Sample records for encoding lipoic acid

  1. Lipoic Acid Synthase (LASY)

    PubMed Central

    Padmalayam, Indira; Hasham, Sumera; Saxena, Uday; Pillarisetti, Sivaram


    OBJECTIVE—Lipoic acid synthase (LASY) is the enzyme that is involved in the endogenous synthesis of lipoic acid, a potent mitochondrial antioxidant. The aim of this study was to study the role of LASY in type 2 diabetes. RESEARCH DESIGN AND METHODS—We studied expression of LASY in animal models of type 2 diabetes. We also looked at regulation of LASY in vitro under conditions that exist in diabetes. Additionally, we looked at effects of LASY knockdown on cellular antioxidant status, inflammation, mitochondrial function, and insulin-stimulated glucose uptake. RESULTS—LASY expression is significantly reduced in tissues from animal models of diabetes and obesity compared with age- and sex-matched controls. In vitro, LASY mRNA levels were decreased by the proinflammatory cytokine tumor necrosis factor (TNF)-α and high glucose. Downregulation of the LASY gene by RNA interference (RNAi) reduced endogenous levels of lipoic acid, and the activities of critical components of the antioxidant defense network, increasing oxidative stress. Treatment with exogenous lipoic acid compensated for some of these defects. RNAi-mediated downregulation of LASY induced a significant loss of mitochondrial membrane potential and decreased insulin-stimulated glucose uptake in skeletal muscle cells. In endothelial cells, downregulation of LASY aggravated the inflammatory response that manifested as an increase in both basal and TNF-α–induced expression of the proinflammatory cytokine, monocyte chemoattractant protein-1 (MCP-1). Overexpression of the LASY gene ameliorated the inflammatory response. CONCLUSIONS—Deficiency of LASY results in an overall disturbance in the antioxidant defense network, leading to increased inflammation, insulin resistance, and mitochondrial dysfunction. PMID:19074983

  2. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail


    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  3. Chlamydia trachomatis Serovar L2 Can Utilize Exogenous Lipoic Acid through the Action of the Lipoic Acid Ligase LplA1▿

    PubMed Central

    Ramaswamy, Aishwarya V.; Maurelli, Anthony T.


    Lipoic acid is an essential protein bound cofactor that is vital for the functioning of several important enzymes involved in central metabolism. Genomes of all sequenced chlamydiae show the presence of two genes encoding lipoic acid ligases and one gene encoding a lipoate synthase. However, the roles of these proteins in lipoic acid utilization or biosynthesis have not yet been characterized. The two distinct lipoic acid ligases in Chlamydia trachomatis serovar L2, LplA1Ct and LplA2Ct (encoded by the open reading frames ctl0537 and ctl0761) display moderate identity with Escherichia coli LplA (30 and 27%, respectively) but possess amino acid sequence motifs that are well conserved among all lipoyl protein ligases. The putative lipoic acid synthase LipACt, encoded by ctl0815, is ca. 43% identical to the E. coli LipA homolog. We demonstrate here the presence of lipoylated proteins in C. trachomatis serovar L2 and show that the lipoic acid ligase LplA1Ct is capable of utilizing exogenous lipoic acid for the lipoylation Therefore, host-derived lipoic acid may be important for intracellular growth and development. Based on genetic complementation in a surrogate host, our study also suggests that the C. trachomatis serovar L2 LipA homolog may not be functional in vivo. PMID:20870766

  4. Lipoic Acid Metabolism in Microbial Pathogens

    PubMed Central

    Spalding, Maroya D.; Prigge, Sean T.


    Summary: Lipoic acid [(R)-5-(1,2-dithiolan-3-yl)pentanoic acid] is an enzyme cofactor required for intermediate metabolism in free-living cells. Lipoic acid was discovered nearly 60 years ago and was shown to be covalently attached to proteins in several multicomponent dehydrogenases. Cells can acquire lipoate (the deprotonated charge form of lipoic acid that dominates at physiological pH) through either scavenging or de novo synthesis. Microbial pathogens implement these basic lipoylation strategies with a surprising variety of adaptations which can affect pathogenesis and virulence. Similarly, lipoylated proteins are responsible for effects beyond their classical roles in catalysis. These include roles in oxidative defense, bacterial sporulation, and gene expression. This review surveys the role of lipoate metabolism in bacterial, fungal, and protozoan pathogens and how these organisms have employed this metabolism to adapt to niche environments. PMID:20508247

  5. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  6. A new regulatory mechanism for bacterial lipoic acid synthesis.


    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  7. Nanoencapsulation improves the in vitro antioxidant activity of lipoic acid.


    Külkamp, Irene C; Rabelo, Bruna D; Berlitz, Simone J; Isoppo, Mateus; Bianchin, Mariana D; Schaffazick, Scheila R; Pohlmann, Adriana R; Guterres, Sílvia S


    Lipoic acid is a widely studied substance, whose therapeutic effects are related to its antioxidant activity. Our objective was to develop lipoic acid-loaded lipid-core nanocapsules and evaluate their in vitro antioxidant effect against lipid peroxidation induced by ascorbyl free radicals, using soybean lecithin liposomes as the substrate. The nanocapsule suspensions were prepared by interfacial deposition of poly(epsilon-caprolactone) and characterized by particle size and polydispersion index (photon correlation spectroscopy), zeta potencial (eletrophoretic mobility), drug content and encapsulation efficiency (HPLC). The extent of lipid peroxidation was determined (TBARS). The nanostrucutures presented mean diameters of between 191 and 349 nm, zeta potential values from -14.1 +/- 4.5 to -10.4 +/- 0.6, and high lipoic acid encapsulation. A significant increase in the antioxidant activity of lipoic acid was achieved through nanoencapsulation or by increasing its concentration in the formulation. The protection results ranged from 48.9 +/- 3.4 to 57.4 +/- 9.1% for lipoic acid-loaded lipid-core nanocapsules. The lipoic acid release from nanostrucutures significantly decreased with increasing polymer concentration. Also, it was observed an increasing in the antioxidant activity as the lipoic acid release time decreased. The co-encapsulation of lipoic acid with melatonin in lipid-core nanocapsules did not improve the protection against lipid peroxidation. The results obtained demonstrate the optimal concentrations of polymer and lipoic acid in the formulations in terms of enhancing the antioxidant activity. Furthermore, by the strategy applied, it was verified that nanoencapsulation is an efficient alternative to increase the antioxidant effect of lipoic acid, representing a potential approach for therapeutic applications.

  8. Antioxidant capacity and stability of liposomes containing a triglyceride derivative of lipoic acid

    USDA-ARS?s Scientific Manuscript database

    The multi-functional nutritional agent lipoic acid offers numerous beneficial effects to oxidatively stressed tissues. Lipoic acid was enzymatically incorporated into a triglyceride in conjunction with oleic acid, creating lipoyl dioleoylglycerol, and then chemically reduced to form dihydrolipoyl d...

  9. Effect of alpha lipoic acid on leukotriene A4 hydrolase.


    Torres, María José; Fierro, Angélica; Pessoa-Mahana, C David; Romero-Parra, Javier; Cabrera, Gonzalo; Faúndez, Mario


    Leukotriene A4 hydrolase is a soluble enzyme with epoxide hydrolase and aminopeptidase activities catalysing the conversion of leukotriene A4 to leukotriene B4 and the hydrolysis of the peptide proline-glycine-proline. Imbalances in leukotriene B4 synthesis are related to several pathologic conditions. Currently there are no available drugs capable to modulate the synthesis of leukotriene B4 or to block its receptors. Here we show the inhibitory profile of alpha lipoic acid on the activity of leukotriene A4 Hydrolase. Alpha lipoic acid inhibited both activities of the enzyme at concentrations lower than 10μM. The 5-lipoxygenase inhibitor zileuton, or the 5-lipoxygenase activating protein inhibitor MK-886, were unable to inhibit the activity of the enzyme. Acute promyelocytic leukaemia HL-60 cells were differentiated to leukotriene A4 hydrolase expressing neutrophil-like cells. Alpha lipoic acid inhibited the aminopeptidase activity of the cytosolic fraction from neutrophil-like cells but had no effect on the cytosolic fraction from undifferentiated cells. Docking and molecular dynamic approximations revealed that alpha lipoic acid participates in electrostatic interactions with K-565 and R-563, which are key residues for the carboxylate group recognition of endogenous substrates by the enzyme. Alpha lipoic acid is a compound widely used in clinical practice, most of its therapeutic effects are associated with its antioxidants properties, however, antioxidant effect alone is unable to explain all clinical effects observed with alpha lipoic acid. Our results invite to evaluate the significance of the inhibitory effect of alpha lipoic acid on the catalytic activity of leukotriene A4 hydrolase using in vivo models.

  10. Effects of lipoic acid in hexacarbon-induced neuropathy.


    Altenkirch, H; Stoltenburg-Didinger, G; Wagner, H M; Herrmann, J; Walter, G


    The effects of lipoic acid on hexacarbon neurotoxicity in rats were investigated. Rats were exposed by inhalation to n-hexane for 24 hours/day, 7 days/week, up to a total period of 9 weeks. Eight animals were exposed to 700 ppm n-hexane only, and eight animals were exposed to 700 ppm n-hexane and additionally received 100 mumol/kg lipoic acid PO daily. Clinical status of the animals was evaluated by examination of general condition, motor performance tests and neurophysiological measurements of caudal nerve motor conduction velocity. Results showed that animals exposed to 700 ppm n-hexane developed severe motor neuropathy leading to paralysis by the 6th week. Motor distal latencies of these animals were severely prolonged. In contrast, in animals treated with lipoic acid the onset of motor neuropathy was delayed for approximately 3 weeks as could be demonstrated by motor performance tests and measurements of motor distal latencies.

  11. A Novel Two-Gene Requirement for the Octanoyltransfer Reaction of Bacillus subtilis Lipoic Acid Biosynthesis

    PubMed Central

    Martin, Natalia; Christensen, Quin H.; Mansilla, María C.; Cronan, John E.; de Mendoza, Diego


    SUMMARY The Bacillus subtilis genome encodes three apparent lipoyl ligase homologues: yhfJ, yqhM, and ywfL which we have renamed lplJ, lipM and lipL, respectively. We show that LplJ encodes the sole lipoyl ligase of this bacterium. Physiological and biochemical characterization of a ΔlipM strain showed that LipM is absolutely required for the endogenous lipoylation of all lipoate-dependent proteins, confirming its role as the B. subtilis octanoyltransferase. However, we also report that in contrast to E. coli, B. subtilis requires a third protein for lipoic acid assembly, LipL. B. subtilis ΔlipL strains are unable to synthesize lipoic acid despite the presence of LipM and the sulfur insertion enzyme, LipA, which should suffice for lipoic acid biosynthesis based on the E. coli model. LipM is only required for the endogenous lipoylation pathway, whereas LipL also plays a role in lipoic acid scavenging. Expression of E. coli lipB allows growth of B. subtilis ΔlipL or ΔlipM strains in the absence of supplements. In contrast, growth of an E. coli ΔlipB strain can be complemented with lipM, but not lipL. These data together with those of the companion paper (Christensen et al., 2011) provide evidence that LipM and LipL catalyze sequential reactions in a novel pathway for lipoic acid biosynthesis. PMID:21338420

  12. [Pharmacological significance of alpha lipoic acid in up to date treatment of diabetic neuropathy].


    Becić, Fahir; Kapić, Elvedina; Rakanović-Todić, Maida


    Alpha lipoic acid is important intramolecular redox system. It is coenzyme of piruvate dehydrogenase and ketoglutarate dehydrogenase. Alpha lipoic acid has enzymatic and cytoprotective effect. It has key role in citric acid cycle, as a coenzyme. Therapeutic efficacy of alpha lipoic acid in diabetic neuropathy is based on reaction with free radicals and lipophylic antioxydans properties. Clinical studies results showed efficacy and safety of alpha liponic acid application in patients with diabetic neuropathy.

  13. Nonlinear Optical Properties of Au-Nanoparticles Conjugated with Lipoic Acid in Water

    NASA Astrophysics Data System (ADS)

    Trejo-Durán, M.; Cornejo-Monroy, D.; Alvarado-Méndez, E.; Olivares-Vargas, A.; Castano, V. M.


    Gold nanoparticles were chemically conjugated with lipoic acid to control their optical properties. Z-scan and other optical techniques were used to characterize the non-linear behavior of the resulting nanostructured materials. The results show that the nonlinearity is of thermal origin, which can be controlled by the use of lipoic acid as well as other organic molecules conjugated onto metal nanoparticles. In particular, the presence of lipoic acid increases n_2 and dn/dT.

  14. Comparison of antioxidant effectiveness of lipoic acid and dihydrolipoic acid.


    Zhao, Feng; Liu, Zai-Qun


    The abilities of dihydrolipoic acid (DHLA) to scavenge peroxynitrite (ONOO(-) ), galvinoxyl radical, 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonate) cation radical (ABTS(+•) ), and 2,2'-diphenyl-1-picrylhydrazyl radical (DPPH) were higher than those of lipoic acid (LA). The effectiveness of DHLA to protect methyl linoleate against 2,2'-azobis(2-amidinopropane hydrochloride) (AAPH)-induced oxidation was about 2.2-fold higher than that of LA, and DHLA can retard the autoxidation of linoleic acid (LH) in the β-carotene-bleaching test. DHLA can also trap ∼0.6 radicals in AAPH-induced oxidation of LH. Moreover, DHLA can scavenge ∼2.0 radicals in AAPH-induced oxidation of DNA and AAPH-induced hemolysis of erythrocytes, whereas LA can scavenge ∼1.5 radicals at the same experimental conditions. DHLA can protect erythrocytes against hemin-induced hemolysis, but accelerate the degradation of DNA in the presence of Cu(2+) . Therefore, the antioxidant capacity of -SH in DHLA is higher than S-S in LA. Copyright © 2010 Wiley Periodicals, Inc.

  15. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.


    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  16. Multisite clickable modification of proteins using lipoic acid ligase.


    Plaks, Joseph G; Falatach, Rebecca; Kastantin, Mark; Berberich, Jason A; Kaar, Joel L


    Approaches that allow bioorthogonal and, in turn, site-specific chemical modification of proteins present considerable opportunities for modulating protein activity and stability. However, the development of such approaches that enable site-selective modification of proteins at multiple positions, including internal sites within a protein, has remained elusive. To overcome this void, we have developed an enzymatic approach for multisite clickable modification based on the incorporation of azide moieties in proteins using lipoic acid ligase (LplA). The ligation of azide moieties to the model protein, green fluorescent protein (GFP), at the N-terminus and two internal sites using lipoic acid ligase was shown to proceed efficiently with near-complete conversion. Modification of the ligated azide groups with poly(ethylene glycol) (PEG), α-d-mannopyranoside, and palmitic acid resulted in highly homogeneous populations of protein-polymer, protein-sugar, and protein-fatty acid conjugates. The homogeneity of the conjugates was confirmed by mass spectrometry (MALDI-TOF) and SDS-PAGE electrophoresis. In the case of PEG attachment, which involved the use of strain-promoted azide-alkyne click chemistry, the conjugation reaction resulted in highly homogeneous PEG-GFP conjugates in less than 30 min. As further demonstration of the utility of this approach, ligated GFP was also covalently immobilized on alkyne-terminated self-assembled monolayers. These results underscore the potential of this approach for, among other applications, site-specific multipoint protein PEGylation, glycosylation, fatty acid modification, and protein immobilization.

  17. Long-term physical and oxidative stability of liposomes containing glycerides of lipoic acid

    USDA-ARS?s Scientific Manuscript database

    The acyl glycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Accelerated storage testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phosp...

  18. Lipoic acid prevents steroid-induced osteonecrosis in rabbits.


    Lu, Bang-Bao; Li, Kang-Hua


    The objective of this study was to investigate in vivo effects of lipoic acid (LA) in preventing steroid-induced osteonecrosis and the possible pathway in a rabbit model. Sixty rabbits were divided into 2 groups: rabbits were intraperitoneally injected with LA aqueous solution at 36 mg/kg of body weight per day for 4 weeks in Group A and rabbits were injected with physiologic saline (PS) as a control in Group B. At 2 weeks after starting treatment, they were intramuscularly injected once with 20 mg/kg of methylprednisolone acetate (MPSL). The femora were histopathologically examined for the presence of osteonecrosis. The plasma levels of total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), glutathione (GSH), endothelin (ET) and malondialdehyde (MDA) were assayed at 2 weeks after the injection of MPSL. The incidence of osteonecrosis was significantly higher in Group B (73.1%) than in Group A (20.8%). The GSH level was higher in Group A than in Group B after the LA injection. The plasma MDA and ET levels were lower in Group A than in Group B at 2 weeks after the MPSL administration. Lipoic acid can prevent the development of steroid-induced osteonecrosis in rabbits. Inhibited oxidative stress and amendment of vascular endothelial dysfunction is a possible mechanism for this effect.

  19. Effects of two antioxidants; α-lipoic acid and fisetin against diabetic cataract in mice.


    Kan, Emrah; Kiliçkan, Elif; Ayar, Ahmet; Çolak, Ramis


    The purpose of this study was to determine whether α-lipoic acid and fisetin have protective effects against cataract in a streptozotocin-induced experimental cataract model. Twenty-eight male BALB/C mice were made diabetic by the intraperitoneal administration of streptozotocin (200 mg/kg). Three weeks after induction of diabetes, mice were divided randomly into 4 groups in which each group contained 7 mice; fisetin-treated group (group 1), α-lipoic acid-treated group (group 2), fisetin placebo group (group 3), α-lipoic acid placebo group (group 4). Fisetin and α-lipoic acid were administered intraperitoneally weekly for 5 weeks. Cataract development was assessed at the end of 8 weeks by slit lamp examination, and cataract formation was graded using a scale. All groups developed at least grade 1 cataract formation. In the fisetin-treated group, the cataract stages were significantly lower than in the placebo group (p = 0.02). In the α-lipoic acid-treated group, the cataract stages were lower than in the placebo group but it did not reach to a significant value. Both fisetin and α-lipoic acid had a protective effect on cataract development in a streptozotocin-induced experimental cataract model. The protective effect of fisetin appears as though more effective than α-lipoic acid.

  20. Effect of lipoic acid combined with paclitaxel on breast cancer cells.


    Li, B J; Hao, X Y; Ren, G H; Gong, Y


    Breast cancer is the most common gynecologic tumor globally that threatens women's health. Lipoic acid is a type of antioxidant that can alleviate oxidative stress damage. Studies showed that lipoic acid could inhibit the proliferation of tumor cells in cervical cancer and colon cancer. This paper intends to explore the combined effect of lipoic acid and paclitaxel on breast cancer cells. Breast cancer MCF-7 cells were divided into four groups: control group, lipoic acid group, paclitaxel group, and a combination group. MTT was applied to detect the drugs' influence on breast cancer cell proliferation. A colony formation test was used to determine the effects on breast cancer cell clone formation rate. Western blot was performed to detect the effects on nuclear factor (NF)-κB. Lipoic acid alone can inhibit tumor cell proliferation and clone formation with time dependence. Compared with the control, paclitaxel alone can significantly suppress tumor cell proliferation and clone formation (P < 0.05). Lipoic acid and paclitaxel in combination obviously strengthened their individual inhibitory effects on tumor cells (P < 0.05). Compared with the paclitaxel alone group, the combination group exhibited more remarkable inhibitory effect (P < 0.05). Lipoic acid alone or combined with paclitaxel can inhibit NF-κB expression and inhibit breast cancer cell proliferation.

  1. Alpha-lipoic acid prevents mitochondrial damage and neurotoxicity in experimental chemotherapy neuropathy.


    Melli, Giorgia; Taiana, Michela; Camozzi, Francesca; Triolo, Daniela; Podini, Paola; Quattrini, Angelo; Taroni, Franco; Lauria, Giuseppe


    The study investigates if alpha-lipoic acid is neuroprotective against chemotherapy induced neurotoxicity, if mitochondrial damage plays a critical role in toxic neurodegenerative cascade, and if neuroprotective effects of alpha-lipoic acid depend on mitochondria protection. We used an in vitro model of chemotherapy induced peripheral neuropathy that closely mimic the in vivo condition by exposing primary cultures of dorsal root ganglion (DRG) sensory neurons to paclitaxel and cisplatin, two widely used and highly effective chemotherapeutic drugs. This approach allowed investigating the efficacy of alpha-lipoic acid in preventing axonal damage and apoptosis and the function and ultrastructural morphology of mitochondria after exposure to toxic agents and alpha-lipoic acid. Our results demonstrate that both cisplatin and paclitaxel cause early mitochondrial impairment with loss of membrane potential and induction of autophagic vacuoles in neurons. Alpha-lipoic acid exerts neuroprotective effects against chemotherapy induced neurotoxicity in sensory neurons: it rescues the mitochondrial toxicity and induces the expression of frataxin, an essential mitochondrial protein with anti-oxidant and chaperone properties. In conclusion mitochondrial toxicity is an early common event both in paclitaxel and cisplatin induced neurotoxicity. Alpha-lipoic acid protects sensory neurons through its anti-oxidant and mitochondrial regulatory functions, possibly inducing the expression of frataxin. These findings suggest that alpha-lipoic acid might reduce the risk of developing peripheral nerve toxicity in patients undergoing chemotherapy and encourage further confirmatory clinical trials.

  2. Neuroprotective role of lipoic acid against acute toxicity of N-acetylaspartic acid.


    Pederzolli, Carolina Didonet; Rosa, Andrea Pereira; de Oliveira, Amanda Szekir; Coelho, Juliana G; Becker, Débora da Luz; Dalazen, Giovana Reche; Moraes, Tarsila Barros; Dutra-Filho, Carlos S


    N-Acetylaspartic acid (NAA) accumulates in Canavan disease, a severe inherited neurometabolic disorder clinically characterized by mental retardation, hypotonia, macrocephaly, and seizures. The mechanisms of brain damage in this disease remain poorly understood. Recent studies developed by our research group showed that NAA induces oxidative stress in vitro and in vivo in cerebral cortex of rats. Lipoic acid is considered as an efficient antioxidant which can easily cross the blood-brain barrier. Considering the absence of specific treatment to Canavan disease, this study evaluates the possible prevention of the oxidative stress promoted by NAA in vivo by the antioxidant lipoic acid to preliminarily evaluate lipoic acid efficacy against pro-oxidative effects of NAA. Fourteen-day-old Wistar rats received an acute administration of 0.6 mmol NAA/g body weight with or without lipoic acid (40 mg/kg body weight). Catalase (CAT), glutathione peroxidase (GPx), and glucose 6-phosphate dehydrogenase activities, hydrogen peroxide content, thiobarbituric acid-reactive substances (TBA-RS), spontaneous chemiluminescence, protein carbonyl content, total antioxidant potential, and DNA-protein cross-links were assayed in the cerebral cortex of rats. CAT, GPx activities, and total antioxidant potential were significantly reduced, while hydrogen peroxide content, TBA-RS, spontaneous chemiluminescence, and protein carbonyl content were significantly enhanced by acute administration of NAA. Those effects were all prevented by lipoic acid pretreatment. Our results clearly show that lipoic acid may protect against the oxidative stress promoted by NAA. This could represent a new therapeutic approach to the patients affected by Canavan disease.

  3. Pharmacokinetic study of lipoic acid in multiple sclerosis: comparing mice and human pharmacokinetic parameters.


    Yadav, Vijayshree; Marracci, Gail H; Munar, Myrna Y; Cherala, Ganesh; Stuber, Lauren E; Alvarez, Lilia; Shinto, Lynne; Koop, Dennis R; Bourdette, Dennis N


    Lipoic acid is a natural antioxidant available as an oral supplement from a number of different manufacturers. Lipoic acid administered subcutaneously is an effective therapy for murine experimental autoimmune encephalomyelitis, a model of multiple sclerosis. The aim of this study was to compare serum lipoic acid levels with oral dosing in patients with multiple sclerosis with serum levels in mice receiving subcutaneous doses of lipoic acid. We performed serum pharmacokinetic studies in patients with multiple sclerosis after a single oral dose of 1200 mg lipoic acid. Patients received one of the three different racemic formulations randomly: tablet (Formulation A) and capsules (Formulations B and C). Mice pharmacokinetic studies were performed with three different subcutaneous doses (20, 50 and 100 mg/kg racemic lipoic acid). The pharmacokinetic parameters included Maximum Serum Concentrations (C(max) in microg/ml) and area under the curve (0-infinity) (AUC ( 0-infinity) in microg*min/ml). We found mean C(max) and AUC (0-infinity) in patients with multiple sclerosis as follows: group A (N = 7) 3.8 +/- 2.6 and 443.1 +/- 283.9; group B (N = 8) 9.9 +/- 4.5 and 745.2 +/- 308.7 and group C (N = 8) 10.3 +/- 3.8 and 848.8 +/- 360.5, respectively. Mean C(max) and AUC (0-infinity) in the mice were: 100 mg/kg lipoic acid: 30.9 +/- 2.9 and 998 +/- 245; 50 mg/kg lipoic acid: 7.6 +/- 1.4 and 223 +/- 20; 20 mg/kg lipoic acid: 2.7 +/- 0.7 and 119 +/- 33. We conclude that patients taking 1200 mg of lipoic acid from two of the three oral formulations achieved serum C(max) and AUC levels comparable to that observed in mice receiving 50 mg/kg subcutaneous dose of lipoic acid, which is a highly therapeutic dose in experimental autoimmune encephalomyelitis. A dose of 1200 mg oral lipoic acid can achieve therapeutic serum levels in patients with multiple sclerosis.

  4. Overproduction of α-Lipoic Acid by Gene Manipulated Escherichia coli

    PubMed Central

    Sun, Yirong; Zhang, Wenbin; Ma, Jincheng; Pang, Hongshen; Wang, Haihong


    Alpha-lipoic acid (LA) is an important enzyme cofactor widely used by organisms and is also a natural antioxidant for the treatment of pathologies driven by low levels of endogenous antioxidants. In order to establish a safer and more efficient process for LA production, we developed a new biological method for LA synthesis based on the emerging knowledge of lipoic acid biosynthesis. We first cloned the lipD gene, which encodes the lipoyl domain of the E2 subunit of pyruvate dehydrogenase, allowing high levels of LipD production. Plasmids containing genes for the biosynthesis of LA were subsequently constructed utilizing various vectors and promotors to produce high levels of LA. These plasmids were transformed into the Escherichia coli strain BL21. Octanoic acid (OA) was used as the substrate for LA synthesis. One transformant, YS61, which carried lipD, lplA, and lipA, produced LA at levels over 200-fold greater than the wild-type strain, showing that LA could be produced efficiently in E. coli using genetic engineering methods. PMID:28068366

  5. Repurposing lipoic acid changes electron flow in two important metabolic pathways of Escherichia coli.


    Feeney, Morgan Anne; Veeravalli, Karthik; Boyd, Dana; Gon, Stéphanie; Faulkner, Melinda Jo; Georgiou, George; Beckwith, Jonathan


    In bacteria, cysteines of cytoplasmic proteins, including the essential enzyme ribonucleotide reductase (RNR), are maintained in the reduced state by the thioredoxin and glutathione/glutaredoxin pathways. An Escherichia coli mutant lacking both glutathione reductase and thioredoxin reductase cannot grow because RNR is disulfide bonded and nonfunctional. Here we report that suppressor mutations in the lpdA gene, which encodes the oxidative enzyme lipoamide dehydrogenase required for tricarboxylic acid (TCA) cycle functioning, restore growth to this redox-defective mutant. The suppressor mutations reduce LpdA activity, causing the accumulation of dihydrolipoamide, the reduced protein-bound form of lipoic acid. Dihydrolipoamide can then provide electrons for the reactivation of RNR through reduction of glutaredoxins. Dihydrolipoamide is oxidized in the process, restoring function to the TCA cycle. Thus, two electron transfer pathways are rewired to meet both oxidative and reductive needs of the cell: dihydrolipoamide functionally replaces glutathione, and the glutaredoxins replace LpdA. Both lipoic acid and glutaredoxins act in the reverse manner from their normal cellular functions. Bioinformatic analysis suggests that such activities may also function in other bacteria.

  6. Repurposing lipoic acid changes electron flow in two important metabolic pathways of Escherichia coli

    PubMed Central

    Feeney, Morgan Anne; Veeravalli, Karthik; Boyd, Dana; Gon, Stéphanie; Faulkner, Melinda Jo; Georgiou, George; Beckwith, Jonathan


    In bacteria, cysteines of cytoplasmic proteins, including the essential enzyme ribonucleotide reductase (RNR), are maintained in the reduced state by the thioredoxin and glutathione/glutaredoxin pathways. An Escherichia coli mutant lacking both glutathione reductase and thioredoxin reductase cannot grow because RNR is disulfide bonded and nonfunctional. Here we report that suppressor mutations in the lpdA gene, which encodes the oxidative enzyme lipoamide dehydrogenase required for tricarboxylic acid (TCA) cycle functioning, restore growth to this redox-defective mutant. The suppressor mutations reduce LpdA activity, causing the accumulation of dihydrolipoamide, the reduced protein-bound form of lipoic acid. Dihydrolipoamide can then provide electrons for the reactivation of RNR through reduction of glutaredoxins. Dihydrolipoamide is oxidized in the process, restoring function to the TCA cycle. Thus, two electron transfer pathways are rewired to meet both oxidative and reductive needs of the cell: dihydrolipoamide functionally replaces glutathione, and the glutaredoxins replace LpdA. Both lipoic acid and glutaredoxins act in the reverse manner from their normal cellular functions. Bioinformatic analysis suggests that such activities may also function in other bacteria. PMID:21521794

  7. Molecular mechanisms of lipoic acid modulation of T-type calcium channels in pain pathway

    PubMed Central

    Lee, Woo Yong; Orestes, Peihan; Latham, Janelle; Naik, Ajit K.; Nelson, Michael T.; Vitko, Iuliia; Perez-Reyes, Edward; Jevtovic-Todorovic, Vesna; Todorovic, Slobodan M.


    α-Lipoic acid (1,2-dithiolane-3-pentanoic acid; lipoic acid) is an endogenous compound used to treat pain disorders in humans, but its mechanisms of analgesic action are not well understood. Here we show that lipoic acid selectively inhibited native CaV3.2 T-type calcium currents (T-currents) and diminished T-channel-dependent cellular excitability in acutely isolated rat sensory neurons. Lipoic acid locally injected into peripheral receptive fields of pain-sensing sensory neurons (nociceptors) in vivo decreased sensitivity to noxious thermal and mechanical stimuli in wild-type but not CaV3.2 knockout mice. Ensuing molecular studies demonstrated that lipoic acid inhibited recombinant CaV3.2 channels heterologously expressed in human embryonic kidney 293 cells by oxidating specific thiol residues on the cytoplasmic face of the channel. This study provides the first mechanistic demonstration of a nociceptive ion channel modulation that may contribute to the documented analgesic properties of lipoic acid in vivo. PMID:19641113

  8. In vitro evaluation of α-lipoic acid-loaded lipid nanocapsules for topical delivery.


    Xia, Nan; Liu, Tian; Wang, Qiang; Xia, Qiang; Bian, Xiaoli


    This study aimed at in vitro evaluation of α-lipoic acid-loaded lipid nanocapsules for topical delivery, which was prepared by hot high-pressure homogenisation. Stable particles could be formed and particle size was 148.54 ± 2.31 nm with polydispersity index below 0.15. Encapsulation efficiency and drug loading of α-lipoic acid were 95.23 ± 0.45% and 2.81 ± 0.37%. Antioxidant study showed α-lipoic acid could be protected by lipid nanocapsules without loss of antioxidant activity. Sustained release of α-lipoic acid from lipid nanocapsules was obtained and cumulative release was 62.18 ± 1.51%. In vitro percutaneous study showed the amount of α-lipoic acid distributed in skin was 1.7-fold than permeated. Cytotoxicity assay and antioxidant activity on L929 cells indicated this formulation had low cytotoxicity and ability of protecting cells from oxidative damage within specific concentration. These studies suggested α-lipoic acid-loaded lipid nanocapsules could be potential formulation for topical delivery.

  9. Yeast display evolution of a kinetically efficient 13-amino acid substrate for lipoic acid ligase

    PubMed Central

    Puthenveetil, Sujiet; Liu, Daniel S.; White, Katharine A.; Thompson, Samuel; Ting, Alice Y.


    E. coli lipoic acid ligase (LplA) catalyzes ATP-dependent covalent ligation of lipoic acid onto specific lysine sidechains of three acceptor proteins involved in oxidative metabolism. Our lab has shown that LplA and engineered mutants can ligate useful small-molecule probes such as alkyl azides (Nat. Biotechnol. 2007, 25, 1483–1487) and photocrosslinkers (Angew. Chem Int. Ed Engl. 2008, 47, 7018–7021) in place of lipoic acid, facilitating imaging and proteomic studies. Both to further our understanding of lipoic acid metabolism, and to improve LplA’s utility as a biotechnological platform, we have engineered a novel 13-amino acid peptide substrate for LplA. LplA’s natural protein substrates have a conserved β-hairpin structure, a conformation that is difficult to recapitulate in a peptide, and thus we performed in vitro evolution to engineer the LplA peptide substrate, called “LplA Acceptor Peptide” (LAP). A ~107 library of LAP variants was displayed on the surface of yeast cells, labeled by LplA with either lipoic acid or bromoalkanoic acid, and the most efficiently labeled LAP clones were isolated by fluorescence activated cell sorting. Four rounds of evolution followed by additional rational mutagenesis produced a “LAP2” sequence with a kcat/Km of 0.99 μM−1min−1, >70-fold better than our previous rationally-designed 22-amino acid LAP1 sequence (Nat. Biotechnol. 2007, 25, 1483–1487), and only 8-fold worse than the kcat/Km values of natural lipoate and biotin acceptor proteins. The kinetic improvement over LAP1 allowed us to rapidly label cell surface peptide-fused receptors with quantum dots. PMID:19863063

  10. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis


    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

  11. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid

    PubMed Central

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna


    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1–10 μmol L−1. Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5–50 μmol L−1. Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  12. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid.


    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna


    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1-10 μmol L(-1). Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5-50 μmol L(-1). Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value.

  13. Protective effect of α-lipoic acid against α-cypermethrin-induced changes in rat cerebellum.


    Elsawy, H; Al-Omair, M A; Sedky, A; Al-Otaibi, L


    Alfa cypermethrin is a pyrethroids extensively used as ectoparasiticide in domestic animals, insecticidal spray on cotton, vegetables and other crops and to kill cockroaches, fleas and termites in house and other buildings. Previous studies have shown the adverse effect of α -cypermethrin on brain. This study was planned to evaluate the possible role of α-lipoic acid in α -cypermethrin induced toxicity in brain of male albino rats. Rats were divided into four groups. The control, α-cypermethrin, α-lipoic acid and α -cypermethrin plus α-lipoic acid treated groups. The duration of the experiment was four weeks. Our results showed that the administration of α-cypermethrin caused a significant decreased in γ- aminobutyric acid level, acetylcholinesterase, catalase, superoxide dismutase activities and increase in lipid peroxidation in cerebellum. Furthermore, the co-administration of α-lipoic acid mitigates the toxicity of α-cypermethrin by partially normalizing the biochemical parameters. The biochemical observations were supported by histopathological examinations. The findings of this investigation suggest that α-lipoic acid may play a protective role against α-cypermethrin induced toxicity in cerebellum of treated rats. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Synthesis of new lipoic acid conjugates and evaluation of their free radical scavenging and neuroprotective activities.


    Bolognesi, Maria Laura; Bergamini, Christian; Fato, Romana; Oiry, Joël; Vasseur, Jean-Jacques; Smietana, Michael


    A series of new lipoic acid derivatives were designed and synthesized as multitarget ligands against Alzheimer's disease. In particular, analogues combining both lipoic acid and cysteine core structures were synthesized. The antioxidant properties of these compounds were evaluated by 1,1-diphenyl-2-picrylhydrazyl (DPPH), 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS(•+) ) radical cation scavenging assays and ferrous ion chelation. The antioxidant potential of the synthesized compounds was also evaluated in a cellular context and compared to α-lipoic acid and its reduced form, dihydrolipoic acid. The antioxidant effects observed for these compounds in vitro confirmed the importance of free thiol functions for effective antioxidant capacities. However, these promising in vitro results were not mirrored by the antioxidant activity in T67 cell line. This suggests that multiple factors are at stake and warrant further investigations.

  15. A Study of the Antioxidant Effect of Alpha Lipoic Acids on Sperm Quality

    PubMed Central

    Ibrahim, Siti Fatimah; Osman, Khairul; Das, Srijit; Othman, Abas Mazni; Majid, Norzaiti Abdul; Rahman, Mohd Padzil Abdul


    OBJECTIVE Assisted reproductive techniques are useful in helping infertile couples achieve successful conception. Initial studies have shown that sperm cryopreservation, one step in assisted reproduction, causes a dramatic reduction in sperm quality. This has been attributed to, among other things, free radical activities. The aim of the present study was to minimize this oxidative attack by adding an antioxidant into the sperm microenvironment. Alpha lipoic acids were selected for this purpose for their efficient free radical scavenging properties and solubility in lipid and aqueous phases. METHODS For this investigation, semen from six Boer bucks was pooled. Seminal analysis of the baseline prior to incubation of samples with different concentrations of Alpha lipoic acids (0.00625, 0.0125, 0.025, 0.05, 0.1 mmol/ml) was performed, and post-seminal analysis was conducted after a one-hour incubation. The comet assay was used to observe the effect of Alpha lipoic acids on sperm DNA integrity. Statistical analysis using an unpaired t-test with a significance level of p<0.05 was then performed. RESULTS Our results indicate that the sperm motility rate was improved after incubation with Alpha lipoic acids at a concentration of 0.02 mmol/ml. This concentration was also capable of reducing DNA damage. CONCLUSION In conclusion, Alpha lipoic acids renders cryoprotection to sperm, thereby improving sperm quality. PMID:18719769

  16. Alpha-Lipoic Acid Supplementation Protects Enzymes from Damage by Nitrosative and Oxidative Stress

    PubMed Central

    Hiller, Sylvia; DeKroon, Robert; Hamlett, Eric D.; Xu, Longquan; Osorio, Cristina; Robinette, Jennifer; Winnik, Witold; Simington, Stephen; Maeda, Nobuyo; Alzate, Oscar; Yi, Xianwen


    Background S-nitrosylation of mitochondrial enzymes involved in energy transfer under nitrosative stress may result in ATP deficiency. We investigated whether α-lipoic acid, a powerful antioxidant, could alleviate nitrosative stress by regulating S-nitrosylation, which could result in retaining the mitochondrial enzyme activity. Methods In this study, we have identified the S-nitrosylated forms of subunit 1 of dihydrolipoyllysine succinyltransferase (complex III), and subunit 2 of the α-ketoglutarate dehydrogenase complex by implementing a fluorescence-based differential quantitative proteomics method. Results We found that the activities of these two mitochondrial enzymes were partially but reversibly inhibited by S-nitrosylation in cultured endothelial cells, and that their activities were partially restored by supplementation of α-lipoic acid. We show that protein S-nitrosylation affects the activity of mitochondrial enzymes that are central to energy supply, and that α-lipoic acid protects mitochondrial enzymes by altering S-nitrosylation levels. Conclusions Inhibiting protein S-nitrosylation with α-lipoic acid seems to be a protective mechanism against nitrosative stress. General significance Identification and characterization of these new protein targets should contribute to expanding the therapeutic power of α-lipoic acid and to a better understanding of the underlying antioxidant mechanisms. PMID:26344063

  17. Peripheral neuropathy in obstetrics: efficacy and safety of α-lipoic acid supplementation.


    Costantino, M; Guaraldi, C; Costantino, D; De Grazia, S; Unfer, V


    Neuropathic pain during pregnancy is a common condition due to the physical changes and compression around pregnancy and childbirth that make pregnant women more prone to develop several medical conditions such as carpal tunnel syndrome, sciatica, meralgia paraesthetica and other nerve entrapment syndromes. Most of the treatments usually performed to counteract neuropathic pain are contraindicated in pregnancy so that, the management of these highly invalidating conditions remains an issue in the clinical practice. We aimed to review the efficacy and safety of alpha lipoic acid supplementation in the treatment of neuropathic pain. Lipoic acid is a co-factor essential in the regulation of mitochondrial energy. It has been demonstrated that lipoic acid supplementation is involved in several biochemical processes and actions, exerting important antioxidant and anti-inflammatory activity and significantly improving pain and paraesthesia in patients with sciatica, carpal tunnel syndrome and diabetic neuropathy. Efficacy of lipoic acid is combined with a high safety profile, making this molecule a novel candidate for the management of several diseases. Data reported so far are promising and dietary supplementation with lipoic acid seems a useful tool to contrast neuropathic pain during pregnancy.

  18. Lipoic Acid Synthetase Deficiency Causes Neonatal-Onset Epilepsy, Defective Mitochondrial Energy Metabolism, and Glycine Elevation

    PubMed Central

    Mayr, Johannes A.; Zimmermann, Franz A.; Fauth, Christine; Bergheim, Christa; Meierhofer, David; Radmayr, Doris; Zschocke, Johannes; Koch, Johannes; Sperl, Wolfgang


    Lipoic acid is an essential prosthetic group of four mitochondrial enzymes involved in the oxidative decarboxylation of pyruvate, α-ketoglutarate, and branched chain amino acids and in the glycine cleavage. Lipoic acid is synthesized stepwise within mitochondria through a process that includes lipoic acid synthetase. We identified the homozygous mutation c.746G>A (p.Arg249His) in LIAS in an individual with neonatal-onset epilepsy, muscular hypotonia, lactic acidosis, and elevated glycine concentration in plasma and urine. Investigation of the mitochondrial energy metabolism showed reduced oxidation of pyruvate and decreased pyruvate dehydrogenase complex activity. A pronounced reduction of the prosthetic group lipoamide was found in lipoylated proteins. PMID:22152680

  19. [Safety and structural analysis of polymers produced in manufacturing process of alpha-lipoic acid].


    Shimoda, Hiroshi; Tanaka, Junji; Seki, Azusa; Honda, Haruya; Akaogi, Seiichiro; Komatsubara, Hirobumi; Suzuki, Nobuo; Kameyama, Mayumi; Tamura, Satoru; Murakami, Nobutoshi


    Alpha-Lipoic acid has recently been permitted for use in foodstuffs and is contained in tablets and capsules. Although alpha-lipoic acid is synthesized from adipic acid, the safety of polymers produced during the purification and drying processes has been an issue of concern. Hence, we examined the safety profiles of thermally denatured polymer (LAP-A) and ethanol-denatured polymer (LAP-B) produced in the manufacturing process of alpha-lipoic acid. Furthermore, we conducted structural analysis of these polymers by 1H-NMR and FAB-MS spectroscopy. In a consecutive ingestion test, male and female mice ingested diet containing 0.1 and 0.2% LAP-A and -B for 4 weeks. Blood uric acid, potassium and lactate dehydrogenase (LDH) tended to increase without dose-dependency. Relative liver weights were also increased. However, male dogs that were orally administered LAP-B (500 mg/kg) once did not show any abnormalities in blood parameters or general condition. These findings indicate that alpha-lipoic acid polymers are not acutely toxic; however, chronic ingestion of these polymers may affect liver and kidney functions.

  20. Wheat germ oil and α-lipoic acid predominantly improve the lipid profile of broiler meat.


    Arshad, Muhammad Sajid; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Shahid, Muhammad


    In response to recent assertions that synthetic antioxidants may have the potential to cause toxic effects and to consumers' increased attention to consuming natural products, the poultry industry has been seeking sources of natural antioxidants, alone or in combination with synthetic antioxidants that are currently being used by the industry. The present study was conducted to determine the effect of α-lipoic acid, α-tocopherol, and wheat germ oil on the status of antioxidant enzymes, fatty acid profile, and serum biochemical profile of broiler blood. One-day-old (180) broiler birds were fed six different feeds varying in their antioxidant content: no addition (T1), natural α-tocopherol (wheat germ oil, T2), synthetic α-tocopherol (T3), α-lipoic acid (T4), α-lipoic acid together with natural α-tocopherol (T5), and α-lipoic acid together with synthetic α-tocopherol (T6). The composition of saturated and unsaturated fatty acids in the breast and leg meat was positively influenced by the different dietary supplements. The content of fatty acid was significantly greater in broilers receiving T2 both in breast (23.92%) and in leg (25.82%) meat, whereas lower fatty acid levels was found in broilers receiving diets containing T6 in the breast (19.57%) and leg (21.30%) meat. Serum total cholesterol (113.42 mg/dL) and triglycerides (52.29 mg/dL) were lowest in the group given natural α-tocopherol and α-lipoic acid. Wheat germ oil containing natural α-tocopherol alone or with α-lipoic acid was more effective than synthetic α-tocopherol in raising levels of antioxidant enzymes superoxide dismutase, catalase, and glutathione reductase while lowering plasma total cholesterol, low-density lipoprotein, and triglycerides and raising high-density lipoprotein and plasma protein significantly. It was concluded that the combination of wheat germ oil and α-lipoic acid is helpful in improving the lipid profile of broilers.

