins (up to 12-fold) and haeme oxygenase 1 (1·5-fold). These results were confirmed using real-time PCR analysis, and α-lipoic acid dose dependently increased the mRNA levels of various proteins involved in drug metabolism and antioxidation. Consistent with these observations, α-lipoic acid dose dependently increased the hepatic concentration of glutathione and the activities of glutathione reductase and glutathione transferase measured using 1-chloro-2,4-dinitrobenzene and 1,2-dichloro-4-nitrobenzene as substrates, but decreased the hepatic and serum concentrations of malondialdehyde. In conclusion, the present study unequivocally demonstrated that α-lipoic acid increases the mRNA expression of proteins involved in drug metabolism and antioxidation in the liver.

  5. STUDIES ON ORGANIC ACID METABOLISM,

    DTIC Science & Technology

    Lipoic acid metabolism: The acetyl and succinyl thio esters of civinyl dimercapto were prepared by chemical and enzymatic means. The oxidation...reduction reactions of the disulfide-dimercapto groups in pyrimidine nucleotide-linked reactions were explored in the initial lipoic acid assay organiam...disulfide couple. The studies appeared to indicate a bound form of lipoic acid to be the coenzyme, and suggested that an amide or possibly another

  6. Effects of Lipoic Acid on High-Fat Diet-Induced Alteration of Synaptic Plasticity and Brain Glucose Metabolism: A PET/CT and 13C-NMR Study.

    PubMed

    Liu, Zhigang; Patil, Ishan; Sancheti, Harsh; Yin, Fei; Cadenas, Enrique

    2017-07-14

    High-fat diet (HFD)-induced obesity is accompanied by insulin resistance and compromised brain synaptic plasticity through the impairment of insulin-sensitive pathways regulating neuronal survival, learning, and memory. Lipoic acid is known to modulate the redox status of the cell and has insulin mimetic effects. This study was aimed at determining the effects of dietary administration of lipoic acid on a HFD-induced obesity model in terms of (a) insulin signaling, (b) brain glucose uptake and neuronal- and astrocytic metabolism, and (c) synaptic plasticity. 3-Month old C57BL/6J mice were divided into 4 groups exposed to their respective treatments for 9 weeks: (1) normal diet, (2) normal diet plus lipoic acid, (3) HFD, and (4) HFD plus lipoic acid. HFD resulted in higher body weight, development of insulin resistance, lower brain glucose uptake and glucose transporters, alterations in glycolytic and acetate metabolism in neurons and astrocytes, and ultimately synaptic plasticity loss evident by a decreased long-term potentiation (LTP). Lipoic acid treatment in mice on HFD prevented several HFD-induced metabolic changes and preserved synaptic plasticity. The metabolic and physiological changes in HFD-fed mice, including insulin resistance, brain glucose uptake and metabolism, and synaptic function, could be preserved by the insulin-like effect of lipoic acid.

  7. Multilayer emulsions as a strategy for linseed oil and α-lipoic acid micro-encapsulation: study on preparation and in vitro characterization.

    PubMed

    Huang, Juan; Wang, Qiang; Li, Tong; Xia, Nan; Xia, Qiang

    2018-07-01

    Linseed oil and α-lipoic acid are bioactive ingredients, which play an important role in human nutrition and health. However, their application in functional foods is limited because of their instabilities and poor solubilities in hydrophilic matrices. Multilayer emulsions are particularly useful to protect encapsulated bioactive ingredients. The aim of this study was to fabricate multilayer emulsions by a high-pressure homogenization method to encapsulate linseed oil and α-lipoic acid simultaneously. Tween 20 and lecithin were used as surfactants to stabilize the oil droplets of primary emulsions. Multilayer emulsions were produced by using an electrostatic layer-by-layer deposition process of lecithin-chitosan membranes. Thermal treatment exhibited that chitosan encapsulation could improve the thermal stability of primary emulsions. During in vitro digestion, it was found that chitosan encapsulation had little effect on the lipolysis of linseed oil and bioaccessibility of α-lipoic acid. The oxidation stability of linseed oil in multilayer emulsions was improved effectively by chitosan encapsulation and α-lipoic acid. Chitosan encapsulation could inhibit the degradation of α-lipoic acid. A physical stability study indicated that multilayer emulsions had good centrifugal, dilution and storage stabilities. Multilayer emulsion is an effective delivery system to incorporate linseed oil and α-lipoic acid into functional foods and beverages. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  8. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.

    PubMed

    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem

    2016-01-01

    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion.

  9. Protective effect of α-lipoic acid against α-cypermethrin-induced changes in rat cerebellum.

    PubMed

    Elsawy, H; Al-Omair, M A; Sedky, A; Al-Otaibi, L

    2017-12-01

    Alfa cypermethrin is a pyrethroids extensively used as ectoparasiticide in domestic animals, insecticidal spray on cotton, vegetables and other crops and to kill cockroaches, fleas and termites in house and other buildings. Previous studies have shown the adverse effect of α -cypermethrin on brain. This study was planned to evaluate the possible role of α-lipoic acid in α -cypermethrin induced toxicity in brain of male albino rats. Rats were divided into four groups. The control, α-cypermethrin, α-lipoic acid and α -cypermethrin plus α-lipoic acid treated groups. The duration of the experiment was four weeks. Our results showed that the administration of α-cypermethrin caused a significant decreased in γ- aminobutyric acid level, acetylcholinesterase, catalase, superoxide dismutase activities and increase in lipid peroxidation in cerebellum. Furthermore, the co-administration of α-lipoic acid mitigates the toxicity of α-cypermethrin by partially normalizing the biochemical parameters. The biochemical observations were supported by histopathological examinations. The findings of this investigation suggest that α-lipoic acid may play a protective role against α-cypermethrin induced toxicity in cerebellum of treated rats. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Wheat germ oil and α-lipoic acid predominantly improve the lipid profile of broiler meat.

    PubMed

    Arshad, Muhammad Sajid; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Shahid, Muhammad

    2013-11-20

    In response to recent assertions that synthetic antioxidants may have the potential to cause toxic effects and to consumers' increased attention to consuming natural products, the poultry industry has been seeking sources of natural antioxidants, alone or in combination with synthetic antioxidants that are currently being used by the industry. The present study was conducted to determine the effect of α-lipoic acid, α-tocopherol, and wheat germ oil on the status of antioxidant enzymes, fatty acid profile, and serum biochemical profile of broiler blood. One-day-old (180) broiler birds were fed six different feeds varying in their antioxidant content: no addition (T1), natural α-tocopherol (wheat germ oil, T2), synthetic α-tocopherol (T3), α-lipoic acid (T4), α-lipoic acid together with natural α-tocopherol (T5), and α-lipoic acid together with synthetic α-tocopherol (T6). The composition of saturated and unsaturated fatty acids in the breast and leg meat was positively influenced by the different dietary supplements. The content of fatty acid was significantly greater in broilers receiving T2 both in breast (23.92%) and in leg (25.82%) meat, whereas lower fatty acid levels was found in broilers receiving diets containing T6 in the breast (19.57%) and leg (21.30%) meat. Serum total cholesterol (113.42 mg/dL) and triglycerides (52.29 mg/dL) were lowest in the group given natural α-tocopherol and α-lipoic acid. Wheat germ oil containing natural α-tocopherol alone or with α-lipoic acid was more effective than synthetic α-tocopherol in raising levels of antioxidant enzymes superoxide dismutase, catalase, and glutathione reductase while lowering plasma total cholesterol, low-density lipoprotein, and triglycerides and raising high-density lipoprotein and plasma protein significantly. It was concluded that the combination of wheat germ oil and α-lipoic acid is helpful in improving the lipid profile of broilers.

  11. POTENTIAL ADMINISTRATION OF LIPOIC ACID AND COENZYME Q AGAINST ADIPOGENSIS: TARGET FOR WEIGHT REDUCTION.

    PubMed

    Al-Ghamdi, Maryam A; Choudhry, Hani; Al-Doghather, Huda A; Huwait, Etimad H; Kumosani, Taha A; Moselhy, Said S

    2017-01-01

    Body overweight and obesity were considered as a risk factor for many systemic diseases as diabetic hypertension, cardiovascular diseases, and some cancers. The lipoic acid and Co Q are considered as coenzymes needed for enhancement metabolic rate. The goal of this study is to evaluate the anti-obese effect of lipoic acid alone or combined with Co-Q in rats. Ninety male albino rats (100-150g) were used in this study, divided into six groups (15 each). Group I: Normal rats fed normal diet. Group II: Rats fed high fat diet (HFD). Group III: Rats fed HFD were given lipoic acid (10 μg/kg b w/day) intra-gastric by stomach tube. Group IV: Rats fed HFD were given Co-Q (10 μg/kg b.w/day) intra-gastric. Group V: Rats fed HFD were given lipoic acid (50 mg/kg b w/day) and Co-Q (10 μg/kg b. w/day). Group VI: Rats were given orlistat intra-gastric (10 mg/kg b w/day) as positive control for 6 weeks. Serum was subjected for determination of lipid profile, liver function tests atherogenic factor and lipoprotein lipase. It was found that treatment with lipoic acid or Co-Q or combined showed increase in the activity of lipoprotein lipase ( P < 0.001) and reduction of atherogenic effect and obesity index ( P <0.001). The effect of combined gives good results than orlistat or individual treatment. lipoic acid combined with Co-Q increase fat oxidation and prevent fat accumulation. The consumption of lipoic acid daily promotes fat oxidation and prevents its accumulation in visceral tissues. Further studies should be carried out to examine the mechanistic signals of these nutrients that helps in weight management.

  12. POTENTIAL ADMINISTRATION OF LIPOIC ACID AND COENZYME Q AGAINST ADIPOGENSIS: TARGET FOR WEIGHT REDUCTION

    PubMed Central

    AL-Ghamdi, Maryam A.; Choudhry, Hani; AL-Doghather, Huda A.; Huwait, Etimad H.; Kumosani, Taha A; Moselhy, Said S

    2017-01-01

    Background: Body overweight and obesity were considered as a risk factor for many systemic diseases as diabetic hypertension, cardiovascular diseases, and some cancers. The lipoic acid and Co Q are considered as coenzymes needed for enhancement metabolic rate. The goal of this study is to evaluate the anti-obese effect of lipoic acid alone or combined with Co-Q in rats. Materials and Methods: Ninety male albino rats (100-150g) were used in this study, divided into six groups (15 each). Group I: Normal rats fed normal diet. Group II: Rats fed high fat diet (HFD). Group III: Rats fed HFD were given lipoic acid (10 μg/kg b w/day) intra-gastric by stomach tube. Group IV: Rats fed HFD were given Co-Q (10 μg/kg b.w/day) intra-gastric. Group V: Rats fed HFD were given lipoic acid (50 mg/kg b w/day) and Co-Q (10 μg/kg b. w/day). Group VI: Rats were given orlistat intra-gastric (10 mg/kg b w/day) as positive control for 6 weeks. Serum was subjected for determination of lipid profile, liver function tests atherogenic factor and lipoprotein lipase. Results: It was found that treatment with lipoic acid or Co-Q or combined showed increase in the activity of lipoprotein lipase (P < 0.001) and reduction of atherogenic effect and obesity index (P <0.001). The effect of combined gives good results than orlistat or individual treatment. Conclusion: lipoic acid combined with Co-Q increase fat oxidation and prevent fat accumulation. The consumption of lipoic acid daily promotes fat oxidation and prevents its accumulation in visceral tissues. Further studies should be carried out to examine the mechanistic signals of these nutrients that helps in weight management. PMID:28480405

  13. THE COMBINATION OF α-LIPOIC ACID INTAKE WITH ECCENTRIC EXERCISE MODULATES ERYTHROPOIETIN RELEASE.

    PubMed

    Morawin, B; Turowski, D; Naczk, M; Siatkowski, I; Zembron-Lacny, A

    2014-08-01

    The generation of reactive nitrogen/oxygen species (RN/OS) represents an important mechanism in erythropoietin (EPO) expression and skeletal muscle adaptation to physical and metabolic stress. RN/OS generation can be modulated by intense exercise and nutrition supplements such as α-lipoic acid, which demonstrates both anti- and pro-oxidative action. The study was designed to show the changes in the haematological response through the combination of α-lipoic acid intake with running eccentric exercise. Sixteen healthy young males participated in the randomised and placebo-controlled study. The exercise trial involved a 90-min run followed by a 15-min eccentric phase at 65% VO2max (-10% gradient). It significantly increased serum concentrations of nitric oxide (NO), hydrogen peroxide (H2O2) and pro-oxidative products such as 8-isoprostanes (8-iso), lipid peroxides (LPO) and protein carbonyls (PC). α-Lipoic acid intake (Thiogamma: 1200 mg daily for 10 days prior to exercise) resulted in a 2-fold elevation of serum H2O2 concentration before exercise, but it prevented the generation of NO, 8-iso, LPO and PC at 20 min, 24 h, and 48 h after exercise. α-Lipoic acid also elevated serum EPO level, which highly correlated with NO/H2O2 ratio (r = 0.718, P < 0.01). Serum total creatine kinase (CK) activity, as a marker of muscle damage, reached a peak at 24 h after exercise (placebo 732 ± 207 IU · L(-1), α-lipoic acid 481 ± 103 IU · L(-1)), and correlated with EPO (r = 0.478, P < 0.01) in the α-lipoic acid group. In conclusion, the intake of high α-lipoic acid modulates RN/OS generation, enhances EPO release and reduces muscle damage after running eccentric exercise.

  14. THE COMBINATION OF α-LIPOIC ACID INTAKE WITH ECCENTRIC EXERCISE MODULATES ERYTHROPOIETIN RELEASE

    PubMed Central

    Morawin, B.; Turowski, D.; Naczk, M.; Siatkowski, I.

    2014-01-01

    The generation of reactive nitrogen/oxygen species (RN/OS) represents an important mechanism in erythropoietin (EPO) expression and skeletal muscle adaptation to physical and metabolic stress. RN/OS generation can be modulated by intense exercise and nutrition supplements such as α-lipoic acid, which demonstrates both anti- and pro-oxidative action. The study was designed to show the changes in the haematological response through the combination of α-lipoic acid intake with running eccentric exercise. Sixteen healthy young males participated in the randomised and placebo-controlled study. The exercise trial involved a 90-min run followed by a 15-min eccentric phase at 65% VO2max (-10% gradient). It significantly increased serum concentrations of nitric oxide (NO), hydrogen peroxide (H2O2) and pro-oxidative products such as 8-isoprostanes (8-iso), lipid peroxides (LPO) and protein carbonyls (PC). α-Lipoic acid intake (Thiogamma: 1200 mg daily for 10 days prior to exercise) resulted in a 2-fold elevation of serum H2O2 concentration before exercise, but it prevented the generation of NO, 8-iso, LPO and PC at 20 min, 24 h, and 48 h after exercise. α-Lipoic acid also elevated serum EPO level, which highly correlated with NO/H2O2 ratio (r = 0.718, P < 0.01). Serum total creatine kinase (CK) activity, as a marker of muscle damage, reached a peak at 24 h after exercise (placebo 732 ± 207 IU · L-1, α-lipoic acid 481 ± 103 IU · L-1), and correlated with EPO (r = 0.478, P < 0.01) in the α-lipoic acid group. In conclusion, the intake of high α-lipoic acid modulates RN/OS generation, enhances EPO release and reduces muscle damage after running eccentric exercise. PMID:25177095

  15. Alpha lipoic acid protects the heart against myocardial post ischemia-reperfusion arrhythmias via KATP channel activation in isolated rat hearts.

    PubMed

    Dudek, Magdalena; Knutelska, Joanna; Bednarski, Marek; Nowiński, Leszek; Zygmunt, Małgorzata; Bilska-Wilkosz, Anna; Iciek, Małgorzata; Otto, Monika; Żytka, Iwona; Sapa, Jacek; Włodek, Lidia; Filipek, Barbara

    2014-06-01

    The cardiovascular effects of alpha lipoic acid were evaluated in isolated rat hearts exposed to ischemia-reperfusion injury in vitro. Alpha-lipoic acid raised the level of sulfane sulfur playing an important role in the release of hydrogen sulfide. H2S was shown to prevent the post-reperfusion arrhythmias and to protect the cardiomyocytes from death caused by hypoxia. The activation of potassium ATP-sensitive channels (K(ATP) channels) is one of the most important mechanisms of action of hydrogen sulfide in the cardiovascular system. The aim of this study was to investigate whether alpha lipoic acid can prevent the occurrence of post-reperfusion arrhythmias in vitro using a Langendorff model of ischemia-reperfusion in rats affecting the K(ATP) channels. Alpha lipoic acid significantly improved post-reperfusion cardiac function (reducing incidence of arrhythmias), especially in a dose of 10(-7)M. These cardiovascular effects of this compound on the measured parameters were reversed by glibenclamide, a selective K(ATP) blocker. Alpha lipoic acid increased the level of sulfane sulfur in the hearts. This may suggest that the positive effects caused by alpha lipoic acid in the cardiovascular system are not only related to its strong antioxidant activity, and the influence on the activity of such enzymes as aldehyde dehydrogenase 2, as previously suggested, but this compound can affect K(ATP) channels. It is possible that this indirect effect of alpha lipoic acid is connected with changes in the release of sulfane sulfur and hydrogen sulfide. Copyright © 2014 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  16. Effect of alpha lipoic acid on leukotriene A4 hydrolase.

    PubMed

    Torres, María José; Fierro, Angélica; Pessoa-Mahana, C David; Romero-Parra, Javier; Cabrera, Gonzalo; Faúndez, Mario

    2017-03-15

    Leukotriene A 4 hydrolase is a soluble enzyme with epoxide hydrolase and aminopeptidase activities catalysing the conversion of leukotriene A 4 to leukotriene B 4 and the hydrolysis of the peptide proline-glycine-proline. Imbalances in leukotriene B 4 synthesis are related to several pathologic conditions. Currently there are no available drugs capable to modulate the synthesis of leukotriene B 4 or to block its receptors. Here we show the inhibitory profile of alpha lipoic acid on the activity of leukotriene A 4 Hydrolase. Alpha lipoic acid inhibited both activities of the enzyme at concentrations lower than 10μM. The 5-lipoxygenase inhibitor zileuton, or the 5-lipoxygenase activating protein inhibitor MK-886, were unable to inhibit the activity of the enzyme. Acute promyelocytic leukaemia HL-60 cells were differentiated to leukotriene A 4 hydrolase expressing neutrophil-like cells. Alpha lipoic acid inhibited the aminopeptidase activity of the cytosolic fraction from neutrophil-like cells but had no effect on the cytosolic fraction from undifferentiated cells. Docking and molecular dynamic approximations revealed that alpha lipoic acid participates in electrostatic interactions with K-565 and R-563, which are key residues for the carboxylate group recognition of endogenous substrates by the enzyme. Alpha lipoic acid is a compound widely used in clinical practice, most of its therapeutic effects are associated with its antioxidants properties, however, antioxidant effect alone is unable to explain all clinical effects observed with alpha lipoic acid. Our results invite to evaluate the significance of the inhibitory effect of alpha lipoic acid on the catalytic activity of leukotriene A 4 hydrolase using in vivo models. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Alpha-lipoic acid treatment of acetaminophen-induced rat liver damage.

    PubMed

    Mahmoud, Y I; Mahmoud, A A; Nassar, G

    2015-01-01

    Acetaminophen (paracetamol) is a well-tolerated analgesic and antipyretic drug when used at therapeutic doses. Overdoses, however, cause oxidative stress, which leads to acute liver failure. Alpha lipoic acid is an antioxidant that has proven effective for ameliorating many pathological conditions caused by oxidative stress. We evaluated the effect of alpha lipoic acid on the histological and histochemical alterations of liver caused by an acute overdose of acetaminophen in rats. Livers of acetaminophen-intoxicated rats were congested and showed centrilobular necrosis, vacuolar degeneration and inflammatory cell infiltration. Necrotic hepatocytes lost most of their carbohydrates, lipids and structural proteins. Liver sections from rats pre-treated with lipoic acid showed fewer pathological changes; the hepatocytes appeared moderately vacuolated with moderate staining of carbohydrates and proteins. Nevertheless, alpha lipoic acid at the dose we used did not protect the liver fully from acetaminophen-induced acute toxicity.

  18. Mechanism of alpha-lipoic acid in attenuating kanamycin-induced ototoxicity☆

    PubMed Central

    Wang, Aimei; Hou, Ning; Bao, Dongyan; Liu, Shuangyue; Xu, Tao

    2012-01-01

    In view of the theory that alpha-lipoic acid effectively prevents cochlear cells from injury caused by various factors such as cisplatin and noise, this study examined whether alpha-lipoic acid can prevent kanamycin-induced ototoxicity. To this end, healthy BALB/c mice were injected subcutaneously with alpha-lipoic acid and kanamycin for 14 days. Auditory brainstem response test showed that increased auditory brainstem response threshold shifts caused by kanamycin were significantly inhibited. Immunohistochemical staining and western blot analysis showed that the expression of phosphorylated p38 mitogen-activated protein kinase and phosphorylated c-Jun N-terminal kinase in mouse cochlea was significantly decreased. The experimental findings suggest that phosphorylated p38 and phosphorylated c-Jun N-terminal kinase mediated kanamycin-induced ototoxic injury in BALB/c mice. Alpha-lipoic acid effectively attenuated kanamycin ototoxicity by inhibiting the kanamycin-induced high expression of phosphorylated p38 and phosphorylated c-Jun N-terminal kinase. PMID:25317129

  19. Acetyl-L-carnitine and alpha-lipoic acid: possible neurotherapeutic agents for mood disorders?

    PubMed

    Soczynska, Joanna K; Kennedy, Sidney H; Chow, Cindy S M; Woldeyohannes, Hanna O; Konarski, Jakub Z; McIntyre, Roger S

    2008-06-01

    Mood disorders are associated with decrements in cognitive function, which are insufficiently treated with contemporary pharmacotherapies. To evaluate the putative neurotherapeutic effects of the mitochondrial cofactors, L-carnitine, acetyl-L-carnitine, and alpha-lipoic acid; and to provide a rationale for investigating their efficacy in the treatment of neurocognitive deficits associated with mood disorders. A PubMed search of English-language articles published between January 1966 and March 2007 was conducted using the search terms carnitine and lipoic acid. L-carnitine and alpha-lipoic acid may offer neurotherapeutic effects (e.g., neurocognitive enhancement) via disparate mechanisms including antioxidant, anti-inflammatory, and metabolic regulation. Preliminary controlled trials in depressed geriatric populations also suggest an antidepressant effect with acetyl-L-carnitine. L-carnitine and alpha-lipoic acid are pleiotropic agents capable of offering neuroprotective and possibly cognitive-enhancing effects for neuropsychiatric disorders in which cognitive deficits are an integral feature.

  20. Topical Application of Liposomal Antioxidants for Protection Against CEES Induced Skin Damage

    DTIC Science & Technology

    2007-07-01

    alveolar macrophages. J Nutr Sci Vitaminol (Tokyo) 1999, 45:675-686. 13. Thirunavukkarasu V, Anuradha CV: Influence of alpha - lipoic acid on lipid...33 4 ABBREVIATIONS: ALA, α- Lipoic acid AT, α-tocopherol CEES, half mustard or 2...Vitamin E (tocopherols and tocotrienols), GSH, N-acetylcysteine (NAC), and lipoic acid are very effective antioxidants. Their antioxidative potential

  1. Safety of long-term feeding of dl-alpha-lipoic acid and its effect on reduced glutathione:oxidized glutathione ratios in beagles.

    PubMed

    Zicker, Steven C; Hagen, Tory M; Joisher, Neha; Golder, Christina; Joshi, Dinesh K; Miller, E Phillip

    2002-01-01

    Alpha-lipoic acid is touted as a powerful antioxidant and possibly a conditionally essential nutrient in older mammals. The safety and efficacy of dl-alpha-lipoic acid was evaluated in 30 adult beagles that were evenly randomized into five groups, each of which was fed one of five different foods with varying inclusion rates of dl-alpha-lipoic acid (0, 150, 1500, 3000, and 4500 ppm). All dogs were fed their respective portion of food daily as their sole source of nutrition for 6 months. Evaluations included general health, body weight, food intake, hematologic and serum biochemical parameters, and glutathione:oxidized glutathione (GSH:GSSG) ratios in lymphocytes. No signs of toxicity were observed at any except the highest level of dl-alpha-lipoic acid inclusion, and no consistent abnormalities were noted in hematologic or biochemical measures at any level. There was a significant overall effect (P< .05) of food on the difference of GSH:GSSG ratio between Day 84 and Day 0. All inclusions of dl-alpha-lipoic acid increased the ratio of GSH:GSSG with the largest numeric improvement occurring at the lowest inclusion rate (150 ppm).

  2. Inhibitory effects of indole α-lipoic acid derivatives on nitric oxide production in LPS/IFNγ activated RAW 264.7 macrophages.

    PubMed

    Karabay, Arzu Zeynep; Koc, Aslı; Gurkan-Alp, A Selen; Buyukbingol, Zeliha; Buyukbingol, Erdem

    2015-04-01

    Alpha-lipoic acid (α-lipoic acid) is a potent antioxidant compound that has been shown to possess anti-inflammatory effects. RAW 264.7 macrophages produce various inflammatory mediators such as nitric oxide, IL-1β, IL-6 and TNF-alpha upon activation with LPS (Lipopolysaccharide) and IFNγ (interferon gamma). In this study, the effect of 12 synthetic indole α-lipoic acid derivatives on nitric oxide production and iNOS (inducible nitric oxide synthase) protein expression in LPS/IFNγ activated RAW 264.7 macrophages was determined. Cell proliferation, nitric oxide levels and iNOS protein expression were examined with thiazolyl blue tetrazolium blue test, griess assay and western blot, respectively. Our results showed that all of the indole α-lipoic acid derivatives showed significant inhibitory effects on nitric oxide production and iNOS protein levels (p < 0.05). The most active compounds were identified as compound I-4b, I-4e and II-3b. In conclusion, these indole α-lipoic acid derivatives may have the potential for treatment of inflammatory conditions related with high nitric oxide production. Copyright © 2015 John Wiley & Sons, Ltd.

  3. Alpha-lipoic acid supplementation protects enzymes from damage by nitrosative and oxidative stress.

    PubMed

    Hiller, Sylvia; DeKroon, Robert; Hamlett, Eric D; Xu, Longquan; Osorio, Cristina; Robinette, Jennifer; Winnik, Witold; Simington, Stephen; Maeda, Nobuyo; Alzate, Oscar; Yi, Xianwen

    2016-01-01

    S-nitrosylation of mitochondrial enzymes involved in energy transfer under nitrosative stress may result in ATP deficiency. We investigated whether α-lipoic acid, a powerful antioxidant, could alleviate nitrosative stress by regulating S-nitrosylation, which could result in retaining the mitochondrial enzyme activity. In this study, we have identified the S-nitrosylated forms of subunit 1 of dihydrolipoyllysine succinyltransferase (complex III), and subunit 2 of the α-ketoglutarate dehydrogenase complex by implementing a fluorescence-based differential quantitative proteomics method. We found that the activities of these two mitochondrial enzymes were partially but reversibly inhibited by S-nitrosylation in cultured endothelial cells, and that their activities were partially restored by supplementation of α-lipoic acid. We show that protein S-nitrosylation affects the activity of mitochondrial enzymes that are central to energy supply, and that α-lipoic acid protects mitochondrial enzymes by altering S-nitrosylation levels. Inhibiting protein S-nitrosylation with α-lipoic acid seems to be a protective mechanism against nitrosative stress. Identification and characterization of these new protein targets should contribute to expanding the therapeutic power of α-lipoic acid and to a better understanding of the underlying antioxidant mechanisms.

  4. Synergistic Effect of Quercetin and α-Lipoic Acid on Aluminium Chloride Induced Neurotoxicity in Rats.

    PubMed

    Al-Otaibi, Sooad Saud; Arafah, Maha Mohamad; Sharma, Bechan; Alhomida, Abdullah Salih; Siddiqi, Nikhat Jamal

    2018-01-01

    The present study was carried out to study the protective effects of quercetin and α -lipoic acid alone and in combination against aluminum chloride induced neurotoxicity in rats. The study consisted of eight groups, namely, Group 1: control rats, Group 2: rats receiving aluminium chloride 7 mg/kg body weight intraperitoneal route (i.p) for two weeks, Group 3: rats receiving quercetin 50 mg/kg body weight i.p. for two weeks, Group 4: rats receiving quercetin 50 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks, Group 5: rats receiving α -lipoic acid 20 mg/kg body weight i.p. for two weeks, Group 6: rats receiving lipoic acid 20 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks, Group 7: rats receiving α -lipoic acid 20 mg/kg body weight and quercetin 50 mg/kg body weight i.p. for two weeks, and Group 8: rats receiving α -lipoic acid 20 mg/kg body weight and quercetin 50 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks. The animals were killed after 24 hours of the last dose by cervical dislocation. Aluminium chloride treatment of rats resulted in significant increases in lipid peroxidation, protein carbonyl levels, and acetylcholine esterase activity in the brain. This was accompanied with significant decreases in reduced glutathione, activities of the glutathione reductase, and superoxide dismutase. Pretreatment of AlCl 3 exposed rats to either quercetin or α -lipoic acid also restored altered lipid peroxidation and superoxide dismutase to near normal levels. Quercetin or α -lipoic acid pretreatment of AlCl 3 exposed rats improved the protein carbonyl and reduced glutathione, glutathione reductase, and acetylcholine esterase activities in rat brains towards normal levels. Combined pretreatment of AlCl3 exposed rats with quercetin and α -lipoic acid resulted in a tendency towards normalization of most of the parameters. Quercetin and α -lipoic acid complemented each other in protecting the rat brain against oxidative stress induced by aluminium chloride.

  5. Synergistic Effect of Quercetin and α-Lipoic Acid on Aluminium Chloride Induced Neurotoxicity in Rats

    PubMed Central

    Al-Otaibi, Sooad Saud

    2018-01-01

    Objectives The present study was carried out to study the protective effects of quercetin and α-lipoic acid alone and in combination against aluminum chloride induced neurotoxicity in rats. Materials and Methods The study consisted of eight groups, namely, Group 1: control rats, Group 2: rats receiving aluminium chloride 7 mg/kg body weight intraperitoneal route (i.p) for two weeks, Group 3: rats receiving quercetin 50 mg/kg body weight i.p. for two weeks, Group 4: rats receiving quercetin 50 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks, Group 5: rats receiving α-lipoic acid 20 mg/kg body weight i.p. for two weeks, Group 6: rats receiving lipoic acid 20 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks, Group 7: rats receiving α-lipoic acid 20 mg/kg body weight and quercetin 50 mg/kg body weight i.p. for two weeks, and Group 8: rats receiving α-lipoic acid 20 mg/kg body weight and quercetin 50 mg/kg body weight followed by aluminium chloride 7 mg/kg body weight i.p. for two weeks. The animals were killed after 24 hours of the last dose by cervical dislocation. Results Aluminium chloride treatment of rats resulted in significant increases in lipid peroxidation, protein carbonyl levels, and acetylcholine esterase activity in the brain. This was accompanied with significant decreases in reduced glutathione, activities of the glutathione reductase, and superoxide dismutase. Pretreatment of AlCl3 exposed rats to either quercetin or α-lipoic acid also restored altered lipid peroxidation and superoxide dismutase to near normal levels. Quercetin or α-lipoic acid pretreatment of AlCl3 exposed rats improved the protein carbonyl and reduced glutathione, glutathione reductase, and acetylcholine esterase activities in rat brains towards normal levels. Combined pretreatment of AlCl3 exposed rats with quercetin and α-lipoic acid resulted in a tendency towards normalization of most of the parameters. Conclusions Quercetin and α-lipoic acid complemented each other in protecting the rat brain against oxidative stress induced by aluminium chloride. PMID:29861723

  6. Role of α-lipoic acid in dextran sulfate sodium-induced ulcerative colitis in mice: studies on inflammation, oxidative stress, DNA damage and fibrosis.

    PubMed

    Trivedi, P P; Jena, G B

    2013-09-01

    Ulcerative colitis affects many people worldwide. Inflammation and oxidative stress play a vital role in its pathogenesis. Previously, we reported that ulcerative colitis leads to systemic genotoxicity in mice. The present study was aimed at elucidating the role of α-lipoic acid in ulcerative colitis-associated local and systemic damage in mice. Experimental colitis was induced using 3%w/v dextran sulfate sodium in drinking water for 2 cycles. α-Lipoic acid was administered in a co-treatment (20, 40, 80 mg/kg bw) and post-treatment (80 mg/kg bw) schedule. Various biochemical parameters, histological evaluation, comet and micronucleus assays, immunohistochemistry and western blot analysis were employed to evaluate the effect of α-lipoic acid in mice with ulcerative colitis. The protective effect of α-lipoic acid was mediated through the modulation of nuclear factor kappa B, cyclooxygenase-2, interleukin 17, signal transducer and activator of transcription 3, nuclear erythroid 2-related factor 2, NADPH: quinone oxidoreductase-1, matrix metalloproteinase-9 and connective tissue growth factor. Further, ulcerative colitis led to an increased gut permeability, plasma lipopolysaccharide level, systemic inflammation and genotoxicity in mice, which was reduced with α-lipoic acid treatment. The present study identifies the underlying mechanisms involved in α-lipoic acid-mediated protection against ulcerative colitis and the associated systemic damage in mice. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Long-term physical and oxidative stability of liposomes containing glycerides of lipoic acid

    USDA-ARS?s Scientific Manuscript database

    The acyl glycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Accelerated storage testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phosp...

  8. Effect of α-lipoic acid and exercise training on cardiovascular disease risk in obesity with impaired glucose tolerance.

    PubMed

    McNeilly, Andrea M; Davison, Gareth W; Murphy, Marie H; Nadeem, Nida; Trinick, Tom; Duly, Ellie; Novials, Anna; McEneny, Jane

    2011-11-22

    Obese subjects with impaired glucose tolerance (IGT) are more susceptible than healthy individuals to oxidative stress and cardiovascular disease. This randomised controlled investigation was designed to test the hypothesis that α-lipoic acid supplementation and exercise training may elicit favourable clinical changes in obese subjects with IGT. All data were collected from 24 obese (BMI ≥ 30 kg/m2) IGT patients. Following participant randomisation into two groups, fasting venous blood samples were obtained at baseline, and before and following intervention. The first group consisted of 12 participants who completed a 12 week control phase followed by 12 weeks of chronic exercise at 65% HRmax for 30 minutes a day, 5 days per week, while ingesting 1 gram per day of α-lipoic acid for 12 weeks. The second group consisted of 12 participants who completed the same 12 week control phase, but this was followed by 12 weeks of 1 gram per day of α-lipoic acid supplementation only (no exercise). The main findings show a comparatively greater rate of low density lipoprotein (LDL) oxidation in the group consisting of α-lipoic acid only (p < 0.05 vs. pre intervention), although total oxidant status was lower post intervention (p < 0.05 vs. baseline) in this group. However, exercise and α-lipoic acid in combination attenuates LDL oxidation. Furthermore, in the α-lipoic acid supplement plus exercise training group, total antioxidant capacity was significantly increased (p < 0.05 vs. baseline and pre intervention). Body fat percentage and waist and hip circumference decreased following exercise training (p < 0.05 vs. post intervention). There were no selective treatment differences for a range of other clinical outcomes including glycaemic regulation (p > 0.05). These findings report that α-lipoic acid ingestion may increase the atherogenicity of LDL when ingested in isolation of exercise, suggesting that in IGT the use of this antioxidant treatment does not ameliorate metabolic disturbances, but instead may detrimentally contribute to the pathogenesis of atherosclerosis and development of CVD. However, when α-lipoic acid is combined with exercise, this atherogenic effect is abolished. © 2011 McNeilly et al; licensee BioMed Central Ltd.

  9. The effects of alpha-lipoic acid on breast of female albino rats exposed to malathion: Histopathological and immunohistochemical study.

    PubMed

    Omran, Ola M; Omer, Osama H

    2015-06-01

    The wide use of the organophosphate insecticide malathion is accompanied by the risk of human exposure and may be involved in the etiology of breast cancers, especially in developing countries. Alpha (α)-lipoic acid, a natural molecule, present in our diet has antioxidant and protective effects in cases such as aging, diabetes mellitus, and vascular and neurodegenerative diseases all in which free radicals are involved. However, there is only scarce data regarding the efficacy and biological activity of α-lipoic acid on malathion-induced breast histopathological changes. To investigate whether malathion can induce mammary histopathological changes, to immunohistochemically analyze the modulations in proliferation-apoptosis balance associated with these changes, to assess the associated metabolic parameters, antioxidant stress and hormonal profile changes and to elucidate the possible protective effect of α-lipoic acid on malathion induced alterations in rats. Forty Wistar female rats weighing 150-170g were divided into four groups. Group 1: control group were injected intraperitoneally (ip) with saline solution. Group2: animals were injected (ip) with malathion twice a day for five days. Group 3: animals were orally given α-lipoic acid, after three hours of treatment with malathion at the same dose given to group 2. Group 4: animals were treated with α-lipoic acid at the same dose given to group 3. Rats were sacrificed on the 90th day, and breast tissues were analyzed for histopathological and immunohistochemical alterations. Blood samples were collected for biochemical tests. α-Lipoic acid exhibited a striking reduction of malathion-induced mammary tumor incidence, and reversed intra-tumor histopathological alterations. Alpha lipoic acid suppressed proliferating cell nuclear antigen (PCNA) and p53 expression, induced apoptosis, upregulated proapoptotic protein Bax. Our results provide the experimental evidence that α-lipoic acid exerts chemopreventive effect in the breast hyperplastic and malignant changes by suppressing abnormal cell proliferation and inducing apoptosis with an oncostatic effects during an early-stage breast cancer. Copyright © 2015 Elsevier GmbH. All rights reserved.

  10. Effect of α-lipoic acid and exercise training on cardiovascular disease risk in obesity with impaired glucose tolerance

    PubMed Central

    2011-01-01

    Obese subjects with impaired glucose tolerance (IGT) are more susceptible than healthy individuals to oxidative stress and cardiovascular disease. This randomised controlled investigation was designed to test the hypothesis that α-lipoic acid supplementation and exercise training may elicit favourable clinical changes in obese subjects with IGT. All data were collected from 24 obese (BMI ≥ 30 kg/m2) IGT patients. Following participant randomisation into two groups, fasting venous blood samples were obtained at baseline, and before and following intervention. The first group consisted of 12 participants who completed a 12 week control phase followed by 12 weeks of chronic exercise at 65% HRmax for 30 minutes a day, 5 days per week, while ingesting 1 gram per day of α-lipoic acid for 12 weeks. The second group consisted of 12 participants who completed the same 12 week control phase, but this was followed by 12 weeks of 1 gram per day of α-lipoic acid supplementation only (no exercise). The main findings show a comparatively greater rate of low density lipoprotein (LDL) oxidation in the group consisting of α-lipoic acid only (p < 0.05 vs. pre intervention), although total oxidant status was lower post intervention (p < 0.05 vs. baseline) in this group. However, exercise and α-lipoic acid in combination attenuates LDL oxidation. Furthermore, in the α-lipoic acid supplement plus exercise training group, total antioxidant capacity was significantly increased (p < 0.05 vs. baseline and pre intervention). Body fat percentage and waist and hip circumference decreased following exercise training (p < 0.05 vs. post intervention). There were no selective treatment differences for a range of other clinical outcomes including glycaemic regulation (p > 0.05). These findings report that α-lipoic acid ingestion may increase the atherogenicity of LDL when ingested in isolation of exercise, suggesting that in IGT the use of this antioxidant treatment does not ameliorate metabolic disturbances, but instead may detrimentally contribute to the pathogenesis of atherosclerosis and development of CVD. However, when α-lipoic acid is combined with exercise, this atherogenic effect is abolished. PMID:22107734

  11. [Safety and structural analysis of polymers produced in manufacturing process of alpha-lipoic acid].

    PubMed

    Shimoda, Hiroshi; Tanaka, Junji; Seki, Azusa; Honda, Haruya; Akaogi, Seiichiro; Komatsubara, Hirobumi; Suzuki, Nobuo; Kameyama, Mayumi; Tamura, Satoru; Murakami, Nobutoshi

    2007-10-01

    Alpha-Lipoic acid has recently been permitted for use in foodstuffs and is contained in tablets and capsules. Although alpha-lipoic acid is synthesized from adipic acid, the safety of polymers produced during the purification and drying processes has been an issue of concern. Hence, we examined the safety profiles of thermally denatured polymer (LAP-A) and ethanol-denatured polymer (LAP-B) produced in the manufacturing process of alpha-lipoic acid. Furthermore, we conducted structural analysis of these polymers by 1H-NMR and FAB-MS spectroscopy. In a consecutive ingestion test, male and female mice ingested diet containing 0.1 and 0.2% LAP-A and -B for 4 weeks. Blood uric acid, potassium and lactate dehydrogenase (LDH) tended to increase without dose-dependency. Relative liver weights were also increased. However, male dogs that were orally administered LAP-B (500 mg/kg) once did not show any abnormalities in blood parameters or general condition. These findings indicate that alpha-lipoic acid polymers are not acutely toxic; however, chronic ingestion of these polymers may affect liver and kidney functions.

  12. Antioxidant Prophylaxis in the Prevention of Prostatic Epithelial Neoplasia

    DTIC Science & Technology

    2007-02-01

    additional year until the end of March 2008. 105Co-enzyme Q10 105Grape seed extract 31.5Alpha Lipoic acid 10.5Lutein 10.5Lycopene...antioxidants used in the study. Ascorbic acid is a potent antioxidant that interacts synergistically with Lipoic acid to destroy many types of free radicals...co-enzyme Q10. Lycopene and lutein are fat soluble carotenoids that work synergistically and possess very high antioxidant activity. Lipoic acid not

  13. Effects of α-lipoic acid and eicosapentaenoic acid in overweight and obese women during weight loss.

    PubMed

    Huerta, Ana E; Navas-Carretero, Santiago; Prieto-Hontoria, Pedro L; Martínez, J Alfredo; Moreno-Aliaga, María J

    2015-02-01

    To evaluate the potential body weight-lowering effects of dietary supplementation with eicosapentaenoic acid (EPA) and α-lipoic acid separately or combined in healthy overweight/obese women following a hypocaloric diet. This is a short-term double-blind placebo-controlled study with parallel design that lasted 10 weeks. Of the randomized participants, 97 women received the allocated treatment [Control, EPA (1.3 g/d), α-lipoic acid (0.3 g/d), and EPA+α-lipoic acid (1.3 g/d+0.3 g/d)], and 77 volunteers completed the study. All groups followed an energy-restricted diet of 30% less than total energy expenditure. Body weight, anthropometric measurements, body composition, resting energy expenditure, blood pressure, serum glucose, and insulin and lipid profile, as well as leptin and ghrelin levels, were assessed at baseline and after nutritional intervention. Body weight loss was significantly higher (P<0.05) in those groups supplemented with α-lipoic acid. EPA supplementation significantly attenuated (P<0.001) the decrease in leptin levels that occurs during weight loss. Body weight loss improved lipid and glucose metabolism parameters but without significant differences between groups. The intervention suggests that α-lipoic acid supplementation alone or in combination with EPA may help to promote body weight loss in healthy overweight/obese women following energy-restricted diets. © 2014 The Obesity Society.

  14. [EFFECT OF α-LIPOIC ACID IN INHIBITING OXIDATIVE STRESS AND PROMOTING DIABETIC WOUND HEALING BY SUPPRESSING EXPRESSION OF miR-29b IN MICE].

    PubMed

    Wu, Jun; Tang, Huiqin; Liu, Qun; Gan, Dingyun; Zhou, Man

    2016-08-08

    To investigate the effect of α-lipoic acid on the oxidative stress of wound tissues and diabetic wound healing in mice with diabetic feet. Sixty male C57BL/6J mice weighting 200-300 g were randomly divided into model group (control group, n =15), α-lipoic acid-treated model group ( n =15), miR-29b mimic group ( n =15), and miR-29b mimic negative control group (NC group, n =15). All animals received intraperitoneal injection of streptozocin to establish the diabetic model. Then, a full thickness wound of 5 mm×2 mm in size was created at 4 weeks after modeling. All mice were administrated with high-sugar-fat-diet. At the same day after modeling, α-lipoic acid-treated model group was continuously given intravenous injection of 100 mg/(kg·d) α-lipoic acid for 14 days; miR-29b mimic group and NC group received the tail intravenous injection of lentiviral vector for miR-29b mimic and miR-29b mimic negative control (a total of 2×10 7 TU), respectively, with the treatment of α-lipoic acid. The wound healing was observed and wound area was measured at 7 and 14 days. The wound tissues were harvested to detect the levels of superoxide dismutase (SOD) and glutathione (GSH) using xanthine oxidase method and 5, 5-dithiobis-2-nitrobenzoic acid staining method at 14 days. At the same day, 7, and 14 days after modeling, the relative miR-29b expression in wound tissues from control and α-lipoic acid-treated model groups was detected by real-time fluorescence quantitative PCR. All mice survived to the experiment end. The wound healing was faster in α-lipoic acid-treated group than control group. At 7 and 14 days, the relative wound area and miR-29b expression level were significantly lower, while the contents of SOD and GSH were significantly higher in α-lipoic acid-treated group than control group ( P <0.05). In addition, miR-29b mimic group had significantly increased relative wound area and significantly decreased the contents of SOD and GSH when compared with NC group at 7 and 14 days ( P <0.05). α-lipoic acid could inhibit oxidative stress and promote diabetic wound healing by suppressing expression of miR-29b in mice.

  15. Circulating irisin and glucose metabolism in overweight/obese women: effects of α-lipoic acid and eicosapentaenoic acid.

    PubMed

    Huerta, A E; Prieto-Hontoria, P L; Fernández-Galilea, M; Sáinz, N; Cuervo, M; Martínez, J A; Moreno-Aliaga, M J

    2015-09-01

    Irisin is a myokine/adipokine with potential role in obesity and diabetes. The objectives of the present study were to analyse the relationship between irisin and glucose metabolism at baseline and during an oral glucose tolerance test (OGTT) and to determine the effects of eicosapentaenoic acid (EPA) and/or α-lipoic acid treatment on irisin production in cultured human adipocytes and in vivo in healthy overweight/obese women following a weight loss program. Seventy-three overweight/obese women followed a 30% energy-restricted diet supplemented without (control) or with EPA (1.3 g/day), α-lipoic acid (0.3 g/day) or both EPA + α-lipoic acid (1.3 + 0.3 g/day) during 10 weeks. An OGTT was performed at baseline. Moreover, human adipocytes were treated with EPA (100-200 μM) or α-lipoic acid (100-250 μM) during 24 h. At baseline plasma, irisin circulating levels were positively associated with glucose levels; however, serum irisin concentrations were not affected by the increment in blood glucose or insulin during the OGTT. Treatment with α-lipoic acid (250 μM) upregulated Fndc5 messenger RNA (mRNA) and irisin secretion in cultured adipocytes. In overweight/obese women, irisin circulating levels decreased significantly after weight loss in all groups, while no additional differences were induced by EPA or α-lipoic acid supplementation. Moreover, plasma irisin levels were positively associated with higher glucose concentrations at beginning and at endpoint of the study. The data from the OGTT suggest that glucose is not a direct contributing factor of irisin release. The higher irisin levels observed in overweight/obese conditions could be a protective response of organism to early glucose impairments.

  16. [Comparative study of alpha-lipoic acid and mexidol effects on affective status, cognitive functions and quality of life in diabetes mellitus patients].

    PubMed

    Volchegorskiĭ, I A; Rassokhina, L M; Koliadich, M I; Alekseev, M I

    2011-01-01

    Short-term, prospective placebo-controlled simple blind randomized study of the effects of alpha-lipoic acid and mexidol on the dynamics of affective status disorders, cognitive functions, and quality of life in parallel with changes in carbohydrate metabolism and lipidemia has been conducted in diabetic patients. It is established that two-week administration of alpha-lipoic acid (600 mg once a day, i.v.) and mexidol (300 mg once a day, i.v.) reduced hyperglycemia by 13.00 with simultaneous decrease of depressive "feelings of guilt". In case of mexidol, these effects were accompanied by positive "vitality" dynamics established with SF-36 questionnaire and reflecting improvement in patients' quality of life. Additionally, course administration of alpha-lipoic acid increased attention as studied with Schulte tables. Favorable psychotropic effects of alpha-lipoic acid and mexidol were unrelated to changes in lipidemia and "lipid peroxidation - antioxidant protection" system indicators.

  17. Effect of the Antioxidant Lipoic Acid in Aortic Phenotype in a Marfan Syndrome Mouse Model.

    PubMed

    Guido, Maria C; Debbas, Victor; Salemi, Vera M; Tavares, Elaine R; Meirelles, Thayna; Araujo, Thaís L S; Nolasco, Patricia; Ferreira-Filho, Julio C A; Takimura, Celso K; Pereira, Lygia V; Laurindo, Francisco R

    2018-01-01

    Marfan syndrome (MFS) cardiovascular manifestations such as aortic aneurysms and cardiomyopathy carry substantial morbidity/mortality. We investigated the effects of lipoic acid, an antioxidant, on ROS production and aortic remodeling in a MFS mgΔ loxPneo mouse model. MFS and WT (wild-type) 1-month-old mice were allocated to 3 groups: untreated, treated with losartan, and treated with lipoic acid. At 6 months old, echocardiography, ROS production, and morphological analysis of aortas were performed. Aortic ROS generation in 6-month-old MFS animals was higher at advanced stages of disease in MFS. An unprecedented finding in MFS mice analyzed by OCT was the occurrence of focal inhomogeneous regions in the aortic arch, either collagen-rich extremely thickened or collagen-poor hypotrophic regions. MFS animals treated with lipoic acid showed markedly reduced ROS production and lower ERK1/2 phosphorylation; meanwhile, aortic dilation and elastic fiber breakdown were unaltered. Of note, lipoic acid treatment associated with the absence of focal inhomogeneous regions in MFS animals. Losartan reduced aortic dilation and elastic fiber breakdown despite no change in ROS generation. In conclusion, oxidant generation by itself seems neutral with respect to aneurysm progression in MFS; however, lipoic acid-mediated reduction of inhomogeneous regions may potentially associate with less anisotropy and reduced chance of dissection/rupture.

  18. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid.

    PubMed

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna

    2015-01-01

    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1-10 μmol L(-1). Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5-50 μmol L(-1). Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value.

  19. Effects of alpha-lipoic acid on spatial learning and memory, oxidative stress, and central cholinergic system in a rat model of vascular dementia.

    PubMed

    Zhao, Ran-Ran; Xu, Fei; Xu, Xiao-Chen; Tan, Guo-Jun; Liu, Liang-Min; Wu, Ning; Zhang, Wen-Zhong; Liu, Ji-Xiang

    2015-02-05

    Brain oxidative stress due to chronic cerebral hypoperfusion was considered to be the major risk factor in the pathogenesis of vascular dementia. In this study, we investigated the protective efficacy of alpha-lipoic acid, an antioxidant, against vascular dementia in rats, as well as the potential mechanism. Bilateral common carotid arteries occlusion (BCCAO) induced severe cognitive deficits tested by Morris water maze (MWM), along with oxidative stress and disturbance of central cholinergic system. However, administration of alpha-lipoic acid (50mg/kg, i.p.) for 28 days significantly restored cognitive deficits induced by BCCAO. Biochemical determination revealed that alpha-lipoic acid markedly decreased the production of malondialdehyde (MDA) and the generation of reactive oxidative species (ROS), and increased the level of reduced glutathione (GSH) in the hippocampal tissue. Additionally, alpha-lipoic acid raised the level of acetylcholine (ACh) and choline acetyltransferase (ChAT) and decreased the activity of acetycholinesterase (AChE) in the hippocampus. These results indicated that treatment with alpha-lipoic acid significantly improved behavioral alterations, protected against oxidative stress, and restored central cholinergic system in the rat model of vascular dementia induced by BCCAO. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  20. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid

    PubMed Central

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna

    2015-01-01

    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1–10 μmol L−1. Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5–50 μmol L−1. Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  1. [The effect of reamberin and alpha-lipoic acid on the tolerance to acute cerebral ischemia in experimental diabetes mellitus].

    PubMed

    Volchegorskii, I A; Miroshnichenko, I Yu; Rassokhina, L M; Faizullin, R M

    To study an effect of reamberin and α-lipoic acid (α-LA) on the tolerance of mice with experimental diabetes mellitus (DM) to acute cerebrovascular accident (ACVA) in mice experiments. The authors studied mice with alloxan diabetes and subtotal and total brain ischemia. In additional experimental series, an effect of reamberin and α-lipoic acid on the tolerance to acute hypoxic hypoxia and intensity of hyperglycemia in experimental DM was studied. The increased vulnerability of animals to ACVA due to hyperglycemia and increased sensitivity to acute hypoxic hypoxia was established. Reamberin and α-lipoic acid administered for 14 days in doses, which are equivalent to therapeutic range in humans, enhance the tolerance to ACVA and acute hypoxic hypoxia in mice with alloxan diabetes. These medications also decrease the intensity of hyperglycemia during concurrent insulin replacement therapy. The increased tolerance to ACVA in mice with alloxan diabetes caused by reamberin and alpha-lipoic acid is associated with an antihypoxic effect of these medications and does not depend on their effect on the intensity of hyperglycemia. Reamberin outperformed α-lipoic acid in the antihypoxic activity, protection against ACVA and the rate of onset of glucose reducing effect in experimental diabetes mellitus.

  2. Lipoic acid protects gastric mucosa from ethanol-induced injury in rat through a mechanism involving aldehyde dehydrogenase 2 activation.

    PubMed

    Li, Jia-Hui; Ju, Gui-Xia; Jiang, Jun-Lin; Li, Nian-Sheng; Peng, Jun; Luo, Xiu-Ju

    2016-11-01

    Numerous studies demonstrate that reactive aldehydes are highly toxic and aldehyde dehydrogenase 2 (ALDH2)-mediated detoxification of reactive aldehydes is thought as an endogenous protective mechanism against reactive aldehydes-induced cell injury. This study aims to explore whether lipoic acid, a potential ALDH2 activator, is able to protect gastric mucosa from ethanol-induced injury through a mechanism involving clearance of reactive aldehydes. The rats received 60% of acidified ethanol through intragastric administration and held for 1 h to establish a mucosal injury model. Lipoic acid (10 or 30 mg/kg) or Alda-1 (a positive control, 10 mg/kg) was given 45 min before the ethanol treatment. The gastric tissues were collected for analysis of gastric ulcer index, cellular apoptosis, 4-hydroxy-2-nonenal (4-HNE) and malondialdehyde (MDA) contents, and ALDH2 activity. The results showed that acute administration of ethanol led to an increase in gastric ulcer index, cellular apoptosis, 4-HNE and MDA contents concomitant with a decrease in ALDH2 activity; these phenomena were reversed by lipoic acid or Alda-1. The gastric protection of lipoic acid was attenuated in the presence of ALDH2 inhibitor. Based on these observations, we conclude that lipoic acid exerts the beneficial effects on ethanol-induced injury through a mechanism involving, at least in part, ALDH2 activation. As a dietary supplement or a medicine already in some countries, lipoic acid can be used to treat the ethanol - induced gastric mucosal injury. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. A Clinical Trial about a Food Supplement Containing α-Lipoic Acid on Oxidative Stress Markers in Type 2 Diabetic Patients.

    PubMed

    Derosa, Giuseppe; D'Angelo, Angela; Romano, Davide; Maffioli, Pamela

    2016-10-28

    The aim of this study was to evaluate the effect of a food supplement containing α-lipoic acid and of a placebo on glyco-metabolic control and on oxidative stress markers in type 2 diabetics. We randomized 105 diabetics to either a supplementation containing 600 mg of α-lipoic acid, 165 mg of L -carnosin, 7.5 mg of zinc, and vitamins of group B, or a placebo, for three months. We evaluated body mass index, fasting plasma glucose (FPG), post-prandial-glucose (PPG), glycated hemoglobin (HbA 1c ), fasting plasma insulin (FPI), HOMA-index (HOMA-IR), lipid profile, high sensitivity C-reactive protein (Hs-CRP), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA). There was a reduction of FPG, PPG, and HbA 1c with the food supplement containing α-lipoic acid compared with a baseline, and with the placebo. Concerning lipid profile, we observed a reduction of LDL-C, and Tg with the food supplement, compared with both the baseline, and the placebo. There was a reduction of Hs-CRP with the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. An increase of SOD, and GSH-Px, and a decrease of MDA were reached by the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. We can conclude that the food supplement containing α-lipoic acid, L -carnosin, zinc, and vitamins of group B improved glycemic control, lipid profile, and anti-oxidative stress markers.

  4. A Clinical Trial about a Food Supplement Containing α-Lipoic Acid on Oxidative Stress Markers in Type 2 Diabetic Patients

    PubMed Central

    Derosa, Giuseppe; D’Angelo, Angela; Romano, Davide; Maffioli, Pamela

    2016-01-01

    The aim of this study was to evaluate the effect of a food supplement containing α-lipoic acid and of a placebo on glyco-metabolic control and on oxidative stress markers in type 2 diabetics. We randomized 105 diabetics to either a supplementation containing 600 mg of α-lipoic acid, 165 mg of L-carnosin, 7.5 mg of zinc, and vitamins of group B, or a placebo, for three months. We evaluated body mass index, fasting plasma glucose (FPG), post-prandial-glucose (PPG), glycated hemoglobin (HbA1c), fasting plasma insulin (FPI), HOMA-index (HOMA-IR), lipid profile, high sensitivity C-reactive protein (Hs-CRP), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA). There was a reduction of FPG, PPG, and HbA1c with the food supplement containing α-lipoic acid compared with a baseline, and with the placebo. Concerning lipid profile, we observed a reduction of LDL-C, and Tg with the food supplement, compared with both the baseline, and the placebo. There was a reduction of Hs-CRP with the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. An increase of SOD, and GSH-Px, and a decrease of MDA were reached by the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. We can conclude that the food supplement containing α-lipoic acid, L-carnosin, zinc, and vitamins of group B improved glycemic control, lipid profile, and anti-oxidative stress markers. PMID:27801825

  5. Implication of the ERK/MAPK pathway in antipsychotics-induced dopamine D2 receptor upregulation and in the preventive effects of (±)-α-lipoic acid in SH-SY5Y neuroblastoma cells.

    PubMed

    Deslauriers, Jessica; Desmarais, Christian; Sarret, Philippe; Grignon, Sylvain

    2014-03-01

    Chronic administration of antipsychotics (APs) has been associated with dopamine D2 receptor (D2R) upregulation and tardive dyskinesia. We previously showed that haloperidol, a first-generation AP, exerted a more robust increase in D2R expression than amisulpride, a second-generation AP and that (±)-α-lipoic acid pre-treatment reversed the AP-induced D2R upregulation. We also demonstrated that the Akt/GSK-3β/β-catenin pathway is involved in the control of D2R expression levels, but is unlikely implicated in the preventive effects of (±)-α-lipoic acid since co-treatment with haloperidol and (±)-α-lipoic acid exerts synergistic effects on Akt/GSK-3β activation. These findings led us to examine whether the ERK/MAPK signaling pathway may be involved in D2R upregulation elicited by APs, and in its reversal by (±)-α-lipoic acid, in SH-SY5Y human neuroblastoma cells. Our results revealed that haloperidol, in parallel with an elevation in D2R mRNA levels, induced a larger increase of ERK (p42/p44) phosphorylation than amisulpride. Pre-treatment with the selective ERK inhibitor U0126 attenuated haloperidol-induced increase in D2R upregulation. Furthermore, (±)-α-lipoic acid prevented AP-induced ERK activation. These results show that (1) the ERK/MAPK pathway is involved in haloperidol-induced D2R upregulation; (2) the preventive effect of (±)-α-lipoic acid on haloperidol-induced D2R upregulation is in part mediated by an ERK/MAPK-dependent signaling cascade. Taken together, our data suggest that (±)-α-lipoic acid exerts synergistic effects with haloperidol on the Akt/GSK-3β pathway, potentially involved in the therapeutic effects of APs, and antagonism of ERK activation and D2R upregulation, potentially involved in tardive dyskinesia and treatment resistance.

  6. Lipoic acid synthetase deficiency causes neonatal-onset epilepsy, defective mitochondrial energy metabolism, and glycine elevation.

    PubMed

    Mayr, Johannes A; Zimmermann, Franz A; Fauth, Christine; Bergheim, Christa; Meierhofer, David; Radmayr, Doris; Zschocke, Johannes; Koch, Johannes; Sperl, Wolfgang

    2011-12-09

    Lipoic acid is an essential prosthetic group of four mitochondrial enzymes involved in the oxidative decarboxylation of pyruvate, α-ketoglutarate, and branched chain amino acids and in the glycine cleavage. Lipoic acid is synthesized stepwise within mitochondria through a process that includes lipoic acid synthetase. We identified the homozygous mutation c.746G>A (p.Arg249His) in LIAS in an individual with neonatal-onset epilepsy, muscular hypotonia, lactic acidosis, and elevated glycine concentration in plasma and urine. Investigation of the mitochondrial energy metabolism showed reduced oxidation of pyruvate and decreased pyruvate dehydrogenase complex activity. A pronounced reduction of the prosthetic group lipoamide was found in lipoylated proteins. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Effects of dietary supplementation with EPA and/or α-lipoic acid on adipose tissue transcriptomic profile of healthy overweight/obese women following a hypocaloric diet.

    PubMed

    Huerta, Ana E; Prieto-Hontoria, Pedro L; Fernández-Galilea, Marta; Escoté, Xavier; Martínez, J Alfredo; Moreno-Aliaga, María J

    2017-01-02

    In obesity, the increment of adiposity levels disrupts the whole body homeostasis, promoting an over production of oxidants and inflammatory mediators. The current study aimed to characterize the transcriptomic changes promoted by supplementation with eicosapentaenoic acid (EPA, 1.3 g/day), α-lipoic acid (0.3 g/day), or both (EPA + α-lipoic acid, 1.3 g/day + 0.3 g/day) in subcutaneous abdominal adipose tissue from overweight/obese healthy women, who followed a hypocaloric diet (30% of total energy expenditure) during ten weeks, by using a microarray approach. At the end of the intervention, a total of 33,297 genes were analyzed using Affymetrix GeneChip arrays. EPA promoted changes in extracellular matrix remodeling gene expression, besides a rise of genes associated with either chemotaxis or wound repair. α-Lipoic acid decreased expression of genes related with cell adhesion and inflammation. Furthermore, α-lipoic acid, especially in combination with EPA, upregulated the expression of genes associated with lipid catabolism while downregulated genes involved in lipids storage. Together, all these data suggest that some of the metabolic effects of EPA and α-lipoic acid could be related to their regulatory actions on adipose tissue metabolism. © 2016 BioFactors, 43(1):117-131, 2017. © 2016 International Union of Biochemistry and Molecular Biology.

  8. Impact evaluation of α-lipoic acid in gamma-irradiated erythrocytes

    NASA Astrophysics Data System (ADS)

    Desouky, Omar S.; Selim, Nabila S.; Elbakrawy, Eman M.; Rezk, Rezk A.

    2011-03-01

    This work is intended to study in vitro the ability of lipoic acid to protect erythrocytes against the oxidative damage resulting from exposure to gamma radiation through measurement of their rheological properties and to study the effects of detergent on their membrane solubility and permeability. Different doses of gamma radiation were applied: the most recommended and applied dose (25 Gy), and two higher doses, namely 50 and 100 Gy. The effect of addition of lipoic acid as well as its effect as a radioprotector was tested. The obtained results show changes in structural integrity of the erythrocyte cell membrane components as a result of oxidative damage due to gamma radiation that could be improved by pre-treatment with the antioxidant lipoic acid.

  9. Behavioral and Neurochemical Effects of Alpha-Lipoic Acid in the Model of Parkinson's Disease Induced by Unilateral Stereotaxic Injection of 6-Ohda in Rat

    PubMed Central

    de Araújo, Dayane Pessoa; De Sousa, Caren Nádia Soares; Araújo, Paulo Victor Pontes; Menezes, Carlos Eduardo de Souza; Sousa Rodrigues, Francisca Taciana; Escudeiro, Sarah Souza; Lima, Nicole Brito Cortez; Patrocínio, Manoel Claúdio Azevedo; Aguiar, Lissiana Magna Vasconcelos; Viana, Glauce Socorro de Barros; Vasconcelos, Silvânia Maria Mendes

    2013-01-01

    This study aimed to investigate behavioral and neurochemical effects of α-lipoic acid (100 mg/kg or 200 mg/kg) alone or associated with L-DOPA using an animal model of Parkinson's disease induced by stereotaxic injection of 6-hydroxydopamine (6-OHDA) in rat striatum. Motor behavior was assessed by monitoring body rotations induced by apomorphine, open field test and cylinder test. Oxidative stress was accessed by determination of lipid peroxidation using the TBARS method, concentration of nitrite and evaluation of catalase activity. α-Lipoic acid decreased body rotations induced by apomorphine, as well as caused an improvement in motor performance by increasing locomotor activity in the open field test and use of contralateral paw (in the opposite side of the lesion produced by 6-OHDA) at cylinder test. α-lipoic acid showed antioxidant effects, decreasing lipid peroxidation and nitrite levels and interacting with antioxidant system by decreasing of endogenous catalase activity. Therefore, α-lipoic acid prevented the damage induced by 6-OHDA or by chronic use of L-DOPA in dopaminergic neurons, suggesting that α-lipoic could be a new therapeutic target for Parkinson's disease prevention and treatment. PMID:24023579

  10. Effect of myo-inositol and alpha-lipoic acid on oocyte quality in polycystic ovary syndrome non-obese women undergoing in vitro fertilization: a pilot study.

    PubMed

    Rago, R; Marcucci, I; Leto, G; Caponecchia, L; Salacone, P; Bonanni, P; Fiori, C; Sorrenti, G; Sebastianelli, A

    2015-01-01

    The aim of the present study was to evaluate the effectiveness of the combined administration of myo-inositol and α-lipoic acid in polycystic ovary syndrome (PCOS) patients with normal body mass index (BMI), who had previously undergone intracytoplasmic sperm injection (ICSI) and received myo-inositol alone. Thirty-six of 65 normal-weight patients affected by PCOS who did not achieve pregnancy and one patient who had a spontaneous abortion were re-enrolled and given a cycle of treatment with myo-inositol and α-lipoic acid. For all female partners of the treated couples, the endocrine-metabolic and ultrasound parameters, ovarian volume, oocyte and embryo quality, and pregnancy rates were assessed before and after three months of treatment and compared with those of previous in vitro fertilization (IVF) cycle(s). After supplementation of myo-inositol with α-lipoic acid, insulin levels, BMI and ovarian volume were significantly reduced compared with myo-inositol alone. No differences were found in the fertilization and cleavage rate or in the mean number of transferred embryos between the two different treatments, whereas the number of grade 1 embryos was significantly increased, with a significant reduction in the number of grade 2 embryos treated with myo-inositol plus α-lipoic acid. Clinical pregnancy was not significantly different with a trend for a higher percentage for of myo-inositol and α-lipoic acid compared to the myo-inositol alone group. Our preliminary data suggest that the supplementation of myo-inositol and α-lipoic acid in PCOS patients undergoing an IVF cycle can help to improve their reproductive outcome and also their metabolic profiles, opening potential for their use in long-term prevention of PCOS.

  11. Memory impairment, oxidative damage and apoptosis induced by space radiation: ameliorative potential of alpha-lipoic acid.

    PubMed

    Manda, Kailash; Ueno, Megumi; Anzai, Kazunori

    2008-03-05

    Exposure to high-energy particle radiation (HZE) may cause oxidative stress and cognitive impairment in the same manner that seen in aged mice. This phenomenon has raised the concerns about the safety of an extended manned mission into deep space where a significant portion of the radiation burden would come from HZE particle radiation. The present study aimed at investigating the role of alpha-lipoic acid against space radiation-induced oxidative stress and antioxidant status in cerebellum and its correlation with cognitive dysfunction. We observed spontaneous motor activities and spatial memory task of mice using pyroelectric infrared sensor and programmed video tracking system, respectively. Whole body irradiation of mice with high-LET (56)Fe beams (500 MeV/nucleon, 1.5 Gy) substantially impaired the reference memory at 30 day post-irradiation; however, no significant effect was observed on motor activities of mice. Acute intraperitoneal treatment of mice with alpha-lipoic acid prior to irradiation significantly attenuated such memory dysfunction. Radiation-induced apoptotic damage in cerebellum was examined using a neuronal-specific terminal deoxynucleotidyl transferase-mediated nick end-labeling method (NeuroTACS). Radiation-induced apoptotic and necrotic cell death of granule cells and Purkinje cells were inhibited significantly by alpha-lipoic acid pretreatment. Alpha-lipoic acid pretreatment exerted a very high magnitude of protection against radiation-induced augmentation of DNA damage (comet tail movement and serum 8-OHdG), lipid proxidation products (MDA+HAE) and protein carbonyls in mice cerebellum. Further, radiation-induced decline of non-protein sulfhydryl (NP-SH) contents of cerebellum and plasma ferric reducing power (FRAP) was also inhibited by alpha-lipoic acid pre-treatment. Results clearly indicate that alpha-lipoic acid is a potent neuroprotective antioxidant. Moreover, present finding also support the idea suggesting the cerebellar involvement in cognition.

  12. Sublethal Total Body Irradiation Leads to Early Cerebellar Damage and Oxidative Stress

    DTIC Science & Technology

    2010-01-01

    mice: protective effect of alpha - lipoic acid . Behav Brain Res 2007b; 177(1): 7-14. [8] Manda K, Ueno M, Anzai K. Melatonin mitigates oxidative...Memory impairment, oxidative damage and apoptosis induced by space radiation: ameliorative potential of alpha - lipoic acid . Behav Brain Res 2008b...1977; 171(1): 39-50. [6] Manda K, Ueno M, Moritake T, Anzai K. - Lipoic acid attenuates x-irradiation-induced oxidative stress in mice. Cell Biol

  13. Lipoic acid attenuates Aroclor 1260-induced hepatotoxicity in adult rats.

    PubMed

    Aly, Hamdy A A; Mansour, Ahmed M; Hassan, Memy H; Abd-Ellah, Mohamed F

    2016-08-01

    The present study was aimed to investigate the mechanistic aspect of Aroclor 1260-induced hepatotoxicity and its protection by lipoic acid. The adult male Albino rats were divided into six groups. Group I served as control. Group II received lipoic acid (35 mg/kg/day). Aroclor 1260 was given to rats by oral gavage at doses 20, 40, or 60 mg/kg/day (Groups III, IV, and V, respectively). Group VI was pretreated with lipoic acid (35 mg/kg/day) 24 h before Aroclor 1260 (40 mg/kg/day). Treatment in all groups was continued for further 15 consecutive days. Serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, and lactate dehydrogenase activities and total bilirubin, total cholesterol, and triglycerides were significantly increased while total protein, total albumin, and high-density lipoprotein were significantly decreased. Hydrogen peroxide production and lipid peroxidation were significantly increased while superoxide dismutase and catalase activities and reduced glutathione (GSH) content was significantly decreased in liver. Caspase-3 & -9 activities were significantly increased in liver. Lipoic acid pretreatment significantly reverted all these abnormalities toward their normal levels. In conclusion, Aroclor 1260 induced liver dysfunction, at least in part, by induction of oxidative stress. Apoptotic effect of hepatic cells is involved in Aroclor 1260-induced liver injury. Lipoic acid could protect rats against Aroclor 1260-induced hepatotoxicity. © 2014 Wiley Periodicals, Inc. Environ Toxicol 31: 913-922, 2016. © 2014 Wiley Periodicals, Inc.

  14. Effect of the Antioxidant Lipoic Acid in Aortic Phenotype in a Marfan Syndrome Mouse Model

    PubMed Central

    Debbas, Victor; Salemi, Vera M.; Tavares, Elaine R.; Meirelles, Thayna; Ferreira-Filho, Julio C. A.; Takimura, Celso K.; Pereira, Lygia V.; Laurindo, Francisco R.

    2018-01-01

    Marfan syndrome (MFS) cardiovascular manifestations such as aortic aneurysms and cardiomyopathy carry substantial morbidity/mortality. We investigated the effects of lipoic acid, an antioxidant, on ROS production and aortic remodeling in a MFS mgΔloxPneo mouse model. MFS and WT (wild-type) 1-month-old mice were allocated to 3 groups: untreated, treated with losartan, and treated with lipoic acid. At 6 months old, echocardiography, ROS production, and morphological analysis of aortas were performed. Aortic ROS generation in 6-month-old MFS animals was higher at advanced stages of disease in MFS. An unprecedented finding in MFS mice analyzed by OCT was the occurrence of focal inhomogeneous regions in the aortic arch, either collagen-rich extremely thickened or collagen-poor hypotrophic regions. MFS animals treated with lipoic acid showed markedly reduced ROS production and lower ERK1/2 phosphorylation; meanwhile, aortic dilation and elastic fiber breakdown were unaltered. Of note, lipoic acid treatment associated with the absence of focal inhomogeneous regions in MFS animals. Losartan reduced aortic dilation and elastic fiber breakdown despite no change in ROS generation. In conclusion, oxidant generation by itself seems neutral with respect to aneurysm progression in MFS; however, lipoic acid-mediated reduction of inhomogeneous regions may potentially associate with less anisotropy and reduced chance of dissection/rupture. PMID:29765495

  15. Alpha-lipoic acid protects oxidative stress, changes in cholinergic system and tissue histopathology during co-exposure to arsenic-dichlorvos in rats.

    PubMed

    Dwivedi, Nidhi; Flora, Govinder; Kushwaha, Pramod; Flora, Swaran J S

    2014-01-01

    We investigated protective efficacy of α-lipoic acid (LA), an antioxidant against arsenic and DDVP co-exposed rats. Biochemical variables suggestive of oxidative stress, neurological dysfunction, and tissue histopathological alterations were determined. Male rats were exposed either to 50 ppm sodium arsenite in drinking water or in combination with DDVP (4 mg/kg, subcutaneously) for 10 weeks. α-Lipoic acid (50mg/kg, pos) was also co-administered in above groups. Arsenic exposure led to significant oxidative stress along, hepatotoxicity, hematotoxicity and altered brain biogenic amines levels accompanied by increased arsenic accumulation in blood and tissues. These altered biochemical variables were supported by histopathological examinations leading to oxidative stress and cell death. These biochemical alterations were significantly restored by co-administration of α-lipoic acid with arsenic and DDVP alone and concomitantly. The results indicate that arsenic and DDVP induced oxidative stress and cholinergic dysfunction can be significantly protected by the supplementation of α-lipoic acid. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Multiple Animal Studies for Medical Chemical Defense Program in Soldier/ Patient Decontamination and Drug Development on Task Order 84-6: Pyruvate Dehydrogenase System for Determining the Effectiveness of Arsenic Antidotes

    DTIC Science & Technology

    1988-03-11

    adenine dinucleotide FAD = flavin-adenine dinucleotide iipS2 = lipoic acid lip(SH)2 = dihydrolipoic acid CoA = coenzyme A. SHepatic PDH complex activity...tissues has yet to be fully characterized, but it probably involves arsenic binding to the lipoic acid and dithiol moieties of the complex (Fluharty...covalently bound lipoic acid substrate of dihydrolipoyl transacetylase is greater per mole of L and CVAA than for sodium arsenite. This is possible

  17. Electrooxidation of pyrrole-terminated self-assembled lipoic acid derivatives

    NASA Astrophysics Data System (ADS)

    Cabrita, Joana F.; Viana, Ana S.; Eberle, Christoph; Montforts, Franz-Peter; Mourato, Ana; Abrantes, Luisa M.

    2009-08-01

    New pyrrole derivatives, pyrrolyl lipoic acid (Py-LA 3) and dipyrrolyl lipoic acid (Py 2-LA 2) have been used for surface attachment and immobilisation on gold surfaces, by self-assembly. The electrooxidation of the surface-confined pyrroles was analysed by cyclic voltammetry and the modified electrodes morphological and thickness changes addressed by scanning probe microscopy and ellipsometry. The data support the formation of oligomers as a result of the pendant-pyrrolyl units ease oxidation but provide no evidence of an effective subsequent polymerisation.

  18. Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant potential and lipid stability of meat.

    PubMed

    Arshad, Muhammad Sajid; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Shahid, Muhammad; Akhtar, Saeed; Sohaib, Muhammad

    2013-11-04

    Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010-11 & 2011-12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio-evaluation of this kind of functional meat in humans.

  19. The effects of lipoic acid and methylprednisolone on nerve healing in rats with facial paralysis.

    PubMed

    Tekdemir, Emrah; Tatlipinar, Arzu; Özbeyli, Dilek; Tekdemir, Özge; Kınal, Emrah

    2018-06-01

    To investigate the effects of lipoic acid and methylprednisolone on nerve healing in rats with traumatic facial paralysis. The rats were randomly divided into four groups, with six rats in the control group and eight each in the remaining three groups. The buccal branch of the facial nerve in all groups except the control group was traumatized by a vascular clamp for 40 minutes. Group 1 was given lipoic acid (LA), Group 2 was given methylprednisolone (MP), and Group 3 was given lipoic acid and methylprednisolone (LA + MP) for one week. Nerve stimulus thresholds were measured before trauma, after trauma and at the end of the one week treatment period. When the groups were compared with each other, post-treatment threshold levels of LA + MP were significantly lower than LA. Although post-treatment threshold levels of LA and MP were still higher than the control group, there was no significant difference between LA + MP and control values (p > .05). Lipoic acid has a positive effect on nerve healing and can enhance the effect of methylprednisolone treatment. It is a good alternative in cases where methylprednisolone cannot be used.

  20. Alpha-lipoic acid reduces body weight and regulates triglycerides in obese patients with diabetes mellitus.

    PubMed

    Okanović, Azra; Prnjavorac, Besim; Jusufović, Edin; Sejdinović, Rifat

    2015-08-01

    To determine an influence of alpha-lipoic acid to reduction of body weight and regulation of total cholesterol concentration, triglycerides and glucose serum levels in obese patients with diabetes mellitus type 2. A prospective study includes two groups of obese patients with diabetes mellitus and signs of peripheral polyneuropathia: examined group (30 patients; 15 females and 15 males), and control group (30 patients; 12 females and 18 males). All were treated with metformin (850-1700 mg/day). Examined patients were additionally treated with alpha-lipoic acid 600 mg/day during 20 weeks. Body mass index and concentrations of total cholesterol, triglycerides and glucose in serum were compared before and after the treatment. The group treated with 600 mg alpha-lipoic acid lost significantly more weight, and had lower triglyceride level than the control group. There were no significant differences in total cholesterol and glucose serum levels between the groups. Alpha-lipoic acid of 600 mg/day treatment have influenced weight and triglycerides loss in obese patients with diabetes mellitus type 2. It should be considered as an important additive therapy in obese patients with diabetes mellitus type 2. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  1. [Use of alpha-lipoic acid and omega-3 in postpartum pain treatment].

    PubMed

    Costantino, D; Guaraldi, C; Costantino, M; Bounous, V E

    2015-10-01

    Postpartum pain is a frequent condition that negatively affects women's quality of life, interferring with everyday life. Analgesic drugs and surgery are often contraindicated in pregnancy and during breast feeding. This review of the literature aims to evaluate the rational of the association of lipoic acid and omega-3 employ in the management of postpartum pain. Lipoic acid is a cofactor essential in mitochondrial metabolism with antioxidant and anti-inflammatory activity. Lipoic acid has been shown to be effective in neuropatic pain treatment in patients with sciatica, carpal tunnel syndrome and diabetic neuropathy. Omega-3 are known for their anti-inflammatory and neurotrophic activity. The peripheral and central activity of both substances allows to act on neuroinflammation mechanisms thus reducing cronicization of pain and also determining a potential improvement of women's emotional status. The preliminary data here presented confirm the positive effect of this association on the treatment of postpartum perineal pain. The supplementation of lipoic acid in association with omega-3 seems effective and safe for the treatment of chronic postpartum pain, allowing a pathogenetic approach to neuroinflammation, thus reducing the consumption of analgesic drugs, often contraindicated during breast-feeding.

  2. Effects of alpha lipoic acid on acrylamide-induced hepatotoxicity in rats.

    PubMed

    Al-Qahtani, F A; Arafah, M; Sharma, B; Siddiqi, N J

    2017-07-31

    Acrylamide (ACR) is a neurotoxicant, reproductive toxicant, and carcinogen in animal species.  It is used in many industries and has been found to form naturally in foods cooked at high temperatures. Alpha-lipoic acid (ALA) is a naturally occurring antioxidant whose therapeutic effect has been related to its antioxidant activity.  This study was carried out to study the protective effect of alpha lipoic acid on acrylamide induced perturbations in rat liver.  Four groups of rats were studied viz., control rats, acrylamide treated rats, alpha lipoic acid treated rats, and alpha lipoic acid plus acrylamide treated rats. ACR and ALA treatment alone and together caused a signifi-cant increase in hepatic reduced glutathione content while a decrease in hepatic ascorbic content was observed when compared to control group.  ALA pretreatment of acrylamide exposed rats caused no a signifi-cant alteration in superoxide dismutase activity but resulted in a tendency towards restoration of glutathione peroxidase and catalase activity to near normal levels.  Gel electrophoresis showed fragmentation of DNA in the treated groups.  The dose of ALA used in the present study afforded partial restoration of oxidative indices altered by ACR in rat liver.

  3. A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development

    PubMed Central

    Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David

    2013-01-01

    SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300

  4. Transepithelial transport of alpha-lipoic acid across human intestinal Caco-2 cell monolayers.

    PubMed

    Takaishi, Naoki; Yoshida, Kazutaka; Satsu, Hideo; Shimizu, Makoto

    2007-06-27

    Alpha-lipoic acid (LA) is used in dietary supplements or food with antioxidative functions. The mechanism for the intestinal absorption of alpha-lipoic acid was investigated in this study by using human intestinal Caco-2 cell monolayers. LA was rapidly transported across the Caco-2 cell monolayers, this transport being energy-dependent, suggesting transporter-mediated transport to be the mechanism involved. The LA transport was strongly dependent on the pH value, being accelerated in the acidic pH range. Furthermore, such monocarboxylic acids as benzoic acid and medium-chain fatty acids significantly inhibited LA transport, suggesting that a proton-linked monocarboxylic acid transporter (MCT) was involved in the intestinal transport of LA. The conversion of LA to the more antioxidative dihydrolipoic acid was also apparent during the transport process.

  5. Alpha-lipoic acid improves subclinical left ventricular dysfunction in asymptomatic patients with type 1 diabetes.

    PubMed

    Hegazy, Sahar K; Tolba, Osama A; Mostafa, Tarek M; Eid, Manal A; El-Afify, Dalia R

    2013-01-01

    Oxidative stress plays an important role in the development of diabetic cardiomyopathy. Alpha-lipoic acid (ALA) is a powerful antioxidant that may have a protective role in diabetic cardiac dysfunction. We investigated the possible beneficial effect of alpha-lipoic acid on diabetic left ventricular (LV) dysfunction in children and adolescents with asymptomatic type 1 diabetes (T1D). Thirty T1D patients (aged 10-14) were randomized to receive insulin treatment (n = 15) or insulin plus alpha-lipoic acid 300 mg twice daily (n = 15) for four months. Age and sex matched healthy controls (n = 15) were also included. Patients were evaluated with conventional 2-dimensional echocardiographic examination (2D), pulsed tissue Doppler (PTD), and 2-dimensional longitudinal strain echocardiography (2DS) before and after therapy. Glutathione, malondialdhyde (MDA), nitric oxide (NO), tumor necrosis factor-alpha (TNF-alpha), Fas ligand (Fas-L), matrix metalloproteinase 2 (MMP-2), and troponin-I were determined and correlated to echocardiographic parameters. Diabetic patients had significantly lower levels of glutathione and significantly higher MDA, NO, TNF-alpha, Fas-L, MMP-2, and troponin-I levels than control subjects. The expression of transforming growth factor beta (TGF-beta) mRNA in peripheral blood mononuclear cells was also increased in diabetic patients. Significant correlations of mitral e'/a' ratio and left ventricular global peak systolic strain with glutathione, MDA, NO, TNF-alpha, and Fas-L were observed in diabetic patients. Alpha-lipoic acid significantly increased glutathione level and significantly decreased MDA, NO, TNF-alpha, Fas-L, MMP-2, troponin-I levels, and TGF-beta gene expression. Moreover, alpha-lipoic acid significantly increased mitral e'/a' ratio and left ventricular global peak systolic strain in diabetic patients. These findings suggest that alpha-lipoic acid may have a role in preventing the development of diabetic cardiomyopathy in type 1 diabetes.

  6. Lipoic acid functionalized SiO2@Ag nanoparticles. Synthesis, characterization and evaluation of biological activity.

    PubMed

    Tudose, Madalina; Culita, Daniela Cristina; Musuc, Adina Magdalena; Somacescu, Simona; Ghica, Cornel; Chifiriuc, Mariana Carmen; Bleotu, Coralia

    2017-10-01

    A novel nanocomposite was obtained through the covalent immobilization of lipoic acid on the surface of silver nanoparticles-decorated silica nanoparticles (SiO 2 @Ag). The hybrid organic - inorganic material obtained was characterized by Fourier transform infrared spectroscopy, thermal analysis, scanning and transmision electron microscopy, X-ray photoelectron spectroscopy and UV-Visible spectroscopy. Its antioxidant, cytotoxic, antimicrobial activity and influence on mammalian cells cycle were evaluated. The results of this study have shown that the functionalization of SiO 2 @Ag with lipoic acid resulted in a composite with increased specificity of interaction with different mammalian cell lines and antioxidant activity, but with decreased cytotoxicity and antimicrobial properties. Therefore, the SiO 2 @Ag functionalized with lipoic acid could be successfully used in certain concentrations to modulate the cell cycle, in order to obtain the desired anti-proliferative or stimulatory therapeutic effect. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Mercury toxicity and antioxidants: Part 1: role of glutathione and alpha-lipoic acid in the treatment of mercury toxicity.

    PubMed

    Patrick, Lyn

    2002-12-01

    Mercury exposure is the second-most common cause of toxic metal poisoning. Public health concern over mercury exposure, due to contamination of fish with methylmercury and the elemental mercury content of dental amalgams, has long been a topic of political and medical debate. Although the toxicology of mercury is complex, there is evidence for antioxidant protection in the prevention of neurological and renal damage caused by mercury toxicity. Alpha-lipoic acid, a coenzyme of pyruvate and alpha-ketoglutarate dehydrogenase, has been used in Germany as an antioxidant and approved treatment for diabetic polyneuropathy for 40 years. Research has attempted to identify the role of antioxidants, glutathione and alpha-lipoic acid specifically, in both mitigation of heavy metal toxicity and direct chelation of heavy metals. This review of the literature will assess the role of glutathione and alpha-lipoic acid in the treatment of mercury toxicity.

  8. Physicochemical Profiling of α-Lipoic Acid and Related Compounds.

    PubMed

    Mirzahosseini, Arash; Szilvay, András; Noszál, Béla

    2016-07-01

    Lipoic acid, the biomolecule of vital importance following glycolysis, shows diversity in its thiol/disulfide equilibria and also in its eight different protonation forms of the reduced molecule. In this paper, lipoic acid, lipoamide, and their dihydro derivatives were studied to quantify their solubility, acid-base, and lipophilicity properties at a submolecular level. The acid-base properties are characterized in terms of six macroscopic, 12 microscopic protonation constants, and three interactivity parameters. The species-specific basicities, the pH-dependent distribution of the microspecies, and lipophilicity parameters are interpreted by various intramolecular effects, and contribute to understanding the antioxidant, chelate-forming, and enzyme cofactor behavior of the molecules observed. © 2016 Wiley-VHCA AG, Zürich.

  9. Dihydrolipoyl dioleoylglycerol antioxidant capacity in phospholipid vesicles

    USDA-ARS?s Scientific Manuscript database

    Antioxidants have critical roles in maintaining cellular homeostasis and disease-state prevention. The multi-functional agent alpha-lipoic acid offers numerous beneficial effects to oxidatively stressed tissues. alpha-Lipoic acid was enzymatically incorporated into a triglyceride in conjunction wi...

  10. Lipoic Acid Metabolism of Plasmodium - A Suitable Drug Target

    PubMed Central

    Storm, Janet; Müller, Sylke

    2012-01-01

    α-Lipoic acid (6,8-thioctic acid; LA) is a vital co-factor of α-ketoacid dehydrogenase complexes and the glycine cleavage system. In recent years it was shown that biosynthesis and salvage of LA in Plasmodium are necessary for the parasites to complete their complex life cycle. LA salvage requires two lipoic acid protein ligases (LplA1 and LplA2). LplA1 is confined to the mitochondrion while LplA2 is located in both the mitochondrion and the apicoplast. LplA1 exclusively uses salvaged LA and lipoylates α-ketoglutarate dehydrogenase, branched chain α-ketoacid dehydrogenase and the H-protein of the glycine cleavage system. LplA2 cannot compensate for the loss of LplA1 function during blood stage development suggesting a specific function for LplA2 that has yet to be elucidated. LA salvage is essential for the intra-erythrocytic and liver stage development of Plasmodium and thus offers great potential for future drug or vaccine development. LA biosynthesis, comprising octanoyl-acyl carrier protein (ACP) : protein N-octanoyltransferase (LipB) and lipoate synthase (LipA), is exclusively found in the apicoplast of Plasmodium where it generates LA de novo from octanoyl-ACP, provided by the type II fatty acid biosynthesis (FAS II) pathway also present in the organelle. LA is the co-factor of the acetyltransferase subunit of the apicoplast located pyruvate dehydrogenase (PDH), which generates acetyl-CoA, feeding into FAS II. LA biosynthesis is not vital for intra-erythrocytic development of Plasmodium, but the deletion of several genes encoding components of FAS II or PDH was detrimental for liver stage development of the parasites indirectly suggesting that the same applies to LA biosynthesis. These data provide strong evidence that LA salvage and biosynthesis are vital for different stages of Plasmodium development and offer potential for drug and vaccine design against malaria. PMID:22607141

  11. Vitamin C, glutathione, or lipoic acid did not decrease brain or kidney mercury in rats exposed to mercury vapor.

    PubMed

    Aposhian, H Vasken; Morgan, Daniel L; Queen, H L Sam; Maiorino, Richard M; Aposhian, Mary M

    2003-01-01

    Some medical practitioners prescribe GSH and vitamin C alone or in combination with DMPS or DMSA for patients with mercury exposure that is primarily due to the mercury vapor emitted by dental amalgams. This study tested the hypothesis that GSH, vitamin C, or lipoic acid alone or in combination with DMPS or DMSA would decrease brain mercury. Young rats were exposed to elemental mercury by individual nose cone, at the rate of 4.0 mg mercury per m3 air for 2 h per day for 7 consecutive days. After a 7-day equilibrium period, DMPS, DMSA, GSH, vitamin C, lipoic acid alone, or in combination was administered for 7 days and the brain and kidneys of the animals removed and analyzed for mercury by cold vapor atomic absorption. None of these regimens reduced the mercury content of the brain. Although DMPS or DMSA was effective in reducing kidney mercury concentrations, GSH, vitamin C, lipoic acid alone, or in combination were not. One must conclude that the palliative effect, if any, of GSH, vitamin C, or lipoic acid for treatment of mercury toxicity due to mercury vapor exposure does not involve mercury mobilization from the brain and kidney.

  12. Effect of α-lipoic acid on symptoms and quality of life in patients with painful diabetic neuropathy.

    PubMed

    Agathos, Evangelos; Tentolouris, Anastasios; Eleftheriadou, Ioanna; Katsaouni, Panagiota; Nemtzas, Ioannis; Petrou, Alexandra; Papanikolaou, Christina; Tentolouris, Nikolaos

    2018-05-01

    Objective To examine the effect of α-lipoic acid on neuropathic symptoms in patients with diabetic neuropathy (DN). Methods Patients with painful DN were treated with 600 mg/day α-lipoic acid, orally, for 40 days. Neuropathy Symptom Score (NSS), Subjective Peripheral Neuropathy Screen Questionnaire (SPNSQ) and douleur neuropathique (DN)4 questionnaire scores were assessed at baseline and day 40. Quality-of-life treatment effects were assessed by Brief Pain Inventory (BPI), Neuropathic Pain Symptom Inventory (NPSI) and Sheehan Disability Scale (SDS). Changes in body weight, arterial blood pressure, fasting serum glucose and lipids were also assessed. Results Out of 72 patients included, significant reductions in neuropathic symptoms were shown by reduced NSS, SPNSQ and DN4 scores at day 40 versus baseline. BPI, NPSI, and SDS in terms of work disability, social life disability, and family life disability scores were also significantly reduced. Moreover, 50% of patients rated their health condition as 'very much better' or 'much better' following α-lipoic acid administration. Fasting triglyceride levels were reduced, but no difference was found in body weight, blood pressure, fasting glucose, or other lipids at day 40 versus baseline. Conclusions A-lipoic acid administration was associated with reduced neuropathic symptoms and triglycerides, and improved quality of life.

  13. [The effect of 3-oxypyridine and succinic acid derivatives on obsessive-compulsive activity of mice in marble-burying test].

    PubMed

    Volchegorskiĭ, I A; Miroshnichenko, I Iu; Rassokhina, L M; Faĭzullin, R M; Priakhina, K E

    2014-01-01

    The effect of domestic derivatives of 3-oxypyridine and succinic acid (emoxipine, reamberin, and mexidol) on obsessive-compulsive behavior of mice was studied in the marble-burying test. Additionally the effect of these drugs on the behavior of animals was assessed in the open field test. Amitriptylin and alpha-lipoic acid were used as reference drugs. It was established that single administration of the investigated drugs in optimal doses, corresponding to therapeutic range in humans, inhibits obsessive-compulsive behavior of mice in the marble-burying test. Amitriptylin and alpha-lipoic acid produced similar effects. It is established that emoxipine stimulates the behavior of mice in the open field after single administration. An increase in the emoxipine dose led to decrease of stimulation and gradual development of sedative effect. Reamberin and mexidol, as well as alpha-lipoic acid and amitriptyline, caused sedation in mice tested in the open field. Inhibiting effect of emoxipine, reamberin, mexidol and alpha-lipoic acid on the obsessive-compulsive behavior in mice directly depended on sedative action of these drugs.

  14. Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant potential and lipid stability of meat

    PubMed Central

    2013-01-01

    Background Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. Methods The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. Results The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010–11 & 2011–12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. Conclusion In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio-evaluation of this kind of functional meat in humans. PMID:24499336

  15. Co-administration of α-lipoic acid and glutathione is associated with no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels during the treatment of neuroborreliosis with intravenous ceftriaxone.

    PubMed

    Puri, Basant K; Hakkarainen-Smith, Jaana S; Derham, Anne; Monro, Jean A

    2015-09-01

    While pharmacotherapy with intravenous ceftriaxone, a third-generation cephalosporin, is a potential treatment of Lyme neuroborreliosis, there is concern that it can cause the formation of biliary sludge, leading to hepatobiliary complications such as biliary colic, jaundice and cholelithiasis, which are reflected in changes in serum levels of bilirubin and markers of cholestatic liver injury (alkaline phosphatase and γ-glutamyltranspeptidase). It has been suggested that the naturally occurring substances α-lipoic acid and glutathione may be helpful in preventing hepatic disease. α-Lipoic acid exhibits antioxidant, anti-inflammatory and anti-apoptotic activities in the liver, while glutathione serves as a sulfhydryl buffer. The aim of this study was to determine whether co-administration of α-lipoic acid and glutathione is associated with significant changes in serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase during the treatment of Lyme neuroborreliosis with long-term intravenous ceftriaxone. Serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase were measured in 42 serologically positive Lyme neuroborreliosis patients before and after long-term treatment with intravenous ceftriaxone (2-4 g daily) with co-administration of oral/intravenous α-lipoic acid (600 mg daily) and glutathione (100 mg orally or 0.6-2.4 g intravenously daily). None of the patients developed biliary colic and there were no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels over the course of the intravenous ceftriaxone treatment (mean length 75.0 days). Co-administration of α-lipoic acid and glutathione is associated with no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels during the treatment of neuroborreliosis with intravenous ceftriaxone.

  16. A rare cause of status epilepticus; alpha lipoic acid intoxication, case report and review of the literature.

    PubMed

    Tolunay, Orkun; Çelik, Tamer; Kömür, Mustafa; Gezgin, Ali Emre; Kaya, Musa Soner; Çelik, Ümit

    2015-11-01

    Alpha lipoic acid is a powerful antioxidant widely used for the supplementary treatment of diabetic neuropathy. Intoxication with alpha lipoic acid is very rare. There is no reported dose of safety in children. A 14-month-old previously healthy girl was referred to our hospital with the diagnosis of drug intoxication. She was admitted to the emergency department with lethargy and continuing involuntary movements for several hours after she had ingested an unknown amount of alpha lipoic acid. On admission she was lethargic and had myoclonic seizures involving all extremities. She had no fever and laboratory examinations were normal except for mild metabolic acidosis. The seizures were unresponsive to bolus midazolam, phenytoin infusion and levetiracetam infusion. She was taken to the pediatric intensive care unit with the diagnosis of status epilepticus. After failure of the treatment with midazolam infusion she was intubated and thiopental sodium infusion was started. Her myoclonic seizures were controlled with thiopental sodium infusion. After 48 h intubation and mechanical ventilation thiopental sodium was gradually reduced and then stopped. Following the withdraw of thiopental sodium, she was seizure free on her discharge on the 8th day. Alpha lipoic acid and derivatives cause side effects in children like refractory convulsions. They are frequently rendered as vitamins by diabetic patients and are left at places where children can easily access them. Therefore, when faced with refractory convulsions in children who have had no disease before, intoxication by medicaments with alpha lipoic acid should be taken into consideration. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  17. Mechanisms of Oxygen Toxicity at the Cellular Level.

    DTIC Science & Technology

    1982-06-30

    exposed and measured using glucose as the sole carbon source. Addition of SH containing reducing agents (cysteine, lipoic acid or dithiothreitol) before...of a Few Seconds. Biotechnology and Bioengineering 16:1645-1657 (1974). (28) Brown, O.R. Failure of Lipoic Acid to Protect Against Cellular Oxygen...respiration, and fatty acid synthesis. The interruption of fatty acid synthesis is not the result of inactivation of the fatty acid synthetase enzyme complex

  18. Lipoic acid and pentoxifylline mitigate nandrolone decanoate-induced neurobehavioral perturbations in rats via re-balance of brain neurotransmitters, up-regulation of Nrf2/HO-1 pathway, and down-regulation of TNFR1 expression.

    PubMed

    Ahmed, Maha A E; El-Awdan, Sally A

    2015-07-01

    Behavioral perturbations associated with nandrolone decanoate abuse by athletes and adolescents may be attributed to oxidative stress and inflammation. However, the underlying mechanisms are not yet fully explored. On the other hand, the natural antioxidant lipoic acid can pass the blood brain barrier and enhance Nrf2/HO-1 (nuclear factor erythroid-2 related factor 2/heme oxygenase-1) pathway. In addition, the phosphodiesterase-IV inhibitor xanthine derivative pentoxifylline has a remarkable inhibitory effect on tumor necrosis factor-alpha (TNF-α). Therefore, this study aimed at investigation of the possible protective effects of lipoic acid and/or pentoxifylline against nandrolone-induced neurobehavioral alterations in rats. Accordingly, male albino rats were randomly distributed into seven groups and treated with either vehicle, nandrolone (15mg/kg, every third day, s.c.), lipoic acid (100mg/kg/day, p.o.), pentoxifylline (200mg/kg/day, i.p.), or nandrolone with lipoic acid and/or pentoxifylline. Rats were challenged in the open field, rewarded T-maze, Morris water maze, and resident-intruder aggression behavioral tests. The present findings showed that nandrolone induced hyperlocomotion, anxiety, memory impairment, and aggression in rats. These behavioral abnormalities were accompanied by several biochemical changes, including altered levels of brain monoamines, GABA, and acetylcholine, enhanced levels of malondialdehyde and TNF-α, elevated activity of acetylcholinesterase, and up-regulated expression of TNF-α receptor-1 (TNFR1). In addition, inhibited catalase activity, down-regulated Nrf2/HO-1 pathway, and suppressed acetylcholine receptor expression were observed. Lipoic acid and pentoxifylline combination significantly mitigated all the previously mentioned deleterious effects mainly via up-regulation of Nrf2/HO-1 pathway, inhibition of TNF-α and down-regulation of TNFR1 expression. In conclusion, the biochemical and histopathological findings of this study revealed the protective mechanisms of lipoic acid and pentoxifylline against nandrolone-induced behavioral changes and neurotoxicity in rats. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Fructose-induced inflammation, insulin resistance and oxidative stress: A liver pathological triad effectively disrupted by lipoic acid.

    PubMed

    Castro, María Cecilia; Massa, María Laura; Arbeláez, Luisa González; Schinella, Guillermo; Gagliardino, Juan J; Francini, Flavio

    2015-09-15

    Fructose administration induces hepatic oxidative stress, insulin resistance, inflammatory and metabolic changes. We tested their potential pathogenic relationship and whether these alterations can be prevented by R/S-α-lipoic acid. Wistar rats received during 21days a commercial diet or the same diet supplemented with 10% fructose in drinking water without/with R/S-α-lipoic acid injection. After this period, we measured a) serum glucose, triglyceride, insulin, homeostasis model assessment-insulin resistance (HOMA-IR), insulin glucose ratio (IGR) and Matsuda indexes and b) liver oxidative stress, inflammatory markers and insulin signaling pathway components. Fructose fed rats had hyperinsulinemia, hypertriglyceridemia, higher HOMA-IR, IGR and lower Matsuda indices compared to control animals, together with increased oxidative stress markers, TNFα, IL1β and PAI-1 gene expression, and TNFα and COX-2 protein content. Whereas insulin receptor level was higher in fructose fed rats, their tyrosine-residue phosphorylation was lower. IRS1/IRS2 protein levels and IRS1 tyrosine-phosphorylation rate were lower in fructose fed rats. All changes were prevented by R/S-α-lipoic acid co-administration. Fructose-induced hepatic oxidative stress, insulin resistance and inflammation form a triad that constitutes a vicious pathogenic circle. This circle can be effectively disrupted by R/S-α-lipoic acid co-administration, thus suggesting mutual positive interaction among the triad components. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Age-Dependent Modulation of Synaptic Plasticity and Insulin Mimetic Effect of Lipoic Acid on a Mouse Model of Alzheimer’s Disease

    PubMed Central

    Sancheti, Harsh; Akopian, Garnik; Yin, Fei; Brinton, Roberta D.; Walsh, John P.; Cadenas, Enrique

    2013-01-01

    Alzheimer’s disease is a progressive neurodegenerative disease that entails impairments of memory, thinking and behavior and culminates into brain atrophy. Impaired glucose uptake (accumulating into energy deficits) and synaptic plasticity have been shown to be affected in the early stages of Alzheimer’s disease. This study examines the ability of lipoic acid to increase brain glucose uptake and lead to improvements in synaptic plasticity on a triple transgenic mouse model of Alzheimer’s disease (3xTg-AD) that shows progression of pathology as a function of age; two age groups: 6 months (young) and 12 months (old) were used in this study. 3xTg-AD mice fed 0.23% w/v lipoic acid in drinking water for 4 weeks showed an insulin mimetic effect that consisted of increased brain glucose uptake, activation of the insulin receptor substrate and of the PI3K/Akt signaling pathway. Lipoic acid supplementation led to important changes in synaptic function as shown by increased input/output (I/O) and long term potentiation (LTP) (measured by electrophysiology). Lipoic acid was more effective in stimulating an insulin-like effect and reversing the impaired synaptic plasticity in the old mice, wherein the impairment of insulin signaling and synaptic plasticity was more pronounced than those in young mice. PMID:23875003

  1. Process Research and Development of Antibodies as Countermeasures for C. Botulinum

    DTIC Science & Technology

    2006-03-01

    acid , lipoic acid , phenol red, putrescine 2HCl, sodium pyruvate, and HEPES is same as HAM’SF12:IMDM (1:1). The concentrations of the glucose...Na2SeO3 0.0085 D-glucose 4000 Linoleic Acid 0.04 Lipoic Acid 0.105 Phenol Red 8.1 Putrescine 2HCl 0.0805 Sodium Pyruvate 110 HEPES 2979 L-Alanine...0.0134 Arachidonic acid 0.014 cholestrol 1.54 DL- alpha -tocopherol- acetate 0.49 Linoleic acid 0.07 linolenic acid 0.07 myristic acid 0.07

  2. Effect of treatment with the antioxidant alpha-lipoic (thioctic) acid on heart and kidney microvasculature in spontaneously hypertensive rats.

    PubMed

    Tayebati, Seyed Khosrow; Tomassoni, Daniele; Di Cesare Mannelli, Lorenzo; Amenta, Francesco

    2016-01-01

    Endothelial cells represent an important vascular site of signaling and development of damage during ischemia, inflammation and other pathological conditions. Excessive reactive oxygen species production causes pathological activation of endothelium including exposure of cell to adhesion molecules. Intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and platelet-endothelial cell adhesion molecule-1 (PECAM-1) are members of the immunoglobulin super-family which are present on the surface of endothelial cells. These molecules represent important markers of endothelial inflammation. The present study was designed to investigate, with immunochemical and immunohistochemical techniques, the effect of treatment with (+/-)-alpha lipoic (thioctic) acid and its enantiomers on heart and kidney endothelium in spontaneously hypertensive rats (SHR). Arterial hypertension is accompanied by an increased oxidative stress status in the heart characterized by thiobarbituric acid reactive substances (TBARS) and nucleic acid oxidation increase. The higher oxidative stress also modifies adhesion molecules expression. In the heart VCAM-1, which was higher than ICAM-1 and PECAM-1, was increased in SHR. ICAM-1, VCAM-1 and PECAM-1 expression was significantly greater in the renal endothelium of SHR. (+/-)-Alpha lipoic acid and (+)-alpha lipoic acid treatment significantly decreased TBARS levels, the nucleic acid oxidation and prevented adhesion molecules expression in cardiac and renal vascular endothelium. These data suggest that endothelial molecules may be used for studying the mechanisms of vascular injury on target organs of hypertension. The effects observed after treatment with (+)-alpha lipoic acid could open new perspectives for countering heart and kidney microvascular injury which represent a common feature in hypertensive end-organs damage.

  3. Investigation of Enantioselective Membrane Permeability of α-Lipoic Acid in Caco-2 and MDCKII Cell.

    PubMed

    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi

    2016-01-26

    α-Lipoic acid (LA) contains a chiral carbon and exists as two enantiomers (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA)). We previously demonstrated that oral bioavailability of RLA is better than that of SLA. This difference arose from the fraction absorbed multiplied by gastrointestinal availability (F(a) × F(g)) and hepatic availability (F(h)) in the absorption phase. However, it remains unclear whether F(a) and/or F(g) are involved in enantioselectivity. In this study, Caco-2 cells and Madin-Darby canine kidney strain II cells were used to assess the enantioselectivity of membrane permeability. LA was actively transported from the apical side to basal side, regardless of the differences in its steric structure. Permeability rates were proportionally increased in the range of 10-250 µg LA/mL, and the permeability coefficient did not differ significantly between enantiomers. Hence, we conclude that enantioselective pharmacokinetics arose from the metabolism (F(h) or F(g) × F(h)), and definitely not from the membrane permeation (F(a)) in the absorption phase.

  4. α-Lipoic acid inhibits sevoflurane-induced neuronal apoptosis through PI3K/Akt signalling pathway.

    PubMed

    Ma, Rong; Wang, Xiang; Peng, Peipei; Xiong, Jingwei; Dong, Hongquan; Wang, Lixia; Ding, Zhengnian

    2016-01-01

    Sevoflurane is a widely used anaesthetic agent, including in anaesthesia of children and infants. Recent studies indicated that the general anaesthesia might cause the cell apoptosis in the brain. This issue raises the concerns about the neuronal toxicity induced by the application of anaesthetic agents, especially in the infants and young children. In this study, we used Morris water maze, western blotting and immunohistochemistry to elucidate the role of α-lipoic acid in the inhibition of neuronal apoptosis. We found that sevoflurane led to the long-term cognitive impairment in the young rats. This adverse effect may be caused by the neuronal death in the hippocampal region, mediated through PI3K/Akt signalling pathway. We also showed that α-lipoic acid offset the effect of sevoflurane on the neuronal apoptosis and cognitive dysfunction. This study elucidated the potential clinical role of α-lipoic acid, providing a promising way in the prevention and treatment of long-term cognitive impairment induced by sevoflurane general anesthesia. Copyright © 2016 John Wiley & Sons, Ltd.

  5. Effects of Alpha-Lipoic Acid on Oxidative Stress and Kinin Receptor Expression in Obese Zucker Diabetic Fatty Rats.

    PubMed

    Midaoui, Adil El; Talbot, Sébastien; Lahjouji, Karim; Dias, Jenny Pena; Fantus, I George; Couture, Réjean

    2015-06-01

    To investigate the impact of alpha-lipoic acid on superoxide anion production and NADPH oxidase activity as well as on the expression of kinin B1 and B2 receptors in key organs of obese Zucker Diabetic Fatty rats. Superoxide anion production was measured by lucigenin chemiluminescence. Kinin B1 and B2 receptors expression was measured at protein and mRNA levels by western blot and qRT-PCR in key organs of Zucker Diabetic Fatty and Zucker lean control rats treated for a period of 6 weeks with a standard diet or a diet containing the antioxidant α-lipoic acid (1 g/kg). Superoxide anion production and NADPH oxidase activity were significantly enhanced in aorta and adipose tissue of Zucker Diabetic Fatty rats. Kinin B1 and B2 receptors expression levels were also significantly increased in the liver and the gastrocnemius muscle of Zucker Diabetic Fatty rats. Expression of both receptors was not altered in the pancreas of Zucker Diabetic Fatty rats and was undetectable in white retroperitoneal adipose tissue. Alpha-lipoic acid prevented the rise in NADPH oxidase activity in aorta and epididymal adipose tissue of Zucker Diabetic Fatty rats and the upregulation of kinin B1 receptor in liver and gastrocnemius muscle and that of kinin B2 receptor in the liver. Alpha-lipoic acid treatment was found to prevent the final body weight increase without affecting significantly hyperglycemia, hyperinsulinemia and insulin resistance index in Zucker Diabetic Fatty rats. Findings support the hypothesis that oxidative stress is implicated in the induction of kinin B1 receptor in Zucker Diabetic Fatty rats. The ability of α-lipoic acid to blunt the body weight gain appears to be mediated in part by preventing NADPH oxidase activity rise in adipose tissue and reversing the hepatic upregulation of kinin B1 receptor in Zucker Diabetic Fatty rats.

  6. Effects of alpha-lipoic acid supplementation on C-reactive protein level: A systematic review and meta-analysis of randomized controlled clinical trials.

    PubMed

    Saboori, S; Falahi, E; Eslampour, E; Zeinali Khosroshahi, M; Yousefi Rad, E

    2018-04-17

    The aim of this meta-analysis was to assess effects of alpha-lipoic acid supplementation on C-reactive protein (CRP) levels in clinical trial studies. A systematic search was carried out on clinical trial studies published in PubMed, ISI Web of Science, Cochrane Library and Scopus databases completed by manual search on reference list of eligible studies accomplished by November 4, 2017. Of a total number of 508 studies found in the first step of literature search, only 11 were included with 264 participants in supplementation groups and 287 in control groups. Estimated pooled random effects size analysis showed a significant reducing effect of alpha-lipoic acid supplementation on CRP level (-0.72 mg/l, 95% CI; -1.4, -0.04; P = 0.03) with a significant heterogeneity between the selected studies. Sub-group analysis showed that alpha-lipoic acid supplementation could significantly reduce serum CRP level when the baseline CRP level was greater than 3 mg/l (-1.02 mg/l, 95% CI: -1.3, -0.73) and when trial duration was >8 weeks (-0.99 mg/l, 95% CI: -1.29, -0.70). Results of subgroup analysis also showed that alpha lipoic acid supplementation could decrease CRP level only in non-diabetic patients (-1.02 mg/l, 95% CI: -1.31, -0.74). Results of the current meta-analysis study showed that alpha-lipoic acid supplementation could significantly decrease CRP level in patients with elevated levels of this inflammatory marker. Copyright © 2018 The Italian Society of Diabetology, the Italian Society for the Study of Atherosclerosis, the Italian Society of Human Nutrition, and the Department of Clinical Medicine and Surgery, Federico II University. Published by Elsevier B.V. All rights reserved.

  7. STUDIES ON MAMMALIAN AND HUMAN PYRUVATE AND ALPHA-KETOGLUTARATE DEHYDROGENATION COMPLEXES

    DTIC Science & Technology

    bound lipoic acid and 17 moles of bound FAD. Alpha -ketoglutarate dehydrogenase complex contains approximately 10 moles of protein-bound lipoic acid , 9...typical metal activators of oxidative decarboxylation reaction of alpha -keto acid . These activating effects were in good agreement with the results of...A coenzyme A- and NAD-linked pyruvate and alpha -ketoglutarate dehydrogenase complexes have been isolated from pig heart muscle as multienzyme units

  8. Lipoic acid and dihydrolipoic acid. A comprehensive theoretical study of their antioxidant activity supported by available experimental kinetic data.

    PubMed

    Castañeda-Arriaga, Romina; Alvarez-Idaboy, J Raul

    2014-06-23

    The free radical scavenging activity of lipoic acid (LA) and dihydrolipoic acid (DHLA) has been studied in nonpolar and aqueous solutions, using the density functional theory and several oxygen centered radicals. It was found that lipoic acid is capable of scavenging only very reactive radicals, while the dehydrogenated form is an excellent scavenger via a hydrogen transfer mechanism. The environment plays an important role in the free radical scavenging activity of DHLA because in water it is deprotonated, and this enhances its activity. In particular, the reaction rate constant of DHLA in water with an HOO(•) radical is close to the diffusion limit. This has been explained on the basis of the strong H-bonding interactions found in the transition state, which involve the carboxylate moiety, and it might have implications for other biological systems in which this group is present.

  9. Alpha-Lipoic acid increases energy expenditure by enhancing adenosine monophosphate-activated protein kinase-peroxisome proliferator-activated receptor-gamma coactivator-1alpha signaling in the skeletal muscle of aged mice

    USDA-ARS?s Scientific Manuscript database

    Skeletal muscle mitochondrial dysfunction is associated with aging and diabetes, which decreases respiratory capacity and increases reactive oxygen species. Lipoic acid (LA) possesses antioxidative and antidiabetic properties. Metabolic action of LA is mediated by activation of adenosine monophospha...

  10. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing

    USDA-ARS?s Scientific Manuscript database

    Alpha-lipoic acid (ALA) is known as a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar sperm and the antioxidant effect of ALA on boar sperm during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0, and 10.0, mg/m...

  11. Enantioselective Pharmacokinetics of α-Lipoic Acid in Rats

    PubMed Central

    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi

    2015-01-01

    α-Lipoic acid (LA) is widely used for nutritional supplements as a racemic mixture, even though the R enantiomer is biologically active. After oral administration of the racemic mixture (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA) mixed at the ratio of 50:50) to rats, RLA showed higher plasma concentration than SLA, and its area under the plasma concentration-time curve from time zero to the last (AUC) was significantly about 1.26 times higher than that of SLA. However, after intravenous administration of the racemic mixture, the pharmacokinetic profiles, initial concentration (C0), AUC, and half-life (T1/2) of the enantiomers were not significantly different. After oral and intraduodenal administration of the racemic mixture to pyrolus-ligated rats, the AUCs of RLA were significantly about 1.24 and 1.32 times higher than that of SLA, respectively. In addition, after intraportal administration the AUC of RLA was significantly 1.16 times higher than that of SLA. In conclusion, the enantioselective pharmacokinetics of LA in rats arose from the fraction absorbed multiplied by gastrointestinal availability (FaFg) and hepatic availability (Fh), and not from the total clearance. PMID:26402669

  12. Enantioselective Pharmacokinetics of α-Lipoic Acid in Rats.

    PubMed

    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi

    2015-09-21

    α-Lipoic acid (LA) is widely used for nutritional supplements as a racemic mixture, even though the R enantiomer is biologically active. After oral administration of the racemic mixture (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA) mixed at the ratio of 50:50) to rats, RLA showed higher plasma concentration than SLA, and its area under the plasma concentration-time curve from time zero to the last (AUC) was significantly about 1.26 times higher than that of SLA. However, after intravenous administration of the racemic mixture, the pharmacokinetic profiles, initial concentration (C₀), AUC, and half-life (T1/2) of the enantiomers were not significantly different. After oral and intraduodenal administration of the racemic mixture to pyrolus-ligated rats, the AUCs of RLA were significantly about 1.24 and 1.32 times higher than that of SLA, respectively. In addition, after intraportal administration the AUC of RLA was significantly 1.16 times higher than that of SLA. In conclusion, the enantioselective pharmacokinetics of LA in rats arose from the fraction absorbed multiplied by gastrointestinal availability (FaFg) and hepatic availability (Fh), and not from the total clearance.

  13. Effects of Low Level Radiation exposure on Neurogenesis and Cognitive Function: Mechanisms and Prevention

    DTIC Science & Technology

    2005-09-01

    precursor cells in culture with uX-lipoic acid reverses the density dependent changes observed in culture; this compound may provide an effective means...inhibited growth of precursor cells in vitro; - Antioxidant treatment of neural precursor cells in culture with a-lipoic acid (ALA) reverses the...with a single lO-Gy dose, and tissues avidin-biotinylated pemxidase complex; GFAP, glial fibrillary acidic protein; DAB, 3,3’- were collected from 6 to

  14. [Antihypoxic effect of 3-hydroxypyridine and succinic acid derivatives and their nootropic action in alloxan diabetes].

    PubMed

    Volchegorskiĭ, I A; Rassokhina, L M; Miroshnichenko, I Iu

    2011-01-01

    Relationship between the antihypoxic effect of 3-hydroxypyridine and succinic acid derivatives (emoxipine, reamberin and mexidol) and their effect on conditional learning, glycemia, and lipidemia was studied in rats with alloxan-induced diabetes. In parallel, the analogous relationship was investigated for alpha-lipoic acid that is regarded as a "gold standard" in treatment of diabetic neuropathy. It was established that single administration of emoxipine and mexidol in mice in doses equivalent to therapeutic-range doses in humans produces antihypoxic effect manifested by increased resistance to acute hypoxic hypoxia in test animals. Alpha-lipoic acid is inferior to emoxipin and mexidol in the degree of antihypoxic action. Reamberin does not exhibit this effect. The introduction of emoxipin, reamberin, mexidol, and alpha-lipoic acid in rats with alloxan diabetes during 7 or 14 days in doses equivalent to therapeutic-range doses in humans corrects conditional learning disorders in direct relationship with the antihypoxic activity of these drugs. The development of the nootropic effect of emoxipin, mexidol, and alpha-lipoic acid is related to a decrease in hyperglycemia and hyperlipidemia in rats with alloxan diabetes. The nootropic action of reamberin is accompanied by a transient hypoglycemizing effect and aggravation of dyslipidemic disorders. The antihypoxic activity of investigated drugs determines the direction and expression of their lipidemic effect, but is not correlated with the hypoglycemizing action these drugs on test animals with alloxan diabetes.

  15. Effects of the Antioxidant α-Lipoic Acid on Human Umbilical Vein Endothelial Cells Infected with Rickettsia rickettsii

    PubMed Central

    Eremeeva, Marina E.; Silverman, David J.

    1998-01-01

    Rickettsia rickettsii infection of endothelial cells is manifested in very distinctive changes in cell morphology, consisting of extensive dilatation of the membranes of the endoplasmic reticulum and outer nuclear envelope and blebbing of the plasma membrane, as seen by transmission electron microscopy (D. J. Silverman, Infect. Immun. 44:545–553, 1984). These changes in cellular architecture are thought to be due to oxidant-mediated cell injury, since their occurrence correlates with dramatic alterations in cellular metabolism, particularly with regard to antioxidant systems. In this study, it was shown that R. rickettsii infection of human umbilical vein endothelial cells resulted in a significant depletion of intracellular reduced glutathione (thiol) content at 72 and 96 h and decreased glutathione peroxidase activity at 72 h postinfection. Infected cells displayed a dramatic increase in the concentration of intracellular peroxides by 72 h. Supplementation of the cell culture medium with 100, 200, or 500 μM α-lipoic acid, a metabolic antioxidant, after inoculation with R. rickettsii restored the intracellular levels of thiols and glutathione peroxidase and reduced the intracellular peroxide levels in infected cells. These effects were dose dependent. Treated infected monolayers maintained better viability at 96 h after inoculation with R. rickettsii than did untreated infected cells. Moreover, supplementation of the cell culture medium with 100 μM α-lipoic acid for 72 h after infection prevented the occurrence of morphological changes in the infected cells. The presence of 100 or 200 μM α-lipoic acid did not influence rickettsial growth in endothelial cells, nor did it affect the ability of R. rickettsii to form lytic plaques in Vero cells. Treatment with 500 μM α-lipoic acid decreased by 50% both the number and size of lytic plaques in Vero cells, and it also decreased the recovery of viable rickettsiae from endothelial cells. However, under all treatment conditions, a significant number of rickettsiae could be detected microscopically. Furthermore, the rickettsiae apparently retained their capacity for intracellular movement, since they possessed long polymerized actin tails after 72 and 96 h of treatment regardless of the concentration of α-lipoic acid used. Since α-lipoic acid does not seem to exhibit direct antirickettsial activity except with long-term exposure at very high concentrations, the mechanism of its protective activity for endothelial cells infected with rickettsiae may involve complex changes in cellular metabolism that only indirectly affect rickettsiae. PMID:9573120

  16. Lipoic acid and Calligonum comosumon attenuate aroclor 1260-induced testicular toxicity in adult rats.

    PubMed

    Aly, Hamdy A A; Alahdal, Abdulrahman M; Nagy, Ayman A; Abdallah, Hossam M; Abdel-Sattar, Essam A; Azhar, Ahmad S

    2017-04-01

    Aroclor 1260 is one of the more representative polychlorinated biphenyls found in biota. This study was designed to delineate the testicular toxicity of Aroclor 1260 and to elucidate the potential protective role of Calligonum comosum (C. comosum) and lipoic acid in adult rats. Aroclor 1260 was dissolved in corn oil and given to rats by gavage at doses 0, 20, 40, or 60 mg/kg/day for 15 consecutive days (Groups I, II, III, and IV, respectively). Groups V and VI were pretreated with C. comosum (200 mg/kg/day) and lipoic acid (35 mg/kg/day) respectively 24 h before Aroclor 1260 (40 mg/kg/day) treatment for 15 consecutive days. Aroclor 1260 (20, 40 or 60 mg/kg/day) treatment significantly decreased testes weight, sperm count and motility and daily sperm production. Serum testosterone was significantly decreased in response to treatment with 40 and 60 mg/kg/day of Aroclor 1260. LDH-X activity was significantly decreased at the three dose levels. Hydrogen peroxide (H 2 O 2 ) production (in a dose-related manner) and lipid peroxidation were significantly increased in response to Aroclor 1260 (20, 40, or 60 mg/kg/day) treatment. Aroclor 1260 at the three dose levels decreased the activities of the antioxidant enzymes SOD, CAT, GPx, and GR and the non-enzymatic antioxidant GSH level. CAT, GPx and GSH showed a dose-response effect. These abnormalities were effectively attenuated by pretreatment with C. comosum (200 mg/kg/day) or lipoic acid (35 mg/kg/day). Histopathological examination showed a dose-related increase in morphological abnormalities of the testis in response to Aroclor 1260 treatment. In conclusion, Aroclor 1260 induced testicular toxicity at least, in part, by induction of oxidative stress. By reversal of biochemical and morphological changes towards normalcy, the cytoprotective role of C. comosum and lipoic acid is illuminated. In comparison, lipoic acid was more protective than C. comosum extract against testicular toxicity induced by Aroclor 1260. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1147-1157, 2017. © 2016 Wiley Periodicals, Inc.

  17. Effects of alpha-lipoic acid on retinal ganglion cells, retinal thicknesses, and VEGF production in an experimental model of diabetes.

    PubMed

    Kan, Emrah; Alici, Ömer; Kan, Elif Kılıç; Ayar, Ahmet

    2017-12-01

    The purpose of the present study was to investigate the effect of alpha-lipoic acid (ALA) on the thicknesses of various retinal layers and on the numbers of retinal ganglion cells and vascular endothelial growth factor levels in experimental diabetic mouse retinas. Twenty-one male BALB/C mice were made diabetic by the intraperitoneal administration of streptozotocin (200 mg/kg). One week after the induction of diabetes, the mice were divided randomly into three groups: control group (non-diabetic mice treated with alpha-lipoic acid, n = 7), diabetic group (diabetic mice without treatment, n = 7), and alpha-lipoic acid treatment group (diabetic mice with alpha-lipoic acid treatment, n = 7). At the end of the 8th week, the thicknesses of the inner nuclear layer (INL), outer nuclear layer (ONL), and full-length retina were measured; also retinal ganglion cells and VEGF expressions were counted on the histological sections of the mouse retinas and compared with each other. The thicknesses of the full-length retina, ONL, and INL were significantly reduced in the diabetic group compared to the control and ALA treatment groups (p = 0.001), whereas the thicknesses of these layers did not show a significant difference between ALA treatment and control groups. The number of ganglion cells in the diabetic group was significantly lower than those in the control and ALA treatment groups (p = 0.001). The VEGF expression was significantly higher in the diabetic group and mostly observed in the ganglion cell and inner nuclear layers compared to the control and ALA treatment groups (p = 0.001). Therefore, the number of ganglion cells and VEGF levels did not show significant differences between the ALA treatment and control groups (p = 0.7). Our results show that alpha-lipoic acid treatment may have an impact on reducing VEGF levels, protecting ganglion cells, and preserving the thicknesses of the inner and outer layers in diabetic mouse retinas.

  18. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells.

    PubMed

    Choi, Ji Hyun; Cho, Soon Ok; Kim, Hyeyoung

    2016-01-01

    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation.

  19. In Vivo Roles of Fatty Acid Biosynthesis Enzymes in Biosynthesis of Biotin and α-Lipoic Acid in Corynebacterium glutamicum.

    PubMed

    Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki

    2017-10-01

    For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase (FAS-II) system. In this study, we reported genetic evidence demonstrating that the FAS-I system is the source of the biotin precursor in vivo in the engineered biotin-prototrophic C. glutamicum strain. This study also uncovered the important physiological role of FasB in lipoic acid biosynthesis. Here, we present an FAS-I enzyme that functions in supplying the lipoic acid precursor, although its biosynthesis has been believed to exclusively depend on FAS-II in organisms. The findings obtained here provide new insights into the metabolic engineering of this industrially important microorganism to produce these compounds effectively. Copyright © 2017 American Society for Microbiology.

  20. In Vivo Roles of Fatty Acid Biosynthesis Enzymes in Biosynthesis of Biotin and α-Lipoic Acid in Corynebacterium glutamicum

    PubMed Central

    Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki

    2017-01-01

    ABSTRACT For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI. Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA. These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum. IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis, which use an individual nonaggregating type II fatty acid synthase (FAS-II) system. In this study, we reported genetic evidence demonstrating that the FAS-I system is the source of the biotin precursor in vivo in the engineered biotin-prototrophic C. glutamicum strain. This study also uncovered the important physiological role of FasB in lipoic acid biosynthesis. Here, we present an FAS-I enzyme that functions in supplying the lipoic acid precursor, although its biosynthesis has been believed to exclusively depend on FAS-II in organisms. The findings obtained here provide new insights into the metabolic engineering of this industrially important microorganism to produce these compounds effectively. PMID:28754705

  1. Oxidative modification of lipoic acid by HNE in Alzheimer disease brain.

    PubMed

    Hardas, Sarita S; Sultana, Rukhsana; Clark, Amy M; Beckett, Tina L; Szweda, Luke I; Murphy, M Paul; Butterfield, D Allan

    2013-01-01

    Alzheimer disease (AD) is an age-related neurodegenerative disease characterized by the presence of three pathological hallmarks: synapse loss, extracellular senile plaques (SP) and intracellular neurofibrillary tangles (NFTs). The major component of SP is amyloid β-peptide (Aβ), which has been shown to induce oxidative stress. The AD brain shows increased levels of lipid peroxidation products, including 4-hydroxy-2-nonenal (HNE). HNE can react covalently with Cys, His, or Lys residues on proteins, altering structure and function of the latter. In the present study we measured the levels of the HNE-modified lipoic acid in brain of subjects with AD and age-matched controls. Lipoic acid is a key co-factor for a number of proteins including pyruvate dehydrogenase and α-ketoglutarate dehydrogenase, key complexes for cellular energetics. We observed a significant decrease in the levels of HNE-lipoic acid in the AD brain compared to that of age-matched controls. To investigate this phenomenon further, the levels and activity of lipoamide dehydrogenase (LADH) were measured in AD and control brains. Additionally, LADH activities were measured after in-vitro HNE-treatment to mice brains. Both LADH levels and activities were found to be significantly reduced in AD brain compared to age-matched control. HNE-treatment also reduced the LADH activity in mice brain. These data are consistent with a two-hit hypothesis of AD: oxidative stress leads to lipid peroxidation that, in turn, causes oxidative dysfunction of key energy-related complexes in mitochondria, triggering neurodegeneration. This study is consonant with the notion that lipoic acid supplementation could be a potential treatment for the observed loss of cellular energetics in AD and potentiate the antioxidant defense system to prevent or delay the oxidative stress in and progression of this devastating dementing disorder.

  2. Lipid Lowering Effect of Antioxidant Alpha-Lipoic Acid in Experimental Atherosclerosis

    PubMed Central

    Amom, Zulkhairi; Zakaria, Zaiton; Mohamed, Jamaluddin; Azlan, Azrina; Bahari, Hasnah; Taufik Hidayat Baharuldin, Mohd; Aris Moklas, Mohd; Osman, Khairul; Asmawi, Zanariyah; Kamal Nik Hassan, Mohd

    2008-01-01

    Accumulating data demonstrated that hypercholesterolemia and oxidative stress play an important role in the development of atherosclerosis. In the present study, a protective activity of alpha-lipoic acid; a metabolic antioxidant in hypercholesterolemic-induced animals was investigated. Eighteen adult male New Zealand White (NZW) rabbit were segregated into three groups labelled as group N, HCD and ALA (n = 6). Group N (normal control) was fed with normal chow, the rest (HCD and ALA) were fed with 100 g/head/day of 1% cholesterol rich diet to induce hypercholesterolemia. Four point two mg/body weight of alpha lipoic acid was concomintantly supplemented to the ALA group. Drinking water was given ad-libitum. The study was designed for 10 weeks. Blood sampling was taken from the ear lobe vein at the beginning, week 5 and week 10. Plasma was prepared for lipid profile estimation and microsomal lipid peroxidation index indicated with malondialdehyde (MDA) formation. At the end of the experiment, the animals were sacrificed and the aorta were excised for intimal lesion analysis. The plasma total cholesterol (TC) and low density lipoprotein (LDL) levels were found to be significantly low in ALA group compared to that of the HCD group (p<0.05). Similarly, low level of MDA (p<0.05) in ALA group was observed compared to that of the HCD group showing a significant reduction of lipid peroxidation activity. Histomorphometric intimal lesion analysis of the aorta showing less of atheromatous plaque formation in alpha lipoic acid supplemented group (p<0.05) compared to HCD group. These findings suggested that alpha lipoic acid posses a dual lipid lowering and anti-atherosclerotic properties indicated with low plasma TC and LDL levels and reduction of athero-lesion formation in hypercholesterolemic-induced rabbits. PMID:18818758

  3. Post-translational modification in the archaea: structural characterization of multi-enzyme complex lipoylation.

    PubMed

    Posner, Mareike G; Upadhyay, Abhishek; Crennell, Susan J; Watson, Andrew J A; Dorus, Steve; Danson, Michael J; Bagby, Stefan

    2013-01-15

    Lipoylation, the covalent attachment of lipoic acid to 2-oxoacid dehydrogenase multi-enzyme complexes, is essential for metabolism in aerobic bacteria and eukarya. In Escherichia coli, lipoylation is catalysed by LplA (lipoate protein ligase) or by LipA (lipoic acid synthetase) and LipB [lipoyl(octanoyl) transferase] combined. Whereas bacterial and eukaryotic LplAs comprise a single two-domain protein, archaeal LplA function typically involves two proteins, LplA-N and LplA-C. In the thermophilic archaeon Thermoplasma acidophilum, LplA-N and LplA-C are encoded by overlapping genes in inverted orientation (lpla-c is upstream of lpla-n). The T. acidophilum LplA-N structure is known, but the LplA-C structure is unknown and LplA-C's role in lipoylation is unclear. In the present study, we have determined the structures of the substrate-free LplA-N-LplA-C complex and E2lipD (dihydrolipoyl acyltransferase lipoyl domain) that is lipoylated by LplA-N-LplA-C, and carried out biochemical analyses of this archaeal lipoylation system. Our data reveal the following: (i) LplA-C is disordered but folds upon association with LplA-N; (ii) LplA-C induces a conformational change in LplA-N involving substantial shortening of a loop that could repress catalytic activity of isolated LplA-N; (iii) the adenylate-binding region of LplA-N-LplA-C includes two helices rather than the purely loop structure of varying order observed in other LplA structures; (iv) LplAN-LplA-C and E2lipD do not interact in the absence of substrate; (v) LplA-N-LplA-C undergoes a conformational change (the details of which are currently undetermined) during lipoylation; and (vi) LplA-N-LplA-C can utilize octanoic acid as well as lipoic acid as substrate. The elucidated functional inter-dependence of LplA-N and LplA-C is consistent with their evolutionary co-retention in archaeal genomes.

  4. d-chiro-Inositol and alpha lipoic acid treatment of metabolic and menses disorders in women with PCOS.

    PubMed

    Cianci, Antonio; Panella, Marco; Fichera, Michele; Falduzzi, Cristina; Bartolo, Manuela; Caruso, Salvatore

    2015-06-01

    To evaluate the effects of the combination of d-chiro-inositol (DCI) and alpha lipoic acid on menses and metabolic disorders in women with polycystic ovary syndrome (PCOS). Forty-six women (26 study group subjects and 20 controls) of reproductive age with PCOS according to Rotterdam criteria were enrolled in this prospective study. Fasting serum samples were collected from each woman. Homeostasis model of insulin resistance, insulin levels, lipid profile, frequency of menstrual cycles, number of ovarian peripheral cysts and BMI of both groups were investigated at baseline and after 180 days. Clinical and metabolic aspects of women on DCI and lipoic acid treatment underwent improvement (p < 0.5) with respect to the control group. Regarding lipid profile, no statistically difference was observed in total cholesterol and triglycerides levels in both groups at follow-up with respect the baseline values (p = NS). DCI and alpha lipoic acid treatment has been thought because it plays an essential role in mitochondrial specific pathways that generate energy from glucose and its potent effect as antioxidant. The association might have a strong impact on metabolic profile even with a short-term treatment. Further investigations are needed to evaluate other effects on reproductive physiology of women with PCOS.

  5. Inhibition of Peripheral TNF-α and Downregulation of Microglial Activation by Alpha-Lipoic Acid and Etanercept Protect Rat Brain Against Ischemic Stroke.

    PubMed

    Wu, Ming-Hsiu; Huang, Chao-Ching; Chio, Chung-Ching; Tsai, Kuen-Jer; Chang, Ching-Ping; Lin, Nan-Kai; Lin, Mao-Tsun

    2016-09-01

    Ischemic stroke, caused by obstruction of blood flow to the brain, would initiate microglia activation which contributes to neuronal damage. Therefore, inhibition of microglia-mediated neuroinflammation could be a therapeutic strategy for ischemic stroke. This study was aimed to elucidate the anti-inflammatory effects of alpha-lipoic acid and etanercept given either singly or in combination in rats subjected to middle cerebral artery occlusion. Both α-lipoic acid and etanercept markedly reduced cerebral infarct, blood-brain barrier disruption, and neurological motor deficits with the former drug being more effective with the dosage used. Furthermore, when used in combination, the reduction was more substantial. Remarkably, a greater diminution in the serum levels of tumor necrosis factor-alpha as well as the brain levels of microglial activation (e.g., microgliosis, amoeboid microglia, and microglial overexpression of tumor necrosis factor-α) was observed with the combined drug treatment as compared to the drugs given separately. We conclude that inhibition of peripheral tumor necrosis factor-alpha as well as downregulation of brain microglial activation by alpha-lipoic acid or etanercept protect rat brain against ischemic stroke. Moreover, when both drugs were used in combination, the stroke recovery was promoted more extensively.

  6. α-Lipoic acid treatment of aged type 2 diabetes mellitus complicated with acute cerebral infarction.

    PubMed

    Zhao, L; Hu, F-X

    2014-01-01

    This study aims to evaluate the efficacy and safety of α-lipoic acid in the treatment of aged type 2 diabetes mellitus (T2DM) complicated with acute cerebral infarction. 90 patients were randomly divided into two groups, on the basis of conventional treatment. The experiment group was administrated with α-lipoic acid, while only Vitamin C for the control group, for 3 consecutive weeks. Before and after the experiment, superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and malondialdehyde (MDA) levels were measured and scored with the NIHSS (National Institutes of Health Stroke Scale), and the changes of blood glucose, insulin function and other indicators were observed. After the treatment, the plasma SOD and GSH-Px levels increased, while MDA decreased (p < 0.05), with statistical significance when compared with the control group (p < 0.01). NIHSS score, blood glucose, blood lipids and HOMA-IA of the experiment group decreased significantly (p < 0.01); and no significant adverse reactions were found in both groups. α-lipoic acid was safe and effective in the treatment of aged T2DM complicated with acute cerebral infarction, significantly reducing the patient's oxidative stress, blood glucose and lipid levels and being able to improve islet function.

  7. Alpha-Lipoic Acid Alleviates Acute Inflammation and Promotes Lipid Mobilization During the Inflammatory Response in White Adipose Tissue of Mice.

    PubMed

    Guo, Jun; Gao, Shixing; Liu, Zhiqing; Zhao, Ruqian; Yang, Xiaojing

    2016-10-01

    Recently, white adipose tissue has been shown to exhibit immunological activity, and may play an important role in host defense and protection against bacterial infection. Αlpha-lipoic acid (α-LA) has been demonstrated to function as an anti-inflammatory and anti-oxidant agent. However, its influence on the inflammatory response and metabolic changes in white adipose tissue remains unknown. We used male C57BL/6 mice as models to study the effect of α-LA on the inflammatory response and metabolic changes in white adipose tissue after stimulation with lipopolysaccharide (LPS). The non-esterified fatty acid content was measured by an automatic biochemical analyzer. The expression of inflammation-, lipid- and energy metabolism-related genes and proteins was determined by quantitative real-time polymerase chain reaction and western blotting. The results indicated that α-LA significantly decreased the epididymis fat weight index and the non-esterified fatty acid content in plasma compared with the control group. LPS significantly increased the expression of inflammation genes and α-LA reduced their expression. The LPS-induced expression of nuclear factor-κB protein was decreased by α-LA. Regarding lipid metabolism, α-LA significantly counteracted the inhibitory effects of LPS on the expression of hormone-sensitive lipase gene and protein. α-LA evidently increased the gene expression of fatty acid transport protein 1 and cluster of differentiation 36. Regarding energy metabolism, α-LA significantly increased the expression of most of mitochondrial DNA-encoded genes compared with the control and LPS group. Accordingly, α-LA can alleviate acute inflammatory response and this action may be related with the promotion of lipid mobilization in white adipose tissue.

  8. Preventive effect of α-lipoic acid on prepulse inhibition deficits in a juvenile two-hit model of schizophrenia.

    PubMed

    Deslauriers, J; Racine, W; Sarret, P; Grignon, S

    2014-07-11

    Some pathophysiological models of schizophrenia posit that prenatal inflammation sensitizes the developing brain to second insults in early life and enhances brain vulnerability, thereby increasing the risk of developing the disorder during adulthood. We previously developed a two-hit animal model, based on the well-established prenatal immune challenge with poly-inosinic/cytidylic acid (polyI:C), followed by juvenile restraint stress (RS). We observed an additive disruption of prepulse inhibition (PPI) of acoustic startle in juvenile mice submitted to both insults. Previous studies have also reported that oxidative stress is associated with pathophysiological mechanisms of psychiatric disorders, including schizophrenia. We report here that PPI disruption in our two-hit animal model of schizophrenia is associated with an increase in oxidative stress. These findings led us to assess whether α-lipoic acid, an antioxidant, can prevent both increase in oxidative status and PPI deficits in our juvenile in vivo model of schizophrenia. In the offspring submitted to prenatal injection of polyI:C and to RS, treatment with α-lipoic acid prevented the development of PPI deficits 24h after the last period of RS. α-Lipoic acid also improved PPI performance in control mice. The reversal effect of α-lipoic acid pretreatment on these behavioral alterations was further accompanied by a normalization of the associated oxidative status and dopaminergic and GABAergic abnormalities in the prefrontal cortex. Based on our double insult paradigm, these results support the hypothesis that oxidative stress plays an important role in the development of PPI deficits, a well-known behavior associated with schizophrenia. These findings form the basis of future studies aiming to unravel mechanistic insights of the putative role of antioxidants in the treatment of schizophrenia, especially during the prodromal stage. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  9. Lipoic Acid Decreases the Viability of Breast Cancer Cells and Activity of PTP1B and SHP2.

    PubMed

    Kuban-Jankowska, Alicja; Gorska-Ponikowska, Magdalena; Wozniak, Michal

    2017-06-01

    Protein tyrosine phosphatases PTP1B and SHP2 are potential targets for anticancer therapy, because of the essential role they play in the development of tumors. PTP1B and SHP2 are overexpressed in breast cancer cells, thus inhibition of their activity can be potentially effective in breast cancer therapy. Lipoic acid has been previously reported to inhibit the proliferation of colon, breast and thyroid cancer cells. We investigated the effect of alpha-lipoic acid (ALA) and its reduced form of dihydrolipoic acid (DHLA) on the viability of MCF-7 cancer cells and on the enzymatic activity of PTP1B and SHP2 phosphatases. ALA and DHLA decrease the activity of PTP1B and SHP2, and have inhibitory effects on the viability and proliferation of breast cancer cells. ALA and DHLA can be considered as potential agents for the adjunctive treatment of breast cancer. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  10. Stability of a liposomal formulation containing lipoyl or dihydrolipoyl acylglycerides

    USDA-ARS?s Scientific Manuscript database

    The acylglycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phospholipids in which the...

  11. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses biotin operon transcription and ligates biotin to its cognate protein. PMID:26442940

  12. CUTANEOUS DELIVERY OF α-TOCOPHEROL AND LIPOIC ACID USING MICROEMULSIONS: INFLUENCE OF COMPOSITION AND CHARGE

    PubMed Central

    Cichewicz, Allie; Pacleb, Chelsea; Connors, Ashley; Hass, Martha A.; Lopes, Luciana B.