  1. [α-Lipoic acid as the main pharmacological drug for in- and outpatient treatment of diabetic polyneuropathy].


    Strokov, I A; Phokina, A S


    α-Lipoic acid, or thioctic acid, (ALA) is the most applicable pharmacological drug for treatment of diabetic polyneuropathy. The article explores the results of experimental studies on the α-lipoic acid effect on mechanisms of peripheral nerves affection in hyperglycemia as well as the data of numerous randomized controlled trials and meta-analyses on studying ALA efficacy in symptomatic diabetic polyneuropathy. It has been shown that amelioration of patients with diabetic polyneuropathy is observed both for ALA infusions and tableted form of the drug. The authors conclude that α-lipoic acid is a drug for treatment of pathogenetic development mechanisms of diabetic polyneuropathy with the best proven efficacy.

  2. A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development

    PubMed Central

    Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David


    SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300

  3. Anti-inflammatory and anti-oxidative effects of alpha-lipoic acid in experimentally induced acute otitis media.


    Tatar, A; Korkmaz, M; Yayla, M; Gozeler, M S; Mutlu, V; Halici, Z; Uslu, H; Korkmaz, H; Selli, J


    To investigate the anti-inflammatory, anti-oxidative and tissue protective effects, as well as the potential therapeutic role, of alpha-lipoic acid in experimentally induced acute otitis media. Twenty-five guinea pigs were assigned to one of five groups: a control (non-otitis) group, and otitis-induced groups treated with saline, penicillin G, alpha-lipoic acid, or alpha-lipoic acid plus penicillin G. Tissue samples were histologically analysed, and oxidative parameters in tissue samples were measured and compared between groups. The epithelial integrity was better preserved, and histological signs of inflammation and secretory metaplasia were decreased, in all groups compared to the saline treated otitis group. In the alpha-lipoic acid plus penicillin G treated otitis group, epithelial integrity was well preserved and histological findings of inflammation were significantly decreased compared to the saline, penicillin G and alpha-lipoic acid treated otitis groups. The most favourable oxidative parameters were observed in the control group, followed by the alpha-lipoic acid plus penicillin G treated otitis group. Alpha-lipoic acid, with its antioxidant, anti-inflammatory and tissue protective properties, may decrease the clinical sequelae and morbidity associated with acute otitis media.

  4. Alpha-lipoic acid reduces body weight and regulates triglycerides in obese patients with diabetes mellitus.


    Okanović, Azra; Prnjavorac, Besim; Jusufović, Edin; Sejdinović, Rifat


    To determine an influence of alpha-lipoic acid to reduction of body weight and regulation of total cholesterol concentration, triglycerides and glucose serum levels in obese patients with diabetes mellitus type 2. A prospective study includes two groups of obese patients with diabetes mellitus and signs of peripheral polyneuropathia: examined group (30 patients; 15 females and 15 males), and control group (30 patients; 12 females and 18 males). All were treated with metformin (850-1700 mg/day). Examined patients were additionally treated with alpha-lipoic acid 600 mg/day during 20 weeks. Body mass index and concentrations of total cholesterol, triglycerides and glucose in serum were compared before and after the treatment. The group treated with 600 mg alpha-lipoic acid lost significantly more weight, and had lower triglyceride level than the control group. There were no significant differences in total cholesterol and glucose serum levels between the groups. Alpha-lipoic acid of 600 mg/day treatment have influenced weight and triglycerides loss in obese patients with diabetes mellitus type 2. It should be considered as an important additive therapy in obese patients with diabetes mellitus type 2. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  5. Alpha lipoic acid attenuates high-fructose-induced pancreatic toxicity.


    Topsakal, Senay; Ozmen, Ozlem; Cankara, Fatma Nihan; Yesilot, Sukriye; Bayram, Dilek; Genç Özdamar, Nilüfer; Kayan, Sümeyra


    Chronic consumption of high-fructose corn syrup (HFCS) causes several problems such as insulin resistance. The goal of the study was to investigate pancreatic damage induced by chronic HFCS consumption and the protective effects of alpha lipoic acid (ALA) on pancreatic cells. Wistar Albino, 4-month-old, female rats weighing 250-300 g were randomly distributed into three groups, each containing eight rats. The study included an HFCS group, an HFCS + ALA-administered group and a control group (CON). The prepared 30% solution of HFCS (F30) (24% fructose, 28% dextrose) was added to the drinking water for 10 weeks. ALA treatment was begun 4 weeks after the first HFCS administration (100 mg/kg/oral, last 6 weeks). Rats were anaesthetised and euthanised by cervical dislocation 24 h after the last ALA administration. Blood samples for biochemical tests (amylase, lipase, malondialdehyde (MDA) and catalase (CAT)) and tissue samples for histopathological and immunohistochemical examinations (caspase-3, insulin and glucagon) were collected. Comparing the control and HFCS groups, serum glucose (150.92 ± 39.77 and 236.50 ± 18.28, respectively, p < 0.05), amylase (2165.00 ± 150.76 and 3027.66 ± 729.19, respectively, p < 0.01), lipase (5.58 ± 2.22 and 11.51 ± 2.74, respectively, p < 0.01) and pancreatic tissue MDA (0.0167 ± 0.004 and 0.0193 ± 0.006, respectively, p < 0.05) levels were increased, whereas tissue CAT (0.0924 ± 0.029 and 0.0359 ± 0.023, respectively, p < 0.05) activity decreased in the HFCS group significantly. Histopathological examination revealed degenerative and necrotic changes in Langerhans islet cells and slight inflammatory cell infiltration in pancreatic tissue in the HFCS group. Immunohistochemically there was a significant decrease in insulin (2.85 ± 0.37 and 0.87 ± 0.64, respectively, p < 0.001) and glucagon (2.71 ± 0.48 and 1.00 ± 0.75, respectively, p < 0.001) secreting cell scores, whereas a

  6. Radiation-induced cognitive dysfunction and cerebellar oxidative stress in mice: protective effect of alpha-lipoic acid.


    Manda, Kailash; Ueno, Megumi; Moritake, Takashi; Anzai, Kazunori


    Reactive oxygen species are implicated in neurodegeneration and cognitive disorders due to higher vulnerability of neuronal tissues. The cerebellum is recently reported to be involved in cognitive function. Therefore, present study aimed at investigating the role alpha-lipoic acid against radiation-induced oxidative stress and antioxidant status in cerebellum and its correlation with cognitive dysfunction. We observed spontaneous motor activities and spatial memory task of mice using pyroelectric infrared sensor and programmed video tracking system, respectively. Whole body X-irradiation (6 Gy) of mice substantially impaired the reference memory and motor activities of mice. However, acute intraperitoneal treatment of mice with alpha-lipoic acid prior to irradiation significantly attenuated such cognitive dysfunction. Alpha-lipoic acid pretreatment exerted a very high magnitude of protection against radiation-induced augmentation of protein carbonyls and thiobarbituric acid reactive substance (TBARS) in mice cerebellum. Further, radiation-induced deficit of total, nonprotein and protein-bound sulfhydryl (T-SH, NP-SH, PB-SH) contents of cerebellum and plasma ferric reducing power (FRAP) was also inhibited by alpha-lipoic acid pre-treatment. Moreover, alpha-lipoic acid treated mice showed an intact cytoarchitecture of cerebellum, higher counts of intact Purkinje cells and granular cells in comparison to untreated irradiated mice. Results clearly indicate that alpha-lipoic acid is potent neuroprotective antioxidant.

  7. Anti-apoptotic and neuroprotective effects of α-lipoic acid on spinal cord ischemia-reperfusion injury in rabbits.


    Emmez, Hakan; Yildirim, Zuhal; Kale, Aydemir; Tönge, Mehmet; Durdağ, Emre; Börcek, Alp Ozgün; Uçankuş, Lortlar Neşe; Doğulu, Fikret; Kiliç, Nedret; Baykaner, M Kemali


    Radical oxygen species produced after injury counteracts antioxidant activity and frequently causes severe oxidative stress for the tissues. Alpha-lipoic acid is a powerful metabolic antioxidant with immunomodulatory effects which provides neuroprotection. The aim of this study is to investigate the neuroprotective and anti-apoptotic effects of alpha-lipoic acid on spinal cord ischemia-reperfusion. Twenty-four adult, male, New Zealand rabbits were divided into sham (n = 8), control (n = 8), and treatment groups (n = 8). The abdominal aorta was clamped for 30 min by an aneurysm clip, approximately 1 cm below the renal artery and 1 cm above the iliac bifurcation in control and treatment groups. Only laparotomy was performed in the sham group. Twenty-five cubic centimeters of saline in control group and 100 mg/kg lipoic acid were administered intraperitoneally in the treatment group after closure of the incision. The animals were killed 48 h later. Spinal cord segments between L2 and S1 were harvested for analysis. Levels of nitric oxide, glutathione, malondialdehyde, advanced oxidation protein products, and superoxide dismutase were analyzed as markers of oxidative stress and inflammation. Caspase-3 activity was analyzed to detect the effect of lipoic acid on apoptosis. In all measured parameters of oxidative stress, administration of lipoic acid significantly demonstrated favorable effects. Both plasma and tissue levels of nitric oxide, glutathione, malondialdehyde, and advanced oxidation protein products significantly changed in favor of antioxidant activity. There was no significant difference between the plasma superoxide dismutase levels of the groups. Histopathological evaluation of the tissues also demonstrated significant decrease in cellular degeneration and infiltration parameters after lipoic acid administration. However, lipoic acid has no effect on caspase-3 activity. Although further studies considering different dose regimens and time intervals are

  8. Alpha lipoic acid changes iron uptake and storage in lens epithelial cells.


    Goralska, Malgorzata; Dackor, Ryan; Holley, Benjamin; McGahan, M Christine


    Alpha lipoic acid (LA) is a cofactor in mitochondrial dehydrogenase complexes. Previous studies have shown that when administered exogenously LA has antioxidant properties, which include free radical scavenging, metal chelation and regeneration of other antioxidants. The cells convert LA into dihydroplipoic acid (DHLA), which in the presence of iron can act as a prooxidant. In vitro DHLA reduces Fe(+3) to Fe(+2) and removes iron from ferritin, increasing the risk of Fe catalyzed free radical formation. In the present study we examined the in vivo effects of lipoic acid treatment on Fe metabolism in cultured lens epithelial cells, and found that LA decreases Fe uptake from transferrin, increases Fe deposition into ferritin and increases the concentration of this protein. When administered together with ascorbic acid, lipoic acid changes the characteristic heavy to light chain ratio of ferritin makeup. The decreased Fe uptake and increased storage diminishes the size of the cytosolic highly reactive Fe pool (LIP). These changes are associated with increased cell resistance to H(2)O(2) challenge. Therefore, LA may reduce the risk of Fe induced oxidative damage and also might be useful as a treatment of Fe overload. Copyright 2003 Elsevier Science Ltd.

  9. Lipoic Acid Gold Nanoparticles Functionalized with Organic Compounds as Bioactive Materials

    PubMed Central

    Turcu, Ioana; Zarafu, Irina; Popa, Marcela; Chifiriuc, Mariana Carmen; Bleotu, Coralia; Culita, Daniela; Ghica, Corneliu; Ionita, Petre


    Water soluble gold nanoparticles protected by lipoic acid were obtained and further functionalized by standard coupling reaction with 1-naphtylamine, 4-aminoantipyrine, and 4′-aminobenzo-15-crown-5 ether. Derivatives of lipoic acid with 1-naphtylamine, 4-aminoantipyrine, and 4′-aminobenzo-15-crown-5 ether were also obtained and characterized. All these were tested for their antimicrobial activity, as well as for their influence on mammalian cell viability and cellular cycle. In all cases a decreased antimicrobial activity of the obtained bioactive nanoparticles was observed as compared with the organic compounds, proving that a possible inactivation of the bioactive groups could occur during functionalization. However, both the gold nanoparticles as well as the functionalized bioactive nanosystems proved to be biocompatible at concentrations lower than 50 µg/mL, as revealed by the cellular viability and cell cycle assay, demonstrating their potential for the development of novel antimicrobial agents. PMID:28336877

  10. Lipoic acid inhibits caspase-dependent and -independent cell death pathways and is neuroprotective against hippocampal damage after pilocarpine-induced seizures.


    dos Santos, Pauline Sousa; Feitosa, Chistiane Mendes; Saldanha, Gláucio Barros; Tomé, Adriana da Rocha; Feng, Dejiang; de Freitas, Rivelilson Mendes


    Alpha-lipoic acid has some neuroprotective properties, but this action has not been investigated in models of epilepsy. The aim of the present study was to investigate the protective efficacy of α-lipoic acid (lipoic acid) against pilocarpine-induced cell death through the caspase-dependent or -independent mitochondrial apoptotic pathways. Wistar rats were injected intraperitoneally with 0.9% saline (control group), pilocarpine (400 mg/kg, pilocarpine group) alone, or α-lipoic acid (20 mg/kg) in association with pilocarpine (400 mg/kg) 30 min before administration of α-lipoic acid. After the treatments all groups were observed for 24 h. Cell death was reduced in lipoic acid-treated rats. Cytosolic translocation of cytochrome c and subsequent activation of caspase-3 were reduced by lipoic acid treatment. AIF nuclear translocation and subsequent large-scale DNA fragmentation were also decreased in lipoic acid-treated rats. Our study suggests that lipoic acid inhibits both caspase-dependent and -independent apoptotic pathways and may be neuroprotective against hippocampal damage during pilocarpine-induced seizures.

  11. The importance of 1,2-dithiolane structure in α-lipoic acid for the downregulation of cell surface β1-integrin expression of human bladder cancer cells.


    Yamasaki, Masao; Soda, Shozen; Sakakibara, Yoichi; Suiko, Masahito; Nishiyama, Kazuo


    Here, we show that cell surface β1-integrin expression, cell adhesion to fibronectin, migration, and invasion were all significantly inhibited by α-lipoic acid. These effects were not observed when cells were treated with dihydrolipoic acid or caprylic acid. These data reveal that the 1,2-dithiolane structure plays an important role in the action of α-lipoic acid.

  12. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing

    USDA-ARS?s Scientific Manuscript database

    Alpha-lipoic acid (ALA) is known as a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar sperm and the antioxidant effect of ALA on boar sperm during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0, and 10.0, mg/m...

  13. Oxidative modification of lipoic acid by HNE in Alzheimer disease brain.


    Hardas, Sarita S; Sultana, Rukhsana; Clark, Amy M; Beckett, Tina L; Szweda, Luke I; Murphy, M Paul; Butterfield, D Allan


    Alzheimer disease (AD) is an age-related neurodegenerative disease characterized by the presence of three pathological hallmarks: synapse loss, extracellular senile plaques (SP) and intracellular neurofibrillary tangles (NFTs). The major component of SP is amyloid β-peptide (Aβ), which has been shown to induce oxidative stress. The AD brain shows increased levels of lipid peroxidation products, including 4-hydroxy-2-nonenal (HNE). HNE can react covalently with Cys, His, or Lys residues on proteins, altering structure and function of the latter. In the present study we measured the levels of the HNE-modified lipoic acid in brain of subjects with AD and age-matched controls. Lipoic acid is a key co-factor for a number of proteins including pyruvate dehydrogenase and α-ketoglutarate dehydrogenase, key complexes for cellular energetics. We observed a significant decrease in the levels of HNE-lipoic acid in the AD brain compared to that of age-matched controls. To investigate this phenomenon further, the levels and activity of lipoamide dehydrogenase (LADH) were measured in AD and control brains. Additionally, LADH activities were measured after in-vitro HNE-treatment to mice brains. Both LADH levels and activities were found to be significantly reduced in AD brain compared to age-matched control. HNE-treatment also reduced the LADH activity in mice brain. These data are consistent with a two-hit hypothesis of AD: oxidative stress leads to lipid peroxidation that, in turn, causes oxidative dysfunction of key energy-related complexes in mitochondria, triggering neurodegeneration. This study is consonant with the notion that lipoic acid supplementation could be a potential treatment for the observed loss of cellular energetics in AD and potentiate the antioxidant defense system to prevent or delay the oxidative stress in and progression of this devastating dementing disorder.

  14. Lipoic acid prevents fructose-induced changes in liver carbohydrate metabolism: role of oxidative stress.


    Castro, María C; Francini, Flavio; Gagliardino, Juan J; Massa, María L


    Fructose administration rapidly induces oxidative stress that triggers compensatory hepatic metabolic changes. We evaluated the effect of an antioxidant, R/S-α-lipoic acid on fructose-induced oxidative stress and carbohydrate metabolism changes. Wistar rats were fed a standard commercial diet, the same diet plus 10% fructose in drinking water, or injected with R/S-α-lipoic acid (35mg/kg, i.p.) (control+L and fructose+L). Three weeks thereafter, blood samples were drawn to measure glucose, triglycerides, insulin, and the homeostasis model assessment-insulin resistance (HOMA-IR) and Matsuda indices. In the liver, we measured gene expression, protein content and activity of several enzymes, and metabolite concentration. Comparable body weight changes and calorie intake were recorded in all groups after the treatments. Fructose fed rats had hyperinsulinemia, hypertriglyceridemia, higher HOMA-IR and lower Matsuda indices compared to control animals. Fructose fed rats showed increased fructokinase gene expression, protein content and activity, glucokinase and glucose-6-phosphatase gene expression and activity, glycogen storage, glucose-6-phosphate dehydrogenase mRNA and enzyme activity, NAD(P)H oxidase subunits (gp91(phox) and p22(phox)) gene expression and protein concentration and phosphofructokinase-2 protein content than control rats. All these changes were prevented by R/S-α-lipoic acid co-administration. Fructose induces hepatic metabolic changes that presumably begin with increased fructose phosphorylation by fructokinase, followed by adaptive changes that attempt to switch the substrate flow from mitochondrial metabolism to energy storage. These changes can be effectively prevented by R/S-α-lipoic acid co-administration. Control of oxidative stress could be a useful strategy to prevent the transition from impaired glucose tolerance to type 2 diabetes. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Lipoic acid metabolism in Escherichia coli: sequencing and functional characterization of the lipA and lipB genes.

    PubMed Central

    Reed, K E; Cronan, J E


    Two genes, lipA and lipB, involved in lipoic acid biosynthesis or metabolism were characterized by DNA sequence analysis. The translational initiation site of the lipA gene was established, and the lipB gene product was identified as a 25-kDa protein. Overproduction of LipA resulted in the formation of inclusion bodies, from which the protein was readily purified. Cells grown under strictly anaerobic conditions required the lipA and lipB gene products for the synthesis of a functional glycine cleavage system. Mutants carrying a null mutation in the lipB gene retained a partial ability to synthesize lipoic acid and produced low levels of pyruvate dehydrogenase and alpha-ketoglutarate dehydrogenase activities. The lipA gene product failed to convert protein-bound octanoic acid moieties to lipoic acid moieties in vivo; however, the growth of both lipA and lipB mutants was supported by either 6-thiooctanoic acid or 8-thiooctanoic acid in place of lipoic acid. These data suggest that LipA is required for the insertion of the first sulfur into the octanoic acid backbone. LipB functions downstream of LipA, but its role in lipoic acid metabolism remains unclear. Images PMID:8444795

  16. Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2’-bipyridyl, lipoic, kojic and picolinic acids

    PubMed Central

    Çevik, Kübra; Ulusoy, Seyhan


    Objective(s): The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. Materials and Methods: The inhibitory activity of 2,2’-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. Results: The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. Conclusion: It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation. PMID:26557964

  17. alpha-Lipoic acid in dietary supplements: development and comparison of HPLC-CEAD and HPLC-ESI-MS methods.


    Durrani, Arjumand I; Schwartz, Heidi; Schmid, Walther; Sontag, Gerhard


    Alpha-lipoic acid is an antioxidant used both in the prevention and treatment of various oxidative stress related diseases. It is an important constituent of some dietary supplements and can also be found in plant and animal sources. A rapid method for the determination of alpha-lipoic acid in dietary supplements based on high performance liquid chromatography coupled with a coulometric electrode array detector (CEAD) and an electrospray ionization mass spectrometer (ESI-MS) was developed. First, alpha-lipoic acid was extracted with methanol by sonication, chromatographic separation was then achieved by isocratic elution [acetonitrile/methanol/50mM potassium dihydrogen phosphate (pH 3, adjusted with phosphoric acid): 350/65/585, v/v/v] using an ACE 3-C-18 column at a flow rate of 0.45 ml/min. alpha-Lipoic acid was detected by means of a CEAD at +300, +400, +450, +500, +550, +600, +650, and +700 mV against palladium reference electrodes. For ESI-MS detection (negative mode), the composition of the mobile phase was changed to 0.1% acetic acid in water/acetonitrile 55:45, v/v applying a flow rate of 0.2 ml/min. The presented methods were utilized to determine the alpha-lipoic acid content in six dietary supplements. The results of both detection modes were in good correlation.

  18. Effects of Lipoic Acid on Antiapoptotic Genes in Control and Ethanol-Treated Fetal Rhombencephalic Neurons

    PubMed Central

    Antonio, Angeline M.; Gillespie, Roberta A.; Druse, Mary J.


    This laboratory showed that ethanol augments apoptosis in fetal rhombencephalic neurons and co-treatment with alpha-lipoic acid (LA) or one of several other antioxidants prevents ethanol-associated apoptosis. Because ethanol increases oxidative stress, which causes apoptosis, it is likely that some of the neuroprotective effects of LA and other antioxidants involve classical antioxidant actions. Considering the reported link of LA with pro-survival cell signaling, it is also possible that LA’s neuroprotective effects involve additional mechanisms. The present study investigated the effects of LA on ethanol-treated fetal rhombencephalic neurons with regard to oxidative stress and up-regulation of the pro-survival genes Xiap and Bcl-2. We included parallel gene expression studies with N-acetyl cysteine (NAC) to determine whether LA’s effects on Xiap and Bcl-2 were shared by other antioxidants. We also used enzyme inhibitors to determine which signaling pathway(s) might be involved with the effects of LA. The results of this investigation showed that LA treatment of ethanol-treated neurons exerted several pro-survival effects. LA blocked two pro-apoptotic changes, i.e., the ethanol-associated rise in ROS and caspase-3. LA also up-regulated the expression genes that encode the anti-apoptotic proteins Bcl-2 and Xiap by a mechanism that involves NF-κB. NAC also up-regulated Bcl-2 and Xiap. Thus, the neuroprotective effects of LA and NAC could involve up-regulation of pro-survival genes as well as their classical antioxidant actions. PMID:21303669

  19. Physiological activities of the combination of fish oil and α-lipoic acid affecting hepatic lipogenesis and parameters related to oxidative stress in rats.


    Ide, Takashi


    We studied the combined effect of fish oil and α-lipoic acid on hepatic lipogenesis and fatty acid oxidation and parameters of oxidative stress in rats fed lipogenic diets high in sucrose. A control diet contained a saturated fat (palm oil) that gives high rate of hepatic lipogenesis. Male Sprague-Dawley rats were fed diets supplemented with 0 or 2.5 g/kg α-lipoic acid and containing 0, 20, or 100 g/kg fish oil, for 21 days. α-Lipoic acid significantly reduced food intake during 0-8 days but not the later period of the experiment. Fish oil and α-lipoic acid decreased serum lipid concentrations and their combination further decreased the parameters in an additive fashion. The combination of fish oil and α-lipoic acid decreased the activity and mRNA levels of hepatic lipogenic enzymes in an additive fashion. Fish oil increased the parameters of hepatic fatty acid oxidation enzymes. α-Lipoic acid appeared to antagonize the stimulating effects of fish oil of fatty acid oxidation through reductions in the activity of some fatty acid oxidation enzymes. α-Lipoic acid attenuated fish oil-dependent increases in serum and liver malondialdehyde levels, and this compound also reduced the serum 8-hydroxy-2'-deoxyguanosine level. α-Lipoic acid affected various parameters related to the antioxidant system; fish oil also affected some of the parameters. The combination of fish oil and α-lipoic acid effectively reduced serum lipid levels through the additive down-regulation of hepatic lipogenesis. α-Lipoic acid was effective in attenuating fish oil-mediated oxidative stress.

  20. Adverse effects of high doses of intravenous alpha lipoic Acid on liver mitochondria.


    Vigil, Michael; Berkson, Burton M; Garcia, Ana Patricia


    Alpha lipoic acid (ALA, thioctic acid), among other actions, is an essential coenzyme in the conversion of pyruvate to acetyl co-enzyme A. Therefore, it is necessary for the production of energy for aerobic organisms. Scientists have found that it can be used medically to help regenerate liver tissue, reverse the complications of diabetes mellitus, slow or stop the growth of cancer cells, and chelate heavy metals, among other actions. In this article, the authors describe the cellular mitochondrial damage from excessively high doses of this beneficial agent.

  1. Possible role of alpha-lipoic acid in the treatment of peripheral nerve injuries

    PubMed Central


    Recent findings on the antioxidant effects of pretreatment with α-lipoic acid (α-LA) on the crush injury of rat sciatic nerve confirm the possible usefulness of α-LA administration in humans with peripheral nerve injuries. We discussed this issue in relation with our recent results in which the combined employment of α-LA and γ-linolenic acid with a rehabilitation program for six weeks reduced sensory symptoms and neuropathic pain in patients with compressive radiculopathy syndrome from disc-nerve root conflict in comparison with patients submitted to rehabilitation program alone for six weeks. PMID:20807428

  2. Cutaneous delivery of α-tocopherol and lipoic acid using microemulsions: influence of composition and charge.


    Cichewicz, Allie; Pacleb, Chelsea; Connors, Ashley; Hass, Martha A; Lopes, Luciana B


    To assess whether the composition and charge of microemulsions affect their ability to simultaneously deliver α-tocopherol and lipoic acid into viable skin layers. α-Tocopherol and lipoic acid were added (1.1 and 0.5% w/w, respectively) to decylglucoside-based microemulsions containing mono-dicaprylin. Microemulsions containing surfactant : oil : water (w/w/w) at 60 : 30 : 10 (ME-O) and 46 : 23 : 31 (ME-W), as well as a cationic form of ME-W containing 1% phytosphingosine (ME-Wphy) were characterized, and their ability to disrupt the skin barrier and deliver the antioxidants in vitro in the skin was evaluated. Antioxidant activity in ME-Wphy-treated skin was assessed using the thiobarbituric acid-reactive substances (TBARS) assay. The internal phase diameters of microemulsions ranged between 42 and 55 nm; phytosphingosine addition and pH adjustment to 5.0 increased zeta potential from -4.3 to +29.1 mV. ME-O displayed w/o structure, whereas ME-W and ME-Wphy were consistent with o/w. Microemulsions affected skin electrical resistance and transepidermal water loss, but did not affect lipoic acid penetration. α-Tocopherol delivery increased following the order ME-O < ME-W < ME-Wphy. ME-Wphy presented suitable short-term stability. The antioxidants delivered by ME-Wphy decreased TBARS cutaneous levels. Even though microemulsion structure only affected tocopherol penetration, delivered levels of both antioxidants were sufficient for a decrease in TBARS, supporting their use for enhanced protection. © 2013 Royal Pharmaceutical Society.


    PubMed Central

    Cichewicz, Allie; Pacleb, Chelsea; Connors, Ashley; Hass, Martha A.; Lopes, Luciana B.


    Objectives To assess whether the composition and charge of microemulsions affect their ability to simultaneously deliver α-tocopherol and lipoic acid into viable skin layers. Methods α-tocopherol and lipoic acid were added (1.1 and 0.5% w/w, respectively) to decylglucoside-based microemulsions containing mono-dicaprylin. Microemulsions containing surfactant:oil:water (w/w/w) at 60:30:10 (ME-O) and 46:23:31 (ME-W), as well as a cationic form of ME-W containing 1% phytosphingosine (ME-Wphy) were characterized, and their ability to disrupt the skin barrier and deliver the antioxidants in vitro in the skin was evaluated. Antioxidant activity in ME-Wphy-treated skin was assessed using the thiobarbituric acid-reactive substances (TBARS) assay. Key findings internal phase diameters of microemulsions ranged between 47.0–53.2 nm; phytosphingosine addition and pH adjustment to 5.0 increased zeta potential from −4.3 to +29.1 mV. ME-O displayed w/o structure, whereas ME-W and ME-Wphy were consistent with o/w. Microemulsions affected skin electrical resistance and transepidermal water loss, but did not affect lipoic acid penetration. α-Tocopherol delivery increased following the order ME-O

  4. [Alpha-lipoic acid triggers elimination of cells with abnormal nuclei in human carcinoma epidermoid cell line].


    Kisurina-Evgen'eva, O P; Onishchenko, G E


    The skin is usually exposed to adverse environmental conditions that may cause pathological cell proliferation and cellular transformations leading to the formation of malignant cells. Antioxidants may affect these processes and induce the elimination of transformed cell. The purpose of this work was to investigate the effect of alfa-lipoic acid on human carcinoma epidermoid cell line A431. Our results showed that alfa-lipoic acid induced inhibition of cell proliferation or stimulated apoptotic cell death. Cells with abnormal nuclei were eliminated by apoptosis. Electron microscopy showed that survived cells had typical for control cells shape and organization of the nuclei, organization of the cytoplasm and organelles. Thus, alfa-lipoic acid not only triggered apoptosis of carcinoma cells, but it may also activate the mechanism of elimination of cells with abnormal chromosome number.

  5. Alpha-lipoic acid induces adipose triglyceride lipase expression and decreases intracellular lipid accumulation in HepG2 cells.


    Kuo, Yung-Ting; Lin, Ting-Han; Chen, Wei-Lu; Lee, Horng-Mo


    Non-alcoholic fatty liver disease can be attributed to the imbalance between lipogenesis and lipolysis in the liver. Alpha-lipoic acid has been shown to activate the 5'-AMP-activated protein kinase (AMPK) signalling pathway and to effectively inhibit the lipogenesis pathway in liver. However, whether alpha-lipoic acid stimulates lipolysis remains unclear. Recently, adipose triglyceride lipase (ATGL) was shown to be responsible for triacylglycerol hydrolase activity in cells. In the present study, we established a fatty liver cell model by incubating HepG2 cells in a high glucose (30mM glucose) and high fat (0.1mM palmitate) medium. We found that the activation of the AMPK signalling pathway induced ATGL protein expression and enhanced lipid hydrolysis. Similarly, treatment of the fatty liver cell model with alpha-lipoic acid reduced intracellular lipid accumulation in HepG2 cells, increased AMPK phosphorylation, and induced ATGL expression. We showed that insulin phosphorylates the transcription factor forkhead box O1 (FOXO1), which regulates ATGL expression and inhibits FOXO1 translocation into the nucleus. In contrast, alpha-lipoic acid dephosphorylated FOXO1 and reversed the nuclear exclusion of FOXO1. These data suggest that alpha-lipoic acid can effectively ameliorate intracellular lipid accumulation and induce ATGL expression through the FOXO1/ATGL pathway in liver cells. Thus, alpha-lipoic acid may be a potential therapeutic agent for treating fatty liver disease. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  6. Evaluation of protective and curative role of α-lipoic acid and selenium in gentamicin-induced nephrotoxicity in rabbits.


    Tahira, Afeefa; Saleem, Uzma; Mahmood, Saeed; Hashmi, Furqan Khurshid; Hussain, Khalid; Bukhari, Nadeem Irfan; Ahmad, Bashir


    Gentamicin induces nephrotoxicity, hence the present study explores protective and curative effects of α-lipoic acid and selenium alone and in combination in gentamicin-induced nephrotoxicity. Forty rabbits were randomly segregated into control, protective and curative groups. The groups A and B received water (10 ml/kg/day) and gentamicin (I/M, 80 mg/kg/day), respectively as normal and gentamicin controls. Four hours before gentamicin nephrotoxic dose, the protective subgroups C, D and E received α-lipoic acid, selenium and combination (50 mg/kg/day α-lipoic acid and 10 mg/kg/day selenium), respectively and then continued for 20 days. Nephrotoxicity was induced in curative subgroups F, G and H with gentamicin sulphate for 9 days and from 10th day onwards, followed the same treatments as for protective group for 26 days. Blood urea nitrogen (BUN), creatinine and antioxidant activity (AOA) were measured in all the groups. Combination of α-lipoic acid (50 mg/kg/day) and selenium (10 mg/kg/day) significantly reduced BUN (58.64%) and creatinine (17.48%) in protective subgroups treated for 20 days as compared to control without affecting AOA (p<0.05). Decrease of 82.19% BUN and 77.38% creatinine, and 46.66% increase in AOA was noted on day 26 in curative group treated with the combination of antioxidants. The combination of α-lipoic acid and selenium (50 mg/kg/day α-lipoic acid and 10 mg/kg/day selenium) was found to be effective in prevention and treatment of gentamicin-induced nephrotoxicity.

  7. Ibuprofen and lipoic acid diamides as potential codrugs with neuroprotective activity.


    Sozio, Piera; D'Aurizio, Eleonora; Iannitelli, Antonio; Cataldi, Amelia; Zara, Susi; Cantalamessa, Franco; Nasuti, Cinzia; Di Stefano, Antonio


    Current evidences support the hypothesis that non-steroidal anti-inflammatory drugs (NSAIDs) and antioxidant therapy might protect against the development of Alzheimer's disease (AD). In the present work, our attention was focused on ibuprofen (IBU) used in clinical trails to prevent Alzheimer's disease, and (R)-alpha-lipoic acid (LA) considered as a potential neuroprotective agent in AD therapy. In particular, we investigated a series of lipophilic molecular combinations obtained by joining (R)-alpha-lipoic acid and ibuprofen via an amide bond. These new entities might allow targeted delivery of the parent drugs to neurons, where cellular oxidative stress and inflammation seem related to Alzheimer's disease. Our study included the synthesis of conjugates 1-3 and the evaluation of their physicochemical and in-vitro antioxidant properties. The new compounds are extremely stable in aqueous buffer solutions (pH = 1.3 and 7.4), and in rat and human plasma they showed a slow bioconversion to ibuprofen and (R)-alpha-lipoic acid. Codrugs 1-3 displayed in vitro free radical scavenging activity and were hydrolyzed more rapidly in brain tissue than in rat serum indicating that these new entities might allow targeted delivery of the parent drugs to neurons. The immunohistochemical analysis of Abeta (1-40) protein showed that Abeta-injected cerebral cortices treated with ibuprofen or compound 1 showed few plaques within capillary vessels and, in particular, Abeta (1-40) protein was less expressed in codrug-1-treated than in ibuprofen-treated cerebral cortex.

  8. Effect of α-lipoic acid and exercise training on cardiovascular disease risk in obesity with impaired glucose tolerance.


    McNeilly, Andrea M; Davison, Gareth W; Murphy, Marie H; Nadeem, Nida; Trinick, Tom; Duly, Ellie; Novials, Anna; McEneny, Jane


    Obese subjects with impaired glucose tolerance (IGT) are more susceptible than healthy individuals to oxidative stress and cardiovascular disease. This randomised controlled investigation was designed to test the hypothesis that α-lipoic acid supplementation and exercise training may elicit favourable clinical changes in obese subjects with IGT. All data were collected from 24 obese (BMI ≥ 30 kg/m2) IGT patients. Following participant randomisation into two groups, fasting venous blood samples were obtained at baseline, and before and following intervention. The first group consisted of 12 participants who completed a 12 week control phase followed by 12 weeks of chronic exercise at 65% HRmax for 30 minutes a day, 5 days per week, while ingesting 1 gram per day of α-lipoic acid for 12 weeks. The second group consisted of 12 participants who completed the same 12 week control phase, but this was followed by 12 weeks of 1 gram per day of α-lipoic acid supplementation only (no exercise). The main findings show a comparatively greater rate of low density lipoprotein (LDL) oxidation in the group consisting of α-lipoic acid only (p < 0.05 vs. pre intervention), although total oxidant status was lower post intervention (p < 0.05 vs. baseline) in this group. However, exercise and α-lipoic acid in combination attenuates LDL oxidation. Furthermore, in the α-lipoic acid supplement plus exercise training group, total antioxidant capacity was significantly increased (p < 0.05 vs. baseline and pre intervention). Body fat percentage and waist and hip circumference decreased following exercise training (p < 0.05 vs. post intervention). There were no selective treatment differences for a range of other clinical outcomes including glycaemic regulation (p > 0.05). These findings report that α-lipoic acid ingestion may increase the atherogenicity of LDL when ingested in isolation of exercise, suggesting that in IGT the use of this antioxidant treatment does not ameliorate

  9. α-Lipoic acid treatment prevents cystine urolithiasis in a mouse model of cystinuria.


    Zee, Tiffany; Bose, Neelanjan; Zee, Jarcy; Beck, Jennifer N; Yang, See; Parihar, Jaspreet; Yang, Min; Damodar, Sruthi; Hall, David; O'Leary, Monique N; Ramanathan, Arvind; Gerona, Roy R; Killilea, David W; Chi, Thomas; Tischfield, Jay; Sahota, Amrik; Kahn, Arnold; Stoller, Marshall L; Kapahi, Pankaj


    Cystinuria is an incompletely dominant disorder characterized by defective urinary cystine reabsorption that results in the formation of cystine-based urinary stones. Current treatment options are limited in their effectiveness at preventing stone recurrence and are often poorly tolerated. We report that the nutritional supplement α-lipoic acid inhibits cystine stone formation in the Slc3a1(-/-) mouse model of cystinuria by increasing the solubility of urinary cystine. These findings identify a novel therapeutic strategy for the clinical treatment of cystinuria.

  10. Assessing the reductive capacity of cells by measuring the recycling of ascorbic and lipoic acids

    PubMed Central

    May, James M.


    Most mammalian cells cannot synthesize vitamin C, or ascorbic acid, and thus must have efficient mechanisms for its intracellular recycling. Ascorbate can be recycled from both its oxidized forms using electrons from several intracellular reducing co-factors, including GSH and the reduced pyridine nucleotides. Methods have been developed to assess the ability of intact cells to recycle ascorbate, which include assay of extracellular ferricyanide reduction and measurement of the ability of the cells to reduce dehydroascorbic acid to ascorbate. Lipoic acid, a disulfide containing medium chain fatty acid, is also taken up by cells and reduced to dihydrolipoic acid, which can be measured upon efflux from the cells using Ellman’s reagent. Together, these assays provide an estimate of the ability of different cell types to recycle ascorbate, and to generate intracellular reducing equivalents to required to maintain the redox status of the cells. PMID:20013182

  11. alpha-Lipoic acid and ascorbate prevent LDL oxidation and oxidant stress in endothelial cells.


    Sabharwal, Anup K; May, James M


    Both alpha-lipoic acid (LA) and ascorbic acid (vitamin C) have been shown to improve endothelial dysfunction, a precursor of atherosclerosis. Since oxidant stress can cause endothelial dysfunction, we tested the interaction and efficacy of these antioxidants in preventing oxidant damage to lipids due to both intra- and extracellular oxidant stresses in EA.hy926 endothelial cells. LA spared intracellular ascorbate in culture and in response to an intracellular oxidant stress induced by the redox cycling agent menadione. Extracellular oxidant stress generated by incubating cells for 2 h in with 0.2 mg/ml LDL and 5 muM Cu2+ caused a time-dependent increase of the lipid peroxidation product malondialdehyde in both cells and LDL, preceded by rapid disappearance of; alpha-tocopherol in LDL. alpha-Lipoic acid at concentrations of 40-80 microM blunted these effects. Similarly, intracellular ascorbate concentrations of 1-2 mM also prevented Cu2+-induced lipid peroxidation in LDL and cells. Cu2+-dependent oxidation of LDL in the presence of ascorbate-loaded cells decreased intracellular ascorbate by 20%, but this decrease was not reversed by LA. Both LA and ascorbate protect endothelial cells and LDL from either intra- or extracellular oxidant stress, but that LA does not spare ascorbate in oxidatively stressed cells.

  12. Determination of lipoic acid by flow-injection and high-performance liquid chromatography with chemiluminescence detection.


    Wołyniec, E; Karpińska, J; Losiewska, S; Turkowicz, M; Klimczuk, J; Kojło, A


    A new flow-injection (FI) and high performance liquid chromatography (HPLC) with chemiluminescence detection method has been proposed for the determination of α-lipoic acid (LA). The assay is based on the measurement of chemiluminescence (CL) produced during the reaction of α-lipoic acid with potassium permanganate in a sodium hexametaphosphate medium (pH 3). This reaction is accompanied by a weak CL, which is greatly increased in the presence of a formaldehyde solution. The proposed FI method allows the determination of LA over the range: 0.5-20μgmL(-1) with LOD 4×10(-3)μgmL(-1). An introduction of HPLC into the flow manifold improves selectivity of the method and allows the determination of LA in a complex sample. The chromatographic linear range is 2.5-30μgmL(-1) with LOD 1.774μgmL(-1). Chromatographic separation was achieved by isocratic elution (acetonitrile/potassium dihydrogen phosphate, pH 3, adjusted with phosphoric acid): 30/70 using a Cosmosil 5C(18)-MS-II (4.6mm×150mm I.D.) column at a flow rate of 1.0mLmin(-1). The presented methods were utilized to determine the α-lipoic acid content in "Alfa-lipoic acid" capsules and in food products. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Homology modeling of Homo sapiens lipoic acid synthase: Substrate docking and insights on its binding mode.


    Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay


    Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Lipoic Acid: its antioxidant and anti-inflammatory role and clinical applications.


    Moura, Fabiana Andréa; de Andrade, Kívia Queiroz; dos Santos, Juliana Célia Farias; Goulart, Marília Oliveira Fonseca


    Lipoic acid (LA) is an antioxidant able to produce its effects in aqueous or lipophilic environments. Lipoate is the conjugate base of lipoic acid, and the most prevalent form of LA under physiological conditions. It presents a highly negative reduction potential, increases the expression of antioxidant enzymes and participates in the recycling of vitamins C and E. Due to these properties, LA is called the "universal antioxidant". LA is also involved with anti-inflammatory action, independently of its antioxidant activity. This review was carried out, aiming to identify, analyze, and rationalize the various clinical, physiopathological and/or physiological situations in which LA, through oral supplementation, was tested on human and animal (rats and mice) models. LA was mainly tested in cardiovascular diseases (CVD), obesity, pain, inflammatory diseases and aging. LA uses in CVD and obesity, in humans, are controversial. On the other hand, beneficial effects on inflammation and pain were observed. LA supplementation in animal models may prolong life, has neuroprotective effects and presents positive effects against cancer. Differences observed in human and animal models can be due, in part, to different treatments (LA combined with other antioxidants, different doses) and to the variety of biomarkers investigated in animal experiments. These results suggest the need for further clinical trials to guide health professionals regarding the safety of prescription of this supplement.