    2013-01-01

    Objectives To assess whether the composition and charge of microemulsions affect their ability to simultaneously deliver α-tocopherol and lipoic acid into viable skin layers. Methods α-tocopherol and lipoic acid were added (1.1 and 0.5% w/w, respectively) to decylglucoside-based microemulsions containing mono-dicaprylin. Microemulsions containing surfactant:oil:water (w/w/w) at 60:30:10 (ME-O) and 46:23:31 (ME-W), as well as a cationic form of ME-W containing 1% phytosphingosine (ME-Wphy) were characterized, and their ability to disrupt the skin barrier and deliver the antioxidants in vitro in the skin was evaluated. Antioxidant activity in ME-Wphy-treated skin was assessed using the thiobarbituric acid-reactive substances (TBARS) assay. Key findings internal phase diameters of microemulsions ranged between 47.0–53.2 nm; phytosphingosine addition and pH adjustment to 5.0 increased zeta potential from −4.3 to +29.1 mV. ME-O displayed w/o structure, whereas ME-W and ME-Wphy were consistent with o/w. Microemulsions affected skin electrical resistance and transepidermal water loss, but did not affect lipoic acid penetration. α-Tocopherol delivery increased following the order ME-O

  13. Reversal of metabolic deficits by lipoic acid in a triple transgenic mouse model of Alzheimer's disease: a 13C NMR study

    PubMed Central

    Sancheti, Harsh; Kanamori, Keiko; Patil, Ishan; Díaz Brinton, Roberta; Ross, Brian D; Cadenas, Enrique

    2014-01-01

    Alzheimer's disease is an age-related neurodegenerative disease characterized by deterioration of cognition and loss of memory. Several clinical studies have shown Alzheimer's disease to be associated with disturbances in glucose metabolism and the subsequent tricarboxylic acid (TCA) cycle-related metabolites like glutamate (Glu), glutamine (Gln), and N-acetylaspartate (NAA). These metabolites have been viewed as biomarkers by (a) assisting early diagnosis of Alzheimer's disease and (b) evaluating the efficacy of a treatment regimen. In this study, 13-month-old triple transgenic mice (a mouse model of Alzheimer's disease (3xTg-AD)) were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C NMR to determine the concentrations of 13C-labeled isotopomers of Glu, Gln, aspartate (Asp), GABA, myo-inositol, and NAA. Total (12C+13C) Glu, Gln, and Asp were quantified by high-performance liquid chromatography to calculate enrichment. Furthermore, we examined the effects of lipoic acid in modulating these metabolites, based on its previously established insulin mimetic effects. Total 13C labeling and percent enrichment decreased by ∼50% in the 3xTg-AD mice. This hypometabolism was partially or completely restored by lipoic acid feeding. The ability of lipoic acid to restore glucose metabolism and subsequent TCA cycle-related metabolites further substantiates its role in overcoming the hypometabolic state inherent in early stages of Alzheimer's disease. PMID:24220168

  14. Assembly of citrate gold nanoparticles on hydrophilic monolayers

    NASA Astrophysics Data System (ADS)

    Vikholm-Lundin, Inger; Rosqvist, Emil; Ihalainen, Petri; Munter, Tony; Honkimaa, Anni; Marjomäki, Varpu; Albers, Willem M.; Peltonen, Jouko

    2016-08-01

    Self-assembled monolayers (SAMs) as model surfaces were linked onto planar gold films thorough lipoic acid or disulfide groups. The molecules used were polyethylene glycol (EG-S-S), N-[tris-(hydroxymethyl)methyl]acrylamide polymers with and without lipoic acid (Lipa-pTHMMAA and pTHMMAA) and a lipoic acid triazine derivative (Lipa-MF). All the layers, but Lipa-MF with a primary amino group were hydroxyl terminated. The layers were characterized by contact angle measurements and atomic force microscopy, AFM. Citrate stabilized nanoparticles, AuNPs in water and phosphate buffer were allowed to assemble on the layers for 10 min and the binding was followed in real-time with surface plasmon resonance, SPR. The SPR resonance curves were observed to shift to higher angles and become increasingly damped, while also the peaks strongly broaden when large nanoparticles assembled on the surface. Both the angular shift and the damping of the curve was largest for nanoparticles assembling on the EG-S-S monolayer. High amounts of particles were also assembled on the pTHMMAA layer without the lipoic acid group, but the damping of the curve was considerably lower with a more even distribution of the particles. Topographical images confirmed that the highest number of particles were assembled on the polyethylene glycol monolayer. By increasing the interaction time more particles could be assembled on the surface.

  15. A Novel Amidotransferase Required for Lipoic Acid Cofactor Assembly in Bacillus subtilis

    PubMed Central

    Christensen, Quin H.; Martin, Natalia; Mansilla, Maria C.; de Mendoza, Diego; Cronan, John E.

    2011-01-01

    SUMMARY In the companion paper (Martin et al., 2011) we reported that Bacillus subtilis requires three proteins for lipoic acid metabolism, all of which are members of the lipoate protein ligase family. Two of the proteins, LipM and LplJ, have been shown to be an octanoyltransferase and a lipoate:protein ligase, respectively. The third protein, LipL, is essential for lipoic acid synthesis, but had no detectable octanoyltransferase or ligase activity either in vitro or in vivo. We report that LipM specifically modifies the glycine cleavage system protein, GcvH, and therefore another mechanism must exist for modification of other lipoic acid requiring enzymes (e.g., pyruvate dehydrogenase). We show that this function is provided by LipL which catalyzes the amidotransfer (transamidation) of the octanoyl moiety from octanoyl-GcvH to the E2 subunit of pyruvate dehydrogenase. LipL activity was demonstrated in vitro with purified components and proceeds via a thioester-linked acyl-enzyme intermediate. As predicted, ΔgcvH strains are lipoate auxotrophs. LipL represents a new enzyme activity. It is a GcvH:[lipoyl domain] amidotransferase that probably employs a Cys-Lys catalytic dyad. Although the active site cysteine residues of LipL and LipB are located in different positions within the polypeptide chains, alignment of their structures show these residues occupy similar positions. Thus, these two homologous enzymes have convergent architectures. PMID:21338421

  16. Protective effect of alpha-lipoic acid in methotrexate-induced ovarian oxidative injury and decreased ovarian reserve in rats.

    PubMed

    Soylu Karapinar, Oya; Pinar, Neslihan; Özcan, Oğuzhan; Özgür, Tümay; Dolapçıoğlu, Kenan

    2017-08-01

    To determine whether the possible oxidative effect of methotrexate (Mtx) on ovary and to evaluate the effectiveness of alpha lipoic acid (ALA), which may be useful in many oxidative stress models. Thirty-two female Wistar-albino rats were randomly divided into four groups; control group, alpha lipoic acid group (ALA 100 mg/kg, 10 days), multiple dose Mtx group (Mtx 1 mg/kg 1, 3, 5, 7 days) and Mtx and ALA group (Mtx 1 mg/kg 1, 3, 5, 7 days and ALA 100 mg/kg, 10 days). Serum total antioxidant status (TAS), total oxidant status (TOS) and oxidative stress index (OSI), tumor necrosis factor-alpha (TNF-α), tissue malondialdehyde (MDA) and activities of glutathione peroxidase (GSH-Px) and catalase (CAT) and anti-Mullerian hormone (AMH) and total ovarian follicle count were evaluated. Mtx administration caused a significant decrease in TAS, a significant increase in TOS and OSI, a significant increase in MDA levels and a decrease in GSH-Px and CAT activity. Moreover the proinflammatory cytokine (TNF-α) was increased in the Mtx group. And AMH values and total follicle count were significantly decreased in Mtx group. However, ALA treatment reversed biochemical results and AMH levels and total follicle count. Alpha lipoic acid ameliorates methotrexate induced oxidative damage of ovarian in rats.

  17. Alpha-lipoic acid (ALA) as a supplementation for weight loss: results from a meta-analysis of randomized controlled trials.

    PubMed

    Kucukgoncu, S; Zhou, E; Lucas, K B; Tek, C

    2017-05-01

    Obesity is associated with significant morbidity and mortality rates. Even modest weight loss may be associated with health benefits. Alpha-lipoic acid (ALA) is a naturally occurring antioxidant. Studies have suggested anti-obesity properties of ALA; however, results are inconsistent. The purpose of this study is to conduct a meta-analysis of the effect of ALA on weight and body mass index (BMI). A comprehensive, systematic literature search identified 10 articles on randomized, double-blind, placebo-controlled studies involving ALA. We conducted a meta-analysis of mean weight and BMI change differences between ALA and placebo treatment groups. Alpha-lipoic acid treatment coincided with a statistically significant 1.27 kg (confidence interval = 0.25 to 2.29) greater mean weight loss compared with the placebo group. A significant overall mean BMI difference of -0.43 kg/ m 2 (confidence interval = -0.82 to -0.03) was found between the ALA and placebo groups. Meta-regression analysis showed no significance in ALA dose on BMI and weight changes. Study duration significantly affected BMI change, but not weight change. Alpha-lipoic acid treatment showed small, yet significant short-term weight loss compared with placebo. Further research is needed to examine the effect of different doses and the long-term benefits of ALA on weight management. © 2017 World Obesity Federation.

  18. Predictors of improvement and progression of diabetic polyneuropathy following treatment with α-lipoic acid for 4 years in the NATHAN 1 trial.

    PubMed

    Ziegler, Dan; Low, Phillip A; Freeman, Roy; Tritschler, Hans; Vinik, Aaron I

    2016-03-01

    We aimed to analyze the impact of baseline factors on the efficacy of α-lipoic acid (ALA) over 4 years in the NATHAN 1 trial. This was a post-hoc analysis of the NATHAN 1 trial, a 4-year randomized study including 460 diabetic patients with mild-to-moderate polyneuropathy using ALA 600 mg qd or placebo. Amongst others, efficacy measures were the Neuropathy Impairment Score of the lower limbs (NIS-LL) and heart rate during deep breathing (HRDB). Improvement and prevention of progression of NIS-LL (ΔNIS-LL≥2 points) with ALA vs. placebo after 4 years was predicted by higher age, lower BMI, male sex, normal blood pressure, history of cardiovascular disease (CVD), insulin treatment, longer duration of diabetes and neuropathy, and higher neuropathy stage. Participants treated with ALA who received ACE inhibitors showed a better outcome in HRDB after 4 years. Better outcome in neuropathic impairments following 4-year treatment with α-lipoic acid was predicted by normal BMI and blood pressure and higher burden due to CVD, diabetes, and neuropathy, while improvement in cardiac autonomic function was predicted by ACE inhibitor treatment. Thus, optimal control of CVD risk factors could contribute to improved efficacy of α-lipoic acid in patients with higher disease burden. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Early vs. late intervention of high fat/low dose streptozotocin treated C57Bl/6J mice with enalapril, α-lipoic acid, menhaden oil or their combination: effect on diabetic neuropathy related endpoints

    PubMed Central

    Yorek, Matthew S.; Obrosov, Alexander; Shevalye, Hanna; Coppey, Lawrence J.; Kardon, Randy H.; Yorek, Mark A.

    2017-01-01

    We have previously demonstrated that enalapril, α-lipoic acid and menhaden (fish) oil has potential as a treatment for diabetic peripheral neuropathy. In this study we sought to determine the efficacy of these treatments individually or in combination on multiple neuropathic endpoints in a high fat fed low dose streptozotocin treated mouse, a model of type 2 diabetes, following early or late intervention. Four or twelve weeks after the onset of hyperglycemia, diabetic mice were treated with enalapril, α-lipoic acid, menhaden oil or their combination for 12 weeks. Afterwards, endpoints including glucose tolerance, motor and sensory nerve conduction velocity, thermal nociception, and intraepidermal and cornea nerve fiber density was determined. Glucose clearance was impaired in diabetic mice and significantly improved only with combination treatment and early intervention. Diabetes caused steatosis, slowing of motor and sensory nerve conduction velocity, thermal hypoalgesia and reduction in intraepidermal and cornea nerve fiber density. Treating diabetic mice with enalapril, α-lipoic acid or menhaden oil partially protected diabetic mice from these deficits, whereas the combination of these three treatments was more efficacious following early or late intervention. These studies suggest that a combination therapy may be more effective for treating neural complications of type 2 diabetes. PMID:28025096

  20. Palladium alpha-lipoic acid complex formulation enhances activities of Krebs cycle dehydrogenases and respiratory complexes I-IV in the heart of aged rats.

    PubMed

    Sudheesh, N P; Ajith, T A; Janardhanan, K K; Krishnan, C V

    2009-08-01

    Age-related decline in the capacity to withstand stress, such as ischemia and reperfusion, results in congestive heart failure. Though the mechanisms underlying cardiac decay are not clear, age dependent somatic damages to mitochondrial DNA (mtDNA), loss of mitochondrial function, and a resultant increase in oxidative stress in heart muscle cells may be responsible for the increased risk for cardiovascular diseases. The effect of a safe nutritional supplement, POLY-MVA, containing the active ingredient palladium alpha-lipoic acid complex, was evaluated on the activities of the Krebs cycle enzymes such as isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, and malate dehydrogenase as well as mitochondrial complexes I, II, III, and IV in heart mitochondria of aged male albino rats of Wistar strain. Administration of 0.05 ml/kg of POLY-MVA (which is equivalent to 0.38 mg complexed alpha-lipoic acid/kg, p.o), once daily for 30 days, was significantly (p<0.05) effective to enhance the Krebs cycle dehydrogenases, and mitochondrial electron transport chain complexes. The unique electronic and redox properties of palladium alpha-lipoic acid complex appear to be a key to this physiological effectiveness. The results strongly suggest that this formulation might be effective to protect the aging associated risk of cardiovascular and neurodegenerative diseases.

  1. Early vs. late intervention of high fat/low dose streptozotocin treated C57Bl/6J mice with enalapril, α-lipoic acid, menhaden oil or their combination: Effect on diabetic neuropathy related endpoints.

    PubMed

    Yorek, Matthew S; Obrosov, Alexander; Shevalye, Hanna; Coppey, Lawrence J; Kardon, Randy H; Yorek, Mark A

    2017-04-01

    We have previously demonstrated that enalapril, α-lipoic acid and menhaden (fish) oil has potential as a treatment for diabetic peripheral neuropathy. In this study we sought to determine the efficacy of these treatments individually or in combination on multiple neuropathic endpoints in a high fat fed low dose streptozotocin treated mouse, a model of type 2 diabetes, following early or late intervention. Four or twelve weeks after the onset of hyperglycemia, diabetic mice were treated with enalapril, α-lipoic acid, menhaden oil or their combination for 12 weeks. Afterwards, endpoints including glucose tolerance, motor and sensory nerve conduction velocity, thermal nociception, and intraepidermal and cornea nerve fiber density was determined. Glucose clearance was impaired in diabetic mice and significantly improved only with combination treatment and early intervention. Diabetes caused steatosis, slowing of motor and sensory nerve conduction velocity, thermal hypoalgesia and reduction in intraepidermal and cornea nerve fiber density. Treating diabetic mice with enalapril, α-lipoic acid or menhaden oil partially protected diabetic mice from these deficits, whereas the combination of these three treatments was more efficacious following early or late intervention. These studies suggest that a combination therapy may be more effective for treating neural complications of type 2 diabetes. Published by Elsevier Ltd.

  2. Lipoic acid functionalized amino acids cationic lipids as gene vectors.

    PubMed

    Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zheng, Li-Ting; Zhao, Zhi-Gang

    2016-10-01

    A series of reducible cationic lipids 4a-4f with different amino acid polar-head groups were prepared. The novel lipid contains a hydrophobic lipoic acid (LA) moiety, which can be reduced under reductive conditions to release of the encapsulated plasmid DNA. The particle size, zeta potential and cellular uptake of lipoplexes formed with DNA, as well as the transfection efficacy (TE) were characterized. The TE of the cationic lipid based on arginine was especially high, and was 2.5times higher than that of a branched polyethylenimine in the presence of 10% serum. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Therapeutic Effects of Rivastigmine and Alfa-Lipoic Acid Combination in the Charles Bonnet Syndrome: Electroencephalography Correlates.

    PubMed

    Hanoglu, Lutfu; Yildiz, Sultan; Polat, Burcu; Demirci, Sema; Tavli, Ahmet Mithat; Yilmaz, Nesrin; Yulug, Burak

    2016-01-01

    Charles Bonnet Syndrome (CBS) is a rare clinical condition which is characterized by complex hallucinations in visually impaired patients. The pathophysiology of this disorder remains largely unknown, and there is still no proven treatment for this disease. In our study, we aimed to investigate the neural activity through Electroencephalography (EEG) power and evaluate the effect of rivastigmine in combination with alpha-lipoic acid on hallucination in two CBS patients with diabetic retinopathy. EEG data was recorded with standard routine EEG protocols for both patients in our electrophysiological research laboratory (REMER Clinical Electrophysiology and Neuromodulation Research and Application Laboratory) with Brain Vision Recorder (Brainproduct, Munich, Germany). All spectral analyses were processed by BrainVision Analyzer 2 (Brainproduct, Munich, Germany, 2.0.4 Version) in 128 Hz sample rates and the EEG recording and analysis was performed before the administration of rivastigmine (4.5 mg/daily and five patch daily for the first and second patients, respectively) in combination with alpha-lipoic acid (600 mg/daily) for both patients while they were not hallucinated during the time period recordings. Based on our measurement protocol, we have compared the patients in the study group with the three control subjects who were found to be normal except of visual disturbances secondary to significant diabetic retinopathy. Highest theta power values were found in right occipital and left temporo-parietal regions for first and second CBS patients, respectively. Additionally, power spectra were lower in two cases as compared to their control groups in the alpha band for all electrodes. We have also shown that acid rivastigmine in combination with alpha-lipoic exerted significant anti-hallucinatory efficiency. Our present findings could support the hypothesis that increased activation of specific areas in the source monitoring system plays an important role in the pathogenesis of CBS. In addition, rivastigmine in combination with alpha-lipoic acid could be a new valuable option for CBS patients.

  4. Metabolic treatment of cancer: intermediate results of a prospective case series.

    PubMed

    Schwartz, Laurent; Buhler, Ludivine; Icard, Philippe; Lincet, Hubert; Steyaert, Jean-Marc

    2014-02-01

    The combination of hydroxycitrate and lipoic acid has been demonstrated by several laboratories to be effective in reducing murine cancer growth. All patients had failed standard chemotherapy and were offered only palliative care by their referring oncologist. Karnofsky status was between 50 and 80. Life expectancy was estimated to be between 2 and 6 months. Ten consecutive patients with chemoresistant advanced metastatic cancer were offered compassionate metabolic treatment. They were treated with a combination of lipoic acid at 600 mg i.v. (Thioctacid), hydroxycitrate at 500 mg t.i.d. (Solgar) and low-dose naltrexone at 5 mg (Revia) at bedtime. Primary sites were lung carcinoma (n=2), colonic carcinoma (n=2), ovarian carcinoma (n=1), esophageal carcinoma (n=1), uterine sarcoma (n=1), cholangiocarcinoma (n=1), parotid carcinoma (n=1) and unknown primary (n=1). The patients had been heavily pre-treated. One patient had received four lines of chemotherapy, four patients three lines, four patients two lines and one patient had received radiation therapy and chemotherapy. An eleventh patient with advanced prostate cancer resistant to hormonotherapy treated with hydroxycitrate, lipoic acid and anti-androgen is also reported. One patient was unable to receive i.v. lipoic acid and was switched to oral lipoic acid (Tiobec). Toxicity was limited to transient nausea and vomiting. Two patients died of progressive disease within two months. Two other patients had to be switched to conventional chemotherapy combined with metabolic treatment, one of when had a subsequent dramatic tumor response. Disease in the other patients was either stable or very slowly progressive. The patient with hormone-resistant prostate cancer had a dramatic fall in Prostate-Specific Antigen (90%), which is still decreasing. These very primary results suggest the lack of toxicity and the probable efficacy of metabolic treatment in chemoresistant advanced carcinoma. It is also probable that metabolic treatment enhances the efficacy of cytotoxic chemotherapy. These results are in line with published animal data. A randomized clinical trial is warranted.

  5. Effects of troxerutin on cognitive deficits and glutamate cysteine ligase subunits in the hippocampus of streptozotocin-induced type 1 diabetes mellitus rats.

    PubMed

    Zhang, Songyun; Li, Hongyan; Zhang, Lihui; Li, Jie; Wang, Ruiying; Wang, Mian

    2017-02-15

    Increasing evidence demonstrates an association between diabetes and hippocampal neuron damage. This study aimed to determine the effects of troxerutin on cognitive deficits and glutamate cysteine ligase subunits (GCLM and GCLC) in the hippocampus of streptozotocin-induced type 1 diabetes mellitus (T1DM) rats. At 12weeks after streptozotocin injection, T1DM rats were randomly divided into 4 groups (n=15 each group) to receive no treatment (T1DM), saline (T1DM+saline), alpha-lipoic acid (T1DM+alpha-lipoic acid), and troxerutin (T1DM+troxerutin), respectively, for 6weeks. Meanwhile, 10 control animals (NC group) were assessed in parallel. Learning performance was evaluated by the Morris water maze. After treatment, hippocampi were collected for pathological examination by hematoxylin and eosin (H&E) staining. Next, hippocampal superoxide dismutase (SOD) activity, and malondialdehyde (MDA) and glutathione (GSH) levels were assessed. Finally, glutamate cysteine ligase catalytic (GCLC) and glutamate cysteine ligase modifier (GCLM) subunit mRNA and protein levels were quantified by reverse transcription polymerase chain reaction (RT-PCR) and Western blot, respectively. Compared with T1DM and T1DM+saline groups, escape latency was overtly reduced in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. Significantly increased GCLM and GCLC mRNA levels, GCLC protein amounts, SOD activity, and GSH levels, and reduced MDA amounts were observed in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. In T1DM and T1DM+saline groups, H&E staining showed less pyramidal cells in the hippocampus, with disorganized layers, karyopyknosis, decreased endochylema, and cavitation, effects relieved in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. Troxerutin alleviates oxidative stress and promotes learning in streptozotocin-induced T1DM rats, a process involving GCLC expression. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Impact of mutations within the [Fe-S] cluster or the lipoic acid biosynthesis pathways on mitochondrial protein expression profiles in fibroblasts from patients.

    PubMed

    Lebigot, E; Gaignard, P; Dorboz, I; Slama, A; Rio, M; de Lonlay, P; Héron, B; Sabourdy, F; Boespflug-Tanguy, O; Cardoso, A; Habarou, F; Ottolenghi, C; Thérond, P; Bouton, C; Golinelli-Cohen, M P; Boutron, A

    2017-11-01

    Lipoic acid (LA) is the cofactor of the E2 subunit of mitochondrial ketoacid dehydrogenases and plays a major role in oxidative decarboxylation. De novo LA biosynthesis is dependent on LIAS activity together with LIPT1 and LIPT2. LIAS is an iron‑sulfur (Fe-S) cluster-containing mitochondrial protein, like mitochondrial aconitase (mt-aco) and some subunits of respiratory chain (RC) complexes I, II and III. All of them harbor at least one [Fe-S] cluster and their activity is dependent on the mitochondrial [Fe-S] cluster (ISC) assembly machinery. Disorders in the ISC machinery affect numerous Fe-S proteins and lead to a heterogeneous group of diseases with a wide variety of clinical symptoms and combined enzymatic defects. Here, we present the biochemical profiles of several key mitochondrial [Fe-S]-containing proteins in fibroblasts from 13 patients carrying mutations in genes encoding proteins involved in either the lipoic acid (LIPT1 and LIPT2) or mitochondrial ISC biogenesis (FDX1L, ISCA2, IBA57, NFU1, BOLA3) pathway. Ten of them are new patients described for the first time. We confirm that the fibroblast is a good cellular model to study these deficiencies, except for patients presenting mutations in FDX1L and a muscular clinical phenotype. We find that oxidative phosphorylation can be affected by LA defects in LIPT1 and LIPT2 patients due to excessive oxidative stress or to another mechanism connecting LA and respiratory chain activity. We confirm that NFU1, BOLA3, ISCA2 and IBA57 operate in the maturation of [4Fe-4S] clusters and not in [2Fe-2S] protein maturation. Our work suggests a functional difference between IBA57 and other proteins involved in maturation of [Fe-S] proteins. IBA57 seems to require BOLA3, NFU1 and ISCA2 for its stability and NFU1 requires BOLA3. Finally, our study establishes different biochemical profiles for patients according to their mutated protein. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. [Effects of α-lipoic acid and vitamin C on oxidative stress in rat exposed to chronic arsenic toxicity].

    PubMed

    Liu, Chong-Bin; Feng, Yan-Hong; Ye, Guang-Hua; Xiao, Min

    2010-12-01

    To explore arsenic-induced oxidative stress and the protective efficacy of α-lipoic acid and vitamin c. 50 male SD rats were randomly divided into 5 groups. Ten rats (the control group) were exposed to deionized water for 6 weeks, and the others were alone exposed to sodium arsenite (50 mg/L water) for 6 weeks, at the same time, three group rats were administered intragastrically (i.g.) with α-lipoic acid 10 mg×kg(-1)×d(-1) and vitamin C 25 mg×kg(-1)×d(-1) either alone or in combination. At the end of experiment, blood was drawn from abdominal aorta, and then the blood, brain and liver of rats were used for biochemical assays, including blood glutathione (GSH), δ-aminolevulinic acid dehydratase (δ-ALAD ), reactive oxygen species (ROS) and oxidized glutathione (GSSG) level. At the same time, the super oxide dismutase (SOD) activity, glutathione peroxidase (GSH-Px) activity, catalase (CAT) activity, ATPase activity of brain and liver were determined. The caspase activity of brain were also determined. There were a significant increase in ROS level (P < 0.05), but a significant decrease in δ-ALAD activity (P < 0.01) in the chronic arsenic toxicity model group compared with the control group. These alterations were marginally restored by co-administration of vitamin C and α-lipoic acid individually, while significant recovery was observed in the animals supplemented with both the antioxidants together with arsenite in rat (P < 0.05). At the same time, there was a significant increase in the ROS and TBARS level of the brain and liver (P < 0.05), and caspase activity of the brain (P < 0.05), while there was a significant decrease in antioxidant enzymes and ATPase activity on arsenite exposure in rats (P < 0.05). These alterations were also marginally restored by co-administration of vitamin C and α-lipoic acid individually, while significant recovery was observed in the animals supplemented with both the antioxidants together with arsenite in rat (P < 0.05). Arsenite-induced oxidative stress can be significantly protected by co-administration of α-lipoic acid and vitamin C individually, but the best effects could be observed with combined administration of two antioxidants during arsenite exposure in animals. The dietary intervention of or supplementation with natural dietary nutrients is possible to prevent the effects of arsenic in populations of risk.

  8. The effects of lipoic acid on redox status in brain regions and systemic circulation in streptozotocin-induced sporadic Alzheimer's disease model.

    PubMed

    Erdoğan, Mehmet Evren; Aydın, Seval; Yanar, Karolin; Mengi, Murat; Kansu, Ahmet Doğukan; Cebe, Tamer; Belce, Ahmet; Çelikten, Mert; Çakatay, Ufuk

    2017-08-01

    While the deterioration of insulin-glucose metabolism (IGM), impaired redox homeostasis (IRH), β-amyloid accumulation was reported in Sporadic Alzheimer's Disease (SAD) model, aforementioned factors related to lipoic acid administration and anthropometric indexes (AIs) are not yet studied with integrative approach. β-amyloid accumulation, redox homeostasis biomarkers and AIs are investigated in SAD model. Streptozotocin-induced inhibition of insulin-signaling cascade but not GLUT-2 and GLUT-3 transporters takes a role in β-amyloid accumulation. Inhibition types are related to IRH in cortex, hippocampus and systemic circulation. Lipoic acid (LA) shows both antioxidant and prooxidant effect according to the anatomical location. LA administration also leads to improved AIs during GLUT-2 inhibition and cortical redox status in GLUT-3 inhibited group. Optimal LA action could be possible if its redox behavior is balanced to antioxidant effect. Diagnostic usage of systemic IRH parameters as biomarkers and their possible correlations with deteriorated IGM should be investigated. Graphical abstract ᅟ.

  9. Alpha lipoic acid efficacy in burning mouth syndrome. A controlled clinical trial

    PubMed Central

    Palacios-Sánchez, Begoña; Cerero-Lapiedra, Rocío; Llamas-Martínez, Silvia; Esparza-Gómez, Germán

    2015-01-01

    Background A double-blind placebo-controlled trial was conducted in order to evaluate the efficacy of alpha lipoic acid (ALA) and determine the statistical significance of the outcome variables. Burning mouth syndrome (BMS) is defined as an oral burning sensation in the absence of clinical signs which could justify the syndrome. Recent studies suggest the existence of neurological factors as a possible cause of the disease. Material and Methods 60 patients with BMS, in two groups: case group with 600 mg/day and placebo as control group; with follow up of 2 months. Results 64% of ALA patients reported some level of improvement, with a level of maintenance of 68.75% one month after treatment. 27.6% of the placebo group also demonstrated some reduction in BMS symptoms. Conclusions Long-term evolution and the intensity of symptoms are variables that reduce the probability of improvement with ALA treatment. Key words: Burning mouth syndrome, neuropathy, alpha lipoic acid. PMID:26034927

  10. α-Lipoic acid protects against cholecystokinin-induced acute pancreatitis in rats

    PubMed Central

    Park, Sung-Joo; Seo, Sang-Wan; Choi, Ok-Sun; Park, Cheung-Seog

    2005-01-01

    AIM: α-Lipoic acid (ALA) has been used as an antioxidant. The aim of this study was to investigate the effect of α-lipoic acid on cholecystokinin (CCK)-octapeptide induced acute pancreatitis in rats. METHODS: ALA at 1 mg/kg was intra-peritoneally injected, followed by 75 μg/kg CCK-octapeptide injected thrice subcutaneously after 1, 3, and 5 h. This whole procedure was repeated for 5 d. We checked the pancreatic weight/body weight ratio, the secretion of pro-inflammatory cytokines and the levels of lipase, amylase of serum. Repeated CCK octapeptide treatment resulted in typical laboratory and morphological changes of experimentally induced pancreatitis. RESULTS: ALA significantly decreased the pancreatic weight/body weight ratio and serum amylase and lipase in CCK octapeptide-induced acute pancreatitis. However, the secretion of IL-1β, IL-6, and TNF-α were comparable in CCK octapeptide-induced acute pancreatitis. CONCLUSION: ALA may have a protective effect against CCK octapeptide-induced acute pancreatitis. PMID:16097064

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keith, Dove; Finlay, Liam; Butler, Judy

    Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve thesemore » results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks.« less

  12. Alpha-lipoic acid-stearylamine conjugate-based solid lipid nanoparticles for tamoxifen delivery: formulation, optimization, in-vivo pharmacokinetic and hepatotoxicity study.

    PubMed

    Dhaundiyal, Ankit; Jena, Sunil K; Samal, Sanjaya K; Sonvane, Bhavin; Chand, Mahesh; Sangamwar, Abhay T

    2016-12-01

    This study was designed to demonstrate the potential of novel α-lipoic acid-stearylamine (ALA-SA) conjugate-based solid lipid nanoparticles in modulating the pharmacokinetics and hepatotoxicity of tamoxifen (TMX). α-lipoic acid-stearylamine bioconjugate was synthesized via carbodiimide chemistry and used as a lipid moiety for the generation of TMX-loaded solid lipid nanoparticles (TMX-SLNs). TMX-SLNs were prepared by solvent emulsification-diffusion method and optimized for maximum drug loading using rotatable central composite design. The optimized TMX-SLNs were stabilized using 10% w/w trehalose as cryoprotectant. In addition, pharmacokinetics and hepatotoxicity of freeze-dried TMX-SLNs were also evaluated in Sprague Dawley rats. Initial characterization with transmission electron microscopy revealed spherical morphology with smooth surface having an average particle size of 261.08 ± 2.13 nm. The observed entrapment efficiency was 40.73 ± 2.83%. In-vitro release study showed TMX release was slow and pH dependent. Pharmacokinetic study revealed a 1.59-fold increase in relative bioavailability as compared to TMX suspension. A decrease in hepatotoxicity of TMX is evidenced by the histopathological evaluation of liver tissues. α-lipoic acid-stearylamine conjugate-based SLNs have a great potential in enhancing the oral bioavailability of poorly soluble drugs like TMX. Moreover, this ALA-SA nanoparticulate system could be of significant value in long-term anticancer therapy with least side effects. © 2016 Royal Pharmaceutical Society.

  13. Alpha-lipoic acid as a new treatment option for Alzheimer's disease--a 48 months follow-up analysis.

    PubMed

    Hager, K; Kenklies, M; McAfoose, J; Engel, J; Münch, G

    2007-01-01

    Oxidative stress and neuronal energy depletion are characteristic biochemical hallmarks of Alzheimer's disease (AD). It is therefore conceivable that pro-energetic and antioxidant drugs such as alpha-lipoic acid might delay the onset or slow down the progression of the disease. In a previous study, 600mg alpha-lipoic acid was given daily to nine patients with AD (receiving a standard treatment with choline-esterase inhibitors) in an open-label study over an observation period of 12 months. The treatment led to a stabilization of cognitive functions in the study group, demonstrated by constant scores in two neuropsychological tests (the mini mental state exam, MMSE and the Alzheimer's disease assessment score cognitive subscale, ADAScog). In this report, we have extended the analysis to 43 patients over an observation period of up to 48 months. In patients with mild dementia (ADAScog < 15), the disease progressed extremely slowly (ADAScog: +1.2 points/year, MMSE: -0.6 points/year), in patients with moderate dementia at approximately twice the rate. However, the progression appears dramatically lower than data reported for untreated patients or patients on choline-esterase inhibitors in the second year of long-term studies. Despite the fact that this study was not double-blinded, placebo-controlled and randomized, our data suggest that treatment with alpha-lipoic acid might be a successful 'neuroprotective' therapy option for AD. However, a state-of-the-art phase II trial is needed urgently.

  14. Effects of Lipoic Acid on Antiapoptotic Genes in Control and Ethanol-Treated Fetal Rhombencephalic Neurons

    PubMed Central

    Antonio, Angeline M.; Gillespie, Roberta A.; Druse, Mary J.

    2011-01-01

    This laboratory showed that ethanol augments apoptosis in fetal rhombencephalic neurons and co-treatment with alpha-lipoic acid (LA) or one of several other antioxidants prevents ethanol-associated apoptosis. Because ethanol increases oxidative stress, which causes apoptosis, it is likely that some of the neuroprotective effects of LA and other antioxidants involve classical antioxidant actions. Considering the reported link of LA with pro-survival cell signaling, it is also possible that LA’s neuroprotective effects involve additional mechanisms. The present study investigated the effects of LA on ethanol-treated fetal rhombencephalic neurons with regard to oxidative stress and up-regulation of the pro-survival genes Xiap and Bcl-2. We included parallel gene expression studies with N-acetyl cysteine (NAC) to determine whether LA’s effects on Xiap and Bcl-2 were shared by other antioxidants. We also used enzyme inhibitors to determine which signaling pathway(s) might be involved with the effects of LA. The results of this investigation showed that LA treatment of ethanol-treated neurons exerted several pro-survival effects. LA blocked two pro-apoptotic changes, i.e., the ethanol-associated rise in ROS and caspase-3. LA also up-regulated the expression genes that encode the anti-apoptotic proteins Bcl-2 and Xiap by a mechanism that involves NF-κB. NAC also up-regulated Bcl-2 and Xiap. Thus, the neuroprotective effects of LA and NAC could involve up-regulation of pro-survival genes as well as their classical antioxidant actions. PMID:21303669

  15. SULFUR COMPOUNDS IN MORPHOGENESIS.

    DTIC Science & Technology

    CHICKENS, GROWTH(PHYSIOLOGY), MITOSIS, BACTERIA, ALGAE, LIPOIC ACID , THIOLS, BELGIUM...ORGANIC SULFUR COMPOUNDS, METABOLISM), (*MORPHOLOGY(BIOLOGY), ORGANIC SULFUR COMPOUNDS), (*NUCLEIC ACIDS , BIOSYNTHESIS), EGGS, EMBRYOS, AMPHIBIANS

  16. Microwave-Assisted Resolution of α-Lipoic Acid Catalyzed by an Ionic Liquid Co-Lyophilized Lipase.

    PubMed

    Liu, Ning; Wang, Lei; Wang, Zhi; Jiang, Liyan; Wu, Zhuofu; Yue, Hong; Xie, Xiaona

    2015-05-29

    The combination of the ionic liquid co-lyophilized lipase and microwave irradiation was used to improve enzyme performance in enantioselective esterification of α-lipoic acid. Effects of various reaction conditions on enzyme activity and enantioselectivity were investigated. Under optimal condition, the highest enantioselectivity (E = 41.2) was observed with a high enzyme activity (178.1 μmol/h/mg) when using the ionic liquid co-lyophilized lipase with microwave assistance. Furthermore, the ionic liquid co-lyophilized lipase exhibited excellent reusability under low power microwave.

  17. Research and Application of Lipoic Acid in Plants

    NASA Astrophysics Data System (ADS)

    Xiao, Renjie; Wang, Xiran; Jiang, Leiyu; Tang, Haoru

    2018-01-01

    Lipoic acid is a kind of small molecular compound with strong oxidizing properties. It has been widely used in medicine and has achieved good results since its discovery. However, it is less used in plants, and the biosynthetic pathway is not clear. The content in the plant is mainly measured by high-performance liquid chromatography(HPLC). At present, it is mainly used as an additive to the culture medium for plant tissue culture and Agrobacterium-mediated plant genetic transformation, in order to reduce the browning rate of explants, improve Agrobacterium-mediated genetic transformation efficiency.

  18. Effect of combination therapy consisting of enalapril, α-lipoic acid, and menhaden oil on diabetic neuropathy in a high fat/low dose streptozotocin treated rat.

    PubMed

    Davidson, Eric P; Holmes, Amey; Coppey, Lawrence J; Yorek, Mark A

    2015-10-15

    We have previously demonstrated that treating diabetic rats with enalapril, an angiotensin converting enzyme (ACE) inhibitor, α-lipoic acid, an antioxidant, or menhaden oil, a natural source of omega-3 fatty acids can partially improve diabetic peripheral neuropathy. In this study we sought to determine the efficacy of combining these three treatments on vascular and neural complications in a high fat fed low dose streptozotocin treated rat, a model of type 2 diabetes. Rats were fed a high fat diet for 8 weeks followed by a 30 mg/kg dose of streptozotocin. Eight weeks after the onset of hyperglycemia diabetic rats were treated with a combination of enalapril, α-lipoic acid and menhaden oil. Diabetic rats not receiving treatment were continued on the high fat diet. Glucose clearance was impaired in diabetic rats and significantly improved with treatment. Diabetes caused steatosis, elevated serum lipid levels, slowing of motor and sensory nerve conduction, thermal hypoalgesia, reduction in intraepidermal nerve fiber profiles, decrease in cornea sub-basal nerve fiber length and corneal sensitivity and impairment in vascular relaxation to acetylcholine and calcitonin gene-related peptide in epineurial arterioles of the sciatic nerve. Treating diabetic rats with the combination of enalapril, α-lipoic acid and menhaden oil reversed all these deficits to near control levels except for motor nerve conduction velocity which was also significantly improved compared to diabetic rats but remained significantly decreased compared to control rats. These studies suggest that a combination therapeutic approach may be most effective for treating vascular and neural complications of type 2 diabetes. Published by Elsevier B.V.

  19. Alpha lipoic acid in obstetrics and gynecology.

    PubMed

    Di Tucci, Chiara; Di Feliciantonio, Mara; Vena, Flaminia; Capone, Carmela; Schiavi, Michele Carlo; Pietrangeli, Daniela; Muzii, Ludovico; Benedetti Panici, Pierluigi

    2018-05-04

    Alpha-Lipoic acid (ALA) is a natural antioxidant synthetized by plants and animals, identified as a catalytic agent for oxidative decarboxylation of pyruvate and α-ketoglutarate. In this review, we analyzed the action of ALA in gynecology and obstetrics focusing in particular on neuropathic pain and antioxidant and anti-inflammatory action. A comprehensive literature search was performed in PubMed and Cochrane Library for retrieving articles in English language on the antioxidant and anti-inflammatory effects of ALA in gynecological and obstetrical conditions. ALA reduces oxidative stress and insulin resistance in women with polycystic ovary syndrome (PCOS). The association of N-acetyl cysteine (NAC), alpha-lipoic acid (ALA), and bromelain (Br) is used for prevention and treatment of endometriosis. In association with omega-3 polyunsaturated fatty acids (n-3 PUFAs) with amitriptyline is used for treatment of vestibulodynia/painful bladder syndrome (VBD/PBS). A promising area of research is ALA supplementation in patients with threatened miscarriage to improve the subchorionic hematoma resorption. Furthermore, ALA could be used in prevention of diabetic embryopathy and premature rupture of fetal membranes induced by inflamation. In conclusion, ALA can be safely used for treatment of neuropatic pain and as a dietary support during pregnancy.

  20. Histomorphometric and Ultrastructural Evaluation of Long-Term Alpha Lipoic Acid and Vitamin B12 Use After Experimental Sciatic Nerve Injury in Rats.

    PubMed

    Arikan, Murat; Togral, Guray; Hasturk, Askin Esen; Horasanli, Bahriye; Helvacioglu, Fatma; Dagdeviren, Atilla; Tekindal, Mustafa Agah; Parpucu, Murat

    2016-01-01

    To analyze the therapeutic effects of long-term alpha lipoic acid (A-LA) and vitamin B12 use via histomorphometric methods and electron microscopy in the transected sciatic nerves of rats. Forty rats were randomized into five groups (n=8/group). In group I, 1 cm segment of sciatic nerve was resected without any other intervention. In group II (sham), following right sciatic nerve transection, primary epineurial anastomosis was performed by placing the edges of the nerve end-to-end. In group III (saline), after right sciatic nerve transection, the ends of the nerves were brought together and closed after application of intraperitoneal physiologic saline. In group IV, 2 mg/kg of alpha lipoic acid and in group V, 2 mg/kg of vitamin B12 was administered intraperitoneally before surgical intervention. Histomorphometric and electron microscopic analyses revealed that vitamin B12 did not prevent structural changes, abnormal myelination and g-ratio deviations regarding the functional aspects of the sciatic nerve. Alpha lipoic acid was more effective in restructuring the histomorphometric and structural aspects of the nerve with more myelinated fibers with optimal values (0.55-0.68) than vitamin B12 groups, in which the number of myelinated nerve fibers significantly decreased at optimal intervals (0.55-0.68). A-LA administration following peripheral nerve transection injury is more effective in promoting nerve healing regarding the structural aspects of the sciatic nerve compared to vitamin B12 and also myelination of nerve fibers by increasing g-values.

  1. Chronic antioxidant therapy reduces oxidative stress in a mouse model of Alzheimer's disease.

    PubMed

    Siedlak, Sandra L; Casadesus, Gemma; Webber, Kate M; Pappolla, Miguel A; Atwood, Craig S; Smith, Mark A; Perry, George

    2009-02-01

    Oxidative modifications are a hallmark of oxidative imbalance in the brains of individuals with Alzheimer's, Parkinson's and prion diseases and their respective animal models. While the causes of oxidative stress are relatively well-documented, the effects of chronically reducing oxidative stress on cognition, pathology and biochemistry require further clarification. To address this, young and aged control and amyloid-beta protein precursor-over-expressing mice were fed a diet with added R-alpha lipoic acid for 10 months to determine the effect of chronic antioxidant administration on the cognition and neuropathology and biochemistry of the brain. Both wild type and transgenic mice treated with R-alpha lipoic acid displayed significant reductions in markers of oxidative modifications. On the other hand, R-alpha lipoic acid had little effect on Y-maze performance throughout the study and did not decrease end-point amyloid-beta load. These results suggest that, despite the clear role of oxidative stress in mediating amyloid pathology and cognitive decline in ageing and AbetaPP-transgenic mice, long-term antioxidant therapy, at levels within tolerable nutritional guidelines and which reduce oxidative modifications, have limited benefit.

  2. The Antioxidant Additive Approach for Alzheimer's Disease Therapy: New Ferulic (Lipoic) Acid Plus Melatonin Modified Tacrines as Cholinesterases Inhibitors, Direct Antioxidants, and Nuclear Factor (Erythroid-Derived 2)-Like 2 Activators.

    PubMed

    Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane

    2016-11-10

    Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.

  3. Gymnema

    MedlinePlus

    ... combination of gymnema, hydroxycitric acid, and niacin-bound chromium by mouth can reduce body weight in people ... these products include alpha-lipoic acid, bitter melon, chromium, devil's claw, fenugreek, garlic, guar gum, horse chestnut, ...

  4. Study on the clinical value of alprostadil combined with α-lipoic acid in treatment of type 2 diabetes mellitus patients with erectile dysfunction.

    PubMed

    Zhang, L; Zhang, H-Y; Huang, F-C; Huang, Q; Liu, C; Li, J-R

    2016-09-01

    We investigated the clinical value of alprostadil combined with the α-lipoic acid in treating type 2 diabetes mellitus with erectile dysfunction (DMED). We selected a total of 76 cases of patients who were admitted to endocrinology department of our hospital from June 2014 to June 2015 and diagnosed as DMED, and the average age was (46.7 ± 7.2) years old, average course of diabetes mellitus was (6.2 ± 2.8) years and average body mass index was (25.4 ± 1.3) kg/m2. 40 cases were randomly divided in the observation group while 36 cases were divided in the control group. They received blood glucose control therapy. The patients in the observation group received 60 mg alprostadil hydrochloride and 600 mg α-lipoic acid added into 250 mL normal saline, intravenous drip once per day for 2 weeks. The patients in the control group took tadalafil 5 mg orally, once per night for 2 weeks as a course of treatment. There were no cases of loss. The effective rate of treatment in observation group is significantly higher than that in the control group (95.0% vs. 80.5%, p < 0.05). The score of IIEF-5, EHGS and the FMD value of brachial artery of the observation group after the operation were significantly higher than that of the control group (p < 0.05). The adverse reaction rate in the observation group was lower than that in the control group (7.5% vs. 13.9%, p < 0.05). Alprostadil combined with α-lipoic acid can improve DMED patients' vascular endothelial function and erection hardness to treat erectile dysfunction with less adverse effects and better safety.

  5. Soft Ultraviolet (UV) Photopatterning and Metallization of Self-Assembled Monolayers (SAMs) Formed from the Lipoic Acid Ester of α-Hydroxy-1-acetylpyrene: The Generality of Acid-Catalyzed Removal of Thiol-on-Gold SAMs using Soft UV Light.

    PubMed

    Pukenas, Laurynas; Prompinit, Panida; Nishitha, Boda; Tate, Daniel J; Singh, N D Pradeep; Wälti, Christoph; Evans, Stephen D; Bushby, Richard J

    2017-05-31

    Under a layer of 0.1 M HCl in isopropanol, soft ultraviolet (UV) (365 nm) photolysis of the thiol-on-gold self-assembled monolayer (SAM) derived from the lipoic acid ester of α-hydroxy-1-acetylpyrene results in the expected removal of the acetylpyrene protecting group. When photolyzing through a mask, this can be used to produce a patterned surface and, at a controlled electrochemical potential, it is then possible to selectively and reversibly electrodeposit copper on the photolyzed regions. Rather surprisingly, under these photolysis conditions, there is not only the expected photodeprotection of the ester but also partial removal of the lipoic acid layer which has been formed. In further studies, it is shown that this type of acid-catalyzed photoremoval of SAM layers by soft UV is a rather general phenomenon and results in the partial removal of the thiol-on-gold SAM layers derived from other ω-thiolated carboxylic acids. However, this phenomenon is chain-length dependent. Under conditions in which there is a ∼60% reduction in the thickness of the SAM derived from dithiobutyric acid, the SAM derived from mercaptoundecanoic acid is almost unaffected. The process by which the shorter-chain SAM layers are partially removed is not fully understood because these compounds do not absorb significantly in the 365 nm region of the spectrum! Significantly, this study shows that acid catalysis photolysis of thiol-on-gold SAMs needs to be used with caution.

  6. Mechanisms of cell uptake, inflammatory potential and protein corona effects with gold nanoparticles.

    PubMed

    Li, Yang; Monteiro-Riviere, Nancy A

    2016-12-01

    To assess inflammation, cellular uptake and endocytic mechanisms of gold nanoparticles (AuNP) in human epidermal keratinocytes with and without a protein corona. Human epidermal keratinocytes were exposed to 40 and 80 nm AuNP with lipoic acid, polyethylene glycol (PEG) and branched polyethyleneimine (BPEI) coatings with and without a protein corona up to 48 h. Inhibitors were selected to characterize endocytosis. BPEI-AuNP showed the greatest uptake, while PEG-AuNP had the least. Protein coronas decreased uptake and affected their mechanism. AuNP uptake was energy-dependent, except for 40 nm lipoic-AuNP. Most AuNP were internalized by clathrin and lipid raft-mediated endocytosis, except for 40 nm PEG was by raft/noncaveolae mediated endocytosis. Coronas inhibited caveolae-mediated-endocytosis with lipoic acid and BPEI-AuNP and altered 40 nm PEG-AuNP from raft/noncaveolae to clathrin. Inflammatory responses decreased with a plasma corona. Results suggest protein coronas significantly affect cellular uptake and inflammatory responses of AuNP.

  7. Selective heterogeneous acid catalyzed esterification of N-terminal sulfyhdryl fatty acids

    USDA-ARS?s Scientific Manuscript database

    Our interest in thiol fatty acids lies in their antioxidative, free radical scavenging, and metal ion scavenging capabilities as applied to cosmeceutical and skin care formulations. The retail market is filled with products containing the disulfide-containing free fatty acid, lipoic acid. These pr...

  8. Treatment of oxidative stress in brain of ovariectomized rats with omega-3 and lipoic acid.

    PubMed

    Behling, Camile S; Andrade, Alexey S; Putti, Jordana S; Mahl, Camila D; Hackenhaar, Fernanda S; da Silva, Ana Carolina A; e Silva, Mélany Natuane C; Salomon, Tiago B; Dos Santos, Carla E I; Dias, Johnny F; Benfato, Mara S

    2015-12-01

    Postmenopausal women are often affected by a group of metabolic disorders related to oxidative stress. Alternative treatments that can improve the quality of life of these women have been the subject of recent studies. The objective of this study was to evaluate the response to oxidative stress in the brains of rats following ovariectomy, and to determine enzymatic and nonenzymatic antioxidant responses when the animals received 3 months of dietary supplementation. Ovariectomy produced changes in antioxidant profiles characterized by reductions in glutathione S-transferase activity, H2 O2 consumption, superoxide dismutase activity, and vitamin C levels and increases in protein carbonylation. Docosahexaenoic fatty acid (DHA) supplementation restored these parameters to normal values and increased values of other antioxidants (glutathione peroxidase and total glutathione). However, DHA supplementation also increased protein carbonylation and lipid peroxidation. Eicosapentaenoic acid supplementation produced no changes in antioxidants, but decreased lipid peroxidation. Lipoic acid supplementation increased consumption of H2 O2 and decreased protein carbonylation and lipid peroxidation. These results suggest that the antioxidant response to omega-3 varies in different tissues, and in this study DHA treatment had a prooxidant effect in the brain. Lipoic acid treatment, on the other hand, had a protective effect, reducing markers of oxidative damage. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging

    PubMed Central

    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida

    2015-01-01

    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA. PMID:26788510

  10. Modulation of antioxidant and detoxification responses mediated by lipoic acid in the fish Corydoras paleatus (Callychthyidae).

    PubMed

    Monserrat, José Maria; Lima, Juliane Ventura; Ferreira, Josencler Luis Ribas; Acosta, Daiane; Garcia, Márcia Longaray; Ramos, Patricia Baptista; Moraes, Tarsila Barros; Dos Santos, Luciane Cougo; Amado, Lílian Lund

    2008-09-01

    Lipoic acid (LA) has been reported as a potential therapeutic agent due its antioxidants proprieties. It was considered its effect in different organs (gills, brain, muscle and liver) of the fish Corydoras paleatus (Callychthyidae). LA (70 mg/kg of body mass) was added to a commercial fish diet, organisms being fed daily (1% body weight). Sixty animals (mean mass: 2.37+/-0.09 g) were placed randomly in aquariums and received (+LA) or not (-LA) lipoic acid enriched diet during four weeks. After, fish were killed and the brain, muscle, gills and liver were dissected. LA treatment reduced significantly (p<0.05) reactive oxygen species concentration in brain and increased (p<0.05) glutamate-cysteine ligase activity in brain and liver of the same experimental group. LA fed organisms showed higher (p<0.05) brain glutathione-S-transferase activity, indicating that LA improves the detoxification and antioxidant capacity face components that waste glutathione in phase II reactions. A conspicuous reduction of protein oxidation was observed in muscle and liver of +LA organisms, indicating that the treatment was also effective in reducing oxidative stress parameters.

  11. Neuroprotective effect of the carnosine - α-lipoic acid nanomicellar complex in a model of early-stage Parkinson's disease.

    PubMed

    Kulikova, Olga I; Berezhnoy, Daniil S; Stvolinsky, Sergey L; Lopachev, Alexander V; Orlova, Valentina S; Fedorova, Tatiana N

    2018-06-01

    In a model of early-stage Parkinson's disease induced by a single intranasal administration of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) to Wistar rats, a neuroprotective effect of a new derivative of carnosine and α-lipoic acid (C/LA nanomicellar complex) was demonstrated. Acute intraperitoneal administration of carnosine, α-lipoic acid and C/LA complex following MPTP administration normalized the total antioxidant activity in the brain tissue. Of all the compounds tested only C/LA complex normalized the metabolism of dopamine (DA) and serotonin (5-HT), while its components did not show similar effects when used separately. C/LA complex effectively restored the level of DA metabolites: the level of DOPAC was increased by 24.7 ± 5.6% compared to the animals that had received MPTP only, and the level of HVA was restored to the values observed in the intact animals. Integral metabolic indices of DA (DOPAC/DA and HVA/DA ratios) and 5-HT turnover (5-HIAA/5-HT ratio) in the striatum tended to increase in case of C/LA complex administration. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Lipoic Acid Restores Age-Associated Impairment of Brain Energy Metabolism through the Modulation of Akt/JNK Signaling and PGC1α Transcriptional Pathway

    PubMed Central

    Jiang, Tianyi; Yin, Fei; Yao, Jia; Brinton, Roberta Díaz; Cadenas, Enrique

    2013-01-01

    Summary This study examines the progress of a hypometabolic state inherent in brain aging with an animal model consisting of Fischer 344 rats of young, middle, and old ages. Dynamic microPET scanning demonstrated a significant decline in brain glucose uptake at old ages, which was associated with a decrease in the expression of insulin-sensitive neuronal glucose transporters GLUT3/4 and of microvascular endothelium GLUT1. Brain aging was associated with an imbalance of the PI3K/Akt pathway of insulin signaling and JNK signaling and a downregulation of the PGC1α – mediated transcriptional pathway of mitochondrial biogenesis that impinged on multiple aspects of energy homeostasis. R-(+)-lipoic acid treatment increased glucose uptake, restored the balance of Akt/JNK signaling, and enhanced mitochondrial bioenergetics and the PGC1α-driven mitochondrial biogenesis. It may be surmised that impairment of a mitochondria-cytosol-nucleus communication is underlying the progression of the age-related hypometabolic state in brain; the effects of lipoic acid are not organelle-limited but reside on the functional and effective coordination of this communication that results in improved energy metabolism. PMID:23815272

  13. Mis-targeting of the mitochondrial protein LIPT2 leads to apoptotic cell death.

    PubMed

    Bernardinelli, Emanuele; Costa, Roberta; Scantamburlo, Giada; To, Janet; Morabito, Rossana; Nofziger, Charity; Doerrier, Carolina; Krumschnabel, Gerhard; Paulmichl, Markus; Dossena, Silvia

    2017-01-01

    Lipoyl(Octanoyl) Transferase 2 (LIPT2) is a protein involved in the post-translational modification of key energy metabolism enzymes in humans. Defects of lipoic acid synthesis and transfer start to emerge as causes of fatal or severe early-onset disease. We show that the first 31 amino acids of the N-terminus of LIPT2 represent a mitochondrial targeting sequence and inhibition of the transit of LIPT2 to the mitochondrion results in apoptotic cell death associated with activation of the apoptotic volume decrease (AVD) current in normotonic conditions, as well as over-activation of the swelling-activated chloride current (IClswell), mitochondrial membrane potential collapse, caspase-3 cleavage and nuclear DNA fragmentation. The findings presented here may help elucidate the molecular mechanisms underlying derangements of lipoic acid biosynthesis.

  14. Effect of alpha-lipoic acid on endometrial implants in an experimental rat model.

    PubMed

    Pınar, Neslihan; Soylu Karapınar, Oya; Özcan, Oğuzhan; Özgür, Tümay; Bayraktar, Suphi

    2017-10-01

    To investigate the antioxidant and anti-inflammatory effects of alpha-lipoic acid (ALA) in the treatment of endometriosis in an experimental rat model by evaluating biochemical and histopathologic parameters. Experimental endometriosis was induced by the peritoneal implantation of autologous endometrial tissue. The rats were randomly divided into two groups with eight rats each. Group I was intraperitoneally administered ALA 100 mg/kg/day for 14 days. Group II was intraperitoneally administered saline solution at the same dosage and over the same period. Endometrial implant volume was measured in both groups both pre- and post-treatment. Tumor necrosis factor alpha (TNF-α) was measured in peritoneal fluid. Total antioxidant status (TAS), total oxidant status (TOS), and oxidative stress index (OSI) were assessed in serum. The implants were histopathologically evaluated. In the ALA group, the serum TOS and OSI levels, the endometrial implant volumes, the TNF-α levels in serum and peritoneal fluid, and the histopathologic scores were significantly lower compared to the control group (P < 0.05). Alpha-lipoic acid may have a therapeutic potential in the treatment of endometriosis due to its antioxidant and anti-inflammatory effects. © 2017 Société Française de Pharmacologie et de Thérapeutique.

  15. Phthalate induced toxicity in prostate cancer cell lines and effects of alpha lipoic acid.

    PubMed

    Kismali, G; Yurdakok-Dikmen, B; Kuzukiran, O; Arslan, P; Filazi, A

    2017-01-01

    The effects of dimethyl phthalate, diethyl phthalate, diisobutyl phthalate, di-n-butyl phthalate, benzylbutyl phthalate, di-2-ethylhexyl phthalate were investigated on human prostate cancer cell lines DU145 and PC3 in vitro. Standards of dimethyl phthalate, diethyl phthalate, di-isobutyl phthalate, dibutyl phthalate, benzyl butyl phthalate, and di-ethyl hexyl phthalate were used. Alpha lipoic acid was used as antioxidant compound. DU145 and PC3 human prostate carcinoma cells were used. MTT assay were used for cytotoxicity assay. A low dose proliferative effect of phthalates in vitro was observed. With the hypothesis of the inhibition of aerobic glycolysis activity in cancer treatment, α-lipoic acid was applied to cells; where as a contrary to previous studies, no change in the cell proliferation was observed. In combination with ALA, at IC50 and lower doses, an increase of the cytotoxic effect was found for DIBP, DBP and BBP; while for DMP, DEP and DEHP, a decrease was observed for DU145 cells. In PC3 cells, a decrease was observed for DMP, DEP and DBPs; while no significant difference were observed for DEHP, DIBP and BBP. The present study demonstrates preliminary information regarding the low dose proliferative effects of phthalates in prostate cancer in vitro (Tab. 2, Fig. 2, Ref. 65).

  16. α-lipoic acid inhibits oxidative stress in testis and attenuates testicular toxicity in rats exposed to carbimazole during embryonic period.

    PubMed

    Prathima, P; Venkaiah, K; Pavani, R; Daveedu, T; Munikumar, M; Gobinath, M; Valli, M; Sainath, S B

    2017-01-01

    The aim of this study was to evaluate the probable protective effect of α-lipoic acid against testicular toxicity in rats exposed to carbimazole during the embryonic period. Time-mated pregnant rats were exposed to carbimazole from the embryonic days 9-21. After completion of the gestation period, all the rats were allowed to deliver pups and weaned. At postnatal day 100, F1 male pups were assessed for the selected reproductive endpoints. Gestational exposure to carbimazole decreased the reproductive organ indices, testicular daily sperm count, epididymal sperm variables viz ., sperm count, viable sperm, motile sperm and HOS-tail coiled sperms. Significant decrease in the activity levels of 3β- and 17β-hydroxysteroid dehydrogenases and expression of StAR mRNA levels with a significant increase in the total cholesterol levels were observed in the testis of experimental rats over the controls. These events were also accompanied by a significant reduction in the serum testosterone levels in CBZ exposed rats, indicating reduced steroidogenesis. In addition, the deterioration of the testicular architecture and reduced fertility ability were noticed in the carbimazole exposed rats. Significant reduction in the activity levels of superoxide dismutase, catalase, glutathione reductase, glutathione peroxidase and reduced glutathione content with a significant increase in the levels of lipid peroxidation were observed in the testis of carbimazole exposed rats over the controls. Conversely, supplementation of α-lipoic acid (70 mg/Kg bodyweight) ameliorated the male reproductive health in rats exposed to carbimazole during the embryonic period as evidenced by enhanced reproductive organ weights, selected sperm variables, testicular steroidogenesis, and testicular enzymatic and non-enzymatic antioxidants. To conclude, diminished testicular antioxidant balance associated with reduced spermatogenesis and steroidogenesis might be responsible for the suppressed reproduction in rats exposed to the carbimazole transplacentally. On the other hand, α-lipoic acid through its antioxidant and steroidogenic properties mitigated testicular toxicity which eventually restored the male reproductive health of carbimazole-exposed rats.

  17. Grafting of 4-aminomethylbenzensulfonamide-lipoic acid conjugate on gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Stiti, M.; Bouzit, H.; Abdaoui, M.; Winum, J. Y.

    2012-02-01

    In this paper, we describe the synthesis of goldnanoparticles bearing aminomethylbenzensulfonamide via a lipoyl moiety. The resulting stable nanoparticles with an average size of 4.0 nm have been achieved by a facile and high-yielding one phase method, by the action of 4-aminomethylbenzensulfonamide-lipoic acid bioconjugate on chloroauric acide, using dimethylsulfoxide (DMSO) as the solvent and sodium tetrahydridoborate (NaBH4) as the reducing agent. UV-vis absorption, transmission electron microscopy (TEM) and X-ray diffraction were used to analyse the morphology and the structure of the obtained nanoparticles. Preliminary study shows that these new nanoparticles are endowed with highly and specific inhibitory activity for the isoform (IX) of carbonic anhydrase over expressed in many cancers, and are therefore attractive candidate to be used both in diagnosis and in treatment of tumours.

  18. {alpha}-Lipoic acid exhibits anti-amyloidogenicity for {beta}-amyloid fibrils in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ono, Kenjiro; Hirohata, Mie; Yamada, Masahito

    2006-03-24

    Inhibition of the formation of {beta}-amyloid fibrils (fA{beta}), as well as the destabilization of preformed fA{beta} in the CNS would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of {alpha}-lipoic acid (LA) and the metabolic product of LA, dihydrolipoic acid (DHLA), on the formation, extension, and destabilization of fA{beta} at pH 7.5 at 37 {sup o}C in vitro. LA and DHLA dose-dependently inhibited fA{beta} formation from amyloid {beta}-protein, as well as their extension. Moreover, they destabilized preformed fA{beta}s. LA and DHLA couldmore » be key molecules for the development of therapeutics for AD.« less

  19. Polycystic ovary syndrome (PCOS) and hyperandrogenism: the role of a new natural association.

    PubMed

    Morgante, G; Cappelli, V; Di Sabatino, A; Massaro, M G; De Leo, V

    2015-10-01

    Polycystic ovary syndrome (PCOS) affects 5-10% of women of childbearing age and manifests itself through oligomenorrhea, anovulation, hirsutism, micro-polycystic ovaries. Insulin resistance is a characteristic of PCOS patients and is more pronounced in obese patients. Insulin resistance and consequent hyperinsulinemia are related to many aspects of the syndrome such as hyperandrogenism, reproductive disorders, acne and hirsutism. In the long-term it may increase the risk of cardiovascular disease and negatively affect lipid profile and blood pressure. Changes in lifestyle and diet can partially improve these aspects. The use of insulin-sensitizing drugs such as metformin often normalises the menstrual cycle, improving hyperandrogenism and, subsequently, the response to ovulation induction therapies. New molecules have recently been marketed, that produce the same results, but without the side-effects. One of these is myo-inositol, a new insulin-sensitizing molecule which has been successfully administered to women suffering from PCOS. Associations between inositol and other compounds that can increase the therapeutic effect have been proposed. Of these, we found to be interesting the association with monacolin K, a natural statin that reduces cholesterol levels starting point of the synthesis of steroids, including androgens, and lipoic acid, known for its anti-inflammatory, antioxidant and insulin-sensitizing activity. We decided to assess the efficacy of the product. We recruited 30 women aged between 24 and 32 years suffering from PCOS with insulin resistance, HOMA index>2.5 and no other endocrine diseases. The following were assessed: Body Mass Index (BMI), characteristics of menstrual cycles, lipid profile (total cholesterol, and HDL), androgens (total testosterone and androstenedione). The patients were also assessed for the degree of hirsutism using the Ferriman-Gallwey Score>8. The subjects were divided into two groups: Group A, treated with an association of 1 g myo-inositol, 5 mg monacolin K and 400 mg lipoic acid for 6 months; Group B, treated with a double dosage of 2 g myo-inositol, 10 mg monacolin K, 800 mg lipoic acid for 6 months. The results have shown good efficacy of both dosages, although women treated with a double dosage of myo-inositol, monacolin K and lipoic acid showed a significantly greater improvement in terms of lipid parameters and those connected with hyperandrogenism. This new myo-inositol, monacolin K and lipoic acid association contains appropriate substances to contrast various etiopathogenic elements responsible for the onset of PCOS and the symptoms of hyperandrogenism and dyslipidemia related to it.

  20. An open-label pilot trial of alpha-lipoic acid for weight loss in patients with schizophrenia without diabetes.

    PubMed

    Ratliff, Joseph C; Palmese, Laura B; Reutenauer, Erin L; Tek, Cenk

    2015-01-01

    A possible mechanism of antipsychotic-induced weight gain is activation of hypothalamic monophosphate-dependent kinase (AMPK) mediated by histamine 1 receptors. Alpha-lipoic acid (ALA), a potent antioxidant, counteracts this effect and may be helpful in reducing weight for patients taking antipsychotics. The objective of this open-label study was to assess the efficacy of ALA (1,200 mg) on twelve non-diabetic schizophrenia patients over ten weeks. Participants lost significant weight during the intervention (-2.2 kg±2.5 kg). ALA was well tolerated and was particularly effective for individuals taking strongly antihistaminic antipsychotics (-2.9 kg±2.6 kg vs. -0.5 kg±1.0 kg). NCT01355952.

  1. Protective effect of α-lipoic acid against radiation-induced fibrosis in mice

    PubMed Central

    Ryu, Seung-Hee; Park, Eun-Young; Kwak, Sungmin; Heo, Seung-Ho; Ryu, Je-Won; Park, Jin-hong

    2016-01-01

    Radiation-induced fibrosis (RIF) is one of the most common late complications of radiation therapy. We found that α-lipoic acid (α-LA) effectively prevents RIF. In RIF a mouse model, leg contracture assay was used to test the in vivo efficacy of α-LA. α-LA suppressed the expression of pro-fibrotic genes after irradiation, both in vivo and in vitro, and inhibited the up-regulation of TGF-β1-mediated p300/CBP activity. Thus, α-LA prevents radiation-induced fibrosis (RIF) by inhibiting the transcriptional activity of NF-κB through inhibition of histone acetyltransferase activity. α-LA is a new therapeutic methods that can be used in the prevention-treatment of RIF. PMID:26799284

  2. Bioprotective carnitinoids: lipoic acid, butyrate, and mitochondria-targeting to treat radiation injury: mitochondrial drugs come of age.

    PubMed

    Steliou, Kosta; Faller, Douglas V; Pinkert, Carl A; Irwin, Michael H; Moos, Walter H

    2015-06-01

    Preclinical Research Given nuclear-power-plant incidents such as the 2011 Japanese Fukushima-Daiichi disaster, an urgent need for effective medicines to protect against and treat the harmful biological effects of radiation is evident. To address such a challenge, we describe potential strategies herein including mitochondrial and epigenetic-driven methods using lipoic and butyric acid ester conjugates of carnitine. The antioxidant and other therapeutically beneficial properties of this class of agents may protect against ionizing radiation and resultant mitochondrial dysfunction. Recent studies of the compounds described herein reveal the potential-although further research and development is required to prove the effectiveness of this approach-to provide field-ready radiation-protective drugs. © 2015 Wiley Periodicals, Inc.

  3. Lipoic acid stimulates cAMP production via G protein coupled receptor dependent and independent mechanisms

    PubMed Central

    Salinthone, Sonemany; Schillace, Robynn V.; Tsang, Catherine; Regan, John W.; Bourdette, Dennis N.; Carr, Daniel W.

    2010-01-01

    Lipoic acid (LA) is a naturally occurring fatty acid that exhibits anti-oxidant and anti-inflammatory properties and is being pursued as a therapeutic for many diseases including multiple sclerosis, diabetic polyneuropathy and Alzheimer’s disease. We previously reported on the novel finding that racemic LA (50:50 mixture of R and S LA) stimulates cAMP production, activates prostanoid EP2 and EP4 receptors and adenylyl cyclases (AC), and suppresses activation and cytotoxicity in NK cells. In this study we present evidence that furthers our understanding of the mechanisms of action of LA. Using various LA derivatives, dihydrolipoic acid (DHLA), S,S-dimethyl lipoic acid (DMLA) and lipoamide (LPM), we discovered that only LA is capable of stimulating cAMP production in NK cells. Furthermore, there is no difference in cAMP production after stimulation with either R-LA, S-LA or racemic LA. Competition and synergistic studies indicate that LA may also activate AC independent of the EP2 and EP4 receptors. Pretreatment of PBMCc with KH7 (a specific peptide inhibitor of soluble AC) and the calcium inhibitor (Bapta) prior to LA treatment resulted in reduced cAMP levels, suggesting that soluble AC and calcium signaling mediate LA stimulation of cAMP production. In addition, pharmacological inhibitor studies demonstrate that LA also activates other G- protein coupled receptors, including histamine and adenosine, but not the beta adrenergic receptors. These novel findings provide information to better understand the mechanisms of action of LA, which can help facilitate the use of LA as a therapeutic for various diseases. PMID:21036588

  4. Hypermetabolic state in the 7-month-old triple transgenic mouse model of Alzheimer's disease and the effect of lipoic acid: a 13C-NMR study

    PubMed Central

    Sancheti, Harsh; Patil, Ishan; Kanamori, Keiko; Díaz Brinton, Roberta; Zhang, Wei; Lin, Ai-Ling; Cadenas, Enrique

    2014-01-01

    Alzheimer's disease (AD) is characterized by age-dependent biochemical, metabolic, and physiologic changes. These age-dependent changes ultimately converge to impair cognitive functions. This study was carried out to examine the metabolic changes by probing glucose and tricarboxylic acid cycle metabolism in a 7-month-old triple transgenic mouse model of AD (3xTg-AD). The effect of lipoic acid, an insulin-mimetic agent, was also investigated to examine its ability in modulating age-dependent metabolic changes. Seven-month-old 3xTg-AD mice were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C nuclear magnetic resonance to determine the concentrations of 13C-labeled isotopomers of glutamate, glutamine, aspartate, gamma aminobutyric acid, and N-acetylaspartate. An intravenous infusion of [1-13C]glucose+[1,2-13C]acetate was given for different periods of time to distinguish neuronal and astrocytic metabolism. Enrichments of glutamate, glutamine, and aspartate were calculated after quantifying the total (12C+13C) concentrations by high-performance liquid chromatography. A hypermetabolic state was clearly evident in 7-month-old 3xTg-AD mice in contrast to the hypometabolic state reported earlier in 13-month-old mice. Hypermetabolism was evidenced by prominent increase of 13C labeling and enrichment in the 3xTg-AD mice. Lipoic acid feeding to the hypermetabolic 3xTg-AD mice brought the metabolic parameters to the levels of nonTg mice. PMID:25099753

  5. Phenol esterase activity of porcine skin

    USDA-ARS?s Scientific Manuscript database

    The alkyl esters of plant-derived phenols may serve as slow-release sources for cutaneous delivery of antioxidants. The ability of skin esterases to hydrolyze phenolic esters was examined. Esters of tyrosol and hydroxytyrosol were prepared from decanoic and lipoic acids. Ferulic acid was esterified ...

  6. A randomized placebo-controlled pilot trial of omega-3 fatty acids and alpha lipoic acid in Alzheimer's disease.

    PubMed

    Shinto, Lynne; Quinn, Joseph; Montine, Thomas; Dodge, Hiroko H; Woodward, William; Baldauf-Wagner, Sara; Waichunas, Dana; Bumgarner, Lauren; Bourdette, Dennis; Silbert, Lisa; Kaye, Jeffrey

    2014-01-01

    Oxidative stress, inflammation, and increased cholesterol levels are all mechanisms that have been associated with Alzheimer's disease (AD) pathology. Several epidemiologic studies have reported a decreased risk of AD with fish consumption. This pilot study was designed to evaluate the effects of supplementation with omega-3 fatty acids alone (ω-3) or omega-3 plus alpha lipoic acid (ω-3 + LA) compared to placebo on oxidative stress biomarkers in AD. The primary outcome measure was peripheral F2-isoprostane levels (oxidative stress measure). Secondary outcome measures included performance on: Mini-Mental State Examination (MMSE), Activities of Daily Living/Instrumental Activities of Daily Living (ADL/IADL), and Alzheimer Disease Assessment Scale-cognitive subscale (ADAS-cog). Thirty-nine AD subjects were randomized to one of three groups: 1) placebo, 2) ω-3, or 3) ω-3 + LA for a treatment duration of 12 months. Eighty seven percent (34/39) of the subjects completed the 12-month intervention. There was no difference between groups at 12 months in peripheral F2-isoprostane levels (p = 0.83). The ω-3 + LA and ω-3 were not significantly different than the placebo group in ADAS-cog (p = 0.98, p = 0.86) and in ADL (p = 0.15, p = 0.82). Compared to placebo, the ω-3 + LA showed less decline in MMSE (p < 0.01) and IADL (p = 0.01) and the ω-3 group showed less decline in IADL (p < 0.01). The combination of ω-3 + LA slowed cognitive and functional decline in AD over 12 months. Because the results were generated from a small sample size, further evaluation of the combination of omega-3 fatty acids plus alpha-lipoic acid as a potential treatment in AD is warranted.