  15. Alpha lipoic acid efficacy in burning mouth syndrome. A controlled clinical trial

    PubMed Central

    Palacios-Sánchez, Begoña; Cerero-Lapiedra, Rocío; Llamas-Martínez, Silvia; Esparza-Gómez, Germán


    Background A double-blind placebo-controlled trial was conducted in order to evaluate the efficacy of alpha lipoic acid (ALA) and determine the statistical significance of the outcome variables. Burning mouth syndrome (BMS) is defined as an oral burning sensation in the absence of clinical signs which could justify the syndrome. Recent studies suggest the existence of neurological factors as a possible cause of the disease. Material and Methods 60 patients with BMS, in two groups: case group with 600 mg/day and placebo as control group; with follow up of 2 months. Results 64% of ALA patients reported some level of improvement, with a level of maintenance of 68.75% one month after treatment. 27.6% of the placebo group also demonstrated some reduction in BMS symptoms. Conclusions Long-term evolution and the intensity of symptoms are variables that reduce the probability of improvement with ALA treatment. Key words: Burning mouth syndrome, neuropathy, alpha lipoic acid. PMID:26034927

  16. α-Lipoic acid protects against cholecystokinin-induced acute pancreatitis in rats

    PubMed Central

    Park, Sung-Joo; Seo, Sang-Wan; Choi, Ok-Sun; Park, Cheung-Seog


    AIM: α-Lipoic acid (ALA) has been used as an antioxidant. The aim of this study was to investigate the effect of α-lipoic acid on cholecystokinin (CCK)-octapeptide induced acute pancreatitis in rats. METHODS: ALA at 1 mg/kg was intra-peritoneally injected, followed by 75 μg/kg CCK-octapeptide injected thrice subcutaneously after 1, 3, and 5 h. This whole procedure was repeated for 5 d. We checked the pancreatic weight/body weight ratio, the secretion of pro-inflammatory cytokines and the levels of lipase, amylase of serum. Repeated CCK octapeptide treatment resulted in typical laboratory and morphological changes of experimentally induced pancreatitis. RESULTS: ALA significantly decreased the pancreatic weight/body weight ratio and serum amylase and lipase in CCK octapeptide-induced acute pancreatitis. However, the secretion of IL-1β, IL-6, and TNF-α were comparable in CCK octapeptide-induced acute pancreatitis. CONCLUSION: ALA may have a protective effect against CCK octapeptide-induced acute pancreatitis. PMID:16097064

  17. UPEI-300, a conjugate of lipoic acid and edaravone, mediates neuroprotection in ischemia/reperfusion.


    Connell, Barry J; Saleh, Monique C; Kucukkaya, Inan; Abd-El-Aziz, Alaa S; Khan, Bobby V; Saleh, Tarek M


    Edaravone, an electron spin trapper with radical scavenging activity, has been shown to be effective in reducing infarct volume in humans following ischemic stroke. However, concerns of edaravone-induced renal toxicity have limited its clinical adoption. Previous work has demonstrated that edaravone produced significant neuroprotection when injected prior to a period of ischemia and/or reperfusion. The current investigation was designed to determine if a newly synthesized co-drug consisting of lipoic acid and edaravone, named UPEI-300, could produce neuroprotection in in vitro and/or an in vivo rodent model of stroke. UPEI-300 produced dose-dependent neuroprotection in vitro and was subsequently tested in vivo. Male rats were anaesthetized and the middle cerebral artery was occluded for 30 min followed by 5.5 h of reperfusion (ischemia/reperfusion; I/R). Pre-administration of UPEI-300 dose-dependently decreased infarct volume. Significant neuroprotection was also observed when UPEI-300 (1.0 mg/kg) was injected during the 30 min period of ischemia as well as up to 60 min following the start of reperfusion. These results indicate that a co-drug consisting of edaravone and lipoic acid is a potent neuroprotectant, and clinically, the use of such a novel co-drug following an ischemic stroke might maintain neuroprotection while potentially decreasing edaravone associated renal toxicity.

  18. The α-lipoic acid improves high-fat diet-induced cerebral damage through inhibition of oxidative stress and inflammatory reaction.


    Liu, Yang; Zhang, Qinghua; Wang, Li; Wang, Hui; Sun, Tao; Xia, Hechun; Yang, Yi; Zhang, Li


    This study is to clarify the protective role of α-lipoic acid in high-fat diet-induced cerebral damage mice. The mice were divided into 5 groups: normal control group, high-fat diet (HFD) group, low-dose α-lipoic acid group for prevention, high-dose α-lipoic acid group for prevention, and high-dose α-lipoic acid group for treatment. The groups' weights and blood glucose changes were monitored. We used HE staining to observe morphological changes in the cerebral cortex. The expression levels of the oxidative stress proteins SOD2, catalase, and the inflammatory pathway proteins p-JNK, p-ERK were measured by western blot and immunochemistry. Compared with the control group, the quantity of cortical neurons in the HFD group was decreased, and the samples exhibited retrogression. However, the lipoic acid significantly protected and promoted the cortical neurons survival. Moreover, compared with the HFD group, the expression levels of SOD2 and catalase in the three α-lipoic acid obtained groups were significantly increased. However, the expression levels of the inflammatory pathway proteins p-JNK and p-ERK were significantly decreased. These results indicate that theα-lipoic acid greatly protects the cortical neurons, and inhibited the oxidative stress and inflammatory reactions in the high-fat diet mice. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Reduced alpha-lipoic acid synthase gene expression exacerbates atherosclerosis in diabetic apolipoprotein E-deficient mice.


    Yi, Xianwen; Xu, Longquan; Hiller, Sylvia; Kim, Hyung-Suk; Maeda, Nobuyo


    To study the effects of reduced lipoic acid gene expression on diabetic atherosclerosis in apolipoprotein E null mice (Apoe(-/-)). Heterozygous lipoic acid synthase gene knockout mice (Lias(+/-)) crossed with Apoe(-/-) mice were used to evaluate the diabetic effect induced by streptozotocin on atherosclerosis in the aortic sinus of the heart. While diabetes markedly increased atherosclerotic plaque size in Apoe(-/-) mice, a small but significant effect of reduced expression of lipoic acid gene was observed in diabetic Lias(+/-)Apoe(-/-) mice. In the aortic lesion area, the Lias(+/-)Apoe(-/-) mice exhibited significantly increased macrophage accumulation and cellular apoptosis than diabetic Lias(+/+)Apoe(-/-) littermates. Plasma glucose, cholesterol, and interleukin-6 were also higher. These abnormalities were accompanied with increased oxidative stress including a decreased ratio of reduced glutathione/oxidized glutathione in erythrocytes, increased systemic lipid peroxidation, and increased Gpx1 and MCP1 gene expression in the aorta. Decreased endogenous lipoic acid gene expression plays a role in development of diabetic atherosclerosis. These findings extend our understanding of the role of antioxidant in diabetic atherosclerosis. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. Alteration of fatty acid profile and nucleotide-related substances in post-mortem breast meat of α-lipoic acid-fed broiler chickens.


    Hamano, Y


    The present study was conducted to determine the effects of α-lipoic acid supplementation on post-mortem changes in the fatty acid profile and concentrations of nucleotide-related substances, especially those of a taste-active compound, inosine 5'-monophosphate, in chicken meat. Mixed-sex broiler chicks aged 14 d were divided into three groups of 16 birds each and were fed on diets supplemented with α-lipoic acid at levels of 0, 100 or 200 mg/kg for 4 weeks. Blood and breast muscle samples were taken at 42 d of age under the fed condition and then after fasting for 18 h. The breast muscle obtained from fasted chickens was subsequently refrigerated at 2°C for one and 3 d. α-Lipoic acid supplementation did not affect any plasma metabolite concentration independently of feeding condition, while a slight increase in plasma glucose concentration was shown with both administration levels of α-lipoic acid. In early post-mortem breast muscle under the fed condition, α-lipoic acid had no effect on concentrations of fatty acids or nucleotides of ATP, ADP, and AMP. In post-mortem breast tissues obtained from fasted chickens, total fatty acid concentrations were markedly increased by α-lipoic acid feeding at 200 mg/kg irrespective of length of refrigeration. This effect was dependent on stearic acid, oleic acid, linoleic acid and linolenic acid. However, among fatty acids, the only predominantly increased unsaturated fatty acid was oleic acid. Dietary supplementation with α-lipoic acid at 200 mg/kg increased the inosine 5'-monophosphate concentration in breast meat and, in contrast, reduced the subsequent catabolites, inosine and xanthine, regardless of the length of refrigeration. Therefore, the present study suggests that α-lipoic acid administration altered the fatty acid profile and improved meat quality by increasing taste-active substances in the post-mortem meat obtained from fasted chickens.

  1. Vitamin A palmitate and α-lipoic acid stability in o/w emulsions for cosmetic application.


    Moyano, M A; Segall, A


    Skin becomes thin, dry, pale, and finely wrinkled with age. Retinoids are a large class of compounds that are important in modern therapy for dermatological treatment of wrinkled skin. Of the retinoids, retinol and vitamin A palmitate are thought to induce thickening of the epidermis and to be effective for treatment of skin diseases. Accordingly, α-lipoic acid or the reduced form, dihydrolipoate, are potent scavengers of hydroxyl radicals, superoxide radicals, peroxyl radicals, singlet oxygen, and nitric oxide with anti-inflammatory properties (1). Cosmetic ingredient stability prediction relies on kinetic quantitative chemical analysis of active components at different temperatures. Vitamin A palmitate and α-lipoic acid, are known to be unstable to light or heat (2). The aims of this study were to evaluate the stability of α-lipoic acid and vitamin A palmitate in the presence of vitamin E (acetate) and other antioxidants in lipophilic/hydrophilic medium (O/W emulsions) at pH 3.0, 5.0, and 7.0. The formulations that were investigated contained 0.12% (w/w) vitamin A palmitate, 0.4% (w/w) vitamin E acetate, and 0.5 % α-lipoic acid (formulation A), supplemented with ascorbyl palmitate, magnesium ascorbyl phosphate, and vitamin C (formulation B) or with butylhydroxytoluene (BHT, formulation C) or ascorbyl palmitate (formulation D). The chemical analyses of α-lipoic acid and vitamin A palmitate were carried out by HPLC. Formulations C and D at pH 7.0 were selected as the most stable for these components. The purpose of this paper is the selection of the most stable formulations for their application in in vivo studies.

  2. Dispersive liquid-liquid microextraction combined with microwave-assisted derivatization for determining lipoic acid and its metabolites in human urine.


    Tsai, Chia-Ju; Chen, Yen-Ling; Feng, Chia-Hsien


    This study explored dispersive liquid-liquid microextraction for extraction and concentration of lipoic acid in human urine. To improve the detection of lipoic acid by both capillary liquid chromatography (CapLC) with UV detection and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), microwave-assisted derivatization with 4-bromomethyl-6,7-dimethoxycoumarin was performed to render lipoic acid chromophores for UV detection and also high ionization efficiency in MALDI. All parameters that affected lipoic acid extraction and derivatization from urine were investigated and optimized. In the analyses of human urine samples, the two methods had a linear range of 0.1-20 μM with a correlation coefficient of 0.999. The detection limits of CapLC-UV and MALDI-TOF MS were 0.03 and 0.02 μM (S/N ≧ 3), respectively. The major metabolites of lipoic acid, including 6,8-bismethylthio-octanoic acid, 4,6-bismethylthio-hexanoic acid, and 2,4-bismethylthio-butanoic acid were also extracted by dispersive liquid-liquid microextraction and detected by MALDI-TOF MS. The minor metabolites (undetectable by MALDI-TOF MS), bisnorlipoic acid and tetranorlipoic acid were also extracted by dispersive liquid-liquid microextraction and identified with an LTQ Orbitrap mass spectrometer. After dispersive liquid-liquid microextraction and microwave-assisted derivatization, all lipoic acid derivatizations and metabolites were structurally confirmed by LTQ Orbitrap.

  3. {alpha}-Lipoic acid exhibits anti-amyloidogenicity for {beta}-amyloid fibrils in vitro

    SciTech Connect

    Ono, Kenjiro; Hirohata, Mie; Yamada, Masahito . E-mail:


    Inhibition of the formation of {beta}-amyloid fibrils (fA{beta}), as well as the destabilization of preformed fA{beta} in the CNS would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of {alpha}-lipoic acid (LA) and the metabolic product of LA, dihydrolipoic acid (DHLA), on the formation, extension, and destabilization of fA{beta} at pH 7.5 at 37 {sup o}C in vitro. LA and DHLA dose-dependently inhibited fA{beta} formation from amyloid {beta}-protein, as well as their extension. Moreover, they destabilized preformed fA{beta}s. LA and DHLA could be key molecules for the development of therapeutics for AD.

  4. α-Lipoic Acid Protects Diabetic Apolipoprotien E-deficient Mice from Nephropathy

    PubMed Central

    Yi, Xianwen; Nickeleit, Volker; James, Leighton R; Maeda, Nobuyo


    Aim Both hyperglycemia and hyperlipidemia increase oxidative stress, and contribute to the development of diabetic nephropathy (DN). We investigated effects of α-lipoic acid, a natural antioxidant and a cofactor in the multienzyme complexes, on the development of DN in diabetic apolipoprotein E-deficient mice. Methods Twelve-weeks-old male apoE−/− mice on C57BL/6J genetic background were made diabetic with injections of streptozotocin (STZ). STZ-treated diabetic apoE−/− mice and non-diabetic control were fed with a synthetic high fat (HF) diet with or without LA supplementation. Multiple parameters including plasma glucose, cholesterol, oxidative stress markers, cytokines, and kidney cortex gene expression, and glomerular morphology were evaluated. Results LA supplementation markedly protected the beta cells and reduced cholesterol levels, attenuated albuminuria and glomerular mesangial expansion in the diabetic mice. Reno-protection by LA was equally effective regardless of whether the dietary supplementation was started 4 weeks before, simultaneously with, or 4 weeks after the induction of diabetes by STZ. LA supplementation significantly improved DN and oxidative stress in the diabetic mice. Severity of albuminuria was positively correlated with level of thiobarbituric acid reactive substances (TBARs) in the kidney (r2=0.62, P<0.05). Diabetes significantly changed the kidney expression of Rage, Sod2, Tgfb1 and Ctgf, Pdp2, nephrin and Lias. LA supplementation corrected these changes except that it further suppressed the expression of the Lias gene coding for lipoic acid synthase. Conclusions Our data indicate that LA supplementation effectively attenuates the development and progression of DN through its antioxidant effect as well as enhancing glucose oxidation. PMID:20801062

  5. Alpha-lipoic acid improves acute deltamethrin-induced toxicity in rats.


    Abdou, Rania H; Abdel-Daim, Mohamed M


    Alpha-lipoic acid (ALA) is a natural dithiol compound, with a free radical scavenger and biological antioxidant properties. The purpose of the current study was to investigate the protective effects of ALA on biochemical alteration and oxidative stress induced by acute deltamethrin intoxication in rats. Markers of liver and kidney injuries in serum of deltamethrin-intoxicated as well as ALA-pretreated rats were analyzed. Moreover, serum and (or) tissue lipid peroxidation, malondialdehyde and antioxidant markers, reduced glutathione, catalase, superoxide dismutase activity, and total antioxidant capacity were evaluated. The results showed that all parameters were altered in the intoxicated group, indicating hepatorenal oxidative damage of deltamethrin. Pre-treatment with ALA reversed the changes in most of the studied parameters in a dose-dependent manner. Histopathological and biochemical findings were parallel. It can be concluded that ALA may be a promising therapeutic option for prevention and (or) treatment of deltamethin toxicity.

  6. Ginger and alpha lipoic acid ameliorate age-related ultrastructural changes in rat liver.


    Mahmoud, Y I; Hegazy, H G


    Because of the important role that oxidative stress is thought to play in the aging process, antioxidants could be candidates for preventing its related pathologies. We investigated the ameliorative effects of two antioxidant supplements, ginger and alpha lipoic acid (ALA), on hepatic ultrastructural alterations in old rats. Livers of young (4 months) and old (24 months) Wistar rats were studied using transmission electron microscopy. Livers of old rats showed sinusoidal collapse and congestion, endothelial thickening and defenestration, and inconsistent perisinusoidal extracellular matrix deposition. Aged hepatocytes were characterized by hypertrophy, cytoplasmic vacuolization and a significant increase in the volume densities of the nuclei, mitochondria and dense bodies. Lipofuscin accumulation and decreased microvilli in bile canaliculi and space of Disse also were observed. The adverse alterations were ameliorated significantly by both ginger and ALA supplementation; ALA was more effective than ginger. Ginger and ALA appear to be promising anti-aging agents based on their amelioration of ultrastructural alterations in livers of old rats.

  7. Alpha lipoic acid efficacy in burning mouth syndrome. A controlled clinical trial.


    Palacios-Sánchez, Begoña; Moreno-López, Luis-Alberto; Cerero-Lapiedra, Rocío; Llamas-Martínez, Silvia; Esparza-Gómez, Germán


    A double-blind placebo-controlled trial was conducted in order to evaluate the efficacy of alpha lipoic acid (ALA) and determine the statistical significance of the outcome variables. Burning mouth syndrome (BMS) is defined as an oral burning sensation in the absence of clinical signs which could justify the syndrome. Recent studies suggest the existence of neurological factors as a possible cause of the disease. 60 patients with BMS, in two groups: case group with 600 mg/day and placebo as control group; with follow up of 2 months. 64% of ALA patients reported some level of improvement, with a level of maintenance of 68.75% one month after treatment. 27.6% of the placebo group also demonstrated some reduction in BMS symptoms. Long-term evolution and the intensity of symptoms are variables that reduce the probability of improvement with ALA treatment.

  8. Alpha-lipoic acid reduces peridural fibrosis after laminectomy of lumbar vertebrae in rabbits.


    Kaya, Miktat; Yildirim, Can Hakan; Kosemehmetoglu, Kemal; Huseyinoglu, Urfettin; Erdogan, Hakan; Akbasak, Aytac; Tasdemiroglu, Erol


    Peridural fibrosis is an inevitable healing process causing failed back surgery syndrome after lumbar spinal operations. In this study, alpha-lipoic acid (ALA), reported to reduce fibrosis in liver, oral mucosa, and peritoneum, investigated as a potential candidate for prevention of peridural fibrosis. Twelve adult New Zealand white male rabbits were divided into control (n = 5) and ALA groups (n = 7). Laminectomy of lumbar spine was performed and ALA was applied on the exposed dura mater topically in ALA group. According to histological peridural grading, the ALA group (median grade 1) showed significantly less peridural fibrosis than the control group (median grade 3, p = 0.005). ALA is a promising substance in the prevention of peridural fibrosis, especially in early preoperative and postoperative period.

  9. Synthesis of lipoic acid-peptide conjugates and their effect on collagen and melanogenesis.


    Lu, Chichong; Kim, Bo Mi; Lee, Duckhee; Lee, Min Hee; Kim, Jin Hwa; Pyo, Hyeong-Bae; Chai, Kyu Yun


    We report new examples of lipoic acid (LA)-peptide conjugates, their potential as codrugs having anti-melanogenic and anti-aging properties was evaluated. These multifunctional molecules were prepared by linking lipophilic moiety (LA) to the pentapeptide KTTKS. The inhibitory effect of LA-peptide conjugates on melanin synthesis and tyrosinase activity is stronger than that of LA or the pentapeptide alone. Importantly, the conjugates display no cytotoxicity at a high concentration. LA-KTTKS and LA-PEG-KTTKS also inhibit UV-induced matrix metalloproteinase-1 expression up to 49.5% and 69.5% at 0.5 mM, respectively. LA-peptide conjugates stimulate collagen biosynthesis in fibroblasts more efficiently than their parent molecules do. These data suggest that LA-peptide conjugates may have cosmeceutical application as anti-melanogenic and anti-aging agents.

  10. Alpha-lipoic acid treatment ameliorates metabolic parameters, blood pressure, vascular reactivity and morphology of vessels already damaged by streptozotocin-diabetes.


    Koçak, G; Aktan, F; Canbolat, O; Ozoğul, C; Elbeğ, S; Yildizoglu-Ari, N; Karasu, C


    The present study investigated the effects of alpha-lipoic acid treatment (50 mg/kg/day) on the metabolism and vascular condition already damaged by streptozotocin (STZ)-diabetes in rats. Carbohydrate and lipid metabolism, oxidative stress and antioxidant status were assessed in non-diabetic controls, 12-week untreated diabetic and 12-week treated diabetic (untreated for 6 weeks and then treated with alpha-lipoic acid for the last 6 weeks) rats. Blood pressures of rats were measured by tail-cuff method. Vascular reactivity was evaluated in isolated aortic rings. Morphology of aorta was examined by electron microscopy technique. Alpha-lipoic acid treatment effectively reversed body weight, blood glucose, plasma insulin, cholesterol, triglycerides and lipid peroxidation levels of diabetic animals. STZ-diabetes resulted in increased blood pressure, which was partially improved by alpha-lipoic acid treatment. Although the superoxide dismutase (SOD) activity in aortic homogenates was not changed by diabetes or antioxidant treatment, catalase or glutathione peroxidase (GPx) activity significantly increased in untreated diabetic rats. Alpha-lipoic acid treatment improved catalase activity in diabetic aorta. The contractile effect of phenylephrine markedly increased in diabetic rings, which was completely reversed by alpha-lipoic acid treatment. The maximum vasorelaxant response of pre-contracted aortic rings exposed to cumulatively increased concentrations of acetylcholine was unaffected by diabetes or antioxidant treatment. Sodium nitroprusside-induced endothelium-independent relaxations were similar in all experimental groups. Various alterations caused by STZ-diabetes in aorta structure were partially ameliorated by alpha-lipoic acid treatment. The potency of alpha-lipoic acid on the reversal of hypertension by affecting vascular reactivity and morphology as well as general metabolism of diabetic rats confirms the importance of hyperglycemia-induced oxidative stress in

  11. The effect of systemic lipoic acid on hearing preservation after cochlear implantation via the round window approach: A guinea pig model.


    Chang, Mun Young; Gwon, Tae Mok; Lee, Ho Sun; Lee, Jun Ho; Oh, Seung Ha; Kim, Sung June; Park, Min-Hyun


    The present study aimed to evaluate the effects of systemic lipoic acid on hearing preservation after cochlear implantation. Twelve Dunkin-Hartley guinea pigs were randomly divided into two groups: the control group and the lipoic acid group. Animals in the lipoic acid group received lipoic acid intraperitoneally for 4 weeks. A sterilised silicone electrode-dummy was inserted through the round window to a depth of approximately 5 mm. The hearing level was measured using auditory brainstem responses (ABRs) prior to electrode-dummy insertion, and at 4 days and 1, 2, 3 and 4 weeks after electrode-dummy insertion. The threshold shift was defined as the difference between the pre-operative threshold and each of the post-operative thresholds. The cochleae were examined histologically 4 weeks after electrode-dummy insertion. Threshold shifts changed with frequency but not time. At 2kHz, ABR threshold shifts were statistically significantly lower in the lipoic acid group than the control group. At 8, 16 and 32kHz, there was no significant difference in the ABR threshold shift between the two groups. Histologic review revealed less intracochlear fibrosis along the electrode-dummy insertion site in the lipoic acid group than in the control group. The spiral ganglion cell densities of the basal, middle and apical turns were significantly higher in the lipoic acid group compared with the control group. Therefore, systemic lipoic acid administration appears to effectively preserve hearing at low frequencies in patients undergoing cochlear implantation. These effects may be attributed to the protection of spiral ganglion cells and prevention of intracochlear fibrosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Antioxidant effect of erdosteine and lipoic acid in ovarian ischemia-reperfusion injury.


    Dokuyucu, R; Karateke, A; Gokce, H; Kurt, R K; Ozcan, O; Ozturk, S; Tas, Z A; Karateke, F; Duru, M


    To investigate the effects of erdosteine and alpha lipoic acid (ALA) in a rat model of ovarian ischaemia-reperfusion injury. Forty-eight female Wistar albino rats were separated, at random, into six groups of eight rats. The groups were classified as: sham, torsion, detorsion, detorsion+erdosteine 100mg/kg, detorsion+alpha lipoic acid (ALA) 100mg/kg, and detorsion+erdosteine+ALA. The investigators executing the biochemical and histological analyses were blinded to the randomization until the end of the study. The TOS (Total Oxidant Status) and OSI (Oxidative Stress Index) levels are higher in the Torsion and Detorsion groups when compared with the ones in the Sham group (p<0.05). Strong correlation was found between OSI and total histological score in the sham, torsion and detorsion groups (r=0.765, p<0.001). The mean levels of TOS and OSI in the rats that received erdosteine and/or ALA were significantly lower compared with the sham, torsion and detorsion groups (p<0.05). Mean TOS and mean OSI were lower in the detorsion+erdosteine+ALA group compared with the detorsion+erdosteine and detorsion+ALA groups (p<0.05). In comparison with the detorsion group, the numbers of primordial follicles (p=0.006) and primary follicles (p=0.036) were increased in the groups that received erdosteine and/or ALA. Erdosteine and ALA decreased ischaemia-reperfusion injury in an experimental rat ovarian torsion model; combination treatment had a greater effect than either agent alone. Treatment with erdosteine and/or ALA was found to preserve the loss of reproductive capacity normally observed after ovarian torsion. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Insulin autoimmune syndrome (Hirata Disease) in European Caucasians taking α-lipoic acid.


    Gullo, Damiano; Evans, Joseph L; Sortino, Grazia; Goldfine, Ira D; Vigneri, Riccardo


    Lipoic acid (LA) is a widely used nutritional supplement and is sometimes used as an adjuvant treatment for diabetic neuropathy and other conditions. Insulin autoimmune syndrome (IAS, Hirata disease) is a rare cause of spontaneous hypoglycaemia, extremely high serum insulin levels and high titres of autoantibodies against endogenous insulin despite no prior exposure to exogenous insulin. In Japanese individuals, IAS is associated with the human leucocyte antigen (HLA) HLA-DRB1*04:06 allele and often occurs upon exposure to sulphhydryl-containing compounds including LA. Only one case has been reported in Caucasians. We now report six Caucasian patients taking LA with IAS and describe a unique HLA subtype in these patients. Six Caucasian patients (M = 3; F = 3), median age 63 years, presented with spontaneous episodes of fasting and postabsorptive hypoglycaemia associated with mainly neuroglycopenic symptoms. No patient was treated with insulin or had an insulinoma. Hypoglycaemic symptoms appeared 30 and 120 days after taking lipoic acid (LA; 600 mg/day). Case histories and standard laboratory analyses were utilized. Discontinuation of LA resulted in a reduction in hypoglycaemic episodes. All patients were treated with oral or iv glucose and prednisone (12.5-25 mg/day). HLA analysis revealed the HLA-DRB1*04:03 allele in five patients, while the HLA-DRB1*04:06 allele was present in one patient. This is the first report of LA-related IAS in Caucasians who possess the HLA-DRB1*04:03 allele, implicating this allele in the genetic susceptibility to IAS in Caucasians. The greater occurrence of the HLA-DRB1*04:03 allele in Caucasian and other populations, combined with the growing use of LA in developed countries, may be a future predictor of additional cases of IAS. © 2013 John Wiley & Sons Ltd.

  14. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study

    PubMed Central

    Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem


    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  15. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.


    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem


    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion.

  16. Oral co-administration of α-lipoic acid, quercetin and captopril prevents gallium arsenide toxicity in rats.


    Bhatt, Kapil; Flora, S J S


    Gallium arsenide (GaAs), an inter-metallic semiconductor, known to exhibit superior optical and electronic properties compared to silicon, promotes its use in semiconductor industries. Extensive use of GaAs will inevitably lead to an increase in the exposure of workers manufacturing these products. Antioxidants are exogenous or endogenous compounds acting in several ways, including scavenging reactive oxygen species (ROS) or their precursors, inhibiting ROS formation, and binding metal ions needed for the catalysis of ROS generation. In the present study we investigated the protective efficacy of α-lipoic acid, quercetin and captopril individually against gallium arsenide exposure. Co-administration of α-lipoic acid with GaAs was most effective in reducing GaAs induced inhibition of blood δ-aminolevulinic acid dehydratase (ALAD) activity, liver, kidney and brain reduced glutathione (GSH) level and elevation of oxidized glutathione (GSSG). Captopril, on the other hand was effective in reducing thiobarbituric acid reactive substance (TBARS) levels, while quercetin reduced ROS in liver and kidney. The results suggest comparatively better preventive efficacy of concomitant α-lipoic acid administration during Gallium arsenide exposure compared to quercetin and captopril in preventing GaAs induced oxidative stress.

  17. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    SciTech Connect

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory


    Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks.

  18. Effects of an inhibitor of poly(ADP-ribose) polymerase, desmethylselegiline, trientine, and lipoic acid in transgenic ALS mice.


    Andreassen, O A; Dedeoglu, A; Friedlich, A; Ferrante, K L; Hughes, D; Szabo, C; Beal, M F


    The development of transgenic mouse models of amyotrophic lateral sclerosis (ALS) allows the testing of neuroprotective agents. We evaluated the effects of five agents in transgenic mice with the G93A Cu,Zn superoxide dismutase mutation. A novel inhibitor of poly(ADP-ribose) polymerase showed no effects on survival. Desmethylselegiline and CGP3466 are agents that exert antiapoptotic effects in vitro by preventing nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase. They had no significant effects on survival in the G93A mice. Trientine, a copper chelator, produced a modest significant increase in survival. Similarly administration of lipoic acid in the diet produced a significant improvement in survival. These results therefore provide evidence for potential therapeutic effects of copper chelators and lipoic acid in the treatment of ALS.

  19. Therapeutic Effects of Rivastigmine and Alfa-Lipoic Acid Combination in the Charles Bonnet Syndrome: Electroencephalography Correlates.


    Hanoglu, Lutfu; Yildiz, Sultan; Polat, Burcu; Demirci, Sema; Tavli, Ahmet Mithat; Yilmaz, Nesrin; Yulug, Burak


    Charles Bonnet Syndrome (CBS) is a rare clinical condition which is characterized by complex hallucinations in visually impaired patients. The pathophysiology of this disorder remains largely unknown, and there is still no proven treatment for this disease. In our study, we aimed to investigate the neural activity through Electroencephalography (EEG) power and evaluate the effect of rivastigmine in combination with alpha-lipoic acid on hallucination in two CBS patients with diabetic retinopathy. EEG data was recorded with standard routine EEG protocols for both patients in our electrophysiological research laboratory (REMER Clinical Electrophysiology and Neuromodulation Research and Application Laboratory) with Brain Vision Recorder (Brainproduct, Munich, Germany). All spectral analyses were processed by BrainVision Analyzer 2 (Brainproduct, Munich, Germany, 2.0.4 Version) in 128 Hz sample rates and the EEG recording and analysis was performed before the administration of rivastigmine (4.5 mg/daily and five patch daily for the first and second patients, respectively) in combination with alpha-lipoic acid (600 mg/daily) for both patients while they were not hallucinated during the time period recordings. Based on our measurement protocol, we have compared the patients in the study group with the three control subjects who were found to be normal except of visual disturbances secondary to significant diabetic retinopathy. Highest theta power values were found in right occipital and left temporo-parietal regions for first and second CBS patients, respectively. Additionally, power spectra were lower in two cases as compared to their control groups in the alpha band for all electrodes. We have also shown that acid rivastigmine in combination with alpha-lipoic exerted significant anti-hallucinatory efficiency. Our present findings could support the hypothesis that increased activation of specific areas in the source monitoring system plays an important role in the

  20. α-Lipoic acid inhibits sevoflurane-induced neuronal apoptosis through PI3K/Akt signalling pathway.


    Ma, Rong; Wang, Xiang; Peng, Peipei; Xiong, Jingwei; Dong, Hongquan; Wang, Lixia; Ding, Zhengnian


    Sevoflurane is a widely used anaesthetic agent, including in anaesthesia of children and infants. Recent studies indicated that the general anaesthesia might cause the cell apoptosis in the brain. This issue raises the concerns about the neuronal toxicity induced by the application of anaesthetic agents, especially in the infants and young children. In this study, we used Morris water maze, western blotting and immunohistochemistry to elucidate the role of α-lipoic acid in the inhibition of neuronal apoptosis. We found that sevoflurane led to the long-term cognitive impairment in the young rats. This adverse effect may be caused by the neuronal death in the hippocampal region, mediated through PI3K/Akt signalling pathway. We also showed that α-lipoic acid offset the effect of sevoflurane on the neuronal apoptosis and cognitive dysfunction. This study elucidated the potential clinical role of α-lipoic acid, providing a promising way in the prevention and treatment of long-term cognitive impairment induced by sevoflurane general anesthesia.

  1. Effects of combined lipoic acid and pyridoxine on albuminuria, advanced glycation end-products, and blood pressure in diabetic nephropathy.


    Noori, Nazanin; Tabibi, Hadi; Hosseinpanah, Farhad; Hedayati, Mehdi; Nafar, Mohsen


    This study was designed to investigate the effects of combined administration of lipoic acid and pyridoxine on albuminuria, oxidative stress, blood pressure, serum advanced glycation end-products, nitric oxide (NO), and endothelin-1 in patients with diabetic nephropathy. Thirty-four patients were randomly assigned to either a supplement group or a placebo group. The patients in the supplement group received 800 mg lipoic acid and 80 mg pyridoxine daily for 12 weeks, whereas the placebo group received corresponding placebos. Urinary albumin, serum malondialdehyde (MDA), and systolic blood pressure decreased significantly in the supplement group compared to the placebo group (p < 0.05). Serum NO increased in the supplement group compared to the placebo group (p < 0.05). Serum pentosidine and carboxymethyl lysine decreased significantly in the supplement group at the end of week 12 compared to baseline (p < 0.05). No statistically significant differences were observed between the two groups in mean changes of serum endothelin-1, glucose, and diastolic blood pressure. The present study indicates that combined administration of lipoic acid and pyridoxine improves albuminuria in patients with diabetic nephropathy by reducing oxidative stress, advanced glycation end-products, and systolic blood pressure. The reduction in microalbuminuria may be of benefit in retarding the progression of diabetic nephropathy.

  2. Self-Assembly of Pyridine-Modified Lipoic Acid Derivatives on Gold and Their Interaction with Thyroxine (T4)

    PubMed Central

    Albers, Willem M.; Milani, Roberto; Tappura, Kirsi; Munter, Tony; Resnati, Giuseppe; Metrangolo, Pierangelo


    Pyridyl derivatives of lipoic acid were prepared as ligands for the study of the interaction with thyroxine (T4). Thin self-assembled films of the ligands were prepared in 70% ethanol on gold and their interaction with T4 was studied by titration experiments in an aqueous buffer solution using Surface Plasmon Resonance (SPR). The thickness and refractive index of the ligand layers were calculated from SPR spectra recorded in two media, also allowing for surface coverage and the density of the layers to be estimated. Two ligands, a 4-pyridyl and a bis(2-hydroxyethyl) derivative of lipoic acid, were selected to investigate the feasibility for producing molecularly imprinted self-assembled layers on gold for T4. The methodology was to co-assemble T4 and the ligand onto the gold surface, elute the T4 from the layer under alkaline conditions, and study the rebinding of T4 to the layer. Multiple elution/rebinding cycles were conducted in different buffer solutions, and rebinding of T4 could be observed, with a moderate binding affinity that depended greatly on the solvent used. More optimal binding was observed in HBS buffer, and the affinity of the interaction could be slightly increased when the 4-pyridyl and bis(2-hydroxy-ethyl) derivatives of lipoic acid were combined in the imprinted layer. PMID:23389045

  3. Lipoic acid plays a role in scleroderma: insights obtained from scleroderma dermal fibroblasts.


    Tsou, Pei-Suen; Balogh, Beatrix; Pinney, Adam J; Zakhem, George; Lozier, Ann; Amin, M Asif; Stinson, William A; Schiopu, Elena; Khanna, Dinesh; Fox, David A; Koch, Alisa E


    Systemic sclerosis (SSc) is a connective tissue disease characterized by fibrosis of the skin and organs. Increase in oxidative stress and platelet-derived growth factor receptor (PDGFR) activation promote collagen I (Col I) production, leading to fibrosis in SSc. Lipoic acid (LA) and its active metabolite dihydrolipoic acid (DHLA) are naturally occurring thiols that act as cofactors and antioxidants, and are produced by lipoic acid synthetase (LIAS). The goal of this study was to examine whether LA and LIAS was deficient in SSc patients and determine the effect of DHLA on the phenotype of SSc dermal fibroblasts. N-acetylcysteine (NAC), a commonly used thiol antioxidant, was included as a comparison. Dermal fibroblasts were isolated from healthy subjects and patients with diffuse cutaneous SSc. Matrix metalloproteinase (MMPs), tissue inhibitors of MMPs (TIMP), plasminogen activator inhibitor-1 (PAI-1) and LIAS were measured by ELISA. The expression of Col I was measured by immunofluorescence, hydroxyproline assay, and quantitative PCR. PDGFR phosphorylation and α-smooth muscle actin (α-SMA) was measured by Western blotting. Student's t-tests were performed for statistical analysis and p-values of less than 0.05 with two-tailed analysis were considered statistically significant. The expression of LA and LIAS in SSc dermal fibroblasts was lower than normal fibroblasts, however LIAS was significantly higher in SSc plasma and appeared to be released from monocytes. DHLA lowered cellular oxidative stress, and decreased PDGFR phosphorylation, Col I, PAI-1, and α-SMA expression in SSc dermal fibroblasts. It also restored the activities of phosphatases that inactivated the PDGFR. SSc fibroblasts produced lower levels of MMP-1 and 3, and DHLA increased them. In contrast, TIMP-1 levels were higher in SSc but DHLA had minimal effect. Both DHLA and NAC increased MMP-1 activity when SSc cells were stimulated with PDGF. In general, DHLA showed better efficacy than NAC in most

  4. The effect of alpha-lipoic acid on temporary threshold shift in humans: a preliminary study.


    Quaranta, N; Dicorato, A; Matera, V; D'Elia, A; Quaranta, A


    Noise-induced hearing loss (NHIL) is a significant source of hearing loss in industrialized countries. Recent research on the cellular bases of NIHL has led to new avenues for protection through prophylactic drugs. Although in experimental animal models several compounds have shown a protective effect in NIHL, limited data are available in humans. Many authors are focusing their attention on the role of antioxidant on hearing protection. Alpha-lipoic acid (ALA), an essential cofactor in mitochondrial enzymes, is a novel biological antioxidant and a potent free radical scavenger and, in animal models, it has been shown to protect from age-induced and cisplatin-induced hearing loss. The aim of our study was to evaluate the effect of alpha-lipoic acid on temporary threshold shift measured 2 minutes after the end of exposure (TTS(2)) induced by a 3 kHz tone in young normally hearing subjects. Thirty young normal hearing volunteers served as control subjects. Individuals were randomly assigned to three groups. Group A (10 subjects) subjects were exposed to a 90 dB HL 3 kHz pure tone for 10 min. Group B (10 subjects) subjects were exposed to a 90 dB HL 3 kHz pure tone one hour after oral ingestion of 600 mg of ALA. Group C (10 subjects) were exposed to a 90 dB HL 3 kHz pure tone after 10 days of oral ingestion of 600 mg of ALA. Statistical analysis showed that prior to the exposure the hearing thresholds did not differ significantly among the three groups. TTS(2) of group C was significantly lower that TTS2 of Groups A and B at 6 kHz (p 0.03), and TEOAEs amplitude change after noise exposure was lower for group C compared to Groups A (p = 0.089) and B (p = 0.03). ALA is a powerful lipophilic antioxidant and free radical scavenger currently used in clinical practice. A single dose of 600 mg of dose ALA did not induce any protection on the TTS(2) induced by a 90 dB HL 3 kHz tone, while 10 days of therapeutic dosage assumption of ALA was associated with significant

  5. Effects of α-lipoic acid and L-carnosine supplementation on antioxidant activities and lipid profiles in rats

    PubMed Central

    Kim, Mi Young; Kim, Eun Jin; Kim, Young-Nam; Choi, Changsun


    α-Lipoic acid and L-carnosine are powerful antioxidants and are often used as a health supplement and as an ergogenic aid. The objective of this study was to investigate the effects of α-lipoic acid and/or L-carnosine supplementation on antioxidant activity in serum, skin, and liver of rats and blood lipid profiles for 6 weeks. Four treatment groups received diets containing regular rat chow diet (control, CON), 0.5% α-lipoic acid (ALA), 0.25% α-lipoic acid + 0.25% L-carnosine (ALA + LC), or 0.5% L-carnosine (LC). Superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) and lipid peroxidation products, malondialdehyde (MDA) concentrations, were analyzed in serum, skin, and liver. Blood lipid profiles were measured, including triglycerides (TG), total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), and low density lipoprotein cholesterol (LDL-C). Skin and liver SOD activities of the ALA and LC groups were higher than those of the CON group (P < 0.05), but serum SOD activity was higher only in the LC group compared to that in the CON group (P < 0.05). Additionally, only liver GSH-Px activity in the LC group was higher than that of the CON and the other groups. Serum and skin MDA levels in the ALA and LC groups were lower than those in the CON group (P < 0.05). Serum TG and TC in the ALA and ALA + LC groups were lower than those in the CON and LC groups (P < 0.05). The HDL-C level in the LC group was higher than that in any other group (P < 0.05). LDL-C level was lower in the ALA + LC and LC groups than that in the CON group (P < 0.05). Thus, α-lipoic acid and L-carnosine supplementation increased antioxidant activity, decreased lipid peroxidation in the serum, liver, and skin of rats and positively modified blood lipid profiles. PMID:22125679

  6. Combination of inositol and alpha lipoic acid in metabolic syndrome-affected women: a randomized placebo-controlled trial.


    Capasso, Immacolata; Esposito, Emanuela; Maurea, Nicola; Montella, Maurizio; Crispo, Anna; De Laurentiis, Michelino; D'Aiuto, Massimiliano; Frasci, Giuseppe; Botti, Gerardo; Grimaldi, Maria; Cavalcanti, Ernesta; Esposito, Giuseppe; Fucito, Alfredo; Brillante, Giuseppe; D'Aiuto, Giuseppe; Ciliberto, Gennaro


    Inositol has been reported to improve insulin sensitivity since it works as a second messenger achieving insulin-like effects on metabolic enzymes. The aim of this study was to evaluate the inositol and alpha lipoic acid combination effectiveness on metabolic syndrome features in postmenopausal women at risk of breast cancer. A six-month prospective, randomized placebo-controlled trial was carried out on a total of 155 postmenopausal women affected by metabolic syndrome at risk of breast cancer, the INOSIDEX trial. All women were asked to follow a low-calorie diet and were assigned randomly to daily consumption of a combination of inositol and alpha lipoic acid (77 pts) or placebo (78 pts) for six months. Primary outcomes we wanted to achieve were both reduction of more than 20% of the HOMA-IR index and of triglycerides serum levels. Secondary outcomes expected were both the improvement of high-density lipoprotein cholesterol levels and the reduction of anthropometric features such as body mass index and waist-hip ratio. A significant HOMA-IR reduction of more than 20% was evidenced in 66.7% (P <0.0001) of patients, associated with a serum insulin level decrease in 89.3% (P <0.0000). A decrease in triglycerides was evidenced in 43.2% of patients consuming the supplement (P <0.0001). An increase in HDL cholesterol (48.6%) was found in the group consuming inositol with respect to the placebo group. A reduction in waist circumference and waist-hip ratio was found in the treated group with respect to the placebo group. Inositol combined with alpha lipoic acid can be used as a dietary supplement in insulin-resistant patients in order to increase their insulin sensitiveness. Daily consumption of inositol combined with alpha lipoic acid has a significant bearing on metabolic syndrome. As metabolic syndrome is considered a modifiable risk factor of breast tumorigenesis, further studies are required to assess whether inositol combined with alpha lipoic acid can be

  7. Is it time to reassess alpha lipoic acid and niacinamide therapy in schizophrenia?


    Seybolt, Sheila E J


    As sulfur containing thiols, alpha lipoic acid (ALA) and its reduced form dihydrolipoic acid (DHLA) are powerful antioxidants and free radical scavengers capable of performing many of the same functions as glutathione (GSH). ALA supplementation may help protect mitochondria from oxidative stress, a possible mechanism contributing to certain forms of brain diseases called schizophrenia. Shortly before the advent of antipsychotic medications, two small studies found ALA relieved psychiatric symptoms in schizophrenia. More recently, animal studies have shown ALA augmentation improves mitochondrial function. At pharmaceutical levels, niacinamide helps preserve mitochondrial membrane integrity and acts as an antioxidant. ALA is a precursor for lipoamide, an essential mitochondrial coenzyme and niacinamide is a component of niacinamide adenine dinucleotide (NAD). NADH, the reduced form of NAD, is involved in the reduction of ALA to DHLA within the mitochondria. This is relevant to contemporary research because DHLA increases GSH and low GSH levels contribute to mitochondrial dysfunction and oxidative stress which have been implicated in the pathophysiology of schizophrenia.