  7. A Randomized Placebo-Controlled Pilot Trial of Omega-3 Fatty Acids and Alpha Lipoic Acid in Alzheimer’s Disease

    PubMed Central

    Shinto, Lynne; Quinn, Joseph; Montine, Thomas; Dodge, Hiroko H.; Woodward, William; Baldauf-Wagner, Sara; Waichunas, Dana; Bumgarner, Lauren; Bourdette, Dennis; Silbert, Lisa; Kaye, Jeffrey

    2013-01-01

    Oxidative stress, inflammation, and increased cholesterol levels are all mechanisms that have been associated with Alzheimer’s disease (AD) pathology. Several epidemiologic studies have reported a decreased risk of AD with fish consumption. This pilot study was designed to evaluate the effects of supplementation with omega-3 fatty acids alone (ω-3) or omega-3 plus alpha lipoic acid (ω-3 +LA) compared to placebo on oxidative stress biomarkers in AD. The primary outcome measure was peripheral F2-isoprostane levels (oxidative stress measure). Secondary outcome measures included performance on: Mini-Mental State Examination (MMSE), Activities of Daily Living/Instrumental Activities of Daily Living (ADL/IADL), and Alzheimer Disease Assessment Scale-cognitive subscale (ADAS-cog). Thirty-nine AD subjects were randomized to one of three groups: 1) placebo, 2) ω-3, or 3) ω-3 + LA for a treatment duration of 12 months. Eighty seven percent (34/39) of the subjects completed the 12-month intervention. There was no difference between groups at 12 months in peripheral F2-isoprostane levels (p = 0.83). The ω-3 +LA and ω-3 were not significantly different than the placebo group in ADAS-cog (p = 0.98, p = 0.86) and in ADL (p = 0.15, p = 0.82). Compared to placebo, the ω-3+LA showed less decline in MMSE (p< 0.01) and IADL (p= 0.01) and the ω-3 group showed less decline in IADL (p < 0.01). The combination of ω-3+LA slowed cognitive and functional decline in AD over 12 months. Because the results were generated from a small sample size, further evaluation of the combination of omega-3 fatty acids plus alpha-lipoic acid as a potential treatment in AD is warranted. PMID:24077434

  8. Lipoate ester multifunctional lubricant additives

    USDA-ARS?s Scientific Manuscript database

    Seven lipoate esters were synthesized by esterification of lipoic acid with different structures of alcohols in the presence of a solid acid catalyst and without solvent. The esters were obtained in good yield, characterized using 1H NMR and GPC; and their physical properties investigated. Four of t...

  9. Homology modeling of Homo sapiens lipoic acid synthase: Substrate docking and insights on its binding mode.

    PubMed

    Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay

    2017-05-07

    Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Encapsulation of the Antioxidant R-(+)-α-Lipoic Acid in Permethylated α- and β-Cyclodextrins: Thermal and X-ray Structural Characterization of the 1:1 Inclusion Complexes.

    PubMed

    Caira, Mino R; Bourne, Susan A; Mzondo, Buntubonke

    2017-05-23

    The naturally occurring compound α-lipoic acid (ALA) is implicated in manifold critical biological roles and its potent antioxidant properties and potential for treatment of various diseases have led to its widespread use as a dietary supplement. However, shortcomings of poor aqueous solubility and low thermal stability have hampered its development as a medicinal agent, prompting the use of cyclodextrins (CDs) to address these problems. The paucity of published structural data on the nature of the interactions between ALA and CDs motivated the present study, which describes the synthesis and X-ray structural elucidation of crystalline inclusion complexes between the biologically relevant R-(+)-α-lipoic acid (RALA) and the host molecules permethylated α-CD (TMA) and permethylated β-CD (TMB). Single crystal X-ray diffraction of TMA·RALA·6H₂O and TMB·RALA revealed significantly different orientations of the RALA molecule within the TMA and TMB cavities, but in both cases the guest molecule is fully encapsulated by the respective parent host molecules and residues of CD molecules of neighboring complex units. While pure RALA melted at 46-48 °C, combined thermal analysis techniques indicated that on heating the respective complexes, the release of RALA occurred at significantly higher onset temperatures, in the range 150-170 °C.

  11. Lipoic Acid: its antioxidant and anti-inflammatory role and clinical applications.

    PubMed

    Moura, Fabiana Andréa; de Andrade, Kívia Queiroz; dos Santos, Juliana Célia Farias; Goulart, Marília Oliveira Fonseca

    2015-01-01

    Lipoic acid (LA) is an antioxidant able to produce its effects in aqueous or lipophilic environments. Lipoate is the conjugate base of lipoic acid, and the most prevalent form of LA under physiological conditions. It presents a highly negative reduction potential, increases the expression of antioxidant enzymes and participates in the recycling of vitamins C and E. Due to these properties, LA is called the "universal antioxidant". LA is also involved with anti-inflammatory action, independently of its antioxidant activity. This review was carried out, aiming to identify, analyze, and rationalize the various clinical, physiopathological and/or physiological situations in which LA, through oral supplementation, was tested on human and animal (rats and mice) models. LA was mainly tested in cardiovascular diseases (CVD), obesity, pain, inflammatory diseases and aging. LA uses in CVD and obesity, in humans, are controversial. On the other hand, beneficial effects on inflammation and pain were observed. LA supplementation in animal models may prolong life, has neuroprotective effects and presents positive effects against cancer. Differences observed in human and animal models can be due, in part, to different treatments (LA combined with other antioxidants, different doses) and to the variety of biomarkers investigated in animal experiments. These results suggest the need for further clinical trials to guide health professionals regarding the safety of prescription of this supplement.

  12. Fragrance chemicals lyral and lilial decrease viability of HaCat cells' by increasing free radical production and lowering intracellular ATP level: protection by antioxidants.

    PubMed

    Usta, Julnar; Hachem, Yassmine; El-Rifai, Omar; Bou-Moughlabey, Yolla; Echtay, Karim; Griffiths, David; Nakkash-Chmaisse, Hania; Makki, Rajaa Fakhoury

    2013-02-01

    We investigate in this study the biochemical effects on cells in culture of two commonly used fragrance chemicals: lyral and lilial. Whereas both chemicals exerted a significant effect on primary keratinocyte(s), HaCat cells, no effect was obtained with any of HepG2, Hek293, Caco2, NIH3T3, and MCF7 cells. Lyral and lilial: (a) decreased the viability of HaCat cells with a 50% cell death at 100 and 60 nM respectively; (b) decreased significantly in a dose dependant manner the intracellular ATP level following 12-h of treatment; (c) inhibited complexes I and II of electron transport chain in liver sub-mitochondrial particles; and (d) increased reactive oxygen species generation that was reversed by N-acetyl cysteine and trolox and the natural antioxidant lipoic acid, without influencing the level of free and/or oxidized glutathione. Lipoic acid protected HaCat cells against the decrease in viability induced by either compound. Dehydrogenation of lyral and lilial produce α,β-unsaturated aldehydes, that reacts with lipoic acid requiring proteins resulting in their inhibition. We propose lyral and lilial as toxic to mitochondria that have a direct effect on electron transport chain, increase ROS production, derange mitochondrial membrane potential, and decrease cellular ATP level, leading thus to cell death. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. The effects of gold nanoparticles in wound healing with antioxidant epigallocatechin gallate and α-lipoic acid.

    PubMed

    Leu, Jyh-Gang; Chen, Siang-An; Chen, Han-Min; Wu, Wen-Mein; Hung, Chi-Feng; Yao, Yeong-Der; Tu, Chi-Shun; Liang, Yao-Jen

    2012-07-01

    Topical applications of antioxidant agents in cutaneous wounds have attracted much attention. Gold nanoparticles (AuNPs), epigallocatechin gallate (EGCG), and α-lipoic acid (ALA) were shown to have antioxidative effects and could be helpful in wound healing. Their effects in Hs68 and HaCaT cell proliferation and in mouse cutaneous wound healing were studied. Both the mixture of EGCG + ALA (EA) and AuNPs + EGCG + ALA (AuEA) significantly increased Hs68 and HaCaT proliferation and migration. Topical AuEA application accelerated wound healing on mouse skin. Immunoblotting of wound tissue showed significant increase of vascular endothelial cell growth factor and angiopoietin-1 protein expression, but no change of angiopoietin-2 or CD31 after 7 days. After AuEA treatment, CD68 protein expression decreased and Cu/Zn superoxide dismutase increased significantly in the wound area. In conclusion, AuEA significantly accelerated mouse cutaneous wound healing through anti-inflammatory and antioxidation effects. This study may support future studies using other antioxidant agents in the treatment of cutaneous wounds. In this study, topically applied gold nanoparticles with epigallocatechin gallate and alpha-lipoic acid were studied regarding their effects in wound healing in cell cultures. Significant acceleration was demonstrated in wound healing in a murine model. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. The Protective Effect of Lipoic Acid on Selected Cardiovascular Diseases Caused by Age-Related Oxidative Stress

    PubMed Central

    Goraca, Anna

    2015-01-01

    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system. PMID:25949771

  15. Combining ligand design and photo-ligation to provide optimal quantum dot-bioconjugates for sensing and imaging

    NASA Astrophysics Data System (ADS)

    Zhan, Naiqian; Palui, Goutam; Safi, Malak; Mattoussi, Hedi

    2014-03-01

    We describe the design and synthesis of two metal-coordinating zwitterion ligands to promote the transfer of hydrophobic QDs to buffer media over broad range of conditions. The ligands are prepared by appending either one or two lipoic acid anchoring groups onto a zwitterion, LA-TEG200-ZW and bis(LA)- ZW. Combining these ligands with a photochemical reduction of the lipoic acid group in the presence of UV irradiation, provides an easy to implement method to transfer luminescent QDs to buffer media, while preserving their optical and spectroscopic properties intact. The resulting zwitterion-QDs have very thin capping shell, which allows their self-assembly with full size proteins via metal-to-histidine coordination. These conjugates have great potential for use in various bio-motivated applications.

  16. Synthesis and tribological investigation of lipoyl glycerides

    USDA-ARS?s Scientific Manuscript database

    Lipoyl glycerides (LG) were synthesized by enzymatic transesterification of lipoic acid (LA) with high oleic sunflower oil (HOSuO) in 2-methyl-2-butanol solvent. The synthesis gave a crude product mixture (LGc) comprising unreacted LA, free fatty acids (FFA), and various LG structures with varying d...

  17. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway

    PubMed Central

    2016-01-01

    SUMMARY Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  18. Efficacy of epalrestat plus α-lipoic acid combination therapy versus monotherapy in patients with diabetic peripheral neuropathy: a meta-analysis of 20 randomized controlled trials.

    PubMed

    Zhao, Ming; Chen, Jia-Yi; Chu, Yu-Dong; Zhu, Ya-Bin; Luo, Lin; Bu, Shi-Zhong

    2018-06-01

    To evaluate the efficacy of α-lipoic acid (ALA) plus epalrestat combination therapy in the treatment of diabetic peripheral neuropathy (DPN). The electronic databases of PubMed, Medline, Embase, the Cochrane Library, the Chinese National Knowledge Infrastructure, the Wanfang Database and the Chinese Biomedical Database were used to retrieve relevant studies without language restrictions. The search was conducted from the inception of each database to 7 October 2016. The key terms were (diabetic peripheral neuropathy or diabetic neuropathy or DPN) AND (α-lipoic acid or lipoic acid or thioctic acid) AND epalrestat. All of the eligible studies met the following inclusion criteria: (1) Randomized controlled trials that compared efficacy and safety of epalrestat plus ALA combination therapy versus epalrestat or ALA monotherapy in patients with DPN. (2) The minimum duration of treatment was 2 weeks. (3) The DPN patients were diagnosed using the World Health Organization standardized type 2 diabetes mellitus and DPN criteria. (4) Studies contained at least one measure that could reflect the efficacy of the drug and nerve conduction velocities. Studies in which the control group used epalrestat or ALA combined with other drugs were excluded. Statistical analyses were performed using STATA software for meta-analysis. The primary outcomes were the therapeutic efficacy, median motor nerve conduction velocity (MNCV), median sensory nerve conduction velocity (SNCV), peroneal MNCV and peroneal SNCV. Twenty studies with 1894 DPN patients were included, including 864 patients in the ALA plus epalrestat group, 473 in the ALA group and 557 in the epalrestat group. The efficacy of ALA plus epalrestat combination therapy was superior to ALA and epalrestat monotherapies (RR = 1.29, 95% CI: 1.21-1.38; RR = 1.43, 95% CI: 1.34-1.54, respectively). ALA plus epalrestat combination therapy also significantly improved median MNCV (WMD = 5.41, 95% CI: 2.07-8.75), median SNCV (WMD = 5.87, 95% CI: 1.52-10.22), peroneal MNCV (WMD = 5.59, 95% CI: 2.70-8.47) and peroneal SNCV (WMD = 4.57, 95% CI: 2.46-6.68). : ALA plus epalrestat combination therapy was superior to ALA and epalrestat monotherapies for clinical efficacy and nerve conduction velocities in patients with DPN.

  19. Roles of Fe-S proteins: from cofactor synthesis to iron homeostasis to protein synthesis.

    PubMed

    Pain, Debkumar; Dancis, Andrew

    2016-06-01

    Fe-S cluster assembly is an essential process for all cells. Impairment of Fe-S cluster assembly creates diseases in diverse and surprising ways. In one scenario, the loss of function of lipoic acid synthase, an enzyme with Fe-S cluster cofactor in mitochondria, impairs activity of various lipoamide-dependent enzymes with drastic consequences for metabolism. In a second scenario, the heme biosynthetic pathway in red cell precursors is specifically targeted, and iron homeostasis is perturbed, but lipoic acid synthesis is unaffected. In a third scenario, tRNA modifications arising from action of the cysteine desulfurase and/or Fe-S cluster proteins are lost, which may lead to impaired protein synthesis. These defects can then result in cancer, neurologic dysfunction or type 2 diabetes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Inhibitory Effect of Natural Anti-Inflammatory Compounds on Cytokines Released by Chronic Venous Disease Patient-Derived Endothelial Cells

    PubMed Central

    Tisato, Veronica; Zauli, Giorgio; Rimondi, Erika; Gianesini, Sergio; Brunelli, Laura; Menegatti, Erica; Zamboni, Paolo; Secchiero, Paola

    2013-01-01

    Large vein endothelium plays important roles in clinical diseases such as chronic venous disease (CVD) and thrombosis; thus to characterize CVD vein endothelial cells (VEC) has a strategic role in identifying specific therapeutic targets. On these bases we evaluated the effect of the natural anti-inflammatory compounds α-Lipoic acid and Ginkgoselect phytosome on cytokines/chemokines released by CVD patient-derived VEC. For this purpose, we characterized the levels of a panel of cytokines/chemokines (n = 31) in CVD patients' plasma compared to healthy controls and their release by VEC purified from the same patients, in unstimulated and TNF-α stimulated conditions. Among the cytokines/chemokines released by VEC, which recapitulated the systemic profile (IL-8, TNF-α, GM-CSF, INF-α2, G-CSF, MIP-1β, VEGF, EGF, Eotaxin, MCP-1, CXCL10, PDGF, and RANTES), we identified those targeted by ex vivo treatment with α-Lipoic acid and/or Ginkgoselect phytosome (GM-CSF, G-CSF, CXCL10, PDGF, and RANTES). Finally, by investigating the intracellular pathways involved in promoting the VEC release of cytokines/chemokines, which are targeted by natural anti-inflammatory compounds, we documented that α-Lipoic acid significantly counteracted TNF-α-induced NF-κB and p38/MAPK activation while the effects of Ginkgo biloba appeared to be predominantly mediated by Akt. Our data provide new insights into the molecular mechanisms of CVD pathogenesis, highlighting new potential therapeutic targets. PMID:24489443

  1. Chemopreventive Effects of Alpha Lipoic Acid on Obesity-Related Cancers.

    PubMed

    Moon, Hyun-Seuk

    2016-01-01

    It has been generally accepted that being overweight or obese is a risk factor for several types of cancers, including breast, thyroid, colon, pancreatic and liver. In fact, people who are obese have more fat tissues that can produce hormones, such as insulin or estrogen, which may cause cancer cells to grow. Alpha lipoic acid (ALA) is anorganosulfur compound derived from octanoic acid, which is produced in animals normally, and is essential for aerobic metabolism. Studies in both in vitro cells and in vivo animal models have shown that ALA inhibits the initiation and promotion stages of carcinogenesis, suggesting that ALA has considerable attention as a chemopreventive agent. This brief review collects the scattered data available in the literature concerning ALA and highlights its anti-cancer properties, intermediary metabolism and exploratory implications. Based on scientific evidences so far, ALA might be useful agents in the management or chemoprevention of obesity-related cancers. © 2016 S. Karger AG, Basel.

  2. Site-specific protein labeling with PRIME and chelation-assisted Click chemistry

    PubMed Central

    Uttamapinant, Chayasith; Sanchez, Mateo I.; Liu, Daniel S.; Yao, Jennifer Z.; White, Katharine A.; Grecian, Scott; Clarke, Scott; Gee, Kyle R.; Ting, Alice Y.

    2016-01-01

    This protocol describes an efficient method to site-specifically label cell-surface or purified proteins with chemical probes in two steps: PRobe Incorporation Mediated by Enzymes (PRIME) followed by chelation-assisted copper-catalyzed azide-alkyne cycloaddition (CuAAC). In the PRIME step, Escherichia coli lipoic acid ligase site-specifically attaches a picolyl azide derivative to a 13-amino acid recognition sequence that has been genetically fused onto the protein of interest. Proteins bearing picolyl azide are chemoselectively derivatized with an alkyne-probe conjugate by chelation-assisted CuAAC in the second step. We describe herein the optimized protocols to synthesize picolyl azide, perform PRIME labeling, and achieve CuAAC derivatization of picolyl azide on live cells, fixed cells, and purified proteins. Reagent preparations, including synthesis of picolyl azide probes and expression of lipoic acid ligase, take 12 d, while the procedure to perform site-specific picolyl azide ligation and CuAAC on cells or on purified proteins takes 40 min-3 h. PMID:23887180

  3. Bioavailability of an R-α-Lipoic Acid/γ-Cyclodextrin Complex in Healthy Volunteers

    PubMed Central

    Ikuta, Naoko; Okamoto, Hinako; Furune, Takahiro; Uekaji, Yukiko; Terao, Keiji; Uchida, Ryota; Iwamoto, Kosuke; Miyajima, Atsushi; Hirota, Takashi; Sakamoto, Norihiro

    2016-01-01

    R-α-lipoic acid (R-LA) is a cofactor of mitochondrial enzymes and a very strong antioxidant. R-LA is available as a functional food ingredient but is unstable against heat or acid. Stabilized R-LA was prepared through complexation with γ-cyclodextrin (CD), yielding R-LA/CD. R-LA/CD was orally administered to six healthy volunteers and showed higher plasma levels with an area under the plasma concentration-time curve that was 2.5 times higher than that after oral administration of non-complexed R-LA, although the time to reach the maximum plasma concentration and half-life did not differ. Furthermore, the plasma glucose level after a single oral administration of R-LA/CD or R-LA was not affected and no side effects were observed. These results indicate that R-LA/CD could be easily absorbed in the intestine. In conclusion, γ-CD complexation is a promising technology for delivering functional but unstable ingredients like R-LA. PMID:27314343

  4. Analysis of the Enhanced Stability of R(+)-Alpha Lipoic Acid by the Complex Formation with Cyclodextrins

    PubMed Central

    Ikuta, Naoko; Sugiyama, Hironori; Shimosegawa, Hiroshi; Nakane, Rie; Ishida, Yoshiyuki; Uekaji, Yukiko; Nakata, Daisuke; Pallauf, Kathrin; Rimbach, Gerald; Terao, Keiji; Matsugo, Seiichi

    2013-01-01

    R(+)-alpha lipoic acid (RALA) is one of the cofactors for mitochondrial enzymes and, therefore, plays a central role in energy metabolism. RALA is unstable when exposed to low pH or heat, and therefore, it is difficult to use enantiopure RALA as a pharma- and nutra-ceutical. In this study, we have aimed to stabilize RALA through complex formation with cyclodextrins (CDs). α-CD, β-CD and γ-CD were used for the formation of these RALA-CD complexes. We confirmed the complex formation using differential scanning calorimetry and showed by using HPLC analysis that complexed RALA is more stable than free RALA when subjected to humidity and high temperature or acidic pH conditions. Scanning electron microscopy studies showed that the particle size and shape differed depending on the cyclodextrin used for complexation. Further, the complexes of CD and RALA showed a different particle size distribution pattern compared with that of CD itself or that of the physical mixture of RALA and CD. PMID:23434662

  5. Alpha-lipoic acid: molecular mechanisms and therapeutic potential in diabetes.

    PubMed

    Rochette, Luc; Ghibu, Steliana; Muresan, Adriana; Vergely, Catherine

    2015-12-01

    Diabetes is a chronic metabolic disease with a high prevalence worldwide. Diabetes and insulin resistance are associated with the development of cardiovascular and nervous diseases. The development of these disorders reflects complex pathological processes in which the oxidative stress caused by reactive oxygen species (ROS) and reactive nitrogen species (RNS) plays a pivotal role. It is widely accepted that diabetes impairs endothelial nitric oxide synthase (eNOS) activity and increases the production of ROS, thus resulting in diminished NO bioavailability and increased oxidative stress. Alpha-lipoic acid (LA) possesses beneficial effects both in the prevention and in the treatment of diabetes. LA is a potent antioxidant with insulin-mimetic and anti-inflammatory activity. LA in the diet is quickly absorbed, transported to the intracellular compartments, and reduced to dihydrolipoic acid (DHLA) under the action of enzymes. LA, which plays an essential role in mitochondrial bioenergetic reactions, has drawn considerable attention as an antioxidant for use in managing diabetic complications such as retinopathy, neuropathy and other vascular diseases.

  6. Selective deposition of dietary α-Lipoic acid in mitochondrial fraction and its synergistic effect with α-Tocoperhol acetate on broiler meat oxidative stability

    PubMed Central

    2013-01-01

    The use of bioactive antioxidants in feed of broiler to mitigate reactive oxygen species (ROS) in biological systems is one of promising nutritional strategies. The aim of present study was to alleviate ROS production in mitochondrial fraction (MF) of meat by supplemented dietary antioxidant in feed of broiler. For this purpose, mitochondria specific antioxidant: α-lipoic acid (25 mg, 75 mg and 150 mg) with or without combination of α-tocopherol acetate (200 mg) used in normal and palm olein oxidized oil (4%) supplemented feed. One hundred and eighty one day old broiler birds were randomly divided into six treatments and provided the mentioned feed from third week. Feed intake, feed conversion ratio (FCR) remained statistically same in all groups while body weight decreased in supplemented groups accordingly at the end of study. The broiler meat MF antioxidant potential was significantly improved by feeding supplemented feed estimated as 1,1-di phenyl-2-picrylhydrazyl (DPPH) free radical scavenging activity, 2,2-azinobis-(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS+) and thiobarbituric acid reactive substances (TBARS). The maximum antioxidant activity was depicted in group fed on 150 mg/kg α-lipoic acid (ALA) and 200 mg/kg α-tocopherol acetate (ATA) (T4) in both breast and leg MF. Moreover, TBARS were higher in leg as compared to breast MF. Although, oxidized oil containing feed reduced the growth, lipid stability and antioxidant potential of MF whilst these traits were improved by receiving feed containing ALA and ATA. ALA and ATA showed higher deposition in T4 group while least in group received oxidized oil containing feed (T5). Positive correlation exists between DPPH free radical scavenging activity and the ABTS + reducing activity. In conclusion, ALA and ATA supplementation in feed had positive effect on antioxidant status of MF that consequently diminished the oxidative stress in polyunsaturated fatty acid enriched meat. PMID:23617815

  7. Comparative genomic analysis reveals 2-oxoacid dehydrogenase complex lipoylation correlation with aerobiosis in archaea.

    PubMed

    Borziak, Kirill; Posner, Mareike G; Upadhyay, Abhishek; Danson, Michael J; Bagby, Stefan; Dorus, Steve

    2014-01-01

    Metagenomic analyses have advanced our understanding of ecological microbial diversity, but to what extent can metagenomic data be used to predict the metabolic capacity of difficult-to-study organisms and their abiotic environmental interactions? We tackle this question, using a comparative genomic approach, by considering the molecular basis of aerobiosis within archaea. Lipoylation, the covalent attachment of lipoic acid to 2-oxoacid dehydrogenase multienzyme complexes (OADHCs), is essential for metabolism in aerobic bacteria and eukarya. Lipoylation is catalysed either by lipoate protein ligase (LplA), which in archaea is typically encoded by two genes (LplA-N and LplA-C), or by a lipoyl(octanoyl) transferase (LipB or LipM) plus a lipoic acid synthetase (LipA). Does the genomic presence of lipoylation and OADHC genes across archaea from diverse habitats correlate with aerobiosis? First, analyses of 11,826 biotin protein ligase (BPL)-LplA-LipB transferase family members and 147 archaeal genomes identified 85 species with lipoylation capabilities and provided support for multiple ancestral acquisitions of lipoylation pathways during archaeal evolution. Second, with the exception of the Sulfolobales order, the majority of species possessing lipoylation systems exclusively retain LplA, or either LipB or LipM, consistent with archaeal genome streamlining. Third, obligate anaerobic archaea display widespread loss of lipoylation and OADHC genes. Conversely, a high level of correspondence is observed between aerobiosis and the presence of LplA/LipB/LipM, LipA and OADHC E2, consistent with the role of lipoylation in aerobic metabolism. This correspondence between OADHC lipoylation capacity and aerobiosis indicates that genomic pathway profiling in archaea is informative and that well characterized pathways may be predictive in relation to abiotic conditions in difficult-to-study extremophiles. Given the highly variable retention of gene repertoires across the archaea, the extension of comparative genomic pathway profiling to broader metabolic and homeostasis networks should be useful in revealing characteristics from metagenomic datasets related to adaptations to diverse environments.

  8. α-Lipoic Acid Protects Diabetic Apolipoprotien E-deficient Mice from Nephropathy

    PubMed Central

    Yi, Xianwen; Nickeleit, Volker; James, Leighton R; Maeda, Nobuyo

    2010-01-01

    Aim Both hyperglycemia and hyperlipidemia increase oxidative stress, and contribute to the development of diabetic nephropathy (DN). We investigated effects of α-lipoic acid, a natural antioxidant and a cofactor in the multienzyme complexes, on the development of DN in diabetic apolipoprotein E-deficient mice. Methods Twelve-weeks-old male apoE−/− mice on C57BL/6J genetic background were made diabetic with injections of streptozotocin (STZ). STZ-treated diabetic apoE−/− mice and non-diabetic control were fed with a synthetic high fat (HF) diet with or without LA supplementation. Multiple parameters including plasma glucose, cholesterol, oxidative stress markers, cytokines, and kidney cortex gene expression, and glomerular morphology were evaluated. Results LA supplementation markedly protected the beta cells and reduced cholesterol levels, attenuated albuminuria and glomerular mesangial expansion in the diabetic mice. Reno-protection by LA was equally effective regardless of whether the dietary supplementation was started 4 weeks before, simultaneously with, or 4 weeks after the induction of diabetes by STZ. LA supplementation significantly improved DN and oxidative stress in the diabetic mice. Severity of albuminuria was positively correlated with level of thiobarbituric acid reactive substances (TBARs) in the kidney (r2=0.62, P<0.05). Diabetes significantly changed the kidney expression of Rage, Sod2, Tgfb1 and Ctgf, Pdp2, nephrin and Lias. LA supplementation corrected these changes except that it further suppressed the expression of the Lias gene coding for lipoic acid synthase. Conclusions Our data indicate that LA supplementation effectively attenuates the development and progression of DN through its antioxidant effect as well as enhancing glucose oxidation. PMID:20801062

  9. Electrophile-modified lipoic derivatives of PDC-E2 elicits anti-mitochondrial antibody reactivity.

    PubMed

    Naiyanetr, Phornnop; Butler, Jeffrey D; Meng, Liping; Pfeiff, Janice; Kenny, Thomas P; Guggenheim, Kathryn G; Reiger, Roman; Lam, Kit; Kurth, Mark J; Ansari, Aftab A; Coppel, Ross L; López-Hoyos, Marcos; Gershwin, M Eric; Leung, Patrick S C

    2011-11-01

    Our laboratory has hypothesized that xenobiotic modification of the native lipoyl moiety of the major mitochondrial autoantigen, the E2 subunit of the pyruvate dehydrogenase complex (PDC-E2), may lead to loss of self-tolerance in primary biliary cirrhosis (PBC). This thesis is based on the finding of readily detectable levels of immunoreactivity of PBC sera against extensive panels of protein microarrays containing mimics of the inner lipoyl domain of PDC-E2 and subsequent quantitative structure-activity relationships (QSARs). Importantly, we have demonstrated that murine immunization with one such mimic, 2-octynoic acid coupled to bovine serum albumin (BSA), induces anti-mitochondrial antibodies (AMAs) and cholangitis. Based upon these data, we have focused on covalent modifications of the lipoic acid disulfide ring and subsequent analysis of such xenobiotics coupled to a 15mer of PDC-E2 for immunoreactivity against a broad panel of sera from patients with PBC and controls. Our results demonstrate that AMA-positive PBC sera demonstrate marked reactivity against 6,8-bis(acetylthio)octanoic acid, implying that chemical modification of the lipoyl ring, i.e. disruption of the S-S disulfide, renders lipoic acid to its reduced form that will promote xenobiotic modification. This observation is particularly significant in light of the function of the lipoyl moiety in electron transport of which the catalytic disulfide constantly opens and closes and, thus, raises the intriguing thesis that common electrophilic agents, i.e. acetaminophen or non-steroidal anti-inflammatory drugs (NSAIDs), may lead to xenobiotic modification in genetically susceptible individuals that results in the generation of AMAs and ultimately clinical PBC. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Radiation-induced cyclooxygenase 2 up-regulation is dependent on redox status in prostate cancer cells.

    PubMed

    Li, Lingyun; Steinauer, Kirsten K; Dirks, Amie J; Husbeck, Bryan; Gibbs, Iris; Knox, Susan J

    2003-12-01

    Cyclooxygenase 2 (COX2) is the inducible isozyme of COX, a key enzyme in arachidonate metabolism and the conversion of arachidonic acid (AA) to prostaglandins (PGs) and other eicosanoids. Previous studies have demonstrated that the COX2 protein is up-regulated in prostate cancer cells after irradiation and that this results in elevated levels of PGE(2). In the present study, we further investigated whether radiation-induced COX2 up-regulation is dependent on the redox status of cells from the prostate cancer cell line PC-3. l-Buthionine sulfoximine (BSO), which inhibits gamma glutamyl cysteine synthetase (gammaGCS), and the antioxidants alpha-lipoic acid and N-acetyl-l-cysteine (NAC) were used to modulate the cellular redox status. BSO decreased the cellular GSH level and increased cellular reactive oxygen species (ROS) in PC-3 cells, whereas alpha-lipoic acid and NAC increased the GSH level and decreased cellular ROS. Both radiation and the oxidant H(2)O(2) had similar effects on COX2 up-regulation and PGE(2) production in PC-3 cells, suggesting that radiation-induced COX2 up-regulation is secondary to the production of ROS. The relative increases in COX2 expression and PGE(2) production induced by radiation and H(2)O(2) were even greater when PC-3 cells were pretreated with BSO. When the cells were pretreated with alpha-lipoic acid or NAC for 24 h, both radiation- and H(2)O(2)-induced COX2 up-regulation and PGE(2) production were markedly inhibited. These results demonstrate that radiation-induced COX2 up-regulation in prostate cancer cells is modulated by the cellular redox status. Radiation-induced increases in ROS levels contribute to the adaptive response of PC-3 cells, resulting in elevated levels of COX2.

  11. Nanobiophotonics for molecular imaging of cancer: Au- and Ag-based Epidermal Growth Factor receptor (EGFR) specific nanoprobes

    NASA Astrophysics Data System (ADS)

    Lucas, Leanne J.; Hewitt, Kevin C.

    2012-03-01

    Our aim is to create and validate a novel SERS-based nanoprobe for optical imaging of the epidermal growth factor receptor (EGFR). Gold and silver nanoparticles (Au/AgNPs) of various sizes were synthesized and coupled to epidermal growth factor (EGF) via a short ligand, α-lipoic acid (206 g/mol), which binds strongly to both Au and Ag nanoparticles via its disulfide end group. We used carbodiimide chemistry to couple EGF to α-lipoic acid. These nanoprobes were tested for binding affinity using Enzyme Linked ImmunoSorbent Assay (ELISA) and, in-vitro, using EGFRoverexpressing A431 cells. The nanoprobes show excellent EGFR-specific binding. Time of Flight Mass Spectrometry demonstrate the carbodiimide based linking of the carboxylic acid end-group of α-lipoic acid to one or more of the three (terminal, or 2 lysine) amine groups on EGF. ELISA confirms that the linked EGF is active by itself, and following conjugation with gold or silver nanoparticles. Compared with bare nanoparticles, UV-Vis spectroscopy of Ag-based nanoprobes exhibit significant plasmon red-shift, while there was no discernable shift for Au-based ones. Dark field microscopy shows abundant uptake by EGFR overexpressing A431 cells, and serves to further confirm the excellent binding affinity. Nanoprobe internalization and consequent aggregation is thought to be the basis of enhanced light scattering in the dark field images, supporting the notion that these nanoprobes should provide excellent SERS signals at all nanoprobe sizes. In summary, novel EGFR-specific nanoprobes have been synthesized and validated by standard assay and in cell culture for use as SERS optical imaging probes.

  12. Studying anti-oxidative properties of inclusion complexes of α-lipoic acid with γ-cyclodextrin in single living fission yeast by confocal Raman microspectroscopy

    NASA Astrophysics Data System (ADS)

    Noothalapati, Hemanth; Ikarashi, Ryo; Iwasaki, Keita; Nishida, Tatsuro; Kaino, Tomohiro; Yoshikiyo, Keisuke; Terao, Keiji; Nakata, Daisuke; Ikuta, Naoko; Ando, Masahiro; Hamaguchi, Hiro-o.; Kawamukai, Makoto; Yamamoto, Tatsuyuki

    2018-05-01

    α-lipoic acid (ALA) is an essential cofactor for many enzyme complexes in aerobic metabolism, especially in mitochondria of eukaryotic cells where respiration takes place. It also has excellent anti-oxidative properties. The acid has two stereo-isomers, R- and S- lipoic acid (R-LA and S-LA), but only the R-LA has biological significance and is exclusively produced in our body. A mutant strain of fission yeast, Δdps1, cannot synthesize coenzyme Q10, which is essential during yeast respiration, leading to oxidative stress. Therefore, it shows growth delay in the minimal medium. We studied anti-oxidant properties of ALA in its free form and their inclusion complexes with γ-cyclodextrin using this mutant yeast model. Both free forms R- and S-LA as well as 1:1 inclusion complexes with γ-cyclodextrin recovered growth of Δdps1 depending on the concentration and form. However, it has no effect on the growth of wild type fission yeast strain at all. Raman microspectroscopy was employed to understand the anti-oxidant property at the molecular level. A sensitive Raman band at 1602 cm-1 was monitored with and without addition of ALAs. It was found that 0.5 mM and 1.0 mM concentrations of ALAs had similar effect in both free and inclusion forms. At 2.5 mM ALAs, free forms inhibited the growth while inclusion complexes helped in recovered. 5.0 mM ALA showed inhibitory effect irrespective of form. Our results suggest that the Raman band at 1602 cm-1 is a good measure of oxidative stress in fission yeast.

  13. In Situ Dechlorination of Solvents in Saturated Soils

    DTIC Science & Technology

    1996-05-01

    riboflavin 0.025 nicotinic acid 0.025 DL-calcium pantothenate 0.025 vitamin B12 0.025 p-aminobenzoic acid 0.025 lipoic acid 0.025 yeast extract...contaminated core materials collected from the Coast Guard Air Station in Traverse City, MI. Four fatty acids and three alcohols were tested for their...EXTRACT CONCENTRATIONS Vitamin/Yeast Extract Concentration (mg/L) d-biotin 0.01 folic acid 0.01 pyridoxine hydrochloride 0.05 thiamin hydrochloride 0.025

  14. Conformational stability and thermodynamic characterization of the lipoic acid bearing domain of human mitochondrial branched chain α-ketoacid dehydrogenase

    PubMed Central

    Naik, Mandar T.; Huang, Tai-Huang

    2004-01-01

    The lipoic acid bearing domain (hbLBD) of human mitochondrial branched chain α-ketoacid dehydrogenase (BCKD) plays important role of substrate channeling in oxidative decarboxylation of the branched chain α-ketoacids. Recently hbLBD has been found to follow two-step folding mechanism without detectable presence of stable or kinetic intermediates. The present study describes the conformational stability underlying the folding of this small β-barrel domain. Thermal denaturation in presence of urea and isothermal urea denaturation titrations are used to evaluate various thermodynamic parameters defining the equilibrium unfolding. The linear extrapolation model successfully describes the two-step; native state ↔denatured state unfolding transition of hbLBD. The average temperature of maximum stability of hbLBD is estimated as 295.6 ± 0.9 K. Cold denaturation of hbLBD is also predicted and discussed. PMID:15322287

  15. A comparative assessment of α-lipoic acid N-phenylamides as non-steroidal androgen receptor antagonists both on and off gold nanoparticles.

    PubMed

    Henderson, Luke C; Altimari, Jarrad M; Dyson, Gail; Servinis, Linden; Niranjan, Birunthi; Risbridger, Gail P

    2012-02-01

    A group of α-lipoic acid N-phenylamides were synthesized employing a variety of amide coupling protocols utilizing electron deficient anilines. These compounds were then assessed for their ability to block androgen-stimulated proliferation of a human prostate cancer cell line, LNCaP. These structurally simple compounds displayed anti-proliferative activities at, typically, 5-20 μM concentrations and were comparable to a commonly used anti-androgen Bicalutamide®. The inclusion of a disulfide (RS-SR) moiety, serving as an anchor to several metal nanoparticle systems (Au, Ag, Fe(2)O(3), etc.), does not impede any biological activity. Conjugation of these compounds to a gold nanoparticle surface resulted in a high degree of cellular toxicity, attributed to the absence of a biocompatible group such as PEG within the organic scaffold. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. The potent free radical scavenger alpha-lipoic acid improves memory in aged mice: putative relationship to NMDA receptor deficits.

    PubMed

    Stoll, S; Hartmann, H; Cohen, S A; Müller, W E

    1993-12-01

    alpha-Lipoic acid (alpha-LA) improved longer-term memory of aged female NMRI mice in the habituation in the open field test at a dose of 100 mg/kg body weight for 15 days. In a separate experiment, no such effect could be found for young mice. alpha-LA alleviated age-related NMDA receptor deficits (Bmax) without changing muscarinic, benzodiazepine, and alpha 2-adrenergic receptor deficits in aged mice. The carbachol-stimulated accumulation of inositol monophosphates was not changed by the treatment with alpha-LA. These results give tentative support to the hypothesis that alpha-LA improves memory in aged mice, probably by a partial compensation of NMDA receptor deficits. Possible modes of action of alpha-LA based on its free radical scavenger properties are discussed in relation to the membrane hypothesis of aging.

  17. Least median of squares and iteratively re-weighted least squares as robust linear regression methods for fluorimetric determination of α-lipoic acid in capsules in ideal and non-ideal cases of linearity.

    PubMed

    Korany, Mohamed A; Gazy, Azza A; Khamis, Essam F; Ragab, Marwa A A; Kamal, Miranda F

    2018-06-01

    This study outlines two robust regression approaches, namely least median of squares (LMS) and iteratively re-weighted least squares (IRLS) to investigate their application in instrument analysis of nutraceuticals (that is, fluorescence quenching of merbromin reagent upon lipoic acid addition). These robust regression methods were used to calculate calibration data from the fluorescence quenching reaction (∆F and F-ratio) under ideal or non-ideal linearity conditions. For each condition, data were treated using three regression fittings: Ordinary Least Squares (OLS), LMS and IRLS. Assessment of linearity, limits of detection (LOD) and quantitation (LOQ), accuracy and precision were carefully studied for each condition. LMS and IRLS regression line fittings showed significant improvement in correlation coefficients and all regression parameters for both methods and both conditions. In the ideal linearity condition, the intercept and slope changed insignificantly, but a dramatic change was observed for the non-ideal condition and linearity intercept. Under both linearity conditions, LOD and LOQ values after the robust regression line fitting of data were lower than those obtained before data treatment. The results obtained after statistical treatment indicated that the linearity ranges for drug determination could be expanded to lower limits of quantitation by enhancing the regression equation parameters after data treatment. Analysis results for lipoic acid in capsules, using both fluorimetric methods, treated by parametric OLS and after treatment by robust LMS and IRLS were compared for both linearity conditions. Copyright © 2018 John Wiley & Sons, Ltd.

  18. The Physiological and Molecular Characterization of a Small Colony Variant of Escherichia coli and Its Phenotypic Rescue

    PubMed Central

    Hirshfield, Irvin

    2016-01-01

    Small colony variants (SCVs) can be defined as a naturally occurring sub-population of bacteria characterized by their reduced colony size and distinct biochemical properties. SCVs of Staphylococcus aureus have been studied extensively over the past two decades due to their role in recurrent human infections. However, little work has been done on SCVs of Escherichia coli, and this work has focused on the physiology and morphology that define these colonies of E. coli, such as small size and slow growth. E. coli strain JW0623, has a null lipA mutation in the lipoic acid synthase gene (lipA), and is a lipoic acid auxotroph. When the mutant was grown in LB medium to log phase, it showed remarkable resistance to acid (pH 3), hydrogen peroxide, heat and osmotic stress compared to its parent BW25113. Using RT-PCR and real time RT-PCR, the expression of certain genes was compared in the two strains in an attempt to create a molecular profile of Escherichia coli SCVs. These include genes involved in glycolysis, TCA cycle, electron transport, iron acquisition, biofilm formation and cyclopropane fatty acid synthesis. It was also demonstrated that the addition of 5 μg/ml of lipoic acid to LB medium allows for the phenotypic rescue of the mutant; reversing its slow growth, its resistance characteristics, and elevated gene expression. These results indicate that the mutation in lipA leads to an E. coli SCV that resembles an electron transport defective SCV of S. aureus These strains are typically auxotrophs, and are phenotypically rescued by adding the missing metabolite to rich medium. There are global shifts in gene expression which are reversible and depend on whether the auxotrophic molecule is absent or present. Looking at the E. coli SCV from an evolutionary point of view, it becomes evident that its path to survival is to express genes that confer stress resistance. PMID:27310825

  19. Effects of Alpha-Lipoic Acid Supplementation on Plasma Adiponectin Levels and Some Metabolic Risk Factors in Patients with Schizophrenia.

    PubMed

    Vidović, Bojana; Milovanović, Srđan; Stefanović, Aleksandra; Kotur-Stevuljević, Jelena; Takić, Marija; Debeljak-Martačić, Jasmina; Pantović, Maja; Đorđević, Brižita

    2017-01-01

    Adiponectin is an adipocyte-derived plasma protein with insulin-sensitizing and anti-inflammatory properties and is suggested to be a biomarker of metabolic disturbances. The aim of this study was to investigate the effects of alpha-lipoic acid (ALA) on plasma adiponectin and some metabolic risk factors in patients with schizophrenia. The plasma adipokine levels (adiponectin and leptin), routine biochemical and anthropometric parameters, markers of oxidative stress, and the serum phospholipid fatty acid profile in eighteen schizophrenic patients at baseline, in the middle, and at the end of a 3-month long supplementation period with ALA (500 mg daily) were determined. A significant increase in the plasma adiponectin concentrations, as well as a decrease in fasting glucose and aspartate aminotransferase activity (AST), was found. Baseline AST activity was independently correlated with the adiponectin concentrations. Our data show that ALA can improve plasma adiponectin levels and may play a potential role in the treatment of metabolic risk factor in patients with schizophrenia. Future randomized controlled trials are needed to confirm these preliminary investigations.

  20. Hypoglycemic Effect of Lipoic Acid, Carnitine and Nigella Sativa in Diabetic Rat Model

    PubMed Central

    Salama, Ragaa Hamdy Mohamed

    2011-01-01

    Objectives Evaluation of therapeutic potentials of α-lipoic acid (α-LA), L-carnitine, Nigella sativa (N. sativa) or combination of them in carbohydrate and lipid metabolism of DM type I. Methods Rat model of diabetes was induced by single i.p injection of Streptozocin (STZ) 65 mg/kg. The rats were randomly assigned to 6 groups (G): healthy reference (HR), diabetic (DM), DM treated with α-lipoic acid, DM treated with L-carnitine, DM treated with N. sativa, and DM treated with combination of the 3 compounds. After 30 days from onset of diabetes, serum and tissue homogenate were obtained for evaluation of glucose metabolism as fasting blood glucose, insulin, insulin sensitivity, HOMA, C-peptide, and pyruvate dehydrogenase (PDH) activity. For lipid metabolism evaluation, total cholesterol and triacylglycerol (TG) were determined. Markers of antioxidants and oxidative status as total antioxidant capacity (TAC), glutathione-S-transeferase (GST), 8-hydroxy-2-deoxyguanosine (8-OH-dG) were measured. Results Either α-LA or N. sativa significantly reduced the elevated blood glucose level. The combination of 3 compounds significantly increased the level of insulin and C-peptide. Also, increased the antioxidant activity measured by TAC and decreased the oxidative damage of DNA as measured by 8-OH-dG. HOMA- β increased in G3 and G6 compared to G2. However, the decrease in TG, and total cholesterol levels were non-significant in all groups. Conclusion Combination of α-LA, L-carnitine and N. sativa will contribute significantly in improvement of the carbohydrate metabolism and to less extent lipid metabolism in diabetic rats, thus increasing the rate of success in management of DM. Also, this combination will have implications in clinical studies and clinical applications. PMID:23267290

  1. Hypoglycemic effect of lipoic Acid, carnitine and nigella sativa in diabetic rat model.

    PubMed

    Salama, Ragaa Hamdy Mohamed

    2011-07-01

    Evaluation of therapeutic potentials of α-lipoic acid (α-LA), L-carnitine, Nigella sativa (N. sativa) or combination of them in carbohydrate and lipid metabolism of DM type I. Rat model of diabetes was induced by single i.p injection of Streptozocin (STZ) 65 mg/kg. The rats were randomly assigned to 6 groups (G): healthy reference (HR), diabetic (DM), DM treated with α-lipoic acid, DM treated with L-carnitine, DM treated with N. sativa, and DM treated with combination of the 3 compounds. After 30 days from onset of diabetes, serum and tissue homogenate were obtained for evaluation of glucose metabolism as fasting blood glucose, insulin, insulin sensitivity, HOMA, C-peptide, and pyruvate dehydrogenase (PDH) activity. For lipid metabolism evaluation, total cholesterol and triacylglycerol (TG) were determined. Markers of antioxidants and oxidative status as total antioxidant capacity (TAC), glutathione-S-transeferase (GST), 8-hydroxy-2-deoxyguanosine (8-OH-dG) were measured. Either α-LA or N. sativa significantly reduced the elevated blood glucose level. The combination of 3 compounds significantly increased the level of insulin and C-peptide. Also, increased the antioxidant activity measured by TAC and decreased the oxidative damage of DNA as measured by 8-OH-dG. HOMA- β increased in G3 and G6 compared to G2. However, the decrease in TG, and total cholesterol levels were non-significant in all groups. Combination of α-LA, L-carnitine and N. sativa will contribute significantly in improvement of the carbohydrate metabolism and to less extent lipid metabolism in diabetic rats, thus increasing the rate of success in management of DM. Also, this combination will have implications in clinical studies and clinical applications.

  2. The Long-Term Survival of a Patient With Stage IV Renal Cell Carcinoma Following an Integrative Treatment Approach Including the Intravenous α-Lipoic Acid/Low-Dose Naltrexone Protocol.

    PubMed

    Berkson, Burton M; Calvo Riera, Francisco

    2017-12-01

    In this case report, we describe the treatment of a 64-year-old male patient diagnosed with metastatic renal cell carcinoma (RCC) in June of 2008. In spite of a left nephrectomy and the standard oncological protocols, the patient developed a solitary left lung metastasis that continued to grow. He was informed that given his diagnosis and poor response to conventional therapy, any further treatment would, at best, be palliative. The patient arrived at the Integrative Medical Center of New Mexico in August of 2010. He was in very poor health, weak, and cachectic. An integrative program-developed by one of the authors using intravenous (IV) α-lipoic acid, IV vitamin C, low-dose naltrexone, and hydroxycitrate, and a healthy life style program-was initiated. From August 2010 to August 2015, the patient's RCC with left lung metastasis was followed closely using computed tomography and positron emission tomography/computed tomography imaging. His most recent positron emission tomography scan demonstrated no residual increased glucose uptake in his left lung. After only a few treatments of IV α-lipoic acid and IV vitamin C, his symptoms began to improve, and the patient regained his baseline weight. His energy and outlook improved, and he returned to work. The patient had stable disease with disappearance of the signs and symptoms of stage IV RCC, a full 9 years following diagnosis, with a gentle integrative program, which is essentially free of side effects. As of November 2017 the patient feels well and is working at his full-time job.

  3. Late Administration of a Palladium Lipoic Acid Complex (POLY-MVA) Modifies Cardiac Mitochondria but Not Functional or Structural Manifestations of Radiation-Induced Heart Disease in a Rat Model

    PubMed Central

    Sridharan, Vijayalakshmi; Seawright, John W.; Antonawich, Francis J.; Garnett, Merrill; Cao, Maohua; Singh, Preeti; Boerma, Marjan

    2017-01-01

    Exposure of the heart to ionizing radiation can cause adverse myocardial remodeling. In small animal models, local heart irradiation causes persistent alterations in cardiac mitochondrial function and swelling. POLY-MVA is a dietary supplement that contains a palladium lipoic acid complex that targets mitochondrial complex I and has been demonstrated to have greater redox potential than lipoic acid alone. POLY-MVA improves mitochondrial function and anti-oxidant enzyme activity in the aged rat heart. In this study, we tested whether POLY-MVA can mitigate cardiac effects of ionizing radiation. Adult male rats were exposed to local heart X rays with a daily dose of 9 Gy for 5 consecutive days. Eighteen weeks after irradiation, POLY-MVA was administered orally at 1 ml/kg bodyweight per day during weekdays, for 6 weeks. Alterations in cardiac function as measured with echocardiography coincided with enhanced mitochondrial swelling, a reduction in mitochondrial expression of complex II, manifestations of adverse remodeling such as a reduction in myocardial microvessel density and an increase in collagen deposition and mast cell numbers. POLY-MVA enhanced left ventricular expression of superoxide dismutase 2, but only in sham-irradiated animals. In irradiated animals, POLY-MVA caused a reduction in markers of inflammatory infiltration, CD2 and CD68. Moreover, POLY-MVA mitigated the effects of radiation on mitochondria. Nonetheless, POLY-MVA did not mitigate adverse cardiac remodeling, suggesting that this tissue remodeling may not be alleviated by altering cardiac mitochondria alone. However, we cannot exclude the possibility that an earlier onset of POLY-MVA administration may have more profound effects on radiation-induced cardiac remodeling. PMID:28231026

  4. Sperm quality after swim up and density gradient centrifugation sperm preparation with supplementation of alpha lipoic acid (ALA): A preliminary study

    NASA Astrophysics Data System (ADS)

    Lestari, Silvia W.; Lestari, Sarah H.; Pujianto, Dwi A.

    2018-02-01

    Intra uterine insemination (IUI) as one of the treatment for infertility, persists low success rate. A factor that contributes to the unsuccessful of IUI is sperm preparation, performed through Swim-up (SU) and Density Gradient Centrifugation (DGC) methods. Furthermore, studies have shown that Alpha Lipoic Acid (ALA) is a potent antioxidant that could enhance the sperm motility and protect the DNA integrity of the sperm [1]. This study is aimed to re-evaluate the efficiency of the DGC and SU methods in selecting sperm before being transferred for IUI by the supplementation of ALA based on the sperm DNA integrity. Semen samples were obtained from 13 men from partners of women who are infertile (normozoospermia) and underwent IUI. Semen analysis based on the guideline of World Health Organization (WHO) 2010 was performed to measure the sperm motility and velocity, before and after sperm preparation. Then, samples were incubated with Alpha Lipoic Acid (ALA) in 0.625 mg (ALA 1), 1.25 mg (ALA 2) and 2.5 mg (ALA 3). The Sperm Chromatin Dispersion (SCD) test was performed to evaluate the sperm DNA Fragmentation Index (DFI). The percentage of motile sperm was higher in prepared sperm (post-DGC and post-SU) than in whole semen. Furthermore, the percentage of motile sperm was higher in post-DGC compared to post-SU. The level of DFI after the supplementation of ALA was decreased in prepared sperm compared to the whole semen. ALA was proved capable to select the better sperm quality with decreased sperm DNA fragmentation of prepared sperm in the all of DFI category.

  5. Antioxidant effect of erdosteine and lipoic acid in ovarian ischemia-reperfusion injury.

    PubMed

    Dokuyucu, R; Karateke, A; Gokce, H; Kurt, R K; Ozcan, O; Ozturk, S; Tas, Z A; Karateke, F; Duru, M

    2014-12-01

    To investigate the effects of erdosteine and alpha lipoic acid (ALA) in a rat model of ovarian ischaemia-reperfusion injury. Forty-eight female Wistar albino rats were separated, at random, into six groups of eight rats. The groups were classified as: sham, torsion, detorsion, detorsion+erdosteine 100mg/kg, detorsion+alpha lipoic acid (ALA) 100mg/kg, and detorsion+erdosteine+ALA. The investigators executing the biochemical and histological analyses were blinded to the randomization until the end of the study. The TOS (Total Oxidant Status) and OSI (Oxidative Stress Index) levels are higher in the Torsion and Detorsion groups when compared with the ones in the Sham group (p<0.05). Strong correlation was found between OSI and total histological score in the sham, torsion and detorsion groups (r=0.765, p<0.001). The mean levels of TOS and OSI in the rats that received erdosteine and/or ALA were significantly lower compared with the sham, torsion and detorsion groups (p<0.05). Mean TOS and mean OSI were lower in the detorsion+erdosteine+ALA group compared with the detorsion+erdosteine and detorsion+ALA groups (p<0.05). In comparison with the detorsion group, the numbers of primordial follicles (p=0.006) and primary follicles (p=0.036) were increased in the groups that received erdosteine and/or ALA. Erdosteine and ALA decreased ischaemia-reperfusion injury in an experimental rat ovarian torsion model; combination treatment had a greater effect than either agent alone. Treatment with erdosteine and/or ALA was found to preserve the loss of reproductive capacity normally observed after ovarian torsion. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Dietary Antioxidants as Modifiers of Physiologic Adaptations to Exercise

    PubMed Central

    Mankowski, Robert T.; Anton, Stephen D.; Buford, Thomas W.; Leeuwenburgh, Christiaan

    2015-01-01

    Adaptive responses to exercise training (ET) are crucial in maintaining physiological homeostasis and health span. Exercise-induced aerobic bioenergetic reactions in mitochondria and cytosol increase production of reactive oxygen species (ROSs), where excess of ROS can be scavenged by enzymatic as well as non-enzymatic antioxidants to protect against deleterious oxidative stress. Free radicals, however, have recently been recognized as crucial signaling agents that promote adaptive mechanisms to ET, such as mitochondrial biogenesis, antioxidant (AO) enzyme activity defense system upregulation, insulin sensitivity, and glucose uptake in skeletal muscle. Commonly used non-enzymatic AO supplements, such as vitamins C and E, a-lipoic acid, and polyphenols, in combination with ET, have been proposed as ways to prevent exercise-induced oxidative stress and hence improve adaptation responses to endurance training. Preclinical and clinical studies to date have shown inconsistent results indicating either positive or negative effects of endurance training combined with different blends of AO supplements (mostly vitamins C and E and a-lipoic acid) on redox status, mitochondrial biogenesis pathways, and insulin sensitivity. Preclinical reports on ET combined with resveratrol, however, have shown consistent positive effects on exercise performance, mitochondrial biogenesis, and insulin sensitivity, with clinical trials reporting mixed effects. Relevant clinical studies have been few and have used inconsistent results and methodology (types of compounds, combinations, and supplementation time). The future studies would investigate the effects of specific antioxidants and other popular supplements, such as a-lipoic acid and resveratrol, on training effects in humans. Of particular importance are older adults who may be at higher risk of age-related increased oxidative stress, an impaired AO enzyme defense system, and comorbidities such as hypertension, insulin resistance, and diabetes. PMID:25606815

  7. α-lipoic acid inhibits high glucose-induced apoptosis in HIT-T15 cells.

    PubMed

    Yang, Yi; Wang, Weiping; Liu, Yinan; Guo, Ting; Chen, Ping; Ma, Kangtao; Zhou, Chunyan

    2012-06-01

    High blood glucose plays an important role in the pathogenesis of diabetes. α-lipoic acid (LA) has been used to prevent and treat diabetes, and is thought to act by increasing insulin sensitivity in many tissues. However, whether LA also has a cytoprotective effect on pancreatic islet beta cells remains unclear. In this study, we assessed whether LA could inhibit apoptosis in beta cells exposed to high glucose concentrations. HIT-T15 pancreatic beta cells were treated with 30 mmol/L glucose in the presence or absence of 0.5 mmol/L LA for 8 days. LA significantly reduced the numbers of apoptotic HIT-T15 cells and inhibited the cell overgrowth normally induced by high glucose treatment. Additionally, LA inhibited insulin expression and secretion in HIT-T15 cells induced by high glucose. Further study demonstrated that LA upregulated Pdx1 and Bcl2 gene expression, reduced Bax gene expression, and promoted phosphorylation of Akt in HIT-T15 cells treated with high glucose. Intriguingly, knockdown of Pdx1 expression partially offset the anti-apoptotic effect of LA. However, inhibition of Akt by PI3K/AKT antagonist LY294002 only slightly reversed the anti-apoptosis effect of LA and mildly decreased the gene expression level of Pdx1 (P > 0.05). Moreover, LA only slightly attenuated reactive oxygen species (ROS) production and augmented mitochondrial membrane potential. Therefore, our data suggest that α-lipoic acid can effectively attenuate high glucose-induced HIT-T15 cell apoptosis probably by increasing Pdx1 expression. These findings provide a new interpretation on the role of LA in the treatment of diabetes. © 2012 The Authors Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  8. The combination of exercise training and alpha-lipoic acid treatment has therapeutic effects on the pathogenic phenotypes of Alzheimer's disease in NSE/APPsw-transgenic mice.

    PubMed

    Cho, Joon Y; Um, Hyun S; Kang, Eun B; Cho, In H; Kim, Chul H; Cho, Jung S; Hwang, Dae Y

    2010-03-01

    Exercise training was suggested as a practical therapeutic strategy for human subjects suffering from Alzheimer's disease (AD) in our previous study. Therefore, the purpose of this study was to investigate the effects of combining exercise training with the administration of antioxidants on the pathological phenotype of AD. To accomplish this, non-transgenic mice (Non-Tg) and NSE/APPsw Tg mice were treated with alpha-lipoic acid and treadmill exercised for 16 weeks, after which their brains were evaluated to determine whether any changes in the pathological phenotype-related factors occurred. The results indicated that (i) the combination-applied (COMA) Tg group with exercise training (ET) and alpha-lipoic acid administration (LA) showed ameliorated spatial learning and memory compared to the sedentary (SED)-Tg and single-treatment groups; (ii) there were no differences in the level of Abeta-42 peptides across groups; (iii) the level of glucose transporter-1 and brain-derived neurotrophic factor proteins were highly increased in the COMA group, (iv) ET and LA did not induce a synergistic effect on the expression of heat shock protein-70 and apoptotic proteins including Bax and caspase-3; (v) the levels of SOD-1 and CAT suppressing oxidative stress were extensively higher in the COMA than in the single-treated groups and (vi) there were no significant differences across groups regarding these serum characteristics, although these levels were lower than the SED-Tg group. Taken together, these results suggest that the combination with ET and LA may contribute to protect the neuron injury induced by Abeta peptides and may be considered an effective therapeutic strategy for human subjects suffering from AD.

  9. Lipoyl dioleoylglycerol: Synthesis and potential use of a novel lipid in tribology

    USDA-ARS?s Scientific Manuscript database

    Lipoyl dioleoylglycerol is a lipophilic derivative of alpha-lipoic acid, a well-known antioxidant. Lipoyl dioleoylglycerol derived from vegetable oil maintains oily characteristics, suggesting potential use as a lubricant additive. Lipoyl dioleoylglycerol exists in an oxidized form with a disulfid...

  10. Lipoic acid stimulates cAMP production via the EP2 and EP4 prostanoid receptors and inhibits IFN gamma synthesis and cellular cytotoxicity in NK cells

    PubMed Central

    Salinthone, Sonemany; Schillace, Robynn V.; Marracci, Gail H.; Bourdette, Dennis N.; Carr, Daniel W.

    2008-01-01

    The antioxidant lipoic acid (LA) treats and prevents the animal model of multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE). In an effort to understand the therapeutic potential of LA in MS, we sought to define the cellular mechanisms that mediate the effects of LA on human natural killer (NK) cells, which are important in innate immunity as the first line of defense against invading pathogens and tumor cells. We discovered that LA stimulates cAMP production in NK cells in a dose-dependent manner. Studies using pharmacological inhibitors and receptor transfection experiments indicate that LA stimulates cAMP production via activation of the EP2 and EP4 prostanoid receptors and adenylyl cyclase. In addition, LA suppressed interleukin (IL)-12/IL-18 induced IFNγ secretion and cytotoxicity in NK cells. These novel findings suggest that LA may inhibit NK cell function via the cAMP signaling pathway. PMID:18562016

  11. Natural Products and Complementary Therapies for Chemotherapy-Induced Peripheral Neuropathy: A Systematic Review

    PubMed Central

    Brami, Cloé; Bao, Ting; Deng, Gary

    2015-01-01

    Chemotherapy-induced peripheral neuropathy (CIPN) is a serious dose-limiting side-effect without any FDA-approved treatment option. Prior reviews focus mostly on pharmacological interventions, but nonpharmaceutical interventions have also been evaluated. A Web of Science and PubMed database search to identify relevant RCTs from January 2005 to May 2015 included the terms: CIPN, cancer; and supplements, vitamin E, goshajinkigan, kampo, acetyl-L-carnitine, carnitine, alpha-lipoic acid, omega-3, glutamine, or glutamate; or massage, acupuncture, mind-body practice, yoga, meditation, Tai-Chi, physical activity, or exercise. Of 1465 publications screened, 12 RCTs evaluated natural products and one evaluated electroacupuncture. Vitamin E may help prevent CIPN. L-glutamine, goshajinkigan, and omega-3 are also promising. Acetyl-L-carnitine may worsen CIPN and alpha-lipoic acid activity is unknown. Electroacupuncture was not superior to placebo. No RCTs were published regarding other complementary therapies, although some studies mention positive incidental findings. Natural products and complementary therapies deserve further investigation, given the lack of effective CIPN interventions. PMID:26652982

  12. Enzymatic hybridization of α-lipoic acid with bioactive compounds in ionic solvents.

    PubMed

    Papadopoulou, Athena A; Katsoura, Maria H; Chatzikonstantinou, Alexandra; Kyriakou, Eleni; Polydera, Angeliki C; Tzakos, Andreas G; Stamatis, Haralambos

    2013-05-01

    The lipase-catalyzed molecular hybridization of α-lipoic acid (LA) with bioactive compounds pyridoxine, tyrosol and tyramine was performed in ionic solvents and deep eutectic solvents. The biocatalytic reactions were catalyzed by Candida antarctica lipase B immobilized onto various functionalized multi-walled carbon nanotubes (f-CNTs-CaLB), as well as by commercial Novozym 435. The use of f-CNTs-CaLB leads, in most cases, to higher conversion yields as compared to Novozym 435. The nature and ion composition of ionic solvents affect the performance of the biocatalytic process. The highest conversion yield was observed in (mtoa)NTf2. The high enzyme stability and the relatively low solubility of substrates in specific media account for the improved biocatalytic synthesis of molecular hybrids of LA. Principal component analysis was used to screen for potential lipoxygenase inhibitors. In vitro studies showed that the synthesized compounds exhibit up to 10-fold increased inhibitory activity on lipoxygenase mediated lipid peroxidation as compared to parent molecules. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Young; Department of Internal Medicine, University of Texas, Southwestern Medical Center, Dallas, TX 75390-8854; Naseem, R. Haris

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activatedmore » receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.« less

  14. Photochemical stability of lipoic acid and its impact on skin ageing.

    PubMed

    Matsugo, Seiichi; Bito, Toshinori; Konishi, Tetsuya

    2011-08-01

    It is well known that α-lipoic acid (LA) functions as an essential co-factor of the mitochondrial multi-enzyme complex and thus plays an important role in energy metabolism. Currently, it is attracting attention as a nutritional supplement because of its unique antioxidant properties and broad spectra of cellular functions. Skin protection from photodamage and ageing is one of the functional applications of LA. Medical and cosmetic application has been widely realized in the world. However, LA has a unique structure bearing a distorted five membered 1, 2-dithiolane ring, making it quite vulnerable to UV radiation. The present article briefly reviews skin ageing from the viewpoint of oxidative stress and sun exposure and analyses the photochemical properties of LA. It also discusses the effect of LA to cellular signalling and its adequate applications to treat skin ageing caused by oxidation. Data presented in this review suggest that LA is a powerful anti-ageing agent under the appropriate usage.

  15. Ginger and alpha lipoic acid ameliorate age-related ultrastructural changes in rat liver.

    PubMed

    Mahmoud, Y I; Hegazy, H G

    2016-01-01

    Because of the important role that oxidative stress is thought to play in the aging process, antioxidants could be candidates for preventing its related pathologies. We investigated the ameliorative effects of two antioxidant supplements, ginger and alpha lipoic acid (ALA), on hepatic ultrastructural alterations in old rats. Livers of young (4 months) and old (24 months) Wistar rats were studied using transmission electron microscopy. Livers of old rats showed sinusoidal collapse and congestion, endothelial thickening and defenestration, and inconsistent perisinusoidal extracellular matrix deposition. Aged hepatocytes were characterized by hypertrophy, cytoplasmic vacuolization and a significant increase in the volume densities of the nuclei, mitochondria and dense bodies. Lipofuscin accumulation and decreased microvilli in bile canaliculi and space of Disse also were observed. The adverse alterations were ameliorated significantly by both ginger and ALA supplementation; ALA was more effective than ginger. Ginger and ALA appear to be promising anti-aging agents based on their amelioration of ultrastructural alterations in livers of old rats.

  16. Induction of inflammation, DNA damage and apoptosis in rat heart after oral exposure to zinc oxide nanoparticles and the cardioprotective role of α-lipoic acid and vitamin E.

    PubMed

    Baky, N A A; Faddah, L M; Al-Rasheed, N M; Al-Rasheed, N M; Fatani, A J

    2013-05-01

    Although zinc oxide nanoparticles (ZnO-NP) are being used on a wide scale in the world consumer market, their potential hazards on humans remain largely unknown. The present study was aimed at investigating the oral toxicity of ZnO-NP in 2 dose regimen (600 mg/kg and 1 g/kg body weight for 5 consecutive days) in rats. In addition, the protective role of either α-lipoic acid (Lipo) or vitamin E (Vit E) against this cardiotoxic effect of ZnO-NPs was assessed. Results revealed that, co-administration of Lipo (200 mg/Kg body weight) or Vit E (100 mg/Kg body weight) daily for 3 weeks to rats intoxicated with ZnO-NPs (in either of the 2 dose regimen) significantly ameliorated the cardiotoxic effect of these nanoparticles. As, both agents significantly reduced the increase in serum cardiac injury markers including troponin-T, creatine kinase-MB (CK-MB), and myoglobin. Additionally, Lipo and Vit E significantly decreased the increase in serum pro-inflammatory biomarkers level including tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and C-reactive protein (CRP). Moreover, either of the 2 used agents successfully alleviated the alteration in nitric oxide (NO) and vascular endothelial growth factor (VEGF) in ZnO-NPs in sera of intoxicated group. They also significantly reduced the increase in cardiac calcium concentration and the consequent oxidative deoxyribonucleic acid (DNA) damage, as well as the increase in cardiac caspase-3 activity of intoxicated rats. Conclusively, these results indicate that early treatment with either α-lipoic acid or vitamin E may offer protection against cardiac tissue injury induced by the deleterious toxic impacts of ZnO-NPs. © Georg Thieme Verlag KG Stuttgart · New York.

  17. Alpha-lipoic acid protects mitochondrial enzymes and attenuates lipopolysaccharide-induced hypothermia in mice

    EPA Science Inventory

    Abstract: Hypothermia is a key symptom of sepsis and the mechanism(s) leading to hypothermia during sepsis is largely unknown. To investigate a potential mechanism and find an effective treatment for hypothermia in sepsis, we induced hypothermia in mice by lipopolysaccharide (LP...

  18. Antioxidant and Anti-stress Compounds Improve Regrowth of Cryopreserved Rubus Shoot Tips

    USDA-ARS?s Scientific Manuscript database

    Regrowth of plants after cryopreservation varies and resulting regrowth ranges from poor to excellent. Oxidative stress is a potential cause of damage in plant tissues. Antioxidants and anti-stress compounds may improve regrowth by preventing or repairing the damage. Lipoic acid (LA), glutathione (...

  19. Nutrition and the brain.

    PubMed

    Morley, John E

    2010-02-01

    Severe nutritional deficiencies, such as protein energy malnutrition and deficiency of nicotinamide, vitamin B(12), folate, and thiamine, have long been recognized to cause severe confusion. Lesser vitamin deficiencies have been linked to the pathogenesis of delirium. Hypo- and hyperglycemia and hypertriglyceridemia can cause cognitive deficits. Epidemiologic and animal studies have linked several other nutrients (omega-3 fatty acids, lutein, alpha-lipoic acid, and the Mediterranean diet) to cognitive performance and the prevention of dementia.

  20. Different therapeutic strategies for burning mouth syndrome: preliminary data.

    PubMed

    Marino, Roberto; Torretta, Sara; Capaccio, Pasquale; Pignataro, Lorenzo; Spadari, Francesco

    2010-09-01

    To compare different therapeutic supportive approaches in patients with burning mouth syndrome. A prospective study was carried out for this purpose. The study involved 56 patients with burning mouth syndrome. They were randomly assigned to treatment with capsaicin, alpha-lipoic acid or lysozyme-lactoperoxidase (test drugs) or boric acid (control group). Symptoms were scored after 60 days treatment and 60 days after drug discontinuation. At the end of the treatment period, there was a significant reduction in the symptom scores of all of the patients who received the test drugs (P<0.01), and at the end of the follow-up period in the test groups as a whole (P<0.01); the reduction was not significant when considering each test group separately after the treatment period. All of the treatments were more effective than boric acid and there was no significant difference in the symptom scores of the control group at either of the study time-points. Our results demonstrate the similar effectiveness of capsaicin and alpha-lipoic acid in controlling the symptoms of burning mouth syndrome. Lysozyme-lactoperoxidase may be effective in the supportive care of BMS patients with xerostomia. The transitory effect observed after discontinuing drug administration justifies the use of prolonged therapy in chronically affected patients. © 2010 John Wiley & Sons A/S.

  1. Natural products used for diabetes.

    PubMed

    Shapiro, Karen; Gong, William C

    2002-01-01

    To review the efficacy and safety of natural products commonly used for diabetes. English and Spanish-language journals retrieved through a MEDLINE search of articles published between 1960 and December 2001 using these index terms: Opuntia, karela, gymnema, tecoma, alpha lipoic acid, thioctic acid, ginseng, panaxans, and diabetes. Natural products have long been used in traditional systems of medicine for diabetes. Products in common use include nopal (prickly pear cactus), fenu-greek, karela (bitter melon), gymnema, ginseng, tronadora, chromium, and alpha-lipoic acid. The popularity of these products varies among people of different ethnicities. Nopal is the most commonly used herbal hypoglycemic among persons of Mexican descent. Karela is more commonly used by persons from Asian countries. Some of these agents have gained universal appeal. For a select number of products, studies have revealed single or multiple mechanisms of action. For several of these, high soluble fiber content is a contributing factor. Based on the available evidence, several natural products in common use can lower blood glucose in patients with diabetes. Commonly used natural products often have a long history of traditional use, and pharmacists who have a stronger understanding of these products are better positioned to counsel patients on their appropriate use.

  2. Lipoic Acid as a Possible Pharmacological Source of Hydrogen Sulfide/Sulfane Sulfur.

    PubMed

    Bilska-Wilkosz, Anna; Iciek, Małgorzata; Kowalczyk-Pachel, Danuta; Górny, Magdalena; Sokołowska-Jeżewicz, Maria; Włodek, Lidia

    2017-03-02

    The aim of the present study was to verify whether lipoic acid (LA) itself is a source of H₂S and sulfane sulfur. It was investigated in vitro non-enzymatically and enzymatically (in the presence of rat tissue homogenate). The results indicate that both H₂S and sulfane sulfur are formed from LA non-enzymatically in the presence of environmental light. These results suggest that H₂S is the first product of non-enzymatic light-dependent decomposition of LA that is, probably, next oxidized to sulfane sulfur-containing compound(s). The study performed in the presence of rat liver and kidney homogenate revealed an increase of H₂S level in samples containing LA and its reduced form dihydrolipoic acid (DHLA). It was accompanied by a decrease in sulfane sulfur level. It seems that, in these conditions, DHLA acts as a reducing agent that releases H₂S from an endogenous pool of sulfane sulfur compounds present in tissues. Simultaneously, it means that exogenous LA cannot be a direct donor of H₂S/sulfane sulfur in animal tissues. The present study is an initial approach to the question whether LA itself is a donor of H₂S/sulfane sulfur.

  3. Mapping the lipoylation site of Arabidopsis thaliana plastidial dihydrolipoamide S-acetyltransferase using mass spectrometry and site-directed mutagenesis

    USDA-ARS?s Scientific Manuscript database

    Background: The catalytic enhancement achieved by the pyruvate dehydrogenase complex (PDC) results from a combination of substrate channeling plus active-site coupling. The mechanism for active-site coupling involves lipoic acid prosthetic groups covalently attached to Lys residues in the primary ...

  4. Physical Characterization of Magnetic Bacteria and Their Electromagnetic Properties in the Frequency Range 1-400 GHz

    DTIC Science & Technology

    1986-05-14

    PA IA 50 mg lipoic acid 50 mP --- TABLE 2. Estimated maximum cell concentrations based upon the elemental composition of the growth medium. In medium...Added amount per liter Tartaric acid 0.37 g Succinic acid 0.37 g Sodium acetate 0.05 g Sodium nitrate 0.17 g Monopotassium phosphate 0.69 g Sodium...Distilled water I liter ) Alternatively, 0.03 g ascorbic acid *±) Stock solution of 2.7 g/L FeC13 and 1.9 g/L Quinic acid ***) Mineral medium (pH 6.5 w/KOH

  5. A comparative study of effects of omega-3 Fatty acids, alpha lipoic Acid and vitamin e in type 2 diabetes mellitus.

    PubMed

    Udupa, A; Nahar, P; Shah, S; Kshirsagar, M; Ghongane, B

    2013-07-01

    Diabetes Mellitus is a metabolic disorder characterized by abnormal lipid and glucose metabolism. Various modes of adjuvant therapy have been advocated to ameliorate insulin resistance. This study was intended to assess the effects of antioxidants; alpha lipoic acid (ALA), omega 3 fatty acid and vitamin E on parameters of insulin sensitivity (blood glucose and HbA1c) in patients of type 2 diabetes mellitus with documented insulin resistance. It was a prospective, randomized, double blind, placebo controlled, single centered study. 104 patients with type 2 diabetes mellitus with insulin resistance were recruited. They were given ALA, omega 3 fatty acid, vitamin E or placebo. Fasting blood glucose and HbA1c were measured at first visit (V1) and after 90 days (V2). Statistical analysis was carried out by paired t-test by using SPSS software version 11 (SPSS, Chicago, USA). Analysis of baseline (V1) vs. end of treatment period (V2) parameters, showed significant decrease in HbA1c in the three treatment group. We also observed decrease in fasting blood glucose in the three treatment group but it was not statistically significant (Gr. I = 0.51, Gr. II = 0.05, Gr. III = 0.22, Gr. IV = 0.88). ALA, Omega 3 fatty acid and vitamin E can be used as add on therapy in patients with type 2 diabetes mellitus to improve insulin sensitivity and lipid metabolism.

  6. The 2-oxoacid dehydrogenase multi-enzyme complex of the archaeon Thermoplasma acidophilum - recombinant expression, assembly and characterization.

    PubMed

    Heath, Caroline; Posner, Mareike G; Aass, Hans C; Upadhyay, Abhishek; Scott, David J; Hough, David W; Danson, Michael J

    2007-10-01

    The aerobic archaea possess four closely spaced, adjacent genes that encode proteins showing significant sequence identities with the bacterial and eukaryal components comprising the 2-oxoacid dehydrogenase multi-enzyme complexes. However, catalytic activities of such complexes have never been detected in the archaea, although 2-oxoacid ferredoxin oxidoreductases that catalyze the equivalent metabolic reactions are present. In the current paper, we clone and express the four genes from the thermophilic archaeon, Thermoplasma acidophilum, and demonstrate that the recombinant enzymes are active and assemble into a large (M(r) = 5 x 10(6)) multi-enzyme complex. The post-translational incorporation of lipoic acid into the transacylase component of the complex is demonstrated, as is the assembly of this enzyme into a 24-mer core to which the other components bind to give the functional multi-enzyme system. This assembled complex is shown to catalyze the oxidative decarboxylation of branched-chain 2-oxoacids and pyruvate to their corresponding acyl-CoA derivatives. Our data constitute the first proof that the archaea possess a functional 2-oxoacid dehydrogenase complex.

  7. The Identification of Splice Variants as Molecular Markers in Parkinson’s Disease

    DTIC Science & Technology

    2008-09-01

    abnormality after unilateral dopamine depletion. Behav Brain Res 104:189-196 61. Jonsson G ( 1980 ) Chemical neurotoxins as denervation tools in...by alpha-lipoic acid. Faseb J 21:2226-2236 64. Kennedy JL, Farrer LA, Andreasen NC, Mayeux R, St George- Hyslop P (2003) The genetics of adult-onset

  8. Modulatory effects of alpha-lipoic acid (ALA) administration on insulin sensitivity in obese PCOS patients.

    PubMed

    Genazzani, A D; Shefer, K; Della Casa, D; Prati, A; Napolitano, A; Manzo, A; Despini, G; Simoncini, T

    2018-05-01

    To evaluate the efficacy of alpha-lipoic acid (ALA) administration on hormonal and metabolic parameters of obese PCOS patients. A group of 32 obese PCOS patients were selected after informed consent. 20 patients referred to have first grade relatives with diabetes type I or II. Hormonal and metabolic parameters as well as OGTT were evaluated before and after 12 weeks of ALA integrative administration (400 mg per os every day). ALA administration significantly decreased insulin, glucose, BMI and HOMA index. Hyperinsulinemia and insulin response to OGTT decreased both as maximal response (Δmax) and as AUC. PCOS with diabetes relatives showed the decrease also of triglyceride and GOT. Interestingly in all PCOS no changes occurred on all hormonal parameters involved in reproduction such as LH, FSH, and androstenedione. ALA integrative administration at a low dosage as 400 mg daily improved the metabolic impairment of all PCOS patients especially in those PCOS with familiar diabetes who have a higher grade of risk of NAFLD and predisposition to diabetes.

  9. Out of Warburg effect: An effective cancer treatment targeting the tumor specific metabolism and dysregulated pH.

    PubMed

    Schwartz, Laurent; Seyfried, Thomas; Alfarouk, Khalid O; Da Veiga Moreira, Jorgelindo; Fais, Stefano

    2017-04-01

    As stated by Otto Warburg nearly a century ago, cancer is a metabolic disease, a fermentation caused by malfunctioning mitochondria, resulting in increased anabolism and decreased catabolism. Treatment should, therefore, aim at restoring the energy yield. To decrease anabolism, glucose uptake should be reduced (ketogenic diet). To increase catabolism, the oxidative phosphorylation should be restored. Treatment with a combination of α-lipoic acid and hydroxycitrate has been shown to be effective in multiple animal models. This treatment, in combination with conventional chemotherapy, has yielded extremely encouraging results in glioblastoma, brain metastasis and lung cancer. Randomized trials are necessary to confirm these preliminary data. The major limitation is the fact that the combination of α-lipoic acid and hydroxycitrate can only be effective if the mitochondria are still present and/or functional. That may not be the case in the most aggressive tumors. The increased intracellular alkalosis is a strong mitogenic signal, which bypasses most inhibitory signals. Concomitant correction of this alkalosis may be a very effective treatment in case of mitochondrial failure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. A novel fullerene lipoic acid derivative: Synthesis and preparation of self-assembled monolayers on gold

    NASA Astrophysics Data System (ADS)

    Viana, A. S.; Leupold, S.; Eberle, C.; Shokati, T.; Montforts, F.-P.; Abrantes, L. M.

    2007-11-01

    Synthesis and preparation of self-assembled monolayers of a novel fullerene lipoic acid derivative on gold are reported. The presence of densely packed SAMs was confirmed by ellipsometry and cyclic voltammetry. The electrochemical response of the modified electrode in organic media exhibits the first two redox peaks characteristic of the extended π-electron system of fullerene. C 60 surface coverage (1.4 × 10 -10 mol cm -2) has been electrochemically determined by the redox process of the adsorbed fullerene moiety and by reductive desorption of the SAM in strong alkaline solution. Electrochemical data indicate that all four sulphur atoms are involved in the self-assembly process, providing an increase of SAM stability in comparison to mono or di-thiolated appended molecules. Visualisation of discrete fullerene molecules by scanning tunnelling microscopy supplied further evidence for gold modification and molecular distribution on the surface. Mixed monolayers of hexanethiol and fullerene derivatives in a proportion of 1:2 have been also studied with the purpose of controlling the amount and distribution of fullerene units on the gold surface.

  11. Stable and selective self-assembly of α-lipoic acid on Ge(001) for biomolecule immobilization

    NASA Astrophysics Data System (ADS)

    Kazmierczak, M.; Flesch, J.; Mitzloff, J.; Capellini, G.; Klesse, W. M.; Skibitzki, O.; You, C.; Bettenhausen, M.; Witzigmann, B.; Piehler, J.; Schroeder, T.; Guha, S.

    2018-05-01

    We demonstrate a novel method for the stable and selective surface functionalization of germanium (Ge) embedded in silicon dioxide. The Ge(001) surface is functionalized using α-lipoic acid (ALA), which can potentially be utilized for the immobilization of a wide range of biomolecules. We present a detailed pH-dependence study to establish the effect of the incubation pH value on the adsorption layer of the ALA molecules. A threshold pH value for functionalization is identified, dividing the examined pH range into two regions. Below a pH value of 7, the formation of a disordered ALA multilayer is observed, whereas a stable well-ordered ALA mono- to bi-layer on Ge(001) is achieved at higher pH values. Furthermore, we analyze the stability of the ALA layer under ambient conditions, revealing the most stable functionalized Ge(001) surface to effectively resist oxidation for up to one week. Our established functionalization method paves the way towards the successful immobilization of biomolecules in future Ge-based biosensors.

  12. Resolution of subchorionic hematoma and symptoms of threatened miscarriage using vaginal alpha lipoic acid or progesterone: clinical evidences.

    PubMed

    Costantino, M; Guaraldi, C; Costantino, D

    2016-04-01

    Alpha Lipoic Acid (ALA) is a safe natural molecule that exerts a selective immunomodulating activity with antioxidant and anti-inflammatory properties. This randomized controlled clinical trial (RCT) tested the effect of the vaginal administration with ALA or Progesterone, in subchorionic hematoma resorption in women with threatened miscarriage. 400 mg of vaginal Progesterone or 10 mg of vaginal ALA were administered to sixty-two pregnant women, in the first trimester of gestation with threatened miscarriage and subchorionic hematoma. Controls were patients who chose not to receive any treatment. In the ALA group the subchorionic hematoma was reabsorbed more quickly in comparison with the progression detected in Progesterone group (p ≤ 0.05). The other parameters checked (pelvic pain and vaginal bleeding) did not show any significant difference and a smaller number of miscarriages was recorded in the ALA group, compared to Progesterone group. Our data provides the first evidence of the efficacy of ALA, administered by vaginal route, in the healing process of patients with threatened miscarriage, thus supporting the normal course of pregnancy. NCT02601898 (ClinicalTrials.gov registry).

  13. α-Lipoic acid suppresses the development of DNFB-induced atopic dermatitis-like symptoms in NC/Nga mice.

    PubMed

    Kim, Gun-Dong; Kim, Tae-Ho; Jang, An-Hee; Ahn, Hyun-Jong; Park, Yong Seek; Park, Cheung-Seog

    2011-02-01

    Atopic dermatitis (AD) is a common skin disease that has complex pathogenic mechanisms. Under specific pathogen-free conditions, repeated epicutaneous treatment of 2-4-dinitrofluorobenzene (DNFB) evokes AD-like clinical symptoms in NC/Nga mice. α-Lipoic acid (α-LA; 1, 2-dithiolane-3-pentanoic acid) is a dietary component that is synthesized in bacteria, yeast, plants, and mammals. α-LA and its reduced form, dihydrolipoic acid, are powerful antioxidants that have many physiological functions, including free radical scavenging of reactive oxygen species, generation of cellular antioxidants, chelation of metal ions, and inflammatory suppression. In this study, we investigated whether α-LA suppresses AD-like skin lesions induced by repeated DNFB application in NC/Nga mice. α-LA significantly suppressed production of interferon (IFN)-γ and interleukin (IL)-4 by activated CD4(+) T cells. We found that the oral administration of α-LA reduced AD-like clinical symptoms and inhibited increases of epidermal thickness in DNFB-induced AD-like skin lesions of NC/Nga mice. Furthermore, total serum IgE levels were dramatically reduced by topical α-LA treatment. Our findings suggest that oral administration of α-LA suppresses the development of AD in DNFB-treated NC/Nga mice and reduces IFN-γ and IL-4 production from activated CD4(+) T cells as well as total serum IgE levels. © 2011 John Wiley & Sons A/S.

  14. Neuroprotective evidence of alpha-lipoic acid and desvenlafaxine on memory deficit in a neuroendocrine model of depression.

    PubMed

    de Sousa, Caren Nádia Soares; Meneses, Lucas Nascimento; Vasconcelos, Germana Silva; da Silva Medeiros, Ingridy; Silva, Márcia Calheiros Chaves; Mouaffak, Fayçal; Kebir, Oussama; da Silva Leite, Cláudio Manuel Gonçalves; Patrocinio, Manoel Cláudio Azevedo; Macedo, Danielle; Vasconcelos, Silvânia Maria Mendes

    2018-05-07

    Cognitive impairment is present in patients with depression. We hypothesized that alpha-lipoic acid (ALA) can reduce cognitive impairment, especially when combined to antidepressants. Female mice received vehicle or corticosterone (CORT) 20 mg/kg, s.c. for 14 days. From the 15th to 21st day, the animals were divided in groups: vehicle, CORT, CORT+desvenlafaxine (DVS) 10 or 20 mg/kg, ALA 100 or 200 mg/kg, DVS10+ALA100, DVS20+ALA100, DVS10+ALA200, or DVS20+ALA200. Tail suspension (TST), social interaction (SIT), novel object recognition (NOR), and Y-maze tests were conducted. Acetylcholinesterase activity (AChE) was measured in the prefrontal cortex (PFC), hippocampus (HC), and striatum (ST). CORT caused depressive-like behavior, impairment in SIT, and cognitive deficits. Alpha-lipoic acid and DVS, alone or combined, reversed CORT effect on TST. In the NOR, ALA200 alone, DVS10+ALA100, or DVS10+ALA200 reversed the deficits in short-term memory, while DVS20 alone or DVS20+ALA200 reversed the deficits in long-term memory. In the Y-maze test, ALA200 alone, DVS20+ALA100, or DVS20+ALA200 reversed the deficits caused by CORT in the working memory. CORT increased AChE in the PFC, HC, and ST. ALA200 alone or DVS20+ALA200 reversed this effect in the PFC, while DVS20 or DVS20+ALA100 reversed this effect in the HC. In the ST, DVS10 or 20, alone or combined, and ALA100 reversed the effects of CORT. These results suggest that DVS+ALA, by reversing CORT-induced memory and social deficits, seems to be a promising therapy for the treatment of depression and reversal of cognitive impairment observed in this disorder.

  15. α-Lipoic acid stabilized DTX/IR780 micelles for photoacoustic/fluorescence imaging guided photothermal therapy/chemotherapy of breast cancer.

    PubMed

    Li, WenTing; Peng, JinRong; Yang, Qian; Chen, LiJuan; Zhang, Lan; Chen, XiaoXin; Qian, ZhiYong

    2018-05-01

    Micellar nanoparticles have unique advantages as carriers for therapeutic or imaging agents, owing to their smaller size and better penetration of tumors. However, some agents, due to their physical or chemical properties, are difficult to load into micelles. IR780 is one of these agents, and is also a promising near-infrared dye for fluorescence imaging (FI)/photoacoustic imaging (PAI) and cancer photothermal therapy (PTT). Its hydrophobic and high crystallization structure results in limited bioavailability in vivo. It is difficult to load into micelles constructed from an amphiphilic block polymer with relatively low molecular weight. In this study, we use computer simulation and introduce another small biomolecule, α-lipoic acid, into the micelles constructed from a mPEG-PCL copolymer, to lower the energy of molecular interaction between MPEG-PCL and IR780, and expect to enhance the loading capacity of the micelles to IR780. The introduction of α-lipoic acid decreases the energy of molecular interaction between MEPG-PCL and IR780 from -46.18 kJ mol-1 to -196.52 kJ mol-1 and increases the loading capacity and stability of the mPEG-PCL micelles to IR780, which also maintains the loading capacity to DTX. We further construct DTX/IR780 co-loaded mPEG-PCL micelles for FI/PAI dual modal imaging guided PTT/chemotherapy of cancer. By FI and PAI evaluation in vitro and in vivo, we demonstrate that the DTX/IR780 co-loaded micelles can be used as FI and PAI probes. By further evaluating the therapeutic outcome of PTT/chemotherapy co-therapy of breast cancer, we demonstrate that the DTX/IR780 co-loaded mPEG-PCL micelles can serve as promising candidates for FI and PAI guided PTT/chemotherapy of breast cancer.

  16. Effects of EPA and lipoic acid supplementation on circulating FGF21 and the fatty acid profile in overweight/obese women following a hypocaloric diet.

    PubMed

    Escoté, Xavier; Félix-Soriano, Elisa; Gayoso, Lucía; Huerta, Ana Elsa; Alvarado, María Antonella; Ansorena, Diana; Astiasarán, Iciar; Martínez, J Alfredo; Moreno-Aliaga, María Jesús

    2018-05-23

    FGF21 has emerged as a key metabolism and energy homeostasis regulator. Dietary supplementation with eicosapentaenoic acid (EPA) and/or α-lipoic acid (LIP) has shown beneficial effects on obesity. In this study, we evaluated EPA and/or LIP effects on plasma FGF21 and the fatty acid (FA) profile in overweight/obese women following hypocaloric diets. At the baseline, FGF21 levels were negatively related to the AST/ALT ratio and HMW adiponectin. The weight loss did not cause any significant changes in FGF21 levels, but after the intervention FGF21 increased in EPA-supplemented groups compared to non-EPA-supplemented groups. EPA supplementation decreased the plasma n-6-PUFA content and increased n-3-PUFAs, mainly EPA and DPA, but not DHA. In the LIP-alone supplemented group a decrease in the total SFA and n-6-PUFA content was observed after the supplementation. Furthermore, EPA affected the desaturase activity, lowering Δ4D and raising Δ5/6D. These effects were not observed in the LIP-supplemented groups. Besides, the changes in FGF21 levels were associated with the changes in EPA, n-3-PUFAs, Δ5/6D, and n-6/n-3 PUFA ratio. Altogether, our study suggests that n-3-PUFAs influence FGF21 levels in obesity, although the specific mechanisms implicated remain to be elucidated.

  17. Lipoic acid prevents suppression of connective tissue proliferation in the rat liver induced by n-3 PUFAs. A pilot study.

    PubMed

    Arend, A; Zilmer, M; Vihalemm, T; Selstam, G; Sepp, E

    2000-01-01

    As previously shown, dietary n-3 polyunsaturated fatty acids (n-3 PUFAs) suppress connective tissue proliferation in the rat liver wound concurrent with an elevated level of lipid peroxidation. The present study was undertaken to investigate the influence of alpha-lipoic acid (LA), a natural anti-oxidant, on these effects of n-3 PUFAs. Rats were fed with a commercial pellet diet (control group) or with diets enriched with 10% of sunflower oil (n-6 group) or 10% of fish oil (n-3 group) for 8 weeks followed by addition of LA to the same diets for 10 days. Then a liver thermic wound was induced and the administration of LA was continued for 6 days. The proliferation of the connective tissue, the level of lipid peroxidation and their peroxidizability and the content of prostaglandins E2 and F2alpha were measured in the liver wounds. LA prevented the suppression of connective tissue proliferation in the healing wound induced by n-3 PUFAs, avoided the increase in peroxidation of lipids, reduced peroxidizability of lipids and modulated the decrease in PGE2 and PGF2alpha. The results indicate that dietary LA may prevent the suppression of liver wound healing induced by n-3 PUFAs.

  18. Influence of alpha-lipoic acid on nicotine-induced lung and liver damage in experimental rats.

    PubMed

    Ateyya, Hayam; Nader, Manar A; Attia, Ghalia M; El-Sherbeeny, Nagla A

    2017-05-01

    Nicotine mediates some of the injurious effects caused by consuming tobacco products. This work aimed at investigating the defensive role of alpha-lipoic acid (ALA) with its known antioxidant and antiinflammatory effect in nicotine-induced lung and liver damage. Rats were arranged into 4 groups: control, nicotine, ALA, and ALA-nicotine groups. Oxidative stress and antioxidant status were determined by assessing thiobarbituric acid reactive substances (TBARS), superoxide dismutase (SOD), and glutathione (GSH) levels in lung and liver. Liver enzymes and lipid profiles were measured and pulmonary and hepatic damage were assessed by histopathological examination. Also, serum levels of transforming growth factor beta 1 (TGF-β1) and vascular cell adhesion molecule 1 (VCAM-1) were determined. The results revealed an increase in TBARS in tissues and a reduction in both SOD and GSH activity in the nicotine-treated rats. Nicotine induced high levels of liver enzymes, TGF-β1, VCAM-1, and dyslipidemia with histopathological changes in the lung and liver. ALA administration along with nicotine attenuated oxidative stress and normalized the SOD and GSH levels, ameliorated dyslipidemia, and improved TGF-β1 and VCAM-1 with better histopathology of the lung and liver. The study data revealed that ALA may be beneficial in alleviating nicotine-induced oxidative stress, dyslipidemia, and both lung and liver damage.

  19. Antitumor Effects of Palladium-α-Lipoic Acid Complex Formulation as an Adjunct in Radiotherapy.

    PubMed

    Veena, Ravindran Kalathil; Ajith, Thekkuttuparambil Ananthanarayanan; Janardhanan, Kainoor Krishnankutty; Antonawich, Francis

    2016-01-01

    Several investigations have been initiated to enhance the antitumor effect of radiation and ameliorate its adverse effects such as reducing blood cell counts and causing DNA damage in normal cells. Compounds that enhance the antitumor activity of radiation without reducing blood cell counts or damaging DNA in normal cells can be of immense use as an adjunct in radiotherapy. We evaluated the antitumor effect of a specific set of minerals, vitamins, and amino acids (Poly-MVA) (2 mL/kg, per os), with and without radiation, against Dalton's lymphoma ascites (DLA) and Ehrlich's ascites carcinoma (EAC) cell lines that were transplanted in a solid-tumor model. Whole-body γ-radiation exposure (2 Gy) was performed using 60Co. Poly-MVA enhanced the antitumor effect of radiation when administered beforehand. Furthermore, Poly-MVA administered once daily for 2 wk, immediately after 4 Gy irradiation, protected DNA damage in peripheral blood. It also rendered protection against the radiation-induced reduction of platelet count. The unique electronic and redox properties of palladium-α-lipoic acid complex in Poly-MVA appear to be responsible for the exhibited effect. The results conclude that the antitumor-enhancing and normal cell-protective effect of Poly-MVA warrants additional studies for its potential clinical application.

  20. Quantification of lipoic acid in plasma by high-performance liquid chromatography-electrospray ionization mass spectrometry.

    PubMed

    Chen, Jun; Jiang, Wenming; Cai, Jia; Tao, Weixing; Gao, Xiaoling; Jiang, Xinguo

    2005-09-25

    A sensitive and specific liquid chromatography electrospray ionization mass spectrometry (LC-ESI-MS) method has been developed and validated for the identification and quantification of lipoic acid (LA) in human plasma. LA and the internal standard, naproxen, were extracted from a 500 microl plasma sample by one-step deproteination using acetonitrile. Chromatographic separation was performed on a Zorbax SB-C(18) Column (100 mmx3.0mm i.d. with 3.5 microm particle size) with the mobile phase consisting of acetonitrile and 0.1% acetic acid (pH 4, adjusted with ammonia solution) (65:35, v/v), and the flow rate was set at 0.3 ml/min. Detection was performed on a single quadrupole mass spectrometer by selected ion monitoring (SIM) mode via electrospray ionization (ESI) source. The method was linear over the concentration range of 5-10,000 ng/ml for LA. The intra- and inter-day precisions were less than 7% and accuracy ranged from -7.87 to 9.74% at the LA concentrations tested. The present method provides a relatively simple and sensitive assay with short turn-around time. The method has been successfully applied to a clinical pharmacokinetic study of LA in 10 healthy subjects.

  1. Consequences of the Combined α-tocopherol, Ascorbic Acid and α-lipoic Acid on the Glutathione, Cholesterol and Fatty Acid Composition in Muscle and Liver of Diabetic Rats

    PubMed Central

    YILMAZ, Okkes; ERSAN, Yasemin; Dilek OZSAHIN, Ayse; Ihsan OZTURK, Ali; OZKAN, Yusuf

    2013-01-01

    Objective(s): Our objective was to evaluate the effects of a triple antioxidant combination [α-tocopherol (AT), ascorbic acid (AA) and α-lipoic acid (LA); AT+AA+LA] on the cholesterol and glutathione levels, and the fatty acid composition of liver and muscle tissues in diabetic rats. Materials and Methods: Forty-three Wistar rats were randomly divided into five groups. The first group was used as a control. The second, third and fourth groups received STZ (45 mg/kg) in citrate buffer. The fourth and fifth groups were injected with intraperitoneal (IP) 50 mg/kg DL-AT and 50 mg /kg DL-LA four times per week and received water-soluble vitamin C (50 mg/kg) in their drinking water for a period of six weeks. Results: Liver cholesterol levels in the AT+AA+LA group were lower than the control (P<0.05). Glutathione level was lower in D-2 (P<0.05) and were higher in D+AT+AA+LA and AT+AA+LA groups than the control groups (P≤ 0.05). The muscle cholesterol levels in the D-1 and D+AT+AA+LA groups were higher than the control group (P≤ 0.05). The levels of oleic acid were higher in the D-1 group and lower in the D-2 group (P<0.001). The arachidonic acid level in the D-1 and D-2 groups were lower (P<0.05), and higher in the D+AT+AA+LA group. Conclusion: Our results revealed that glutathione levels and the Stearoyl CoA Desaturase enzyme products in liver tissues of diabetic and non-diabetic rats were increased by triple antioxidant mixture. PMID:24298385

  2. Consequences of the Combined α-tocopherol, Ascorbic Acid and α-lipoic Acid on the Glutathione, Cholesterol and Fatty Acid Composition in Muscle and Liver of Diabetic Rats.

    PubMed

    Yilmaz, Okkes; Ersan, Yasemin; Dilek Ozsahin, Ayse; Ihsan Ozturk, Ali; Ozkan, Yusuf

    2013-02-01

    Our objective was to evaluate the effects of a triple antioxidant combination [α-tocopherol (AT), ascorbic acid (AA) and α-lipoic acid (LA); AT+AA+LA] on the cholesterol and glutathione levels, and the fatty acid composition of liver and muscle tissues in diabetic rats. Forty-three Wistar rats were randomly divided into five groups. The first group was used as a control. The second, third and fourth groups received STZ (45 mg/kg) in citrate buffer. The fourth and fifth groups were injected with intraperitoneal (IP) 50 mg/kg DL-AT and 50 mg /kg DL-LA four times per week and received water-soluble vitamin C (50 mg/kg) in their drinking water for a period of six weeks. Liver cholesterol levels in the AT+AA+LA group were lower than the control (P<0.05). Glutathione level was lower in D-2 (P<0.05) and were higher in D+AT+AA+LA and AT+AA+LA groups than the control groups (P≤ 0.05). The muscle cholesterol levels in the D-1 and D+AT+AA+LA groups were higher than the control group (P≤ 0.05). The levels of oleic acid were higher in the D-1 group and lower in the D-2 group (P<0.001). The arachidonic acid level in the D-1 and D-2 groups were lower (P<0.05), and higher in the D+AT+AA+LA group. Our results revealed that glutathione levels and the Stearoyl CoA Desaturase enzyme products in liver tissues of diabetic and non-diabetic rats were increased by triple antioxidant mixture.

  3. A C. elegans Model for Mitochondrial Fatty Acid Synthase II: The Longevity-Associated Gene W09H1.5/mecr-1 Encodes a 2-trans-Enoyl-Thioester Reductase

    PubMed Central

    Gurvitz, Aner

    2009-01-01

    Our recognition of the mitochondria as being important sites of fatty acid biosynthesis is continuously unfolding, especially in light of new data becoming available on compromised fatty acid synthase type 2 (FASII) in mammals. For example, perturbed regulation of murine 17β-HSD8 encoding a component of the mitochondrial FASII enzyme 3-oxoacyl-thioester reductase is implicated in polycystic kidney disease. In addition, over-expression in mice of the Mecr gene coding for 2-trans-enoyl-thioester reductase, also of mitochondrial FASII, leads to impaired heart function. However, mouse knockouts for mitochondrial FASII have hitherto not been reported and, hence, there is a need to develop alternate metazoan models such as nematodes or fruit flies. Here, the identification of Caenorhabditis elegans W09H1.5/MECR-1 as a 2-trans-enoyl-thioester reductase of mitochondrial FASII is reported. To identify MECR-1, Saccharomyces cerevisiae etr1Δ mutant cells were employed that are devoid of mitochondrial 2-trans-enoyl-thioester reductase Etr1p. These yeast mutants fail to synthesize sufficient levels of lipoic acid or form cytochrome complexes, and cannot respire or grow on non-fermentable carbon sources. A mutant yeast strain ectopically expressing nematode mecr-1 was shown to contain reductase activity and resemble the self-complemented mutant strain for these phenotype characteristics. Since MECR-1 was not intentionally targeted for compartmentalization using a yeast mitochondrial leader sequence, this inferred that the protein represented a physiologically functional mitochondrial 2-trans-enoyl-thioester reductase. In accordance with published findings, RNAi-mediated knockdown of mecr-1 in C. elegans resulted in life span extension, presumably due to mitochondrial dysfunction. Moreover, old mecr-1(RNAi) worms had better internal organ appearance and were more mobile than control worms, indicating a reduced physiological age. This is the first report on RNAi work dedicated specifically to curtailing mitochondrial FASII in metazoans. The availability of affected survivors will help to position C. elegans as an excellent model for future pursuits in the emerging field of mitochondrial FASII research. PMID:19924289

  4. Lipoic acid metabolism in Trypanosoma cruzi as putative target for chemotherapy.

    PubMed

    Vacchina, Paola; Lambruschi, Daniel A; Uttaro, Antonio D

    2018-03-01

    Lipoic acid (LA) is a cofactor of relevant enzymatic complexes including the glycine cleave system and 2-ketoacid dehydrogenases. Intervention on LA de novo synthesis or salvage could have pleiotropic deleterious effect in cells, making both pathways attractive for chemotherapy. We show that Trypanosoma cruzi was susceptible to treatment with LA analogues. 8-Bromo-octanic acid (BrO) inhibited the growth of epimastigote forms of both Dm28c and CL Brener strains, although only at high (chemotherapeutically irrelevant) concentrations. The methyl ester derivative MBrO, was much more effective, with EC 50 values one order of magnitude lower (62-66 μM). LA did not bypass the toxic effect of its analogues. Small monocarboxylic acids appear to be poorly internalized by T. cruzi: [ 14 C]-octanoic acid was taken up 12 fold less efficiently than [ 14 C]-palmitic acid. Western blot analysis of lipoylated proteins allowed the detection of the E2 subunits of pyruvate dehydrogenase (PDH), branched chain 2-ketoacid dehydrogenase and 2-ketoglutarate dehydrogenase complexes. Growth of parasites in medium with 10 fold lower glucose content, notably increased PDH activity and the level of its lipoylated E2 subunit. Treatment with BrO (1 mM) and MBrO (0.1 mM) completely inhibited E2 lipoylation and all three dehydrogenases activities. These observations indicate the lack of specific transporters for octanoic acid and most probably also for BrO and LA, which is in agreement with the lack of a LA salvage pathway, as previously suggested for T. brucei. They also indicate that the LA synthesis/protein lipoylation pathway could be a valid target for drug intervention. Moreover, the free LA available in the host would not interfere with such chemotherapeutic treatments. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Improvement of mTORC1-driven overproduction of apoB-containing triacylglyceride-rich lipoproteins by short-chain fatty acids, 4-phenylbutyric acid and (R)-α-lipoic acid, in human hepatocellular carcinoma cells.

    PubMed

    Roberts, Joseph L; He, Bo; Erickson, Anjeza; Moreau, Régis

    2016-03-01

    The activation of hepatic kinase mechanistic target of rapamycin complex 1 (mTORC1) is implicated in the development of obesity-related metabolic disorders. This study investigated the metabolic sequelae of mTORC1 hyperactivation in human hepatoma cells and the lipid-regulating mechanisms of two short-chain fatty acids: 4-phenylbutyric acid (PBA) and (R)-α-lipoic acid (LA). We created three stable cell lines that exhibit low, normal, or high mTORC1 activity. mTORC1 hyperactivation induced the expression of lipogenic (DGAT1 and DGAT2) and lipoprotein assembly (MTP and APOB) genes, thereby raising cellular triacylglyceride (TG) and exacerbating secretion of apoB-containing TG-rich lipoproteins. LYS6K2, a specific inhibitor of the p70 S6 kinase branch of mTORC1 signaling, reversed these effects. PBA and LA decreased secreted TG through distinct mechanisms. PBA repressed apoB expression (both mRNA and protein) and lowered secreted TG without mitigation of mTORC1 hyperactivity or activation of AMPK. LA decreased cellular and secreted TG by attenuating mTORC1 signaling in an AMPK-independent manner. LA did not regulate apoB expression but led to the secretion of apoB-containing TG-poor lipoproteins by repressing the expression of lipogenic genes, FASN, DGAT1, and DGAT2. Our studies provide new mechanistic insight into the hypolipidemic activity of PBA and LA in the context of mTORC1 hyperactivation and suggest that the short-chain fatty acids may aid in the prevention and treatment of hypertriglyceridemia. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Chronic treatment of (R)-α-lipoic acid reduces blood glucose and lipid levels in high-fat diet and low-dose streptozotocin-induced metabolic syndrome and type 2 diabetes in Sprague-Dawley rats.

    PubMed

    Ghelani, Hardik; Razmovski-Naumovski, Valentina; Nammi, Srinivas

    2017-06-01

    (R)- α -lipoic acid ( ALA ), an essential cofactor in mitochondrial respiration and a potential antioxidant, possesses a wide array of metabolic benefits including anti-obesity, glucose lowering, insulin-sensitizing, and lipid-lowering effects. In this study, the curative effects of ALA (100 mg/kg) on a spectrum of conditions related to metabolic syndrome and type 2 diabetes ( T2D ) were investigated in a high-fat diet (HFD)-fed and low-dose streptozotocin (STZ)-induced rat model of metabolic syndrome and T2D . The marked rise in the levels of glucose, triglycerides, total-cholesterol, LDL-cholesterol, and VLDL-cholesterol in the blood of HFD-fed and low-dose STZ-injected rats were significantly reduced by ALA treatment. Furthermore, ALA treatment significantly increased the serum HDL-cholesterol levels and tended to inhibit diabetes-induced weight reduction. Mathematical computational analysis revealed that ALA also significantly improved insulin sensitivity and reduced the risk of atherosclerotic lesions and coronary atherogenesis. This study provides scientific evidence to substantiate the use of ALA to mitigate the glucose and lipid abnormality in metabolic syndrome and T2D .

  7. α-Lipoic acid protects against the cytotoxicity and oxidative stress induced by cadmium in HepG2 cells through regeneration of glutathione by glutathione reductase via Nrf2/ARE signaling pathway.

    PubMed

    Shi, Chunli; Zhou, Xue; Zhang, Jiayu; Wang, Jiachun; Xie, Hong; Wu, Zhigang

    2016-07-01

    α-Lipoic acid (α-LA) is a potent natural antioxidant, which is capable of regenerating glutathione (GSH). However, the mechanisms by which α-LA regenerates reduced glutathione (rGSH) via the reduction of oxidized glutathione (GSSG) by glutathione reductase (GR) are still not well understood. In the present study, we investigated if α-LA replenished rGSH by GR via Nrf2/ARE signaling pathway in cadmium-treated HepG2 cells. We found that α-LA antagonized the oxidative damage and alleviated the cytotoxicity in cadmium-induced HepG2 cells by regeneration of rGSH. α-LA regenerated rGSH by activating Nrf2 signaling pathway via promoting the nuclear translocation of Nrf2, which upregulates the transcription of GR, and thus increased the activity of GR. Our results indicated that α-LA was an effective agent to antagonize the oxidative stress and alleviate the cytotoxicity in cadmium-treated HepG2 cells by regenerating rGSH through activating Nrf2 signaling pathway. Copyright © 2016. Published by Elsevier B.V.

  8. Tumor regression with a combination of drugs interfering with the tumor metabolism: efficacy of hydroxycitrate, lipoic acid and capsaicin.

    PubMed

    Schwartz, Laurent; Guais, Adeline; Israël, Maurice; Junod, Bernard; Steyaert, Jean-Marc; Crespi, Elisabetta; Baronzio, Gianfranco; Abolhassani, Mohammad

    2013-04-01

    Cellular metabolic alterations are now well described as implicated in cancer and some strategies are currently developed to target these different pathways. In previous papers, we demonstrated that a combination of molecules (namely alpha-lipoic acid and hydroxycitrate, i.e. Metabloc™) targeting the cancer metabolism markedly decreased tumor cell growth in mice. In this work, we demonstrate that the addition of capsaicin further delays tumor growth in mice in a dose dependant manner. This is true for the three animal model tested: lung (LLC) cancer, bladder cancer (MBT-2) and melanoma B16F10. There was no apparent side effect of this ternary combination. The addition of a fourth drug (octreotide) is even more effective resulting in tumor regression in mice bearing LLC cancer. These four compounds are all known to target the cellular metabolism not its DNA. The efficacy, the apparent lack of toxicity, the long clinical track records of these medications in human medicine, all points toward the need for a clinical trial. The dramatic efficacy of treatment suggests that cancer may simply be a disease of dysregulated cellular metabolism.

  9. Spectroscopic analysis of irradiated erythrocytes

    NASA Astrophysics Data System (ADS)

    Selim, Nabila S.; Desouky, Omar S.; Ismail, Nagla M.; Dakrory, Amira Z.

    2011-12-01

    The aim of the present work is to study the effect of gamma radiation on the lipid part of the erythrocyte membrane, and to test the efficiency of lipoic acid as a radioprotector. This effect was evaluated using electron paramagnetic resonance (EPR), and Fourier transform infrared (FT-IR) spectroscopy. The results showed an increase in the number of spin density by 14%, 22% and 65% after exposure to 25, 50 and 100 Gy respectively; whereas there was a decline in the obtained density after incubation with lipoic acid by a factor of approximately 32%. The FT-IR spectra of the irradiated erythrocytes samples showed a marked decrease in the intensity of all characteristic peaks, which increased as the irradiation dose increased. The second-derivative of these spectra, allow the conformationally sensitive membrane acyl chain methylene stretching modes to be separated from the protein (mostly hemoglobin) vibrations that dominate the spectra of intact cells. The 2850 cm -1 band showed changes in the band shape and position after exposure to 50 and 100 Gy. Therefore it can be concluded that the band at 2850 cm -1 only is useful in monitoring the radiation effect of the lipids cell membrane intact cells.

  10. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing.

    PubMed

    Shen, Tao; Jiang, Zhong-Liang; Li, Cong-Jun; Hu, Xiao-Chen; Li, Qing-Wang

    2016-04-01

    Alpha-lipoic acid (ALA) is known to be a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar spermatozoa and its antioxidant effect on boar spermatozoa during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0 or 10.0 mg/ml) of ALA were added to the extender used to freeze boar semen, and the effects on the quality and endogenous antioxidant enzyme activities of frozen-thawed spermatozoa were assessed. The results indicated that the addition of ALA to the extender resulted in a higher percentage of motile spermatozoa post-thaw (P < 0.05). The activities of superoxide dismutase, lactate dehydrogenase, glutamic-oxaloacetic transaminase and catalase improved after adding ALA to the extender (P < 0.05). Artificial insemination results showed that pregnancy rate and litter size were significantly higher at 6.0 mg/ml in the ALA group than in the control group (P < 0.05). In conclusion, ALA conferred a cryoprotective capacity to the extender used for boar semen during the process of freezing-thawing, and the optimal concentration of ALA for the frozen extender was 6.0 mg/ml.

  11. Growth of fluorescence gold clusters using photo-chemically activated ligands

    NASA Astrophysics Data System (ADS)

    Mishra, Dinesh; Aldeek, Fadi; Michael, Serge; Palui, Goutam; Mattoussi, Hedi

    2016-03-01

    Ligands made of lipoic acid (LA) appended with a polyethylene glycol (PEG) chain have been used in the aqueous phase growth of luminescent gold clusters with distinct emission from yellow to near-IR, using two different routes. In the first route, the gold-ligand complex was chemically reduced using sodium borohydride in alkaline medium, which gave near- IR luminescent gold clusters with maximum emission around 745 nm. In the second method, LA-PEG ligand was photochemically modified to a mixture of thiols, oligomers and oxygenated species under UV-irradiation, which was then used as both reducing agent and stabilizing ligand. By adjusting the pH, temperature, and time of the reaction, we were able to obtain clusters with two distinct emission properties. Refluxing the gold-ligand complex in alkaline medium in the presence of excess ligand gave yellow emission within the first two hours and the emission shifted to red after overnight reaction. Mass spectrometry and chemical assay were used to understand the photo-chemical transformation of Lipoic Acid (LA). Mass spectroscopic studies showed the photo-irradiated product contains thiols, oligomers (dimers, trimers and tetramers) as well as oxygenated species. The amount of thiol formed under different conditions of irradiation was estimated using Ellman's assay.

  12. Alpha-lipoic acid attenuates endoplasmic reticulum stress-induced insulin resistance by improving mitochondrial function in HepG2 cells.

    PubMed

    Lei, Lin; Zhu, Yiwei; Gao, Wenwen; Du, Xiliang; Zhang, Min; Peng, Zhicheng; Fu, Shoupeng; Li, Xiaobing; Zhe, Wang; Li, Xinwei; Liu, Guowen

    2016-10-01

    Alpha-lipoic acid (ALA) has been reported to have beneficial effects for improving insulin sensitivity. However, the underlying molecular mechanism of the beneficial effects remains poorly understood. Endoplasmic reticulum (ER) stress and mitochondrial dysfunction are considered causal factors that induce insulin resistance. In this study, we investigated the effect of ALA on the modulation of insulin resistance in ER-stressed HepG2 cells, and we explored the potential mechanism of this effect. HepG2 cells were incubated with tunicamycin (Tun) for 6h to establish an ER stress cell model. Tun treatment induced ER stress, mitochondrial dysfunction and insulin resistance. Interestingly, ALA had no significant effect on ER stress signals. Pretreatment of the ER stress cell model with ALA for 24h improved insulin sensitivity, restored the expression levels of mitochondrial oxidative phosphorylation (OXPHOS) complexes and increased intracellular ATP production. Moreover, ALA augmented the β-oxidation capacity of the mitochondria. Importantly, ALA treatment could decrease oligomycin-induced mitochondrial dysfunction and then improved insulin resistance. Taken together, our data suggest that ALA prevents ER stress-induced insulin resistance by enhancing mitochondrial function. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Treatment modalities for burning mouth syndrome: a systematic review.

    PubMed

    de Souza, Isadora Follak; Mármora, Belkiss Câmara; Rados, Pantelis Varvaki; Visioli, Fernanda

    2018-06-01

    In the burning mouth syndrome (BMS), patients experience a burning sensation in the oral cavity with no associated injury or clinical manifestation. The etiology of this condition is still poorly understood, and therefore, treatment is challenging. The aim of this study is to perform a systematic review of treatment possibilities described in the literature for BMS. PubMed, Embase, and SciELO databases were searched for randomized clinical trials published between 1996 and 2016. Following application of inclusion and exclusion criteria, 29 papers were analyzed and divided into five subcategories according to the type of treatment described: antidepressants, alpha-lipoic acid, phytotherapeutic agents, analgesic and anti-inflammatory agents, and non-pharmacological therapies. In each category, the results found were compared with regard to the methodology employed, sample size, assessment method, presence or absence of adverse effects, and treatment outcomes. The analysis revealed that the use of antidepressants and alpha-lipoic acid has been showing promising results; however, more studies are necessary before we can have a first-line treatment strategy for patients with BMS. To review systematically the literature about Burning Mouth Syndrome treatment may aid the clinicians to choose the treatment modality to improve patients symptoms based on the best evidence.

  14. The effect of acetyl-L-carnitine and R-alpha-lipoic acid treatment in ApoE4 mouse as a model of human Alzheimer's disease.

    PubMed

    Shenk, Justin C; Liu, Jiankang; Fischbach, Kathryn; Xu, Kui; Puchowicz, Michel; Obrenovich, Mark E; Gasimov, Eldar; Alvarez, Ludis Morales; Ames, Bruce N; Lamanna, Joseph C; Aliev, Gjumrakch

    2009-08-15

    We measured age-dependent effects of human ApoE4 on cerebral blood flow (CBF) using ApoE4 transgenic mice compared to age-matched wild-type (WT) mice by use of [(14)C] iodoantipyrene autoradiography. ApoE4 associated factors reduce CBF gradually to create brain hypoperfusion when compared to WT, and the differences in CBF are greatest as animals age from 6-weeks to 12-months. Transmission electron microscopy with colloidal gold immunocytochemistry showed structural damage in young and aged microvessel endothelium of ApoE4 animals extended to the cytoplasm of perivascular cells, perivascular nerve terminals and hippocampal neurons and glial cells. These abnormalities coexist with mitochondrial structural alteration and mitochondrial DNA overproliferation and/or deletion in all brain cellular compartments. Spatial memory and temporal memory tests showed a trend in improving cognitive function in ApoE4 mice fed selective mitochondrial antioxidants acetyl-l-carnitine and R-alpha-lipoic acid. Our findings indicate that ApoE4 genotype-induced mitochondrial changes and associated structural damage may explain age-dependent pathology seen in AD, indicating potential for novel treatment strategies in the near future.

  15. Alpha lipoic acid (ALA) modulates expression of apoptosis associated proteins in hippocampus of rats exposed during postnatal period to sodium arsenite (NaAsO2).

    PubMed

    Dixit, Shilpi; Dhar, Pushpa; Mehra, Raj D

    2015-01-01

    The present study focused on the role of exogenous alpha lipoic acid (ALA) in amelioration of inorganic arsenic ( iAs ) induced effects on apoptosis and apoptosis associated proteins in developing rat hippocampus. NaAsO 2 (1.5/2.0 mg/kg bw) alone or along with ALA (70 mg/kg bw) was administered to rat pups (experimental groups) by intraperitoneal (i.p.) route from postnatal day (PND) 4-15. Controls received no treatment/distilled water/ALA. On PND 16, the animals were perfusion fixed and the brains were processed for paraffin embedding (CV and TUNEL staining) and cryopreservation (immunohistochemistry). The fresh brain tissue was used for Western blotting. Significant increase was observed in TUNEL positive cells and Bax (pro-apoptotic protein) expression in hippocampal sub-regions of iAs alone treated groups, whereas Bcl-2 expression was intensified in animals receiving ALA with iAs . Densitometric analysis (Western blots) revealed optimal restoration of Bax and Bcl-2 ratio in animals receiving ALA with iAs , thereby suggesting the protective role of ALA in iAs induced developmental neurotoxicity.

  16. Glutaredoxin S15 Is Involved in Fe-S Cluster Transfer in Mitochondria Influencing Lipoic Acid-Dependent Enzymes, Plant Growth, and Arsenic Tolerance in Arabidopsis1[OPEN

    PubMed Central

    2016-01-01

    Glutaredoxins (Grxs) are small proteins that function as oxidoreductases with roles in deglutathionylation of proteins, reduction of antioxidants, and assembly of iron-sulfur (Fe-S) cluster-containing enzymes. Which of the 33 Grxs in Arabidopsis (Arabidopsis thaliana) perform roles in Fe-S assembly in mitochondria is unknown. We have examined in detail the function of the monothiol GrxS15 in plants. Our results show its exclusive mitochondrial localization, and we are concluding it is the major or only Grx in this subcellular location. Recombinant GrxS15 has a very low deglutathionylation and dehydroascorbate reductase activity, but it binds a Fe-S cluster. Partially removing GrxS15 from mitochondria slowed whole plant growth and respiration. Native GrxS15 is shown to be especially important for lipoic acid-dependent enzymes in mitochondria, highlighting a putative role in the transfer of Fe-S clusters in this process. The enhanced effect of the toxin arsenic on the growth of GrxS15 knockdown plants compared to wild type highlights the role of mitochondrial glutaredoxin Fe-S-binding in whole plant growth and toxin tolerance. PMID:26672074

  17. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy

    PubMed Central

    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin

    2016-01-01

    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  18. Triple-combination treatment with oral α-lipoic acid, betamethasone injection, and NB-UVB for non-segmental progressive vitiligo.

    PubMed

    Li, Li; Li, Lu; Wu, Yan; Gao, Xing-Hua; Chen, Hong-Duo

    2016-06-01

    Vitiligo is an acquired depigmenting disease with uncertain etiopathogenesis and the treatment modalities need to be consistently updated. To evaluate a triple-combination treatment with oral α-lipoic acid (ALA), betamethasone injection, and narrowband ultraviolet B (NB-UVB) on vitiligo. Patients with non-segmental and progressive vitiligo lesions were randomly assigned to two groups. The treatment group and the control group were respectively treated with oral ALA and placebo, in combination with betamethasone injection and NB-UVB. The effectiveness and adverse events were evaluated by investigators and patients before and after treatment. Fifty non-segmental progressive vitiligo patients were enrolled in the study. The treatment period was 6 months. In treatment group, over 40% patients achieved > 50% improvement and ≥ 5 satisfaction score by 3-month therapy (M3). This percentage increased to 90% at M6. Treatment group achieved better efficacy than control group at M3, while no difference was seen at M6. The combined treatment with oral ALA, betamethasone injection, and NB-UVB was effective and safe on non-segmental progressive vitiligo. ALA could accelerate the initial response of repigmentation.

  19. Lipoic acid biosynthesis defects.

    PubMed

    Mayr, Johannes A; Feichtinger, René G; Tort, Frederic; Ribes, Antonia; Sperl, Wolfgang

    2014-07-01

    Lipoate is a covalently bound cofactor essential for five redox reactions in humans: in four 2-oxoacid dehydrogenases and the glycine cleavage system (GCS). Two enzymes are from the energy metabolism, α-ketoglutarate dehydrogenase and pyruvate dehydrogenase; and three are from the amino acid metabolism, branched-chain ketoacid dehydrogenase, 2-oxoadipate dehydrogenase, and the GCS. All these enzymes consist of multiple subunits and share a similar architecture. Lipoate synthesis in mitochondria involves mitochondrial fatty acid synthesis up to octanoyl-acyl-carrier protein; and three lipoate-specific steps, including octanoic acid transfer to glycine cleavage H protein by lipoyl(octanoyl) transferase 2 (putative) (LIPT2), lipoate synthesis by lipoic acid synthetase (LIAS), and lipoate transfer by lipoyltransferase 1 (LIPT1), which is necessary to lipoylate the E2 subunits of the 2-oxoacid dehydrogenases. The reduced form dihydrolipoate is reactivated by dihydrolipoyl dehydrogenase (DLD). Mutations in LIAS have been identified that result in a variant form of nonketotic hyperglycinemia with early-onset convulsions combined with a defect in mitochondrial energy metabolism with encephalopathy and cardiomyopathy. LIPT1 deficiency spares the GCS, and resulted in a combined 2-oxoacid dehydrogenase deficiency and early death in one patient and in a less severely affected individual with a Leigh-like phenotype. As LIAS is an iron-sulphur-cluster-dependent enzyme, a number of recently identified defects in mitochondrial iron-sulphur cluster synthesis, including NFU1, BOLA3, IBA57, GLRX5 presented with deficiency of LIAS and a LIAS-like phenotype. As in DLD deficiency, a broader clinical spectrum can be anticipated for lipoate synthesis defects depending on which of the affected enzymes is most rate limiting.

  20. Alpha Lipoic Acid Plus Omega-3 Fatty Acids for Vestibulodynia Associated With Painful Bladder Syndrome.

    PubMed

    Murina, Filippo; Graziottin, Alessandra; Felice, Raffaele; Gambini, Dania

    2017-03-01

    This study assessed the effectiveness of alpha lipoic acid (ALA) plus omega-3 polyunsaturated fatty acids (n-3 PUFAs) in combination with amitriptyline therapy in patients with vestibulodynia/painful bladder syndrome (VBD/PBS). Women with VBD/PBS were randomly assigned to receive amitriptyline or amitriptyline plus a commercially available preparation (ALAnerv Age; Alfa Wassermann, Bologna, Italy) containing, in 2 capsules, ALA 600 mg plus docosahexaenoic acid 250 mg and eicosapentaenoic acid 16.67 mg. Symptoms of burning and pain were assessed using a 10-cm visual analog scale and the short form of the McGill-Melzack Pain Questionnaire. Among 84 women who were randomized, the mean ± standard deviation dose of amitriptyline was 21.7 ± 6.6 mg/day, without statistical difference between the two groups. Pain, as assessed using both the pain rating index of the visual analog scale and the short-form McGill Pain Questionnaire, decreased significantly in both trial groups, with a greater effect seen with the addition of ALA and n-3 PUFAs. The addition of ALA/n-3 PUFAs to amitriptyline treatment was also associated with improvements in dyspareunia and pelvic floor muscle tone. The overall incidence of adverse events was low, and none led to treatment discontinuation. The addition of ALA/n-3 PUFAs to amitriptyline treatment in patients with VBD/PBS appears to improve outcomes and may allow for a lower dosage of amitriptyline, which may lead to fewer adverse effects. Copyright © 2017 The Society of Obstetricians and Gynaecologists of Canada/La Société des obstétriciens et gynécologues du Canada. Published by Elsevier Inc. All rights reserved.

  1. Immunomodulatory activities of alpha lipoic acid with a special focus on its efficacy in preventing miscarriage.

    PubMed

    Monastra, Giovanni; De Grazia, Sara; Cilaker Micili, Serap; Goker, Asli; Unfer, Vittorio

    2016-12-01

    Alpha lipoic acid (ALA) is an essential mitochondrial co-factor and, as a free molecule, it can exert multi-level immunomodulatory functions. Both ALA and its reduced form, dihydrolipoic acid (DHLA), are believed to be able to chelate heavy metals, to regenerate essential antioxidants and to repair important molecules damaged by oxidation. The largest part of the effects of ALA/DHLA couple can be explained by a specific stimulatory activity on Nrf2-dependent gene transcription and by the inhibition of NF-kB activity. These features have prompted its use as a drug for several diseases. Areas covered: This article surveys the main features of ALA/DHLA and its therapeutic effects. Its complex and differentiated function cannot simply be reduced to anti-inflammatory, antioxidant and detoxifying action. We highlight its capability to finely modulate several physiological pathways when unbalanced. In particular, we focus our attention on pregnancy, in relation to ALA administration by oral route and by a new formulation for vaginal delivery, in patients with threatened miscarriage. Expert opinion: Future efforts should be devoted to explaining carefully ALA/DHLA mechanism of action to reactivate the physiological balance when modified during pregnancy. On the other hand, ALA safety in pregnant women and its pharmacokinetics by vaginal route, have to be studied in depth. Moreover, ALA efficacy has to be confirmed in a much larger sample of patients.

  2. Effect of combined acetylmethionine, cyanocobalamin and α-lipoic acid on hepatic metabolism in high-yielding dairy cow.

    PubMed

    Fiore, Enrico; Perillo, Laura; Piccione, Giuseppe; Gianesella, Matteo; Bedin, Silvia; Armato, Leonardo; Giudice, Elisabetta; Morgante, Massimo

    2016-11-01

    The aim of the study reported in this Research Communication was to investigate the effect of a combined acetylmethionine, cyanocobalamin and α-lipoic acid treatment, on some metabolic parameters of early lactating high-yielding dairy cows. Thirty cows were randomly divided into two groups: experimental group (EG, n = 20) and control group (CG, n = 10). EG received 20 ml of treatment and CG received 20 ml of placebo. The treatments were administered for seven times every 2 d. Blood samples were collected from all cows at 3 time points: 10 ± 2, 30 ± 2 and 50 ± 2 d postpartum. Glucose, β-hydroxybutyrate (BHB), nonesterified fatty acids (NEFA), triglycerides, total cholesterol (TC), alanine aminotransferase (ALT), aspartate aminotransferase (AST), γ-glutamiltransferase (GGT), total bilirubin (TB), conjugated bilirubin (CB), total proteins (TP), globulins, albumin and urea concentrations were determined. Two-way repeated measure analysis of variance was applied. Significant differences in the values of glucose, BHB, NEFA, triglycerides, TC, AST and urea were found between EG and CG. Moreover, the increased glucose, TC, ALT, GGT, TP and globulins, and the reduced BHB, NEFA, AST, triglycerides, TB, CB and urea concentrations were evident in both groups, but the changes were more pronounced in EG. Our findings indicate that our treatment positively influenced liver metabolism in high-yielding dairy cows.

  3. Effect of γ-Cyclodextrin Inclusion Complex on the Absorption of R-α-Lipoic Acid in Rats

    PubMed Central

    Uchida, Ryota; Iwamoto, Kosuke; Nagayama, Suetada; Miyajima, Atsushi; Okamoto, Hinako; Ikuta, Naoko; Fukumi, Hiroshi; Terao, Keiji; Hirota, Takashi

    2015-01-01

    R-α-lipoic acid (RLA) is an endogenous organic acid, and works as a cofactor for mitochondrial enzymes and as a kind of antioxidant. Inclusion complexes of RLA with α-, β- or γ-cyclodextrins (CD) were prepared and orally administered as a suspension to rats. Among them, RLA/γ-CD showed the highest plasma exposure, and its area under the plasma concentration-time curve (AUC) of RLA was 2.2 times higher than that after oral administration of non-inclusion RLA. On the other hand, the AUC after oral administration of non-inclusion RLA and RLA/γ-CD to pylorus-ligated rats did not differ. However, the AUC after intraduodenal administration of RLA/γ-CD was 5.1 times higher than that of non-inclusion RLA, and was almost comparable to the AUC after intraduodenal administration of RLA-Na solution. Furthermore, the AUC after intraduodenal administration of RLA/γ-CD was not affected by biliary ligation or co-administration of an amylase inhibitor. These findings demonstrated that RLA was absorbed from the small intestine effectively when orally administered as a γ-CD inclusion complex, which could be easily dissolved in the lumen of the intestine. In conclusion, γ-CD inclusion complex is an appropriate formulation for supplying RLA as a drug or nutritional supplement with respect to absorption. PMID:25946345

  4. Methylenedioxymethamphetamine inhibits mitochondrial complex I activity in mice: a possible mechanism underlying neurotoxicity

    PubMed Central

    Puerta, Elena; Hervias, Isabel; Goñi-Allo, Beatriz; Zhang, Steven F; Jordán, Joaquín; Starkov, Anatoly A; Aguirre, Norberto

    2010-01-01

    Background and purpose: 3,4-methylenedioxymethamphetamine (MDMA) causes a persistent loss of dopaminergic cell bodies in the substantia nigra of mice. Current evidence indicates that such neurotoxicity is due to oxidative stress but the source of free radicals remains unknown. Inhibition of mitochondrial electron transport chain complexes by MDMA was assessed as a possible source. Experimental approach: Activities of mitochondrial complexes after MDMA were evaluated spectrophotometrically. In situ visualization of superoxide production in the striatum was assessed by ethidium fluorescence and striatal dopamine levels were determined by HPLC as an index of dopaminergic toxicity. Key results: 3,4-methylenedioxymethamphetamine decreased mitochondrial complex I activity in the striatum of mice, an effect accompanied by an increased production of superoxide radicals and the inhibition of endogenous aconitase. α-Lipoic acid prevented superoxide generation and long-term toxicity independent of any effect on complex I inhibition. These effects of α-lipoic acid were also associated with a significant increase of striatal glutathione levels. The relevance of glutathione was supported by reducing striatal glutathione content with L-buthionine-(S,R)-sulfoximine, which exacerbated MDMA-induced dopamine deficits, effects suppressed by α-lipoic acid. The nitric oxide synthase inhibitor, NG-nitro-L-arginine, partially prevented MDMA-induced dopamine depletions, an effect reversed by L-arginine but not D-arginine. Finally, a direct relationship between mitochondrial complex I inhibition and long-term dopamine depletions was found in animals treated with MDMA in combination with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. Conclusions and implications: Inhibition of mitochondrial complex I following MDMA could be the source of free radicals responsible for oxidative stress and the consequent neurotoxicity of this drug in mice. This article is commented on by Moncada, pp. 217–219 of this issue. To view this commentary visit http://dx.doi.org/10.1111/j.1476-5381.2010.00706.x and to view related papers in this issue by Pravdic et al. and Kurz et al. visit http://dx.doi.org/10.1111/j.1476-5381.2010.00698.x and http://dx.doi.org/10.1111/j.1476-5381.2010.00656.x PMID:20423338

  5. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by DL-α-Lipoic Acid.

    PubMed

    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester C S; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba

    2015-02-18

    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3-1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1-3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants DL-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3-MST/H2S pathway, and speculate that this may contribute to the pathogenesis of hyperglycemic endothelial cell dysfunction. We also suggest that therapy with H2S donors, or treatment with the combination of 3-MP and lipoic acid may be beneficial in improving angiogenesis and bioenergetics in hyperglycemia.

  6. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by dl-α-Lipoic Acid

    PubMed Central

    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester CS; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba

    2015-01-01

    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3–1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1–3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants dl-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3-MST/H2S pathway, and speculate that this may contribute to the pathogenesis of hyperglycemic endothelial cell dysfunction. We also suggest that therapy with H2S donors, or treatment with the combination of 3-MP and lipoic acid may be beneficial in improving angiogenesis and bioenergetics in hyperglycemia. PMID:25715337

  7. The analysis and assessment of the effect of selected endo- and exogenous substances on prevention and treatment of selected conditions and injuries within the musculoskeletal system.

    PubMed

    Tomaszewski, Wiesław E; Obmiński, Zbigniew

    2017-04-12

    The aim of the presented report, prepared based on the results of the newest studies available in the reference sources, is the analysis and assessment of the important endo- and exogenous substances, whose role and significance in prevention and complex treatment of civilization-related diseases (including the pathological conditions and injuries of the musculoskeletal system) can be essential and significantly contribute to the improvement of the efficacy of the accepted treatment approach. Three substances, namely a-lipoic acid, y-linolenic acid and a-linoleic acid were subject to a detailed analysis and assessment.

  8. Robust and specific ratiometric biosensing using a copper-free clicked quantum dot-DNA aptamer sensor

    NASA Astrophysics Data System (ADS)

    Zhang, Haiyan; Feng, Guoqiang; Guo, Yuan; Zhou, Dejian

    2013-10-01

    We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate.We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate. Electronic supplementary information (ESI) available: Details on the synthesis, purification and characterisation of the DHLA-PEG600-N3, cyclooctyne-DNA, and QD-TBA20 conjugates as well as all supporting figures and tables. See DOI: 10.1039/c3nr02897f

  9. Enhancing the quality and lipid stability of chicken nuggets using natural antioxidants.

    PubMed

    Arshad, Muhammad Sajid; Imran, Ali; Nadeem, Muhammad Tahir; Sohaib, Muhammad; Saeed, Farhan; Anjum, Faqir Muhammad; Kwon, Joong-Ho; Hussain, Shahzad

    2017-06-08

    Current day consumers prefer natural antioxidants to synthetic antioxidants because they are more active. However, the activity generally depends on the specific condition and composition of food. The aim of this study was to investigate the effect of wheat germ oil and α-lipoic acid on the quality characteristics, antioxidant status, fatty acid profile, and sensory attributes of chicken nuggets. Six types of diets were prepared for feeding the chickens to evaluate the quality of nuggets made from the leg meat of these experimental animals. These included control, diet enriched with wheat germ oil (WGO), which is a rich natural source of α-tocopherol (AT), diet with added AT or α-lipoic acid (ALA), diet with a combination of either ALA and WGO (ALA + WGO) or ALA and synthetic AT (ALA + AT). ALA has great synergism with synthetic as well as natural AT (WGO). The diet with WGO and ALA showed the best potential with respect to both antioxidant activity and total phenolic content. HPLC results revealed that the chicken nuggets made from WGO + ALA group showed maximum deposition of AT and ALA. The stability of the nuggets from control group was found to be significantly lower than that of nuggets from the WGO + ALA group. Total fatty acid content too was higher in the nuggets from this group. The poly unsaturated fatty acids (PUFA) were found to be higher in the nuggets from the groups fed with a combination of natural and synthetic antioxidants. It is concluded that the combination of natural and synthetic antioxidants in the animal feed exerts a synergistic effect in enhancing the stability and quality of chicken nuggets.

  10. α-lipoic acid ameliorates n-3 highly-unsaturated fatty acids induced lipid peroxidation via regulating antioxidant defenses in grass carp (Ctenopharyngodon idellus).

    PubMed

    Shi, Xiao-Chen; Jin, Ai; Sun, Jian; Yang, Zhou; Tian, Jing-Jing; Ji, Hong; Yu, Hai-Bo; Li, Yang; Zhou, Ji-Shu; Du, Zhen-Yu; Chen, Li-Qiao

    2017-08-01

    This study evaluated the protective effect of α-lipoic acid (LA) on n-3 highly unsaturated fatty acids (HUFAs)-induced lipid peroxidation in grass carp. The result indicated that diets with n-3 HUFAs increased the production of malondialdehyde (MDA) (P < 0.05), thereby inducing lipid peroxidation in liver and muscle of grass carp. Meanwhile, compared with control group, the hepatosomatic index (HSI) and kidney index (KI) of grass carp were markedly increased in n-3 HUFAs-only group. However, diets with LA remarkably inhibited the n-3 HUFAs-induced increase of HSI, KI, and MDA level in serum, liver and muscle (P < 0.05). Interestingly, LA also significantly elevated the ratio of total n-3 HUFAs in fatty acid composition of muscle and liver (P < 0.05). Furthermore, LA significantly promoted the activity of antioxidant enzymes in serum, muscle and liver of grass carp (P < 0.05), including superoxide dismutase (SOD), catalase (CAT), and glutathione s-transferase (GST). The further results showed that LA significantly elevated mRNA expression of antioxidant enzymes with promoting the mRNA expression of NF-E2-related nuclear factor 2 (Nrf2) and decreasing Kelch-like-ECH-associated protein 1 (Keap1) mRNA level. From the above, these results suggested that LA could attenuate n-3 HUFAs-induced lipid peroxidation, remit the toxicity of the lipid peroxidant, and protect n-3 HUFAs against lipid peroxidation to promote its deposition in fish, likely strengthening the activity of antioxidant enzymes through regulating mRNA expressions of antioxidant enzyme genes via mediating Nrf2-Keap1 signaling pathways. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Detection in vivo of a Novel Endogenous Etheno DNA Adduct Derived from Arachidonic Acid and the Effects of Antioxidants on Its Formation

    PubMed Central

    Cruz, Idalia M.; Pondicherry, Sharanya R.; Fernandez, Aileen; Schultz, Casey L.; Yang, Peiying; Pan, Jishen; Desai, Dhimant; Krzeminski, Jacek; Amin, Shantu; Christov, Plamen P.; Hara, Yukihiko; Chung, Fung-Lung

    2014-01-01

    Previous studies showed that the 7-(1′,2′-dihydroxyheptyl) substituted etheno DNA adducts are products from reactions with epoxide of (E)-4-hydroxy-2-nonenal (HNE), an oxidation product of ω-6 polyunsaturated fatty acids (PUFAs). In this work, we report the detection of 7-(1′,2′-dihydroxyheptyl)-1,N6-ethenodeoxyadenosine (DHHedA) in rodent and human tissues by two independent methods: a 32P-postlabeling/HPLC method and an isotope dilution liquid chromatography electrospray ionization tandem mass spectrometry method (ID-LC-ESI-MS/MS), demonstrating for the first time that DHHedA is a background DNA lesion in vivo. We showed that DHHedA can be formed upon incubation of arachidonic acid (AA) with deoxyadenosine (dA), supporting the notion that ω-6 PUFAs are the endogenous source of DHHedA formation. Because cyclic adducts are derived from the oxidation of PUFAs, we subsequently examined the effects of antioxidants, α-lipoic acid, Polyphenon E and vitamin E, on the formation of DHHedA and γ-hydroxy-1,N2-propanodeoxyguanosine (γ-OHPdG), a widely studied acrolein-derived adduct arising from oxidized PUFAs, in the livers of Long Evans Cinnamon (LEC) rats. LEC rats are inflicted with elevated lipid peroxidation and prone to the development of hepatocellular carcinomas. The results showed that while the survival of LEC rats increased significantly by α-lipoic acid, none of the antioxidants inhibited the formation of DHHedA and only Polyphenon E decreased the formation of γ-OHPdG. In contrast, vitamin E caused a significant increase in the formation of both γ-OHPdG and DHHedA in the livers of LEC rats. PMID:24816294

  12. Myoinositol combined with alpha-lipoic acid may improve the clinical and endocrine features of polycystic ovary syndrome through an insulin-independent action.

    PubMed

    De Cicco, Simona; Immediata, Valentina; Romualdi, Daniela; Policola, Caterina; Tropea, Anna; Di Florio, Christian; Tagliaferri, Valeria; Scarinci, Elisa; Della Casa, Silvia; Lanzone, Antonio; Apa, Rosanna

    2017-09-01

    The aim of our study was to investigate the effects of a combined treatment with alpha-lipoic acid (ALA) and myoinositol (MYO) on clinical, endocrine and metabolic features of women affected by polycystic ovary syndrome (PCOS). In this pilot cohort study, forty women with PCOS were enrolled and clinical, hormonal and metabolic parameters were evaluated before and after a six-months combined treatment with ALA and MYO daily. Studied patients experienced a significant increase in the number of cycles in six months (p < 0.01). The free androgen index (FAI), the mean androstenedione and DHEAS levels significantly decreased after treatment (p < 0.05). Mean SHBG levels significantly raised (p < 0.01). A significant improvement in mean Ferriman-Gallwey (F-G) score (p < 0.01) and a significant reduction of BMI (p < 0.01) were also observed. A significant reduction of AMH levels, ovarian volume and total antral follicular count were observed in our studied women (p< 0.05). No significant changes occurred in gluco-insulinaemic and lipid parameters after treatment. The combined treatment of ALA and MYO is able to restore the menstrual pattern and to improve the hormonal milieu of PCOS women, even in the absence of apparent changes in insulin metabolism.