  8. Ethacrynic and alpha-lipoic acids inhibit vaccinia virus late gene expression.


    Spisakova, Martina; Cizek, Zdenek; Melkova, Zora


    Smallpox was declared eradicated in 1980. However recently, the need of agents effective against poxvirus infection has emerged again. In this paper, we report an original finding that two redox-modulating agents, the ethacrynic and alpha-lipoic acids (EA, LA), inhibit growth of vaccinia virus (VACV) in vitro. The effect of EA and LA was compared with those of beta-mercaptoethanol, DTT and ascorbic acid, but these agents increased VACV growth in HeLa G cells. The inhibitory effects of EA and LA on the growth of VACV were further confirmed in several cell lines of different embryonic origin, in epithelial cells, fibroblasts, macrophages and T-lymphocytes. Finally, we have analyzed the mechanism of action of the two agents. They both decreased expression of VACV late genes, as demonstrated by western blot analysis and activity of luciferase expressed under control of different VACV promoters. In contrast, they did not inhibit virus entry into the cell, expression of VACV early genes or VACV DNA synthesis. The results suggest new directions in development of drugs effective against poxvirus infection.

  9. Alpha-lipoic acid: molecular mechanisms and therapeutic potential in diabetes.


    Rochette, Luc; Ghibu, Steliana; Muresan, Adriana; Vergely, Catherine


    Diabetes is a chronic metabolic disease with a high prevalence worldwide. Diabetes and insulin resistance are associated with the development of cardiovascular and nervous diseases. The development of these disorders reflects complex pathological processes in which the oxidative stress caused by reactive oxygen species (ROS) and reactive nitrogen species (RNS) plays a pivotal role. It is widely accepted that diabetes impairs endothelial nitric oxide synthase (eNOS) activity and increases the production of ROS, thus resulting in diminished NO bioavailability and increased oxidative stress. Alpha-lipoic acid (LA) possesses beneficial effects both in the prevention and in the treatment of diabetes. LA is a potent antioxidant with insulin-mimetic and anti-inflammatory activity. LA in the diet is quickly absorbed, transported to the intracellular compartments, and reduced to dihydrolipoic acid (DHLA) under the action of enzymes. LA, which plays an essential role in mitochondrial bioenergetic reactions, has drawn considerable attention as an antioxidant for use in managing diabetic complications such as retinopathy, neuropathy and other vascular diseases.

  10. Alpha-lipoic acid as a dietary supplement: Molecular mechanisms and therapeutic potential

    PubMed Central

    Shay, Kate Petersen; Moreau, Régis F.; Smith, Eric J.; Smith, Anthony R.; Hagen, Tory M.


    Alpha-lipoic acid (LA) has become a common ingredient in multivitamin formulas, anti-aging supplements, and even pet food. It is well-defined as a therapy for preventing diabetic polyneuropathies, and scavenges free radicals, chelates metals, and restores intracellular glutathione levels which otherwise decline with age. How do the biochemical properties of LA relate to its biological effects? Herein, we review the molecular mechanisms of LA discovered using cell and animal models, and the effects of LA on human subjects. Though LA has long been touted as an antioxidant, it has also been shown to improve glucose and ascorbate handling, increase eNOS activity, activate Phase II detoxification via the transcription factor Nrf2, and lower expression of MMP-9 and VCAM-1 through repression of NF-kappa-B. LA and its reduced form, dihydrolipoic acid, may use their chemical properties as a redox couple to alter protein conformations by forming mixed disulfides. Beneficial effects are achieved with low micromolar levels of LA, suggesting that some of its therapeutic potential extends beyond the strict definition of an antioxidant. Current trials are investigating whether these beneficial properties of LA make it an appropriate treatment not just for diabetes, but also for the prevention of vascular disease, hypertension, and inflammation. PMID:19664690

  11. Alpha-lipoic acid and alpha-lipoamide prevent oxidant-induced lysosomal rupture and apoptosis.


    Persson, H L; Svensson, A I; Brunk, U T


    Alpha-lipoic acid (LA) and its corresponding derivative, alpha-lipoamide (LM), have been described as antioxidants, but the mechanisms of their putative antioxidant effects remain largely uncharacterised. The vicinal thiols present in the reduced forms of these compounds suggest that they might possess metal chelating properties. We have shown previously that cell death caused by oxidants may be initiated by lysosomal rupture and that this latter event may involve intralysosomal iron which catalyzes Fenton-type chemistry and resultant peroxidative damage to lysosomal membranes. Here, using cultured J774 cells as a model, we show that both LA and LM stabilize lysosomes against oxidative stress, probably by chelating intralysosomal iron and, consequently, preventing intralysosomal Fenton reactions. In preventing oxidant-mediated apoptosis, LM is significantly more effective than LA, as would be expected from their differing capacities to enter cells and concentrate within the acidic lysosomal compartment. As previously reported, the powerful iron-chelator, desferrioxamine (Des) (which also locates within the lysosomal compartment), also provides protection against oxidant-mediated cell death. Interestingly, although Des enhances the partial protection afforded by LA, it confers no additional protection when added with LM. Therefore, the antioxidant actions of LA and LM may arise from intralysosomal iron chelation, with LM being more effective in this regard.

  12. Lipoic Acid as a Possible Pharmacological Source of Hydrogen Sulfide/Sulfane Sulfur.


    Bilska-Wilkosz, Anna; Iciek, Małgorzata; Kowalczyk-Pachel, Danuta; Górny, Magdalena; Sokołowska-Jeżewicz, Maria; Włodek, Lidia


    The aim of the present study was to verify whether lipoic acid (LA) itself is a source of H₂S and sulfane sulfur. It was investigated in vitro non-enzymatically and enzymatically (in the presence of rat tissue homogenate). The results indicate that both H₂S and sulfane sulfur are formed from LA non-enzymatically in the presence of environmental light. These results suggest that H₂S is the first product of non-enzymatic light-dependent decomposition of LA that is, probably, next oxidized to sulfane sulfur-containing compound(s). The study performed in the presence of rat liver and kidney homogenate revealed an increase of H₂S level in samples containing LA and its reduced form dihydrolipoic acid (DHLA). It was accompanied by a decrease in sulfane sulfur level. It seems that, in these conditions, DHLA acts as a reducing agent that releases H₂S from an endogenous pool of sulfane sulfur compounds present in tissues. Simultaneously, it means that exogenous LA cannot be a direct donor of H₂S/sulfane sulfur in animal tissues. The present study is an initial approach to the question whether LA itself is a donor of H₂S/sulfane sulfur.

  13. Lipoic Acid-Dependent Oxidative Catabolism of α-Keto Acids in Mitochondria Provides Evidence for Branched-Chain Amino Acid Catabolism in Arabidopsis1

    PubMed Central

    Taylor, Nicolas L.; Heazlewood, Joshua L.; Day, David A.; Millar, A. Harvey


    Lipoic acid-dependent pathways of α-keto acid oxidation by mitochondria were investigated in pea (Pisum sativum), rice (Oryza sativa), and Arabidopsis. Proteins containing covalently bound lipoic acid were identified on isoelectric focusing/sodium dodecyl sulfate-polyacrylamide gel electrophoresis separations of mitochondrial proteins by the use of antibodies raised to this cofactor. All these proteins were identified by tandem mass spectrometry. Lipoic acid-containing acyltransferases from pyruvate dehydrogenase complex and α-ketoglutarate dehydrogenase complex were identified from all three species. In addition, acyltransferases from the branched-chain dehydrogenase complex were identified in both Arabidopsis and rice mitochondria. The substrate-dependent reduction of NAD+ was analyzed by spectrophotometry using specific α-keto acids. Pyruvate- and α-ketoglutarate-dependent reactions were measured in all three species. Activity of the branched-chain dehydrogenase complex was only measurable in Arabidopsis mitochondria using substrates that represented the α-keto acids derived by deamination of branched-chain amino acids (Val [valine], leucine, and isoleucine). The rate of branched-chain amino acid- and α-keto acid-dependent oxygen consumption by intact Arabidopsis mitochondria was highest with Val and the Val-derived α-keto acid, α-ketoisovaleric acid. Sequencing of peptides derived from trypsination of Arabidopsis mitochondrial proteins revealed the presence of many of the enzymes required for the oxidation of all three branched-chain amino acids. The potential role of branched-chain amino acid catabolism as an oxidative phosphorylation energy source or as a detoxification pathway during plant stress is discussed. PMID:14764908

  14. Alpha-lipoic acid potently inhibits peroxynitrite-mediated DNA strand breakage and hydroxyl radical formation: implications for the neuroprotective effects of alpha-lipoic acid.


    Jia, Zhenquan; Zhu, Hong; Vitto, Michael J; Misra, Bhaba R; Li, Yunbo; Misra, Hara P


    Alpha-lipoic acid (LA) has recently been reported to afford protection against neurodegenerative disorders in humans and experimental animals. However, the mechanisms underlying LA-mediated neuroprotection remain an enigma. Because peroxynitrite has been extensively implicated in the pathogenesis of various forms of neurodegenerative disorders, this study was undertaken to investigate the effects of LA in peroxynitrite-induced DNA strand breaks, a critical event leading to peroxynitrite-elicited cytotoxicity. Incubation of phi X-174 plasmid DNA with the 3-morpholinosydnonimine (SIN-1), a peroxynitrite generator, led to the formation of both single- and double-stranded DNA breaks in a concentration- and time-dependent fashion. The presence of LA at 100-1,600 microM was found to significantly inhibit SIN-1-induced DNA strand breaks in a concentration-dependent manner. The consumption of oxygen induced by 250 microM SIN-1 was found to be decreased in the presence of high concentrations of LA (400-1,600 microM), indicating that LA at these concentrations may affect the generation of peroxynitrite from auto-oxidation of SIN-1. It is observed that incubation of the plasmid DNA with authentic peroxynitrite resulted in a significant formation of DNA strand breaks, which could also be dramatically inhibited by the presence of LA (100-1,600 microM). EPR spectroscopy in combination with spin-trapping experiments, using 5,5-dimethylpyrroline-N-oxide (DMPO) as spin trap, resulted in the formation of DMPO-hydroxyl radical adduct (DMPO-OH) from authentic peroxynitrite and LA at 50-1,600 microM inhibited the adduct signal. Taken together, these studies demonstrate for the first time that LA can potently inhibit peroxynitrite-mediated DNA strand breakage and hydroxyl radical formation. In view of the critical involvement of peroxynitrite in the pathogenesis of various neurodegenerative diseases, the inhibition of peroxynitrite-mediated DNA damage by LA may be responsible, at least

  15. Effects of dietary supplementation with EPA and/or α-lipoic acid on adipose tissue transcriptomic profile of healthy overweight/obese women following a hypocaloric diet.


    Huerta, Ana E; Prieto-Hontoria, Pedro L; Fernández-Galilea, Marta; Escoté, Xavier; Martínez, J Alfredo; Moreno-Aliaga, María J


    In obesity, the increment of adiposity levels disrupts the whole body homeostasis, promoting an over production of oxidants and inflammatory mediators. The current study aimed to characterize the transcriptomic changes promoted by supplementation with eicosapentaenoic acid (EPA, 1.3 g/day), α-lipoic acid (0.3 g/day), or both (EPA + α-lipoic acid, 1.3 g/day + 0.3 g/day) in subcutaneous abdominal adipose tissue from overweight/obese healthy women, who followed a hypocaloric diet (30% of total energy expenditure) during ten weeks, by using a microarray approach. At the end of the intervention, a total of 33,297 genes were analyzed using Affymetrix GeneChip arrays. EPA promoted changes in extracellular matrix remodeling gene expression, besides a rise of genes associated with either chemotaxis or wound repair. α-Lipoic acid decreased expression of genes related with cell adhesion and inflammation. Furthermore, α-lipoic acid, especially in combination with EPA, upregulated the expression of genes associated with lipid catabolism while downregulated genes involved in lipids storage. Together, all these data suggest that some of the metabolic effects of EPA and α-lipoic acid could be related to their regulatory actions on adipose tissue metabolism. © 2016 BioFactors, 43(1):117-131, 2017. © 2016 International Union of Biochemistry and Molecular Biology.

  16. Adding a combination of hydroxycitrate and lipoic acid (METABLOC™) to chemotherapy improves effectiveness against tumor development: experimental results and case report.


    Guais, Adeline; Baronzio, GianFranco; Sanders, Edward; Campion, Frédéric; Mainini, Carlo; Fiorentini, Giammaria; Montagnani, Francesco; Behzadi, Mahsa; Schwartz, Laurent; Abolhassani, Mohammad


    Altered metabolism of cancer first highlighted by Otto Warburg has a long history. Although ignored for a considerable amount of time, it is now receiving substantial attention. We recently published results obtained with a combination of two drugs, lipoic acid and hydroxycitrate, targeting metabolic enzymes particularly affected in cancer: ATP citrate lyase and pyruvate dehydrogenase kinase. This treatment was as efficient as chemotherapy in the three mouse cancer models that were tested. In this work, we asked if our drug combination could be used in conjunction with standard cytotoxic chemotherapy, in particular cisplatin, to improve basic protocol efficacy. A combination of lipoic acid and hydroxycitrate was administered to mice implanted with syngeneic cancer cells, LL/2 lung carcinoma and MBT-2 bladder carcinoma, concommitantly with classical chemotherapy (cisplatin or methotrexate). We demonstrate that the triple combination lipoic acid + hydroxycitrate + cisplatin or methotrexate is more efficient than cisplatin or methotrexate used individually or the combination of lipoic acid and hydroxycitrate administered alone. Of particular note are the results obtained in the treatment of an 80 year-old female who presented with ductal adenocarcinoma of the pancreas accompanied by liver metastases. A treatment course using gemcitabine plus α-lipoic acid and hydroxycitrate gave highly promising results. The in vivo data, coupled with the case study results, suggest a possible advantage in using a treatment targeted at cancer metabolism in association with classical chemotherapy.

  17. Alpha-lipoic acid ameliorates the epithelial mesenchymal transition induced by unilateral ureteral obstruction in mice

    PubMed Central

    Cho, Hyun Seop; Kim, Jin Hyun; Jang, Ha Nee; Lee, Tae Won; Jung, Myeong Hee; Kim, Tae Ho; Chang, Se-Ho; Park, Dong Jun


    The epithelial-to-mesenchymal transition (EMT) is one of mechanisms that induce renal interstitial fibrosis. Understanding EMT in renal fibrosis has important therapeutic implications for patients with kidney disease. Alpha-lipoic acid (ALA) is a natural compound with antioxidant properties. Studies for ALA are performed in acute kidney injury with renal tubular apoptosis, renal inflammation, and oxidative stress. We investigated the effects of ALA on EMT-mediated renal interstitial fibrosis in mice with unilateral ureteral obstruction (UUO). UUO mice developed severe tubular atrophy and tubulointerstitial fibrosis, with a robust EMT response and ECM deposition after 7 postoperative days. In contrast, ALA-treated UUO mice showed only moderate injury and minimal fibrosis and also larger reductions in the expression of ECM proteins, inflammatory factors, and EMT markers. ALA was shown to be involved in the suppression of infiltrating macrophages associated with EMT and the progression of interstitial fibrosis. It also lessened the destruction of the tubular basement membrane, by reducing the expression of matrix metalloproteinases. This is the first study to show that ALA modulates EMT in a UUO mouse model. Our results suggest that ALA merits further exploration as a therapeutic agent in the prevention and treatment of chronic kidney disease. PMID:28378840

  18. Beneficial effect of supplemental lipoic acid on diabetes-induced pregnancy loss in the mouse.


    Padmanabhan, Rengasamy; Mohamed, Shafiullah; Singh, Sarabjit


    Uncontrolled diabetes mellitus (DM) is an etiological factor for recurrent pregnancy loss, fetal growth disorders, and major congenital malformations in the offspring. Antioxidant therapy has been advocated to overcome the oxidant-antioxidant disequilibrium inherent in diabetes. The objective of this article was to evaluate the beneficial effects of alpha-lipoic acid (LA) on fetal outcome in a mouse model of streptozotocin (STZ)-induced DM. Timed pregnant mice were made diabetic by intraperitoneal (IP) injection of a single dose of STZ (200 mg/kg) on gestation day (GD) 2. Diabetic animals were supplemented daily with an IP injection of 15 mg/kg of LA starting on GD 4 and continued through GD 12. Fetuses were examined on GD 18 for malformations and growth restriction. Some diabetic mice injected with Evans blue were examined on GD 3.5 and GD 6.5 to evaluate frequency of implantations. STZ-treated mice had all cardinal signs of DM. LA treatment did not normalize blood glucose levels of DM mice. Rates of pregnancy in saline control, DM, and DM + LA groups were 90%, 28%, and 64%, respectively, indicating that LA promotes pregnancy in DM animals. However, postimplantation resorption showed a threefold increase in the DM + LA group. Rates of intrauterine growth restriction and major congenital malformations were also augmented thus indicating that the interaction between DM and LA has deleterious effects on postimplantation embryos.

  19. The impact of alpha-lipoic acid on amikacin-induced nephrotoxicity.


    Asci, Halil; Saygin, Mustafa; Cankara, Fatma Nihan; Bayram, Dilek; Yesilot, Sukriye; Candan, Ibrahim Aydin; Ilhan, Ilter


    Amikacin (AK) is an antibacterial drug, but it has remarkable nephrotoxic and ototoxic side effects due to increase in reactive oxygen radicals. This study was established to determine the possible protective effects of alpha-lipoic acid (ALA), a powerful antioxidant, on AK-induced nephrotoxicity. Three different groups of rats (n = 6) were administered saline (control), AK (1.2 g/kg, intraperitoneally), ALA (100 mg/kg, p.o.) and AK combination (ALA one day before the AK for five days). Renal function, oxidative stress markers and histological changes were evaluated at the end of the experiment. Malondialdehyde was increased as an indicator of free radical formation in AK-induced group and decreased with ALA treatment. While catalase activity was increased significantly, superoxide dismutase and glutathione peroxidase activities were not statistically significant increased with ALA treatment. The result showed that AK enhanced levels of urea, creatinine and blood urea nitrogen in serum significantly. Administration of ALA reduced these levels of biochemical markers. Histopathological observations were confirmed by biochemical findings. In conclusion, ALA is suggested to be a potential candidate to ameliorate AK-induced nephrotoxicity.

  20. Effect of alpha lipoic acid on ifosfamide-induced central neurotoxicity in rats.


    Ozturk, Gulfer; Ginis, Zeynep; Kurt, Sefika Nur; Albayrak, Aynur; Bilen, Sule; Fadillioglu, Ersin


    Ifosfamide (IFOS) which is a cytotoxic alkylating agent may cause central nervous system toxicity. Alpha-lipoic acid (ALA) has a strong antioxidant effects. We hypothesized that ALA could attenuate on ifosfamide-induced central neurotoxicity in rats. Rats were divided into Control, IFOS, ALA and IFOS+ALA groups. The toxic effects of IFOS were analyzed by oxidative parameters and caspase 3 immunohistochemical examinations of brain tissue. The catalase activity of IFOS group significantly reduced in comparison with control groups (p < 0.05). The malondialdehyde (MDA) level and protein carbonyl (PC) content in brain tissue were significantly higher in IFOS group than in the other groups (p < 0.05). ALA treatments significantly prevented the increase in MDA level (p < 0.001) and PC content (p < 0.05) in brain tissue. IFOS group showed profound activation of caspase 3. The control, ALA and IFOS+ALA groups did not show caspase 3 activation. It was concluded that ALA treatments may have beneficial effects protecting neurons from central neurotoxicity caused by IFOS.

  1. Treatment with alpha-lipoic acid reduces asymmetric dimethylarginine in patients with type 2 diabetes mellitus.


    Mittermayer, Friedrich; Pleiner, Johannes; Francesconi, Mario; Wolzt, Michael


    Elevated asymmetric dimethylarginine (ADMA) concentrations predict cardiovascular events in patients with type 2 diabetes mellitus (T2DM). It has been shown that alpha-lipoic acid (ALA) improves endothelial function and oxidative stress in these patients. The present study investigated if ALA reduces ADMA in patients with T2DM. Plasma concentrations of ADMA, L-arginine and symmetric dimethylarginine (SDMA) were determined in a double-blind, randomized, placebo-controlled study in patients with T2DM. Intravenous ALA (n = 16) or placebo (n = 14) was administered daily for 3 weeks. ALA reduced ADMA while no change was observed with placebo (mean change -0.05 micromol/1[95% CI: -0.01; -0.09] vs. 0.01 micromol/1 [95% CI: -0.05; -0.03]; ANOVA p = 0.031). SDMA and L-arginine were not affected by ALA. In conclusion ALA treatment reduces ADMA in patients with T2DM. Long-term studies need to demonstrate if ALA may cause cardiovascular risk reduction.

  2. Protective effects of alpha lipoic acid versus N-acetylcysteine on ifosfamide-induced nephrotoxicity.


    El-Sisi, Alaa El-Din E; El-Syaad, Magda E; El-Desoky, Karima I; Moussa, Ethar A


    Ifosfamide (IFO) is a highly effective chemotherapeutic agent for treating a variety of pediatric solid tumors. However, its use is limited due to its serious side effect on kidneys. The side-chain oxidation of IFO in renal tubular cells produces a reactive toxic metabolite that is believed to be responsible for its nephrotoxic effect. Therefore, this study was carried out to investigate the possible underlying mechanisms that may be involved in IFO-induced nephrotoxicity, including free radical generation and the possible role of alpha lipoic acid (ALA) versus N-acetylcysteine (NAC) in protection against this toxicity. Male albino rats were injected intraperitoneally with saline, IFO (50 mg/kg daily for 5 days), IFO + ALA (100 mg/kg daily for 8 days) and IFO + NAC (200 mg/kg daily for 8 days). Kidney malondialdehyde, nitric oxide and glutathione contents and serum biochemical parameters and histopathological analysis were determined. Both ALA and NAC markedly reduced the severity of renal dysfunction induced by IFO. NAC was more nephroprotective than ALA. This study suggests that oxidative stress is possibly involved in the IFO-induced nephrotoxicity in rats. The study also suggests the potential therapeutic role for ALA and NAC against IFO-induced nephrotoxicity.

  3. Photochemical stability of lipoic acid and its impact on skin ageing.


    Matsugo, Seiichi; Bito, Toshinori; Konishi, Tetsuya


    It is well known that α-lipoic acid (LA) functions as an essential co-factor of the mitochondrial multi-enzyme complex and thus plays an important role in energy metabolism. Currently, it is attracting attention as a nutritional supplement because of its unique antioxidant properties and broad spectra of cellular functions. Skin protection from photodamage and ageing is one of the functional applications of LA. Medical and cosmetic application has been widely realized in the world. However, LA has a unique structure bearing a distorted five membered 1, 2-dithiolane ring, making it quite vulnerable to UV radiation. The present article briefly reviews skin ageing from the viewpoint of oxidative stress and sun exposure and analyses the photochemical properties of LA. It also discusses the effect of LA to cellular signalling and its adequate applications to treat skin ageing caused by oxidation. Data presented in this review suggest that LA is a powerful anti-ageing agent under the appropriate usage.

  4. Lipoic acid stimulates bone formation in ovariectomized rats in a dose-dependent manner.


    Radzki, Radoslaw Piotr; Bienko, Marek; Wolski, Dariusz; Lis, Alicja; Radzka, Agnieszka


    This study was undertaken to determine the osteotropic effect of different doses of lipoic acid (LA) on the mineralization of bone tissue in female Wistar rats with experimental osteopenia induced by bilateral ovariectomy. Fifty-six rats were randomly selected and submitted to either a sham operation (n = 8) or an ovariectomy (n = 48). The ovariectomized rats were randomly placed into two control groups, treated subcutaneously with either physiological saline or 17β-estradiol in the dose of 4 μg/kg body mass per day, and four experimental groups that received LA subcutaneously in the doses of 12.5, 25, 50, and 100 mg/kg body mass per day (n = 8 in each group). After 28 days of experimental treatment, the rats were sacrificed, and body mass, total skeletal density, and body composition were recorded. Blood serum and isolated femora were stored for further analysis. Our results revealed that the osteoprotective effect of LA was dose-dependent and was observed in rats treated with 50 and 100 mg/kg of LA. Moreover, the LA applied to the ovariectomized rats in the dose of 50 mg/kg not only stopped the bone resorption, but stimulated its formation.

  5. Enzymatic hybridization of α-lipoic acid with bioactive compounds in ionic solvents.


    Papadopoulou, Athena A; Katsoura, Maria H; Chatzikonstantinou, Alexandra; Kyriakou, Eleni; Polydera, Angeliki C; Tzakos, Andreas G; Stamatis, Haralambos


    The lipase-catalyzed molecular hybridization of α-lipoic acid (LA) with bioactive compounds pyridoxine, tyrosol and tyramine was performed in ionic solvents and deep eutectic solvents. The biocatalytic reactions were catalyzed by Candida antarctica lipase B immobilized onto various functionalized multi-walled carbon nanotubes (f-CNTs-CaLB), as well as by commercial Novozym 435. The use of f-CNTs-CaLB leads, in most cases, to higher conversion yields as compared to Novozym 435. The nature and ion composition of ionic solvents affect the performance of the biocatalytic process. The highest conversion yield was observed in (mtoa)NTf2. The high enzyme stability and the relatively low solubility of substrates in specific media account for the improved biocatalytic synthesis of molecular hybrids of LA. Principal component analysis was used to screen for potential lipoxygenase inhibitors. In vitro studies showed that the synthesized compounds exhibit up to 10-fold increased inhibitory activity on lipoxygenase mediated lipid peroxidation as compared to parent molecules.

  6. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail:


    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  7. Effects of lipoic acid on growth and biochemical responses of common carp fed with carbohydrate diets.


    Santos, R A; Caldas, S; Primel, E G; Tesser, M B; Monserrat, J M


    Lipoic acid (LA) is an antioxidant that also favors glucose uptake in mammals. Until now, there are no studies evaluating the potential effect of this molecule on glycemic control in fish. It was evaluated LA effects on glucose uptake in common carp Cyprinus carpio fed with carbohydrate diets from two carbohydrate sources: glucose (GLU) and starch (STA), and supplemented or not with LA, being the diets: +GLU/-LA (GLU); +GLU/+LA (GLU + LA); +STA/-LA (STA); and +STA/+LA (STA + LA). Carp juveniles (6.5 ± 0.1 g) were fed with each diet ad libitum 4 times a day, during 68 days. Muscle glycogen concentration was higher (p < 0.05) in GLU and GLU + LA than in STA and STA + LA groups. On fish fed with starch, muscle cholesterol and triglyceride concentrations were higher (p < 0.05) in fish fed diets supplemented with LA. Muscle protein levels were higher in fish fed with LA, independent of the diet carbohydrate source. Lipid peroxidation was significantly reduced (p < 0.05) in fish muscle on fish fed the STA + LA diets when compared with the STA diet. Our findings indicate that LA modulates lipid, proteins and carbohydrate metabolism together with the well-known antioxidant effect. Also, LA showed to enhance starch utilization taking into account muscle cholesterol and triglyceride levels.

  8. Effect of α-Lipoic Acid on Platelet Reactivity in Type 1 Diabetic Patients

    PubMed Central

    Mollo, Roberto; Zaccardi, Francesco; Scalone, Giancarla; Scavone, Giuseppe; Rizzo, Paola; Navarese, Eliano Pio; Manto, Andrea; Pitocco, Dario; Lanza, Gaetano Antonio; Ghirlanda, Giovanni; Crea, Filippo


    OBJECTIVE Type 1 diabetes is associated with increased platelet reactivity. We investigated whether α-lipoic acid (ALA) has any effect on platelet reactivity in these patients. RESEARCH DESIGN AND METHODS We randomly assigned 51 type 1 diabetic patients to ALA (600 mg once daily) or placebo for 5 weeks. Platelet reactivity was evaluated by the PFA-100 method and by measuring CD41 and CD62 platelet expression. C-reactive protein (CRP) and 8-iso-prostaglandin F2α serum levels also were measured. RESULTS Baseline variables were similar in the two groups. After treatment, closure time was longer (P = 0.006) and CD62P platelet expression was lower, both before (P = 0.002) and after (P = 0.009) ADP stimulation in the ALA group compared with the placebo group. CRP and 8-iso-prostaglandin F2α levels showed no differences between the two groups. CONCLUSIONS Our data show that ALA reduces measures of platelet reactivity ex vivo in type 1 diabetic patients, independently of antioxidant or anti-inflammatory effects. PMID:22228743

  9. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    PubMed Central

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen


    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  10. [The blood glutathione system in cerebral vascular diseases and its treatment with alpha-lipoic acid].


    Kolesnichenko, L S; Kulinskiĭ, V I; Shprakh, V V; Bardymov, V V; Verlan, N V; Gubina, L P; Pensionerova, G A; Sergeeva, M P; Stanevich, L M; Filippova, G T


    The changes of glutathione metabolism are rare in dyscirculatory encephalopathy and ischemic stroke (IS) of mild severity. The frequent and considerable changes have been revealed in IS of moderate and high severity as well as in hemorrhagic stroke. An increase of activities of glutathione peroxidase and glutathione transferase is the most typical. The increase of enzyme activity was not observed at the beginning of treatment after 3 days and in patients with severe degree of disease who died later. A standard therapy decreased the quantity and/or expression of changes of the glutathione metabolism in patients with IS of moderate and high severity while the addition of alpha-lipoic acid (alpha-LA) led to the complete normalization in IS of moderate severity and normalization of most parameters in IS of high severity. The increase of functional activity of the glutathione system at the early stage of treatment of IS and the favorable changes during the treatment, in particular after the addition of alpha-LA, were correlated with the improvement of neurological status assessed with the NIHSS. It has been confirmed that the glutathione system plays an important role in the tolerance to brain ischemia.

  11. Effect of alpha-lipoic acid on radiation-induced small intestine injury in mice

    PubMed Central

    Jeong, Bae Kwon; Song, Jin Ho; Jeong, Hojin; Choi, Hoon Sik; Jung, Jung Hwa; Hahm, Jong Ryeal; Woo, Seung Hoon; Jung, Myeong Hee; Choi, Bong-Hoi; Kim, Jin Hyun; Kang, Ki Mun


    Purpose Radiation therapy is a highly effective treatment for patients with solid tumors. However, it can cause damage and inflammation in normal tissues. Here, we investigated the effects of alpha-lipoic acid (ALA) as radioprotection agent for the small intestine in a mouse model. Materials and Methods Whole abdomen was evenly irradiated with total a dose of 15 Gy. Mice were treated with either ALA (100 mg/kg, intraperitoneal injection [i.p.]) or saline (equal volume, i.p.) the prior to radiation as 100 mg/kg/day for 3 days. Body weight, food intake, histopathology, and biochemical parameters were evaluated. Results Significant differences in body weight and food intake were observed between the radiation (RT) and ALA + RT groups. Moreover, the number of crypt cells was higher in the ALA + RT group. Inflammation was decreased and recovery time was shortened in the ALA + RT group compared with the RT group. The levels of inflammation-related factors (i.e., phosphorylated nuclear factor kappa B and matrix metalloproteinase-9) and mitogen-activated protein kinases were significantly decreased in the ALA + RT group compared with those in the RT group. Conclusions ALA treatment prior to radiation decreases the severity and duration of radiation-induced enteritis by reducing inflammation, oxidative stress, and cell death. PMID:26943777

  12. Protective effects of alpha lipoic acid on radiation-induced salivary gland injury in rats

    PubMed Central

    Kim, Jin Hyun; Kim, Kyung Mi; Jung, Myeong Hee; Jung, Jung Hwa; Kang, Ki Mun; Jeong, Bae Kwon; Kim, Jin Pyeong; Park, Jung Je; Woo, Seung Hoon


    Purpose Radiation therapy is a treatment for patients with head and neck (HN) cancer. However, radiation exposure to the HN often induces salivary gland (SG) dysfunction. We investigated the effect of α-lipoic acid (ALA) on radiation-induced SG injury in rats. Results ALA preserved acinoductal integrity and acinar cell secretary function following irradiation. These results are related to the mechanisms by which ALA inhibits oxidative stress by inhibiting gp91 mRNA and 8-OHdG expression and apoptosis of acinar cells and ductal cells by inactivating MAPKs in the early period and expression of inflammation-related factors including NF-κB, IκB-α, and TGF-β1 and fibrosis in late irradiated SG. ALA effects began in the acute phase and persisted for at least 56 days after irradiation. Materials and Methods Rats were assigned to followings: control, ALA only (100 mg/kg, i.p.), irradiated, and ALA administered 24 h and 30 min prior to irradiation. The neck area including the SG was evenly irradiated with 2 Gy per minute (total dose, 18 Gy) using a photon 6-MV linear accelerator. Rats were killed at 4, 7, 28, and 56 days after radiation. Conclusions Our results show that ALA could be used to ameliorate radiation-induced SG injury in patients with HN cancer. PMID:27072584

  13. α-lipoic acid reduces hypertension and increases baroreflex sensitivity in renovascular hypertensive rats.


    Queiroz, Thyago M; Guimarães, Drielle D; Mendes-Junior, Leônidas G; Braga, Valdir A


    Renovascular hypertension has robust effects on control of blood pressure, including an impairment in baroreflex mechanisms, which involves oxidative stress. Although α-lipoic acid (LA) has been described as a potent antioxidant, its effect on renovascular hypertension and baroreflex sensitivity (BRS) has not been investigated. In the present study we analyzed the effects caused by chronic treatment with LA on blood pressure, heart rate and baroreflex sensitivity (sympathetic and parasympathetic components) in renovascular hypertensive rats. Male Wistar rats underwent 2-Kidney-1-Clip (2K1C) or sham surgery and were maintained untouched for four weeks to develop hypertension. Four weeks post-surgery, rats were treated with LA (60 mg/kg) or saline for 14 days orally. On the 15th day mean arterial pressure (MAP) and heart rate (HR) were recorded. In addition, baroreflex sensitivity test using phenylephrine (8 µg/kg, i.v.) and sodium nitroprusside (25 µg/kg, i.v.) was performed. Chronic treatment with LA decreased blood pressure in hypertensive animals; however, no significant changes in baseline HR were observed. Regarding baroreflex, LA treatment increased the sensitivity of both the sympathetic and parasympathetic components. All parameters studied were not affected by treatment with LA in normotensive animals. Our data suggest that chronic treatment with LA promotes antihypertensive effect and improves baroreflex sensitivity in rats with renovascular hypertension.

  14. Lipoic acid suppresses compound 48/80-induced anaphylaxis-like reaction

    PubMed Central

    Choi, Yun Ho; Chai, Ok Hee; Han, Eui-Hyeog; Choi, Su-Young; Kim, Hyoung Tae


    Alpha-lipoic acid (LA), a naturally occurring dithiol compound, is an essential cofactor in metabolic reactions involved in energy utilization. LA improves glycemic control, reduces diabetic polyneuropathies, atherosclerosis, and allergic inflammation. The effects of LA on mast cell-mediated anaphylactic reactions, however, are unknown. LA dose-dependently inhibited systemic and passive cutaneous anaphylaxis-like reactions in mice induced by compound 48/80, a condensation product of N-methyl-p-methoxyphenethylamine and formaldehyde. Pretreatment with LA, prior to induction of the systemic anaphylaxis-like reaction with compound 48/80, reduced plasma histamine levels in a dose-dependent manner. In our in vitro study, LA decreased histamine release from rat peritoneal mast cells (RPMCs) triggered by compound 48/80. Moreover, an increase in calcium uptake activated by compound 48/80 was inhibited by LA. LA also significantly elevated intracellular cyclic adenosine-3',5' monophosphate (cAMP) levels in RPMCs. This inhibition of mediator release from RPMCs may be due to inhibition of calcium uptake and augmentation of intracellular cAMP levels. Based on these results, we suggest that LA may be a potential remedy for allergy-related diseases. PMID:21267406

  15. Alpha-lipoic acid protects cardiomyocytes against hypoxia/reoxygenation injury by inhibiting autophagy

    SciTech Connect

    Cao, Xueming; Chen, Aihua Yang, Pingzhen; Song, Xudong; Liu, Yingfeng; Li, Zhiliang; Wang, Xianbao; Wang, Lizi; Li, Yunpeng


    Highlights: •We observed the cell viability and death subjected to H/R in H9c2 cardiomyocytes. •We observed the degree of autophagy subjected to H/R in H9c2 cardiomyocytes. •LA inhibited the degree of autophagy in parallel to the enhanced cell survival. •LA inhibited the autophagy in parallel to the decreased total cell death. •We concluded that LA protected cardiomyocytes against H/R by inhibiting autophagy. -- Abstract: Hypoxia/reoxygenation (H/R) is an important in vitro model for exploring the molecular mechanisms and functions of autophagy during myocardial ischemia/reperfusion (I/R). Alpha-lipoic acid (LA) plays an important role in the etiology of cardiovascular disease. Autophagy is widely implicated in myocardial I/R injury. We assessed the degree of autophagy by pretreatment with LA exposed to H/R in H9c2 cell based on the expression levels of Beclin-1, LC3II/LC3I, and green fluorescent protein-labeled LC3 fusion proteins. Autophagic vacuoles were confirmed in H9c2 cells exposed to H/R using transmission electron microscopy. Our findings indicated that pretreatment with LA inhibited the degree of autophagy in parallel to the enhanced cell survival and decreased total cell death in H9c2 cells exposed to H/R. We conclude that LA protects cardiomyocytes against H/R injury by inhibiting autophagy.

  16. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing.


    Shen, Tao; Jiang, Zhong-Liang; Li, Cong-Jun; Hu, Xiao-Chen; Li, Qing-Wang


    Alpha-lipoic acid (ALA) is known to be a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar spermatozoa and its antioxidant effect on boar spermatozoa during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0 or 10.0 mg/ml) of ALA were added to the extender used to freeze boar semen, and the effects on the quality and endogenous antioxidant enzyme activities of frozen-thawed spermatozoa were assessed. The results indicated that the addition of ALA to the extender resulted in a higher percentage of motile spermatozoa post-thaw (P < 0.05). The activities of superoxide dismutase, lactate dehydrogenase, glutamic-oxaloacetic transaminase and catalase improved after adding ALA to the extender (P < 0.05). Artificial insemination results showed that pregnancy rate and litter size were significantly higher at 6.0 mg/ml in the ALA group than in the control group (P < 0.05). In conclusion, ALA conferred a cryoprotective capacity to the extender used for boar semen during the process of freezing-thawing, and the optimal concentration of ALA for the frozen extender was 6.0 mg/ml.

  17. [Alpha lipoic acid and its antioxidant against cancer and diseases of central sensitization].


    Durand, Marisa; Mach, Núria


    The alpha lipoic acid (ALA) may control and limit the production of free radicals, influencing the development of pathologies such cancer or central sensitization diseases. However, the molecular mechanisms are still not elucidated. The objective of the present review is to contrast the antioxidant properties of ALA in the prevention and development of pathologies related to the oxidative stress. In this work, more than 100 articles published during the last 20 years that relate ALA consumption and pathologies related to the oxidative stress have been analysed. The articles have been obtained from different specialized databases (PubMed central, Web of science, Elsevier Journal, Science Direct) and included experiments in animals, cells, and humans. Domains evaluated included ALA, central sensitization diseases, free radicals, and ALA. Results from in vitro and laboratory animals experiments demonstrate that ALA controls the cell apoptosis of different type of cancers through out the increase of reactive oxygen species, and decrease of cell growth. Moreover, results demonstrated that ALA presents an antioxidant capacity and the ability to regenerate other antioxidants, which is essential to treat the central sensitization diseases. The ALA plays a significant role as antioxidant and prooxidant in cancer and central sensitization diseases, although more extensive studies are required to determine the clinical significance in humans. Copyright © AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

  18. Alpha-lipoic acid impairs body weight gain of young broiler chicks via modulating peripheral AMPK.


    Wang, Yufeng; Everaert, Nadia; Song, Zhigang; Decuypere, Eddy; Vermeulen, Daniel; Buyse, Johan


    In mammals, the AMP-activated protein kinase (AMPK) pathways in the central and peripheral tissues coordinately integrate inputs from multiple sources to regulate energy balance. The present study was aimed to explore the potential role of hepatic AMPK in the energy homeostasis of broiler chickens. Diets with 0, 0.05% or 0.1% alpha-lipoic acid (α-LA), a known AMPK inhibitor were provided to broiler chicks for 7days. As a result, α-LA supplementation decreased the relative growth rate of broiler chicks. Hepatic AMPKα2 mRNA levels were significantly upregulated by dietary α-LA, in concert with the increased phosphorylated AMPKα protein levels. In addition, hepatic FAS mRNA levels together with the malonyl-CoA to total CoA ester ratio were reduced by α-LA supplementation. Moreover, the hepatic phosphorylated glycogen synthase levels were increased resulting in a markedly decreased hepatic glycogen content. In conclusion, dietary α-LA supplementation decreased the in vivo hepatic glycogenesis and lipogenesis via stimulating hepatic AMPKα mRNA levels and the phosphorylated gene product. The stimulatory effect of α-LA on hepatic AMPK mRNA and pAMPKα protein levels together with our previous observations regarding its inhibitory effect on hypothalamic AMPK may have altered the energy balance and hence impaired body weight gain of broiler chicks. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Effect of alpha lipoic acid on oxidative stress and vascular wall of diabetic rats.


    Balkis Budin, Siti; Othman, Faizah; Louis, S R; Abu Bakar, M; Radzi, M; Osman, K; Das, S; Mohamed, J


    PREMISES AND OBJECTIVES: Antioxidant plays an important role in preventing the progression of diabetes mellitus (DM) complications. The aim of the present study was to investigate the effect of alpha lipoic acid (ALA) supplementation on plasma lipid, oxidative stress and vascular changes in diabetic rats. Diabetes was induced by a single intravenous injection of streptozotocin (STZ) (50 mg/kg). The diabetic rats were divided into two groups: (i) supplemented group with ALA (100 mg/kg/day) and (ii) non-supplemented group without ALA. Non-diabetic rats (NDM) formed the control group, which received saline injection. Following eight weeks of supplementation, fasting blood glucose (FBG) and glycosylated hemoglobin (HBA1c) in ALA-supplemented rats was found to be significantly lower than the non-supplemented group. ALA-supplementation also improved dyslipidemia that occurred in diabetic rats. ALA-supplementation also significantly increased plasma superoxide dismutase (SOD) activity and vitamin C level as compared to the No Suppl group. The increase in plasma and aorta malondealdehyde + 4-hydroxynonenal (MDA + 4-HNE) levels were also inhibited and the levels of oxidative DNA damage of peripheral lymphocytes were significantly reduced. Electron microscopic examination of thoracic aorta revealed that normal tissue organization was disrupted in STZ-diabetic rats with ALA-supplementation reducing the changes in the vascular morphology. It is concluded that ALA has the potential in preventing the alteration of vascular morphology in diabetic rats probably through the improvement of glycemic status and dyslipidemia as well as its antioxidant activities.

  20. Tumour microenvironment-responsive lipoic acid nanoparticles for targeted delivery of docetaxel to lung cancer

    PubMed Central

    Gu, Fenfen; Hu, Chuling; Tai, Zhongguang; Yao, Chong; Tian, Jing; Zhang, Lijuan; Xia, Qingming; Gong, Chunai; Gao, Yuan; Gao, Shen


    In the present study, we developed a novel type of reduction-sensitive nanoparticles (NPs) for docetaxel (DTX) delivery based on cross-linked lipoic acid NPs (LANPs). The physicochemical properties, cellular uptake and in vitro cytotoxicity of DTX loaded LANPs (DTX-LANPs) on A549 cells were investigated. Furthermore, the in vivo distribution and in vivo efficacy of DTX-LANPs was evaluated. The results showed that DTX-LANPs had a particle size of 110 nm and a negative zeta potential of −35 mv with excellent colloidal stability. LANPs efficiently encapsulated DTX with a high drug loading of 4.51% ± 0.49% and showed remarkable reduction-sensitive drug release in vitro. Cellular uptake experiments demonstrated that LANPs significantly increased intracellular DTX uptake by about 10 fold as compared with free DTX. The cytotoxicity of DTX-LANPs showed significantly higher potency in inhibiting A549 cell growth than free DTX, while blank LANPs had a good biocompatibility. In addition, in vivo experiments demonstrated that DTX-LANPs could enhance tumour targeting and anti-tumour efficacy with low systemic toxicity. In conclusion, LANPs may prove to be a potential tumour microenvironment-responsive delivery system for cancer treatment, with the potential for commercialization due to the simple component, controllable synthesis, stability and economy. PMID:27805051

  1. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade.