  13. Effects of alpha-lipoic acid supplementation on growth performance, antioxidant capacity and biochemical parameters for ammonia-exposed broilers.

    PubMed

    Lu, Min; Bai, Jie; Wei, Fengxian; Xu, Bin; Sun, Quanyou; Li, Jie; Wang, Gaili; Tang, Xiangfang; Zhang, Hongfu; Yin, Qingqiang; Li, Shaoyu

    2017-08-01

    In order to estimate the effect of alpha-lipoic acid (LA) supplementation on relieving ammonia stress of broilers, 180 22-day-old male broilers were assigned to three groups, six replicates in each group and 10 birds per replicate. The three groups were: (1) a control group without ammonia stress; (2) exposure to 70 ppm atmospheric ammonia (AM); (3) exposure to 70 ppm atmospheric ammonia and administration of 300 mg/kg LA (AM + LA). The experimental period was 3 weeks. Results showed that average daily weight gain was increased and feed conversion ratio was decreased in the AM + LA group, compared with the AM group (P < 0.05). Total superoxide dismutase and glutathione peroxidase activities in serum, and glutathione content in liver were higher in the AM + LA group than that in the AM group (P < 0.05); however, serum malondialdehyde content was decreased by LA addition (P < 0.05). Additionally, serum glutamic-pyruvic transaminase, creatine kinase and lactate dehydrogenase activities were reduced and albumin level was increased by LA addition (P < 0.05). In conclusion, LA addition could relieve ammonia stress to restore broiler production performance to normal levels. © 2016 Japanese Society of Animal Science.

  14. α-Lipoic acid attenuates transplacental nicotine-induced germ cell and oxidative DNA damage in adult mice.

    PubMed

    Anto, Santo K; Koyada, Naresh; Khan, Sabbir; Jena, Gopabandhu

    2016-11-01

    Smoking during pregnancy is associated with numerous fetal and developmental complications and reproductive dysfunctions in the offspring. Nicotine is one of the key chemicals of tobacco responsible for addiction. The present study was aimed to investigate the protective role of α-lipoic acid (ALA) during the transplacental nicotine-induced germ cell and DNA damage in the offspring of Swiss mice. Pregnant mice were treated with nicotine (20 mg/kg/day) in drinking water from 10 to 20 days of gestation period, and ALA (120 mg/kg/day) was administered orally for the same period. Endpoint of evaluation includes general observations at delivery and throughout the study, litter weight and size, sperm count and sperm head morphology, while structural damages and protein expression were assessed by histology and immunohistochemistry, respectively. Maternal nicotine exposure led to decreased growth rate, litter and testicular weight, testosterone level, 3β-HSD expression and sperm count as well as increased sperm head abnormalities, micronucleus frequency and 8-oxo-dG positive cells, and the effects have been restored by ALA supplementation. The present study clearly demonstrated that ALA ameliorates nicotine-associated oxidative stress, DNA damage and testicular toxicity in the offspring by improving steroidogenesis, spermatogenesis and sperm count.

  15. Colonic and Hepatic Modulation by Lipoic Acid and/or N-Acetylcysteine Supplementation in Mild Ulcerative Colitis Induced by Dextran Sodium Sulfate in Rats

    PubMed Central

    Moura, Fabiana Andréa; de Andrade, Kívia Queiroz; de Araújo, Orlando Roberto Pimentel; Santos, Juliana Célia de Farias

    2016-01-01

    Lipoic acid (LA) and N-acetylcysteine (NAC) are antioxidant and anti-inflammatory agents that have not yet been tested on mild ulcerative colitis (UC). This study aims to evaluate the action of LA and/or NAC, on oxidative stress and inflammation markers in colonic and hepatic rat tissues with mild UC, induced by dextran sodium sulfate (DSS) (2% w/v). LA and/or NAC (100 mg·kg·day−1, each) were given, once a day, in the diet, in a pretreatment phase (7 days) and during UC induction (5 days). Colitis induction was confirmed by histological and biochemical analyses (high performance liquid chromatography, spectrophotometry, and Multiplex®). A redox imbalance occurred before an immunological disruption in the colon. NAC led to a decrease in hydrogen peroxide (H2O2), malondialdehyde (MDA) levels, and myeloperoxidase activity. In the liver, DSS did not cause damage but treatments with both antioxidants were potentially harmful, with LA increasing MDA and LA + NAC increasing H2O2, tumor necrosis factor alpha, interferon gamma, and transaminases. In summary, NAC exhibited the highest colonic antioxidant and anti-inflammatory activity, while LA + NAC caused hepatic damage. PMID:27957238

  16. Regeneration of glutathione by α-lipoic acid via Nrf2/ARE signaling pathway alleviates cadmium-induced HepG2 cell toxicity.

    PubMed

    Zhang, Jiayu; Zhou, Xue; Wu, Wenbo; Wang, Jiachun; Xie, Hong; Wu, Zhigang

    2017-04-01

    Alpha-lipoic acid (α-LA) is an important antioxidant that is capable of regenerating other antioxidants, such as glutathione (GSH). However, the underlying molecular mechanism by which α-LA regenerates GSH remains poorly understood. The current study aimed to investigate whether α-LA regenerates GSH by activation of Nrf2 to alleviate cadmium-induced cytotoxicity in HepG2 cells. In the present study, we found that cadmium induced cell death by depletion of GSH through inactivation of Nrf2. Addition of α-LA to cadmium-treated cells reactivated Nrf2 and regenerated GSH through elevating the Nrf2-downstream genes γ-glutamate-cysteine ligase (γ-GCL) and GR, both of which are key enzymes for GSH synthesis. However, blocking Nrf2 with brusatol in the cells co-treated with α-LA and cadmium reduced the mRNA and the protein levels of γ-GCL and GR, thus suppressed GSH regeneration by α-LA. Our results indicated that α-LA activated Nrf2 signaling pathway, which upregulated the transcription of the enzymes for GSH synthesis and therefore GSH contents to alleviate cadmium-induced cytotoxicity in HepG2 cells. Copyright © 2017. Published by Elsevier B.V.

  17. AMPK/p53 Axis Is Essential for α-Lipoic Acid-Regulated Metastasis in Human and Mouse Colon Cancer Cells.

    PubMed

    Park, Sunmi; Choi, Seung Kug; Choi, Yura; Moon, Hyun-Seuk

    2015-10-01

    α-Lipoic acid (ALA) has an anticancer property of lung, cervix, and prostate cancer cells. However, direct evidence that ALA contributes to the development of colon cancer has not been fully elucidated. In addition, no previous studies have evaluated whether ALA may regulate malignant potential, such as adhesion, invasion, and colony formation of colon cancer cells. To address the aforementioned questions, we conducted in vitro ALA signaling studies using human (HT29) and mouse (MCA38) colon cancer cell lines. We observed that cell proliferation is reduced by ALA administration in a dose-dependent manner in human and mouse colon cancer cell lines. Specifically, 0.5 to 1 mM concentration of ALA significantly decreased cell proliferation when compared with control. Similarly, we found that ALA downregulates adhesion, invasion, and colony formation. Finally, we observed that ALA activates p53 and AMPK signaling pathways in human and mouse colon cancer cells. We found for the first time that ALA suppresses cell proliferation and malignant potential via p53 and AMPK signaling pathways in human and mouse colon cancer cells. These new and early mechanistic studies provide a causal role of ALA in colon cancer, suggesting that ALA might be a useful agent in the management or chemoprevention of colon cancer.

  18. Mitochondrial modulators in experimental Huntington's disease: reversal of mitochondrial dysfunctions and cognitive deficits.

    PubMed

    Mehrotra, Arpit; Kanwal, Abhinav; Banerjee, Sanjay Kumar; Sandhir, Rajat

    2015-06-01

    Huntington's disease (HD) is a chronic neurodegenerative condition involving impaired mitochondrial functions. The present study evaluates the therapeutic potential of combined administration of mitochondrial modulators: alpha-lipoic acid and acetyl-l-carnitine on mitochondrial dysfunctions in 3-NP-induced HD. Our results reveal 3-NP administration resulted in compromise of mitochondrial functions in terms of: (1) impaired activity of mitochondrial respiratory chain enzymes, altered cytochrome levels, reduced histochemical staining of complex-II and IV, reduced in-gel activity of complex-I to V, and reduced mRNA expression of respiratory chain complexes; (2) enhanced mitochondrial oxidative stress indicated by increased malondialdehyde, protein carbonyls, reactive oxygen species and nitrite levels, along with decreased Mn-superoxide dismutase and catalase activity; (3) mitochondrial structural changes measured by mitochondrial swelling, reduced mitochondrial membrane potential and ultra-structure changes; (4) increased cytosolic cytochrome c levels, caspase-3 and -9 activity along with altered expression of apoptotic proteins (AIF, Bim, Bad, and Bax); and (5) impaired cognitive functions assessed using Morris water maze and Y-maze. Combination of mitochondrial modulators (alpha-lipoic acid + acetyl-l-carnitine) on the other hand ameliorated 3-NP-induced mitochondrial dysfunctions, oxidative stress, histologic alterations, and behavioral deficits, suggesting their therapeutic efficacy in the management of HD. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Gas-saturated solution process to obtain microcomposite particles of alpha lipoic acid/hydrogenated colza oil in supercritical carbon dioxide.

    PubMed

    Mishima, Kenji; Honjo, Masatoshi; Sharmin, Tanjina; Ito, Shota; Kawakami, Ryo; Kato, Takafumi; Misumi, Makoto; Suetsugu, Tadashi; Orii, Hideaki; Kawano, Hiroyuki; Irie, Keiichi; Sano, Kazunori; Mishima, Kenichi; Harada, Takunori; Ouchi, Mikio

    2016-09-01

    Alpha lipoic acid (ALA), an active substance in anti-aging products and dietary supplements, need to be masked with an edible polymer to obscure its unpleasant taste. However, the high viscosity of the ALA molecules prevents them from forming microcomposites with masking materials even in supercritical carbon dioxide (scCO2). Therefore, the purpose of this study was to investigate and develop a novel production method for microcomposite particles for ALA in hydrogenated colza oil (HCO). Microcomposite particles of ALA/HCO were prepared by using a novel gas-saturated solution (PGSS) process in which the solid-dispersion method is used along with stepwise temperature control (PGSS-STC). Its high viscosity prevents the formation of microcomposites in the conventional PGSS process even under strong agitation. Here, we disperse the solid particles of ALA and HCO in scCO2 at low temperatures and change the temperature stepwise in order to mix the melted ALA and HCO in scCO2. As a result, a homogeneous dispersion of the droplets of ALA in melted HCO saturated with CO2 is obtained at high temperatures. After the rapid expansion of the saturated solution through a nozzle, microcomposite particles of ALA/HCO several micrometers in diameter are obtained.

  20. Glutaredoxin S15 Is Involved in Fe-S Cluster Transfer in Mitochondria Influencing Lipoic Acid-Dependent Enzymes, Plant Growth, and Arsenic Tolerance in Arabidopsis.

    PubMed

    Ströher, Elke; Grassl, Julia; Carrie, Chris; Fenske, Ricarda; Whelan, James; Millar, A Harvey

    2016-03-01

    Glutaredoxins (Grxs) are small proteins that function as oxidoreductases with roles in deglutathionylation of proteins, reduction of antioxidants, and assembly of iron-sulfur (Fe-S) cluster-containing enzymes. Which of the 33 Grxs in Arabidopsis (Arabidopsis thaliana) perform roles in Fe-S assembly in mitochondria is unknown. We have examined in detail the function of the monothiol GrxS15 in plants. Our results show its exclusive mitochondrial localization, and we are concluding it is the major or only Grx in this subcellular location. Recombinant GrxS15 has a very low deglutathionylation and dehydroascorbate reductase activity, but it binds a Fe-S cluster. Partially removing GrxS15 from mitochondria slowed whole plant growth and respiration. Native GrxS15 is shown to be especially important for lipoic acid-dependent enzymes in mitochondria, highlighting a putative role in the transfer of Fe-S clusters in this process. The enhanced effect of the toxin arsenic on the growth of GrxS15 knockdown plants compared to wild type highlights the role of mitochondrial glutaredoxin Fe-S-binding in whole plant growth and toxin tolerance. © 2016 American Society of Plant Biologists. All Rights Reserved.

  1. Synergistic ameliorative effects of sesame oil and alpha-lipoic acid against subacute diazinon toxicity in rats: hematological, biochemical, and antioxidant studies.

    PubMed

    Abdel-Daim, Mohamed M; Taha, Ramadan; Ghazy, Emad W; El-Sayed, Yasser S

    2016-01-01

    Diazinon (DZN) is a common organophosphorus insecticide extensively used for agriculture and veterinary purposes. DZN toxicity is not limited to insects; it also induces harmful effects in mammals and birds. Our experiment evaluated the protective and antioxidant potential of sesame oil (SO) and (or) alpha-lipoic acid (ALA) against DZN toxicity in male Wistar albino rats. DZN-treated animals exhibited macrocytic hypochromic anemia and significant increases in serum biochemical parameters related to liver injury, including aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), γ-glutamyl transferase (γGT), cholesterol, and triglycerides. They also had elevated levels of markers related to cardiac injury, such as lactate dehydrogenase (LDH) and creatine phosphokinase (CPK), and increased biomarkers of renal injury, urea and creatinine. DZN also increased hepatic, renal, and cardiac lipid peroxidation and decreased antioxidant biomarker levels. SO and (or) ALA supplementation ameliorated the deleterious effects of DZN intoxication. Treatment improved hematology and serum parameters, enhanced endogenous antioxidant status, and reduced lipid peroxidation. Importantly, they exerted synergistic hepatoprotective, nephroprotective, and cardioprotective effects. Our findings demonstrate that SO and (or) ALA supplementation can alleviate the toxic effects of DZN via their potent antioxidant and free radical-scavenging activities.

  2. Small molecular antioxidants effectively protect from PUVA-induced oxidative stress responses underlying fibroblast senescence and photoaging.

    PubMed

    Briganti, Stefania; Wlaschek, Meinhard; Hinrichs, Christina; Bellei, Barbara; Flori, Enrica; Treiber, Nicolai; Iben, Sebastian; Picardo, Mauro; Scharffetter-Kochanek, Karin

    2008-09-01

    Exposure of human fibroblasts to 8-methoxypsoralen plus ultraviolet-A irradiation (PUVA) results in stress-induced cellular senescence in fibroblasts. We here studied the role of the antioxidant defense system in the accumulation of reactive oxygen species (ROS) and the effect of the antioxidants alpha-tocopherol, N-acetylcysteine, and alpha-lipoic acid on PUVA-induced cellular senescence. PUVA treatment induced an immediate and increasing generation of intracellular ROS. Supplementation of PUVA-treated fibroblasts with alpha-tocopherol (alpha-Toc), N-acetylcysteine (NAC), or alpha-lipoic acid (alpha-LA) abrogated the increased ROS generation and rescued fibroblasts from the ROS-dependent changes into the cellular senescence phenotype, such as cytoplasmic enlargement, enhanced expression of senescence-associated-beta-galactosidase and matrix-metalloproteinase-1, hallmarks of photoaging and intrinsic aging. PUVA treatment disrupted the integrity of cellular membranes and impaired homeostasis and function of the cellular antioxidant system with a significant decrease in glutathione and hydrogen peroxide-detoxifying enzymes activities. Supplementation with NAC, alpha-LA, and alpha-Toc counteracted these changes. Our data provide causal evidence that (i) oxidative stress due to an imbalance in the overall cellular antioxidant capacity contributes to the induction and maintenance of the PUVA-induced fibroblast senescence and that (ii) low molecular antioxidants protect effectively against these deleterious alterations.

  3. Alpha-lipoic acid and cardiovascular disease.

    PubMed

    Wollin, Stephanie D; Jones, Peter J H

    2003-11-01

    Alpha-lipoic acid (ALA) has been identified as a powerful antioxidant found naturally in our diets, but appears to have increased functional capacity when given as a supplement in the form of a natural or synthetic isolate. ALA and its active reduced counterpart, dihydrolipoic acid (DHLA), have been shown to combat oxidative stress by quenching a variety of reactive oxygen species (ROS). Because this molecule is soluble in both aqueous and lipid portions of the cell, its biological functions are not limited solely to one environment. In addition to ROS scavenging, ALA has been shown to be involved in the recycling of other antioxidants in the body including vitamins C and E and glutathione. Not only have the antioxidant qualities of this molecule been studied, but there are also several reports pertaining to its blood lipid modulating characteristics, protection against LDL oxidation and modulation of hypertension. Therefore, ALA represents a possible protective agent against risk factors of cardiovascular disease (CVD). The objective of this review is to examine the literature pertaining to ALA in relation to CVD and describe the most powerful actions and potential uses of this naturally occurring antioxidant. Despite the numerous studies on ALA, many questions remain relating to the use of ALA as a supplement. There is no consensus on dosage, dose frequency, form of administration, and/or preferred form of ALA. However, collectively the literature increases our understanding of the potential uses for supplementation with ALA and identifies key areas for future research.

  4. Biallelic Mutations in LIPT2 Cause a Mitochondrial Lipoylation Defect Associated with Severe Neonatal Encephalopathy.

    PubMed

    Habarou, Florence; Hamel, Yamina; Haack, Tobias B; Feichtinger, René G; Lebigot, Elise; Marquardt, Iris; Busiah, Kanetee; Laroche, Cécile; Madrange, Marine; Grisel, Coraline; Pontoizeau, Clément; Eisermann, Monika; Boutron, Audrey; Chrétien, Dominique; Chadefaux-Vekemans, Bernadette; Barouki, Robert; Bole-Feysot, Christine; Nitschke, Patrick; Goudin, Nicolas; Boddaert, Nathalie; Nemazanyy, Ivan; Delahodde, Agnès; Kölker, Stefan; Rodenburg, Richard J; Korenke, G Christoph; Meitinger, Thomas; Strom, Tim M; Prokisch, Holger; Rotig, Agnes; Ottolenghi, Chris; Mayr, Johannes A; de Lonlay, Pascale

    2017-08-03

    Lipoate serves as a cofactor for the glycine cleavage system (GCS) and four 2-oxoacid dehydrogenases functioning in energy metabolism (α-oxoglutarate dehydrogenase [α-KGDHc] and pyruvate dehydrogenase [PDHc]), or amino acid metabolism (branched-chain oxoacid dehydrogenase, 2-oxoadipate dehydrogenase). Mitochondrial lipoate synthesis involves three enzymatic steps catalyzed sequentially by lipoyl(octanoyl) transferase 2 (LIPT2), lipoic acid synthetase (LIAS), and lipoyltransferase 1 (LIPT1). Mutations in LIAS have been associated with nonketotic hyperglycinemia-like early-onset convulsions and encephalopathy combined with a defect in mitochondrial energy metabolism. LIPT1 deficiency spares GCS deficiency and has been associated with a biochemical signature of combined 2-oxoacid dehydrogenase deficiency leading to early death or Leigh-like encephalopathy. We report on the identification of biallelic LIPT2 mutations in three affected individuals from two families with severe neonatal encephalopathy. Brain MRI showed major cortical atrophy with white matter abnormalities and cysts. Plasma glycine was mildly increased. Affected individuals' fibroblasts showed reduced oxygen consumption rates, PDHc, α-KGDHc activities, leucine catabolic flux, and decreased protein lipoylation. A normalization of lipoylation was observed after expression of wild-type LIPT2, arguing for LIPT2 requirement in intramitochondrial lipoate synthesis. Lipoic acid supplementation did not improve clinical condition nor activities of PDHc, α-KGDHc, or leucine metabolism in fibroblasts and was ineffective in yeast deleted for the orthologous LIP2. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  5. Au NPs immersed in sol-gel matrix: nonlinear optical characterization

    NASA Astrophysics Data System (ADS)

    Aguilera-Zavala, Angélica; Trejo-Durán, Mónica; Ortiz-Jiménez, Orlando; Cornejo-Monroy, Delfino; Severiano-Carrillo, Israel; Alvarado-Méndez, Edgar

    2016-09-01

    Physical and optical characterization of thin films doped with Au Nanoparticles onto a silica substrate is presented. Films were prepared through sol-gel process, by using Au nanoparticles immersed in lipoic acid as dopant by means of hydrolysis and acid catalyzed reaction of tetraethyl-orthosilicate. The surface was characterized by SEM and AFM microscopies. Z-scan technique was used to measure nonlinear optical properties as nonlinear absorption and refraction indexes, using two different wavelengths. At 633 nm it was possible to observe nonlinear absorption only but at 514 nm both nonlinear properties were observed.

  6. Tuning the Emission and Quantum Yield of Gold and Silver Nanoclusters Through Ligand Design and Doping

    NASA Astrophysics Data System (ADS)

    Mishra, Dinesh

    Nanoparticles have been extensively studied in the past few decades due to the possibilities they offer in applications ranging from medicine to energy generation. A new class of ultra-small noble metal nanoparticles consisting of tens to hundreds of atoms, commonly known as clusters or nanoclusters, have drawn interest of the research community recently due to their unique optical, electronic and structural properties. Over the past few years, advances have been made in the synthesis of atomically precise noble metal clusters (for example, silver and gold) with distinct optical properties. Their ultra-small size distinguishes them from conventional plasmonic nanoparticles and the properties are very sensitive to the slight variation in the compositon of the cluster, i.e. the number of the metal atoms and/or the nature of the ligands. These clusters are interesting because of their potential applications in field such as sensing, imaging, catalysis, clean energy, photonics, etc. as well as they provide fundamental insight into the evolution of the optical and electronic properties of these clusters. In this project, we explored the strategies to synthesize luminescent metallic clusters of gold and silver and to promote their solubility and stability in aqueous and biological medium. We focused particularly on the thiolate protected clusters due to the higher affinity of gold and silver to sulfur. Lipoic acid (Thioctic acid) is a bio-molecule with a cyclic disulfide ring, which also acts as a chelating ligand. Due to the higher binding affinity of the cyclic disulfide ring to nanocrystal surface, lipoic acid and chemically modified lipoic acid molecules have been widely reported for the synthesis and functionalization of inorganic nanocrystals. Here, we describe the use of bidentate lipoic acid ligands in the one phase growth of luminescent gold and silver nanoclusters. In addition, we have synthesized a new set of monothiol ligands containing PEG and zwitterion for the functionalization of fluorescent clusters. Chapter 1 introduces the fundamental properties of metallic clusters and the origin of these properties from electronic and structural point of view. The optical properties of ultra-small nanocrystals (<2 nm) in comparison to the plasmonic particles is described. In addition, the variation of optical and structural properties from one metal to another as well as one ligand to another is also compared. Chapter 2 describes the synthesis of ultra-small size gold clusters with different optical emission (ranging from blue to red) using photo-activated LA-PEG ligands. The influence of various factors on the growth of the clusters is also studied. Optical properties of the clusters were studied by UV-visible absorption, PL emission and excitation and time resolved fluorescence spectroscopy. XPS and DOSY NMR were used to characterize the oxidation states and sizes of these clusters. The photo-chemical transformation of LA-PEG ligands to thiols and the effect of various experimental parameters such as solvent, oxygen, ligand functional group and effect of acid are described in chapter 3. Thiol yield percentage was quantified using ellman assay. Chapter 4 describes the one phase aqueous synthesis of Ag29 clusters capped with bidentate dihydrolipoic acid (DHLA). We also describe the drastic enhancement of the PL intensity upon gold doping of the Ag29 clusters. Optical properties along with the size characterization by electrospray ionization mass spectrometry is also described. We further describe the growth of these clusters using DHLA-PEG molecules. Chapter 5 describes the synthesis of highly fluorescent Au25-xAgx clusters stabilized with two types of ligands (triphenylphosphine and thiols). We designed a set of monothiolate ligands appended with PEG and zwitterionic moieties. This approach allows to prepare water soluble and stable metallic clusters with enhanced photoluminescence and well defined optical properties. Chapter 6 is the overall summary of our findings and prospects and outlook.

  7. Oxidative stress, histopathological and electron microscopic alterations induced by dimethylnitrosamine in renal male mice and the protective effect of α-lipoic acid.

    PubMed

    Hamza, Reham Z; Ismail, Hayat A A; El-Shenawy, Nahla S

    2017-03-01

    Dimethylnitrosamine (DMN) is a waste product of several industrial processes. α-Lipoic acid (ALA) is a vitamin-like chemical also called as an antioxidant. Therefore, the study was designed to investigate the potential benefits of ALA in reducing the nephropathy of DMN in male mice. Animals were divided into 6 groups (n=8) and received their treatment for 4 weeks as follows: groups 1-4 served as control, ALA-treatment (16.12 mg/kg), DMN low dose treatment and DMN high dose treatment, respectively. Groups 5 and 6 received ALA before DMN low dose and DMN high dose, respectively. Superoxide dismutase, catalase, glutathione peroxidase and xanthine oxidase, total antioxidant capacity, nitric oxide, lipid peroxidation as well as the levels of uric acid and creatinine were determined. The histological and ultrastructure changes of renal tissue were also evaluated. Treatment of the DMN mice with ALA showed a reduction in the levels of kidney nitric oxide, lipid peroxidation, as well as creatinine and uric acid levels as compared with the DMN group. The results show that ALA plays an important role in quenching the free radicals resulting from the metabolism of DMN, thereby inhibiting lipid peroxidation and protecting membrane lipids from oxidative damage and, in turn, preventing oxidative stress and apoptosis. Histopathological and ultrastructure analysis of renal tissue confirmed the oxidative stress results occurred in DMN renal mice. Concomitant administration of ALA with DMN significantly decreased all the histopathological changes induced by DMN. The present study elucidated the therapeutic effects of ALA administered in combination with DMN to minimize its renal toxicity.

  8. The impact of high fructose on cardiovascular system: Role of α-lipoic acid.

    PubMed

    Saygin, M; Asci, H; Cankara, F N; Bayram, D; Yesilot, S; Candan, I A; Alp, H H

    2016-02-01

    The aim of this study was to evaluate the role of α-lipoic acid (α-LA) on oxidative damage and inflammation that occur in endothelium of aorta and heart while constant consumption of high-fructose corn syrup (HFCS). The rats were randomly divided into three groups with each group containing eight rats. The groups include HFCS, HFCS + α-LA treatment, and control. HFCS was given to the rats at a ratio of 30% of F30 corn syrup in drinking water for 10 weeks. α-LA treatment was given to the rats at a dose of 100 mg/kg/day orally for the last 6 weeks. At the end of the experiment, the rats were killed by cervical dislocation. The blood samples were collected for biochemical studies, and the aortic and cardiac tissues were collected for evaluation of oxidant-antioxidant system, tissue bath, and pathological examination. HFCS had increased the levels of malondialdehyde, creatine kinase MB, lactate dehydrogenase, and uric acid and showed significant structural changes in the heart of the rats by histopathology. Those changes were improved by α-LA treatment as it was found in this treatment group. Immunohistochemical expressions of tumor necrosis factor α and inducible nitric oxide synthase were increased in HFCS group, and these receptor levels were decreased by α-LA treatment. All the tissue bath studies supported these findings. Chronic consumption of HFCS caused several problems like cardiac and endothelial injury of aorta by hyperuricemia and induced oxidative stress and inflammation. α-LA treatment reduced uric acid levels, oxidative stress, and corrected vascular responses. α-LA can be added to cardiac drugs due to its cardiovascular protective effects against the cardiovascular diseases. © The Author(s) 2015.

  9. EPA, DHA, and Lipoic Acid Differentially Modulate the n-3 Fatty Acid Biosynthetic Pathway in Atlantic Salmon Hepatocytes.

    PubMed

    Bou, Marta; Østbye, Tone-Kari; Berge, Gerd M; Ruyter, Bente

    2017-03-01

    The aim of the present study was to investigate how EPA, DHA, and lipoic acid (LA) influence the different metabolic steps in the n-3 fatty acid (FA) biosynthetic pathway in hepatocytes from Atlantic salmon fed four dietary levels (0, 0.5, 1.0 and 2.0%) of EPA, DHA or a 1:1 mixture of these FA. The hepatocytes were incubated with [1- 14 C] 18:3n-3 in the presence or absence of LA (0.2 mM). Increased endogenous levels of EPA and/or DHA and LA exposure both led to similar responses in cells with reduced desaturation and elongation of [1- 14 C] 18:3n-3 to 18:4n-3, 20:4n-3, and EPA, in agreement with reduced expression of the Δ6 desaturase gene involved in the first step of conversion. DHA production, on the other hand, was maintained even in groups with high endogenous levels of DHA, possibly due to a more complex regulation of this last step in the n-3 metabolic pathway. Inhibition of the Δ6 desaturase pathway led to increased direct elongation to 20:3n-3 by both DHA and LA. Possibly the route by 20:3n-3 and then Δ8 desaturation to 20:4n-3, bypassing the first Δ6 desaturase step, can partly explain the maintained or even increased levels of DHA production. LA increased DHA production in the phospholipid fraction of hepatocytes isolated from fish fed 0 and 0.5% EPA and/or DHA, indicating that LA has the potential to further increase the production of this health-beneficial FA in fish fed diets with low levels of EPA and/or DHA.

  10. Alpha-Lipoic Acid Downregulates IL-1β and IL-6 by DNA Hypermethylation in SK-N-BE Neuroblastoma Cells.

    PubMed

    Dinicola, Simona; Proietti, Sara; Cucina, Alessandra; Bizzarri, Mariano; Fuso, Andrea

    2017-09-26

    Alpha-lipoic acid (ALA) is a pleiotropic molecule with antioxidant and anti-inflammatory properties, of which the effects are exerted through the modulation of NF-kB. This nuclear factor, in fact, modulates different inflammatory cytokines, including IL-1b and IL-6, in different tissues and cell types. We recently showed that IL-1b and IL-6 DNA methylation is modulated in the brain of Alzheimer's disease patients, and that IL-1b expression is associated to DNA methylation in the brain of patients with tuberous sclerosis complex. These results prompted us to ask whether ALA-induced repression of IL-1b and IL-6 was dependent on DNA methylation. Therefore, we profiled DNA methylation in the 5'-flanking region of the two aforementioned genes in SK-N-BE human neuroblastoma cells cultured in presence of ALA 0.5 mM. Our experimental data pointed out that the two promoters are hypermethylated in cells supplemented with ALA, both at CpG and non-CpG sites. Moreover, the observed hypermethylation is associated with decreased mRNA expression and decreased cytokine release. These results reinforce previous findings indicating that IL-1b and IL-6 undergo DNA methylation-dependent modulation in neural models and pave the road to study the epigenetic mechanisms triggered by ALA.

  11. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading.

    PubMed

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan

    2015-01-01

    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with ClinicalTrials.gov Identifier: NCT02439879.

  12. Adjunctive α-lipoic acid reduces weight gain compared with placebo at 12 weeks in schizophrenic patients treated with atypical antipsychotics: a double-blind randomized placebo-controlled study.

    PubMed

    Kim, Nam Wook; Song, Yul-Mai; Kim, Eosu; Cho, Hyun-Sang; Cheon, Keun-Ah; Kim, Su Jin; Park, Jin Young

    2016-09-01

    α-Lipoic acid (ALA) has been reported to be effective in reducing body weight in rodents and obese patients. Our previous open trial showed that ALA may play a role in reducing weight gain in patients with schizophrenia on atypical antipsychotics. The present study evaluated the efficacy of ALA in reducing weight and BMI in patients with schizophrenia who had experienced significant weight gain since taking atypical antipsychotics. In a 12-week, double-blind randomized placebo-controlled study, 22 overweight and clinically stable patients with schizophrenia were randomly assigned to receive ALA or placebo. ALA was administered at 600-1800 mg, as tolerated. Weight, BMI, abdomen fat area measured by computed tomography, and metabolic values were determined. Adverse effects were also assessed to examine safety. Overall, 15 patients completed 12 weeks of treatment. There was significant weight loss and decreased visceral fat levels in the ALA group compared with the placebo group. There were no instances of psychopathologic aggravation or severe ALA-associated adverse effects. ALA was effective in reducing weight and abdominal obesity in patients with schizophrenia who had experienced significant weight gain since beginning an atypical antipsychotic regimen. Moreover, ALA was well tolerated throughout this study. ALA might play an important role as an adjunctive treatment in decreasing obesity in patients who take atypical antipsychotics.

  13. Evaluation of laser therapy and alpha-lipoic acid for the treatment of burning mouth syndrome: a randomized clinical trial.

    PubMed

    Barbosa, Natália Guimarães; Gonzaga, Amanda Katarinny Goes; de Sena Fernandes, Luzia Leiros; da Fonseca, Aldilane Gonçalves; Queiroz, Salomão Israel Monteiro Lourenço; Lemos, Telma Maria Araújo Moura; da Silveira, Éricka Janine Dantas; de Medeiros, Ana Miryam Costa

    2018-03-03

    The aim of this study was to evaluate the efficacy of low-level laser therapy (LLLT) and alpha-lipoic acid (ALA) in the treatment of burning mouth syndrome (BMS) and secondary oral burning (SOB) by unstimulated sialometry, symptom assessment, and measurement of salivary TNF-α levels. Forty-four patients were randomized into four treatment groups: BMS/laser (n = 10), BMS/ALA (n = 5), SOB/laser (n = 15), and SOB/ALA (n = 14). The control group consisted of eight healthy female subjects. Unstimulated salivary flow was measured before and after treatment, and the collected saliva was stored at - 20 °C for the analysis of TNF-α. Symptoms were evaluated before and after treatment using a pain visual analog scale. Most patients were women (81.8%) during menopause (72.2%). LLLT and ALA were efficient in increasing salivary flow only in BMS but provided symptom relief in both conditions. TNF-α levels did not differ between patients with BMS and SOB or between those patients and the control group. No differences were observed in posttreatment TNF-α levels in either condition. The results of this study suggest that LLLT and ALA are efficient therapies in reducing burning mouth symptoms, with LLLT being more efficient than ALA.

  14. Investigating the role of backward walking therapy in alleviating plantar pressure of patients with diabetic peripheral neuropathy.

    PubMed

    Zhang, Xingguang; Zhang, Yanqi; Gao, Xiaoxiao; Wu, Jinxiao; Jiao, Xiumin; Zhao, Jing; Lv, Xiaofeng

    2014-05-01

    To investigate the effect of combination therapy of backward walking training and alpha-lipoic acid (ALA) treatment on the distribution of plantar pressure in patients with diabetic peripheral neuropathy (DPN). This study is a double-blinded, randomized controlled trial. The test group was treated with combination therapy of backward walking exercise and ALA (ALA for 2wk, backward walking exercise for 12wk), and the control group only received ALA treatment. Clinical and laboratory setting. Patients with DPN (N=60) were divided into the test group (n=30) or control group (n=30). Backward walking exercise with ALA treatment for the test group; lipoic acid treatment for the control group. Plantar pressure before and after treatment was tested and analyzed with the flatbed plantar pressure measurement system. After treatment, peak plantar pressure in the forefoot dropped for both the test and control groups; peak plantar pressure for the test group dropped significantly. Peak plantar pressure in the medial foot slightly increased for the test group, suggesting a more even distribution of plantar pressure in the test group after treatment. The combination therapy of ALA and backward walking proved to be more effective than ALA monotherapy. Backward walking also proved to have an ameliorating effect on balance ability and muscle strength of patients with DPN. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  15. Behavioral and neurochemical effects of alpha lipoic acid associated with omega-3 in tardive dyskinesia induced by chronic haloperidol in rats.

    PubMed

    de Araújo, Dayane Pessoa; Camboim, Thaisa Gracielle Martins; Silva, Ana Patrícia Magalhães; Silva, Caio da Fonseca; de Sousa, Rebeca Canuto; Barbosa, Mabson Delâno Alves; Oliveira, Lucidio Clebeson; Cavalcanti, José Rodolfo Lopes de Paiva; Lucena, Eudes Euler de Souza; Guzen, Fausto Pierdoná

    2017-07-01

    Tardive dyskinesia (TD) is characterized by involuntary movements of the lower portion of the face being related to typical antipsychotic therapy. TD is associated with the oxidative imbalance in the basal ganglia. Lipoic acid (LA) and omega-3 (ω-3) are antioxidants acting as enzyme cofactors, regenerating antioxidant enzymes. This study aimed to investigate behavioral and neurochemical effects of supplementation with LA (100 mg/kg) and ω-3 (1 g/kg) in the treatment of TD induced by chronic use of haloperidol (HAL) (1 mg/kg) in rats. Wistar male rats were used, weighing between 180-200 g. The animals were treated chronically (31 days) with LA alone or associated with HAL or ω-3. Motor behavior was assessed by open-field test, the catalepsy test, and evaluation of orofacial dyskinesia. Oxidative stress was accessed by determination of lipid peroxidation and concentration of nitrite. LA and ω-3 alone or associated caused an improvement in motor performance by increasing locomotor activity in the open-field test and decreased the permanence time on the bar in the catalepsy test and decreased the orofacial dyskinesia. LA and ω-3 showed antioxidant effects, decreasing lipid peroxidation and nitrite levels. Thus, the use of LA associated with ω-3 reduced the extrapyramidal effects produced by chronic use of HAL.

  16. Alpha lipoic acid intoxicatıon: An adult.

    PubMed

    Emir, Duygu Ferek; Ozturan, Ibrahim Ulas; Yilmaz, Serkan

    2018-06-01

    Alpha lipoic acid (ALA) is a potent antioxidant used to treat a variety of disorders. Although ALA is considered a very safe supplement and intoxication is very rare, acute high-dose ingestions can cause mortality. In this report, we discuss a very rare case of ALA intoxication to increase awareness of this issue. A 22-year-old female was referred to our emergency department with ALA intoxication after ingesting a total of 18g of ALA with a suicidal intention. The patient was found in an altered mental state and confused. During the physical examination, the patient's Glasgow Coma Scale was 13 (E4M6V3); however, she was neither alert nor oriented. Vital signs revealed a mildly decreased blood pressure, tachycardia, and an increased respiratory rate. Cranial nerve examination was normal except a horizontal gaze nystagmus. Laboratory testing showed a decompensated metabolic acidosis. T wave inversions were seen in the electrocardiography (EKG). The patient was treated with supportive treatment and discharged within three days of intensive care unit (ICU) admission. ALA is a very common supplement that is easily accessible worldwide. Although ALA intoxication is very rare, it is sometimes seen after accidental or suicidal acute ingestion. Neurologic effects, metabolic acidosis, and t wave inversions in the EKG are observed when this acute poisoning occurs. Supportive treatment should be the main therapy. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Attenuation of Glucose-Induced Myoglobin Glycation and the Formation of Advanced Glycation End Products (AGEs) by (R)-α-Lipoic Acid In Vitro

    PubMed Central

    Ghelani, Hardik; Razmovski-Naumovski, Valentina; Pragada, Rajeswara Rao

    2018-01-01

    High-carbohydrate containing diets have become a precursor to glucose-mediated protein glycation which has been linked to an increase in diabetic and cardiovascular complications. The aim of the present study was to evaluate the protective effect of (R)-α-lipoic acid (ALA) against glucose-induced myoglobin glycation and the formation of advanced glycation end products (AGEs) in vitro. Methods: The effect of ALA on myoglobin glycation was determined via the formation of AGEs fluorescence intensity, iron released from the heme moiety of myoglobin and the level of fructosamine. The extent of glycation-induced myoglobin oxidation was measured via the levels of protein carbonyl and thiol. Results: The results showed that the co-incubation of ALA (1, 2 and 4 mM) with myoglobin (1 mg/mL) and glucose (1 M) significantly decreased the levels of fructosamine, which is directly associated with the decrease in the formation of AGEs. Furthermore, ALA significantly reduced the release of free iron from myoglobin which is attributed to the protection of myoglobin from glucose-induced glycation. The results also demonstrated a significant protective effect of ALA on myoglobin from oxidative damage, as seen from the decreased protein carbonyls and increased protein thiols. Conclusion: The anti-glycation properties of ALA suggest that ALA supplementation may be beneficial in the prevention of AGEs-mediated diabetic and cardiovascular complications. PMID:29419812

  18. Alpha-lipoic acid impairs body weight gain of young broiler chicks via modulating peripheral AMPK.

    PubMed

    Wang, Yufeng; Everaert, Nadia; Song, Zhigang; Decuypere, Eddy; Vermeulen, Daniel; Buyse, Johan

    2017-09-01

    In mammals, the AMP-activated protein kinase (AMPK) pathways in the central and peripheral tissues coordinately integrate inputs from multiple sources to regulate energy balance. The present study was aimed to explore the potential role of hepatic AMPK in the energy homeostasis of broiler chickens. Diets with 0, 0.05% or 0.1% alpha-lipoic acid (α-LA), a known AMPK inhibitor were provided to broiler chicks for 7days. As a result, α-LA supplementation decreased the relative growth rate of broiler chicks. Hepatic AMPKα2 mRNA levels were significantly upregulated by dietary α-LA, in concert with the increased phosphorylated AMPKα protein levels. In addition, hepatic FAS mRNA levels together with the malonyl-CoA to total CoA ester ratio were reduced by α-LA supplementation. Moreover, the hepatic phosphorylated glycogen synthase levels were increased resulting in a markedly decreased hepatic glycogen content. In conclusion, dietary α-LA supplementation decreased the in vivo hepatic glycogenesis and lipogenesis via stimulating hepatic AMPKα mRNA levels and the phosphorylated gene product. The stimulatory effect of α-LA on hepatic AMPK mRNA and pAMPKα protein levels together with our previous observations regarding its inhibitory effect on hypothalamic AMPK may have altered the energy balance and hence impaired body weight gain of broiler chicks. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Pre-clinical and Clinical Safety Studies of CMX-2043: A Cytoprotective Lipoic Acid Analogue for Ischaemia–Reperfusion Injury

    PubMed Central

    Kates, Steven A; Lader, Alan S; Casale, Ralph; Beeuwkes, Reinier

    2014-01-01

    CMX-2043 is an α-lipoic acid analogue targeted to reduction of cellular injury and organ damage due to ischaemia–reperfusion injury (IRI). It has been shown to be effective in a rat model of cardiac IRI. The studies here reported evaluate its safety and pharmacokinetic profile in preparation for human clinical studies in procedures associated with IRI. Safety and tolerability were tested in standard pre-clinical in vitro and animal models and in a Phase 1 human clinical trial. CMX-2043 did not bind to a wide range of receptors and specific targets at approximately 4 μg/mL (10 μM). It was not mutagenic by Ames assay, did not produce chromosome aberrations in Chinese hamster ovary (CHO) cells, and was negative for clastogenic potential. Toxicological studies in rats including both single and 14-day repeat intravenous doses and in dogs (single intravenous dose) with a 2-week recovery period were conducted. The NOAEL in rats and dogs was 30 and >10 mg/kg, respectively. No serious adverse events were reported in a placebo-controlled, sequential dose escalation Phase 1 clinical trial. The low toxicity in the pre-clinical studies and the absence of adverse events in the Phase 1 trial have supported investigation of CMX-2043 in a human efficacy trial. PMID:24751172

  20. Induction of ER Stress-Mediated Apoptosis by α-Lipoic Acid in A549 Cell Lines

    PubMed Central

    Kim, Jong In; Lee, Chang Min; Park, Eok-Sung; Kim, Ki Nyun; Kim, Hyung Chul; Lee, Hae Young

    2012-01-01

    Background α-Lipoic acid (α-LA) has been studied as an anticancer agent as well as a therapeutic agent for diabetes and obesity. We performed this study to evaluate the anticancer effects and mechanisms of α-LA in a lung cancer cell line, A549. Materials and Methods α-LA-induced apoptosis of A549 cells was detected by fluorescence-activated cell sorting analysis and a DNA fragmentation assay. Expression of apoptosis-related genes was analyzed by western blot and reverse transcription-polymerase chain reaction analyses. Results α-LA induced apoptosis and DNA fragmentation in A549 cells in a dose- and time-dependent manner. α-LA increased caspase activity and the degradation of poly (ADP-ribose) polymerase. It induced expression of endoplasmic reticulum (ER) stress-related genes, such as glucose-regulated protein 78, C/EBP-homologous protein, and the short form of X-box binding protein-1, and decreased expression of the anti-apoptotic protein, X-linked inhibitor of apoptosis protein. Reactive oxygen species (ROS) production was induced by α-LA, and the antioxidant N-acetyl-L-cysteine decreased the α-LA-induced increase in expression of apoptosis and ER stress-related proteins. Conclusion α-LA induced ER stress-mediated apoptosis in A549 cells via ROS. α-LA may therefore be clinically useful for treating lung cancer. PMID:22363901

  1. Alpha Lipoamide Ameliorates Motor Deficits and Mitochondrial Dynamics in the Parkinson's Disease Model Induced by 6-Hydroxydopamine.

    PubMed

    Zhou, Bo; Wen, Min; Lin, Xin; Chen, Yun-Hua; Gou, Yun; Li, Yong; Zhang, Yi; Li, Hong-Wei; Tang, Lei

    2018-05-01

    The precise mechanisms underlying neuronal injury in Parkinson's disease (PD) are not yet fully elucidated; however, evidence from the in vitro and in vivo PD models suggest that mitochondrial dysfunction may play a major role in PD pathogenesis. Alpha lipoamide, a neutral amide derivative of the lipoic acid, is a better cofactor for mitochondrial dehydrogenase with a stronger protective effect on mitochondria than lipoic acid. Identification of these protective effects of alpha lipoamide on mitochondria, together with the evidence that mitochondrial dysfunction plays a critical role in PD, we speculate that alpha lipoamide may exert a protective effect in PD by regulating the mitochondrial function. The present study investigated the neuroprotective effects of alpha lipoamide in an animal model of PD induced by 6-hydroxydopamine (6-OHDA). The results demonstrated that alpha lipoamide could significantly antagonize the 6-OHDA-induced behavioral damages; restore ATP levels in the midbrain; and also improve the fragmentation, vacuolization, and morphology of the mitochondria. The results of Western blot indicated that alpha lipoamide significantly restored the number of dopaminergic neurons in midbrain and substantially recovered the balance between mitochondrial fission, fusion, and transport. In conclusion, the results demonstrated that alpha lipoamide might exert a significant neuroprotective effect in the animal model of PD by regulation of the dynamic properties of mitochondria.

  2. Novel 3-phenylcoumarin-lipoic acid conjugates as multi-functional agents for potential treatment of Alzheimer's disease.

    PubMed

    Jalili-Baleh, Leili; Nadri, Hamid; Forootanfar, Hamid; Samzadeh-Kermani, Alireza; Küçükkılınç, Tuba Tüylü; Ayazgok, Beyza; Rahimifard, Mahban; Baeeri, Maryam; Doostmohammadi, Mohsen; Firoozpour, Loghman; Bukhari, Syed Nasir Abbas; Abdollahi, Mohammad; Ganjali, Mohammad Reza; Emami, Saeed; Khoobi, Mehdi; Foroumadi, Alireza

    2018-05-02

    New series of triazole-containing 3-phenylcoumarin-lipoic acid conjugates were designed as multi-functional agents for treatment of Alzheimer's disease. The target compounds 4a-o were synthesized via the azide-alkyne cycloaddition reaction and their biological activities were primarily evaluated in terms of neuroprotection against H 2 O 2 -induced cell death in PC12 cells and AChE/BuChE inhibition. The promising compounds 4j and 4i containing four carbons spacer were selected for further biological evaluations. Based on the obtained results, the benzocoumarin derivative 4j with IC 50 value of 7.3 µM was the most potent AChE inhibitor and displayed good inhibition toward intracellular reactive oxygen species (ROS). This compound with antioxidant and metal chelating ability showed also protective effect on cell injury induced by Aβ 1-42 in SH-SY5Y cells. Although the 8-methoxycoumarin analog 4i was slightly less active than 4j against AChE, but displayed higher protection ability against H 2 O 2 -induced cell death in PC12 and could significantly block Aβ-aggregation. The results suggested that the prototype compounds 4i and 4j might be promising multi-functional agents for the further development of the disease-modifying treatments of Alzheimer's disease. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Lipoic Acid and Progesterone Alone or in Combination Ameliorate Retinal Degeneration in an Experimental Model of Hereditary Retinal Degeneration.

    PubMed

    Ramírez-Lamelas, Dolores T; Benlloch-Navarro, Soledad; López-Pedrajas, Rosa; Gimeno-Hernández, Roberto; Olivar, Teresa; Silvestre, Dolores; Miranda, María

    2018-01-01

    Retinitis pigmentosa (RP) is a group of inherited retinopathies characterized by photoreceptors death. Our group has shown the positive progesterone (P4) actions on cell death progression in an experimental model of RP. In an effort to enhance the beneficial effects of P4, the aim of this study was to combine P4 treatment with an antioxidant [lipoic acid (LA)] in the rd1 mice. rd1 and control mice were treated with 100 mg/kg body weight of P4, LA, or a combination of both on postnatal day 7 (PN7), 9, and 11, and were sacrificed at PN11. The administration of LA and/or P4 diminishes cell death in rd1 retinas. The effect obtained after the combined administration of LA and P4 is higher than the one obtained with LA or P4 alone. The three treatments decreased GFAP staining, however, in the far peripheral retina, and the two treatments that offered better results were LA and LA plus P4. LA or LA plus P4 increased retinal glutathione (GSH) concentration in the rd1 mice. Although LA and P4 are able to protect photoreceptors from death in rd1 mice retinas, a better effectiveness is achieved when administering LA and P4 at the same time.

  4. Lipoic acid improves hypertriglyceridemia by stimulating triacylglycerol clearance and downregulating liver triacylglycerol secretion

    PubMed Central

    Butler, Judy A.; Hagen, Tory M.; Moreau, Régis

    2009-01-01

    Elevated blood triacylglycerol (TG) is a significant contributing factor to the current epidemic of obesity-related health disorders, including type-2 diabetes, nonalcoholic fatty liver disease, and cardiovascular disease. The observation that mice lacking the enzyme sn-glycerol-3-phosphate acyltransferase are protected from insulin resistance suggests the possibility that the regulation of TG synthesis be a target for therapy. Five-week old Zucker Diabetic Fatty (ZDF) rats were fed a diet containing (R)-α-lipoic acid (LA, ~200 mg/kg body weight per day) for 5 weeks. LA offset the rise in blood and liver TG by inhibiting liver lipogenic gene expression (e.g. sn-glycerol-3-phosphate acyltransferase-1 and diacylglycerol O-acyltransferase-2), lowering hepatic TG secretion, and stimulating clearance of TG-rich lipoproteins. LA-induced TG lowering was not due to the anorectic properties of LA, as pair-fed rats developed hypertriglyceridemia. Livers from LA-treated rats exhibited elevated glycogen content, suggesting dietary carbohydrates were stored as glycogen rather than becoming lipogenic substrate. Although AMP-activated protein kinase (AMPK) reportedly mediates the metabolic effects of LA in rodents, no change in AMPK activity was observed, suggesting LA acted independently of this kinase. The hepatic expression of peroxisome proliferator activated receptor α (PPARα) target genes involved in fatty acid β-oxidation was either unchanged or decreased with LA, indicating a different mode of action than for fibrate drugs. Given its strong safety record, LA may have potential clinical applications for the treatment or prevention of hypertriglyceridemia and diabetic dyslipidemia. PMID:19232511

  5. Supplementation with α-Lipoic Acid Alone or in Combination with Eicosapentaenoic Acid Modulates the Inflammatory Status of Healthy Overweight or Obese Women Consuming an Energy-Restricted Diet.

    PubMed

    Huerta, Ana E; Prieto-Hontoria, Pedro L; Sáinz, Neira; Martínez, J Alfredo; Moreno-Aliaga, María J

    2016-03-09

    The proinflammatory state induced by obesity plays an important role in obesity-related metabolic complications. Our objective was to evaluate whether dietary supplementation with α-lipoic acid (LA) and eicosapentaenoic acid (EPA), separately or in combination, could improve inflammatory and cardiovascular disease risk markers in healthy overweight or obese women consuming an energy-restricted diet. Within the context of the Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP) study, Caucasian women (n = 73) aged 20-50 y with a BMI (in kg/m 2 ) between 27.5 and 40 consumed an energy-restricted diet for 10 wk after being randomly assigned to 1 of 4 parallel experimental groups: a control group or groups supplemented with 1.3 g EPA/d, 0.3 g LA/d, or both. Secondary outcomes were measured at baseline and at the end of the study. These included circulating inflammatory [C-reactive protein (CRP), adiponectin, interleukin 6 (IL-6), chemerin, haptoglobin, amyloid A, and leukocytes] and cardiovascular disease risk markers (platelet count and circulating apelin, asymmetric dimethylarginine, vascular endothelial growth factor, and plasminogen activator inhibitor 1). Gene expression of IL6, adhesion G protein-coupled receptor E1 (ADGRE1), interleukin 10 (IL10), chemokine (C-C motif) ligand 2, and adiponectin was measured in subcutaneous abdominal adipose tissue biopsies at endpoint. Supplementation with LA caused a greater reduction in some circulating inflammatory risk markers, such as CRP (-0.13 ± 0.07 mg/dL compared with 0.06 ± 0.07 mg/dL, P < 0.05) and leukocyte count (-0.74 ± 0.18 × 10 3 /mm 3 compared with 0.06 ± 0.18 × 10 3 /mm 3 , P < 0.01), than in the groups that were not supplemented with LA. In contrast, the fall in apelin concentrations that accompanied weight loss was less pronounced in groups that were supplemented with LA (-1.1 ± 4.9 pg/mL) than in those that were not (-21.3 ± 4.8 pg/mL, P < 0.01). In adipose tissue, compared with those who did not receive EPA, EPA-supplemented groups exhibited a downregulation of ADGRE1 (0.7 ± 0.1-fold compared with 1.0 ± 0.1-fold) (P < 0.05) and an upregulation of IL10 (1.8 ± 0.2-fold compared with 1.0 ± 0.2-fold) (P < 0.05) gene expression. Dietary supplementation with LA improves some systemic inflammatory and cardiovascular disease-related risk markers in healthy overweight or obese women independently of weight loss, whereas EPA modulates inflammation-related genes in adipose tissue. This trial was registered at clinicaltrials.gov as NCT01138774. © 2016 American Society for Nutrition.

  6. Amides of non-steroidal anti-inflammatory drugs with thiomorpholine can yield hypolipidemic agents with improved anti-inflammatory activity.

    PubMed

    Theodosis-Nobelos, Panagiotis; Kourti, Malamati; Gavalas, Antonios; Rekka, Eleni A

    2016-02-01

    Novel amides of non steroidal anti-inflammatory drugs (NSAIDs), α-lipoic acid and indole-3-acetic acid with thiomorpholine were synthesised by a simple method and at high yields (60-92%). All the NSAID derivatives highly decreased lipidemic indices in the plasma of Triton treated hyperlipidemic rats. The most potent compound was the indomethacin derivative, which decreased total cholesterol, triglycerides and LDL cholesterol by 73%, 80% and 83%, respectively. They reduced acute inflammation equally or more than most parent acids. Hence, it could be concluded that amides of common NSAIDs with thiomorpholine acquire considerable hypolipidemic potency, while they preserve or augment their anti-inflammatory activity, thus addressing significant risk factors for atherogenesis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Effects of triple antioxidant combination (vitamin E, vitamin C and alpha-lipoic acid) with insulin on lipid and cholesterol levels and fatty acid composition of brain tissue in experimental diabetic and non-diabetic rats.

    PubMed

    Ozkan, Yusuf; Yilmaz, Okkeş; Oztürk, Ali Ihsan; Erşan, Yasemin

    2005-09-01

    The aim of this research was to examine the effects of a triple antioxidant combination (vitamins E (VE) and C (VC) plus alpha-lipoic acid (LA)) on the total lipid and cholesterol levels and the fatty acid composition of brain tissues in experimental diabetic and non-diabetic rats. VE and LA were injected intraperitoneally (50 mg/kg) four times per week and VC was provided as a supplement dissolved in the drinking water (50 mg/kg). In addition, rats in the diabetes 1 and D+VELAVC groups were given daily by subcutaneous insulin injections (8 IU/kg), but no insulin was given to rats in the diabetes 2 group. The results indicate that the brain lipid levels in the D+VELAVC, diabetes 1 and diabetes 2 groups were higher than in the control group (P<0.01). Total lipid was also higher in the non-diabetic rats treated with LA and VC. Total cholesterol was higher in the diabetes 1 and diabetes 2 groups (P<0.05) than in controls. Cholesterol levels were similar in the D+VELAVC and LA groups but lower in the VC, VE and VELAVC groups of non-diabetic rats (P<0.05 and P<0.01). In respect of fatty acid composition, palmitic acid levels were lower in the diabetes 2 and non-diabetic VE groups than the control group (P<0.05), but higher in the non-diabetic LA group (P<0.05). Oleic acid (18:1 n-9) levels were lower in the diabetic and non-diabetic groups than the control group (P<0.01), but higher in the non-diabetic LA group. Arachidonic acid (20:4 n-6) levels were similar in the diabetes 1, D+VELAVC and control groups (P>0.05) but higher in the non-diabetic VE, VC, LA and VEVCLA groups (P<0.05) and lower in the diabetes 2 group (P<0.05). Docosahexaenoic acid (22:6 n-3) was elevated in the diabetes 2 and VEVCLA groups (P<0.01, P<0.05). In conclusion, the current study confirmed that treatment with a triple combination of VE, VC and LA protects the arachidonic acid level in the brains of diabetic and non-diabetic rats.

  8. Sulforaphane and alpha-lipoic acid upregulate the expression of the pi class of glutathione S-transferase through c-jun and Nrf2 activation.

    PubMed

    Lii, Chong-Kuei; Liu, Kai-Li; Cheng, Yi-Ping; Lin, Ai-Hsuan; Chen, Haw-Wen; Tsai, Chia-Wen

    2010-05-01

    The anticarcinogenic effect of dietary organosulfur compounds has been partly attributed to their modulation of the activity and expression of phase II detoxification enzymes. Our previous studies indicated that garlic allyl sulfides upregulate the expression of the pi class of glutathione S-transferase (GSTP) through the activator protein-1 pathway. Here, we examined the modulatory effect of sulforaphane (SFN) and alpha-lipoic acid (LA) or dihydrolipoic acid (DHLA) on GSTP expression in rat Clone 9 liver cells. Cells were treated with LA or DHLA (50-600 micromol/L) or SFN (0.2-5 micromol/L) for 24 h. Immunoblots and real-time PCR showed that SFN, LA, and DHLA dose dependently induced GSTP protein and mRNA expression. Compared with the induction by the garlic organosulfur compound diallyl trisulfide (DATS), the effectiveness was in the order of SFN > DATS > LA = DHLA. The increase in GSTP enzyme activity in cells treated with 5 micromol/L SFN, 50 micromol/L DATS, and 600 micromol/L LA and DHLA was 172, 75, 122, and 117%, respectively (P < 0.05). A reporter assay showed that the GSTP enhancer I (GPEI) was required for GSTP induction by the organosulfur compounds. Electromobility gel shift assays showed that the DNA binding of GPEI to nuclear proteins reached a maximum at 0.5-1 h after SFN, LA, and DHLA treatment. Super-shift assay revealed that the transcription factors c-jun and nuclear factor erythroid-2 related factor 2 (Nrf2) were bound to GPEI. These results suggest that SFN and LA in either its oxidized or reduced form upregulate the transcription of the GSTP gene by activating c-jun and Nrf2 binding to the enhancer element GPEI.

  9. Protecting the BBB Endothelium against Cigarette Smoke-Induced Oxidative Stress Using Popular Antioxidants: Are they really beneficial?

    PubMed Central

    Kaisar, Mohammad Abul; Prasad, Shikha; Cucullo, Luca

    2015-01-01

    Blood Brain Barrier (BBB) exposed to realistic concentrations (comparable to a chronic heavy smoker) of Cigarette Smoke Extract (CSE) triggers a strong endothelial inflammatory which can lead to the onset of neurological disorders. The involvement of Reactive Oxygen Species (ROS) in this inflammatory cascade is evident from the up-regulation of nuclear factor erythroid 2 related factor 2 (Nrf-2), a transcription factor involved in anti-oxidant response signaling in CSE exposed endothelial cells. We have shown that pre-treatment with α-tocopherol and/or ascorbic acid is highly protective for the BBB, thus suggesting that, prophylactic administration of antioxidants can reduce CSE and/or inflammatory-dependent BBB damage. We have assessed and ranked the protective effects of 5 popular OTC antioxidants (Coenzyme Q10, Melatonin, Glutathione, Lipoic acid and Resveratrol) against CSE-induced BBB endothelial damage using hCMEC/D3 cells. The analysis of pro-inflammatory cytokines release by ELISA revealed that, resveratrol, lipoic acid melatonin and Co-Q10 inhibited the BBB endothelial release of pro-inflammatory cytokines IL-6 & IL-8, reduced (not Co-Q10) CSE-induced up-regulation of Platelet Endothelial Cell Adhesion Molecule -1 (PECAM-1), Vascular Endothelial Cell Adhesion Molecule-1 (VCAM-1) & E-selectin and inhibited monocytes-endothelial cell adhesion. The anti-inflammatory effects correlated with the anti-oxidative protection endowed by these compounds as evidenced by upregulation of NADPH: Quinone Oxidoreductase 1 (NQO1) and reduced cellular oxidative stress. CSE-induced release of Vascular Endothelial Growth Factor (VEGF) was inhibited by all tested compounds although the effect was not strictly dose-dependent. Further in vivo studies are required to validate our results and expand our current study to include combinatorial treatments. PMID:26410779

  10. Complementary Cholesterol-Lowering Response of a Phytosterol/α-Lipoic Acid Combination in Obese Zucker Rats

    PubMed Central

    Rideout, Todd C.; Carrier, Bradley; Wen, Shin; Raslawsky, Amy; Browne, Richard W.; Harding, Scott V.

    2015-01-01

    To investigate the cholesterol-lowering effectiveness of a phytosterol/α-lipoic acid (PS/αLA) therapy, thirty-two male Zucker rats were randomly assigned to 1 of 4 diets for 30 days: (i) high fat diet (HF, 40% energy from fat); (ii) HF diet supplemented with 3% phytosterols; (iii) HF diet supplemented with 0.25% αLA; or (iv) HF diet supplemented with PS (3%) and αLA (0.25%, PS/αLA). Compared with the HF diet, combination PS/αLA proved more effective in reducing non-HDL cholesterol (−55%) than either the PS (−24%) or the αLA (−25%) therapies alone. PS supplementation did not affect LDL particle number, however, αLA supplementation reduced LDL particle number when supplemented alone (−47%) or in combination with PS (−54%). Compared with the HF-fed animals, evidence of increased HDL-particle number was evident in all treatment groups to a similar extent (21–22%). PS-mediated interruption of intestinal cholesterol absorption was evident by increased fecal cholesterol loss (52%) and compensatory increase in HMG-CoA reductase mRNA (1.6 fold of HF), however, αLA supplementation did not affect fecal cholesterol loss. Hepatic mRNA and protein expression patterns suggested that αLA modulated multiple aspects of cholesterol homeostasis including reduced synthesis (HMG-CoA reductase mRNA, 0.7 fold of HF), reduced bile acid synthesis (CYP7a1 expression, 0.17 of HF), and increased cholesterol clearance (reduced PCSK9 mRNA, 0.5 fold of HF; increased LDLr protein, 2 fold of HF). Taken together, this data suggests that PS and αLA work through unique and complementary mechanisms to provide a superior and more comprehensive cholesterol lowering response than either therapy alone. PMID:25664679

  11. (R)-α-Lipoic acid inhibits fructose-induced myoglobin fructation and the formation of advanced glycation end products (AGEs) in vitro.

    PubMed

    Ghelani, Hardik; Razmovski-Naumovski, Valentina; Pragada, Rajeswara Rao; Nammi, Srinivas

    2018-01-15

    Fructose-mediated protein glycation (fructation) has been linked to an increase in diabetic and cardiovascular complications due to over consumption of high-fructose containing diets in recent times. The objective of the present study is to evaluate the protective effect of (R)-α-lipoic acid (ALA) against fructose-induced myoglobin fructation and the formation of advanced glycation end products (AGEs) in vitro. The anti-glycation activity of ALA was determined using the formation of AGEs fluorescence intensity, iron released from the heme moiety of myoglobin and the level of fructosamine. The fructation-induced myoglobin oxidation was examined using the level of protein carbonyl content and thiol group estimation. The results showed that co-incubation of myoglobin (1 mg/mL), fructose (1 M) and ALA (1, 2 and 4 mM) significantly inhibited the formation of AGEs during the 30 day study period. ALA markedly decreased the levels of fructosamine, which is directly associated with the reduction of AGEs formation. Furthermore, ALA significantly reduced free iron release from myoglobin which is attributed to the protection of myoglobin from fructose-induced glycation. The results also demonstrated a significant protective effect of ALA on myoglobin oxidative damages, as seen from decreased protein carbonyl content and increased protein thiols. These findings provide new insights into the anti-glycation properties of ALA and emphasize that ALA supplementation is beneficial in the prevention of AGEs-mediated diabetic and cardiovascular complications.

  12. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading

    PubMed Central

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan

    2015-01-01

    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with ClinicalTrials.gov Identifier: NCT02439879. PMID:26345602

  13. Synergic prooxidant, apoptotic and TRPV1 channel activator effects of alpha-lipoic acid and cisplatin in MCF-7 breast cancer cells.

    PubMed

    Nur, Gökhan; Nazıroğlu, Mustafa; Deveci, Haci Ahmet

    2017-12-01

    Resistance to cisplatin (Cisp) in the treatment of breast cancer is a major obstacle. Alpha-lipoic acid (ALA) has both antioxidant and oxidant properties. ALA has been used on stimulation mechanisms of apoptosis and oxidative stress in the treatment of cancer with a combination of chemotherapeutic agents, although its role on molecular mechanisms in the cancer cells has not been clarified yet. The aim of this study was to evaluate if a combination therapy of ALA with Cisp can alter the effect of this chemotherapy drug in the MCF-7 breast cancer cells. The MCF-7 cells were divided into four treatment groups as control, Cisp (0.025 mM), ALA (0.05 mM), and Cisp + ALA. Apoptosis, mitochondrial membrane depolarization, reactive oxygen species (ROS) production, lipid peroxidation, PARP1, caspase 3 and 9 expression levels are increased through activating TRPV1 in the cells by the Cisp and ALA treatments, although cell viability, reduced glutathione and glutathione peroxidase (GPx) values were decreased by the treatments. The Cisp and ALA-induced increase of intracellular free Ca 2+ concentration was decreased with the TRPV1 blocker, capsazepine. Apoptosis and oxidant effects of Cisp were increased by activation of TRPV1 channels, but its action on the values was further increased by the ALA treatment. Combination therapy of ALA and Cisp could be used as an effective strategy in the treatment of breast cancer.

  14. Efficacy of DL-alpha-lipoic acid on methanol induced free radical changes, protein oxidative damages and hsp70 expression in folate deficient rat nervous tissue.

    PubMed

    Rajamani, Rathinam; Muthuvel, Arumugam; Manikandan, Sundaramahalingam; Srikumar, Ramasundaram; Sheeladevi, Rathinasamy

    2007-05-01

    DL-alpha-Lipoic acid (LPA) was reported to be effective in reducing free radicals generated by oxidative stress. The protective of effect of LPA on methanol (MeOH) induced free radical changes and oxidative damages in discrete regions of rat brain have been reported in this study. Folate deficient rat (FDD) model was used. The five animal groups (saline control, FDD control, FDD+MeOH, FDD+LPA+MeOH, LPA control) were used. The FDD+MeOH and FDD+LPA+MeOH animals were injected intraperitoneally with methanol (3gm/kg). After 24h, the level of free radical scavengers such as, superoxide dismutase, catalase, glutathione peroxidase, reduced glutathione was estimated in six discrete regions of brain, retina and optic nerve. Level of protein thiol, protein carbonyl and lipid peroxidation was also estimated. Expression of heat shock protein 70 mRNA (hsp70) was studied in the cerebellum and hippocampus by reverse transcriptase PCR. All the samples showed elevation in the level of free radical scavenging enzymes and reduced level of glutathione in the FDD+MeOH group in relation to the other groups. hsp70 expression was more in FDD+MeOH group when compared to FDD+LPA+MeOH group. In conclusion, MeOH exposure leads to increased free radical generation and protein oxidative damages in the rat nervous tissue. Treatment with LPA prevents oxidative damage induced by MeOH exposure.

  15. Efficient Synthesis of a Maghemite/Gold Hybrid Nanoparticle System as a Magnetic Carrier for the Transport of Platinum-Based Metallotherapeutics

    PubMed Central

    Štarha, Pavel; Smola, David; Tuček, Jiří; Trávníček, Zdeněk

    2015-01-01

    The preparation and thorough characterization of a hybrid magnetic carrier system for the possible transport of activated platinum-based anticancer drugs, as demonstrated for cisplatin (cis-[Pt(NH3)2Cl2], CDDP), are described. The final functionalized mag/Au–LA–CDDP* system consists of maghemite/gold nanoparticles (mag/Au) coated by lipoic acid (HLA; LA stands for deprotonated form of lipoic acid) and functionalized by activated cisplatin in the form of cis-[Pt(NH3)2(H2O)2]2+ (CDDP*). The relevant techniques (XPS, EDS, ICP-MS) proved the incorporation of the platinum-containing species on the surface of the studied hybrid system. HRTEM, TEM and SEM images showed the nanoparticles as spherical with an average size of 12 nm, while their superparamagnetic feature was proven by 57Fe Mössbauer spectroscopy. In the case of mag/Au, mag/Au–HLA and mag/Au–LA–CDDP*, weaker magnetic interactions among the Fe3+ centers of maghemite, as compared to maghemite nanoparticles (mag), were detected, which can be associated with the non-covalent coating of the maghemite surface by gold. The pH and time-dependent stability of the mag/Au–LA–CDDP* system in different media, represented by acetate (pH 5.0), phosphate (pH 7.0) and carbonate (pH 9.0) buffers and connected with the release of the platinum-containing species, showed the ability of CDDP* to be released from the functionalized nanosystem. PMID:25603182

  16. The impact of α-Lipoic acid on cell viability and expression of nephrin and ZNF580 in normal human podocytes.

    PubMed

    Leppert, Ulrike; Gillespie, Allan; Orphal, Miriam; Böhme, Karen; Plum, Claudia; Nagorsen, Kaj; Berkholz, Janine; Kreutz, Reinhold; Eisenreich, Andreas

    2017-09-05

    Human podocytes (hPC) are essential for maintaining normal kidney function and dysfunction or loss of hPC play a pivotal role in the manifestation and progression of chronic kidney diseases including diabetic nephropathy. Previously, α-Lipoic acid (α-LA), a licensed drug for treatment of diabetic neuropathy, was shown to exhibit protective effects on diabetic nephropathy in vivo. However, the effect of α-LA on hPC under non-diabetic conditions is unknown. Therefore, we analyzed the impact of α-LA on cell viability and expression of nephrin and zinc finger protein 580 (ZNF580) in normal hPC in vitro. Protein analyses were done via Western blot techniques. Cell viability was determined using a functional assay. hPC viability was dynamically modulated via α-LA stimulation in a concentration-dependent manner. This was associated with reduced nephrin and ZNF580 expression and increased nephrin phosphorylation in normal hPC. Moreover, α-LA reduced nephrin and ZNF580 protein expression via 'kappa-light-chain-enhancer' of activated B-cells (NF-κB) inhibition. These data demonstrate that low α-LA had no negative influence on hPC viability, whereas, high α-LA concentrations induced cytotoxic effects on normal hPC and reduced nephrin and ZNF580 expression via NF-κB inhibition. These data provide first novel information about potential cytotoxic effects of α-LA on hPC under non-diabetic conditions. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Supplementation with α-Lipoic Acid, CoQ10, and Vitamin E Augments Running Performance and Mitochondrial Function in Female Mice

    PubMed Central

    Abadi, Arkan; Crane, Justin D.; Ogborn, Daniel; Hettinga, Bart; Akhtar, Mahmood; Stokl, Andrew; MacNeil, Lauren; Safdar, Adeel; Tarnopolsky, Mark

    2013-01-01

    Antioxidant supplements are widely consumed by the general public; however, their effects of on exercise performance are controversial. The aim of this study was to examine the effects of an antioxidant cocktail (α-lipoic acid, vitamin E and coenzyme Q10) on exercise performance, muscle function and training adaptations in mice. C57Bl/J6 mice were placed on antioxidant supplement or placebo-control diets (n = 36/group) and divided into trained (8 wks treadmill running) (n = 12/group) and untrained groups (n = 24/group). Antioxidant supplementation had no effect on the running performance of trained mice nor did it affect training adaptations; however, untrained female mice that received antioxidants performed significantly better than placebo-control mice (p ≤ 0.05). Furthermore, antioxidant-supplemented females (untrained) showed elevated respiratory capacity in freshly excised muscle fibers (quadriceps femoris) (p ≤ 0.05), reduced oxidative damage to muscle proteins (p ≤ 0.05), and increased expression of mitochondrial proteins (p ≤ 0.05) compared to placebo-controls. These changes were attributed to increased expression of proliferator-activated receptor gamma coactivator 1α (PGC-1α) (p ≤ 0.05) via activation of AMP-activated protein kinase (AMPK) (p ≤ 0.05) by antioxidant supplementation. Overall, these results indicate that this antioxidant supplement exerts gender specific effects; augmenting performance and mitochondrial function in untrained females, but does not attenuate training adaptations. PMID:23565271

  18. The effects and mechanisms of mitochondrial nutrient alpha-lipoic acid on improving age-associated mitochondrial and cognitive dysfunction: an overview.