    El-Gowelli, Hanan M; Saad, Evan I; Abdel-Galil, Abdel-Galil A; Ibrahim, Einas R


    In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associated with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients.

  2. Behavioral and Neurochemical Effects of Alpha-Lipoic Acid in the Model of Parkinson's Disease Induced by Unilateral Stereotaxic Injection of 6-Ohda in Rat

    PubMed Central

    de Araújo, Dayane Pessoa; De Sousa, Caren Nádia Soares; Araújo, Paulo Victor Pontes; Menezes, Carlos Eduardo de Souza; Sousa Rodrigues, Francisca Taciana; Escudeiro, Sarah Souza; Lima, Nicole Brito Cortez; Patrocínio, Manoel Claúdio Azevedo; Aguiar, Lissiana Magna Vasconcelos; Viana, Glauce Socorro de Barros; Vasconcelos, Silvânia Maria Mendes


    This study aimed to investigate behavioral and neurochemical effects of α-lipoic acid (100 mg/kg or 200 mg/kg) alone or associated with L-DOPA using an animal model of Parkinson's disease induced by stereotaxic injection of 6-hydroxydopamine (6-OHDA) in rat striatum. Motor behavior was assessed by monitoring body rotations induced by apomorphine, open field test and cylinder test. Oxidative stress was accessed by determination of lipid peroxidation using the TBARS method, concentration of nitrite and evaluation of catalase activity. α-Lipoic acid decreased body rotations induced by apomorphine, as well as caused an improvement in motor performance by increasing locomotor activity in the open field test and use of contralateral paw (in the opposite side of the lesion produced by 6-OHDA) at cylinder test. α-lipoic acid showed antioxidant effects, decreasing lipid peroxidation and nitrite levels and interacting with antioxidant system by decreasing of endogenous catalase activity. Therefore, α-lipoic acid prevented the damage induced by 6-OHDA or by chronic use of L-DOPA in dopaminergic neurons, suggesting that α-lipoic could be a new therapeutic target for Parkinson's disease prevention and treatment. PMID:24023579

  3. The impact of high fructose on cardiovascular system: Role of α-lipoic acid.


    Saygin, M; Asci, H; Cankara, F N; Bayram, D; Yesilot, S; Candan, I A; Alp, H H


    The aim of this study was to evaluate the role of α-lipoic acid (α-LA) on oxidative damage and inflammation that occur in endothelium of aorta and heart while constant consumption of high-fructose corn syrup (HFCS). The rats were randomly divided into three groups with each group containing eight rats. The groups include HFCS, HFCS + α-LA treatment, and control. HFCS was given to the rats at a ratio of 30% of F30 corn syrup in drinking water for 10 weeks. α-LA treatment was given to the rats at a dose of 100 mg/kg/day orally for the last 6 weeks. At the end of the experiment, the rats were killed by cervical dislocation. The blood samples were collected for biochemical studies, and the aortic and cardiac tissues were collected for evaluation of oxidant-antioxidant system, tissue bath, and pathological examination. HFCS had increased the levels of malondialdehyde, creatine kinase MB, lactate dehydrogenase, and uric acid and showed significant structural changes in the heart of the rats by histopathology. Those changes were improved by α-LA treatment as it was found in this treatment group. Immunohistochemical expressions of tumor necrosis factor α and inducible nitric oxide synthase were increased in HFCS group, and these receptor levels were decreased by α-LA treatment. All the tissue bath studies supported these findings. Chronic consumption of HFCS caused several problems like cardiac and endothelial injury of aorta by hyperuricemia and induced oxidative stress and inflammation. α-LA treatment reduced uric acid levels, oxidative stress, and corrected vascular responses. α-LA can be added to cardiac drugs due to its cardiovascular protective effects against the cardiovascular diseases. © The Author(s) 2015.

  4. Dihydrolipoic but not alpha-lipoic acid affects susceptibility of eukaryotic cells to bacterial invasion.


    Bozhokina, Ekaterina; Khaitlina, Sofia; Gamaley, Irina


    Sensitivity of eukaryotic cells to facultative pathogens can depend on physiological state of host cells. Previously we have shown that pretreatment of HeLa cells with N-acetylcysteine (NAC) makes the cells 2-3-fold more sensitive to invasion by the wild-type Serratia grimesii and recombinant Escherichia coli expressing gene of actin-specific metalloprotease grimelysin [1]. To evaluate the impact of chemically different antioxidants, in the present work we studied the effects of α-Lipoic acid (LA) and dihydrolipoic acid (DHLA) on efficiency of S. grimesii and recombinant E. coli expressing grimelysin gene to penetrate into HeLa and CaCo cells. Similarly to the effect of NAC, pretreatment of HeLa and CaCo cells with 0.6 or 1.25 mM DHLA increased the entry of grimelysin producing bacteria by a factor of 2.5 and 3 for the wild-type S. grimesii and recombinant E. coli, respectively. In contrast, pretreatment of the cells with 0.6 or 1.25 mM LA did not affect the bacteria uptake. The increased invasion of HeLa and CaCo cells correlated with the enhanced expression of E-cadherin and β-catenin genes, whereas expression of these genes in the LA-treated cells was not changed. Comparison of these results suggests that it is sulfhydryl group of DHLA that promotes efficient modification of cell properties assisting bacterial uptake. We assume that the NAC- and DHLA-induced stimulation of the E-cadherin-catenin pathway contributes to the increased internalization of the grimelysin producing bacteria within transformed cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. [Evaluation of the actiom of lipoic acid in ischemia and hypertension].


    Borets, V M; Kishkovich, V P; Lis, M A; Butkevich, N D; Kalkun, D P


    A total of 203 patients, 48 -- with ischemic and 155 -- with hypertensive disease in the 11A and 11B stages, were examined. The effect of lipoic acid (LA) was assessed on the ground of the dynamics in the clinical picture of the patients, some vitamins allowance figures and the activity of a number of enzymes in leucocytes, erythrocytes and in the blood serum. The LA was administered in the form of tablets, in a dose of 75 mg per day, for 10 dyas. As controls served 90 patients with ischemic and hypertensive diseases. Investigations showed the LA to have but a little influence on the clinical picture of the disease, raising somewhat the beta-lipoproteids level in patients with hypertensive and ischemic disease, irrespective of their age, and increasing the level of free fatty acids in patients over 50, forcing it down in those below 50. An age-specific effect of the LA on the blood proteinic spectrum was disclosed, viz. in patients below 55 it increased the proportion of albumins and reduced that of gamma-globulins, whereas in those aged above 55 reverse picture was in evidence. In the young LA had the tendency of bringing down the coagulating activity of the blood; whereas disaggregation of thrombocytes changed not depending upon the age, but on the form of the affection, decreasing in patients with hypertensive disease and remaining unchanged in those with ischemic heart disease. The LA helped normalize the thiamine metabolism in the organism and that of the thiamine-diphosphate containing enzymes with concurrently disturbed utilization of riboflavin in the examined patients.

  6. Beneficial effects of natural antioxidants EGCG and alpha-lipoic acid on life span and age-dependent behavioral declines in Caenorhabditis elegans.


    Brown, Marishka K; Evans, Joseph L; Luo, Yuan


    Oxidative stress has been associated with both the aging process and the development of age-dependent tissue degenerative pathologies. Beneficial effects of antioxidant therapies to abrogate the deleterious consequences of elevated free radicals are implicated in disease prevention and cost-effective strategy. Previous data have shown protective effects of the polyphenol green tea constituent epigallocatechin gallate (EGCG) and a classic natural antioxidant alpha-lipoic acid (LA) against oxidative stress and aging. In this study, EGCG and alpha-lipoic acid were applied to model Caenorhabditis elegans, and their ability to modulate the life span and several age-associated behavioral declines were examined, including: pharyngeal pumping, chemotaxic behavior and amyloid beta-associated pathological behavior. It was demonstrated that both antioxidants attenuated the levels of hydrogen peroxide in C. elegans, but their effects on age-dependent decline in behaviors were different. EGCG, but not alpha-lipoic acid, attenuated the rate of decline in pharyngeal pumping behavior in C. elegans. In contrast, alpha-lipoic acid, but not EGCG, extended mean and maximal life span in C. elegans. Both EGCG and alpha-lipoic acid were able to facilitate the chemotaxis index and this effect was additive. Furthermore, EGCG, but not alpha-lipoic acid, moderately alleviated an Abeta-induced pathological behavior in a transgenic C. elegans strain. These results indicate that natural antioxidants can protect against age-dependent behavioral declines. Other protective mechanisms, in addition to their antioxidant properties, may underlie their differential beneficial effects on aging and physiological behaviors.

  7. A Clinical Trial about a Food Supplement Containing α-Lipoic Acid on Oxidative Stress Markers in Type 2 Diabetic Patients

    PubMed Central

    Derosa, Giuseppe; D’Angelo, Angela; Romano, Davide; Maffioli, Pamela


    The aim of this study was to evaluate the effect of a food supplement containing α-lipoic acid and of a placebo on glyco-metabolic control and on oxidative stress markers in type 2 diabetics. We randomized 105 diabetics to either a supplementation containing 600 mg of α-lipoic acid, 165 mg of L-carnosin, 7.5 mg of zinc, and vitamins of group B, or a placebo, for three months. We evaluated body mass index, fasting plasma glucose (FPG), post-prandial-glucose (PPG), glycated hemoglobin (HbA1c), fasting plasma insulin (FPI), HOMA-index (HOMA-IR), lipid profile, high sensitivity C-reactive protein (Hs-CRP), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA). There was a reduction of FPG, PPG, and HbA1c with the food supplement containing α-lipoic acid compared with a baseline, and with the placebo. Concerning lipid profile, we observed a reduction of LDL-C, and Tg with the food supplement, compared with both the baseline, and the placebo. There was a reduction of Hs-CRP with the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. An increase of SOD, and GSH-Px, and a decrease of MDA were reached by the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. We can conclude that the food supplement containing α-lipoic acid, L-carnosin, zinc, and vitamins of group B improved glycemic control, lipid profile, and anti-oxidative stress markers. PMID:27801825

  8. Effects of aspirin & simvastatin and aspirin, simvastatin, & lipoic acid on heme oxygenase-1 in healthy human subjects.


    Bharucha, Adil E; Choi, Kyoung Moo; Saw, Jessica J; Gibbons, Simon J; Farrugia, Gianrico F; Carlson, David A; Zinsmeister, Alan R


    Heme oxygenase 1 (HO-1) degrades heme and protects against oxidative stress. In vitro and animal models suggest that HO-1 is beneficial in several diseases (e.g., postoperative ileus, gastroparesis, acute pancreatitis, and colitis). However, the only drugs (i.e., hemin and heme arginate) which pharmacologically upregulate HO-1 in humans are expensive and can only be administered intravenously. Our aims were to compare the effects of placebo, aspirin, and simvastatin alone, and with α-lipoic acid, on HO-1 protein concentration and activity in humans. This randomized, double-blind, placebo-controlled study compared the effects of three oral regimens administered for 7 days, i.e., placebo; aspirin (325 mg twice daily) and simvastatin (40 mg twice daily); aspirin, simvastatin, and the sodium salt of R- α-lipoic acid (NaRLA, 600 mg three times daily) on markers of HO-1 activation (i.e., plasma HO-1 protein concentration and venous monocyte HO-1 protein activity) in 18 healthy subjects (14 females). Markers of HO-1 activation were evaluated at baseline, days 2, and 7. Baseline HO-1 protein concentrations and activity were similar among the three groups. Compared to placebo, aspirin and simvastatin combined, or together with NaRLA did not affect HO-1 protein concentration or activity at 2 or 7 days. HO-1 protein concentrations and activity were correlated on day 7 (r = 0.75, p = 0.0004) but not at baseline and on day 2. At therapeutic doses, aspirin, simvastatin, and α-lipoic acid do not increase plasma HO-1 protein concentration or venous monocyte HO-1 activity in healthy humans. © 2014 John Wiley & Sons Ltd.


    PubMed Central

    Bharucha, Adil E.; Choi, Kyoung Moo; Saw, Jessica; Gibbons, Simon J.; Farrugia, Gianrico; Carlson, David; Zinsmeister, Alan R


    SUMMARY Background Heme-oxygenase 1 (HO-1) degrades heme and protects against oxidative stress. In vitro and animal models suggest that HO-1 is beneficial in several diseases (e.g., post-operative ileus, gastroparesis, acute pancreatitis, and colitis). However the only drugs (i.e., hemin and heme arginate) which pharmacologically up-regulate HO-1 in humans are expensive and can only be administered intravenously. Our aims were to compare the effects of placebo, aspirin and simvastatin alone, and with α-lipoic acid, on HO-1 protein concentration and activity in humans. Methods This randomized, double-blind, placebo-controlled study compared the effects of 3 oral regimens administered for 7 days, ie, placebo; aspirin (325 mg twice daily) and simvastatin (40 mg twice daily); aspirin, simvastatin, and the sodium salt of R-α-lipoic acid (NaRLA, 600 mg three times daily) on markers of HO-1 activation (i.e., plasma HO-1 protein concentration and venous monocyte HO-1 protein activity) in 18 healthy subjects (14 females). Markers of HO-1 activation were evaluated at baseline, days 2 and 7. Key Results Baseline HO-1 protein concentrations and activity were similar amongst the three groups. Compared to placebo, aspirin and simvastatin combined, or together with NaRLA did not affect HO-1 protein concentration or activity at 2 or 7 days. HO-1 protein concentrations and activity were correlated on day 7 (r = 0.75, p = 0.0004) but not at baseline and on day 2. Conclusions At therapeutic doses, aspirin, simvastatin, and α-lipoic acid do not increase plasma HO-1 protein concentration or venous monocyte HO-1 activity in healthy humans. PMID:25093998

  10. Stability, cutaneous delivery and antioxidant potential of a lipoic acid and α-tocopherol co-drug incorporated in microemulsions

    PubMed Central

    Thomas, Siji; Vieira, Camila S.; Hass, Martha A.; Lopes, Luciana B.


    The aim of this study was to assess the skin penetration, stability and antioxidant effects of a α-tocopherol-lipoic acid co-drug. To enhance penetration, we evaluated three microemulsions varying in water content and composition of the oil phase (isopropyl myristate with either monocaprylin or oleic acid). The co-drug was incorporated at 1% (w/w). Co-drug hydrolysis in the microemulsion increased with increases in time (up to 48 h) and formulation water content (10–30%, w/w). Microemulsions increased the co-drug delivery into viable layers of porcine ear skin by 2.9–7.8–fold compared to a control formulation (20% monocaprylin in isopropyl myristate) after 24 h. Penetration enhancement was influenced by the oil phase, with the formulation containing monocaprylin displaying the most pronounced effect. Antioxidant activity, assessed in skin bioequivalents using the thiobarbituric acid-reactive substances (TBARS) assay, demonstrated that TBARS levels decreased by 39% after treatment with the co-drug-containing microemulsion compared to the unloaded formulation. In addition to the co-drug, tocopherol (8.2 ± 0.6 μg/cm2) was detected in the viable bioequivalent tissues, suggesting that the co-drug was partly hydrolyzed after 12 h. Taken together, these results support the potential of nanodispersed formulations containing a tocopherol-lipoic acid co-drug to improve skin antioxidant activity. PMID:24961388

  11. The oxidative damage and inflammation caused by pesticides are reverted by lipoic acid in rat brain.


    Astiz, Mariana; de Alaniz, María J T; Marra, Carlos Alberto


    We have previously demonstrated that the administration of low doses of dimethoate, glyphosate and zineb to rats (i.p. 1/250 LD50, three times a week for 5weeks) provokes severe oxidative stress (OS) in specific brain regions: substantia nigra, cortex and hippocampus. These effects were also observed in plasma. Lipoic acid (LA) is considered an "ideal antioxidant" due to its ability to scavenge reactive species, reset antioxidant levels and cross the blood-brain barrier. To investigate its protective effect we administered LA (i.p. 25, 50 and 100mg/kg) simultaneously with the pesticide mixture (PM) for 5weeks. After suppression of PM administration, we evaluated the restorative effect of LA for a further 5weeks. LA prevented OS and the production of nitrites+nitrates [NOx] caused by PM in a dose-dependent manner. The PM-induced decrease in reduced glutathione and α-tocopherol levels in all brain regions was completely restored by LA at both high doses. PM administration also caused an increase in prostaglandins E(2) and F(2α) in brain that was reduced by LA in a dose-dependent fashion. Taking into account the relationship between OS, inflammation and apoptosis, we measured caspase and calpain activity. Only milli- and micro-calpain isoforms were increased in the PM-treated group and LA reduced the activities to basal levels. We also demonstrated that interrupting PM administration is not enough to restore the levels of all the parameters measured and that LA is necessary to achieve basal status. In our experimental model LA displayed a protective role against pesticide-induced damage, suggesting that LA administration is a promising therapeutic strategy to cope with disorders suspected to be caused by OS generators, especially in brain.

  12. (R)-α-Lipoic Acid Protects Retinal Pigment Epithelial Cells from Oxidative Damage

    PubMed Central

    Voloboueva, Ludmila A.; Liu, Jiankang; Suh, Jung H.; Ames, Bruce N.; Miller, Sheldon S.


    PURPOSE To determine whether (R)-α-lipoic acid (LA) protects cultured human fetal retinal pigment epithelial (hfRPE) cells against oxidative injury and identify the pathways that may mediate protection. METHODS Cultured hfRPE cells were pretreated with various concentrations of LA for 14 to 16 hours followed by treatment with a chemical oxidant, tert-butylhydroperoxide (t-BuOOH; 0.8 mM, 3 hours). Reactive oxygen species (ROS) production and cell viability were measured using H2DCF and MTT assays, respectively. RPE cells were evaluated with fluorescent dyes (SYTOX Orange and SYTO Green; Molecular Probes, Eugene, OR), which differentiate between live and dead cells. Apoptosis was visualized by using the TUNEL assay. Changes in mitochondrial membrane potential were detected by JC-1 dye. Intracellular levels of reduced glutathione (GSH) and oxidized glutathione (GSSG) were measured by HPLC. Regulation of γ-glutamylcysteine ligase (GCL), the rate-controlling enzyme of GSH production, was assayed by RT-PCR. RESULTS Pretreatment of hfRPE cells with LA, 0.2 mM and 0.5 mM, significantly reduced the levels of t-BuOOH-induced intra-cellular ROS, by 23% and 49%, respectively. LA (0.5 mM) prevented oxidant-induced cell death and apoptosis and also increased the viability of oxidant-treated hfRPE cells from 38% to 90% of control. LA upregulated the mRNA expression of GCL, and was protective against t-BuOOH-induced decreases in both mitochondrial membrane potential and intracellular levels of GSH and GSH/GSSG. CONCLUSIONS The present study suggests that the protective effect of LA involves multiple pathways and that LA could be effective against age-associated increase in oxidative stress and mitochondrial dysfunction in RPE cells. PMID:16249512

  13. Effects of dietary supplementation of alpha-lipoic acid on early glomerular injury in diabetes mellitus.


    Melhem, M F; Craven, P A; Derubertis, F R


    Antioxidants, in particular vitamin E (VE), have been reported to protect against diabetic renal injury. alpha-Lipoic acid (LA) has been found to attenuate diabetic peripheral neuropathy, but its effects on nephropathy have not been examined. In the present study, parameters of glomerular injury were examined in streptozotocin diabetic rats after 2 mo on unsupplemented diets and in diabetic rats that received the lowest daily dose of dietary LA (30 mg/kg body wt), VE (100 IU/kg body wt), or vitamin C (VC; 1 g/kg body wt), which detectably increased the renal cortical content of each antioxidant. Blood glucose values did not differ among the diabetic groups. At 2 mo, inulin clearance, urinary albumin excretion, fractional albumin clearance, glomerular volume, and glomerular content of immunoreactive transforming growth factor-beta (TGF-beta) and collagen alpha1 (IV) all were significantly increased in unsupplemented D compared with age-matched nondiabetic controls. With the exception of inulin clearance, LA prevented or significantly attenuated the increase in all of these glomerular parameters in D, as well as the increases in renal tubular cell TGF-beta seen in D. At the dose used, VE reduced inulin clearance in D to control levels but failed to alter any of the other indices of glomerular injury or to suppress renal tubular cell TGF-beta in D. VC suppressed urinary albumin excretion, fractional albumin clearance, and glomerular volume but not glomerular or tubular TGF-beta or glomerular collagen alpha1 (IV) content. LA but not VE or VC significantly increased renal cortical glutathione content in D. These data indicate that LA is effective in the prevention of early diabetic glomerular injury and suggest that this agent may have advantages over high doses of either VE or VC.

  14. Effect of alpha-lipoic acid on relieving ammonia stress and hepatic proteomic analyses of broilers.


    Lu, M; Bai, J; Xu, B; Sun, Q Y; Wei, F X; Tang, X F; Zhang, H F; Li, J; Wang, G L; Yin, Q Q; Li, S Y


    Ammonia in poultry houses not only affects worker health but also induces a variety of poultry diseases. Alpha-lipoic acid (LA) is an effective antioxidant that protects cells against oxidative injury during various toxic and pathological processes. This study was designed to evaluate the mitigating effects of LA supplementation on ammonia stress and hepatic proteome changes in broilers. Male broilers (22 d old) were allocated to 3 groups: (1) a control group without ammonia stress (CTRL); (2) exposure to 70 ppm ammonia (AM); and (3) exposure to 70 ppm ammonia and dietary administration of 300 mg/kg LA (AM+LA). Ammonia exposure significantly decreased broiler growth performance and plasma glutathione peroxidase activity (P < 0.05), and increased plasma malondialdehyde content and glutamic-pyruvic transaminase activity (P < 0.05). These negative effects were eliminated by LA supplementation. Comparative proteomic analyses revealed 291 differentially expressed proteins in the AM group compared to the CTRL and AM+LA groups. A total of 30 proteins were differentially expressed between the AM/CTRL and (AM+LA)/AM groups. The addition of LA restored 24 of these proteins to control levels; these proteins were mainly related to transcription regulation, detoxification, protein translation and degradation, and immune and stress responses. The differentially expressed proteins included the high mobility group box (HMGB) and glutathione S-transferase (GST), which is closely related to immune response and oxidative stress, and collagens, which are implicated in liver injury. The addition of LA to broiler diet may reduce ammonia toxicity by maintaining the antioxidant system, xenobiotic metabolism, and metabolic pathways. © 2016 Poultry Science Association Inc.

  15. Bio-active nanoemulsions enriched with gold nanoparticle, marigold extracts and lipoic acid: In vitro investigations.


    Guler, Emine; Barlas, F Baris; Yavuz, Murat; Demir, Bilal; Gumus, Z Pinar; Baspinar, Yucel; Coskunol, Hakan; Timur, Suna


    A novel and efficient approach for the preparation of enriched herbal formulations was described and their potential applications including wound healing and antioxidant activity (cell based and cell free) were investigated via in vitro cell culture studies. Nigella sativa oil was enriched with Calendula officinalis extract and lipoic acid capped gold nanoparticles (AuNP-LA) using nanoemulsion systems. The combination of these bio-active compounds was used to design oil in water (O/W) and water in oil (W/O) emulsions. The resulted emulsions were characterized by particle size measurements. The phenolic content of each nanoemulsion was examined by using both colorimetric assay and chromatographic analyses. Two different methods containing cell free chemical assay (1-diphenyl-2-picrylhydrazyl method) and cell based antioxidant activity test were used to evaluate the antioxidant capacities. In order to investigate the bio-activities of the herbal formulations, in vitro cell culture experiments, including cytotoxicity, scratch assay, antioxidant activity and cell proliferation were carried out using Vero cell line as a model cell line. Furthermore, to monitor localization of the nanoemulsions after application of the cell culture, the cell images were monitored via fluorescence microscope after FITC labeling. All data confirmed that the enriched N. sativa formulations exhibited better antioxidant and wound healing activity than N. sativa emulsion without any enrichment. In conclusion, the incorporation of AuNP-LA and C. officinalis extract into the N. sativa emulsions significantly increased the bio-activities. The present work may support further studies about using the other bio-active agents for the enrichment of herbal preparations to strengthen their activities. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Alpha-lipoic acid protects against potassium cyanide-induced seizures and mortality.


    Abdel-Zaher, Ahmed O; Abdel-Hady, Randa H; Abdel Moneim, Wafaa M; Salim, Safa Y


    This study was proposed to investigate the potential protective effect of alpha-lipoic acid (α-LA) against potassium cyanide (KCN)-induced seizures and lethality in mice. The intraperitoneal ED(50) value of KCN, as measured by induction of clonic and tonic seizures was increased by pretreatment of mice with α-LA (25, 50 and 100 mg/kg) intraperitoneally in a dose-dependent manner. Similarly, the intraperitoneal LD(50) value of KCN, based on 24h mortality, was increased by pretreatment with α-LA in a dose-dependent manner. Intraperitoneal injection of the estimated ED(50) of KCN (4.8 mg/kg) into mice increased, 1h later, nitric oxide (NO) production and brain glutamate and malondialdehyde (MDA) levels. The estimated ED(50) of KCN also decreased brain intracellular reduced glutathione (GSH) level and glutathione peroxidase (GSH-Px) activity in these animals. Administration of the estimated LD(50) of KCN (6 mg/kg) produced, 24h later, similar marked biochemical alterations in surviving animals. Pretreatment of mice with α-LA inhibited; dose-dependently KCN (ED(50) and LD(50))-induced an increase in NO production and brain MDA level as well as a decrease in brain intracellular GSH level and GSH-Px activity. The elevation induced by KCN in brain glutamate level was not inhibited by α-LA. It can be concluded that the protective effect of α-LA against KCN-induced seizures and lethality may be due to inhibition of NO overproduction and maintenance of intracellular antioxidant defense mechanisms.

  17. Interaction of α-Lipoic Acid with the Human Na+/Multivitamin Transporter (hSMVT)*

    PubMed Central

    Zehnpfennig, Britta; Wiriyasermkul, Pattama; Carlson, David A.; Quick, Matthias


    The human Na+/multivitamin transporter (hSMVT) has been suggested to transport α-lipoic acid (LA), a potent antioxidant and anti-inflammatory agent used in therapeutic applications, e.g. in the treatment of diabetic neuropathy and Alzheimer disease. However, the molecular basis of the cellular delivery of LA and in particular the stereospecificity of the transport process are not well understood. Here, we expressed recombinant hSMVT in Pichia pastoris and used affinity chromatography to purify the detergent-solubilized protein followed by reconstitution of hSMVT in lipid bilayers. Using a combined approach encompassing radiolabeled LA transport and equilibrium binding studies in conjunction with the stabilized R-(+)- and S-(−)-enantiomers and the R,S-(+/−) racemic mixture of LA or lipoamide, we identified the biologically active form of LA, R-LA, to be the physiological substrate of hSMVT. Interaction of R-LA with hSMVT is strictly dependent on Na+. Under equilibrium conditions, hSMVT can simultaneously bind ∼2 molecules of R-LA in a biphasic binding isotherm with dissociation constants (Kd) of 0.9 and 7.4 μm. Transport of R-LA in the oocyte and reconstituted system is exclusively dependent on Na+ and exhibits an affinity of ∼3 μm. Measuring transport with known amounts of protein in proteoliposomes containing hSMVT in outside-out orientation yielded a catalytic turnover number (kcat) of about 1 s−1, a value that is well in agreement with other Na+-coupled transporters. Our data suggest that hSMVT-mediated transport is highly specific for R-LA at our tested concentration range, a finding with wide ramifications for the use of LA in therapeutic applications. PMID:25971966

  18. Attenuation of uremia by orally feeding alpha-lipoic acid on acetaminophen induced uremic rats.


    Pradhan, Shrabani; Mandal, Shreya; Roy, Suchismita; Mandal, Arpita; Das, Koushik; Nandi, Dilip K


    Uremia means excess nitrogenous waste products in the blood & their toxic effects. An acute acetaminophen (paracetamol, N-acetyl p-aminophenol; APAP) overdose may result into potentially fatal hepatic and renal necrosis in humans and experimental animals. The aims of this present study were to investigate the protective effect of alpha-lipoic acid (ALA) on oxidative stress & uremia on male albino rats induced by acetaminophen. The study was performed by 24 albino male Wister strain rats which were randomly divided into four groups: Group I, control - receives normal food and water, Groups II, III & IV receive acetaminophen interperitoneally at the dose of 500 mg/kg/day for 10 days, from 11th day Groups III & IV were treated with ALA at the dose of 5 mg & 10 mg/100 g/day for 15 days, respectively. After 25 days of treatment, it was observed that there was a significant increase in plasma urea, creatinine, sodium and malondialdehyde (MDA) levels (p < 0.05) but a significant decrease in super oxide dismutase (SOD) & catalase activity & potassium level in uremic group is compared with control group & there was a significant increase in SOD & catalase (p < 0.05) & a significant decrease in serum urea, creatinine & Na and MDA (p < 0.05) in Group III & Group IV is compared with Group II & significant changes were observed in high ALA dose group. In conclusion it was observed that the ALA has nephroprotective activities by biochemical observations against acetaminophen induced uremic rats.

  19. Interaction of α-Lipoic Acid with the Human Na+/Multivitamin Transporter (hSMVT).


    Zehnpfennig, Britta; Wiriyasermkul, Pattama; Carlson, David A; Quick, Matthias


    The human Na(+)/multivitamin transporter (hSMVT) has been suggested to transport α-lipoic acid (LA), a potent antioxidant and anti-inflammatory agent used in therapeutic applications, e.g. in the treatment of diabetic neuropathy and Alzheimer disease. However, the molecular basis of the cellular delivery of LA and in particular the stereospecificity of the transport process are not well understood. Here, we expressed recombinant hSMVT in Pichia pastoris and used affinity chromatography to purify the detergent-solubilized protein followed by reconstitution of hSMVT in lipid bilayers. Using a combined approach encompassing radiolabeled LA transport and equilibrium binding studies in conjunction with the stabilized R-(+)- and S-(-)-enantiomers and the R,S-(+/-) racemic mixture of LA or lipoamide, we identified the biologically active form of LA, R-LA, to be the physiological substrate of hSMVT. Interaction of R-LA with hSMVT is strictly dependent on Na(+). Under equilibrium conditions, hSMVT can simultaneously bind ~2 molecules of R-LA in a biphasic binding isotherm with dissociation constants (Kd) of 0.9 and 7.4 μm. Transport of R-LA in the oocyte and reconstituted system is exclusively dependent on Na(+) and exhibits an affinity of ~3 μm. Measuring transport with known amounts of protein in proteoliposomes containing hSMVT in outside-out orientation yielded a catalytic turnover number (kcat) of about 1 s(-1), a value that is well in agreement with other Na(+)-coupled transporters. Our data suggest that hSMVT-mediated transport is highly specific for R-LA at our tested concentration range, a finding with wide ramifications for the use of LA in therapeutic applications.

  20. Lipoic Acid Use and Functional Outcomes after Thrombolysis in Patients with Acute Ischemic Stroke and Diabetes

    PubMed Central

    Choi, Kang-Ho; Kim, Joon-Tae; Kim, Hyung-Seok; Kim, Ja-Hae; Nam, Tai-Seung; Choi, Seong-Min; Lee, Seung-Han; Kim, Byeong-Chae; Kim, Myeong-Kyu; Cho, Ki-Hyun


    Background Alpha-lipoic acid (aLA) is a strong antioxidant commonly used for treating diabetic polyneuropathy. Previously, we demonstrated the neurorestorative effects of aLA after cerebral ischemia in rats. However, its effects on patients with stroke remain unknown. We investigated whether patients treated with aLA have better functional outcomes after acute ischemic stroke (AIS) and reperfusion therapy than patients not receiving aLA. Methods In this retrospective study of 172 prospectively registered patients with diabetes and AIS treated with tissue plasminogen activator (tPA), we investigated the relationship between aLA use and functional outcome both after 3 months and after 1 year. The functional outcomes included occurrence of hemorrhagic transformation (HT), early neurological deterioration (END), and early clinical improvement (ECI). Favorable outcomes were defined as modified Rankin Scale (mRS) scores of 0–2. Results Of the 172 patients with AIS and diabetes, 47 (27.3%) used aLA. In the entire cohort, favorable outcomes occurred at significantly higher rates both at 3 months and at 1 year in those treated with aLA. The risks for END and HT were lower and the occurrence of ECI was higher in patients treated with aLA. In multivariable analysis, aLA use was associated with favorable outcomes both at 3 months and at 1 year. Age, HT, and increased National Institutes of Health Stroke Scale scores were negative predictors of a favorable outcome. Conclusions The use of aLA in patients with AIS and diabetes who are treated with tPA is associated with favorable outcomes. These results indicate that aLA could be a useful intervention for the treatment of AIS after reperfusion therapy. PMID:27677185

  1. Lipoic acid as an anti-inflammatory and neuroprotective treatment for Alzheimer's disease.


    Maczurek, Annette; Hager, Klaus; Kenklies, Marlene; Sharman, Matt; Martins, Ralph; Engel, Jürgen; Carlson, David A; Münch, Gerald


    Alzheimer's disease (AD) is a progressive neurodegenerative disorder that destroys patient memory and cognition, communication ability with the social environment and the ability to carry out daily activities. Despite extensive research into the pathogenesis of AD, a neuroprotective treatment - particularly for the early stages of disease - remains unavailable for clinical use. In this review, we advance the suggestion that lipoic acid (LA) may fulfil this therapeutic need. A naturally occurring cofactor for the mitochondrial enzymes pyruvate dehydrogenase and alpha-ketoglutarate dehydrogenase, LA has been shown to have a variety of properties which can interfere with the pathogenesis or progression of AD. For example, LA increases acetylcholine (ACh) production by activation of choline acetyltransferase and increases glucose uptake, thus supplying more acetyl-CoA for the production of ACh. LA chelates redox-active transition metals, thus inhibiting the formation of hydroxyl radicals and also scavenges reactive oxygen species (ROS), thereby increasing the levels of reduced glutathione. In addition, LA down-regulates the expression of redox-sensitive pro-inflammatory proteins including TNF and inducible nitric oxide synthase. Furthermore, LA can scavenge lipid peroxidation products such as hydroxynonenal and acrolein. In human plasma, LA exists in an equilibrium of free and plasma protein bound form. Up to 150 muM, it is bound completely, most likely binding to high affinity fatty acid sites on human serum albumin, suggesting that one large dose rather than continuous low doses (as provided by "slow release" LA) will be beneficial for delivery of LA to the brain. Evidence for a clinical benefit for LA in dementia is yet limited. There are only two published studies, in which 600 mg LA was given daily to 43 patients with AD (receiving a standard treatment with choline-esterase inhibitors) in an open-label study over an observation period of up to 48 months. Whereas

  2. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury

    PubMed Central

    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue


    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries. PMID:27314327

  3. The role of lipoic acid in the protection against of metallic pollutant effects in the shrimp Litopenaeus vannamei (Crustacea, Decapoda).


    Lobato, Roberta Oliveira; Nunes, Silvana Manske; Wasielesky, Wilson; Fattorini, Daniele; Regoli, Francesco; Monserrat, José Marìa; Ventura-Lima, Juliane


    The effects of cadmium (Cd) and arsenic (As), dosed alone or in combination have been poorly investigated in crustaceans. Besides, it is not known if dietary supplementation of exogenous antioxidants, like lipoic acid (LA), might prevent or even reverse toxic effects of Cd and As. The objective of the present study was to evaluate the role of lipoic acid in modulating biochemical responses after Cd and As exposures in Litopenaeus vannamei. Muscle from shrimp exposed to Cd alone or Cd+As showed a decrease in glutathione (GSH) levels, while the pre-treatment with LA reversed this situation. In this tissue, the pre-treatment with LA also induced an increase in glutathione-S-transferase (GST) activity in all groups. In hepatopancreas it was observed a marked accumulation of Cd and As, a decrease in the reactive oxygen species (ROS) concentration in response to Cd exposure alone (-LA); concomitant in the same group it was observed an increment of metallothionein-like content. As exposure induced an increase in GSH levels but LA reversed this increase. Also, LA showed to increase the GST activity in all groups treated. Besides, in this organ LA showed to augment total antioxidant competence. Obtained results indicate that LA can be used as a chemo-protectant against oxidative insults in shrimp.

  4. The disulfide compound α-lipoic acid and its derivatives: A novel class of anticancer agents targeting mitochondria.


    Dörsam, Bastian; Fahrer, Jörg


    The endogenous disulfide α-lipoic acid (LA) is an essential mitochondrial co-factor. In addition, LA and its reduced counterpart dihydro lipoic acid form a potent redox couple with antioxidative functions, for which it is used as dietary supplement and therapeutic. Recently, it has gained attention due to its cytotoxic effects in cancer cells, which is the key aspect of this review. We initially recapitulate the dietary occurrence, gastrointestinal absorption and pharmacokinetics of LA, illustrating its diverse antioxidative mechanisms. We then focus on its mode of action in cancer cells, in which it triggers primarily the mitochondrial pathway of apoptosis, whereas non-transformed primary cells are hardly affected. Furthermore, LA impairs oncogenic signaling and displays anti-metastatic potential. Novel LA derivatives such as CPI-613, which target mitochondrial energy metabolism, are described and recent pre-clinical studies are presented, which demonstrate that LA and its derivatives exert antitumor activity in vivo. Finally, we highlight clinical studies currently performed with the LA analog CPI-613. In summary, LA and its derivatives are promising candidates to complement the arsenal of established anticancer drugs due to their mitochondria-targeted mode of action and non-genotoxic properties. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Acetyl-L-carnitine and α-lipoic acid affect rotenone-induced damage in nigral dopaminergic neurons of rat brain, implication for Parkinson's disease therapy.


    Zaitone, Sawsan A; Abo-Elmatty, Dina M; Shaalan, Aly A


    Although the mechanisms of neurodegeneration in Parkinson's disease are not fully understood, mitochondrial dysfunction, oxidative stress and environmental toxins may be involved. The current research was directed to investigate the protective role of two bioenergetic antioxidants, acetyl-L-carnitine and α-lipoic acid, in rotenone-parkinsonian rats. Ninety six male rats were divided into five groups. Group I is the vehicle-injected group, group II is the disease control group and was injected with six doses of rotenone (1.5 mg/kg/48 h, s.c.). Groups III, IV and V received rotenone in addition to acetyl-L-carnitine (100 mg/kg/day, p.o.), α-lipoic acid (50 mg/kg/day, p.o.) or their combination, respectively. Results showed that rotenone-treated rats exhibited bradykinesia and motor impairment in the open-field and square bridge tests. In addition, ATP level was decreased whereas lipid peroxides and protein carbonyls increased in the striata of rotenone-treated rats as compared to vehicle-treated rats. Treatment with acetyl-L-carnitine or α-lipoic acid improved the motor performance and reduced the level of lipid peroxides in rat brains as compared to rotenone group. Further, ATP production was enhanced along with acetyl-L-carnitine treatments (p≤0.05). Taken together, our study reinforces the view that acetyl-L-carnitine and α-lipoic acid are promising candidates for neuroprotection in Parkinson's disease.

  6. Age-dependent modulation of synaptic plasticity and insulin mimetic effect of lipoic acid on a mouse model of Alzheimer's disease.


    Sancheti, Harsh; Akopian, Garnik; Yin, Fei; Brinton, Roberta D; Walsh, John P; Cadenas, Enrique


    Alzheimer's disease is a progressive neurodegenerative disease that entails impairments of memory, thinking and behavior and culminates into brain atrophy. Impaired glucose uptake (accumulating into energy deficits) and synaptic plasticity have been shown to be affected in the early stages of Alzheimer's disease. This study examines the ability of lipoic acid to increase brain glucose uptake and lead to improvements in synaptic plasticity on a triple transgenic mouse model of Alzheimer's disease (3xTg-AD) that shows progression of pathology as a function of age; two age groups: 6 months (young) and 12 months (old) were used in this study. 3xTg-AD mice fed 0.23% w/v lipoic acid in drinking water for 4 weeks showed an insulin mimetic effect that consisted of increased brain glucose uptake, activation of the insulin receptor substrate and of the PI3K/Akt signaling pathway. Lipoic acid supplementation led to important changes in synaptic function as shown by increased input/output (I/O) and long term potentiation (LTP) (measured by electrophysiology). Lipoic acid was more effective in stimulating an insulin-like effect and reversing the impaired synaptic plasticity in the old mice, wherein the impairment of insulin signaling and synaptic plasticity was more pronounced than those in young mice.

  7. Development of Sensitive Analytical Approach for the Quantification of α-Lipoic Acid Using Boron Doped Diamond Electrode.


    Stankovic, Dalibor M; Mehmeti, Eda; Kalcher, Kurt


    A boron doped diamond (BDD) electrode was investigated for use as an electrochemical sensor for α-lipoic acid (LA) using amperometric and differential pulse voltammetric detection. LA displays a well expressed oxidation peak at +0.9 V vs. Ag/AgCl in solutions with a pH value of 3. It was found that signals obtained are linearly related to the concentration range from 0.3 to 105 μM with detection limit of 0.088 μM. Interferences by common compounds such as ascorbic acid, uric acid and dopamine were tested and the method was successfully applied to the determination of LA in human body fluids where it gave recoveries in the range from 95 to 97%.