    PubMed

    Liu, Jiankang

    2008-01-01

    We have identified a group of nutrients that can directly or indirectly protect mitochondria from oxidative damage and improve mitochondrial function and named them "mitochondrial nutrients". The direct protection includes preventing the generation of oxidants, scavenging free radicals or inhibiting oxidant reactivity, and elevating cofactors of defective mitochondrial enzymes with increased Michaelis-Menten constant to stimulate enzyme activity, and also protect enzymes from further oxidation, and the indirect protection includes repairing oxidative damage by enhancing antioxidant defense systems either through activation of phase 2 enzymes or through increase in mitochondrial biogenesis. In this review, we take alpha-lipoic acid (LA) as an example of mitochondrial nutrients by summarizing the protective effects and possible mechanisms of LA and its derivatives on age-associated cognitive and mitochondrial dysfunction of the brain. LA and its derivatives improve the age-associated decline of memory, improve mitochondrial structure and function, inhibit the age-associated increase of oxidative damage, elevate the levels of antioxidants, and restore the activity of key enzymes. In addition, co-administration of LA with other mitochondrial nutrients, such as acetyl-L: -carnitine and coenzyme Q10, appears more effective in improving cognitive dysfunction and reducing oxidative mitochondrial dysfunction. Therefore, administrating mitochondrial nutrients, such as LA and its derivatives in combination with other mitochondrial nutrients to aged people and patients suffering from neurodegenerative diseases, may be an effective strategy for improving mitochondrial and cognitive dysfunction.

  19. The antioxidants alpha-lipoic acid and N-acetylcysteine reverse memory impairment and brain oxidative stress in aged SAMP8 mice.

    PubMed

    Farr, Susan A; Poon, H Fai; Dogrukol-Ak, Dilek; Drake, Jeniffer; Banks, William A; Eyerman, Edward; Butterfield, D Allan; Morley, John E

    2003-03-01

    Oxidative stress may play a crucial role in age-related neurodegenerative disorders. Here, we examined the ability of two antioxidants, alpha-lipoic acid (LA) and N-acetylcysteine (NAC), to reverse the cognitive deficits found in the SAMP8 mouse. By 12 months of age, this strain develops elevated levels of Abeta and severe deficits in learning and memory. We found that 12-month-old SAMP8 mice, in comparison with 4-month-old mice, had increased levels of protein carbonyls (an index of protein oxidation), increased TBARS (an index of lipid peroxidation) and a decrease in the weakly immobilized/strongly immobilized (W/S) ratio of the protein-specific spin label MAL-6 (an index of oxidation-induced conformational changes in synaptosomal membrane proteins). Chronic administration of either LA or NAC improved cognition of 12-month-old SAMP8 mice in both the T-maze footshock avoidance paradigm and the lever press appetitive task without inducing non-specific effects on motor activity, motivation to avoid shock, or body weight. These effects probably occurred directly within the brain, as NAC crossed the blood-brain barrier and accumulated in the brain. Furthermore, treatment of 12-month-old SAMP8 mice with LA reversed all three indexes of oxidative stress. These results support the hypothesis that oxidative stress can lead to cognitive dysfunction and provide evidence for a therapeutic role for antioxidants.

  20. Alpha-lipoic acid protects cardiomyocytes against hypoxia/reoxygenation injury by inhibiting autophagy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao, Xueming; Chen, Aihua, E-mail: aihuachen2012@sina.com; Yang, Pingzhen

    Highlights: •We observed the cell viability and death subjected to H/R in H9c2 cardiomyocytes. •We observed the degree of autophagy subjected to H/R in H9c2 cardiomyocytes. •LA inhibited the degree of autophagy in parallel to the enhanced cell survival. •LA inhibited the autophagy in parallel to the decreased total cell death. •We concluded that LA protected cardiomyocytes against H/R by inhibiting autophagy. -- Abstract: Hypoxia/reoxygenation (H/R) is an important in vitro model for exploring the molecular mechanisms and functions of autophagy during myocardial ischemia/reperfusion (I/R). Alpha-lipoic acid (LA) plays an important role in the etiology of cardiovascular disease. Autophagy ismore » widely implicated in myocardial I/R injury. We assessed the degree of autophagy by pretreatment with LA exposed to H/R in H9c2 cell based on the expression levels of Beclin-1, LC3II/LC3I, and green fluorescent protein-labeled LC3 fusion proteins. Autophagic vacuoles were confirmed in H9c2 cells exposed to H/R using transmission electron microscopy. Our findings indicated that pretreatment with LA inhibited the degree of autophagy in parallel to the enhanced cell survival and decreased total cell death in H9c2 cells exposed to H/R. We conclude that LA protects cardiomyocytes against H/R injury by inhibiting autophagy.« less

  1. Staphylococcus aureus SufT: an essential iron-sulphur cluster assembly factor in cells experiencing a high-demand for lipoic acid.

    PubMed

    Mashruwala, Ameya A; Roberts, Christina A; Bhatt, Shiven; May, Kerrie L; Carroll, Ronan K; Shaw, Lindsey N; Boyd, Jeffrey M

    2016-12-01

    Staphylococcus aureus SufT is composed solely of the domain of unknown function 59 (DUF59) and has a role in the maturation of iron-sulphur (Fe-S) proteins. We report that SufT is essential for S. aureus when growth is heavily reliant upon lipoamide-utilizing enzymes, but dispensable when this reliance is decreased. LipA requires Fe-S clusters for lipoic acid (LA) synthesis and a ΔsufT strain had phenotypes suggestive of decreased LA production and decreased activities of lipoamide-requiring enzymes. Fermentative growth, a null clpC allele, or decreased flux through the TCA cycle diminished the demand for LA and rendered SufT non-essential. Abundance of the Fe-S cluster carrier Nfu was increased in a ΔclpC strain and a null clpC allele was unable to suppress the LA requirement of a ΔsufT Δnfu strain. Over-expression of nfu suppressed the LA requirement of the ΔsufT strain. We propose a model wherein SufT, and by extension the DUF59, is essential for the maturation of holo-LipA in S. aureus cells experiencing a high demand for lipoamide-dependent enzymes. The findings presented suggest that the demand for products of Fe-S enzymes is a factor governing the usage of one Fe-S cluster assembly factor over another in the maturation of apo-proteins. © 2016 John Wiley & Sons Ltd.

  2. The Combination of N-Acetyl Cysteine, Alpha-Lipoic Acid, and Bromelain Shows High Anti-Inflammatory Properties in Novel In Vivo and In Vitro Models of Endometriosis

    PubMed Central

    Agostinis, C.; Zorzet, S.; De Leo, R.; Zauli, G.; De Seta, F.; Bulla, R.

    2015-01-01

    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory “marker” VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis. PMID:25960622

  3. The combination of N-acetyl cysteine, alpha-lipoic acid, and bromelain shows high anti-inflammatory properties in novel in vivo and in vitro models of endometriosis.

    PubMed

    Agostinis, C; Zorzet, S; De Leo, R; Zauli, G; De Seta, F; Bulla, R

    2015-01-01

    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory "marker" VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis.

  4. L-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB), Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2), and Hypoxia-Inducible Factor (HIF)

    PubMed Central

    Park, Seoung Ju; Lee, Kyung Sun; Lee, Su Jeong; Kim, So Ri; Park, Seung Yong; Jeon, Myoung Shin; Lee, Heung Bum; Lee, Yong Chul

    2012-01-01

    Reactive oxygen species (ROS) play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, L-2-oxothiazolidine-4-carboxylic acid (OTC) or α-lipoic acid (LA) on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA) increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB), nuclear factor erythroid 2p45-related factor-2 (Nrf2), hypoxia-inducible factor (HIF)-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling. PMID:22942681

  5. Investigation of the role of α-lipoic acid on fatty acids profile, some minerals (zinc, copper, iron) and antioxidant activity against aluminum-induced oxidative stress in the liver of male rats.

    PubMed

    Sahin, Zafer; Ozkaya, Ahmet; Yilmaz, Okkes; Yuce, Abdurrauf; Gunes, Mehmet

    2017-07-26

    We have investigated the effects of α-lipoic acid (LA), a powerful antioxidant, on the fatty acid (FA) profiles, aluminum accumulation, antioxidant activity and some minerals such as zinc, copper and iron against aluminum chloride (AlCl3)-induced oxidative stress in rat liver. Twenty-eight male Wistar rats were divided into four groups as control, LA, AlCl3 and LA+AlCl3. For 30 days, LA was intraperitoneally administrated (50 mg/kg) and AlCl3 was given via orogastric gavage (1600 ppm) every other day. AlCl3-treated animals exhibited higher hepatic malondialdehyde concentration and lower glutathione peroxidase and catalase activity, whereas these alterations were restored by the LA supplementation. Total saturated FA of the AlCl3-treated group was higher than the LA supplementation groups. Moreover, total unsaturated FA level of the LA+AlCl3 group was higher than the AlCl3-treated group. Hepatic zinc level of the AlCl3-treated group was lower than the control group, whereas it was higher in the LA and the LA+AlCl3 groups. Hepatic copper levels did not significantly change in the experimental groups. Iron level was lower in the LA and LA+AlCl3 groups compared with the AlCl3-treated group. Moreover, the liver Al concentration was found to be lower in the LA and LA+AlCl3 groups compared to the AlCl3 group. These results indicate that AlCl3 treatment can induce oxidative stress in the liver. LA supplementation has a beneficial effect on the AlCl3-induced alterations such as high lipid peroxidation, Al accumulation, FA profile ratios and mineral concentrations.

  6. Alpha-Lipoic Acid Reduces LDL-Particle Number and PCSK9 Concentrations in High-Fat Fed Obese Zucker Rats

    PubMed Central

    Carrier, Bradley; Wen, Shin; Zigouras, Sophia; Browne, Richard W.; Li, Zhuyun; Patel, Mulchand S.; Williamson, David L.; Rideout, Todd C.

    2014-01-01

    We characterized the hypolipidemic effects of alpha-lipoic acid (LA, R-form) and examined the associated molecular mechanisms in a high fat fed Zucker rat model. Rats (n = 8) were assigned to a high fat (HF) diet or the HF diet with 0.25% LA (HF-LA) for 30 days and pair fed to remove confounding effects associated with the anorectic properties of LA. Compared with the HF controls, the HF-LA group was protected against diet-induced obesity (102.5±3.1 vs. 121.5±3.6,% change BW) and hypercholesterolemia with a reduction in total-C (−21%), non-HDL-C (−25%), LDL-C (−16%), and total LDL particle number (−46%) and an increase in total HDL particles (∼22%). This cholesterol-lowering response was associated with a reduction in plasma PCSK9 concentration (−70%) and an increase in hepatic LDLr receptor protein abundance (2 fold of HF). Compared with the HF-fed animals, livers of LA-supplemented animals were protected against TG accumulation (−46%), likely through multiple mechanisms including: a suppressed lipogenic response (down-regulation of hepatic acetyl-CoA carboxylase and fatty acid synthase expression); enhanced hepatic fat oxidation (increased carnitine palmitoyltransferase Iα expression); and enhanced VLDL export (increased hepatic diacylglycerol acyltransferase and microsomal triglyceride transfer protein expression and elevated plasma VLDL particle number). Study results also support an enhanced fatty acid uptake (2.8 fold increase in total lipase activity) and oxidation (increased CPT1β protein abundance) in muscle tissue in LA-supplemented animals compared with the HF group. In summary, in the absence of a change in caloric intake, LA was effective in protecting against hypercholesterolemia and hepatic fat accumulation under conditions of strong genetic and dietary predisposition toward obesity and dyslipidemia. PMID:24595397

  7. Germanium Plasmon Enhanced Resonators for Label-Free Terahertz Protein Sensing

    NASA Astrophysics Data System (ADS)

    Bettenhausen, Maximilian; Römer, Friedhard; Witzigmann, Bernd; Flesch, Julia; Kurre, Rainer; Korneev, Sergej; Piehler, Jacob; You, Changjiang; Kazmierczak, Marcin; Guha, Subhajit; Capellini, Giovanni; Schröder, Thomas

    2018-03-01

    A Terahertz protein sensing concept based on subwavelength Ge resonators is presented. Ge bowtie resonators, compatible with CMOS fabrication technology, have been designed and characterized with a resonance frequency of 0.5 THz and calculated local intensity enhancement of 10.000. Selective biofunctionalization of Ge resonators on Si wafer was achieved in one step using lipoic acid-HaloTag ligand (LA-HTL) for biofunctionalization and passivation. The results lay the foundation for future investigation of protein tertiary structure and the dynamics of protein hydration shell in response to protein conformation changes.

  8. Sensing Reversible Protein–Ligand Interactions with Single-Walled Carbon Nanotube Field-Effect Transistors

    PubMed Central

    2015-01-01

    We report on the reversible detection of CaptAvidin, a tyrosine modified avidin, with single-walled carbon nanotube (SWNT) field-effect transistors (FETs) noncovalently functionalized with biotin moieties using 1-pyrenebutyric acid as a linker. Binding affinities at different pH values were quantified, and the sensor’s response at various ionic strengths was analyzed. Furthermore, protein “fingerprints” of NeutrAvidin and streptavidin were obtained by monitoring their adsorption at several pH values. Moreover, gold nanoparticle decorated SWNT FETs were functionalized with biotin using 1-pyrenebutyric acid as a linker for the CNT surface and (±)-α-lipoic acid linkers for the gold surface, and reversible CaptAvidin binding is shown, paving the way for potential dual mode measurements with the addition of surface enhanced Raman spectroscopy (SERS). PMID:25126155

  9. Influence of Different Antioxidants on X-Ray Induced DNA Double-Strand Breaks (DSBs) Using γ-H2AX Immunofluorescence Microscopy in a Preliminary Study

    PubMed Central

    Brand, Michael; Sommer, Matthias; Ellmann, Stephan; Wuest, Wolfgang; May, Matthias S.; Eller, Achim; Vogt, Sabine; Lell, Michael M.; Kuefner, Michael A.; Uder, Michael

    2015-01-01

    Background Radiation exposure occurs in X-ray guided interventional procedures or computed tomography (CT) and γ-H2AX-foci are recognized to represent DNA double-strand breaks (DSBs) as a biomarker for radiation induced damage. Antioxidants may reduce the induction of γ-H2AX-foci by binding free radicals. The aim of this study was to establish a dose-effect relationship and a time-effect relationship for the individual antioxidants on DSBs in human blood lymphocytes. Materials and Methods Blood samples from volunteers were irradiated with 10 mGy before and after pre-incubation with different antioxidants (zinc, trolox, lipoic acid, ß-carotene, selenium, vitamin E, vitamin C, N-acetyl-L-cysteine (NAC) and Q 10). Thereby, different pre-incubation times, concentrations and combinations of drugs were evaluated. For assessment of DSBs, lymphocytes were stained against the phosphorylated histone variant γ-H2AX. Results For zinc, trolox and lipoic acid regardless of concentration or pre-incubation time, no significant decrease of γ-H2AX-foci was found. However, ß-carotene (15%), selenium (14%), vitamin E (12%), vitamin C (25%), NAC (43%) and Q 10 (18%) led to a significant reduction of γ-H2AX-foci at a pre-incubation time of 1 hour. The combination of different antioxidants did not have an additive effect. Conclusion Antioxidants administered prior to irradiation demonstrated the potential to reduce γ-H2AX-foci in blood lymphocytes. PMID:25996998

  10. Low-cost and disposable sensors for the simultaneous determination of coenzyme Q10 and α-lipoic acid using manganese (IV) oxide-modified screen-printed graphene electrodes.

    PubMed

    Charoenkitamorn, Kanokwan; Chaiyo, Sudkate; Chailapakul, Orawon; Siangproh, Weena

    2018-04-03

    In this work, for the first time, manganese (IV) oxide-modified screen-printed graphene electrodes (MnO 2 /SPGEs) were developed for the simultaneous electrochemical detection of coenzyme Q10 (CoQ10) and α-lipoic acid (ALA). This sensor exhibits attractive benefits such as simplicity, low production costs, and disposability. Cyclic voltammetry (CV) was used to characterize the electrochemical behavior of the analyte and investigate the capacitance and electroactive surface area of the unmodified and modified electrode surfaces. The electrochemical behavior of CoQ10 and ALA on MnO 2 /SPGEs was also discussed. Additionally, square wave anodic stripping voltammetry (SWASV) was used for the quantitative determination of CoQ10 and ALA. Under optimal conditions, the obtained signals are linear in the concentration range from 2.0 to 75.0 μg mL -1 for CoQ10 and 0.3-25.0 μg mL -1 for ALA. The low limits of detection (LODs) were found to be 0.56 μg mL -1 and 0.088 μg mL -1 for CoQ10 and ALA, respectively. Moreover, we demonstrated the utility and applicability of the MnO 2 /SPGE sensor through simultaneous measurements of CoQ10 and ALA in dietary supplements. The sensor provides high accuracy measurements, exhibiting its high potential for practical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Advantages of the Alpha-lipoic Acid Association with Chlorpromazine in a Model of Schizophrenia Induced by Ketamine in Rats: Behavioral and Oxidative Stress evidences.

    PubMed

    Sampaio, Luis Rafael Leite; Cysne Filho, Francisco Maurício Sales; de Almeida, Jamily Cunha; Diniz, Danilo Dos Santos; Patrocínio, Cláudio Felipe Vasconcelos; de Sousa, Caren Nádia Soares; Patrocínio, Manoel Cláudio Azevedo; Macêdo, Danielle; Vasconcelos, Silvânia Maria Mendes

    2018-03-01

    Schizophrenia is a chronic mental disorder reported to compromise about 1% of the world's population. Although its pathophysiological process is not completely elucidated, evidence showing the presence of an oxidative imbalance has been increasingly highlighted in the literature. Thus, the use of antioxidant substances may be of importance for schizophrenia treatment. The objective of this study was to evaluate the behavioral and oxidative alterations by the combination of chlorpromazine (CP) and alpha-lipoic acid (ALA), a potent antioxidant, in the ketamine (KET) model of schizophrenia in rats. Male Wistar rats (200-300 g) were treated for 10 days with saline, CP or ALA alone or in combination with CP previous to KET and the behavioral (open field, Y-maze and PPI tests) and oxidative tests were performed on the last day of treatment. The results showed that KET induced hyperlocomotion, impaired working memory and decreased PPI. CP alone or in combination with ALA prevented KET-induced behavioral effects. In addition, the administration of KET decreased GSH and increased nitrite, lipid peroxidation and myeloperoxidase activity. CP alone or combined with ALA prevented the oxidative alterations induced by KET. In conclusion, the treatment with KET in rats induced behavioral impairments accompanied by hippocampal oxidative alterations, possibly related to NMDA receptors hypofunction. Besides that, CP alone or combined with ALA prevented these effects, showing a beneficial activity as antipsychotic agents. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

  12. Early alpha-lipoic acid therapy protects from degeneration of the inner retinal layers and vision loss in an experimental autoimmune encephalomyelitis-optic neuritis model.

    PubMed

    Dietrich, Michael; Helling, Niklas; Hilla, Alexander; Heskamp, Annemarie; Issberner, Andrea; Hildebrandt, Thomas; Kohne, Zippora; Küry, Patrick; Berndt, Carsten; Aktas, Orhan; Fischer, Dietmar; Hartung, Hans-Peter; Albrecht, Philipp

    2018-03-07

    In multiple sclerosis (MS), neurodegeneration is the main reason for chronic disability. Alpha-lipoic acid (LA) is a naturally occurring antioxidant which has recently been demonstrated to reduce the rate of brain atrophy in progressive MS. However, it remains uncertain if it is also beneficial in the early, more inflammatory-driven phases. As clinical studies are costly and time consuming, optic neuritis (ON) is often used for investigating neuroprotective or regenerative therapeutics. We aimed to investigate the prospect for success of a clinical ON trial using an experimental autoimmune encephalomyelitis-optic neuritis (EAE-ON) model with visual system readouts adaptable to a clinical ON trial. Using an in vitro cell culture model for endogenous oxidative stress, we compared the neuroprotective capacity of racemic LA with the R/S-enantiomers and its reduced form. In vivo, we analyzed retinal neurodegeneration using optical coherence tomography (OCT) and the visual function by optokinetic response (OKR) in MOG 35-55 -induced EAE-ON in C57BL/6J mice. Ganglion cell counts, inflammation, and demyelination were assessed by immunohistological staining of retinae and optic nerves. All forms of LA provided equal neuroprotective capacities in vitro. In EAE-ON, prophylactic LA therapy attenuated the clinical EAE score and prevented the thinning of the inner retinal layer while therapeutic treatment was not protective on visual outcomes. A prophylactic LA treatment is necessary to protect from visual loss and retinal thinning in EAE-ON, suggesting that a clinical ON trial starting therapy after the onset of symptoms may not be successful.

  13. Potential Therapeutic Effects of Lipoic Acid on Memory Deficits Related to Aging and Neurodegeneration.

    PubMed

    Molz, Patrícia; Schröder, Nadja

    2017-01-01

    The aging process comprises a series of organic alterations, affecting multiple systems, including the nervous system. Aging has been considered the main risk factor for the advance of neurodegenerative diseases, many of which are accompanied by cognitive impairment. Aged individuals show cognitive decline, which has been associated with oxidative stress, as well as mitochondrial, and consequently energetic failure. Lipoic acid (LA), a natural compound present in food and used as a dietary supplement, has been considered a promising agent for the treatment and/or prevention of neurodegenerative disorders. In spite of a number of preclinical studies showing beneficial effects of LA in memory functioning, and pointing to its neuroprotective potential effect, to date only a few studies have examined its effects in humans. Investigations performed in animal models of memory loss associated to aging and neurodegenerative disorders have shown that LA improves memory in a variety of behavioral paradigms. Moreover, cell and molecular mechanisms underlying LA effects have also been investigated. Accordingly, LA displays antioxidant, antiapoptotic, and anti-inflammatory properties in both in vivo and in vitro studies. In addition, it has been shown that LA reverses age-associated loss of neurotransmitters and their receptors, which can underlie its effects on cognitive functions. The present review article aimed at summarizing and discussing the main studies investigating the effects of LA on cognition as well as its cell and molecular effects, in order to improve the understanding of the therapeutic potential of LA on memory loss during aging and in patients suffering from neurodegenerative disorders, supporting the development of clinical trials with LA.

  14. Type 1 5'-deiodinase activity is inhibited by oxidative stress and restored by alpha-lipoic acid in HepG2 cells.

    PubMed

    Chen, Kanjun; Yan, Biao; Wang, Fei; Wen, Feiting; Xing, Xingan; Tang, Xue; Shi, Yonghui; Le, Guowei

    2016-04-08

    3,3',5-triiodothyronine (T3) is largely generated from thyroxine (T4) by the catalysis of deiodinases in peripheral tissues. Emerging evidences have indicated its broad participation in regulating various metabolic process via protecting tissues from oxidative stress and improving cellular antioxidant capacity. However, the potential correlation between the oxidative stress and conversion of T4 to T3 is still unclear. In the present study, the effects of T3 and T4 on redox homeostasis in HepG2 cells pre-treated with H2O2 was investigated. It revealed that T3 significantly rescued the apoptotic cell death, consistent with an upregulation of cell antioxidant ability and reduction of ROS accumulation while T4 did not. Afterwards, we examined the enzyme activity and mRNA expression of type 1 5'-deiodianse (DIO1), T3 and rT3 level and found that H2O2 reduced both DIO1 activity and expression in a dose-dependent manner, which consequently declined T3 and rT3 generation. Alpha-lipoic acid (LA) treatment notably restored DIO1 activity, T3 and rT3 level, as well as transcriptional abnormalities of inflammation-associated genes. It suggests that oxidative stress may reduce DIO1 activity by an indirect way like activating cellular inflammatory responses. All these results indicate that the oxidative stress downregulates the conversion of T4 to T3 through DIO1 function in HepG2 cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Determination of lipoic acid in human urine by capillary zone electrophoresis.

    PubMed

    Kubalczyk, Paweł; Głowacki, Rafał

    2017-07-01

    Fast, simple, and accurate CE method enabling determination of lipoic acid (LA) in human urine has been developed and validated. LA is a disulfide-containing natural compound absorbed from the organism's diet. Due to powerful antioxidant activity, LA has been used for prevention and treatment of various diseases and disorders, e.g. cardiovascular diseases, neurodegenerative disorders, and cancer. The proposed analytical procedure consists of liquid-liquid sample extraction, reduction of LA with tris(2-carboxyethyl)phosphine, derivatization with 1-benzyl-2-chloropyridinium bromide (BCPB) followed by field amplified sample injection stacking, capillary zone electrophoresis separation, and ultraviolet-absorbance detection of LA-BCPB derivative at 322 nm. Effective baseline electrophoretic separation was achieved within 6 min under the separation voltage of 20 kV (∼80 μA) using a standard fused-silica capillary (effective length 51.5 cm, 75 μm id) and BGE consisted of 0.05 mol/L borate buffer adjusted to pH 9. The experimentally determined limit of detection for LA in urine was 1.2 μmol/L. The calibration curve obtained for LA in urine showed linearity in the range 2.5-80 μmol/L, with R 2 0.9998. The relative standard deviation of the points of the calibration curve was lower than 10%. The analytical procedure was successfully applied to analysis of real urine samples from seven healthy volunteers who received single 100 mg dose of LA. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Potential Therapeutic Effects of Lipoic Acid on Memory Deficits Related to Aging and Neurodegeneration

    PubMed Central

    Molz, Patrícia; Schröder, Nadja

    2017-01-01

    The aging process comprises a series of organic alterations, affecting multiple systems, including the nervous system. Aging has been considered the main risk factor for the advance of neurodegenerative diseases, many of which are accompanied by cognitive impairment. Aged individuals show cognitive decline, which has been associated with oxidative stress, as well as mitochondrial, and consequently energetic failure. Lipoic acid (LA), a natural compound present in food and used as a dietary supplement, has been considered a promising agent for the treatment and/or prevention of neurodegenerative disorders. In spite of a number of preclinical studies showing beneficial effects of LA in memory functioning, and pointing to its neuroprotective potential effect, to date only a few studies have examined its effects in humans. Investigations performed in animal models of memory loss associated to aging and neurodegenerative disorders have shown that LA improves memory in a variety of behavioral paradigms. Moreover, cell and molecular mechanisms underlying LA effects have also been investigated. Accordingly, LA displays antioxidant, antiapoptotic, and anti-inflammatory properties in both in vivo and in vitro studies. In addition, it has been shown that LA reverses age-associated loss of neurotransmitters and their receptors, which can underlie its effects on cognitive functions. The present review article aimed at summarizing and discussing the main studies investigating the effects of LA on cognition as well as its cell and molecular effects, in order to improve the understanding of the therapeutic potential of LA on memory loss during aging and in patients suffering from neurodegenerative disorders, supporting the development of clinical trials with LA. PMID:29311912

  17. α-Lipoic Acid Promotes Neurological Recovery After Ischemic Stroke by Activating the Nrf2/HO-1 Pathway to Attenuate Oxidative Damage.

    PubMed

    Lv, Chengmei; Maharjan, Surendra; Wang, Qingqing; Sun, Yongxin; Han, Xu; Wang, Shan; Mao, Zhengchun; Xin, Yanming; Zhang, Bing

    2017-01-01

    Alpha-lipoic acid (α-LA) has been demonstrated to be protective against cerebral ischemia injury. Herein, we investigate the neuroprotective effect and underlying mechanisms of α-LA. In vivo study, α-LA was administered intravenously upon reperfusion of transient middle cerebral artery occlusion. Garcia score was used to evaluate neurologic recovery. Infarct volume was examined by TTC staining, and oxidative damage was evaluated by ELISA assay. In an in vitro study, neurons were pretreated with α-LA at different doses and then subjected to OGD. Lentiviral vectors were applied to knockdown nuclear factor-erythroid 2-related factor-2 (Nrf2) or heme oxygenase-1 (HO-1). Cell viability was measured using CCK8. Protein expression was evaluated using western blot, and immunofluorescence staining was assessed. α-LA significantly reduced the infarct volume, brain edema, and oxidative damage and promoted neurologic recovery in rats. Pretreatment of α-LA caused an obvious increase in cell viability and a decrease in intracellular reactive oxygen species. Western blot analyses and immunofluorescence staining demonstrated a distinct increase in Nrf2 and HO-1 protein expression. Conversely, knockdown of Nrf2 or HO-1 resulted in the down-regulation of HO-1 protein and inhibited the neuroprotective effect of α-LA. α-LA treatment is neuroprotective and promotes functional recovery after ischemic stroke by attenuating oxidative damage, which is partially mediated by the Nrf2/HO-1 pathway. © 2017 The Author(s). Published by S. Karger AG, Basel.

  18. Alpha-lipoic acid-mediated activation of muscarinic receptors improves hippocampus- and amygdala-dependent memory.

    PubMed

    Mahboob, Aamra; Farhat, Syeda Mehpara; Iqbal, Ghazala; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf; Nabavi, Seyed Mohammad; Ahmed, Touqeer

    2016-04-01

    Aluminum (Al) is a neurotoxic agent which readily crosses the blood-brain-barrier (BBB) and accumulates in the brain leading to neurodegenerative disorders, characterised by cognitive impairment. Alpha-lipoic acid (ALA) is an antioxidant and has a potential to improve cognitive functions. This study aimed to evaluate the neuroprotective effect of ALA in AlCl3-induced neurotoxicity mouse model. Effect of ALA (25mg/kg/day) was evaluated in the AlCl3-induced neurotoxicity (AlCl3 150 mg/kg/day) mouse model on learning and memory using behaviour tests and on the expression of muscarinic receptor genes (using RT-PCR), in hippocampus and amygdala. Following ALA treatment, the expression of muscarinic receptor genes M1, M2 and choline acetyltransferase (ChaT) were significantly improved (p<0.05) relative to AlCl3-treated group. ALA enhanced fear memory (p<0.01) and social novelty preference (p<0.001) comparative to the AlCl3-treated group. Fear extinction memory was remarkably restored (p<0.001) in ALA-treated group demonstrated by reduced freezing response as compared to the AlCl3-treated group which showed higher freezing. In-silico analysis showed that racemic mixture of ALA has higher binding affinity for M1 and M2 compared to acetylcholine. These novel findings highlight the potential role of ALA in cognitive functions and cholinergic system enhancement thus presenting it an enviable therapeutic candidate for the treatment of neurodegenerative disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Revisiting the ALA/N (alpha-lipoic acid/low-dose naltrexone) protocol for people with metastatic and nonmetastatic pancreatic cancer: a report of 3 new cases.

    PubMed

    Berkson, Burton M; Rubin, Daniel M; Berkson, Arthur J

    2009-12-01

    The authors, in a previous article, described the long-term survival of a man with pancreatic cancer and metastases to the liver, treated with intravenous alpha-lipoic acid and oral low-dose naltrexone (ALA/N) without any adverse effects. He is alive and well 78 months after initial presentation. Three additional pancreatic cancer case studies are presented in this article. At the time of this writing, the first patient, GB, is alive and well 39 months after presenting with adenocarcinoma of the pancreas with metastases to the liver. The second patient, JK, who presented to the clinic with the same diagnosis was treated with the ALA/N protocol and after 5 months of therapy, PET scan demonstrated no evidence of disease. The third patient, RC, in addition to his pancreatic cancer with liver and retroperitoneal metastases, has a history of B-cell lymphoma and prostate adenocarcinoma. After 4 months of the ALA/N protocol his PET scan demonstrated no signs of cancer. In this article, the authors discuss the poly activity of ALA: as an agent that reduces oxidative stress, its ability to stabilize NF(k)B, its ability to stimulate pro-oxidant apoptosic activity, and its discriminative ability to discourage the proliferation of malignant cells. In addition, the ability of lowdose naltrexone to modulate an endogenous immune response is discussed. This is the second article published on the ALA/N protocol and the authors believe the protocol warrants clinical trial.

  20. α-Lipoic Acid Treatment Improves Vision-Related Quality of Life in Patients with Dry Age-Related Macular Degeneration.

    PubMed

    Tao, Yuan; Jiang, Pengfei; Wei, Yuhua; Wang, Ping; Sun, Xiaoling; Wang, Hong

    2016-11-01

    Dry form of age-related macular degeneration (AMD) constitutes 90% of AMD cases, and it is characterized by the formation of drusen under the retina and the slow breakdown of the light-sensing cells in the macula, which causes a gradual loss of central vision. Since oxidative stress is involved in the pathogenesis of dry AMD, α-lipoic acid (LA) with antioxidant properties was selected, and its effect on anti-oxidative markers and visual quality in patients with dry AMD was assessed. A total of 100 dry AMD patients (60-83 years old) were randomly assigned to LA treatment group (n = 50) and placebo control group (n = 50). We measured the serum superoxide dismutase (SOD) activity, an important marker of antioxidant defense, best-corrected visual acuity (BCVA), contrast sensitivity, and Chinese-Version Low Vision Quality of Life (CLVQOL) before and after LA or placebo intervention. Pearson correlation coefficients were calculated to explore the relationship between contrast sensitivity values and CLVQOL scores. There was a statistically significant increase in serum SOD activity after LA intervention. The CLVQOL score was improved significantly after LA treatment. The contrast sensitivity measured at middle and low spatial frequency was significantly higher after LA treatment. CLVQOL scores were positively correlated with contrast sensitivity at low spatial frequency (3 cyc/degree) in LA-treated group. These results indicate that LA treatment improves vision-related quality of life in patients with dry AMD probably by increasing antioxidant activity. Thus, LA can be regarded as a promising agent for the treatment of AMD.

  1. Mitochondrial fatty acid biosynthesis and muscle fiber plasticity in very long-chain acyl-CoA dehydrogenase-deficient mice.

    PubMed

    Tucci, Sara; Mingirulli, Nadja; Wehbe, Zeinab; Dumit, Verónica I; Kirschner, Janbernd; Spiekerkoetter, Ute

    2018-01-01

    The white skeletal muscle of very long-chain acyl-CoA-dehydrogenase-deficient (VLCAD -/- ) mice undergoes metabolic modification to compensate for defective β-oxidation in a progressive and time-dependent manner by upregulating glucose oxidation. This metabolic regulation seems to be accompanied by morphologic adaptation of muscle fibers toward the glycolytic fiber type II with the concomitant upregulation of mitochondrial fatty acid biosynthesis (mFASII) and lipoic acid biosynthesis. Dietary supplementation of VLCAD -/- mice with different medium-chain triglycerides over 1 year revealed that odd-chain species has no effect on muscle fiber switch, whereas even-chain species inhibit progressive metabolic adaptation. Our study shows that muscle may undergo adaptive mechanisms that are modulated by dietary supplementation. We describe for the first time a concomitant change of mFASII in this muscular adaptation process. © 2017 Federation of European Biochemical Societies.

  2. Correlation of α-Lipoic Acid and S. Glutathione Level with Free Radical Excess in Tobacco Consumers.

    PubMed

    Sharma, Suman; Kaur, Manjinder; Suhalka, M L; Shrivastav, Chanchal

    2016-04-01

    Tobacco consumption is a serious health hazard and most important avoidable cause of death worldwide. Tobacco is recognized as lethal toxin, ripping off 7-11 minutes of human life with each cigarette through harmful compounds and inducing free radical synthesis and a high rate of lipid peroxidation. These free radicals are scavenged by the endogenous antioxidants viz. S. Glutathione (S.GSH) and S. α-Lipoic acid (S. α-LA), thus preventing the endothelial damage. The present study was designed with an aim to find out the lipid peroxidative stress through S. Malondialdehyde (S.MDA) and its correlation with antioxidant levels like S. Glutathione (S. GSH) and S. α- Lipoic acid (S. α- LA) among tobacco users (in both smokers and chewers). A case control cross-sectional study was carried out in the Department of Physiology among 200 subjects; aged 18-50 years of both sexes which were chosen randomly from institutional campus and healthy volunteers. The subjects were broadly divided into two groups (A & B); group A comprised of tobacco users (n=150) with history of smoking cigarette/biddies and chewing tobacco daily, for at least one year and group B had controls (non tobacco users) (n=50). S. MDA, S.GSH and S. α-LA levels were estimated by standardized methods. The data was analysed by unpaired student t-test and Pearson's correlation coefficient (r) for finding the correlation between antioxidants and S.MDA in group-A and group-B. The present study reports the significantly higher (p<0.0001) levels of S.MDA and lower (p<0.0001) levels of S.GSH and S. α-LA in tobacco users as compared to nontobacco users. The observed value of S.MDA was (2.72±0.87, 1.39±0.47) nmol/ml, S. α-LA was (9.94±5.96, 14.24 ± 4.34) μg/ml and S.GSH was (23.24±7.04, 32.82±2.95) mg/dl respectively in group-A and group-B. A significant (p<0.01) strong negative correlation was observed between S. MDA and antioxidants (S.GSH and S. α-LA) with a Pearson co-efficient of r=-0.619, r= -0.625 respectively, in group A. The decreased level of S. α-LA and S. GSH, in our study clearly indicates potential risk of cellular damage in tobacco users due to lipid peroxidation. Hence, the present study recommends supplementation of S. α-LA and Vitamin C in tobacco users to prevent this damage whereas quitting this evil habit will be the best available option.

  3. Stabilization of anthocyanins in blackberry juice by glutathione fortification.

    PubMed

    Stebbins, Nathan B; Howard, Luke R; Prior, Ronald L; Brownmiller, Cindi; Mauromoustakos, Andy

    2017-10-18

    Blackberry anthocyanins provide attractive color and antioxidant activity. However, anthocyanins degrade during juice processing and storage, so maintaining high anthocyanin concentrations in berry juices may lead to greater antioxidant and health benefits for the consumer. This study evaluated potential additives to stabilize anthocyanins during blackberry juice storage. The anthocyanin stabilizing agents used were: glutathione, galacturonic acid, diethylenetriaminepentaacetic acid and tannic acid, which were added at a level of 500 mg L -1 . Juice anthocyanin, flavonol, and ellagitannin content and percent polymeric color were measured over five weeks of accelerated storage at 30 °C. Glutathione had the greatest protective effect on total anthocyanins and polymeric color. Therefore a second study was performed with glutathione in combination with lipoic and ascorbic acids in an effort to use antioxidant recycling to achieve a synergistic effect. However, the antioxidant recycling system had no protective effect relative to glutathione alone. Glutathione appears to be a promising blackberry juice additive to protect against anthocyanin degradation during storage.

  4. Untargeted metabolomic on urine samples after α-lipoic acid and/or eicosapentaenoic acid supplementation in healthy overweight/obese women.

    PubMed

    Romo-Hualde, Ana; Huerta, Ana E; González-Navarro, Carlos J; Ramos-López, Omar; Moreno-Aliaga, María J; Martínez, J Alfredo

    2018-05-09

    Eicosapentaenoic acid (EPA) and α-lipoic acid (α-LA) have been investigated for their beneficial effects on obesity and cardiovascular risk factors. In the current research, the goal was to evaluate metabolomic changes following the dietary supplementation of these two lipids, alone or combined in healthy overweight/obese sedentary women following an energy-restricted diet. For this purpose, an untargeted metabolomics approach was conducted on urine samples using liquid chromatography coupled with time of flight mass spectrometry (HPLC-TOF-MS). This is a short-term double blind placebo-controlled study with a parallel nutritional design that lasted 10 weeks. Participants were assigned to one of the 4 experimental groups [Control, EPA (1.3 g/d), α-LA (0.3 g/d) and EPA+α-LA (1.3 g/d + 0.3 g/d)]. All intervention groups followed an energy-restricted diet of 30% less than total energy expenditure. Clinically relevant biochemical measurements were analyzed. Urine samples (24 h) were collected at baseline and after 10 weeks. Untargeted metabolomic analysis on urine samples was carried out, and principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA) were performed for the pattern recognition and characteristic metabolites identification. Urine samples were scattered in the PCA scores plots in response to the supplementation with α-LA. Totally, 28 putative discriminant metabolites in positive ionization, and 6 in negative ionization were identified among groups clearly differentiated according to the α-LA administration. Remarkably is the presence of an ascorbate intermediate metabolite (one of the isomers of trihydroxy-dioxohexanoate, or dihydroxy-oxohexanedionate) in the groups supplemented with α-LA. This fact might be associated with antioxidant properties of both α-LA and ascorbic acid. Correlations between phenotypical parameters and putative metabolites of provided additional information on whether there is a direct or inverse relationship between them. Especially interesting are the negative correlation between ascorbate intermediate metabolite and asymmetric dimethylarginine (ADMA) and the positive one between superoxide dismutase (SOD) and α-LA supplementation. This metabolomic approach supports that the beneficial effects of α-LA administration on body weight reduction may be partly explained by the antioxidant properties of this organosulfur carboxylic acid mediated by isomers of trihydroxy-dioxohexanoate, or dihydroxy-oxohexanedionate. Clinicaltrials.gov NCT01138774 .

  5. Robust, active tumor-targeting and fast bioresponsive anticancer nanotherapeutics based on natural endogenous materials.

    PubMed

    Sun, Bingfeng; Deng, Chao; Meng, Fenghua; Zhang, Jian; Zhong, Zhiyuan

    2016-11-01

    The clinical success of cancer nanomedicines critically depends on availability of simple, safe and highly efficient nanocarriers. Here, we report that robust and multifunctional nanoparticles self-assembled from hyaluronic acid-g-poly(γ-benzyl-l-glutamate)-lipoic acid conjugates achieve a remarkably high loading (up to 25.8wt.%) and active targeted delivery of doxorubicin (DOX) to human breast tumor xenograft in vivo. DOX-loaded nanoparticles following auto-crosslinking (DOX-CLNPs) are highly stable with little drug leakage under physiological conditions while quickly release ca. 92% DOX in 30h under a cytoplasmic-mimicking reductive environment. The in vitro assays reveal that DOX-CLNPs possess a superior selectivity and antitumor activity to clinically used pegylated liposomal doxorubicin hydrochloride (DOX-LPs) in CD44 receptor overexpressing MCF-7 human breast cancer cells. Strikingly, DOX-CLNPs exhibit a superb tolerated dose of over 100mg DOX equiv./kg, which is more than 5 times higher than DOX-LPs, and an extraordinary breast tumor accumulation of 8.6%ID/g in mice. The in vivo therapeutic studies in MCF-7 human breast tumor-bearing nude mice show that DOX-CLNPs effectively inhibit tumor growth, improve survival rate, and significantly decrease adverse effects as compared to DOX-LPs. DOX-CLNPs based on natural endogenous materials with high drug loading, great stability and CD44-targetability are highly promising for precision cancer chemotherapy. We demonstrate that with rational design, simple and multifunctional anticancer nanotherapeutics can be developed to achieve highly efficient and targeted cancer chemotherapy. Doxorubicin-loaded multifunctional nanoparticles based on hyaluronic acid-g-poly(γ-benzyl-l-glutamate)-lipoic acid conjugates exhibit a high drug loading, superior stability, fast bioresponsivity, high tolerability, and obvious selectivity toward CD44-overexpressing tumors in vivo. These nanotherapeutics achieve effective tumor suppression, drastically improved survival rate and reduced side effects as compared to clinically used pegylated liposomal doxorubicin in MCF-7 human breast tumor-bearing nude mice. Unlike previously reported multifunctional nanomedicines, the present nanotherapeutics primarily based on natural endogenous materials are simple and straightforward to fabricate, which makes them potentially interesting for clinical translation. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  6. Effect of alpha-lipoic acid on relieving ammonia stress and hepatic proteomic analyses of broilers.

    PubMed

    Lu, M; Bai, J; Xu, B; Sun, Q Y; Wei, F X; Tang, X F; Zhang, H F; Li, J; Wang, G L; Yin, Q Q; Li, S Y

    2017-01-01

    Ammonia in poultry houses not only affects worker health but also induces a variety of poultry diseases. Alpha-lipoic acid (LA) is an effective antioxidant that protects cells against oxidative injury during various toxic and pathological processes. This study was designed to evaluate the mitigating effects of LA supplementation on ammonia stress and hepatic proteome changes in broilers. Male broilers (22 d old) were allocated to 3 groups: (1) a control group without ammonia stress (CTRL); (2) exposure to 70 ppm ammonia (AM); and (3) exposure to 70 ppm ammonia and dietary administration of 300 mg/kg LA (AM+LA). Ammonia exposure significantly decreased broiler growth performance and plasma glutathione peroxidase activity (P < 0.05), and increased plasma malondialdehyde content and glutamic-pyruvic transaminase activity (P < 0.05). These negative effects were eliminated by LA supplementation. Comparative proteomic analyses revealed 291 differentially expressed proteins in the AM group compared to the CTRL and AM+LA groups. A total of 30 proteins were differentially expressed between the AM/CTRL and (AM+LA)/AM groups. The addition of LA restored 24 of these proteins to control levels; these proteins were mainly related to transcription regulation, detoxification, protein translation and degradation, and immune and stress responses. The differentially expressed proteins included the high mobility group box (HMGB) and glutathione S-transferase (GST), which is closely related to immune response and oxidative stress, and collagens, which are implicated in liver injury. The addition of LA to broiler diet may reduce ammonia toxicity by maintaining the antioxidant system, xenobiotic metabolism, and metabolic pathways. © 2016 Poultry Science Association Inc.

  7. Bio-active nanoemulsions enriched with gold nanoparticle, marigold extracts and lipoic acid: In vitro investigations.

    PubMed

    Guler, Emine; Barlas, F Baris; Yavuz, Murat; Demir, Bilal; Gumus, Z Pinar; Baspinar, Yucel; Coskunol, Hakan; Timur, Suna

    2014-09-01

    A novel and efficient approach for the preparation of enriched herbal formulations was described and their potential applications including wound healing and antioxidant activity (cell based and cell free) were investigated via in vitro cell culture studies. Nigella sativa oil was enriched with Calendula officinalis extract and lipoic acid capped gold nanoparticles (AuNP-LA) using nanoemulsion systems. The combination of these bio-active compounds was used to design oil in water (O/W) and water in oil (W/O) emulsions. The resulted emulsions were characterized by particle size measurements. The phenolic content of each nanoemulsion was examined by using both colorimetric assay and chromatographic analyses. Two different methods containing cell free chemical assay (1-diphenyl-2-picrylhydrazyl method) and cell based antioxidant activity test were used to evaluate the antioxidant capacities. In order to investigate the bio-activities of the herbal formulations, in vitro cell culture experiments, including cytotoxicity, scratch assay, antioxidant activity and cell proliferation were carried out using Vero cell line as a model cell line. Furthermore, to monitor localization of the nanoemulsions after application of the cell culture, the cell images were monitored via fluorescence microscope after FITC labeling. All data confirmed that the enriched N. sativa formulations exhibited better antioxidant and wound healing activity than N. sativa emulsion without any enrichment. In conclusion, the incorporation of AuNP-LA and C. officinalis extract into the N. sativa emulsions significantly increased the bio-activities. The present work may support further studies about using the other bio-active agents for the enrichment of herbal preparations to strengthen their activities. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. A preliminary investigation of alpha-lipoic acid treatment of antipsychotic drug-induced weight gain in patients with schizophrenia.

    PubMed

    Kim, Eosu; Park, Dong-Wha; Choi, Song-Hee; Kim, Jae-Jin; Cho, Hyun-Sang

    2008-04-01

    Weight gain and other metabolic disturbances have now become discouraging, major side effects of atypical antipsychotic drugs (AAPDs). The novel strategies required to counteract these serious consequences, however, should avoid modulating the activities of the neurotransmitter receptors involved because those receptors are the therapeutic targets of AAPDs. Adenosine monophosphate-activated protein kinase is an enzyme that plays a pivotal role in energy homeostasis. We hypothesized that alpha-lipoic acid (ALA), which is known to modulate adenosine monophosphate-activated protein kinase activity in the hypothalamus and peripheral tissues, would ameliorate AAPD-induced weight gain. We describe the case series of a 12-week ALA trial in schizophrenia patients treated with AAPDs. Two of 7 enrolled subjects were dropped from the study because of noncompliance and demand for new medication to treat depressive symptoms, respectively. The mean (SD) weight loss was 3.16 (3.20) kg (P = 0.043, last observation carried forward; median, 3.03 kg; range, 0-8.85 kg). On average, body mass index showed a significant reduction (P = 0.028) over the 12 weeks. During the same period, a statistically significant reduction was also observed in total cholesterol levels (P = 0.042), and there was a weak trend toward the reduction in insulin resistance (homeostasis model assessment of insulin resistance) (P = 0.080). Three subjects reported increased energy subjectively. The total scores on the Brief Psychiatric Rating Scale and the Montgomery-Asberg Depression Rating Scale did not vary significantly during the study. These preliminary data suggest the possibility that ALA can ameliorate the adverse metabolic effects induced by AAPDs. To confirm the benefits of ALA, more extended study is warranted.

  9. Alpha-lipoic acid supplement in obesity treatment: A systematic review and meta-analysis of clinical trials.

    PubMed

    Namazi, Nazli; Larijani, Bagher; Azadbakht, Leila

    2018-04-01

    Previous studies have supported positive roles of antioxidant supplements on weight-loss. One antioxidant supplement is Alpha-lipoic acid. However, recommending ALA as an anti-obesity supplement remains controversial. Accordingly, the purpose of the present study was to perform a meta-analysis on the effects of ALA supplement on anthropometric indices among adult subjects. We searched five electronic databases till September 2016. Placebo-controlled clinical trials were included. Weighted Mean Difference (WMD) was pooled using a random-effects model. Findings of 12 included trials indicated that ALA supplement reduced body weight (WMD: -0.69 kg; 95% CI: -1.27, -0.10; I 2  = 0%) and BMI (WMD: -0.38 kg/m 2 ; 95% CI: -0.53, -0.24; I 2  = 0%) significantly compared to the placebo group. However, its effects on Waist Circumference (WC) was not significant (WMD: -0.30 cm; 95% CI: -1.18, 0.58; I 2  = 17.8%). Stratification by health status indicated that ALA decreased WC in unhealthy subjects (WMD: -2.00 cm; 95% CI: -4.19, 0.19; I 2  = 1.3%) more than healthy individuals (0.03 cm; 95% CI: -0.69, 0.75; I 2  = 0%). The present study revealed that supplementation with ALA slightly but significantly decreased body weight and BMI. Safe dosage for ALA is up to 1200 mg/day. However, it seems that ALA cannot be cost-effective. Further studies are needed to clarify the effects of ALA on metabolic parameter in unhealthy obese individuals. Copyright © 2017 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  10. Effects of Lipoic Acid Supplementation on Activities of Cyclooxygenases and Levels of Prostaglandins E2 and F2 α Metabolites, in the Offspring of Rats with Streptozotocin-Induced Diabetes

    PubMed Central

    Oriquat, Ghaleb A.; Abu-Samak, Mahmoud; Al Hanbali, Othman A.; Salim, Maher D.

    2016-01-01

    Background. Our aim was to evaluate the protective effect of lipoic acid (LA) on fetal outcome of diabetic mothers. Methods. Diabetes was induced in female rats using streptozotocin and rats were made pregnant. Pregnant control (group 1; n = 9; and group 2; n = 7) or pregnant diabetic (group 3; n = 10; and group 4; n = 8) rats were treated daily with either LA (groups 2 and 4) or vehicle (groups 1 and 3) between gestational days 0 and 15. On day 15 of gestation, the fetuses, placentas, and membranes were dissected, examined morphologically, and then homogenized, to measure cyclooxygenase (COX) activities and metabolisms of prostaglandin (PG) E2 (PGEM) and PGF2 α (PGFM) levels. The level of total glutathione was measured in the maternal liver and plasma and in all fetuses. Results. Supplementation of diabetic rats with LA was found to significantly (p < 0.05) reduce resorption rates in diabetic rats and led to a significant (p < 0.05) increase in liver, plasma, and fetuses total glutathione from LA-TD rats as compared to those from V-TD. Decreased levels of PGEM and elevated levels of PGFM in the fetuses, placentas, and membranes were characteristic of experimental diabetic gestation associated with malformation. The levels of PGEM in malformed fetuses from LA-TD mothers was significantly (p < 0.05) higher than those in malformed fetuses from V-TD rats. Conclusions. LA treatment did not completely prevent the occurrence of malformations. Thus, other factors may be involved in the pathogenesis of the diabetes-induced congenital malformations. PMID:28042582

  11. Brain antioxidant effect of mirtazapine and reversal of sedation by its combination with alpha-lipoic acid in a model of depression induced by corticosterone.

    PubMed

    Oliveira, Tatiana de Queiroz; de Sousa, Caren Nádia Soares; Vasconcelos, Germana Silva; de Sousa, Luciene Costa; de Oliveira, Anneheydi Araújo; Patrocínio, Cláudio Felipe Vasconcelos; Medeiros, Ingridy da Silva; Honório Júnior, José Eduardo Ribeiro; Maes, Michael; Macedo, Danielle; Vasconcelos, Silvânia Maria Mendes

    2017-09-01

    Depression is accompanied by activated neuro-oxidative and neuro-nitrosative pathways, while targeting these pathways has clinical efficacy in depression. This study aimed to investigate the effects of mirtazapine (MIRT) alone and combined with alpha-lipoic acid (ALA) against corticosterone (CORT) induced behavioral and oxidative alterations. Male mice received vehicle or CORT 20mg/kg during 14 days. From the 15th to 21st days they were divided in groups administered: vehicle, MIRT 3mg/kg or the combinations MIRT+ALA100 or MIRT+ALA200. On the 21st day of treatment, the animals were subjected to behavioral tests. Twenty-four hours after the last drug administration hippocampus (HC) and striatum (ST) were dissected for the determination reduced glutathione (GSH), lipid peroxidation (LP) and nitrite levels. CORT induced anxiety- and depressive-like behaviors as observed by increased immobility time in the tail suspension test and decreased sucrose consumption. MIRT or MIRT+ALA are effective in reversing anxiety- and depressive-like behaviors induced by CORT. CORT and MIRT alone prolonged sleeping time and this effect was reversed by MIRT+ALA. CORT significantly increased LP, which was reversed by MIRT or MIRT+ALA. Nitrite levels were increased in CORT-treated animals and reversed by MIRT+ALA200 (HC), MIRT or MIRT+ALA (ST). A relative small sample size and lack of a washout period between drug administration and behavioral testing. MIRT or MIRT+ALA reverse CORT-induced anxiety- and depressive-like behaviors probably via their central antioxidant effects. Augmentation of MIRT with ALA may reverse sedation, an important side effect of MIRT. Randomized controlled studies are needed to examine the clinical efficacy of this combination in human depression. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Electroencephalographic study of chlorpromazine alone or combined with alpha-lipoic acid in a model of schizophrenia induced by ketamine in rats.

    PubMed

    Sampaio, Luis Rafael Leite; Borges, Lucas Teixeira Nunes; Barbosa, Talita Matias; Matos, Natalia Castelo Branco; Lima, Ricardo de Freitas; Oliveira, Mariana Nascimento de; Gularte, Viviane Nóbrega; Patrocínio, Manoel Cláudio Azevedo; Macêdo, Danielle; Vale, Otoni Cardoso do; Vasconcelos, Silvânia Maria Mendes de

    2017-03-01

    Schizophrenia is characterized by behavioral symptoms, brain function impairments and electroencephalographic (EEG) changes. Dysregulation of immune responses and oxidative imbalance underpins this mental disorder. The present study aimed to investigate the effects of the typical antipsychotic chlorpromazine (CP) alone or combined with the natural antioxidant alpha-lipoic acid (ALA) on changes in the hippocampal average spectral power induced by ketamine (KET). Three days after stereotactic implantation of electrodes, male Wistar rats were divided into groups treated for 10 days with saline (control) or KET (10 mg/kg, IP). CP (1 or 5 mg/kg, IP) alone or combined with ALA (100 mg/kg, P.O.) was administered 30 min before KET or saline. Hippocampal EEG recordings were taken on the 1st, 5th and 10th days of treatment immediately after the last drug administration. KET significantly increased average spectral power of delta and gamma-high bands on the 5th and 10th days of treatment when compared to control. Gamma low-band significantly increased on the 1st, 5th and 10th days when compared to control group. This effect of KET was prevented by CP alone or combined with ALA. Indeed, the combination of ALA 100 + CP1 potentiated the inhibitory effects of CP1 on gamma low-band oscillations. In conclusion, our results showed that KET presents excitatory and time-dependent effects on hippocampal EEG bands activity. KET excitatory effects on EEG were prevented by CP alone and in some situations potentiated by its combination with ALA. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Ammonia-induced oxidative damage in neurons is prevented by resveratrol and lipoic acid with participation of heme oxygenase 1.

    PubMed

    Bobermin, Larissa Daniele; Wartchow, Krista Minéia; Flores, Marianne Pires; Leite, Marina Concli; Quincozes-Santos, André; Gonçalves, Carlos-Alberto

    2015-07-01

    Ammonia is a metabolite that, at high concentrations, is implicated in neurological disorders, such as hepatic encephalopathy (HE), which is associated with acute or chronic liver failure. Astrocytes are considered the primary target of ammonia toxicity in the central nervous system (CNS) because glutamine synthetase (GS), responsible for ammonia metabolism in CNS, is an astrocytic enzyme. Thus, neuronal dysfunction has been associated as secondary to astrocytic impairment. However, we demonstrated that ammonia can induce direct effects on neuronal cells. The cell viability was decreased by ammonia in SH-SY5Y cells and cerebellar granule neurons. In addition, ammonia induced increased reactive oxygen species (ROS) production and decreased GSH intracellular content, the main antioxidant in CNS. As ammonia neurotoxicity is strongly associated with oxidative stress, we also investigated the potential neuroprotective roles of the antioxidants, resveratrol (RSV) and lipoic acid (LA), against ammonia toxicity in cerebellar granule neurons. RSV and LA were able to prevent the oxidative damage induced by ammonia, maintaining the levels of ROS production and GSH close to basal values. Both antioxidants also decreased ROS production and increased GSH content under basal conditions (in the absence of ammonia). Moreover, we showed that heme oxygenase 1 (HO1), a protein associated with protection against stress conditions, is involved in the beneficial effects of RSV and LA in cerebellar granule neurons. Thus, this study reinforces the neuroprotective effects of RSV and LA. Although more studies in vivo are required, RSV and LA could represent interesting therapeutic strategies for the management of HE. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Alpha Lipoic Acid (ALA) effects on subchorionic hematoma: preliminary clinical results.

    PubMed

    Porcaro, G; Brillo, E; Giardina, I; Di Iorio, R

    2015-09-01

    The clinic use of alpha Lipoic Acid (ALA) is linked to its capability to exert antioxidant effects and, more interestingly, to counteract the pathologic changes of complex networks of cytokines, chemokines and growth factors, restoring their physiological state. The aim of this randomized controlled clinical trial was to test the contribution of oral supplementation of ALA to the standard treatment with Progesterone vaginal suppositories, in healing subchorionic hematomas in patients with threatened miscarriage. Controls were administered only Progesterone suppositories. Nineteen pregnant women in the first trimester of gestation, with threatened miscarriage and ultrasound evidence of subchorionic hematoma, were included in the trial and randomly divided in two groups: controls, treated with 400 mg Progesterone (200 mg 2 times per day), given by vaginal suppositories, and case study treated with the same Progesterone dosage, plus ALA, given orally at the dose of 600 mg (300 mg 2 times per day, DAV®, Lo.Li. Pharma srl, Italy). Sixteen patients completed the trial. Treatment was performed until complete resolution of the clinical picture. In both groups, the subjects improved significantly but, in general, a better and faster evolution in the major signs of threatened miscarriage was observed in the subjects treated with ALA and Progesterone. In these patients, the speed of resorption of subchorionic hematoma was significantly (p ≤ 0.05) superior compared to controls. The ALA and Progesterone group showed a faster decrease or disappearance of all symptoms than that observed in the control group, however the difference was not significant. These preliminary results suggest that ALA supplementation significantly contributes to speed up the process of restoration of physiological conditions in threatened miscarriage and ameliorates the medical conditions of both the mothers and the foetus, probably modulating the networks of cytokines, growth factors and other molecules.

  15. Cross talk between poly(ADP-ribose) polymerase 1 methylation and oxidative stress involved in the toxic effect of anatase titanium dioxide nanoparticles.

    PubMed

    Bai, Wenlin; Chen, Yujiao; Gao, Ai

    2015-01-01

    Given the tremendous growth in the application of titanium dioxide nanoparticles (TNPs), concerns about the potential health hazards of TNPs to humans have been raised. Poly(ADP-ribose) polymerase 1 (PARP-1), a highly conserved DNA-binding protein, is involved in many molecular and cellular processes. Limited data demonstrated that certain nanomaterials induced the aberrant hypermethylation of PARP-1. However, the mechanism involved in TNP-induced PARP-1 abnormal methylation has not been studied. A549 cells were incubated with anatase TNPs (22.1 nm) for 24 hours pretreatment with or without methyltransferase inhibitor 5-aza-2'-deoxycytidine and the reactive oxygen species (ROS) scavenger α-lipoic acid to assess the possible role of methylation and ROS in the toxic effect of TNPs. After TNPs characterization, a battery of assays was performed to evaluate the toxic effect of TNPs, PARP-1 methylation status, and oxidative damage. Results showed that TNPs decreased the cell viability in a dose-dependent manner, in accordance with the increase of lactate dehydrogenase activity, which indicated membrane damage of cells. Similar to the high level of PARP-1 methylation, the generation of ROS was significantly increased after exposure to TNPs for 24 hours. Furthermore, α-lipoic acid decreased TNP-induced ROS generation and then attenuated TNP-triggered PARP-1 hypermethylation. Meanwhile, 5-aza-2'-deoxycytidine simultaneously decreased the ROS generation induced by TNPs, resulting in the decline of PARP-1 methylation. In summary, TNPs triggered the aberrant hypermethylation of the PARP-1 promoter and there was a cross talk between oxidative stress and PARP-1 methylation in the toxic effect of TNPs.

  16. Effects of alpha-lipoic acid supplementation in different stages on growth performance, antioxidant capacity and meat quality in broiler chickens.

    PubMed

    Guo, Z Y; Li, J L; Zhang, L; Jiang, Y; Gao, F; Zhou, G H

    2014-01-01

    This experiment was conducted to investigate the effect of basal dietary supplementation with 500 mg/kg alpha-lipoic acid (LA) on growth performance, antioxidant capacity and meat quality in different stages in broiler chickens. A total of 240 Arbor Acre chickens were randomly assigned into 4 treatment groups, each treatment containing 6 replicates of 10 chickens each. Group 1 was the control group without LA supplementation; Group 2 was supplied with LA in the starter period; Group 3 was supplied with LA in the grower period; and Group 4 was supplied with LA in the whole period. The results showed that LA supplementation improved average feed intake and body weight gain in all three experimental groups, especially in Group 2. LA supplementation significantly decreased abdominal fat yield in Groups 3 and 4. LA supplementation all improved hepatic total antioxidant capacity, the level of glutathione, the activities of total superoxide dismutase, catalase (CAT) and glutathione peroxidase, in particular in Group 4. LA supplementation decreased the activity of liver xanthine oxidase (XO) in all experimental groups, and that of liver monoamine oxidase in Group 3. The activities of liver CAT and XO in Group 2 were higher than that in Group 3. LA supplementation elevated the pH24 h and decreased drip loss in breast meat in Groups 3 and 4. In conclusion, LA supplementation can improve growth performance, antioxidant properties and meat quality in broiler chicken. LA supplementation in the starter period can improve growth performance and supplementation in the grower - and in the whole period can improve carcass characteristics. There was no significant difference in meat quality of broiler chickens fed on LA-supplemented diet in different stages.

  17. Lens and cornea lesions of rats fed corn syrup and the protective effects of alpha lipoic acid.

    PubMed

    Gunes, Alime; Ozmen, Ozlem; Saygın, Mustafa; Ascı, Halil; Tok, Levent; Tok, Ozlem; Dıncoglu, Dılnur

    2016-03-01

    To examine the pathological findings that occurred in the lens and cornea and biochemical findings in the lens of rats fed with corn syrup and the protective effects of alpha lipoic acid (ALA). Twenty-four rats were randomly divided into three groups. Group I served as the control group. Group II was used as the study group; the rats were treated with 30% corn sugar solution for 10 weeks. Group III was the treatment group. Corn syrup was given by the oral route to the rats during the study, and ALA (100 mg/kg) was added to the treatment 4 weeks after the study began. At the end of the experiment, central corneal thickness (CCT) was measured in all rats with an ultrasonic pachymeter. Then the right eyes of the rats were enucleated for histopathological examination of the cornea and lens. The left lenses were homogenized for biochemical analyses. The lenses of the rats treated with corn syrup revealed severe damage; many lens fibers appeared swollen and ruptured with large vacuoles near the lens epithelium. In addition, malondialdehyde (MDA) levels, a parameter of oxidative stress, increased but not significantly in Group II; however. ALA treatment decreased MDA levels significantly. Antioxidant enzyme and catalase (CAT) activities were significantly decreased in Group II, and ALA treatment increased these activities; however, the increase was not significant. Changes were observed in the cornea such as epithelial alterations, subepithelial vacuolizations, collagen fibers loss in the stromal layer, interruptions in the subepithelial basement membrane and central corneal thickening. Corn syrup can cause severe damage in rat lenses and corneas. However, ALA ameliorates the effect of corn syrup-related lesions on the cornea and lens.

  18. Evaluation of Eudragit® Retard Polymers for the Microencapsulation of Alpha-Lipoic Acid.

    PubMed

    Pecora, Tiziana M G; Musumeci, Teresa; Musumeci, Lucrezia; Fresta, Massimo; Pignatello, Rosario

    2016-01-01

    Microencapsulation of natural antioxidants in polymeric systems represents a possible strategy for improving the oral bioavailability of compounds that are otherwise poorly soluble. α-lipoic acid (ALA) was microencapsulated with polymethacrylate polymers (blends at various ratios of Eudragit® RS100 and RL100 resins). Microspheres were produced by solvent displacement of an ethanol cosolution of ALA and polymers; the microsuspensions were then freeze-dried, using trehalose as a cryoprotector. Microspheres were characterized in the solid state for micromeritic properties and drug loading, as well as by infrared spectroscopy, powder X-ray diffractometry and differential scanning calorimetry. The antioxidant activity of free and encapsulated ALA was assessed by the 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay. In vitro release studies, performed in simulated gastric (pH 1.2) and intestinal fluid (pH 6.8), showed that, depending on polymer composition and drug-to-polymer ratio, ALA release can be slowed down, compared to the dissolution pattern of the free drug. Solid-state characterization confirmed the chemical stability of ALA in the microspheres, suggesting that ALA did not develop strong interactions with the polymer and was present in an amorphous or a disordered-crystalline state within the polymer network. As indicated by the DPPH assay, the microencapsulation of ALA in Eudragit® Retard matrices did not alter its antioxidant activity. ALA was effectively encapsulated in Eudragit® Retard matrices, showing a chemical stability up to 6 months at room conditions and at 40°C. Moreover, since the drug maintained its antioxidant activity in vitro, the potential application of these microparticulate systems for oral administration would deserve further studies.

  19. Alpha-lipoic acid affects the oxidative stress in various brain structures in mice with methionine and choline deficiency.

    PubMed

    Veskovic, Milena; Mladenovic, Dusan; Jorgacevic, Bojan; Stevanovic, Ivana; de Luka, Silvio; Radosavljevic, Tatjana

    2015-04-01

    Deficiency in methionine or choline can induce oxidative stress in various organs such as liver, kidney, heart, and brain. This study was to examine the effects of alpha-lipoic acid (LA) on oxidative stress induced by methionine and choline deficiency (MCD) in several brain structures. Male mice C57BL/6 (n = 28) were divided into four groups: (1) control - continuously fed with standard chow; (2) LA - fed with standard chow and receiving LA; (3) MCD2 - fed with MCD diet for two weeks, and (4) MCD2+LA - fed with MCD diet for two weeks and receiving LA (100 mg/kg/day intraperitonealy [i.p.]). Brain tissue (cortex, hypothalamus, striatum and hippocampus) was taken for determination of oxidative stress parameters. MCD diet induced a significant increase in malondialdehyde and NOx concentration in all brain regions, while LA restored their content to normal values. Similar to this, in MCD2 group, activity of total SOD, MnSOD, and Cu/ZnSOD was reduced by MCD diet, while LA treatment improved their activities in all brain structures. Besides, in MCD2 group a decrease in catalase activity in cortex and GSH content in hypothalamus was evident, while LA treatment induced an increase in catalase activity in cortex and striatum and GSH content in hypothalamus. LA treatment can significantly reduce lipid peroxidation and nitrosative stress, caused by MCD diet, in all brain regions by restoring antioxidant enzymes activities, predominantly total SOD, MnSOD, and Cu/ZnSOD, and to a lesser extent by modulating catalase activity and GSH content. LA supplementation may be used in order to prevent brain oxidative injury induced by methionine and choline deficiency. © 2014 by the Society for Experimental Biology and Medicine.

  20. Antioxidant and anti-inflammatory activities of alpha lipoic acid protect against indomethacin-induced gastric ulcer in rats.

    PubMed

    Gomaa, Asmaa M S; Abd El-Mottaleb, Nashwa A; Aamer, Hazem A

    2018-05-01

    Little is known about the role of tumor necrosis factor-alpha (TNF-α), plasminogen activator inhibitor-1 (PAI-1), and inducible nitric oxide synthase (iNOS) in the gastric ulcer and the effect of alpha lipoic acid (ALA) in their modulation. Hence, this experimental study was designed to assess the possible protective effect of ALA against indomethacin (IND)-induced gastric ulcer in rats, as well as to determine the possible underlying mechanisms with a special focus on TNF-α, PAI-1, and iNOS. Adult male rats (n = 28) were divided into four equal groups: the control group received distilled water, the vehicle group received 0.5% carboxymethylcellulose, the ulcer group received a single oral dose of IND (50 mg/kg) and the ALA-treated group received ALA (100 mg/kg) orally for 3 days before ulcer induction. Four hours after IND administration, all rats were sacrificed. The ulcer index, and gastric tissue homogenate contents of total antioxidant capacity (TAC), malondialdehyde (MDA), TNF-α, and PAI-1 were evaluated. Immunohistochemical evaluation of iNOS protein expression and histopathological examination of gastric tissue were investigated. The results revealed that ALA pretreatment significantly decreased the ulcer index, the gastric levels of MDA, TNF-α, PAI-1, and iNOS protein expression while increased the gastric levels of TAC as well as improved the histopathological appearance of gastric tissues. In conclusion, ALA ameliorated the IND-induced gastric ulceration. This could be attributed to its antioxidant and anti-inflammatory activities via suppression of TNF-α-induced elevation of both PAI-1 level and iNOS expression in the gastric tissue. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  1. Interaction of α-Lipoic Acid with the Human Na+/Multivitamin Transporter (hSMVT)*

    PubMed Central

    Zehnpfennig, Britta; Wiriyasermkul, Pattama; Carlson, David A.; Quick, Matthias

    2015-01-01

    The human Na+/multivitamin transporter (hSMVT) has been suggested to transport α-lipoic acid (LA), a potent antioxidant and anti-inflammatory agent used in therapeutic applications, e.g. in the treatment of diabetic neuropathy and Alzheimer disease. However, the molecular basis of the cellular delivery of LA and in particular the stereospecificity of the transport process are not well understood. Here, we expressed recombinant hSMVT in Pichia pastoris and used affinity chromatography to purify the detergent-solubilized protein followed by reconstitution of hSMVT in lipid bilayers. Using a combined approach encompassing radiolabeled LA transport and equilibrium binding studies in conjunction with the stabilized R-(+)- and S-(−)-enantiomers and the R,S-(+/−) racemic mixture of LA or lipoamide, we identified the biologically active form of LA, R-LA, to be the physiological substrate of hSMVT. Interaction of R-LA with hSMVT is strictly dependent on Na+. Under equilibrium conditions, hSMVT can simultaneously bind ∼2 molecules of R-LA in a biphasic binding isotherm with dissociation constants (Kd) of 0.9 and 7.4 μm. Transport of R-LA in the oocyte and reconstituted system is exclusively dependent on Na+ and exhibits an affinity of ∼3 μm. Measuring transport with known amounts of protein in proteoliposomes containing hSMVT in outside-out orientation yielded a catalytic turnover number (kcat) of about 1 s−1, a value that is well in agreement with other Na+-coupled transporters. Our data suggest that hSMVT-mediated transport is highly specific for R-LA at our tested concentration range, a finding with wide ramifications for the use of LA in therapeutic applications. PMID:25971966

  2. α-Lipoic acid inhibits human lung cancer cell proliferation through Grb2-mediated EGFR downregulation.

    PubMed

    Yang, Lan; Wen, Ya; Lv, Guoqing; Lin, Yuntao; Tang, Junlong; Lu, Jingxiao; Zhang, Manqiao; Liu, Wen; Sun, Xiaojuan

    2017-12-09

    Alpha lipoic acid (α -LA) is a naturally occurring antioxidant and metabolic enzyme co-factor. Recently, α -LA has been reported to inhibit the growth of various cancer cells, but the precise signaling pathways that mediate the effects of α -LA on non-small cell lung cancer (NSCLC) development remain unclear. The CCK-8 assay was used to assess cell proliferation in NSCLC cell lines after α -LA treatment. The expression of growth factor receptor-bound protein 2 (Grb2), cyclin-dependent kinase (CDK)-2, CDK4, CDK6, Cyclin D3, Cyclin E1, Ras, c-Raf, epidermal growth factor receptor (EGFR), ERK1/2 and activated EGFR and ERK1/2 was evaluated by western blotting. Grb2 levels were restored in α-LA-treated cells by transfection of a plasmid carrying Grb2 and were reduced in NSCLC cells via specific siRNA-mediated knockdown. α -LA dramatically decreased NSCLC cell proliferation by downregulating Grb2; in contrast, Grb2 overexpression significantly prevented α-LA-induced decrease in cell growth in vitro. Western blot analysis indicated that α-LA decreased the levels of phospho-EGFR, CDK2/4/6, Cyclins D3 and E1, which are associated with the inhibition of G1/S-phase transition. Additional experiments indicated that Grb2 inhibition partially abolished EGF-induced phospho-EGFR and phospho-ERK1/2 activity. In addition, α-LA exerted greater inhibitory effects than gefitinib on NSCLC cells by preventing EGF-induced EGFR activation. For the first time, these findings provide the first evidence that α-LA inhibits cell proliferation through Grb2 by suppressing EGFR phosphorylation and that MAPK/ERK is involved in this pathway. Copyright © 2017. Published by Elsevier Inc.

  3. Lipoic acid inhibits cell proliferation of tumor cells in vitro and in vivo

    PubMed Central

    Feuerecker, Benedikt; Pirsig, Sabine; Seidl, Christof; Aichler, Michaela; Feuchtinger, Annette; Bruchelt, Gernot; Senekowitsch-Schmidtke, Reingard

    2012-01-01

    Cancer cells convert glucose preferentially to lactate even in the presence of oxygen (aerobic glycolysis–Warburg effect). New concepts in cancer treatment aim at inhibition of aerobic glycolysis. Pyruvate dehydrogenase converts pyruvate to acetylCoA thus preventing lactate formation. Therefore, the aim of this study was to evaluate compounds that could activate pyruvate dehydrogenase in cancer cells. We investigated the effects of (R)-(+)-α-lipoic acid (LPA) and dichloroacetate (DCA), possible activators of pyruvate dehydrogenase, on suppression of aerobic glycolysis and induction of cell death. The neuroblastoma cell lines Kelly, SK-N-SH, Neuro-2a and the breast cancer cell line SkBr3 were incubated with different concentrations (0.1–30 mM) of LPA and DCA. The effects of both compounds on cell viability/proliferation (WST-1 assay), [18F]-FDG uptake, lactate production and induction of apoptosis (flow cytometric detection of caspase-3) were evaluated. Furthermore, NMRI nu/nu mice that had been inoculated s.c. with SkBr3 cells were treated daily for four weeks with LPA (i.p, 18.5 mg/kg) starting at day 7 p.i.. Tumor development was measured with a sliding calliper and monitored via [18F]-FDG-PET. Residual tumors after therapy were examined histopathologically. These data suggests that LPA can reduce (1) cell viability/proliferation, (2) uptake of [18F]-FDG and (3) lactate production and increase apoptosis in all investigated cell lines. In contrast, DCA was almost ineffective. In the mouse xenograft model with s.c. SkBr3 cells, daily treatment with LPA retarded tumor progression. Therefore, LPA seems to be a promising compound for cancer treatment. PMID:22954700

  4. Effects of alpha-lipoic acid on associative and spatial memory of sham-irradiated and 56Fe-irradiated C57BL/6J male mice.

    PubMed

    Villasana, Laura E; Rosenthal, Rosalind A; Doctrow, Susan R; Pfankuch, Timothy; Zuloaga, Damian G; Garfinkel, Alexandra Maccoll; Raber, Jacob

    2013-01-01

    Cranial irradiation with (56)Fe, a form of space radiation, causes hippocampus-dependent cognitive changes. (56)Fe irradiation also increases reactive oxygen species (ROS) levels, which may contribute to these changes. Therefore, we investigated the effects of the antioxidant alpha lipoic acid (ALA) on cognition following sham-irradiation and irradiation. Male mice were irradiated (brain only) with (56)Fe (3 Gy) or sham-irradiated at 6-9 months of age. Half of the mice remained fed a regular chow and the other half of the mice were fed a caloric-matched diet containing ALA starting two-weeks prior to irradiation and throughout cognitive testing. Following cognitive testing, levels of 3-nitrotyrosine (3NT), a marker of oxidative protein stress, and levels of microtubule-associated protein (MAP-2), a dendritic protein important for cognition, were assessed using immunohistochemistry and confocal microscopy. ALA prevented radiation-induced impairments in spatial memory retention in the hippocampal and cortical dependent water maze probe trials following reversal learning. However, in sham-irradiated mice, ALA treatment impaired cortical-dependent novel object recognition and amygdala-dependent cued fear conditioning. There was a trend towards lower 3NT levels in irradiated mice receiving a diet containing ALA than irradiated mice receiving a regular diet. In the hippocampal dentate gyrus of mice on regular diet, irradiated mice had higher levels of MAP-2 immunoreactivity than sham-irradiated mice. Thus, ALA might have differential effects on the brain under normal physiological conditions and those involving environmental challenges such as cranial irradiation. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Lipoic acid mitigates oxidative stress and recovers metabolic distortions in salt-stressed wheat seedlings by modulating ion homeostasis, the osmo-regulator level and antioxidant system.

    PubMed

    Gorcek, Zeynep; Erdal, Serkan

    2015-11-01

    Soil salinity is one of the most detrimental environmental factors affecting the growth of plants and limiting their agricultural productivity. This study investigated whether exogenous lipoic acid (LA) pretreatment plays a role in promoting salt tolerance in wheat seedlings. The seedlings were treated with LA (1.75 mmol L(-1)) and salt (100 mmol L(-1) NaCl) separately and a combination of them. Salt stress significantly reduced relative water content, leaf surface area, ribulose bisphosphate carboxylase expression, and chlorophyll content but increased the content of osmo-regulator protein, carbohydrates and proline. In addition, salinity led to an imbalance in the inorganic composition of wheat leaves. While it elevated Na(+) content compared to control, Ca content and K(+)/Na(+) ratio were reduced. Under saline conditions, despite increases in antioxidant enzyme activity and levels of antioxidant compounds (ascorbate and glutathione), the content of reactive oxygen species (superoxide anion, hydrogen peroxide) and malondialdehyde were higher than in control seedlings. LA significantly promoted osmo-regulator level and antioxidant enzyme activities compared to stressed seedlings alone. Also, it both increased levels of ascorbate and glutathione and regenerated their oxidised forms, thus contributing to maintaining cellular redox status. Similarly, LA prevented excessive accumulation of Na(+) and promoted K(+)/Na(+) ratio and Ca content. Reactive oxygen species content was significantly reduced, and the inhibitions in the above parameters markedly recovered. LA reduced salinity-induced oxidative damage and thus contributed to the growth and development of plants in saline soils by modulating ion homeostasis between plant and soil as well as in osmo-regulator content and antioxidant system. © 2014 Society of Chemical Industry.

  6. Effect of alpha-lipoic acid on asymmetric dimethylarginine and disability in multiple sclerosis patients: A randomized clinical trial.

    PubMed

    Khalili, Mohammad; Soltani, Madjid; Moghadam, Shirin Amiri; Dehghan, Parvin; Azimi, Amirreza; Abbaszadeh, Omid

    2017-07-01

    Multiple Sclerosis (MS) is an inflammatory and demyelinating disease of the central nervous system. Oxidative stress plays a major role in the onset and progression of MS. Asymmetric dimethylarginine (ADMA) formation is dependent on oxidative stress status. We examined whether alpha-lipoic acid (ALA) as a potent antioxidant could improve the Expanded Disability Status Scale (EDSS) and decrease plasma level of ADMA in multiple sclerosis patients. In a randomized, double-blinded clinical trial conducted at Sina Hospital in Tehran, Iran, from September 2009 to July 2011, 24 patients with relapsing-remitting MS were divided into a treatment group receiving ALA (1200mg/day) for 12 weeks and a control group receiving placebo. Then patients' EDSS and Plasma levels of ADMA were measured at baseline and 12 weeks later. Statistical analysis was done by SPSS software version 16 using the K-S test, Chi square, Mann-Whitney U-test and Wilcoxon test. The plasma levels of ADMA in the intervention group were decreased significantly (p=0.04). Also, no patient had increased EDSS score in the supplement group, where 2 out of 12 patients in the placebo group experienced so. Comparing the serum level of ADMA between the two groups failed to show any significant change in the supplement group compared with the control group. Considering that ADMA is produced by oxidative stress in MS patients and leads to increase of inflammation, ALA may have the potential of beneficial effects in them, in part, by decreasing the plasma level of ADMA and stopping progression. The trial was registered at the Iranian Registry of Clinical Trials (http://www.irct.ir) with the Irct ID: No. IRCT138812222602N2. The authors received no financial support for the research, authorship, and/or publication of this article.

  7. Anti-inflammatory effects of the selective phosphodiesterase 3 inhibitor, cilostazol, and antioxidants, enzymatically-modified isoquercitrin and α-lipoic acid, reduce dextran sulphate sodium-induced colorectal mucosal injury in mice.

    PubMed

    Kangawa, Yumi; Yoshida, Toshinori; Abe, Hajime; Seto, Yoshiki; Miyashita, Taishi; Nakamura, Michi; Kihara, Tohru; Hayashi, Shim-Mo; Shibutani, Makoto

    2017-04-04

    Developing effective treatments and preventing inflammatory bowel disease (IBD) are urgent challenges in improving patients' health. It has been suggested that platelet activation and reactive oxidative species generation are involved in the pathogenesis of IBD. We examined the inhibitory effects of a selective phosphodiesterase-3 inhibitor, cilostazol (CZ), and two antioxidants, enzymatically modified isoquercitrin (EMIQ) and α-lipoic acid (ALA), against dextran sulphate sodium (DSS)-induced colitis. BALB/c mice were treated with 0.3% CZ, 1.5% EMIQ, and 0.2% ALA in their feed. Colitis was induced by administering 5% DSS in drinking water for 8days. The inhibitory effects of these substances were evaluated by measuring relevant clinical symptoms (faecal blood, diarrhoea, and body weight loss), colon length, plasma cytokine and chemokine levels, whole genome gene expression, and histopathology. Diarrhoea was suppressed by each treatment, while CZ prevented shortening of the colon length. All treatment groups exhibited decreased plasma levels of interleukin (IL)-6 and tumour necrosis factor (TNF)-α compared with the DSS group. Microarray analysis showed that cell adhesion, cytoskeleton regulation, cell proliferation, and apoptosis, which might be related to inflammatory cell infiltration and mucosal healing, were affected in all the groups. DSS-induced mucosal injuries such as mucosal loss, submucosal oedema, and inflammatory cell infiltration in the distal colon were prevented by CZ or antioxidant treatment. These results suggest that anti-inflammatory effects of these agents reduced DSS-induced mucosal injuries in mice and, therefore, may provide therapeutic benefits in IBD. Copyright © 2016 Elsevier GmbH. All rights reserved.

  8. Various levels and forms of dietary α-lipoic acid in broiler chickens: Impact on blood biochemistry, stress response, liver enzymes, and antibody titers.

    PubMed

    Kim, D W; Mushtaq, M M H; Parvin, R; Kang, H K; Kim, J H; Na, J C; Hwangbo, J; Kim, J D; Yang, C B; Park, B J; Choi, H C

    2015-02-01

    The present experiment was conducted to evaluate the impact of various levels and forms of α-lipoic acid (ALA) on blood biochemistry, immune and stress response, and antibody titers in broiler chickens. The four levels (7.5, 15, 75, and 150 ppm) and 2 sources (powder, P-ALA and encapsulated, E-ALA) of ALA along with negative (C-) and positive control (C+; contains antibiotics) diets consisted of 10 dietary treatments, and these treatments were allocated to 1,200 1-d-old chicks and were replicated 12 times with 10 birds per replicate. Among the blood biochemistry parameters, creatinine levels were almost 3 times lower in E-ALA-supplemented diets compared to the C- diet (0.09 vs. 0.25 mg/dL; P<0.0001). Neither level nor source of ALA affected blood urea nitrogen (BUN), total protein (TP), albumin, globulin, or albumin to globulin ratio (AGR). The supplemented diets decreased serum levels of the liver enzymes aspartate-aminotransferase (AST; P<0.006) and alanine-aminotransferase (ALT; P<0.0003). The Newcastle disease virus (NDV) antibody response in supplemented groups was poor at day zero (P<0.0001) but increased by d 14 (P<0.03). Birds did not respond to infectious bronchitis virus (IBV) vaccination at any observed stage (P>0.05). The concentration of cortisol was reduced in chickens fed ALA-supplemented diets as compared to the C- diet (P<0.001). Results suggest that ALA-supplemented diets ameliorated blood biochemistry profiles and immune responses and reduced stress in broiler chickens. The encapsulated form of ALA was more effective than the powder form. © 2015 Poultry Science Association Inc.

  9. The potential antifibrotic impact of apocynin and alpha-lipoic acid in concanavalin A-induced liver fibrosis in rats: Role of NADPH oxidases 1 and 4.

    PubMed

    Fayed, Mostafa R; El-Naga, Reem N; Akool, El-Sayed; El-Demerdash, Ebtehal

    2018-01-01

    Liver fibrosis results from chronic inflammation that precipitates excessive accumulation of extracellular matrix. Oxidative stress is involved in its pathogenesis. This study aimed to elucidate the potential antifibrotic effect of the NADPH oxidase (NOX) inhibitor, apocynin against concanavalin A (ConA)-induced immunological model of liver fibrosis, and to investigate the ability of the antioxidant, alpha-lipoic acid (α-LA) to potentiate this effect. Rats were treated with apocynin and/or α-LA for six weeks. Hepatotoxicity indices, oxidative stress, insulin, NOXs, inflammatory and liver fibrosis markers were assessed. Treatment of animals with apocynin and α-LA significantly ameliorated the changes in liver functions and histopathological architecture induced by ConA. Liver fibrosis induced by ConA was evident where alpha-smooth muscle actin and transforming growth factor- beta1 were elevated, which was further confirmed by Masson's trichrome stain and increased hydroxyproline. Co-treatment with apocynin and α-LA significantly reduced their expression. Besides, apocynin and α-LA significantly ameliorated oxidative stress injury evoked by ConA, as evidenced by enhancing reduced glutathione content, antioxidant enzymes activities and decreasing lipid peroxides. ConA induced a significant elevation in serum insulin level and inflammatory markers; tumor necrosis factor-alpha, interleukin-6 and nuclear factor kappa b. Furthermore, the mRNA tissue expression of NOXs 1 and 4 was found to be elevated in the ConA group. All these elevations were significantly reduced by apocynin and α-LA co-treatment. These findings indicate that using apocynin and α-LA in combination possess marked antifibrotic effects, and that NOX enzymes are partially involved in the pathogenesis of ConA-induced liver fibrosis.

  10. Transgenic cells with increased plastoquinone levels and methods of use

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sayre, Richard T.; Subramanian, Sowmya; Cahoon, Edgar

    Disclosed herein are transgenic cells expressing a heterologous nucleic acid encoding a prephenate dehydrogenase (PDH) protein, a heterologous nucleic acid encoding a homogentisate solanesyl transferase (HST) protein, a heterologous nucleic acid encoding a deoxyxylulose phosphate synthase (DXS) protein, or a combination of two or more thereof. In particular examples, the disclosed transgenic cells have increased plastoquinone levels. Also disclosed are methods of increasing cell growth rates or production of biomass by cultivating transgenic cells expressing a heterologous nucleic acid encoding a PDH protein, a heterologous nucleic acid encoding an HST protein, a heterologous nucleic acid encoding a DXS protein, ormore » a combination of two or more thereof under conditions sufficient to produce cell growth or biomass.« less

  11. Effects of alpha lipoic acid, ascorbic acid-6-palmitate, and fish oil on the glutathione, malonaldehyde, and fatty acids levels in erythrocytes of streptozotocin induced diabetic male rats.

    PubMed

    Yilmaz, Okkeş; Ozkan, Yusuf; Yildirim, Mehmet; Oztürk, A Ihsan; Erşan, Yasemin

    2002-01-01

    In this research, it has been aimed to evaluate the improvement effects of alpha lipoic acid (ALA), ascorbic acid-6-palmitate (AA6P), fish oil (FO), and their combination (COM) on some biochemical properties in erythrocytes of streptozotocin (STZ)-induced diabetic male rats. According to experimental results, glutathione (GSH) level in erythrocytes decreased in diabetes (P < 0.01), D + ALA, and D + AA6P groups (P < 0.001). Malonaldehyde (MA) level increased in diabetes (P < 0.05), D + FO, and D + COM groups (P < 0.001), but its level in D + AA6P and D + ALA groups was lower in diabetes group (P < 0.01). Total lipid level in diabetes and diabetes plus antioxidant administered groups were higher than control. Total cholesterol level was high in diabetes and D + ALA groups (P < 0.05), but its level reduced in D + FO compared to control and diabetes groups, P < 0.05, < 0.001, respectively. Total triglyceride (TTG) level was high in the D + ALA (P < 0.05) and D + COM (P < 0.001) groups. In contrast, TTG level in blood of diabetes group was higher than diabetes plus antioxidant and FO administered groups (P < 0.001). According to gas chromatography analysis results, while the palmitic acid raised in diabetes group (P < 0.05), stearic acid in D + FO, D + ALA, and diabetes groups was lower than control (P < 0.05), oleic acid reduced in D + COM and D + FO groups, but its level raised in D + AA6P and D + ALA groups (P < 0.01). As the linoleic acid (LA) elevated in ALA + D, D + AA6P, and diabetes groups, linolenic acid level in diabetes, D + AA6P, and D + FO groups was lower than control (P < 0.001). Arachidonic acid (AA) decreased in D + ALA, D+ AA6P, and diabetes groups (P < 0.01), but its level in D + COM and D + FO was higher than control (P < 0.05). Docosahexaenoic acid (DHA) increased in D + AA6P and D + COM (P < 0.05). While the total saturated fatty acid level raised in diabetes group, its level reduced in D + ALA and D + FO groups (P < 0.05). In contrast, total unsaturated fatty acid level in D + ALA and D + FO groups was higher than control (P < 0.05). In conclusion, present data have confirmed that the combination of the ALA, AA6P, and FO have improvement effects on the recycling of GSSG to reduced GSH in erythrocytes of diabetic rats, and in addition to this, oxidative stress was suppressed by ALA and AA6P, and unsaturated fatty acid degree was raised by the effects of ALA and FO. Copyright 2002 Wiley-Liss, Inc.

  12. Effect of Antioxidants Supplementation on Aging and Longevity

    PubMed Central

    Bartosz, Grzegorz

    2014-01-01

    If aging is due to or contributed by free radical reactions, as postulated by the free radical theory of aging, lifespan of organisms should be extended by administration of exogenous antioxidants. This paper reviews data on model organisms concerning the effects of exogenous antioxidants (antioxidant vitamins, lipoic acid, coenzyme Q, melatonin, resveratrol, curcumin, other polyphenols, and synthetic antioxidants including antioxidant nanoparticles) on the lifespan of model organisms. Mechanisms of effects of antioxidants, often due to indirect antioxidant action or to action not related to the antioxidant properties of the compounds administered, are discussed. The legitimacy of antioxidant supplementation in human is considered. PMID:24783202

  13. Inulin based glutathione-responsive delivery system for colon cancer treatment.

    PubMed

    Wang, Dongdong; Sun, Feifei; Lu, Chunbo; Chen, Peng; Wang, Zhaojie; Qiu, Yuanhao; Mu, Haibo; Miao, Zehong; Duan, Jinyou

    2018-05-01

    Colorectal cancer is one of the most common types of tumor in the world. Here we developed a lipoic acid esterified polysaccharide (inulin) delivery system for tanshinone IIA to treat colorectal cancer in vitro. The release of tanshinone IIA in the system was highly responsive to glutathione, which is commonly abundant in cancer cells. In addition, this drug delivery system was proliferative to Bifidobacterium longum, the common inhabitant of human intestine. Thus, this strategy might be useful to improve colon cancer therapy efficacy of anticancer drugs and meanwhile promote the growth of beneficial commensal flora in the gut. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Orthomolecular medicine: the therapeutic use of dietary supplements for anti-aging

    PubMed Central

    Janson, Michael

    2006-01-01

    Dietary supplements at high doses as part of medical therapy have been controversial, but the evidence suggests that they play a significant role in prevention and treatment of diseases as well as protection from accelerated aging that results from oxygen free-radical damage, inflammation, and glycation. This literature review examines several supplements that have documented roles in medical therapy, including vitamins C and E, coenzyme Q10, alpha-lipoic acid, chromium, L-carnitine, and quercetin. The evidence shows benefits in diabetes, cardiovascular disease, hypertension, congestive heart failure, age-related deterioration of brain function and vision, and immune function, as well as other age-related health problems. PMID:18046879

  15. GLUT1 deficiency syndrome in clinical practice.

    PubMed

    Klepper, Joerg

    2012-07-01

    GLUT1 deficiency syndrome (GLUT1DS) is caused by impaired glucose transport into brain and is effectively treated by means of a ketogenic diet. In clinical practice the diagnosis of GLUT1DS often is challenging due to the increasing complexity of symptoms, diagnostic cut-offs for hypoglycorrhachia and genetic heterogeneity. In terms of treatment alternative ketogenic diets and their long-term side effects as well as novel compounds such as alpha-lipoic acid and triheptanoin have raised a variety of issues. The current diagnostic and therapeutic approach to GLUT1DS is discussed in this review in view of these recent developments. Copyright © 2011. Published by Elsevier B.V.

  16. Orthomolecular medicine: the therapeutic use of dietary supplements for anti-aging.

    PubMed

    Janson, Michael

    2006-01-01

    Dietary supplements at high doses as part of medical therapy have been controversial, but the evidence suggests that they play a significant role in prevention and treatment of diseases as well as protection from accelerated aging that results from oxygen free-radical damage, inflammation, and glycation. This literature review examines several supplements that have documented roles in medical therapy, including vitamins C and E, coenzyme Q10, alpha-lipoic acid, chromium, L-carnitine, and quercetin. The evidence shows benefits in diabetes, cardiovascular disease, hypertension, congestive heart failure, age-related deterioration of brain function and vision, and immune function, as well as other age-related health problems.

  17. [Toxicological aspects and health risks associated with hydroquinone in skin bleaching formula].

    PubMed

    Kooyers, T J; Westerhof, W

    2004-04-17

    The use of hydroquinone as a cosmetic skin-bleaching agent has been forbidden since January 2001. It is now available only on prescription. The ban has been introduced because of medium-term effects such as white patches on the skin, particularly on the face (leukoderma with confetti-like depigmentation), and subcutaneous dark collections of pigment (exogenous ochonosis). Long-term effects are a possibility; cancer being the most likely. Renal adenomas and leukaemia occurred in animal experiments indicating the nephrotoxicity and carcinogenic properties of the substance. It is now known how hydroquinone and its metabolites can cause damage to DNA and inhibit apoptosis of mutated cells. The carcinogenic action of benzene is difficult to attribute to its hydroquinone metabolite. Daily use of hydroquinone causes it to accumulate in the body as absorption into the skin is faster than excretion in the urine. The use of hydroquinone as a skin-bleaching agent is accordingly unsafe and should be completely banned. Alternatives such as azaleic acid and thioctic acid (alpha-lipoic acid) are available.

  18. Effect of palladium α-lipoic acid complex on energy in the brain mitochondria of aged rats.

    PubMed

    Ajith, Thekkuttuparambil Ananthanarayanan; Nima, Nalin; Veena, Ravindran Kalathil; Janardhanan, Kainoor Krishnankutty; Antonawich, Francis

    2014-01-01

    According to the mitochondrial mutation theory of aging, the impairment of mitochondrial functions and decline of cellular bioenergetics are induced by highly reactive oxygen species (ROS). Supplementation with antioxidants may protect mitochondria against respiration-linked oxidative stress and reduce decay by preserving genomic and structural integrity. Several clinical studies have reported beneficial effects of α-lipoic acid (LA) administration in individuals with Alzheimer's disease, particularly improving their spatial orientation; however, no studies have been reported on the effects of palladium α-lipoic acid (Pd-LA). The current study examined the effects of the Pd-LA complex on mitochondrial energy status in the brains of aged rats. The study used male Wistar rats, some that were older than 24 mo and weighed approximately 350 ± 50 g and some that were younger than 24 mo and weighed approximately 175 ± 25 g. The research team divided the rats into 5 groups of 6 rats. The study was conducted at the Amala Cancer Research Centre in Amala Nagar, Thrissur, Kerala, India. Three groups of rats were controls: (1) young controls administered no solution, (2) aged controls administered 1 mL/kg of a 0.25% solution (PO) of sodium hydroxide (NaOH), and (3) positive aged controls treated with LA (7.6 mg/kg, PO) dissolved in an alkaline saline (0.25% NaOH, w/v). Two groups were intervention groups: (1) aged rats treated with 1.2 mg/kg of Pd-LA (PO) and (2) aged rats treated with 23.5 mg/kg of Pd-LA (PO). The research team administered the solutions once daily for 30 d. After 30 d, all animals were sacrificed. The research team evaluated serum transaminases, lactate dehydrogenase (LDH), serum urea, and creatinine. The activities of superoxide dismutase (SOD), catalase (CAT), and the levels of reduced glutathione (GSH) were determined in the blood samples. Krebs cycle dehydrogenases were evaluated in the brain mitochondria. Furthermore, the activities of the respiratory chain complexes I, III and IV as well as adenosine triphosphate (ATP) levels were estimated in the mitochondrial fraction. The study found that Pd-LA elevated the mitochondrial ATP levels in the brains of aged rats by enhancing the activity of not only the Krebs cycle dehydrogenases but also complexes I and IV. Furthermore, Pd-LA improved the body weight and blood antioxidant status of aged rats without affecting the functions of liver or renal cells. The results of the current study demonstrate that Pd-LA improves mitochondrial energy status in the brains of aged rats. The effects can be attributed to the enhancing effect on the Krebs cycle dehydrogenase and the activities of complexes I, III, and IV. The results further support the possible use of Pd-LA as an adjuvant treatment, together with the standard cholinesterase inhibitors, in individuals with mild or moderate dementia caused by Alzheimer's disease (AD).

  19. Metal resistant plants and phytoremediation of environmental contamination

    DOEpatents

    Meagher, Richard B.; Li, Yujing; Dhankher, Om P.

    2010-04-20

    The present disclosure provides a method of producing transgenic plants which are resistant to at least one metal ion by transforming the plant with a recombinant DNA comprising a nucleic acid encoding a bacterial arsenic reductase under the control of a plant expressible promoter, and a nucleic acid encoding a nucleotide sequence encoding a phytochelatin biosynthetic enzyme under the control of a plant expressible promoter. The invention also relates a method of phytoremediation of a contaminated site by growing in the site a transgenic plant expressing a nucleic acid encoding a bacterial arsenate reductase and a nucleic acid encoding a phytochelatin biosynthetic enzyme.

  20. Signal enhancement of carboxylic acids by inclusion with β-cyclodextrin in negative high-voltage-assisted laser desorption ionization mass spectrometry.

    PubMed

    Ren, Xinxin; Liu, Jia; Zhang, Chengsen; Sun, Jiamu; Luo, Hai

    2014-01-15

    It is difficult to directly analyze carboxylic acids in complex mixtures by ambient high-voltage-assisted laser desorption ionization mass spectrometry (HALDI-MS) in negative ion mode due to the low ionization efficiency of carboxylic acids. A method for the rapid detection of carboxylic acids in negative HALDI-MS has been developed based on their inclusion with β-cyclodextrin (β-CD). The negative HALDI-MS signal-to-noise ratios (S/Ns) of aliphatic, aromatic and hetero atom-containing carboxylic acids can all be significantly improved by forming 1:1 complexes with β-CD. These complexes are mainly formed by specific inclusion interactions which are verified by their collision-induced dissociation behaviors in comparison with that of their corresponding maltoheptaose complexes. A HALDI-MS/MS method has been successfully developed for the detection of α-lipoic acid in complex cosmetics and ibuprofen in a viscous drug suspension. The negative HALDI-MS S/Ns of carboxylic acids can be improved up to 30 times via forming non-covalent complexes with β-CD. The developed method shows the advantages of being rapid and simple, and is promising for rapid detection of active ingredients in complex samples or fast screening of drugs and cosmetics. Copyright © 2013 John Wiley & Sons, Ltd.

  1. Uptake of Biotin by Chlamydia Spp. through the Use of a Bacterial Transporter (BioY) and a Host-Cell Transporter (SMVT)

    PubMed Central

    Fisher, Derek J.; Fernández, Reinaldo E.; Adams, Nancy E.; Maurelli, Anthony T.

    2012-01-01

    Chlamydia spp. are obligate intracellular Gram-negative bacterial pathogens that cause disease in humans and animals. Minor variations in metabolic capacity between species have been causally linked to host and tissue tropisms. Analysis of the highly conserved genomes of Chlamydia spp. reveals divergence in the metabolism of the essential vitamin biotin with genes for either synthesis (bioF_2ADB) and/or transport (bioY). Streptavidin blotting confirmed the presence of a single biotinylated protein in Chlamydia. As a first step in unraveling the need for divergent biotin acquisition strategies, we examined BioY (CTL0613) from C. trachomatis 434/Bu which is annotated as an S component of the type II energy coupling-factor transporters (ECF). Type II ECFs are typically composed of a transport specific component (S) and a chromosomally unlinked energy module (AT). Intriguingly, Chlamydia lack recognizable AT modules. Using 3H-biotin and recombinant E. coli expressing CTL0613, we demonstrated that biotin was transported with high affinity (a property of Type II ECFs previously shown to require an AT module) and capacity (apparent K(m) of 3.35 nM and V(max) of 55.1 pmol×min−1×mg−1). Since Chlamydia reside in a host derived membrane vacuole, termed an inclusion, we also sought a mechanism for transport of biotin from the cell cytoplasm into the inclusion vacuole. Immunofluorescence microscopy revealed that the mammalian sodium multivitamin transporter (SMVT), which transports lipoic acid, biotin, and pantothenic acid into cells, localizes to the inclusion. Since Chlamydia also are auxotrophic for lipoic and pantothenic acids, SMVT may be subverted by Chlamydia to move multiple essential compounds into the inclusion where BioY and another transporter(s) would be present to facilitate transport into the bacterium. Collectively, our data validates the first BioY from a pathogenic organism and describes a two-step mechanism by which Chlamydia transport biotin from the host cell into the bacterial cytoplasm. PMID:23029384

  2. Determination of refraction nonlinear index, for effect thermal, of solutions with nanoparticles of gold

    NASA Astrophysics Data System (ADS)

    Olivares-Vargas, A.; Trejo-Durán, M.; Alvarado-Méndez, E.; Cornejo-Monroy, D.; Mata-Chávez, R. I.; Estudillo-Ayala, J. M.; Castaño-Meneses, V.

    2013-09-01

    Research of nonlinear optical properties of materials for manufacturing opto-electronic devices, had a great growth in the last years. The solutions with nanoparticle metals present nonlinear optical properties. In this work we present the results of characterizing, analyzing and determining the magnitude and sign of the nonlinear refractive index, using the z-scan technique in solutions with nanoparticles of gold, lipoic acid and sodium chloride. We used a continuous Argon laser at 514 nm with variable power, an 18 cms lens, and a chopper. We determined the nonlinear refractive index in the order of 10-9. These materials have potential applications mainly as optical limiters.

  3. Fatty acid-producing hosts

    DOEpatents

    Pfleger, Brian F; Lennen, Rebecca M

    2013-12-31

    Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.

  4. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    PubMed Central

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves II, H. James

    2015-01-01

    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or “chemistry space.” Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set. PMID:25802223

  5. Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods

    DOEpatents

    Thompson, David N [Idaho Falls, ID; Thompson, Vicki S [Idaho Falls, ID; Schaller, Kastli D [Ammon, ID; Apel, William A [Jackson, WY; Lacey, Jeffrey A [Idaho Falls, ID; Reed, David W [Idaho Falls, ID

    2011-04-12

    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  6. Lipoic acid induces p53-independent cell death in colorectal cancer cells and potentiates the cytotoxicity of 5-fluorouracil.

    PubMed

    Dörsam, Bastian; Göder, Anja; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg

    2015-10-01

    Alpha-lipoic acid (LA), which plays a pivotal role in mitochondrial energy metabolism, is an endogenous dithiol compound with an array of antioxidative functions. It has been shown that LA triggers cell death in tumor cell lines, whereas non-transformed cells are hardly affected. In the present study, we analyzed the cytotoxicity of LA on colorectal cancer (CRC) cells differing in their p53 status and investigated a putative synergistic effect with the anticancer drug 5-fluorouracil (5-FU). We show that LA induces a dose-dependent decrease in cell viability, which was independent of the p53 status as attested in isogenic p53-proficient and p53-deficient cell lines. This effect was largely attributable to cell death induction as revealed by Annexin-V/PI staining. LA-treated HCT116 cells underwent caspase-dependent and caspase-independent cell death, which was blocked by the pan-caspase inhibitor zVAD and the RIP-kinase inhibitor Necrostatin-1, respectively. In CaCO-2 and HT29 cells, LA induced caspase-dependent cell demise via activation of caspase-9, caspase-3 and caspase-7 with subsequent PARP-1 cleavage as demonstrated by immunoblot analysis, activity assays and pan-caspase inhibition. Interestingly, LA treatment did neither activate p53 nor induced genotoxic effects as shown by lack of DNA strand breaks and phosphorylation of histone 2AX. Finally, we provide evidence that LA increases the cytotoxic effect induced by the anticancer drug 5-FU as revealed by significantly enhanced cell death rates in HCT116 and CaCO-2 cells. Collectively, these findings demonstrate that LA induces CRC cell death independent of their p53 status and potentiates the cytotoxicity of 5-FU without causing DNA damage on its own, which makes it a candidate for tumor therapy.

  7. New insights on the modulatory roles of metformin or alpha-lipoic acid versus their combination in dextran sulfate sodium-induced chronic colitis in rats.

    PubMed

    Samman, Fatma S; Elaidy, Samah M; Essawy, Soha S; Hassan, Mohammad S

    2017-11-24

    Dextran sulfate sodium (DSS)-induced colitis is the most widely used model that resembles ulcerative colitis (UC) in human with challenging chronic mechanistic oxidative stress-inflammatory/immunological cascades. In models of acute colitis, reduction of oxidative stress and inflammatory burdens beside manipulation of many transcriptional factors were achieved by metformin or alpha-lipoic acid (α-LA). Currently, in vivo DSS-induced chronic colitis was conducted and the possible therapeutic roles of metformin and/or α-LA were explored. Chronic UC was induced by adding 5% DSS orally in drinking water for 7 days followed by 3% DSS in drinking water for 14 days in adult male albino Wistar rats. Intraperitoneal administration of α-LA (25 mg/kg, twice/day) and/or metformin (100 mg/kg/day) were set at day 7 of DSS administration and continued for 14 days. Body weights, survival rates, disease activity index (DAI), colonic oxidative stress markers, tumor necrosis factor (TNF)-α levels, colonic nuclear factor-kappa-B (NF-κB) immunohistochemical expression, and the colonic histopathological changes were observed. Metformin or/and α-LA attenuated the severity of the DSS-induced colitis through improving the reductions in body weights, the DAI, the colonic oxidative stress markers, TNF-α, and NF-κB levels, and the morphological mucosal damage scores. Significant synergetic therapeutic effects were observed with combined therapeutic regimens. Therapeutically, metformin and α-LA could be administered in chronic colitis. The combination of currently used pharmaceutics with natural and synthetic potent antioxidant compounds will become a therapeutic strategy of choice for UC to improve the quality of life if sufficient clinical trials are available. Copyright © 2017 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier B.V. All rights reserved.

  8. Alpha-lipoic acid alone and combined with clozapine reverses schizophrenia-like symptoms induced by ketamine in mice: Participation of antioxidant, nitrergic and neurotrophic mechanisms.

    PubMed

    Vasconcelos, Germana Silva; Ximenes, Naiara Coelho; de Sousa, Caren Nádia Soares; Oliveira, Tatiana de Queiroz; Lima, Laio Ladislau Lopes; de Lucena, David Freitas; Gama, Clarissa Severino; Macêdo, Danielle; Vasconcelos, Silvânia Maria Mendes

    2015-07-01

    Oxidative stress has important implications in schizophrenia. Alpha-lipoic acid (ALA) is a natural antioxidant synthesized in human tissues with clinical uses. We studied the effect of ALA or clozapine (CLZ) alone or in combination in the reversal of schizophrenia-like alterations induced by ketamine (KET). Adult male mice received saline or KET for 14 days. From 8th to 14th days mice were additionally administered saline, ALA (100 mg/kg), CLZ 2.5 or 5 mg/kg or the combinations ALA+CLZ2.5 or ALA+CLZ5. Schizophrenia-like symptoms were evaluated by prepulse inhibition of the startle (PPI) and locomotor activity (positive-like), social preference (negative-like) and Y maze (cognitive-like). Oxidative alterations (reduced glutathione - GSH and lipid peroxidation - LP) and nitrite in the prefrontal cortex (PFC), hippocampus (HC) and striatum (ST) and BDNF in the PFC were also determined. KET caused deficits in PPI, working memory, social interaction and hyperlocomotion. Decreased levels of GSH, nitrite (HC) and BDNF and increased LP were also observed in KET-treated mice. ALA and CLZ alone reversed KET-induced behavioral alterations. These drugs also reversed the decreases in GSH (HC) and BDNF and increase in LP (PFC, HC and ST). The combination ALA+CLZ2.5 reversed behavioral and some neurochemical parameters. However, ALA+CLZ5 caused motor impairment. Therefore, ALA presented an antipsychotic-like profile reversing KET-induced positive- and negative-like symptoms. The mechanism partially involves antioxidant, neurotrophic and nitrergic pathways. The combination of ALA+CLZ2.5 improved most of the parameters evaluated in this study without causing motor impairment demonstrating, thus, that possibly when combined with ALA a lower dose of CLZ is required. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Lipoic acid suppresses portal endotoxemia-induced steatohepatitis and pancreatic inflammation in rats

    PubMed Central

    Tian, Yu-Feng; He, Chih-Tsueng; Chen, Yu-Ting; Hsieh, Po-Shiuan

    2013-01-01

    AIM: To examine the effect of α-lipoic acid (LA) on mild portal endotoxemia-induced steatohepatitis and associated pancreatic abnormalities in fructose-fed rats. METHODS: Rats were randomly assigned into two groups with a regular or 60% fructose-enriched diet for 8 wk. After fructose feeding for 4 wk, rats were further divided into four subgroups: with intraportal saline (FPV), with intraportal saline plus administration of LA (FPV + LA), with lipopolysaccharide (LPS) infusion (FPLPS), and with LPS infusion plus administration of LA (FPLPS + LA). Rats were treated with LPS using intraportal infusion while LA was administered orally. Metabolite levels, superoxide levels, inflammatory markers, malondialdehyde content, glutathione content and toll-like receptor 4 (TLR4) gene expression were all measured using standard biochemical techniques. Pancreatic insulin secretion was evaluated by a hyperglycemic clamp technique. Histology of liver and pancreas tissues were evaluated using hematoxylin and eosin staining and immunohistochemistry. RESULTS: Fructose-induced elevation in plasma C-reactive protein, amylase, superoxide, white blood cell count as well as in hepatic and pancreatic contents of malondialdehyde, tumor necrosis factor alpha and interleukin-6 were increased in animals treated with LPS and reversed with LA administration. The augmented hepatic gene expression of TLR4 in fructose-fed rats was further increased in those with intraportal LPS infusion, which was partially reversed by LA administration. Pathological examination showed inflammatory changes and leukocyte infiltration in hepatic and pancreatic islets of animals treated with LPS but were rarely observed in those with LA treatment. In addition to affects on the liver, impaired pancreatic insulin secretion seen in fructose-fed rats was deteriorated in with LPS treatment and partially reversed with LA administration. CONCLUSION: These data suggest LA could significantly suppress mild portal-endotoxemia but not fructose-induced liver and pancreatic abnormalities in a rodent model for metabolic syndrome. PMID:23687413

  10. Cardioprotective effects of lipoic acid, quercetin and resveratrol on oxidative stress related to thyroid hormone alterations in long-term obesity.

    PubMed

    Cheserek, Maureen Jepkorir; Wu, Guirong; Li, Longnan; Li, Lirong; Karangwa, Eric; Shi, Yonghui; Le, Guowei

    2016-07-01

    This study investigated possible mechanisms for cardioprotective effects of lipoic acid (LA), quercetin (Q) and resveratrol (R) on oxidative stress related to thyroid hormone alterations in long-term obesity. Female C57BL/6 mice were fed on high-fat diet (HFD), HFD+LA, HFD+R, HFD+Q and normal diet for 26weeks. Body weight, blood pressure, thyroid hormones, oxidative stress markers, angiotensin converting enzyme (ACE), nitric oxide synthase (NOS) and ion pump activities were measured, and expression of cardiac genes was analyzed by real-time polymerase chain reaction. HFD induced marked increase (P<.05) in body weight, blood pressure and oxidative stress, while plasma triidothyronine levels reduced. ACE activity increased (P<.05) in HFD mice (0.69±0.225U/mg protein) compared with controls (0.28±0.114U/mg protein), HFD+LA (0.231±0.02U/mg protein) and HFD+Q (0.182±0.096U/mg protein) at 26weeks. Moreover, Na(+)/K(+)-ATPase and Ca(2+)-ATPase activities increased in HFD mice whereas NOS reduced. A 1.5-fold increase in TRα1 and reduction in expression of the deiodinase iodothyronine DIO1, threonine protein kinase and NOS3 as well as up-regulation of AT1α, ACE, ATP1B1, GSK3β and Cja1 genes also occurred in HFD mice. Conversely, LA, Q and R inhibited weight gain; reduced TRα1 expression as well as increased DIO1; reduced ACE activity and AT1α, ATP1B1 and Cja1 gene expression as well as inhibited GSK3β; increased total antioxidant capacity, GSH and catalase activity; and reduced blood pressure. In conclusion, LA, resveratrol and quercetin supplementation reduces obesity thereby restoring plasma thyroid hormone levels and attenuating oxidative stress in the heart and thus may have therapeutic potential in heart diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Alpha-lipoic acid blocks HIV-1 LTR-dependent expression of hygromycin resistance in THP-1 stable transformants.

    PubMed

    Merin, J P; Matsuyama, M; Kira, T; Baba, M; Okamoto, T

    1996-09-23

    Gene expression of human immunodeficiency virus (HIV) depends on a host cellular transcription factors including nuclear factor-kappaB (NF-kappaB). The involvement of reactive oxygen intermediates (ROI) has been implicated as intracellular messengers in the inducible activation of NF-kappaB. In this study, we compared the efficacy of two antioxidants, alpha-lipoic acid (LA) and N-acetylcysteine (NAC), which are widely recognized NF-kappaB inhibitors. Here, we demonstrate that LA has a more potent activity in inhibiting NF-KappaB-mediated gene expression in THP-1 cells that have been stably transfected with a plasmid bearing a hygromycin B resistance gene under the control of HIV-1 long terminal repeat (LTR) promoter. The spontaneous activation of NF-kappaB in this cell culture system leads to expression of the hygromycin phosphotransferase gene hence rendering the cells resistance to hygromycin B. In this study, the effect of the test compounds against transcriptional activity of HIV-1 LTR was evaluated based on the degree of cellular toxicity due to the inhibitory activity on the expression of hygromycin B resistance gene in the presence of hygromycin B. We also found that 0.2 mM LA could cause 40% reduction in the HIV-1 expression from the TNF-alpha-stimulated OM 10.1, a cell line latently infected with HIV-1. On the other hand, 10 mM NAC was required to elicit the same effect. Furthermore, the initiation of HIV-1 induction by TNF-alpha was completely abolished by 1 mM LA. These findings confirm the involvement of ROI in NF-kappaB-mediated HIV gene expression as well as the efficacy of LA as a therapeutic regimen for HIV infection and acquired immunodeficiency syndrome (AIDS). Moreover, this study validates the applicability of our present assay system which we primarily designed for the screening of candidate drugs against HIV-1 gene expression.

  12. Lipoic acid in secondary progressive MS

    PubMed Central

    Powers, Katherine; Murchison, Charles; Heriza, Elizabeth; Winges, Kimberly; Yadav, Vijayshree; Cameron, Michelle; Kim, Ed; Horak, Fay; Simon, Jack; Bourdette, Dennis

    2017-01-01

    Objective: To determine whether lipoic acid (LA), an endogenously produced antioxidant, slowed the whole-brain atrophy rate and was safe in secondary progressive MS (SPMS). Methods: Patients with SPMS aged 40–70 years enrolled in a single center, 2-year, double-blind, randomized trial of daily oral 1,200 mg LA vs placebo. Primary outcome was change in annualized percent change brain volume (PCBV). Secondary outcomes were changes in rates of atrophy of segmented brain, spinal cord, and retinal substructures, disability, quality of life, and safety. Intention-to-treat analysis used linear mixed models. Results: Participation occurred between May 2, 2011, and August 14, 2015. Study arms of LA (n = 27) and placebo (n = 24) were matched with mean age of 58.5 (SD 5.9) years, 61% women, mean disease duration of 29.6 (SD 9.5) years, and median Expanded Disability Status Score of 6.0 (interquartile range 1.75). After 2 years, the annualized PCBV was significantly less in the LA arm compared with placebo (−0.21 [standard error of the coefficient estimate (SEE) 0.14] vs −0.65 [SEE 0.10], 95% confidence interval [CI] 0.157–0.727, p = 0.002). Improved Timed 25-Foot Walk was almost but not significantly better in the LA than in the control group (−0.535 [SEE 0.358] vs 0.137 [SEE 0.247], 95% CI −1.37 to 0.03, p = 0.06). Significantly more gastrointestinal upset and fewer falls occurred in LA patients. Unexpected renal failure (n = 1) and glomerulonephritis (n = 1) occurred in the LA cohort. Compliance, measured by pill counts, was 87%. Conclusions: LA demonstrated a 68% reduction in annualized PCBV and suggested a clinical benefit in SPMS while maintaining favorable safety, tolerability, and compliance over 2 years. ClinicalTrials.gov identifier: NCT01188811. Classification of evidence: This study provides Class I evidence that for patients with SPMS, LA reduces the rate of brain atrophy. PMID:28680916

  13. Nature-based molecules combined with rivastigmine: A symbiotic approach for the synthesis of new agents against Alzheimer's disease.

    PubMed

    Nesi, Giulia; Chen, Qiuhe; Sestito, Simona; Digiacomo, Maria; Yang, Xiaohong; Wang, Shengnan; Pi, Rongbiao; Rapposelli, Simona

    2017-12-01

    Starting from nature as original source, new potential agents with pleiotropic activities have been synthesized and evaluated as neuroprotective agents. In this work, novel nature-based hybrids, combining antioxidant motifs with rivastigmine, have been designed and synthesized. The biological results revealed that the new compounds inhibit both AChE and BuChE. In particular, lipoic acid hybrids LA1, LA2, LA3 resulted to be the most potent inhibitors of BuChE showing IC 50 values ranging from 340 to 378 nM. Analogously, all the compounds were able to inhibit the self β-amyloid 1-42 aggregation. The gallic acid hybrid GA2 as well as the 2-chromonecarboxylic acid hybrids CA1 and CA2 prevented the self-mediated Aβ aggregation with percentages of inhibition ranging from 53% to 59%. Finally, some of them also show potent neuroprotective effects against glutamate-induced cell death and low toxicity in HT22 cells. Copyright © 2017. Published by Elsevier Masson SAS.

  14. Complementary and alternative medicine for the treatment of multiple sclerosis

    PubMed Central

    Yadav, Vijayshree; Shinto, Lynne; Bourdette, Dennis

    2010-01-01

    Multiple sclerosis (MS) is a chronic disabling disease of the CNS that affects people during early adulthood. Despite several US FDA-approved medications, the treatment options in MS are limited. Many people with MS explore complementary and alternative medicine (CAM) treatments to help control their MS and treat their symptoms. Surveys suggest that up to 70% of people with MS have tried one or more CAM treatment for their MS. People with MS using CAM generally report deriving some benefit from the therapies. The CAM therapies most frequently used include diet, omega-3 fatty acids and antioxidants. There is very limited research evaluating the safety and effectiveness of CAM in MS. The most promising among CAM therapies that warrant further investigation are a low-fat diet, omega-3 fatty acids, lipoic acid and vitamin D supplementation as potential anti-inflammatory and neuroprotective agents in both relapsing and progressive forms of MS. There is very limited research evaluating the safety and effectiveness of CAM in MS. However, in recent years, the NIH and the National MS Society have been actively supporting the research in this very important area. PMID:20441425

  15. Regulation of Sirtuin-Mediated Protein Deacetylation by Cardioprotective Phytochemicals

    PubMed Central

    2017-01-01

    Modulation of posttranslational modifications (PTMs), such as protein acetylation, is considered a novel therapeutic strategy to combat the development and progression of cardiovascular diseases. Protein hyperacetylation is associated with the development of numerous cardiovascular diseases, including atherosclerosis, hypertension, cardiac hypertrophy, and heart failure. In addition, decreased expression and activity of the deacetylases Sirt1, Sirt3, and Sirt6 have been linked to the development and progression of cardiac dysfunction. Several phytochemicals exert cardioprotective effects by regulating protein acetylation levels. These effects are mainly exerted via activation of Sirt1 and Sirt3 and inhibition of acetyltransferases. Numerous studies support a cardioprotective role for sirtuin activators (e.g., resveratrol), as well as other emerging modulators of protein acetylation, including curcumin, honokiol, oroxilyn A, quercetin, epigallocatechin-3-gallate, bakuchiol, tyrosol, and berberine. Studies also point to a cardioprotective role for various nonaromatic molecules, such as docosahexaenoic acid, alpha-lipoic acid, sulforaphane, and caffeic acid ethanolamide. Here, we review the vast evidence from the bench to the clinical setting for the potential cardioprotective roles of various phytochemicals in the modulation of sirtuin-mediated deacetylation. PMID:29234485

  16. Antioxidants inhibit SAA formation and pro-inflammatory cytokine release in a human cell model of alkaptonuria.

    PubMed

    Spreafico, Adriano; Millucci, Lia; Ghezzi, Lorenzo; Geminiani, Michela; Braconi, Daniela; Amato, Loredana; Chellini, Federico; Frediani, Bruno; Moretti, Elena; Collodel, Giulia; Bernardini, Giulia; Santucci, Annalisa

    2013-09-01

    Alkaptonuria (AKU) is an ultra-rare autosomal recessive disease that currently lacks an appropriate therapy. Recently we provided experimental evidence that AKU is a secondary serum amyloid A (SAA)-based amyloidosis. The aim of the present work was to evaluate the use of antioxidants to inhibit SAA amyloid and pro-inflammatory cytokine release in AKU. We adopted a human chondrocytic cell AKU model to evaluate the anti-amyloid capacity of a set of antioxidants that had previously been shown to counteract ochronosis in a serum AKU model. Amyloid presence was evaluated by Congo red staining. Homogentisic acid-induced SAA production and pro-inflammatory cytokine release (overexpressed in AKU patients) were evaluated by ELISA and multiplex systems, respectively. Lipid peroxidation was evaluated by means of a fluorescence-based assay. Our AKU model allowed us to prove the efficacy of ascorbic acid combined with N-acetylcysteine, taurine, phytic acid and lipoic acid in significantly inhibiting SAA production, pro-inflammatory cytokine release and membrane lipid peroxidation. All the tested antioxidant compounds were able to reduce the production of amyloid and may be the basis for establishing new therapies for AKU amyloidosis.

  17. Antioxidants inhibit SAA formation and pro-inflammatory cytokine release in a human cell model of alkaptonuria

    PubMed Central

    Spreafico, Adriano; Millucci, Lia; Ghezzi, Lorenzo; Geminiani, Michela; Braconi, Daniela; Amato, Loredana; Chellini, Federico; Frediani, Bruno; Moretti, Elena; Collodel, Giulia; Bernardini, Giulia

    2013-01-01

    Objective. Alkaptonuria (AKU) is an ultra-rare autosomal recessive disease that currently lacks an appropriate therapy. Recently we provided experimental evidence that AKU is a secondary serum amyloid A (SAA)-based amyloidosis. The aim of the present work was to evaluate the use of antioxidants to inhibit SAA amyloid and pro-inflammatory cytokine release in AKU. Methods. We adopted a human chondrocytic cell AKU model to evaluate the anti-amyloid capacity of a set of antioxidants that had previously been shown to counteract ochronosis in a serum AKU model. Amyloid presence was evaluated by Congo red staining. Homogentisic acid-induced SAA production and pro-inflammatory cytokine release (overexpressed in AKU patients) were evaluated by ELISA and multiplex systems, respectively. Lipid peroxidation was evaluated by means of a fluorescence-based assay. Results. Our AKU model allowed us to prove the efficacy of ascorbic acid combined with N-acetylcysteine, taurine, phytic acid and lipoic acid in significantly inhibiting SAA production, pro-inflammatory cytokine release and membrane lipid peroxidation. Conclusion. All the tested antioxidant compounds were able to reduce the production of amyloid and may be the basis for establishing new therapies for AKU amyloidosis. PMID:23704321

  18. Thermal and acid tolerant beta xylosidases, arabinofuranosidases, genes encoding, related organisms, and methods

    DOEpatents

    Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A

    2013-04-30

    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  19. Fast detection of Listeria monocytogenes through a nanohybrid quantum dot complex.

    PubMed

    Donoso, Wendy; Castro, Ricardo I; Guzmán, Luis; López-Cabaña, Zoraya; Nachtigall, Fabiane M; Santos, Leonardo S

    2017-09-01

    Listeria monocytogenes is a recognized foodborne pathogen that causes listeriosis in susceptible consumers. Currently, the detection systems for Listeria in food detect live and dead bacteria, being the viable microorganisms most relevant for their ability to cause sickness in the population at risk. For this reason, a new nanohybrid compound was developed for the optical detection of Listeria that was based on polyamidoamine dendrimers functionalized with an auxotrophic cofactor (lipoic acid), together with the coupling of fluorescent semiconductor crystals (quantum dots). The nanohybrid sensor has a detection limit for viable L. monocytogenes of 5.19 × 10 3 colony-forming units per milliliter under epifluorescence microscopy. It was specific when used among other pathogens commonly found in food.

  20. A diagnostic and therapeutic approach to primary burning mouth syndrome.

    PubMed

    Moghadam-Kia, Siamak; Fazel, Nasim

    Primary burning mouth syndrome (BMS) is an oral mucosal disorder that is characterized by a chronic and often debilitating intraoral burning sensation for which no localized or systemic cause can be found. BMS most commonly affects postmenopausal women. The pathophysiology of primary BMS is not well understood. Diagnosing BMS can prove to be challenging. BMS patients can also pose a therapeutic challenge to clinicians who are consulted to evaluate these patients. Most commonly used therapies include tricyclic antidepressants, α-lipoic acid, clonazepam, and cognitive-behavioral therapy. Clinical judgment, patient counseling, and monitoring of pain are important. Further research is required to assess the effectiveness of serotonin and newer serotonin-noradrenalin reuptake inhibitors. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Thiamine pyrophosphokinase deficiency causes a Leigh Disease like phenotype in a sibling pair: identification through whole exome sequencing and management strategies.

    PubMed

    Fraser, Jamie L; Vanderver, Adeline; Yang, Sandra; Chang, Taeun; Cramp, Laura; Vezina, Gilbert; Lichter-Konecki, Uta; Cusmano-Ozog, Kristina P; Smpokou, Patroula; Chapman, Kimberly A; Zand, Dina J

    2014-01-01

    We present a sibling pair with Leigh-like disease, progressive hypotonia, regression, and chronic encephalopathy. Whole exome sequencing in the younger sibling demonstrated a homozygous thiamine pyrophosphokinase (TPK) mutation. Initiation of high dose thiamine, niacin, biotin, α-lipoic acid and ketogenic diet in this child demonstrated improvement in neurologic function and re-attainment of previously lost milestones. The diagnosis of TPK deficiency was difficult due to inconsistent biochemical and diagnostic parameters, rapidity of clinical demise and would not have been made in a timely manner without the use of whole exome sequencing. Molecular diagnosis allowed for attempt at dietary modification with cofactor supplementation which resulted in an improved clinical course.

  2. The Sulfur Carrier Protein TusA Has a Pleiotropic Role in Escherichia coli That Also Affects Molybdenum Cofactor Biosynthesis*

    PubMed Central

    Dahl, Jan-Ulrik; Radon, Christin; Bühning, Martin; Nimtz, Manfred; Leichert, Lars I.; Denis, Yann; Jourlin-Castelli, Cécile; Iobbi-Nivol, Chantal; Méjean, Vincent; Leimkühler, Silke

    2013-01-01

    The Escherichia coli l-cysteine desulfurase IscS mobilizes sulfur from l-cysteine for the synthesis of several biomolecules such as iron-sulfur (FeS) clusters, molybdopterin, thiamin, lipoic acid, biotin, and the thiolation of tRNAs. The sulfur transfer from IscS to various biomolecules is mediated by different interaction partners (e.g. TusA for thiomodification of tRNAs, IscU for FeS cluster biogenesis, and ThiI for thiamine biosynthesis/tRNA thiolation), which bind at different sites of IscS. Transcriptomic and proteomic studies of a ΔtusA strain showed that the expression of genes of the moaABCDE operon coding for proteins involved in molybdenum cofactor biosynthesis is increased under aerobic and anaerobic conditions. Additionally, under anaerobic conditions the expression of genes encoding hydrogenase 3 and several molybdoenzymes such as nitrate reductase were also increased. On the contrary, the activity of all molydoenzymes analyzed was significantly reduced in the ΔtusA mutant. Characterization of the ΔtusA strain under aerobic conditions showed an overall low molybdopterin content and an accumulation of cyclic pyranopterin monophosphate. Under anaerobic conditions the activity of nitrate reductase was reduced by only 50%, showing that TusA is not essential for molybdenum cofactor biosynthesis. We present a model in which we propose that the direction of sulfur transfer for each sulfur-containing biomolecule is regulated by the availability of the interaction partner of IscS. We propose that in the absence of TusA, more IscS is available for FeS cluster biosynthesis and that the overproduction of FeS clusters leads to a modified expression of several genes. PMID:23281480

  3. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2014-02-25

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  4. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-05-16

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  5. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-04-01

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  6. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2010-10-12

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  7. EGVIII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-05-23

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl8, and the corresponding EGVIII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVIII, recombinant EGVIII proteins and methods for producing the same.

  8. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2010-10-05

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  9. EGVI endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-06-06

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  10. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2009-05-05

    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  11. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2013-07-16

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  12. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2012-02-14

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  13. EGVII endoglucanase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2015-04-14

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  14. Identification of a novel fatty acid elongase with a wide substrate specificity from arachidonic acid-producing fungus Mortierella alpina 1S-4.

    PubMed

    Sakuradani, Eiji; Nojiri, Masutoshi; Suzuki, Haruna; Shimizu, Sakayu

    2009-09-01

    The isolation and characterization of a gene (MALCE1) that encodes a fatty acid elongase from arachidonic acid-producing fungus Mortierella alpina 1S-4 are described. MALCE1 was confirmed to encode a fatty acid elongase by its expression in yeast Saccharomyces cerevisiae, resulting in the accumulation of 18-, 19-, and 20-carbon monounsaturated fatty acids and eicosanoic acid. Furthermore, the MALCE1 yeast transformant efficiently elongated exogenous 9-hexadecenoic acid, 9,12-octadecadienoic acid, and 9,12,15-octadecatrienoic acid. The MALCE1 gene-silenced strain obtained from M. alpina 1S-4 exhibited a low content of octadecanoic acid and a high content of hexadecanoic acid, compared with those in the wild strain. The enzyme encoded by MALCE1 was demonstrated to be involved in the conversion of hexadecanoic acid to octadecanoic acid, its main role in M. alpina 1S-4.

  15. Protection against radiation-induced oxidative stress in cultured human epithelial cells by treatment with antioxidant agents

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wan, X. Steven; Ware, Jeffrey H.; Zhou, Zhaozong

    2006-04-01

    Purpose: To evaluate the protective effects of antioxidant agents against space radiation-induced oxidative stress in cultured human epithelial cells. Methods and Materials: The effects of selected concentrations of N-acetylcysteine, ascorbic acid, sodium ascorbate, co-enzyme Q10, {alpha}-lipoic acid, L-selenomethionine, and vitamin E succinate on radiation-induced oxidative stress were evaluated in MCF10 human breast epithelial cells exposed to radiation with X-rays, {gamma}-rays, protons, or high mass, high atomic number, and high energy particles using a dichlorofluorescein assay. Results: The results demonstrated that these antioxidants are effective in protecting against radiation-induced oxidative stress and complete or nearly complete protection was achieved by treatingmore » the cells with a combination of these agents before and during the radiation exposure. Conclusion: The combination of antioxidants evaluated in this study is likely be a promising countermeasure for protection against space radiation-induced adverse biologic effects.« less

  16. Fortified extract of red berry, Ginkgo biloba, and white willow bark in experimental early diabetic retinopathy.

    PubMed

    Bucolo, Claudio; Marrazzo, Giuseppina; Platania, Chiara Bianca Maria; Drago, Filippo; Leggio, Gian Marco; Salomone, Salvatore

    2013-01-01

    Diabetic retinopathy is a complex condition where inflammation and oxidative stress represent crucial pathways in the pathogenesis of the disease. Aim of the study was to investigate the effects of a fortified extract of red berries, Ginkgo biloba and white willow bark containing carnosine and α-lipoic acid in early retinal and plasma changes of streptozotocin-induced diabetic rats. Diabetes was induced by a single streptozotocin injection in Sprague Dawley rats. Diabetics and nondiabetic (control) rats were treated daily with the fortified extract for the ten days. Retina samples were collected and analyzed for their TNF-α and VEGF content. Moreover, plasma oxidative stress was evaluated by thiobarbituric acid reacting substances (TBARS). Increased TNF-α and VEGF levels were observed in the retina of diabetic rats. Treatment with the fortified extract significantly lowered retinal cytokine levels and suppressed diabetes-related lipid peroxidation. These data demonstrate that the fortified extract attenuates the degree of retinal inflammation and plasma lipid peroxidation preserving the retina in early diabetic rats.

  17. Dietary supplementation with a combination of alpha-lipoic acid, acetyl-L-carnitine, glycerophosphocoline, docosahexaenoic acid, and phosphatidylserine reduces oxidative damage to murine brain and improves cognitive performance.

    PubMed

    Suchy, James; Chan, Amy; Shea, Thomas B

    2009-01-01

    Alzheimer disease has a complex etiology composed of nutritional and genetic risk factors and predispositions. Moreover, genetic risk factors for cognitive decline may remain latent pending age-related decline in nutrition, suggesting the potential importance of early nutritional intervention, including preventative approaches. We hypothesized that a combination of multiple nutritional additives may be able to provide neuroprotection. We demonstrate herein that dietary supplementation with a mixture of ALA, ALCAR, GPC, DHA, and PS reduced reactive oxygen species in normal mice by 57% and prevented the increase in reactive oxygen species normally observed in mice lacking murine ApoE when maintained on a vitamin-free, iron-enriched, oxidative-challenge diet. We further demonstrate that supplementation with these agents prevented the marked cognitive decline otherwise observed in normal mice maintained on this challenge diet. These findings add to the growing body of research indicating that key dietary supplementation may delay the progression of age-related cognitive decline.

  18. Novel promising therapeutics against chronic neuroinflammation and neurodegeneration in Alzheimer's disease.

    PubMed

    Venigalla, Madhuri; Sonego, Sandra; Gyengesi, Erika; Sharman, Matthew J; Münch, Gerald

    2016-05-01

    Alzheimer's disease (AD) is a progressive neurodegenerative disorder, characterized by deposition of amyloid plaques and neurofibrillary tangles, as well as microglial and astroglial activation, and, finally, leading to neuronal dysfunction and death. Current treatments for AD primarily focus on enhancement of cholinergic transmission. However, these treatments are only symptomatic, and no disease-modifying drug is available for the treatment of AD patients. This review will provide an overview of the antioxidant, anti-inflammatory, anti-amyloidogenic, neuroprotective, and cognition-enhancing effects of a variety of nutraceuticals including curcumin, apigenin, docosahexaenoic acid, epigallocatechin gallate, α-lipoic acid and resveratrol and their potential for AD prevention and treatment. We suggest that therapeutic use of these compounds might lead to a safe strategy to delay the onset of AD or slow down its progression. The continuing investigation of the potential of these substances is necessary as they are promising compounds to yield a possible remedy for this pervasive disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Mitochondrion-Permeable Antioxidants to Treat ROS-Burst-Mediated Acute Diseases

    PubMed Central

    Zhang, Zhong-Wei; Xu, Xiao-Chao; Liu, Ting

    2016-01-01

    Reactive oxygen species (ROS) play a crucial role in the inflammatory response and cytokine outbreak, such as during virus infections, diabetes, cancer, cardiovascular diseases, and neurodegenerative diseases. Therefore, antioxidant is an important medicine to ROS-related diseases. For example, ascorbic acid (vitamin C, VC) was suggested as the candidate antioxidant to treat multiple diseases. However, long-term use of high-dose VC causes many side effects. In this review, we compare and analyze all kinds of mitochondrion-permeable antioxidants, including edaravone, idebenone, α-Lipoic acid, carotenoids, vitamin E, and coenzyme Q10, and mitochondria-targeted antioxidants MitoQ and SkQ and propose astaxanthin (a special carotenoid) to be the best antioxidant for ROS-burst-mediated acute diseases, like avian influenza infection and ischemia-reperfusion. Nevertheless, astaxanthins are so unstable that most of them are inactivated after oral administration. Therefore, astaxanthin injection is suggested hypothetically. The drawbacks of the antioxidants are also reviewed, which limit the use of antioxidants as coadjuvants in the treatment of ROS-associated disorders. PMID:26649144

  20. The Path of Carbon in Photosynthesis XX. The Steady State

    DOE R&D Accomplishments Database

    Calvin, M.; Massini, Peter

    1952-09-01

    The separation of the phenomenon of photosynthesis in green plants into a photochemical reaction and into the light-dependent reduction of carbon dioxide is discussed, The reduction of carbon dioxide and the fate of the assimilated carbon were investigated with the help of the tracer technique (exposure of the planks to the radioactive C{sup 14}O{sub 2}) and of paper chromatography. A reaction cycle is proposed in which phosphoglyceric acid is the first isolable assimilations product. Analyses of the algal extracts which had assimilated radioactive carbon dioxide in a stationary condition ('steady-state' photosynthesis) for a long time provided further information concerning the proposed cycle and permitted the approximate estimation, for a number of compounds of what fraction of each compound was taking part in the cycle. The earlier supposition that light influences the respiration cycle was confirmed. The possibility of the assistance of {alpha}-lipoic acid, or of a related substance, in this influence and in the photosynthesis cycle, is discussed.

  1. BGL7 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Ward, Michael

    2013-01-29

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  2. BGL6 .beta.-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Ward, Michael

    2012-10-02

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  3. BGL5 .beta.-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-02-28

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  4. BGL5 .beta.-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-03-18

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  5. BGL6 beta-glucosidase and nucleic acids encoding the same

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dunn-Coleman, Nigel; Ward, Michael

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  6. BGL6 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Ward, Michael

    2014-03-04

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  7. BGL7 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Ward, Michael

    2015-04-14

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  8. BGL7 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Ward, Michael

    2014-03-25

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  9. BGL6 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Ward, Michael

    2015-08-11

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  10. BGL3 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2007-09-25

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  11. BGL3 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-04-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  12. BGL4 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2011-12-06

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  13. BGL4 .beta.-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-05-16

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  14. BGL3 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2011-06-14

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  15. BGL6 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Ward, Michael [San Francisco, CA

    2009-09-01

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  16. BGL3 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2012-10-30

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  17. BGL4 beta-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

    2008-01-22

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  18. 4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic Acid (C75), an Inhibitor of Fatty-acid Synthase, Suppresses the Mitochondrial Fatty Acid Synthesis Pathway and Impairs Mitochondrial Function*

    PubMed Central

    Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui

    2014-01-01

    4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139

  19. Use of an alpha lipoic, methylsulfonylmethane and bromelain dietary supplement (Opera®) for chemotherapy-induced peripheral neuropathy management, a prospective study.

    PubMed

    Desideri, Isacco; Francolini, Giulio; Becherini, Carlotta; Terziani, Francesca; Delli Paoli, Camilla; Olmetto, Emanuela; Loi, Mauro; Perna, Marco; Meattini, Icro; Scotti, Vieri; Greto, Daniela; Bonomo, Pierluigi; Sulprizio, Susanna; Livi, Lorenzo

    2017-03-01

    Chemotherapy-induced peripheral neuropathy (CIPN) is a major clinical problem associated with a number of cytotoxic agents. OPERA ® (GAMFARMA srl, Milan, Italy) is a new dietary supplement where α-lipoic acid, Boswellia Serrata, methylsulfonylmethane and bromelain are combined in a single capsule. The aim of this prospective study was to determine the efficacy and safety of OPERA ® supplementation in a series of patients affected by CIPN. We selected 25 subjects with CIPN evolving during or after chemotherapy with potentially neurotoxic agents. Patients were enrolled at the first clinical manifestation of neuropathy. CIPN was assessed at the enrollment visit and subsequently repeated every 3 weeks until 12 weeks. Primary endpoint was the evaluation of changes of measured scores after 12 weeks of therapy compared to baseline evaluation. Secondary endpoints were the evaluation of neuropathy reduction at 12 weeks after beginning of therapy with OPERA ® . Analysis of VAS data showed reduction in pain perceived by patients. According to NCI-CTC sensor and motor score, mISS scale and TNSc scale, both pain and both sensor and motor neuropathic impairment decreased after 12 weeks of treatments. Treatment with OPERA supplement was well tolerated; no increase in the toxicity profile of any of the therapeutic regimen that the patients were undergoing was reported. OPERA ® was able to improve CIPN symptoms in a prospective series of patients treated with neurotoxic chemotherapy, with no significant toxicity or interaction. Prospective RCT in a selected patients' population is warranted to confirm its promising activity.

  20. Cell culture compositions

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

    2014-03-18

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

Top