  8. Effect of alpha lipoic acid on smoking-induced skin damage.


    Yıldırım Baş, Funda; Bayram, Dilek; Arslan, Bahriye; Armağan, Ilkay; Yeşilot, Şükriye; Çiçek, Emine; Yorgancıgil, Emre


    Exposed to cigarette leads to the formation of reactive oxygen species and the generation of bioactive molecules that can damage skin cells. This investigation was carried out to study possible effects of Alpha Lipoic Acid (ALA) on smoking-induced rat skin injury. 28 Spraque-Dawley female rats were allocated into three groups: control group (n = 8), smoking group (n = 10; 12 cigarettes/day, 8 weeks) and smoking + ALA group (n = 10; 12 cigarettes/day + 100 mg/kg, 8 weeks). Experiment group animals were sacrificed under anaesthesia with 10%ketamine + 2%xylasine at the end of second mounts and then skin examples were taken from the epigastric area. Histochemical (Haematoxylin-Eosin and Masson's trichrome, immunohistochemical (TNF-α) and biochemical analysis (CAT, MDA and protein carbonylation) were performed on these skin tissues. Histologically, skin was distinguished normal structure in the control group. In the smoking group, collagen bundles and hair follicle degradation/reduction, sweat gland degeneration, mononuclear cell infiltration in dermis were encountered. In ALA-treated group, all of these changes were improved (p < 0.05). Collagen bundles structures were appearance more regular than the smoking group . Immunohistologically, intense staining was observed in the smoking group, while very weak staining was observed in control group, weak staining was observed in the ALA-treated group. Biochemically; The CAT activity compared to cigarette group with control was raised high and in ALA group was higher compared to both groups, but not significant (p > 0.05). MDA; which is indicator of lipid peroxidation was significantly higher in cigarette group than in control group (p < 0.05) and was significantly lower in ALA group than cigarette (p < 0.05). Protein carbonylation was higher in cigarette group than the control group but not in the non-significant (p > 0.05). In the ALA it was significantly lower compared to the

  9. Effect of alpha lipoic acid on retinal ganglion cell survival in an optic nerve crush model

    PubMed Central

    Liu, Ruixing; Wang, Yanling; Pu, Mingliang


    Purpose This study was conducted to determine whether alpha lipoic acid (ALA) promotes the survival of retinal ganglion cells (RGCs) in a rat model of optic nerve crush (ONC) injury and to investigate the neuroprotective mechanisms of ALA in the retina in this ONC injury model. Methods Adult male Sprague-Dawley rats (180–220 g) were subjected to ONC injury surgery. ALA (63 mg/kg) was injected intravenously 1 day before or after the ONC injury. Animals were euthanized after 10 days, and the number of ganglion cells positive for RNA-binding protein with multiple splicing (Rbpms), which is an RGC marker, were counted on the whole mount retinas. In addition, immunofluorescence and immunoblotting were performed to examine the localization and levels of erythropoietin receptor (EPOR) and neurotrophin-4/5 (NT4/5) in the retinas in all experimental groups. To determine whether the EPO/EPOR signaling pathway was involved in the ALA antioxidant pathway, the rats were subjected to ruxolitinib (INCB018424, 0.25 mg/kg, bid, intraperitoneal, i.p.) treatment after the animals were injected intravenously with ALA 1 day before ONC injury. Results The average number of Rbpms-positive cells/mm2 in the control group (sham-operated group), the ONC group, the ALA-ONC group, and the ONC-ALA group retinas was 2219±28, 418±8, 848±22, and 613±18/mm2, respectively. The ALA-ONC and ONC-ALA groups showed a statistically significantly increased RGC survival rate compared to the ONC group. There were statistical differences in the RGC survival rates between the ALA-ONC (39%) and ONC-ALA groups (28%; p<0.05). Immunofluorescent labeling showed that EPOR and NT4/5 expression was significant in the retinal ganglion cell layer (GCL). At the same time, western blot analysis revealed that ALA induced upregulation of EPOR protein and NT4/5 protein expression in the retina after ONC injury. However, INCB018424 reversed the protective effects of ALA on the ONC retinas. Conclusions ALA has

  10. Alpha Lipoic Acid Attenuates Radiation-Induced Thyroid Injury in Rats

    PubMed Central

    Jung, Jung Hwa; Jung, Jaehoon; Kim, Soo Kyoung; Woo, Seung Hoon; Kang, Ki Mun; Jeong, Bae-Kwon; Jung, Myeong Hee; Kim, Jin Hyun; Hahm, Jong Ryeal


    Exposure of the thyroid to radiation during radiotherapy of the head and neck is often unavoidable. The present study aimed to investigate the protective effect of α-lipoic acid (ALA) on radiation-induced thyroid injury in rats. Rats were randomly assigned to four groups: healthy controls (CTL), irradiated (RT), received ALA before irradiation (ALA + RT), and received ALA only (ALA, 100 mg/kg, i.p.). ALA was treated at 24 h and 30 minutes prior to irradiation. The neck area including the thyroid gland was evenly irradiated with 2 Gy per minute (total dose of 18 Gy) using a photon 6-MV linear accelerator. Greater numbers of abnormal and unusually small follicles in the irradiated thyroid tissues were observed compared to the controls and the ALA group on days 4 and 7 after irradiation. However, all pathologies were decreased by ALA pretreatment. The quantity of small follicles in the irradiated rats was greater on day 7 than day 4 after irradiation. However, in the ALA-treated irradiated rats, the numbers of small and medium follicles were significantly decreased to a similar degree as in the control and ALA-only groups. The PAS-positive density of the colloid in RT group was decreased significantly compared with all other groups and reversed by ALA pretreatment. The high activity index in the irradiated rats was lowered by ALA treatment. TGF-ß1 immunoreactivity was enhanced in irradiated rats and was more severe on the day 7 after radiation exposure than on day 4. Expression of TGF-ß1 was reduced in the thyroid that had undergone ALA pretreatment. Levels of serum pro-inflammatory cytokines (TNF-α, IL-1ß and IL-6) did not differ significantly between the all groups. This study provides that pretreatment with ALA decreased the severity of radiation-induced thyroid injury by reducing inflammation and fibrotic infiltration and lowering the activity index. Thus, ALA could be used to ameliorate radiation-induced thyroid injury. PMID:25401725

  11. DHL‑TauZnNa, a newly synthesized α-lipoic acid derivative, induces autophagy in human colorectal cancer cells.


    Hiratsuka, Takahiro; Inomata, Masafumi; Kono, Yohei; Yokoyama, Shigeo; Shiraishi, Norio; Kitano, Seigo


    In recent years, several antioxidant substances have been found to have an antiproliferative effect on various types of carcinomas. α-lipoic acid (ALA) induces apoptosis in several types of cancer cell lines, but it is difficult to apply α-lipoic acid in clinical use as it is easily oxidized and unstable. Recently, we succeeded in synthesizing the α-lipoic acid derivative sodium N-[6,8-dimercaptooctanoyl]-2-aminoethanesulfonate zinc complex (DHL-TauZnNa), which has highly stable antioxidant effects. We investigated whether DHL-TauZnNa elicits its antiproliferative effects in vivo and in vitro by inducing apoptosis, autophagy or cell cycle arrest, and we analyzed the expression of proteins related to these phenomena and their phosphorylation in HT-29 human colon cancer cells. Subcutaneously administered DHL-TauZnNa treatment applied daily for 41 days significantly inhibited tumor growth by 43% in a xenograft mouse model (P=0.0271). DHL-TauZnNa significantly reduced cell viability over that of controls in the trypan-blue exclusion test in a time- and dose-dependent manner (P<0.05). DHL-TauZnNa increased the proportion of cells in S phase and decreased that of cells in G0/G1 phase in the cell cycle analysis of HT-29 cells. Although DHL-TauZnNa did not increase caspase-3/7 activity and DNA fragmentation in flow cytometry analysis, it increased the expression of microtubule-associated protein light chain 3-II. Autophagosomes and autolysosomes were observed by electron microscopy in the cytoplasm of HT-29 cells treated with DHL-TauZnNa. These results suggest that DHL-TauZnNa inhibited the proliferation of HT-29 cells through the mechanisms of G2/M cell cycle arrest and autophagy but not that of apoptosis. The newly synthesized ALA derivative DHL-TauZnNa may be expected to become a novel cancer therapeutic strategy through its induction of autophagy.

  12. Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant potential and lipid stability of meat

    PubMed Central


    Background Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. Methods The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. Results The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010–11 & 2011–12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. Conclusion In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio

  13. EPA, DHA, and Lipoic Acid Differentially Modulate the n-3 Fatty Acid Biosynthetic Pathway in Atlantic Salmon Hepatocytes.


    Bou, Marta; Østbye, Tone-Kari; Berge, Gerd M; Ruyter, Bente


    The aim of the present study was to investigate how EPA, DHA, and lipoic acid (LA) influence the different metabolic steps in the n-3 fatty acid (FA) biosynthetic pathway in hepatocytes from Atlantic salmon fed four dietary levels (0, 0.5, 1.0 and 2.0%) of EPA, DHA or a 1:1 mixture of these FA. The hepatocytes were incubated with [1-(14)C] 18:3n-3 in the presence or absence of LA (0.2 mM). Increased endogenous levels of EPA and/or DHA and LA exposure both led to similar responses in cells with reduced desaturation and elongation of [1-(14)C] 18:3n-3 to 18:4n-3, 20:4n-3, and EPA, in agreement with reduced expression of the Δ6 desaturase gene involved in the first step of conversion. DHA production, on the other hand, was maintained even in groups with high endogenous levels of DHA, possibly due to a more complex regulation of this last step in the n-3 metabolic pathway. Inhibition of the Δ6 desaturase pathway led to increased direct elongation to 20:3n-3 by both DHA and LA. Possibly the route by 20:3n-3 and then Δ8 desaturation to 20:4n-3, bypassing the first Δ6 desaturase step, can partly explain the maintained or even increased levels of DHA production. LA increased DHA production in the phospholipid fraction of hepatocytes isolated from fish fed 0 and 0.5% EPA and/or DHA, indicating that LA has the potential to further increase the production of this health-beneficial FA in fish fed diets with low levels of EPA and/or DHA.

  14. [Mechanism of alpha-lipoic acid in treating TNBS-induced colitis in mice].


    Sun, J; Sun, M J


    Objective: To investigate whether α-lipoic acid (ALA) regulates autophagy in the pathogenesis of colitis through the mammalian target of rapamycin (mTOR) signaling pathway. Methods: Balb/c mouse colitis model was induced with 2, 4, 6-trinitrobenzenesulfonic acid (TNBS). Male Balb/c mice (22-25 g) were divided into four groups: control group, ALA group, colitis group, and ALA treatment group, with 10 mice in each group. ALA was administered at a dose of 80 mg/kg once a day for 7 days. The colon weight index, the disease activity index (DAI) and the histologic degeneration score (HDS) of colon tissue in each group were calculated. The autophagy gene Beclin-1 mRNA level was detected by RT-PCR. The levels of mTOR, phosphorylated mTOR (p-mTOR), and Beclin-1 proteins were detected by Western blot. Results: Compared with the control group, there was no statistically significant difference in colon weight index in the ALA group[(9.21±0.57)vs(8.91±0.91)g/kg, P>0.05], but increased in the colitis group [(12.65±1.33)g/kg, P<0.05] and decreased in the ALA treatment group [(10.04±1.02)g/kg, P<0.05]; there were no significant differences in DAI or HDS in the ALA group, but significantly increased in the colitis group, and decreased in the ALA treatment group (all P<0.05). The Beclin-1 mRNA and protein levels showed no significant differences between the control and the ALA groups (1.00±0.12 vs 1.05±0.05, 1.00±0.11 vs 1.00±0.06). However, the expression of Beclin-1 was significantly decreased in the colitis group compared to the control group (0.51±0.07 vs 1.00±0.12, 0.52±0.07 vs 1.00±0.11, both P<0.05), but significantly increased in the ALA treatment group compared to the colitis group (1.75±0.09 vs 0.51±0.07, 1.82±0.14 vs 0.52±0.07, both P<0.05). The mTOR total protein levels were not significantly different among the four groups, but the p-mTOR level was significantly higher in the colitis group than in the control group (3.07±0.20 vs 1.00±0.07), and

  15. Alpha-Lipoic acid increases energy expenditure by enhancing adenosine monophosphate-activated protein kinase-peroxisome proliferator-activated receptor-gamma coactivator-1alpha signaling in the skeletal muscle of aged mice

    USDA-ARS?s Scientific Manuscript database

    Skeletal muscle mitochondrial dysfunction is associated with aging and diabetes, which decreases respiratory capacity and increases reactive oxygen species. Lipoic acid (LA) possesses antioxidative and antidiabetic properties. Metabolic action of LA is mediated by activation of adenosine monophospha...

  16. The protective effect of lipoic acid on selected cardiovascular diseases caused by age-related oxidative stress.


    Skibska, Beata; Goraca, Anna


    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system.

  17. The Protective Effect of Lipoic Acid on Selected Cardiovascular Diseases Caused by Age-Related Oxidative Stress

    PubMed Central

    Goraca, Anna


    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system. PMID:25949771

  18. The effect of lipoic acid on macro and trace metal levels in living tissues exposed to oxidative stress.


    Ciftci, Harun; Bakal, Unal


    Environmental pollution resulting from fast-paced industrialization, various chemicals used in agriculture, additives in food, smoking and use of alcohol, radiation, some viruses and poor dietary habits all have currently increased the incidence and types of cancer. Polycyclic hydrocarbons are an example of this type of carcinogens. Living things are exposed to this free radical-increasing substance due to various reasons. Oxidative stress caused by reactive oxygen species has an important place in the etiology of cancer, which develops in relation to many factors. Injury caused by cancer in the organism may affect other organs, as well as the tumors organs and tissues. In addition, it is known that some changes take place in the content of macro and trace elements due to cancer in the organism. Our study is intended to explore the protective role of alpha-lipoic acid, which has antioxidant characteristics in living tissues exposed to oxidative stress, in the macro and trace element levels.

  19. Design, synthesis and evaluation of PEGylated lipoic acid derivatives with functionality as potent anti-melanogenic agents.


    Lu, Chichong; Kim, Bo-Mi; Chai, Kyu Yun


    The novel PEGylated lipoic acid (LA) derivatives with functionality were synthesized in satisfactory yield by simple procedures and evaluated about its anti-melanogenic activity on the B16F10 melanoma cells. Grafting a PEG moiety onto the carboxyl group of LA has reduced the cell cytotoxicity and provided the water solubility and functionality to incorporate the other bioactive moieties. We have found that derivatives showed inhibition of melanin formation by up to 36.5% at 0.1 mM, whereas LA decreased the melanin formation by 8.6%. In addition, it also inhibits at least 86.4% UV-induced MMP-1 expression at 0.1 mM which is higher than LA. These data suggest that the novel PEGylated LA derivatives with functionality may thus serve as a potentially effective anti-melanogenic and anti-aging agent.

  20. Simultaneous determination of the endogenous free α-lipoic acid and dihydrolipoic acid in human plasma and erythrocytes by RP-HPLC coupled with electrochemical detector.


    Khan, Muhammad Imran; Iqbal, Zafar; Khan, Abad


    A highly sensitive, precise, and accurate reversed-phase high performance liquid-chromatography/electrochemical detection method for simultaneous determination of the endogenous free α-lipoic acid and dihydrolipoic acid in biological matrices is presented. The two analytes are extracted from samples with acetonitrile-10% m-phosphoric acid solution(aqueous) (50:50 v/v). To determine the total lipoic acid, samples are treated with tris(2-carboxyethyl)phosphine solution in phosphate buffer: pH 2.5 with 85% o-phosphoric acid prior to deproteination. The two analytes are separated on a C18 (150 × 4.6 mm, 5 μm) analytical column using acetonitrile-50 mM phosphate buffer: pH 2.5 with 85% o-phosphoric acid (35:65 v/v) as the isocratic mobile phase pumped at a flow rate of 2.0 ml/min at the column oven temperature of 35 °C. The column eluents are monitored at a potential of 0.9 V. These analytes are efficiently resolved in <7 min.

  1. Impact of mutations within the [Fe-S] cluster or the lipoic acid biosynthesis pathways on mitochondrial protein expression profiles in fibroblasts from patients.


    Lebigot, E; Gaignard, P; Dorboz, I; Slama, A; Rio, M; de Lonlay, P; Héron, B; Sabourdy, F; Boespflug-Tanguy, O; Cardoso, A; Habarou, F; Ottolenghi, C; Thérond, P; Bouton, C; Golinelli-Cohen, M P; Boutron, A


    Lipoic acid (LA) is the cofactor of the E2 subunit of mitochondrial ketoacid dehydrogenases and plays a major role in oxidative decarboxylation. De novo LA biosynthesis is dependent on LIAS activity together with LIPT1 and LIPT2. LIAS is an iron‑sulfur (Fe-S) cluster-containing mitochondrial protein, like mitochondrial aconitase (mt-aco) and some subunits of respiratory chain (RC) complexes I, II and III. All of them harbor at least one [Fe-S] cluster and their activity is dependent on the mitochondrial [Fe-S] cluster (ISC) assembly machinery. Disorders in the ISC machinery affect numerous Fe-S proteins and lead to a heterogeneous group of diseases with a wide variety of clinical symptoms and combined enzymatic defects. Here, we present the biochemical profiles of several key mitochondrial [Fe-S]-containing proteins in fibroblasts from 13 patients carrying mutations in genes encoding proteins involved in either the lipoic acid (LIPT1 and LIPT2) or mitochondrial ISC biogenesis (FDX1L, ISCA2, IBA57, NFU1, BOLA3) pathway. Ten of them are new patients described for the first time. We confirm that the fibroblast is a good cellular model to study these deficiencies, except for patients presenting mutations in FDX1L and a muscular clinical phenotype. We find that oxidative phosphorylation can be affected by LA defects in LIPT1 and LIPT2 patients due to excessive oxidative stress or to another mechanism connecting LA and respiratory chain activity. We confirm that NFU1, BOLA3, ISCA2 and IBA57 operate in the maturation of [4Fe-4S] clusters and not in [2Fe-2S] protein maturation. Our work suggests a functional difference between IBA57 and other proteins involved in maturation of [Fe-S] proteins. IBA57 seems to require BOLA3, NFU1 and ISCA2 for its stability and NFU1 requires BOLA3. Finally, our study establishes different biochemical profiles for patients according to their mutated protein. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Lipoic acid modified low molecular weight polyethylenimine mediates nontoxic and highly potent in vitro gene transfection.


    Zheng, Meng; Zhong, Yinan; Meng, Fenghua; Peng, Rui; Zhong, Zhiyuan


    The clinical success of gene therapy intimately relies on the development of safe and efficient gene carrier systems. We found here that 1.8 kDa polyethylenimine (PEI) following hydrophobic modification with lipoic acid (LA) mediated nontoxic and highly potent in vitro gene transfection in both HeLa and 293T cells. 1.8 kDa PEI-LA conjugates were prepared with controlled degree of substitution (DS) by coupling LA to PEI using carbodiimide chemistry. Gel electrophoresis measurements showed that the DNA binding ability of 1.8 kDa PEI was impaired by lipoylation, in which an N/P ratio of 2/1 and 4-6/1 was required for 1.8 kDa PEI and 1.8 kDa PEI-LA conjugates, respectively, to completely inhibit DNA migration. Interestingly, dynamic light scattering measurements (DLS) revealed that PEI-LA conjugates condensed DNA into much smaller sizes (183-84 nm) than unmodified 1.8 kDa PEI (444-139 nm) at N/P ratios ranging from 20/1 to 60/1. These polyplexes revealed similar surface charges of ca. +22 to +30 mV. 1.8 kDa PEI-LA(2) polyplexes formed at an N/P ratio of 10/1 were stable against exchange with 12-fold excess of negatively charged dextran sodium sulfate (DSS) relative to DNA phosphate groups while 1.8 kDa PEI controls dissociated at 6-fold excess of DSS, indicating that lipoylation of 1.8 kDa PEI resulted in stronger binding with DNA. Importantly, DNA was released from 1.8 kDa PEI-LA(2) polyplexes upon addition of 10 mM dithiothreitol (DTT). Reduction-triggered unpacking of 1.8 kDa PEI-LA(2) polyplexes was also confirmed by DLS. MTT assays demonstrated that all PEI-LA conjugates and polyplexes were essentially nontoxic to HeLa and 293T cells up to a tested concentration of 50 μg/mL and an N/P ratio of 80/1, respectively. The in vitro gene transfection studies in HeLa and 293T cells showed that lipoylation of 1.8 kDa PEI markedly boosted its transfection activity. For example, 1.8 kDa PEI-LA(2) polyplexes displayed 400-fold and 500-fold higher levels of gene expression

  3. Thermoregulatory and cardiovascular responses to creatine, glycerol and alpha lipoic acid in trained cyclists

    PubMed Central


    Background It has been shown that supplementation with creatine (Cr) and glycerol (Gly), when combined with glucose (Glu) necessary for the enhancement of Cr uptake by skeletal muscle, induces significant improvements in thermoregulatory and cardiovascular responses during exercise in the heat. Purpose To determine whether Cr/Gly-induced thermoregulatory and cardiovascular responses are maintained when the majority (~75%) of the Glu in the Cr/Gly supplement is replaced with the insulintropic agent alpha lipoic acid (Ala). Methods 22 healthy endurance trained cyclists were randomly assigned to receive either 20 g/day (4 × 5 g/day) of Cr, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly and 150 g/day (4 × 37.5 g/day) of Glu or 20 g/day (4 × 5 g/day) of Cr monohydrate, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly (100 g/day (4 × 25 g/day) of Glu and 1000 mg/day (4 × 250 mg/day) of Ala for 7 days for 7 days. Exercise trials were conducted pre- and post-supplementation and involved 40 min of constant-load cycling exercise at 70% O2 max by a self-paced 16.1 km time trial at 30°C and 70% relative humidity. Results Median and range values of TBW increased significantly by 2.1 (1.3-3.3) L and 1.8 (0.2-4.6) L in Cr/Gly/Glu and Cr/Gly/Glu/Ala groups respectively (P = 0.03) and of BM not significantly by 1.8 (0.2-3.0) kg and 1.2 (0.5-2.1) kg in Cr/Gly/Glu and in Cr/Gly/Glu/Ala, respectively (P = 0.75). During constant load exercise, heart rate (HR) and core temperature (Tcore) were significantly lower post-supplementation: HR was reduced on average by 3.3 ± 2.1 beats/min and by 4.8 ± 3.3 beats/min (mean ± SD) and Tcore by 0.2 ± 0.1 (mean ± SD) in the Cr/Gly/Glu and Cr/Gly/Glu/Ala, respectively The reduction in HR and Tcore was not significantly different between the supplementation groups. Conclusions In comparison to the established hyper hydrating Cr

  4. Thermoregulatory and cardiovascular responses to creatine, glycerol and alpha lipoic acid in trained cyclists.


    Polyviou, Thelma P; Pitsiladis, Yannis P; Lee, Wu Chean; Pantazis, Takas; Hambly, Catherine; Speakman, John R; Malkova, Dalia


    It has been shown that supplementation with creatine (Cr) and glycerol (Gly), when combined with glucose (Glu) necessary for the enhancement of Cr uptake by skeletal muscle, induces significant improvements in thermoregulatory and cardiovascular responses during exercise in the heat. To determine whether Cr/Gly-induced thermoregulatory and cardiovascular responses are maintained when the majority (~75%) of the Glu in the Cr/Gly supplement is replaced with the insulintropic agent alpha lipoic acid (Ala). 22 healthy endurance trained cyclists were randomly assigned to receive either 20 g/day (4 × 5 g/day) of Cr, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly and 150 g/day (4 × 37.5 g/day) of Glu or 20 g/day (4 × 5 g/day) of Cr monohydrate, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly (100 g/day (4 × 25 g/day) of Glu and 1000 mg/day (4 × 250 mg/day) of Ala for 7 days for 7 days. Exercise trials were conducted pre- and post-supplementation and involved 40 min of constant-load cycling exercise at 70% O2 max by a self-paced 16.1 km time trial at 30°C and 70% relative humidity. Median and range values of TBW increased significantly by 2.1 (1.3-3.3) L and 1.8 (0.2-4.6) L in Cr/Gly/Glu and Cr/Gly/Glu/Ala groups respectively (P = 0.03) and of BM not significantly by 1.8 (0.2-3.0) kg and 1.2 (0.5-2.1) kg in Cr/Gly/Glu and in Cr/Gly/Glu/Ala, respectively (P = 0.75). During constant load exercise, heart rate (HR) and core temperature (Tcore) were significantly lower post-supplementation: HR was reduced on average by 3.3 ± 2.1 beats/min and by 4.8 ± 3.3 beats/min (mean ± SD) and Tcore by 0.2 ± 0.1 (mean ± SD) in the Cr/Gly/Glu and Cr/Gly/Glu/Ala, respectively The reduction in HR and Tcore was not significantly different between the supplementation groups. In comparison to the established hyper hydrating Cr/Gly/Glu supplement, supplement containing Cr/Gly/Ala and

  5. The effect of lipoic acid on wound healing in a full thickness uterine injury model in rats.


    Micili, Serap Cilaker; Goker, Asli; Sayin, Oya; Akokay, Pinar; Ergur, Bekir Uğur


    Aim of this study was to investigate the effects of lipoic acid on uterine wound healing by immunohistochemical and biochemical assay in a rat uterine horn model with full thickness injury. Thirty-two female Wistar albino rats were randomised into five groups: Control group, with no intervention; uterine scar group 15days (US15d), uterine scar group 15 days + alpha lipoic acid (ALA) (US15d + ALA), uterine scar group 30 days (US30d) and uterine scar group 30 days + ALA (US30 days + ALA). After uterine incision 100 mg/kg of ALA was administered by oral gavage for either 15 or 30 days. Vascular endothelial growth factor (VEGF) and alpha smooth muscle actin (α-SMA) distribution were evaluated by immunohistochemical methods in tissue and ELISA methods in tissue homogenate. The percentage of α-SMA positive area in US15d + ALA and US30d + ALA groups was significantly higher than US15 and US30d groups. The percentage of VEGF positive area in US15d + ALA group was significantly higher than US15d group and US30d + ALA group was significantly higher than US30d group. Biochemically, α-SMA was significantly higher in the US15d + ALA group when compared to US15d group and higher in US30d + ALA group when compared to US30d group. VEGF was significantly higher in US15d + ALA and US30d + ALA groups when compared to US15 and US30d groups. In conclusion, ALA was found to be effective in enhancing wound healing in uterine full thickness injury.

  6. Alpha-Lipoic Acid Alleviates Acute Inflammation and Promotes Lipid Mobilization During the Inflammatory Response in White Adipose Tissue of Mice.


    Guo, Jun; Gao, Shixing; Liu, Zhiqing; Zhao, Ruqian; Yang, Xiaojing


    Recently, white adipose tissue has been shown to exhibit immunological activity, and may play an important role in host defense and protection against bacterial infection. Αlpha-lipoic acid (α-LA) has been demonstrated to function as an anti-inflammatory and anti-oxidant agent. However, its influence on the inflammatory response and metabolic changes in white adipose tissue remains unknown. We used male C57BL/6 mice as models to study the effect of α-LA on the inflammatory response and metabolic changes in white adipose tissue after stimulation with lipopolysaccharide (LPS). The non-esterified fatty acid content was measured by an automatic biochemical analyzer. The expression of inflammation-, lipid- and energy metabolism-related genes and proteins was determined by quantitative real-time polymerase chain reaction and western blotting. The results indicated that α-LA significantly decreased the epididymis fat weight index and the non-esterified fatty acid content in plasma compared with the control group. LPS significantly increased the expression of inflammation genes and α-LA reduced their expression. The LPS-induced expression of nuclear factor-κB protein was decreased by α-LA. Regarding lipid metabolism, α-LA significantly counteracted the inhibitory effects of LPS on the expression of hormone-sensitive lipase gene and protein. α-LA evidently increased the gene expression of fatty acid transport protein 1 and cluster of differentiation 36. Regarding energy metabolism, α-LA significantly increased the expression of most of mitochondrial DNA-encoded genes compared with the control and LPS group. Accordingly, α-LA can alleviate acute inflammatory response and this action may be related with the promotion of lipid mobilization in white adipose tissue.

  7. Palladium alpha-lipoic acid complex formulation enhances activities of Krebs cycle dehydrogenases and respiratory complexes I-IV in the heart of aged rats.


    Sudheesh, N P; Ajith, T A; Janardhanan, K K; Krishnan, C V


    Age-related decline in the capacity to withstand stress, such as ischemia and reperfusion, results in congestive heart failure. Though the mechanisms underlying cardiac decay are not clear, age dependent somatic damages to mitochondrial DNA (mtDNA), loss of mitochondrial function, and a resultant increase in oxidative stress in heart muscle cells may be responsible for the increased risk for cardiovascular diseases. The effect of a safe nutritional supplement, POLY-MVA, containing the active ingredient palladium alpha-lipoic acid complex, was evaluated on the activities of the Krebs cycle enzymes such as isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, and malate dehydrogenase as well as mitochondrial complexes I, II, III, and IV in heart mitochondria of aged male albino rats of Wistar strain. Administration of 0.05 ml/kg of POLY-MVA (which is equivalent to 0.38 mg complexed alpha-lipoic acid/kg, p.o), once daily for 30 days, was significantly (p<0.05) effective to enhance the Krebs cycle dehydrogenases, and mitochondrial electron transport chain complexes. The unique electronic and redox properties of palladium alpha-lipoic acid complex appear to be a key to this physiological effectiveness. The results strongly suggest that this formulation might be effective to protect the aging associated risk of cardiovascular and neurodegenerative diseases.

  8. The use of alpha-lipoic acid (ALA), gamma linolenic acid (GLA) and rehabilitation in the treatment of back pain: effect on health-related quality of life.


    Ranieri, M; Sciuscio, M; Cortese, A M; Santamato, A; Di Teo, L; Ianieri, G; Bellomo, R G; Stasi, M; Megna, M


    The aim of this trial was to evaluate the effects of alpha-lipoic acid (ALA) and gamma-linolenic acid (GLA) and the beneficial effect of physical exercise on positive sensory symptoms and neuropathic pain in patients with compressive radiculopathy syndrome from disc-nerve root conflict. Often these painful syndromes after the acute event, tend to recurr becoming subacute or chronic syndromes that become for the period of interest disabiling is an event very important in these cases proper prevention, based on a maintenance drug therapy and the strengthening exercises of paravertebral muscles, flexibility exercises on the spine and when needed on the reduction of body weight. In this Observational Cohort, two-arm trial, 203 patients were enrolled and divided into two groups, the first, ALA and GLA group, (n = 101) received oral dose of 600 mg of alpha-lipoic acid (ALA) and 360 mg of gamma-linolenic acid (GLA) and a rehabilitation program for six weeks, the second (n = 102) treated with only rehabilitation program. Patients were recruited at the centre of Physical Medicine and Rehabilitation, they underwent a physiatric examination at the primary outcome (t0) and secondary outcomes were recorded at monitoring visits scheduled at two weeks = t1, four weeks = t2, six weeks = t3, and at the same has been administered the following scale: VAS scale, SF-36, Oswestry Low Back Pain Disability Questionnaire, Aberdeen Back Pain Scale (ABPS), Revised Leeds Disability Questionnaire (LDQ), Roland and Morris Disability Questionnaire. Significant improvements was noted in the ALA and GLA group for paresthesia, stabbing and burning pain, as showed by VAS (Visual Analogue Scale), Oswestry Low Back Pain Disability Questionnaire, Aberdeen Low Back Pain Scale; also, improvements of quality of life has been noted, in the same group, as showed by SF-36, LDQ (Revised Leeds Disability Questionnaire), Roland and Morris disability questionnaire. All these outcome measure showed statistically

  9. Effect of combined acetylmethionine, cyanocobalamin and α-lipoic acid on hepatic metabolism in high-yielding dairy cow.


    Fiore, Enrico; Perillo, Laura; Piccione, Giuseppe; Gianesella, Matteo; Bedin, Silvia; Armato, Leonardo; Giudice, Elisabetta; Morgante, Massimo


    The aim of the study reported in this Research Communication was to investigate the effect of a combined acetylmethionine, cyanocobalamin and α-lipoic acid treatment, on some metabolic parameters of early lactating high-yielding dairy cows. Thirty cows were randomly divided into two groups: experimental group (EG, n = 20) and control group (CG, n = 10). EG received 20 ml of treatment and CG received 20 ml of placebo. The treatments were administered for seven times every 2 d. Blood samples were collected from all cows at 3 time points: 10 ± 2, 30 ± 2 and 50 ± 2 d postpartum. Glucose, β-hydroxybutyrate (BHB), nonesterified fatty acids (NEFA), triglycerides, total cholesterol (TC), alanine aminotransferase (ALT), aspartate aminotransferase (AST), γ-glutamiltransferase (GGT), total bilirubin (TB), conjugated bilirubin (CB), total proteins (TP), globulins, albumin and urea concentrations were determined. Two-way repeated measure analysis of variance was applied. Significant differences in the values of glucose, BHB, NEFA, triglycerides, TC, AST and urea were found between EG and CG. Moreover, the increased glucose, TC, ALT, GGT, TP and globulins, and the reduced BHB, NEFA, AST, triglycerides, TB, CB and urea concentrations were evident in both groups, but the changes were more pronounced in EG. Our findings indicate that our treatment positively influenced liver metabolism in high-yielding dairy cows.

  10. Effects of Alpha-Lipoic Acid Supplementation on Plasma Adiponectin Levels and Some Metabolic Risk Factors in Patients with Schizophrenia.


    Vidović, Bojana; Milovanović, Srđan; Stefanović, Aleksandra; Kotur-Stevuljević, Jelena; Takić, Marija; Debeljak-Martačić, Jasmina; Pantović, Maja; Đorđević, Brižita


    Adiponectin is an adipocyte-derived plasma protein with insulin-sensitizing and anti-inflammatory properties and is suggested to be a biomarker of metabolic disturbances. The aim of this study was to investigate the effects of alpha-lipoic acid (ALA) on plasma adiponectin and some metabolic risk factors in patients with schizophrenia. The plasma adipokine levels (adiponectin and leptin), routine biochemical and anthropometric parameters, markers of oxidative stress, and the serum phospholipid fatty acid profile in eighteen schizophrenic patients at baseline, in the middle, and at the end of a 3-month long supplementation period with ALA (500 mg daily) were determined. A significant increase in the plasma adiponectin concentrations, as well as a decrease in fasting glucose and aspartate aminotransferase activity (AST), was found. Baseline AST activity was independently correlated with the adiponectin concentrations. Our data show that ALA can improve plasma adiponectin levels and may play a potential role in the treatment of metabolic risk factor in patients with schizophrenia. Future randomized controlled trials are needed to confirm these preliminary investigations.

  11. Effect of γ-Cyclodextrin Inclusion Complex on the Absorption of R-α-Lipoic Acid in Rats

    PubMed Central

    Uchida, Ryota; Iwamoto, Kosuke; Nagayama, Suetada; Miyajima, Atsushi; Okamoto, Hinako; Ikuta, Naoko; Fukumi, Hiroshi; Terao, Keiji; Hirota, Takashi


    R-α-lipoic acid (RLA) is an endogenous organic acid, and works as a cofactor for mitochondrial enzymes and as a kind of antioxidant. Inclusion complexes of RLA with α-, β- or γ-cyclodextrins (CD) were prepared and orally administered as a suspension to rats. Among them, RLA/γ-CD showed the highest plasma exposure, and its area under the plasma concentration-time curve (AUC) of RLA was 2.2 times higher than that after oral administration of non-inclusion RLA. On the other hand, the AUC after oral administration of non-inclusion RLA and RLA/γ-CD to pylorus-ligated rats did not differ. However, the AUC after intraduodenal administration of RLA/γ-CD was 5.1 times higher than that of non-inclusion RLA, and was almost comparable to the AUC after intraduodenal administration of RLA-Na solution. Furthermore, the AUC after intraduodenal administration of RLA/γ-CD was not affected by biliary ligation or co-administration of an amylase inhibitor. These findings demonstrated that RLA was absorbed from the small intestine effectively when orally administered as a γ-CD inclusion complex, which could be easily dissolved in the lumen of the intestine. In conclusion, γ-CD inclusion complex is an appropriate formulation for supplying RLA as a drug or nutritional supplement with respect to absorption. PMID:25946345

  12. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    PubMed Central

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory


    It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks. PMID:24944020

  13. Prophylactic action of lipoic acid on oxidative stress and growth performance in broilers at risk of developing ascites syndrome.


    Díaz-Cruz, Antonio; Serret, Maurilio; Ramírez, Guadalupe; Avila, Ernesto; Guinzberg, Raquel; Piña, Enrique


    The objective of this study was to assess the effects of dietary supplementation with lipoic acid (LA) on broilers maintained at 2235 m above sea level with high risk to develop ascites syndrome (AS). A total of 2040 chicks were fed under commercial conditions with water and specific diets ad libitum during 7 weeks in two consecutive experiments. Mortality and indicators of performance and oxidative stress were compared weekly in broilers fed a basal diet plus 0, 10, 20, or 40 parts/10(6) LA. The effects of LA at 40 parts/10(6) were also studied during the initial 3 weeks or the last 4 weeks of the production cycle. Diets supplemented with 40 parts/10(6) of LA during 7 weeks significantly improved feed conversion, decreased general mortality and mortality attributable to AS, and lowered thiobarbituric acid reactive substances and hydroxyl radicals in liver, and increased total glutathione pool. Smaller doses or shorter periods of exposure to LA were partially effective. In conclusion, LA under our experimental conditions has a prophylactic action in broilers with high risk to develop AS due to oxygen availability limitation.

  14. Differential efficiency of simvastatin and lipoic acid treatments on Bothrops jararaca envenomation-induced acute kidney injury in mice.


    Barone, Juliana Marton; Alponti, Rafaela Fadoni; Frezzatti, Rodrigo; Zambotti-Villela, Leonardo; Silveira, Paulo Flávio


    Snake bite accidents by Bothrops genus is an important public health issue in Brazil and one of its most serious complications is the acute kidney injury (AKI). Here we evaluated the effects of Bothrops jararaca venom (vBj) and the treatments with lipoic acid (LA) and simvastatin (SA) on renal function, aminopeptidase (AP) activities and renal redox status. Primordial events for establishment of AKI by vBj were hyperuricemia, hypercreatinemia, urinary hyperosmolality, renal oxidative stress and reduction of hematocrit and protein content in the membrane of renal cortex and medulla and in the plasma. In the renal cortex and medulla the changes caused by vBj in soluble and membrane-bound AP activities had a similar pattern. The beneficial effects of LA and SA on envenomed mice were similar on the hyperuricemia, renal oxidative stress and reduction of hematocrit. LA mitigated the hypercreatinemia, but exacerbated the urinary urea and creatinine, whereas SA mitigated the decrease of plasma urea, urinary hyperosmolality and hypercreatinuria induced by vBj. The beneficial effects of LA and especially of SA on renal effects of vBj open a new perspective for clinical investigations of these drugs as coadjuvant agents in the serotherapy of Bothrops envenomation.

  15. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B1-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers

    PubMed Central

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun


    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B1 (AFB1). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB1. In the AFB1 group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB1 group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  16. α-Lipoic acid (α-LA) inhibits the transcriptional activity of interferon regulatory factor 1 (IRF-1) via SUMOylation.


    Sun, Tao; Gao, Fuyu; Lin, Xiaoyan; Yu, Ruixiang; Zhao, Yong; Luan, Jingjie; Li, Hongyan; Song, Mingzhu


    Osteoarthritis (OA), one of the most common joint disorders, is one of the leading causes of disability among the elderly. Proinflammatory cytokines, such as interleukin (IL)-1β, which is synthesized locally by synovial cells and chondrocytes, have been shown to play a critical role in sustaining cartilage damage in arthritis by creating an imbalance between cartilage degradation and the repair process. Alpha-lipoic acid (α-LA), which is synthesized in animal and plant tissues, has demonstrated its protective effects in a variety of diseases. However, whether or not LA has a protective effect in OA is still unknown. In this study, we found that α-LA inhibits the IL-1β-induced increase in matrix metallopeptidase 3 (MMP-3) and matrix metallopeptidase 13 (MMP-13) expression and activity. Our data also demonstrate that interferon regulatory factor 1 (IRF-1) participates in the induction of MMP-3 and MMP-13. However, α-LA treatment did not change IRF-1 levels. Importantly, we found that α-LA increases SUMOylation of IRF-1, which attenuates IRF-1's transcriptional activity. Finally, we found that α-LA treatment leads to an increase in SUMO-1, but not in SUMO-2 or SUMO-3. Taken together, this study shows that α-LA exerts anti-inflammatory effects in an IL-1β-stimulated chondrocyte model, thereby suggesting a potential protective effect of α-LA in OA.

  17. Tolerability in the elderly population of high-dose alpha lipoic acid: a potential antioxidant therapy for the eye

    PubMed Central

    Sarezky, Daniel; Raquib, Aaishah R; Dunaief, Joshua L; Kim, Benjamin J


    Purpose Alpha lipoic acid (ALA) is an antioxidant and iron-chelating supplement that has potential benefits for geographic atrophy in dry age-related macular degeneration as well as other eye diseases. The purpose of this study was to determine the tolerability of ALA in the elderly population. Patients and methods Fifteen subjects, age ≥65 years, took sequential ALA doses of 600, 800, and 1,200 mg. Each dose was taken once daily with a meal for 5 days. After each dose was taken by the subjects for 5 days, the subjects were contacted by phone, a review of systems was performed, and they were asked if they thought they could tolerate taking that dose of ALA for an extended period of time. Results The 600 mg dose was well tolerated. At the 800 mg dose, one subject had an intolerable flushing sensation. At the 1,200 mg dose, two subjects had intolerable upper gastrointestinal side effects and one subject had an intolerable flushing sensation. Subjects taking gastrointestinal prophylaxis medications had no upper gastrointestinal side effects. Conclusion High-dose ALA is not completely tolerated by the elderly. These preliminary data suggest that gastrointestinal prophylaxis may improve tolerability. (, NCT02613572). PMID:27729766

  18. The neuroprotective benefit from pioglitazone (PIO) addition on the alpha lipoic acid (ALA)-based treatment in experimental diabetic rats.


    Jin, Heung Yong; Lee, Kyung Ae; Wu, Jin Zu; Baek, Hong Sun; Park, Tae Sun


    In this study, we investigated the combined effect of pioglitazone (PIO) with alpha lipoic acid (ALA) on the peripheral nerves of diabetic rats. Animals were divided into 8 groups (N = 6-8) and designated according to ALA (100 mg/kg/day) and PIO (10 mg/kg/day) treatment: Normal, Normal + ALA, Normal + PIO, Normal + ALA + PIO, DM, DM + ALA, DM + PIO, and DM + ALA + PIO. After 24 weeks, current perception threshold, mechanical allodynia, oxidative stresses, intraepidermal nerve fiber density (IENFD), and axonal morphology in the sciatic nerve were compared among groups. IENFD in the DM + ALA + PIO group was significantly less reduced than in other DM groups (7.61 ± 0.52 vs. 5.62 ± 0.96, 5.56 ± 0.60, and 7.10 ± 0.70 for DM, DM + ALA, and DM + PIO, respectively P < 0.05). The mean myelinated axonal area in the sciatic nerves was significantly higher in the DM + ALA + PIO group compared with non-treated DM group (70.2 ± 3.46 vs. 61.1 ± 2.91, P < 0.05) although significant differences were not present between combination therapy and monotherapy independent of ALA or PIO. Our results demonstrated that combination therapy using PIO based on ALA can give an additional benefit in peripheral nerve preservation in diabetes. Moreover, PIO can be preferentially considered when additional glucose-lowering agent is required in DPN patients treated with ALA.

  19. Ammonia-induced oxidative damage in neurons is prevented by resveratrol and lipoic acid with participation of heme oxygenase 1.


    Bobermin, Larissa Daniele; Wartchow, Krista Minéia; Flores, Marianne Pires; Leite, Marina Concli; Quincozes-Santos, André; Gonçalves, Carlos-Alberto


    Ammonia is a metabolite that, at high concentrations, is implicated in neurological disorders, such as hepatic encephalopathy (HE), which is associated with acute or chronic liver failure. Astrocytes are considered the primary target of ammonia toxicity in the central nervous system (CNS) because glutamine synthetase (GS), responsible for ammonia metabolism in CNS, is an astrocytic enzyme. Thus, neuronal dysfunction has been associated as secondary to astrocytic impairment. However, we demonstrated that ammonia can induce direct effects on neuronal cells. The cell viability was decreased by ammonia in SH-SY5Y cells and cerebellar granule neurons. In addition, ammonia induced increased reactive oxygen species (ROS) production and decreased GSH intracellular content, the main antioxidant in CNS. As ammonia neurotoxicity is strongly associated with oxidative stress, we also investigated the potential neuroprotective roles of the antioxidants, resveratrol (RSV) and lipoic acid (LA), against ammonia toxicity in cerebellar granule neurons. RSV and LA were able to prevent the oxidative damage induced by ammonia, maintaining the levels of ROS production and GSH close to basal values. Both antioxidants also decreased ROS production and increased GSH content under basal conditions (in the absence of ammonia). Moreover, we showed that heme oxygenase 1 (HO1), a protein associated with protection against stress conditions, is involved in the beneficial effects of RSV and LA in cerebellar granule neurons. Thus, this study reinforces the neuroprotective effects of RSV and LA. Although more studies in vivo are required, RSV and LA could represent interesting therapeutic strategies for the management of HE.

  20. Modulation of antioxidant and detoxifying capacity in fish Cyprinus carpio (Cyprinidae) after treatment with nanocapsules containing lipoic acid.


    Longaray-Garcia, Márcia; Flores, Juliana Artigas; Külkamp-Guerreiro, Irene Clemes; Guterres, Sílvia Stanisçuaski; Pereira, Talita Carneiro Brandão; Bogo, Maurício Reis; Monserrat, José Maria


    Lipoic acid (LA) is a water- and lipid-soluble molecule with capacity to pass through cell membranes and with several antioxidant properties. Previous studies have shown that polymeric nanocapsules with LA favor the protection of this antioxidant, increasing their physical and chemical stability compared to formulations containing free LA. The aim of this study was to evaluate and compare the effect of free LA and LA-nanocapsules on antioxidant enzymes, the concentration of reduced glutathione (GSH) and a by-product of lipid peroxidation (malondialdehyde), as well as the expression of gene coding for different forms of glutathione-S-transferase (GST) in model fish. For this, carp Cyprinus carpio (Cyprinidae) were exposed (i.p.) to different forms of LA (free and in nanocapsules) for different times (48h, 96h and 1week) and the brain, liver and muscle were analyzed. Results indicated that the organs respond differently depending on the time and form in which LA was delivered. After 96h and 1week, a better antioxidant response was found generally in the formulation with nanocapsules. The nanocapsule composition showed to be a factor to be considered in future studies, because in some organs and exposure times empty nanocapsules promoted an antioxidant effect and in others a pro-oxidant effect.

  1. Effects of alpha-lipoic acid supplementation on growth performance, antioxidant capacity and biochemical parameters for ammonia-exposed broilers.


    Lu, Min; Bai, Jie; Wei, Fengxian; Xu, Bin; Sun, Quanyou; Li, Jie; Wang, Gaili; Tang, Xiangfang; Zhang, Hongfu; Yin, Qingqiang; Li, Shaoyu


    In order to estimate the effect of alpha-lipoic acid (LA) supplementation on relieving ammonia stress of broilers, 180 22-day-old male broilers were assigned to three groups, six replicates in each group and 10 birds per replicate. The three groups were: (1) a control group without ammonia stress; (2) exposure to 70 ppm atmospheric ammonia (AM); (3) exposure to 70 ppm atmospheric ammonia and administration of 300 mg/kg LA (AM + LA). The experimental period was 3 weeks. Results showed that average daily weight gain was increased and feed conversion ratio was decreased in the AM + LA group, compared with the AM group (P < 0.05). Total superoxide dismutase and glutathione peroxidase activities in serum, and glutathione content in liver were higher in the AM + LA group than that in the AM group (P < 0.05); however, serum malondialdehyde content was decreased by LA addition (P < 0.05). Additionally, serum glutamic-pyruvic transaminase, creatine kinase and lactate dehydrogenase activities were reduced and albumin level was increased by LA addition (P < 0.05). In conclusion, LA addition could relieve ammonia stress to restore broiler production performance to normal levels. © 2016 Japanese Society of Animal Science.

  2. Effects of lipoic acid on AMPK and adiponectin in adipose tissue of low- and high-fat-fed rats.


    Prieto-Hontoria, Pedro L; Pérez-Matute, Patricia; Fernández-Galilea, Marta; Alfredo Martínez, J; Moreno-Aliaga, María J


    Lipoic acid (LA) is an antioxidant with antiobesity and antidiabetic properties. Adiponectin is an adipokine with potent anti-inflammatory and insulin-sensitizing properties. AMP-activated protein kinase (AMPK) is a key enzyme involved in cellular energy homeostasis. Activation of AMPK has been considered as a target to reverse the metabolic abnormalities associated with obesity and type 2 diabetes. The aim of this study was to determine the effects of LA on AMPK phosphorylation and adiponectin production in adipose tissue of low-fat (control diet) and high-fat diet-fed rats. Dietary supplementation with LA reduced body weight and adiposity in control and high-fat-fed rats. LA also reduced basal hyperinsulinemia as well as the homeostasis model assessment (HOMA) levels, an index of insulin resistance, in high-fat-fed rats, which was in part independent of their food intake lowering actions. Furthermore, AMPK phosphorylation was increased in white adipose tissue (WAT) from LA-treated rats as compared with pair-fed animals. Dietary supplementation with LA also upregulated adiponectin gene expression in WAT, while a negative correlation between adiposity-corrected adiponectin levels and HOMA index was found. Our present data suggest that the ability of LA supplementation to prevent insulin resistance in high-fat diet-fed rats might be related in part to the stimulation of AMPK and adiponectin in WAT.

  3. UPEI-400, a conjugate of lipoic acid and scopoletin, mediates neuroprotection in a rat model of ischemia/reperfusion.


    Connell, Barry J; Saleh, Monique C; Rajagopal, Desikan; Saleh, Tarek M


    Previously, our laboratory provided evidence that lipoic acid (LA) covalently bonded to various antioxidants, resulted in enhanced neuroprotection compared to LA on its own. The naturally occurring compound scopoletin, a coumarin derivative, has been shown in various in vitro studies to have both antioxidant and anti-inflammatory mechanism of actions. The present investigation was designed to determine if scopoletin on its own, or a co-drug consisting of LA and scopoletin covalently bonded together, named UPEI-400, would be capable of demonstrating a similar neuroprotective efficacy. Using a rat stroke model, male rats were anesthetized (Inactin(®); 100 mg/kg, iv), the middle cerebral artery was permanently occluded for 6 h (pMCAO), or in separate animals, occluded for 30 min followed by 5.5 h of reperfusion (ischemia/reperfusion; I/R). Pre-administration of either scopoletin or UPEI-400 significantly decreased infarct volume in the I/R model (p < 0.05), but not in the pMCAO model of stroke. UPEI-400 was ∼1000 times more potent compared to scopoletin alone. Since UPEI-400 was only effective in a model of I/R, it is possible that it may act to enhance neuronal antioxidant capacity and/or upregulate anti-inflammatory pathways to prevent the neuronal cell death. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Alfa-lipoic acid protects testosterone secretion pathway and sperm quality against 4-tert-octylphenol induced reproductive toxicity.


    Othman, Azza I; El-Missiry, Mohamed A; Koriem, Khaled M; El-Sayed, Aml A


    The protective effect of α-lipoic acid (LA) (50 mg/kg bw) against 4-tert-octylphenol (OP) (50 mg/kg bw) induced reproductive toxicity in male rats was studied. LA was injected 1h prior to OP administration three times a week. OP caused significant increase in oxidative stress in hypothalamus and epididymal sperm, disturbed hormonal levels in serum, decreased sperm quality, increased DNA fragmentation and loss of 35 and 95 kDa proteins in sperm, as well as elevated proliferating index in testis. LA protected against oxidative stress through promoting the levels of glutathione and glutathione-S-transferase in hypothalamus and sperm. In addition, LA prevented the decrease in testosterone, dehydroepiandrosterone sulfate, 3β-hydroxysteroid dehydrogenase, and inhibited the elevations in sex-hormone-binding globulin levels and showed normal sperm quality. LA modulated proliferation of germ cell, protected against DNA fragmentation and maintained membrane protein organization in the sperm. In conclusion, LA normalized oxidative stress and protected testosterone synthesis pathway across hypothalamus-testicular axis and sperm quality indicating its defensive influence against OP-induced oxidative reproductive dysfunction in male rats.

  5. Alpha-lipoic acid protects against cisplatin-induced ototoxicity via the regulation of MAPKs and proinflammatory cytokines.


    Kim, Jeongho; Cho, Hyun-Ju; Sagong, Borum; Kim, Se-Jin; Lee, Jae-Tae; So, Hong-Seob; Lee, In-Kyu; Kim, Un-Kyung; Lee, Kyu-Yup; Choo, Yon-Sik


    Cisplatin is an effective antineoplastic drug that is widely used to treat various cancers; however, it causes side effects such as ototoxicity via the induction of apoptosis of hair cells in the cochlea. Alpha-lipoic acid (ALA) has been reported to exert a protective effect against both antibiotic-induced and cisplatin-induced hearing loss. Therefore, this study was conducted to (1) elucidate the mechanism of the protective effects of ALA against cisplatin-induced ototoxicity using in vitro and ex vivo culture systems of HEI-OC1 auditory cells and rat cochlear explants and (2) to gain additional insight into the apoptotic mechanism of cisplatin-induced ototoxicity. ALA pretreatment significantly reduced apoptotic cell death of the inner and outer hair cells in cisplatin-treated organ of Corti explants and attenuated ototoxicity via marked inhibition of the increase in the expression of IL-1β and IL-6, the phosphorylation of ERK and p38, the degradation of IκBα, the increase in intracellular levels of ROS, and the activation of caspase-3 in cisplatin-treated HEI-OC1 cells. This study represents the first histological evaluation of the organ of Corti following treatment with ALA, and these results indicate that the protective effects of ALA against cisplatin-induced ototoxicity are mediated via the regulation of MAPKs and proinflammatory cytokines. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Biochemical responses over time in common carp Cyprinus carpio (Teleostei, Cyprinidae) during fed supplementation with α-lipoic acid.


    Enamorado, Alain D; Martins, Atila C; Flores, Juliana A; Tesser, Marcelo Borges; Caldas, Sergiane S; Primel, Ednei G; Monserrat, José Maria


    The current study aimed to evaluate the influence of lipoic acid (LA) supplementation (439.84±6.71 mg LA/kg feed) on antioxidants responses throughout the time in intestine, liver and muscle of juvenile common carp Cyprinus carpio. Two experimental groups were fed during four weeks with a diet with or without LA. Glutathione-S-transferase (GST) activity, glutathione (GSH) content, antioxidant capacity against peroxyl radicals (ACAP) and lipid peroxidation (TBARS) were evaluated in these organs. Also, a technique to measure protein disulfide bonds and sulfhydryl groups was optimized for intestine samples. GST activity was significantly higher (p<0.05) in intestine after two weeks of supplementation. GSH content was also significantly higher (p<0.05) in intestine, liver and muscle of fish fed with LA after two and three weeks, respectively. Total capacity antioxidant against peroxyl radicals was significantly increased (p<0.05) in the muscle of animals fed with LA after the fourth week. Concentration of disulfide bonds was higher in the intestine of fish fed with LA but this group also showed higher concentration of sulfhydryl groups (p<0.05). It is concluded that supplementation with LA is a safe strategy to induce antioxidant responses and improves the antioxidant status in different organs of common carp. Two week of supplementation are required to induce antioxidant responses in intestine and liver and three week for muscle.

  7. The protective effect of alpha lipoic acid on Schwann cells exposed to constant or intermittent high glucose.


    Sun, Lian-Qing; Chen, Ying-Ying; Wang, Xuan; Li, Xiao-Jin; Xue, Bing; Qu, Ling; Zhang, Ting-Ting; Mu, Yi-Ming; Lu, Ju-Ming


    Diabetic peripheral neuropathy (DPN) is one of the most common and costly microvascular complications of diabetes, and no effective therapy exists. Previous studies have demonstrated that oxidative stress may be the unifying factor for the damaging effect of hyperglycemia. The aim of this study was to examine the impact of treatment with Alpha lipoic acid (ALA) on the intermittent high glucose (IHG) or high glucose (HG)-induced oxidative stress-induced mitochondrial pathway activation and Schwann cells (SCs) apoptosis in vitro. Our results suggested that IHG and HG induced SCs apoptosis in both caspase-dependent and caspase-independent pathways related to oxidative stress. More importantly, the cytotoxic effect of IHG was significantly more potent than that of HG. Treatment with ALA inhibited the IHG and HG-induced oxidative stress and apoptosis in SCs. Furthermore, treatment with ALA down-regulated the Bax expression and the release of cytochrome c and AIF translocation, but up-regulated the Bcl-2 expression in SCs. Treatment with ALA attenuated the activation of caspase-3 and caspase-9 and minimized the cleavage of PARP in SCs. These findings suggest that variability in glycemic control could be more deleterious than a constant HG and ALA antagonized the IHG-induced oxidative stress, activation of mitochondrial pathway and apoptosis in SCs.

  8. Effects of α-lipoic acid therapy on sympathetic heart innervation in patients with previous experience of transient takotsubo cardiomyopathy.


    Marfella, Raffaele; Barbieri, Michelangela; Sardu, Celestino; Rizzo, Maria Rosaria; Siniscalchi, Mario; Paolisso, Pasquale; Ambrosino, Maria; Fava, Ilaria; Materazzi, Crescenzo; Cinquegrana, Giorgio; Gottilla, Rossella; Elia, Luigi Raffaele; D'andrea, Davide; Coppola, Antonino; Rambaldi, Pier Francesco; Mauro, Ciro; Mansi, Luigi; Paolisso, Giuseppe


    Takotsubo syndrome is a stress cardiomyopathy, characterized by reversible left ventricle (LV) apical ballooning in the absence of significant angiographic coronary artery stenosis. The frequent association with emotional stress suggests in this disease an autonomic nervous system involvement. We could think that a therapeutic treatment targeting heart sympathetic dysfunction could be of crucial importance. From January 2010 to June 2012, 886 patients were consecutively evaluated at Cardarelli Hospital, Naples, Italy. Among these, 48 patients met takotsubo cardiomyopathy (TCM) criteria. Each patient was assessed with history and physical examination, 12-lead electrocardiogram, serum troponin, coronary arteriography, and left ventricular angiogram, perfusion myocardial scintigraphy with technetium 99m, with echocardiography and 123I-metaiodobenzylguanidine (MIBG) myocardial scintigraphy. At discharge, the surviving patients were randomly assigned to α-lipoic acid (ALA) treatment (600mg once daily) or placebo. Following discharge, after the initial TCM event, patients returned to our outpatient clinic at Internal Medicine of the Second University Naples for the follow-up evaluation quarterly until 12 months. Routine analysis, myocardial damage serum markers, oxidative stress serum markers, pro-inflammatory cytokines, and sympathetic tone activity were evaluated in all patients. ALA administration improved MIBG defect size at 12 months compared to placebo. Adrenergic cardiac innervation dysfunction in TCM patients persists after previous experience of transient stress-induced cardiac dysfunction. ALA treatment improves the adrenergic cardiac innervation. This study evaluates whether sympatho-vagal alterations are TCM event-related. Copyright © 2015 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

  9. Proteomic and biochemical responses of canola (Brassica napus L.) exposed to salinity stress and exogenous lipoic acid.


    Yıldız, Mustafa; Akçalı, Nermin; Terzi, Hakan


    To evaluate the mitigating effects of exogenous lipoic acid (LA) on NaCl toxicity, proteomic, biochemical and physiological changes were investigated in the leaves of canola (Brassica napus L.) seedlings. Salinity stress decreased the growth parameters and contents of ascorbate (AsA) and glutathione (GSH), and increased the contents of malondialdehyde (MDA), proline, cysteine and the activities of antioxidant enzymes such as superoxide dismutase (SOD), guaiacol peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX). The foliar application of LA alleviated the toxic effects of salinity stress on canola seedlings and notably decreased MDA content and increased growth parameters, cysteine content, and activities of CAT and POD. In the proteomic analyses, total proteins from the leaves of control, LA, NaCl and NaCl+LA treated-seedlings were separated using two-dimensional gel electrophoresis (2-DE). A total of 28 proteins were differentially expressed. Of these, 21 proteins were successfully identified by MALDI-TOF/TOF MS. These proteins had functions related to photosynthesis, stress defense, energy metabolism, signal transduction, protein folding and stabilization indicating that LA might play important roles in salinity through the regulation of photosynthesis, stress defense and signal transduction related proteins. The proteomic findings have provided new insight to reveal the effect of LA on salinity stress for the first time.

  10. α-Lipoic Acid in Soluplus(®) Polymeric Nanomicelles for Ocular Treatment of Diabetes-Associated Corneal Diseases.


    Alvarez-Rivera, Fernando; Fernández-Villanueva, David; Concheiro, Angel; Alvarez-Lorenzo, Carmen


    α-Lipoic acid (ALA) is a powerful antioxidant valuable for prevention and treatment of ophthalmic complications such as diabetic keratopathy and retinopathy. The aim of this work was to develop micelle-based formulations that can enhance the solubility, stability, and corneal permeability of ALA. Compared to a conventional surfactant (sodium dioctylsulfosuccinate), Soluplus(®) (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol copolymer) led to smaller micelles (70-80 vs. 240-528 nm) with improved ability to solubilize ALA, maintaining ocular compatibility (Hens Egg Test on the Chorio-Allantoic Membrane). Soluplus nanomicelles enhanced more than 10-fold ALA solubility compared to common eye drops and withstood strong dilution in lachrymal fluid, filtration through sterilizing membranes, and freeze-drying. Interestingly, Soluplus nanomicelle formulation prepared with 1 or 2 mM block copolymer concentration exhibited in situ gelling capability and transformed into weak gels at 35°C, which is expected to increase corneal residence time. Bovine corneal permeability revealed that Soluplus nanomicelles notably enhanced ALA accumulation into the cornea as well as flux of drug toward the receptor chamber. Overall, these findings point out Soluplus nanomicelles as suitable carriers of ALA that may exhibit improved performance compared to currently available eye drop solutions.

  11. Mixed micelles of lipoic acid-chitosan-poly(ethylene glycol) and distearoylphosphatidylethanolamine-poly(ethylene glycol) for tumor delivery.


    Elsaid, Zeeneh; Taylor, Kevin M G; Puri, Sanyogitta; Eberlein, Cath A; Al-Jamal, Khuloud; Bai, Jie; Klippstein, Rebecca; Wang, Julie Tzu-Wen; Forbes, Ben; Chana, Jasminder; Somavarapu, Satyanarayana


    Many chemotherapeutics suffer from poor aqueous solubility and tissue selectivity. Distearoylphosphatidylethanolamine-poly(ethylene glycol) (DSPE-PEG) micelles are a promising formulation strategy for the delivery of hydrophobic anticancer drugs. However, storage and in vivo instability restrict their use. The aim of this study was to prepare mixed micelles, containing a novel polymer, lipoic acid-chitosan-poly(ethylene glycol) (LACPEG), and DSPE-PEG, to overcome these limitations and potentially increase cancer cell internalisation. Drug-loaded micelles were prepared with a model tyrosine kinase inhibitor and characterized for size, surface charge, stability, morphology, drug entrapment efficiency, cell viability (A549 and PC-9 cell lines), in vivo biodistribution, ex vivo tumor accumulation and cellular internalisation. Micelles of size 30-130nm with entrapment efficiencies of 46-81% were prepared. LACPEG/DSPE-PEG mixed micelles showed greater interaction with the drug (condensing to half their size following entrapment), greater stability, and a safer profile in vitro compared to DSPE-PEG micelles. LACPEG/DSPE-PEG and DSPE-PEG micelles had similar entrapment efficiencies and in vivo tumor accumulation levels, but LACPEG/DSPE-PEG micelles showed higher tumor cell internalisation. Collectively, these findings suggest that LACPEG/DSPE-PEG mixed micelles provide a promising platform for tumor delivery of hydrophobic drugs. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Kinetic modeling and scale up of lipoic acid (LA) production from Saccharomyces cerevisiae in a stirred tank bioreactor.


    Jayakar, Shilpa S; Singhal, Rekha S


    Scale up studies for production of lipoic acid (LA) from Saccharomyces cerevisiae have been reported in this paper for the first time. LA production in batch mode was carried out in a stirred tank bioreactor at varying agitation and aeration with maximum LA production of 512 mg/L obtained at 350 rpm and 25 % dissolved oxygen in batch culture conditions. Thus, LA production increased from 352 mg/L in shake flask to 512 mg/L in batch mode in a 5 L stirred tank bioreactor. Biomass production under these conditions was mathematically explained using logistic equation and data obtained for LA production and substrate utilization were successfully fitted using Luedeking-Piret and Mercier's models. The kinetic studies showed LA production to be growth associated. Further enhancement of LA production was carried out using fed-batch (variable volume) and semi-continuous modes of fermentation. Semi-continuous fermentation with three feeding cycles of sucrose effectively increased the production of LA from 512 to 725 mg/L.

  13. Quantification of lipoic acid from skin samples by HPLC using ultraviolet, electrochemical and evaporative light scattering detectors.


    Campos, Patrícia Mazureki; Praça, Fabíola Silva Garcia; Bentley, Maria Vitória Lopes Badra


    Lipoic acid (LA) is an endogenous organosulfur compound with potent antioxidant property. LA is often used as a drug for the treatment of skin disorders. For the accomplishment of topical applications of LA appropriate drug quantification methods are essential. Thus far, no HPLC methods have been reported for the measurement of LA extracted from skin. In this article we report on the development and validation of three sensitive and specific HPLC methods for LA and dihydrolipoic acid (DHLA) using ultraviolet (UV), electrochemical (EC) or evaporative light scattering (ELS) detection. These methods demonstrate different linearity ranges. The chromatographic separations were performed by RP-HPLC (250 × 4 mm, 5 μm) with isocratic elution using an acidic mobile phase for the three detection techniques. The lower limits of detection and quantification were 0.04 and 0.08 ng LA, respectively, for HPLC coupled to ELS, an innovative detector for LA with high sensitivity. The extraction of LA from skin samples showed recoveries greater than 71%. The recovered LA concentrations from stratum corneum and epidermis+dermis layers were: 5.41 ± 0.56 and 4.92 ± 0.33 μg/mL, respectively for HPLC/UV and 6.52 ± 0.49 and 5.01 ± 0.41 μg/mL, respectively, for HPLC/EC for the added LA concentration (6.67 μg/mL), and 8.88 ± 0.46 and 8.95 ± 0.08 μg/mL, respectively, for HPLC/ELS for the added LA concentration (10 μg/mL). These three optimized HPLC methods allowed for a simple, rapid and reliable determination of LA in human skin. They should be useful for the development of drug delivery systems for topical applications of LA.

  14. Lipoic acid metabolism in Escherichia coli: the lplA and lipB genes define redundant pathways for ligation of lipoyl groups to apoprotein.

    PubMed Central

    Morris, T W; Reed, K E; Cronan, J E


    Lipoic acid is a covalently bound disulfide-containing cofactor required for function of the pyruvate dehydrogenase, alpha-ketoglutarate dehydrogenase, and glycine cleavage enzyme complexes of Escherichia coli. Recently we described the isolation of the lplA locus, the first gene known to encode a lipoyl-protein ligase for the attachment of lipoyl groups to lipoate-dependent apoenzymes (T. W. Morris, K. E. Reed, and J. E. Cronan, Jr., J. Biol. Chem. 269:16091-16100, 1994). Here, we report an unexpected redundancy between the functions of lplA and lipB, a gene previously identified as a putative lipoate biosynthetic locus. First, analysis of lplA null mutants revealed the existence of a second lipoyl ligase enzyme. We found that lplA null mutants displayed no growth defects unless combined with lipA (lipoate synthesis) or lipB mutations and that overexpression of wild-type LplA suppressed lipB null mutations. Assays of growth, transport, lipoyl-protein content, and apoprotein modification demonstrated that lplA encoded a ligase for the incorporation of exogenously supplied lipoate, whereas lipB was required for function of the second lipoyl ligase, which utilizes lipoyl groups generated via endogenous (lipA-mediated) biosynthesis. The lipB-dependent ligase was further shown to cause the accumulation of aberrantly modified octanoyl-proteins in lipoate-deficient cells. Lipoate uptake assays of strains that overproduced lipoate-accepting apoproteins also demonstrated coupling between transport and the subsequent ligation of lipoate to apoprotein by the LplA enzyme. Although mutations in two genes (fadD and fadL) involved in fatty acid failed to affect lipoate utilization, disruption of the smp gene severely decreased lipoate utilization. DNA sequencing of the previously identified slr1 selenolipoate resistance mutation (K. E. Reed, T. W. Morris, and J. E. Cronan, Jr., Proc. Natl. Acad. Sci. USA 91:3720-3724, 1994) showed this mutation (now called lplA1) to be a G76S

  15. Protective effect of alpha-lipoic acid, aerobic or resistance exercise from colitis in second hand smoke exposed young rats.


    Özbeyli, Dilek; Berberoglu, Ayşe Cansu; Özen, Anıl; Erkan, Oktay; Başar, Yunus; Şen, Tunahan; Akakın, Dilek; Yüksel, Meral; Kasımay Çakır, Özgür


    The role of second hand smoke (SHS) exposure on ulcerative colitis is not known. Our aim was to examine the effects of α-lipoic acid (ALA), chronic aerobic (AE) or resistance exercise (RE) on SHS exposed rats with colitis. Sprague-Dawley male rats (150-200 g, n=54) were selected for colitis induction. Among the colitis groups, one group was exposed to SHS (6 d/wk, 4 cigarettes/d) and the other was not. The SHS group was divided into subgroups as follows: sedentary; AE (swimming; 3 d/wk); and RE (climbing with weight; 3 d/wk). After 5 weeks, colitis was induced by intrarectal acetic acid. All groups had subgroups that were given subcutaneously ALA (50 mg/kg per day) or vehicle for 3 days. Following decapitation, colon tissues were sampled to examine malondialdehyde (MDA) and glutathione (GSH) levels, myeloperoxidase (MPO) activity, luminol and lucigenin chemiluminenscence, macroscopic scoring and histologic examination. ANOVA and Student's t-test were used for statistical analysis. The increased macroscopic and microscopic scores, MPO, MDA, luminol and lucigenin measurements in colitis and SHS-colitis groups were decreased via ALA (P<.05-.001). AE declined macroscopic and microscopic scores, MDA, lucigenin compared to colitis and SHS-colitis groups (P<.01-.001). RE reduced microscopic score, MPO, MDA, luminol, lucigenin (P<.05-.001) that were increased with colitis. Decreased GSH levels (P<.01) in the SHS-colitis group approached to control levels when given ALA. According to our results SHS and colitis induction increased inflammatory damage. SHS did not worsen it more than colitis. Our results suggest that ALA, AE or RE might be protective for SHS exposed ulcerative colitis conditions. © 2016 John Wiley & Sons Australia, Ltd.

  16. Mice with heterozygous deficiency of lipoic acid synthase have an increased sensitivity to lipopolysaccharide-induced tissue injury

    PubMed Central

    Yi, Xianwen; Kim, Kuikwon; Yuan, Weiping; Xu, Longquan; Kim, Hyung-Suk; Homeister, Jonathon W.; Key, Nigel S.; Maeda, Nobuyo


    α-Lipoic acid (1, 2-dithiolane-3-pentanoic acid; LA), synthesized in mitochondria by LA synthase (Lias), is a potent antioxidant and a cofactor for metabolic enzyme complexes. In this study, we examined the effect of genetic reduction of LA synthesis on its antioxidant and anti-inflammatory properties using a model of LPS-induced inflammation in Lias+/– mice. The increase of plasma proinflammatory cytokine, TNF-α, and NF-κB at an early phase following LPS injection was greater in Lias+/– mice compared with Lias+/+ mice. The circulating blood white blood cell (WBC) and platelet counts dropped continuously during the initial 4 h. The counts subsequently recovered partially in Lias+/+ mice, but the recovery was impaired totally in Lias+/– mice. Administration of exogenous LA normalized the recovery of WBC counts in Lias+/– mice but not platelets. Enhanced neutrophil sequestration in the livers of Lias+/– mice was associated with increased hepatocyte injury and increased gene expression of growth-related oncogene, E-selectin, and VCAM-1 in the liver and/or lung. Lias gene expression in tissues was 50% of normal expression in Lias+/– mice and reduced further by LPS treatment. Decreased Lias expression was associated with diminished hepatic LA and tissue oxidative stress. Finally, Lias+/– mice displayed enhanced mortality when exposed to LPS-induced sepsis. These data demonstrate the importance of endogenously produced LA for preventing leukocyte accumulation and tissue injury that result from LPS-induced inflammation. PMID:18845616

  17. α-Lipoic acid interaction with dopamine D2 receptor-dependent activation of the Akt/GSK-3β signaling pathway induced by antipsychotics: potential relevance for the treatment of schizophrenia.


    Deslauriers, Jessica; Desmarais, Christian; Sarret, Philippe; Grignon, Sylvain


    Chronic administration of antipsychotics has been associated with dopamine D2 receptor (D2R) upregulation and tardive dyskinesia. We have previously shown that haloperidol, a first-generation antipsychotic (FGA), exerted an increase in D2R expression and oxidative stress and that (±)-α-lipoic acid reversed its effect. Previous studies have implicated the Akt/glycogen synthase kinase-3β (GSK-3β) signaling pathway in antipsychotic action. These findings led us to examine whether the Akt/GSK-3β pathway was involved in D2R upregulation and oxidative stress elicited by antipsychotics and, in (±)-α-lipoic acid-induced reversal of these phenomena, in SH-SY5Y cells. Antipsychotics increased phosphorylation of Akt and GSK-3β, and additive effects were observed with (±)-α-lipoic acid. GSK-3β inhibitors reversed haloperidol-induced overexpression of D2R mRNA levels but did not affect haloperidol-induced oxidative stress. Sustained antipsychotic treatment increased β-arrestin-2 and D2R receptor interaction. Regarding Akt/GSK-3β downstream targets, antipsychotics increased β-catenin levels, whereas (±)-α-lipoic acid induced an elevation of mTOR activation. These results suggest (1) that the effect of antipsychotics on the Akt/GSK-3β pathway in SH-SY5Y cells is reminiscent of their in vivo action, (2) that (±)-α-lipoic acid partially synergizes with antipsychotic drugs (APDs) on the same pathway, and (3) that the Akt/GSK-3β signaling cascade is not involved in the preventive effect of (±)-α-lipoic acid on antipsychotics-induced D2R upregulation.

  18. Alpha-lipoic acid-stearylamine conjugate-based solid lipid nanoparticles for tamoxifen delivery: formulation, optimization, in-vivo pharmacokinetic and hepatotoxicity study.


    Dhaundiyal, Ankit; Jena, Sunil K; Samal, Sanjaya K; Sonvane, Bhavin; Chand, Mahesh; Sangamwar, Abhay T


    This study was designed to demonstrate the potential of novel α-lipoic acid-stearylamine (ALA-SA) conjugate-based solid lipid nanoparticles in modulating the pharmacokinetics and hepatotoxicity of tamoxifen (TMX). α-lipoic acid-stearylamine bioconjugate was synthesized via carbodiimide chemistry and used as a lipid moiety for the generation of TMX-loaded solid lipid nanoparticles (TMX-SLNs). TMX-SLNs were prepared by solvent emulsification-diffusion method and optimized for maximum drug loading using rotatable central composite design. The optimized TMX-SLNs were stabilized using 10% w/w trehalose as cryoprotectant. In addition, pharmacokinetics and hepatotoxicity of freeze-dried TMX-SLNs were also evaluated in Sprague Dawley rats. Initial characterization with transmission electron microscopy revealed spherical morphology with smooth surface having an average particle size of 261.08 ± 2.13 nm. The observed entrapment efficiency was 40.73 ± 2.83%. In-vitro release study showed TMX release was slow and pH dependent. Pharmacokinetic study revealed a 1.59-fold increase in relative bioavailability as compared to TMX suspension. A decrease in hepatotoxicity of TMX is evidenced by the histopathological evaluation of liver tissues. α-lipoic acid-stearylamine conjugate-based SLNs have a great potential in enhancing the oral bioavailability of poorly soluble drugs like TMX. Moreover, this ALA-SA nanoparticulate system could be of significant value in long-term anticancer therapy with least side effects. © 2016 Royal Pharmaceutical Society.

  19. Curcumin, Silybin Phytosome(®) and α-R-Lipoic Acid Mitigate Chronic Hepatitis in Rat by Inhibiting Oxidative Stress and Inflammatory Cytokines Production.


    Ali, Shimaa O; Darwish, Hebatallah A; Ismail, Nabila A


    Chronic hepatitis is recognized as a worldwide health problem that gradually progresses towards cirrhosis and hepatocellular carcinoma. Despite the large number of experiments using animal models for allergic hepatitis, it is still difficult to produce a picture of chronic hepatitis. Therefore, this study was conducted to introduce an animal model approximating to the mechanism of chronicity in human hepatitis. The study also aimed to examine the hepatoprotective effects of curcumin, silybin phytosome(®) and α-R-lipoic acid against thioacetamide (TAA)-induced chronic hepatitis in rat model. TAA was administered intraperitoneally at a dose of 200 mg/kg three times weekly for 4 weeks. At the end of this period, a group of rats was killed to assess the development of chronic hepatitis in comparison with their respective control group. TAA administration was then discontinued, and the remaining animals were subsequently allocated into four groups. Group 1 was left untreated, whereas groups 2-4 were allowed to receive daily oral doses of curcumin, silybin phytosome(®) or α-R-lipoic acid, respectively, for 7 weeks. Increases in hepatic levels of malondialdehyde associated with TAA administration were inhibited in groups receiving supplements. Furthermore, glutathione depletion, collagen deposition, macrophage activation and nuclear factor κappa-B expression as well as tumour necrosis factor-α and interleukin-6 levels were significantly decreased in response to supplements administration. Serological analysis of liver function and liver histopathological examination reinforced the results. The above evidence collectively indicates that the antioxidant and anti-inflammatory activities of curcumin, silybin phytosome(®) and α-R-lipoic acid may confer therapeutic efficacy against chronic hepatitis. © 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

  20. Ibuprofen and lipoic acid diamide as co-drug with neuroprotective activity: pharmacological properties and effects in beta-amyloid (1-40) infused Alzheimer's disease rat model.


    Di Stefano, A; Sozio, P; Cerasa, L S; Iannitelli, A; Cataldi, A; Zara, S; Giorgioni, G; Nasuti, C


    Both oxidative stress and inflammation are elevated in brains of Alzheimer's disease patients, but their pathogenic significance still remains unclear. Current evidence support the hypothesis that non-steroidal anti-inflammatory drugs (NSAIDs) and antioxidant therapy might protect against the development of Alzheimer's disease, and ibuprofen has the strongest epidemiological support. In the present work our attention was focused on (R)-alpha-lipoic acid considered as a potential neuroprotective agent in Alzheimer's disease therapy. In particular, we investigated a new co-drug (1) obtained by joining (R)-alpha-lipoic acid and ibuprofen via a diamide bond, for evaluating its potential to antagonize the deleterious structural and cognitive effects of beta-amyloid (1-40) in an infused Alzheimer's disease rat model. Our results indicated that infusion of beta-amyloid (1-40) impairs memory performance through a progressive cognitive deterioration; however, ibuprofen and co-drug 1 seemed to protect against behavioural detriment induced by simultaneous administration of beta-amyloid (1-40) protein. The obtained data were supported by the histochemical findings of the present study: beta-amyloid protein was less expressed in 1-treated than in ibuprofen and (R)-alpha-lipoic acid alone-treated cerebral cortex. Taken together, the present findings suggest that co-drug 1 treatment may protect against the cognitive dysfunction induced by intracerebroventricular infusion of beta-amyloid (1-40) in rats. Thus, co-drug 1 could prove useful as a tool for controlling Alzheimer's disease-induced cerebral amyloid deposits and behavioural deterioration.

  1. Antiproliferative effects of a new α-lipoic acid derivative, DHL-HisZnNa, in HT29 human colon cancer cells in vitro.


    Kono, Yohei; Inomata, Masafumi; Hagiwara, Satoshi; Hiratsuka, Takahiro; Suzuki, Kosuke; Koga, Hironori; Shiraishi, Norio; Noguchi, Takayuki; Kitano, Seigo


    α-Lipoic acid has been reported to induce apoptosis in several cancer cell lines. However, it is prone to oxidation, polymerization and desulfurization, and is insoluble in water. In this study an α-lipoic acid derivative, sodium N-(dihydrolipoyl)-l-histidinate zinc complex (DHL-HisZnNa), was synthesized, which can eliminate active oxygen species. The antiproliferative effects of DHL-HisZnNa, on human colon cancer cell HT29 in vitro, were evaluated. Whether DHL-HisZnNa elicits its antiproliferative effects by inducing apoptosis and cell cycle arrest, was investigated. Expressions of cell-cycle-related proteins and their phosphorylation on HT-29 was also analyzed. DHL-HisZnNa inhibited cancer cell growth in cultures. Cell cycle analysis by flow cytometry showed time-dependent accumulation of HT-29 cells in G1 phase after exposure to DHL-HisZnNa. Analysis of DNA fragmentation did not reveal evidence of apoptosis after exposure to DHL-HisZnNa. Cells treated with DHL-HisZnNa showed an increase in p53 phosphorylation with the Bio-Plex Phosphoprotein assay. DHL-HisZnNa increased protein levels of the cyclin-dependent kinase inhibitor p21 and decreased that of phosphorylated retinoblastoma protein (Rb) by western blot analysis. Results obtained with DHL-HisZnNa are on a single colon cancer cell line and not comparative experiments with α-lipoic acid. This is the first study, to our knowledge, to report the antiproliferative effects of DHL-HisZnNa and the molecular mechanisms by which it inhibits growth of HT29.

  2. Determination of lipoic acid, Trolox methyl ether and tocopherols in human plasma by liquid-chromatography and ion-trap tandem mass spectrometry.


    Montero, Olimpio; Ramírez, María; Sánchez-Guijo, Alberto; González, Constancio


    A method for the simultaneous determination of lipoic acid and/or Trolox methyl ether, along with α-, γ- and δ-tocopherol was developed using liquid chromatography-tandem mass spectrometry with negative electrospray ionization (HPLC-ESI-MS/MS) in an ion-trap mass spectrometer. Detection and quantification were accomplished by a multiple reaction monitoring method, using specific transitions from precursor ion to product ion for each analyte. Chromatographic separation was achieved in a 12 min run using a C(18) -bonded phase and methanol-aqueous ammonium acetate elution gradient. Linear correlations of the chromatographic peak area (r.u. × s(-1) ) to the injected amount (ng) gave the slope values (r.u. × s(-1)  × ng(-1) ) 2.34 × 10(4) for α-tocopherol, 5.05 × 10(4) for γ-tocopherol, 1.27 × 10(5) for δ-tocopherol, 8.86 × 10(5) for lipoic acid and 1.23 × 10(5) for Trolox methyl ether. The lower limit of quantification ranged between 0.02 and 1.22 ng for Trolox methyl ether and lipoic acid. MS(3) experiments of γ- and δ-tocopherol suggest ion-radical reactions and dependence of the tocopherol fragmentation pattern on the phenolic ring methylation degree. The method is shown to be applicable to measurement of these metabolites in human serum after extraction. Copyright © 2012 John Wiley & Sons, Ltd.

  3. Correlation of α-Lipoic Acid and S. Glutathione Level with Free Radical Excess in Tobacco Consumers

    PubMed Central

    Kaur, Manjinder; Suhalka, M.L.; Shrivastav, Chanchal


    Introduction Tobacco consumption is a serious health hazard and most important avoidable cause of death worldwide. Tobacco is recognized as lethal toxin, ripping off 7-11 minutes of human life with each cigarette through harmful compounds and inducing free radical synthesis and a high rate of lipid peroxidation. These free radicals are scavenged by the endogenous antioxidants viz. S. Glutathione (S.GSH) and S. α-Lipoic acid (S. α-LA), thus preventing the endothelial damage. Aim The present study was designed with an aim to find out the lipid peroxidative stress through S. Malondialdehyde (S.MDA) and its correlation with antioxidant levels like S. Glutathione (S. GSH) and S. α- Lipoic acid (S. α- LA) among tobacco users (in both smokers and chewers). Materials and Methods A case control cross-sectional study was carried out in the Department of Physiology among 200 subjects; aged 18-50 years of both sexes which were chosen randomly from institutional campus and healthy volunteers. The subjects were broadly divided into two groups (A & B); group A comprised of tobacco users (n=150) with history of smoking cigarette/biddies and chewing tobacco daily, for at least one year and group B had controls (non tobacco users) (n=50). S. MDA, S.GSH and S. α-LA levels were estimated by standardized methods. The data was analysed by unpaired student t-test and Pearson’s correlation coefficient (r) for finding the correlation between antioxidants and S.MDA in group-A and group-B. Results The present study reports the significantly higher (p<0.0001) levels of S.MDA and lower (p<0.0001) levels of S.GSH and S. α-LA in tobacco users as compared to nontobacco users. The observed value of S.MDA was (2.72±0.87, 1.39±0.47) nmol/ml, S. α-LA was (9.94±5.96, 14.24 ± 4.34) μg/ml and S.GSH was (23.24±7.04, 32.82±2.95) mg/dl respectively in group-A and group-B. A significant (p<0.01) strong negative correlation was observed between S. MDA and antioxidants (S.GSH and S.

  4. Correlation of α-Lipoic Acid and S. Glutathione Level with Free Radical Excess in Tobacco Consumers.


    Sharma, Suman; Kaur, Manjinder; Suhalka, M L; Shrivastav, Chanchal


    Tobacco consumption is a serious health hazard and most important avoidable cause of death worldwide. Tobacco is recognized as lethal toxin, ripping off 7-11 minutes of human life with each cigarette through harmful compounds and inducing free radical synthesis and a high rate of lipid peroxidation. These free radicals are scavenged by the endogenous antioxidants viz. S. Glutathione (S.GSH) and S. α-Lipoic acid (S. α-LA), thus preventing the endothelial damage. The present study was designed with an aim to find out the lipid peroxidative stress through S. Malondialdehyde (S.MDA) and its correlation with antioxidant levels like S. Glutathione (S. GSH) and S. α- Lipoic acid (S. α- LA) among tobacco users (in both smokers and chewers). A case control cross-sectional study was carried out in the Department of Physiology among 200 subjects; aged 18-50 years of both sexes which were chosen randomly from institutional campus and healthy volunteers. The subjects were broadly divided into two groups (A & B); group A comprised of tobacco users (n=150) with history of smoking cigarette/biddies and chewing tobacco daily, for at least one year and group B had controls (non tobacco users) (n=50). S. MDA, S.GSH and S. α-LA levels were estimated by standardized methods. The data was analysed by unpaired student t-test and Pearson's correlation coefficient (r) for finding the correlation between antioxidants and S.MDA in group-A and group-B. The present study reports the significantly higher (p<0.0001) levels of S.MDA and lower (p<0.0001) levels of S.GSH and S. α-LA in tobacco users as compared to nontobacco users. The observed value of S.MDA was (2.72±0.87, 1.39±0.47) nmol/ml, S. α-LA was (9.94±5.96, 14.24 ± 4.34) μg/ml and S.GSH was (23.24±7.04, 32.82±2.95) mg/dl respectively in group-A and group-B. A significant (p<0.01) strong negative correlation was observed between S. MDA and antioxidants (S.GSH and S. α-LA) with a Pearson co-efficient of r=-0.619, r= -0

  5. Alpha-lipoic acid-mediated activation of muscarinic receptors improves hippocampus- and amygdala-dependent memory.


    Mahboob, Aamra; Farhat, Syeda Mehpara; Iqbal, Ghazala; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf; Nabavi, Seyed Mohammad; Ahmed, Touqeer


    Aluminum (Al) is a neurotoxic agent which readily crosses the blood-brain-barrier (BBB) and accumulates in the brain leading to neurodegenerative disorders, characterised by cognitive impairment. Alpha-lipoic acid (ALA) is an antioxidant and has a potential to improve cognitive functions. This study aimed to evaluate the neuroprotective effect of ALA in AlCl3-induced neurotoxicity mouse model. Effect of ALA (25mg/kg/day) was evaluated in the AlCl3-induced neurotoxicity (AlCl3 150 mg/kg/day) mouse model on learning and memory using behaviour tests and on the expression of muscarinic receptor genes (using RT-PCR), in hippocampus and amygdala. Following ALA treatment, the expression of muscarinic receptor genes M1, M2 and choline acetyltransferase (ChaT) were significantly improved (p<0.05) relative to AlCl3-treated group. ALA enhanced fear memory (p<0.01) and social novelty preference (p<0.001) comparative to the AlCl3-treated group. Fear extinction memory was remarkably restored (p<0.001) in ALA-treated group demonstrated by reduced freezing response as compared to the AlCl3-treated group which showed higher freezing. In-silico analysis showed that racemic mixture of ALA has higher binding affinity for M1 and M2 compared to acetylcholine. These novel findings highlight the potential role of ALA in cognitive functions and cholinergic system enhancement thus presenting it an enviable therapeutic candidate for the treatment of neurodegenerative disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Evidence for protective effect of lipoic acid and desvenlafaxine on oxidative stress in a model depression in mice.


    Silva, Márcia Calheiros Chaves; de Sousa, Caren Nádia Soares; Gomes, Patrícia Xavier Lima; de Oliveira, Gersilene Valente; Araújo, Fernanda Yvelize Ramos; Ximenes, Naiara Coelho; da Silva, Jéssica Calheiros; Vasconcelos, Germana Silva; Leal, Luzia Kalyne Almeida Moreira; Macêdo, Danielle; Vasconcelos, Silvânia Maria Mendes


    Oxidative stress is implicated in the neurobiology of depression. Here we investigated oxidative alterations in brain areas of animals submitted to the model of depression induced by corticosterone (CORT) and the effects of the antioxidant compound alpha-lipoic acid (ALA) alone or associated with the antidepressant desvenlafaxine (DVS) in these alterations. Female mice received vehicle or CORT (20 mg/kg) during 14 days. From the 15th to 21st days different animals received further administrations of: vehicle, DVS (10 or 20 mg/kg), ALA (100 or 200 mg/kg), or the combinations of DVS10+ALA100, DVS20+ALA100, DVS10+ALA200, or DVS20+ALA200. Twenty-four hours after the last drug administration prefrontal cortex (PFC), hippocampus (HC) and striatum (ST) were dissected for the determination of the activity of superoxide dismutase (SOD), reduced glutathione (GSH) and lipid peroxidation (LP) levels. CORT significantly increased SOD activity in the PFC and HC, decreased GSH levels in the HC and increased LP in all brain areas studied when compared to saline-treated animals. Decrements of SOD activity were observed in all groups and brain areas studied when compared to controls and CORT. The hippocampal decrease in GSH was reversed by ALA100, DVS10+ALA100, DVS20+ALA100 and DVS20+ALA200. The same DVS+ALA combination groups presented increased levels of GSH in the PFC and ST. The greater GSH levels were observed in the PFC, HC and ST of DVS20+ALA200 mice. LP was reversed in the groups ALA200 (PFC), DVS10+ALA100, DVS20+ALA100 (PFC, HC and ST), and DVS20+ALA200 (PFC, HC). Our findings contribute to the previous preclinical evidences implicating ALA as a promising agent for augmentation therapy in depression. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Structural Analysis of Crystalline R(+)-α-Lipoic Acid-α-cyclodextrin Complex Based on Microscopic and Spectroscopic Studies.


    Ikuta, Naoko; Endo, Takatsugu; Hosomi, Shota; Setou, Keita; Tanaka, Shiori; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Takahashi, Kenji; Terao, Keiji; Matsugo, Seiichi


    R(+)-α-lipoic acid (RALA) is a naturally-occurring substance, and its protein-bound form plays significant role in the energy metabolism in the mitochondria. RALA is vulnerable to a variety of physical stimuli, including heat and UV light, which prompted us to study the stability of its complexes with cyclodextrins (CDs). In this study, we have prepared and purified a crystalline RALA-αCD complex and evaluated its properties in the solid state. The results of ¹H NMR and PXRD analyses indicated that the crystalline RALA-αCD complex is a channel type complex with a molar ratio of 2:3 (RALA:α-CD). Attenuated total reflection/Fourier transform infrared analysis of the complex showed the shift of the C=O stretching vibration of RALA due to the formation of the RALA-αCD complex. Raman spectroscopic analysis revealed the significant weakness of the S-S and C-S stretching vibrations of RALA in the RALA-αCD complex implying that the dithiolane ring of RALA is almost enclosed in glucose ring of α-CD. Extent of this effect was dependent on the direction of the excitation laser to the hexagonal morphology of the crystal. Solid-state NMR analysis allowed for the chemical shift of the C=O peak to be precisely determined. These results suggested that RALA was positioned in the α-CD cavity with its 1,2-dithiolane ring orientated perpendicular to the plane of the α-CD ring.

  8. Alpha-lipoic acid affects the oxidative stress in various brain structures in mice with methionine and choline deficiency

    PubMed Central

    Veskovic, Milena; Mladenovic, Dusan; Jorgacevic, Bojan; Stevanovic, Ivana; de Luka, Silvio


    Deficiency in methionine or choline can induce oxidative stress in various organs such as liver, kidney, heart, and brain. This study was to examine the effects of alpha-lipoic acid (LA) on oxidative stress induced by methionine and choline deficiency (MCD) in several brain structures. Male mice C57BL/6 (n = 28) were divided into four groups: (1) control – continuously fed with standard chow; (2) LA – fed with standard chow and receiving LA; (3) MCD2 – fed with MCD diet for two weeks, and (4) MCD2+LA – fed with MCD diet for two weeks and receiving LA (100 mg/kg/day intraperitonealy [i.p.]). Brain tissue (cortex, hypothalamus, striatum and hippocampus) was taken for determination of oxidative stress parameters. MCD diet induced a significant increase in malondialdehyde and NOx concentration in all brain regions, while LA restored their content to normal values. Similar to this, in MCD2 group, activity of total SOD, MnSOD, and Cu/ZnSOD was reduced by MCD diet, while LA treatment improved their activities in all brain structures. Besides, in MCD2 group a decrease in catalase activity in cortex and GSH content in hypothalamus was evident, while LA treatment induced an increase in catalase activity in cortex and striatum and GSH content in hypothalamus. LA treatment can significantly reduce lipid peroxidation and nitrosative stress, caused by MCD diet, in all brain regions by restoring antioxidant enzymes activities, predominantly total SOD, MnSOD, and Cu/ZnSOD, and to a lesser extent by modulating catalase activity and GSH content. LA supplementation may be used in order to prevent brain oxidative injury induced by methionine and choline deficiency. PMID:25193852

  9. Efficacy and Safety of Antioxidant Treatment With α-Lipoic Acid Over 4 Years in Diabetic Polyneuropathy

    PubMed Central

    Ziegler, Dan; Low, Phillip A.; Litchy, William J.; Boulton, Andrew J.M.; Vinik, Aaron I.; Freeman, Roy; Samigullin, Rustem; Tritschler, Hans; Munzel, Ullrich; Maus, Joachim; Schütte, Klemens; Dyck, Peter J.


    OBJECTIVE To evaluate the efficacy and safety of α-lipoic acid (ALA) over 4 years in mild-to-moderate diabetic distal symmetric sensorimotor polyneuropathy (DSPN). RESEARCH DESIGN AND METHODS In a multicenter randomized double-blind parallel-group trial, 460 diabetic patients with mild-to-moderate DSPN were randomly assigned to oral treatment with 600 mg ALA once daily (n = 233) or placebo (n = 227) for 4 years. Primary end point was a composite score (Neuropathy Impairment Score [NIS]–Lower Limbs [NIS-LL] and seven neurophysiologic tests). Secondary outcome measures included NIS, NIS-LL, nerve conduction, and quantitative sensory tests (QSTs). RESULTS Change in primary end point from baseline to 4 years showed no significant difference between treatment groups (P = 0.105). Change from baseline was significantly better with ALA than placebo for NIS (P = 0.028), NIS-LL (P = 0.05), and NIS-LL muscular weakness subscore (P = 0.045). More patients showed a clinically meaningful improvement and fewer showed progression of NIS (P = 0.013) and NIS-LL (P = 0.025) with ALA than with placebo. Nerve conduction and QST results did not significantly worsen with placebo. Global assessment of treatment tolerability and discontinuations due to lack of tolerability did not differ between the groups. The rates of serious adverse events were higher on ALA (38.1%) than on placebo (28.0%). CONCLUSIONS Four-year treatment with ALA in mild-to-moderate DSPN did not influence the primary composite end point but resulted in a clinically meaningful improvement and prevention of progression of neuropathic impairments and was well tolerated. Because the primary composite end point did not deteriorate significantly in placebo-treated subjects, secondary prevention of its progression by ALA according to the trial design was not feasible. PMID:21775755

  10. Total Oxidative status of Mouse Vitrified Pre-Antral Follicles with Pre-Treatment of Alpha Lipoic Acid

    PubMed Central

    Hatami, Sahar; Zavareh, Saeed; Salehnia, Mojdeh; Lashkarbolouki, Taghi; Ghorbanian, Mohammad Taghi; Karimi, Isaac


    Background: Cryopreservation of pre-antral follicles is a hopeful technique to preserve female fertility. The aim of the present study was to evaluate reactive oxygen species (ROS) and total antioxidant capacity (TAC) levels of mouse vitrified pre-antral follicles in the presence of alpha lipoic acid (ALA). Methods: Isolated pre-antral follicles (140–150 µm in diameter) were divided into vitrified–warmed and fresh groups. Each group was subjected to in vitro maturation with or without ALA for 12 days, followed by adding human chronic gonadotropin to induce ovulation. In vitro fertilization was performed to evaluate their developmental competence. In parallel, the amount of ROS and TAC were assessed after 0, 24, 48, 72, and 96 h of culture by 2',7'-dichlorofluorescin assay and ferric reducing/antioxidant power assay, respectively. Results: The respective rates of survival, antrum formation, and metaphase II oocytes were significantly higher in ALA-supplemented groups compared to the groups not treated with ALA. TAC and ROS levels were significantly decreased and increased, respectively during the culture period up to 96 h in the absence of ALA in both vitrified and non-vitrified samples. However, with pretreatment of ALA, TAC levels were increased significantly and remained constant up to 96 h in vitrified-warmed pre-antral follicles, while ROS levels completely returned to the level of starting point after 96 h of culture in the presence of ALA. Conclusion: Pretreatment of ALA positively influences development of pre-antral follicles in vitrified and non-vitrified samples through increasing follicular TAC level and decreasing ROS levels. PMID:24842145

  11. Therapeutic potential of α-lipoic acid derivative, sodium zinc histidine dithiooctanamide, in a mouse model of allergic rhinitis.


    Nakano, Toshiaki; Hsu, Li-Wen; Lai, Chia-Yun; Takaoka, Yuki; Inomata, Masafumi; Kitano, Seigo; Chen, Chao-Long; Goto, Shigeru


    Oxidative stress is involved in various diseases, including allergies. Several studies have pointed to the preventive and therapeutic potential of antioxidants in allergic disorders. However, little is known about the immunomodulatory effects of antioxidants in type I hypersensitivity. In this study we aimed to explore the impact of a water-soluble antioxidant and α-lipoic acid derivative, sodium zinc histidine dithiooctanamide (DHL-HisZn), on mast-cell- and T-cell-mediated allergic and immune responses both in vitro and in vivo. The therapeutic impact of DHL-HisZn on mast-cell-mediated type I hypersensitivity was evaluated by a mast-cell degranulation assay using bone marrow-derived mast cells and by a mouse model of ovalbumin (OVA)-induced allergic rhinitis. The effect of DHL-HisZn on the proportion of regulatory T cells (Tregs) was evaluated using flow cytometry. During the course of OVA-induced allergic rhinitis in mice, serum nitrate was elevated, suggesting the involvement of oxidative stress in allergic responses. DHL-HisZn not only suppressed mast-cell degranulation but also ameliorated OVA-induced nasal hypersensitivity, with significant suppression of serum nitrate. DHL-HisZn treatment significantly suppressed OVA-specific immunoglobulin E (IgE) but enhanced OVA-specific IgG2a in OVA-sensitized and nasal-challenged mice. Furthermore, DHL-HisZn treatment suppressed interleukin-17 production in OVA-stimulated splenocytes. Finally, we demonstrated the induction of Tregs by DHL-HisZn in concanavalin A blasts. These findings suggest that DHL-HisZn may regulate mast-cell-, T-helper 2 (Th2)-, and Th17-mediated allergic and immune responses by induction of Tregs. © 2017 ARS-AAOA, LLC.

  12. New α-lipoic acid derivative, DHL-HisZn, ameliorates renal ischemia-reperfusion injury in rats.


    Koga, Hironori; Hagiwara, Satoshi; Kusaka, Jyunya; Goto, Koji; Uchino, Tetyuya; Shingu, Chihiro; Kai, Shinya; Noguchi, Takayuki


    Ischemia-reperfusion (I/R) occurs frequently in a variety of clinical settings, such as renal transplantation. In addition, I/R is a major cause of acute kidney injury (AKI). A recent study has reported that reactive oxygen species (ROS) are important mediators of AKI, suggesting that reducing ROS generation may prevent renal injury. The present study evaluated the ability of DHL-HisZn, a new α-lipoic acid derivative, to inhibit ROS generation and prevent renal I/R injury in rats. Rats received an intravenous infusion of DHL-HisZn or saline, and then underwent experimentally induced renal I/R injury or sham treatment. Rats were sacrificed after 60 min of ischemia and 24 h of reperfusion. To evaluate the renal protective effects of DHL-HisZn, serum blood urea nitrogen (BUN) and creatinine (Cre) concentrations were determined, kidneys were histologically assessed, and malondialdehyde (MDA), a biomarker of oxidative stress, was evaluated. In addition, antimycin A (AMA)-stimulated RAW264.7 cells were treated with DHL-HisZn to assess its antioxidant effects in vitro. DHL-HisZn treatment attenuated I/R-induced histologic alterations, reduced serum levels of serum BUN and Cre, and decreased MDA levels in the kidneys of rats with renal I/R injury. Furthermore, DHL-HisZn decreased ROS levels in AMA-stimulated RAW264.7 cells. Our in vitro and in vivo findings suggest that DHL-HisZn may have therapeutic potential against various human I/R conditions. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Effects of α-lipoic acid on endothelial function in aged diabetic and high-fat fed rats

    PubMed Central

    Sena, C M; Nunes, E; Louro, T; Proença, T; Fernandes, R; Boarder, M R; Seiça, R M


    Background and purpose: This study was conducted to investigate the effects of α-lipoic acid (α-LA) on endothelial function in diabetic and high-fat fed animal models and elucidate the potential mechanism underlying the benefits of α-LA. Experimental approach: Plasma metabolites reflecting glucose and lipid metabolism, endothelial function, urinary albumin excretion (UAE), plasma and aortic malondialdehyde (MDA) and urinary 8-hydroxydeoxyguanosine (8-OHdG) were assessed in non-diabetic controls (Wistar rats), untreated Goto-Kakizaki (GK) diabetic and high-fat fed GK rats (fed with atherogenic diet only, treated with α-LA and treated with vehicle, for 3 months). Vascular eNOS, nitrotyrosine, carbonyl groups and superoxide anion were also assessed in the different groups. Key results: α-LA and soybean oil significantly reduced both total and non-HDL serum cholesterol and triglycerides induced by atherogenic diet. MDA, carbonyl groups, vascular superoxide and 8-OHdG levels were higher in GK and high-fat fed GK groups and fully reversed with α-LA treatment. High-fat fed GK diabetic rats showed significantly reduced endothelial function and increased UAE, effects ameliorated with α-LA. This endothelial dysfunction was associated with decreased NO production, decreased expression of eNOS and increased vascular superoxide production and nitrotyrosine expression. Conclusions and implications: α-LA restores endothelial function and significantly improves systemic and local oxidative stress in high-fat fed GK diabetic rats. Improved endothelial function due to α-LA was at least partially attributed to recoupling of eNOS and increased NO bioavailability and represents a pharmacological approach to prevent major complications associated with type 2 diabetes. PMID:17906683

  14. α-Lipoic acid, a scavenging agent for H₂O₂, reduces ethanol-stimulated locomotion in mice.


    Ledesma, Juan Carlos; Aragon, Carlos M G


    The main system of central ethanol oxidation is mediated by the enzyme catalase. By reacting with H(2)O(2), brain catalase forms compound I (the catalase-H(2)O(2) system), which is able to oxidize ethanol to acetaldehyde in the brain. Previous studies have demonstrated that pharmacological manipulations of brain catalase activity modulate the stimulant effects of ethanol in mice. However, the role of H(2)O(2) in the behavioral effects of ethanol has not yet been clearly addressed. In the present study, we investigated the effects of alpha-lipoic acid (LA), a scavenging agent for H(2)O(2), on ethanol-induced locomotor stimulation. CD-1 mice were pretreated with LA [0-100 mg/kg, intraperitoneally (IP)] 0-60 min prior to administration of ethanol (0-3.75 g/kg, IP). In another experiment, animals were pretreated with LA (0, 25, or 50 mg/kg, IP) 30 min before cocaine (10 mg/kg, IP), amphetamine (2 mg/kg, IP), or caffeine (25 mg/kg, IP). After these treatments the animals were placed in an open-field chamber and their locomotor activity was measured for 20 min. LA 25, 50, and 100 mg/kg IP prevented ethanol-induced locomotor stimulation. LA did not affect the locomotor-stimulating effects of cocaine, amphetamine, and caffeine. Additionally, we demonstrated that LA prevents the inactivation of brain catalase by 3-amino-1,2,4-triazole, thus indicating that H(2)O(2) levels are reduced by LA. These data support the idea that a decrease in cerebral H(2)O(2) production by LA administration inhibits ethanol-stimulated locomotion. This study suggests that the brain catalase-H(2)O(2) system, and by implication centrally formed acetaldehyde, plays a key role in the psychopharmacological effects of ethanol.

  15. Comparison of the effects of lipoic acid and glutathione against cisplatin-induced ototoxicity in auditory cells.


    Koo, Doo Yeob; Lee, Se Hee; Lee, SungHo; Chang, Jiwon; Jung, Hak Hyun; Im, Gi Jung


    The aims of this study were to examine lipoic acid (LA)- or glutathione (GSH)-mediated protection against cytotoxicity following cisplatin exposure in HEI-OC1 auditory cells and measure the potential of LA and GSH to scavenge reactive oxygen species (ROS). This study also compares their protective effects and discusses the determination of a preventive or therapeutic dose. HEI-OC1 cells were pretreated with LA or GSH for 24 h and then exposed to 15 μM cisplatin for 48 h. The resulting cytotoxicity was measured using a cell counting kit-8, and intracellular ROS level was measured using flow cytometry. The protective or anti-ROS effects of LA and GSH were compared. Measurement of caspase 3, 8, 9 activity and Western blot analysis of PARP were performed. Pretreatment with LA at 300 μM and GSH at 3 mM protected HEI-OC1 cells against cisplatin-induced cytotoxicity and significantly reduced the cisplatin-induced increase in ROS. LA showed a significantly more effective protection against cisplatin-induced ototoxicity compared to that shown by GSH (85.4% vs. 73.1% cell viability). Both LA and GSH showed the maximal protective effect at different concentrations in normal or cisplatin-induced cytotoxic conditions. The preventive or therapeutic dose for harmful conditions is quite different for the two drugs and needs careful adjustments. This comparative study on the protective effects of LA and GSH against cisplatin-induced ototoxicity in an auditory cell line posed many challenges. Although LA and GSH showed a significant protective effect against cisplatin, the LA's effect was superior. The concentration at which the maximal protective effect of LA or GSH was noted was 3 times higher in cytotoxic conditions than in normal conditions, which suggests the need for drug dose adjustments based on the purpose (preventive or therapeutic). Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  16. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: a pilot study.


    Keith, Dove J; Butler, Judy A; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L; Christensen, J Mark; Pereira, Cliff; Hagen, Tory M


    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age=32 years) and older adults (average age=79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen.

  17. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: A pilot study

    PubMed Central

    Keith, Dove J.; Butler, Judy A.; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L.; Christensen, J. Mark; Pereira, Cliff; Hagen, Tory M.


    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age = 32 years) and older adults (average age = 79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3 h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen. PMID:22609537

  18. α-Lipoic acid prevents the intestinal epithelial monolayer damage under heat stress conditions: model experiments in Caco-2 cells.


    Varasteh, Soheil; Fink-Gremmels, Johanna; Garssen, Johan; Braber, Saskia


    Under conditions of high ambient temperatures and/or strenuous exercise, humans and animals experience considerable heat stress (HS) leading among others to intestinal epithelial damage through induction of cellular oxidative stress. The aim of this study was to characterize the effects of α-Lipoic Acid (ALA) on HS-induced intestinal epithelial injury using an in vitro Caco-2 cell model. A confluent monolayer of Caco-2 cells was pre-incubated with ALA (24 h) prior to control (37 °C) or HS conditions (42 °C) for 6 or 24 h and the expression of heat shock protein 70 (HSP70), heat shock factor-1 (HSF1), and the antioxidant Nrf2 were investigated. Intestinal integrity was determined by measuring transepithelial resistance, paracellular permeability, junctional complex reassembly, and E-cadherin expression and localization. Furthermore, cell proliferation was measured in an epithelial wound healing assay and the expression of the inflammatory markers cyclooxygenase-2 (COX-2) and transforming growth Factor-β (TGF-β) was evaluated. ALA pretreatment increased the HSP70 mRNA and protein expression under HS conditions, but did not significantly modulate the HS-induced activation of HSF1. The HS-induced increase in Nrf2 gene expression as well as the Nrf2 nuclear translocation was impeded by ALA. Moreover, ALA prevented the HS-induced impairment of intestinal integrity. Cell proliferation under HS conditions was improved by ALA supplementation as demonstrated in an epithelial wound healing assay and ALA was able to affect the HS-induced inflammatory response by decreasing the COX-2 and TGF-β mRNA expression. ALA supplementation could prevent the disruption of intestinal epithelial integrity by enhancing epithelial cell proliferation, and reducing the inflammatory response under HS conditions in an in vitro Caco-2 cell model.

  19. Therapeutic Potential of Dioscorea Extract (DA-9801) in Comparison with Alpha Lipoic Acid on the Peripheral Nerves in Experimental Diabetes.


    Jin, Heung Yong; Kim, Sun Hee; Yu, Hea Min; Baek, Hong Sun; Park, Tae Sun


    DA-9801, a mixture of extracts from Dioscorea japonica Thunb. and Dioscorea nipponica Makino, was reported to have neurotrophic activity. Therefore, we investigated the therapeutic potential of DA-9801, in comparison with alpha lipoic acid (ALA), for peripheral nerves preservation in experimental diabetes. Experimental animals were divided into 4 groups, and each group was designated according to the type of treatment administered as follows: normal, DM, DM+DA-9801, and DM+ALA. After 16 weeks, response thresholds to tactile and thermal stimuli were higher in DM+DA-9801 group than in nontreated DM group. This degree of increase in DM+DA-9801 group indicates more therapeutic potency of DA-9801 than ALA. Western blot analysis showed more significant increase in NGF and decrease in TNF-α and IL-6 in DM+DA-9801 group than in DM or DM+ALA groups (P < 0.05). IENF density was reduced less significantly in the DM+DA-9801 group than in other DM groups (7.61 ± 0.32, 4.2 ± 0.26, and 6.5 ± 0.30 in DM+DA-9801, DM, and DM+ALA, resp., P < 0.05). Mean myelinated axonal area in the sciatic nerves was significantly greater in DM+DA-9801 group than in other DM groups (69.2 ± 5.76, 54.0 ± 6.32, and 63.1 ± 5.41 in DM+DA-9801, DM, and DM+ALA, resp., P < 0.05). Results of this study demonstrated potential therapeutic applications of DA-9801 for the treatment of diabetic peripheral neuropathy.

  20. Effects of alpha-lipoic acid on expression of iron transport and storage proteins in BV-2 microglia cells.


    Chen, Ping; Li, Fei-Mi; Zhou, Yu-Fu; Qian, Christopher; Li, Juan; Jiang, Li-Rong; Qian, Zhong-Ming


    The antioxidant properties of alpha-lipoic acid (ALA) are associated with its ability to reduce iron in cells and tissues, which is partly due to its inhibiting effect on iron uptake from transferrin and its promoting effect on iron deposition into ferritin. However, the relevant mechanisms are unknown. We therefore investigated the effects of ALA on the expression of transferrin receptor 1 (TfR1), divalent metal transporter 1 (DMT1), ferroportin 1 (Fpn1) and ferritin in BV-2 microglia cells. We demonstrated that ALA significantly inhibited DMT1 expression, lowered ferritin-light-chain (Ft-L) and ferritin-heavy-chain (Ft-H) content, and had no effect on TfR1 and Fpn1 in BV-2 microglia cells. This indicated that the inhibiting effect of ALA on DMT1 might be one of the causes of the ALA-induced reduction in cellular transferrin-bound-iron uptake. We also demonstrated that ALA enhanced DMT1 and TfR1 expression in ferric ammonium citrate (FAC)-treated cells. FAC treatment led to a significant increase in Ft-L, Ft-H and Fpn1, and pre-treatment with ALA resulted in a further increase in the contents of Ft-L and Ft-H but not Fpn1 in cells. ALA could up-regulate TfR1, DMT1 and ferritin expression when iron is increased outside of the cell, promoting iron deposition into ferritin by increasing cell iron uptake, and then reducing free iron both inside and outside of the cell. Copyright © 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  1. Bacteriological analysis of water by potentiometric measurement of lipoic acid reduction: preliminary assays for selective detection of indicator organisms.

    PubMed Central

    Charriere, G; Jouenne, T; Lemeland, J F; Selegny, E; Junter, G A


    The practical task of adapting an original potentiometric technique to the bacteriological analysis of water is discussed. Various laboratory strains of organisms belonging to the usual aquatic flora were inoculated one by one in a minimal lactose broth supplied with lipoic (thioctic) acid. The time evolution of the redox potential of the cultures was followed during incubation by combined gold versus reference electrodes. When the incubation temperature was regulated at 36 degrees C, most organisms were able to grow and to reduce the coenzyme, generating changes in the redox potential of the culture. However, very few organisms developed significant reductive activity when the temperature was increased to 41 degrees C and when the broth was provided with sodium deoxycholate. Among the fecal coliform organisms, only Escherichia coli and Klebsiella pneumoniae exhibited early but reproducible potential-time responses. Positive potentiometric responses were also recorded with Acinetobacter calcoaceticus. E. coli showed rapid potentiometric signals as compared with K. pneumoniae. The time required for 100-mV shift of potential to be detected was related to the logarithm of the initial concentration of E. coli or K. pneumoniae in the culture broth. Experiments on natural surface water samples showed the the potentiometric method, associated with the selective incubation conditions, mainly detected E. coli among the bacterial flora of the tested environmental water. The calibration curve relating the time required for a 100-mV shift of potential to be detected to the number of fecal coliforms, as determined by control fecal coliform-selective plate counts, was consistent with the composite standard curve of detection times obtained with six different laboratory strains of E. coli.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:6421230

  2. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    PubMed Central

    Li, Y.; Ma, Q. G.; Zhao, L. H.; Guo, Y. Q.; Duan, G. X.; Zhang, J. Y.; Ji, C.


    Alpha-lipoic acid (α-LA) is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1). Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05) change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver. PMID:25050030

  3. Structural Analysis of Crystalline R(+)-α-Lipoic Acid-α-cyclodextrin Complex Based on Microscopic and Spectroscopic Studies

    PubMed Central

    Ikuta, Naoko; Endo, Takatsugu; Hosomi, Shota; Setou, Keita; Tanaka, Shiori; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Takahashi, Kenji; Terao, Keiji; Matsugo, Seiichi


    R(+)-α-lipoic acid (RALA) is a naturally-occurring substance, and its protein-bound form plays significant role in the energy metabolism in the mitochondria. RALA is vulnerable to a variety of physical stimuli, including heat and UV light, which prompted us to study the stability of its complexes with cyclodextrins (CDs). In this study, we have prepared and purified a crystalline RALA-αCD complex and evaluated its properties in the solid state. The results of 1H NMR and PXRD analyses indicated that the crystalline RALA-αCD complex is a channel type complex with a molar ratio of 2:3 (RALA:α-CD). Attenuated total reflection/Fourier transform infrared analysis of the complex showed the shift of the C=O stretching vibration of RALA due to the formation of the RALA-αCD complex. Raman spectroscopic analysis revealed the significant weakness of the S–S and C–S stretching vibrations of RALA in the RALA-αCD complex implying that the dithiolane ring of RALA is almost enclosed in glucose ring of α-CD. Extent of this effect was dependent on the direction of the excitation laser to the hexagonal morphology of the crystal. Solid-state NMR analysis allowed for the chemical shift of the C=O peak to be precisely determined. These results suggested that RALA was positioned in the α-CD cavity with its 1,2-dithiolane ring orientated perpendicular to the plane of the α-CD ring. PMID:26501268

  4. Alpha-Lipoic Acid Shows Promise to Improve Migraine in Patients with Insulin Resistance: A 6-Month Exploratory Study.


    Cavestro, Cinzia; Bedogni, Giorgio; Molinari, Filippo; Mandrino, Silvia; Rota, Eugenia; Frigeri, Maria Cristina


    Alpha-lipoic acid (ALA) is known to lower insulin resistance (IR), which is common among migraineurs. To assess the effect of ALA on headache in migraineurs with IR, we performed an exploratory study on a cohort of patients with migraine, followed at our Headache Center. The 32 patients took ALA 400 mg b.i.d. for 6 months in addition to their on-going treatment. The percentage of patients with a reduction of at least 50% of the attacks was 0.53 (confidence interval [95% CI] 0.36-0.70) at 2 months, 0.56 (0.39-0.73) at 4 months, and 0.69 (0.53-0.85) at 6 months. The incidence rate ratio of attacks at 6 months versus baseline was 0.48 (0.43-0.53, P < .001), corresponding to a mean (95% CI) number of attacks of 5 (4-6) versus 11 (10-12). The number of days of treatment in the previous month was 7.7 (6.8-8.7) at baseline, 5.4 (4.6-6.2) at 2 months, 5.3 (4.5-6.1) at 4 months, and 4.3 (3.6-5.0) at 6 months. Baseline and 120-min glucose and insulin and quantitative insulin sensitivity check index (QUICKI) and the Stumvoll index did not change at 6 months versus baseline. This exploratory study shows that the administration of ALA may be associated with a reduction in the number of attacks and the days of treatment in migraineurs with IR. A randomized controlled trial is needed to test this possibility.

  5. Effects of alpha-lipoic acid on chemerin secretion in 3T3-L1 and human adipocytes.


    Prieto-Hontoria, Pedro L; Pérez-Matute, Patricia; Fernández-Galilea, Marta; López-Yoldi, Miguel; Sinal, Christopher J; Martínez, J Alfredo; Moreno-Aliaga, María J


    Chemerin is a novel adipokine associated with obesity and insulin resistance. α-Lipoic acid (α-LA) has shown beneficial properties on diabetes and obesity. The aim of this study was to examine the effects of α-LA on chemerin production in adipocytes in absence or presence of TNF-α, insulin and AICAR. The potential signaling pathways involved in α-LA effects on chemerin were also analyzed. α-LA actions on chemerin were tested in differentiated 3T3-L1 adipocytes and in some cases in human subcutaneous and omental adipocytes. Chemerin mRNA levels were measured by RT-PCR and the amount of chemerin secreted to culture media was determined by ELISA. α-LA induced a concentration-dependent inhibition on both chemerin secretion and mRNA levels in 3T3-L1 adipocytes. The AMPK activator AICAR and the PI3K inhibitor LY294002 dramatically abrogated both chemerin secretion and gene expression, and further potentiated the inhibitory effect of α-LA on chemerin secretion. Insulin was able to partially reverse the inhibitory action of α-LA on chemerin secretion. α-LA also reduced basal chemerin secretion in both subcutaneous and omental adipocytes from overweight/obese subjects. Moreover, α-LA was able to abolish the stimulatory effects of the pro-inflammatory cytokine TNF-α on chemerin secretion. Our data demonstrated the ability of α-LA to inhibit chemerin production, an adipokine associated to obesity and metabolic syndrome, suggesting that the reduction of chemerin could contribute to the antiobesity/antidiabetic properties described for α-LA. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Lens and cornea lesions of rats fed corn syrup and the protective effects of alpha lipoic acid.


    Gunes, Alime; Ozmen, Ozlem; Saygın, Mustafa; Ascı, Halil; Tok, Levent; Tok, Ozlem; Dıncoglu, Dılnur


    To examine the pathological findings that occurred in the lens and cornea and biochemical findings in the lens of rats fed with corn syrup and the protective effects of alpha lipoic acid (ALA). Twenty-four rats were randomly divided into three groups. Group I served as the control group. Group II was used as the study group; the rats were treated with 30% corn sugar solution for 10 weeks. Group III was the treatment group. Corn syrup was given by the oral route to the rats during the study, and ALA (100 mg/kg) was added to the treatment 4 weeks after the study began. At the end of the experiment, central corneal thickness (CCT) was measured in all rats with an ultrasonic pachymeter. Then the right eyes of the rats were enucleated for histopathological examination of the cornea and lens. The left lenses were homogenized for biochemical analyses. The lenses of the rats treated with corn syrup revealed severe damage; many lens fibers appeared swollen and ruptured with large vacuoles near the lens epithelium. In addition, malondialdehyde (MDA) levels, a parameter of oxidative stress, increased but not significantly in Group II; however. ALA treatment decreased MDA levels significantly. Antioxidant enzyme and catalase (CAT) activities were significantly decreased in Group II, and ALA treatment increased these activities; however, the increase was not significant. Changes were observed in the cornea such as epithelial alterations, subepithelial vacuolizations, collagen fibers loss in the stromal layer, interruptions in the subepithelial basement membrane and central corneal thickening. Corn syrup can cause severe damage in rat lenses and corneas. However, ALA ameliorates the effect of corn syrup-related lesions on the cornea and lens.

  7. Role of alpha-lipoic acid in the management of anemia in patients with chronic renal failure undergoing hemodialysis

    PubMed Central

    El-Nakib, Gehad A; Mostafa, Tarek M; Abbas, Tarek M; El-Shishtawy, Mamdouh M; Mabrouk, Mokhtar M; Sobh, Mohammed A


    Introduction Anemia associated with chronic kidney disease is a serious complication necessitating expenditure of huge medical efforts and resources. This study investigates the role of alpha-lipoic acid (ALA) in end stage renal disease patients undergoing hemodialysis. By the virtue of its antioxidative effects, ALA is expected to act as an erythropoietin (EPO) adjuvant, and also has extended beneficial effects on endothelial dysfunction. Methods Forty-four patients undergoing hemodialysis and receiving EPO were randomized into two groups: the first group received ALA 600 mg once daily for 3 months; while the other group represented the control group. Parameters measured at baseline and at end of study were hemoglobin, EPO doses, EPO resistance index (ERI), iron store indices, malondialdehyde, oxidized low-density lipoprotein (ox-LDL), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), and asymmetric dimethylarginine (ADMA), as well as routine laboratory follow-up. Results EPO doses and ERI were significantly decreased in the treatment group, while they did not change in the control group. Hemoglobin, iron store indices, malondialdehyde, oxidized ox-LDL, IL-6, TNF-α, and ADMA were similar in both treatment and control groups at baseline, and did not change by the end of study period. Likewise, routine laboratory measures were not affected by the treatment. Conclusion ALA could be used in hemodialysis patients to reduce requirements for EPO. However, larger and longer term studies are required to clarify the exact role of ALA in hemodialysis as well as in pre-hemodialysis patients. PMID:24023521

  8. Lipoic acid induces p53-independent cell death in colorectal cancer cells and potentiates the cytotoxicity of 5-fluorouracil.


    Dörsam, Bastian; Göder, Anja; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg


    Alpha-lipoic acid (LA), which plays a pivotal role in mitochondrial energy metabolism, is an endogenous dithiol compound with an array of antioxidative functions. It has been shown that LA triggers cell death in tumor cell lines, whereas non-transformed cells are hardly affected. In the present study, we analyzed the cytotoxicity of LA on colorectal cancer (CRC) cells differing in their p53 status and investigated a putative synergistic effect with the anticancer drug 5-fluorouracil (5-FU). We show that LA induces a dose-dependent decrease in cell viability, which was independent of the p53 status as attested in isogenic p53-proficient and p53-deficient cell lines. This effect was largely attributable to cell death induction as revealed by Annexin-V/PI staining. LA-treated HCT116 cells underwent caspase-dependent and caspase-independent cell death, which was blocked by the pan-caspase inhibitor zVAD and the RIP-kinase inhibitor Necrostatin-1, respectively. In CaCO-2 and HT29 cells, LA induced caspase-dependent cell demise via activation of caspase-9, caspase-3 and caspase-7 with subsequent PARP-1 cleavage as demonstrated by immunoblot analysis, activity assays and pan-caspase inhibition. Interestingly, LA treatment did neither activate p53 nor induced genotoxic effects as shown by lack of DNA strand breaks and phosphorylation of histone 2AX. Finally, we provide evidence that LA increases the cytotoxic effect induced by the anticancer drug 5-FU as revealed by significantly enhanced cell death rates in HCT116 and CaCO-2 cells. Collectively, these findings demonstrate that LA induces CRC cell death independent of their p53 status and potentiates the cytotoxicity of 5-FU without causing DNA damage on its own, which makes it a candidate for tumor therapy.

  9. Lipoic acid and haloperidol-induced vacuous chewing movements: Implications for prophylactic antioxidant use in tardive dyskinesia.


    Lister, Joshua; Andreazza, Ana C; Navaid, Bushra; Wilson, Virginia S; Teo, Celine; Nesarajah, Yasika; Wilson, Alan A; Nobrega, José N; Fletcher, Paul J; Remington, Gary


    Tardive dyskinesia (TD), a potentially irreversible antipsychotic (AP)-related movement disorder, is a risk with all currently available antipsychotics. AP-induced vacuous chewing movements (VCMs) in rats, a preclinical model of TD, can be attenuated by antioxidant-based treatments although there is a shortage of well-designed studies. Lipoic acid (LA) represents a candidate antioxidant for the treatment of oxidative stress-related nervous system disorders; accordingly, its effects on AP-induced VCMs and striatal oxidative stress were examined. Rats treated with haloperidol decanoate (HAL; 21mg/kg every 3weeks, IM) for 12weeks were concurrently treated with LA (10 or 20mg/kg, PO). VCMs were assessed weekly by a blinded rater, and locomotor activity was evaluated as were striatal lipid peroxidation markers and serum HAL levels. VCMs were decreased by the lower dose (nonsignificant), whereas a significant increase was recorded with the higher dose of LA. HAL decreased locomotor activity and this was unaffected by LA. Striatal malondialdehyde (MDA) levels in HAL-treated rats were reduced by both LA doses, while 4-hydroxynonenal (4-HNE) levels were predictive of final VCM scores (averaged across weeks 10-12). Study limitations include differences between antipsychotics in terms of oxidative stress, LA dosing, choice of biomarkers for lipid peroxidation, and generalizability to TD in humans. Collectively, current preclinical evidence does not support a "protective" role for antioxidants in preventing TD or its progression, although clinical evidence offers limited evidence supporting such an approach. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Nucleic acid compositions and the encoding proteins


    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.


    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  11. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging.


    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida


    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA.

  12. Clinical Usefulness of Oral Supplementation with Alpha-Lipoic Acid, Curcumin Phytosome, and B-Group Vitamins in Patients with Carpal Tunnel Syndrome Undergoing Surgical Treatment

    PubMed Central

    Pajardi, Giorgio; Bortot, Paola; Ponti, Veronica; Novelli, Chiara


    We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS), scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n = 60) served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n = 60) received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation). Patients in Group C (n = 60) received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05). Moreover, patients in Group B had a significantly lower number of positive Phalen's tests at 3 months compared with the other study groups (P < 0.05). We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve. PMID:24563654

  13. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging

    PubMed Central

    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida


    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA. PMID:26788510

  14. Clinical usefulness of oral supplementation with alpha-lipoic Acid, curcumin phytosome, and B-group vitamins in patients with carpal tunnel syndrome undergoing surgical treatment.


    Pajardi, Giorgio; Bortot, Paola; Ponti, Veronica; Novelli, Chiara


    We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS), scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n = 60) served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n = 60) received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation). Patients in Group C (n = 60) received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05). Moreover, patients in Group B had a significantly lower number of positive Phalen's tests at 3 months compared with the other study groups (P < 0.05). We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve.

  15. Modulatory effects of curcumin, silybin-phytosome and alpha-R-lipoic acid against thioacetamide-induced liver cirrhosis in rats.


    Ali, Shimaa Omar; Darwish, Hebatallah Abd El-moeti; Ismail, Nabila Abd El-fattah


    Liver cirrhosis is the final consequence of a progressive fibrotic process characterized by excessive collagen deposition and destruction of the normal liver architecture. This study aimed to investigate the protective effects of curcumin, silybin-phytosome and alpha-R-lipoic acid against thioacetamide-induced cirrhosis. Male rats were allocated into five groups of which one group received saline and served as normal control. Animals from groups 2-5 were treated with thioacetamide administered intraperitoneally at a dose of 200 mg/kg 3 times per week for 7 weeks. Group 2 was left untreated while groups from 3 to 5 were given a daily oral dose of curcumin, silybin-phytosome or alpha-R-lipoic acid simultaneously with thioacetamide. Increases in hepatic levels of malondialdehyde (MDA) and protein carbonyls (Pr Co) associated with thioacetamide administration were partially blocked in those groups receiving supplements. Glutathione (GSH) depletion, collagen deposition, matrix metalloproteinase-2 (MMP-2) activity, transforming growth factor-β1 (TGF-β1) level as well as α-smooth muscle actin (α-SMA) and heat shock protein-47 (HSP-47) gene expressions were also decreased in response to supplements administration. Serological analysis of liver function and histopathological examination reinforced the results. In conclusion, the present study highlights the antioxidant and the antifibrotic potentials of these supplements against chronic liver diseases caused by ongoing hepatic damage. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Alleviation of lindane induced toxicity in testis of Swiss mice (Mus musculus) by combined treatment with vitamin C, vitamin E and alpha-lipoic acid.


    Nagda, Girima; Bhatt, Devendra Kumar


    Mitigation of lindane induced toxicity in testis of Swiss mice by combined treatment with vitamin C, vitamin E and alpha-lipoic acid has been evaluated. Male healthy mice (40), 8-10 weeks old were randomly selected and divided into 4 groups, control (C); lindane (L); antioxidant (A) and antioxidant plus lindane (A+L). Group C animals were administered only the vehicle (olive oil); in group L lindane was administered orally at a dose of 40 mg/kg body wt.; in group A combination of antioxidants at a dose of 125 mg/kg body wt.(vitamin C: 50 mg/kg body wt., vitamin E: 50 mg/kg body wt. and alpha-lipoic acid: 25 mg/kg body wt.) was administered orally; in group A+L both antioxidants (125 mg/kg body wt.) and lindane (40 mg/kg body wt.) were administered at their respective doses. In group A+L antioxidants were administered 1 h prior to lindane administration. All treatments were continuously given for 60 days. Histopathological changes due to lindane intoxication indicated shrunken and distorted seminiferous tubules, sparse Leydig cells and blood vessels and atrophy in the tissue. The testis weight also decreased significantly. Lindane treated group showed increased lipid peroxidation, whereas glutathione, glutathione peroxidase, superoxide dismutase, catalase and protein were significantly decreased compared to control. Lindane induced damage was minimized by administration of antioxidants. Results suggest that combined pretreatment with antioxidants can alleviate the damage caused to testis by lindane.

  17. Lipoic Acid Restores Age-Associated Impairment of Brain Energy Metabolism through the Modulation of Akt/JNK Signaling and PGC1α Transcriptional Pathway

    PubMed Central

    Jiang, Tianyi; Yin, Fei; Yao, Jia; Brinton, Roberta Díaz; Cadenas, Enrique


    Summary This study examines the progress of a hypometabolic state inherent in brain aging with an animal model consisting of Fischer 344 rats of young, middle, and old ages. Dynamic microPET scanning demonstrated a significant decline in brain glucose uptake at old ages, which was associated with a decrease in the expression of insulin-sensitive neuronal glucose transporters GLUT3/4 and of microvascular endothelium GLUT1. Brain aging was associated with an imbalance of the PI3K/Akt pathway of insulin signaling and JNK signaling and a downregulation of the PGC1α – mediated transcriptional pathway of mitochondrial biogenesis that impinged on multiple aspects of energy homeostasis. R-(+)-lipoic acid treatment increased glucose uptake, restored the balance of Akt/JNK signaling, and enhanced mitochondrial bioenergetics and the PGC1α-driven mitochondrial biogenesis. It may be surmised that impairment of a mitochondria-cytosol-nucleus communication is underlying the progression of the age-related hypometabolic state in brain; the effects of lipoic acid are not organelle-limited but reside on the functional and effective coordination of this communication that results in improved energy metabolism. PMID:23815272

  18. Lipoic acid restores age-associated impairment of brain energy metabolism through the modulation of Akt/JNK signaling and PGC1α transcriptional pathway.


    Jiang, Tianyi; Yin, Fei; Yao, Jia; Brinton, Roberta D; Cadenas, Enrique


    This study examines the progress of a hypometabolic state inherent in brain aging with an animal model consisting of Fischer 344 rats of young, middle, and old ages. Dynamic microPET scanning demonstrated a significant decline in brain glucose uptake at old ages, which was associated with a decrease in the expression of insulin-sensitive neuronal glucose transporters GLUT3/4 and of microvascular endothelium GLUT1. Brain aging was associated with an imbalance between the PI3K/Akt pathway of insulin signaling and c-Jun N-terminal kinase (JNK) signaling and a downregulation of the PGC1α-mediated transcriptional pathway of mitochondrial biogenesis that impinged on multiple aspects of energy homeostasis. R-(+)-lipoic acid treatment increased glucose uptake, restored the balance of Akt/JNK signaling, and enhanced mitochondrial bioenergetics and the PGC1α-driven mitochondrial biogenesis. It may be surmised that impairment of a mitochondria-cytosol-nucleus communication is underlying the progression of the age-related hypometabolic state in brain; the effects of lipoic acid are not organelle-limited, but reside on the functional and effective coordination of this communication that results in improved energy metabolism. © 2013 the Anatomical Society and John Wiley & Sons Ltd.

  19. The clinical efficacy of cosmeceutical application of liquid crystalline nanostructured dispersions of alpha lipoic acid as anti-wrinkle.


    Sherif, Saly; Bendas, Ehab R; Badawy, Sabry


    Topical 5% alpha lipoic acid (ALA) has shown efficacy in treatment of photo-damaged skin. The aim of this work was to evaluate the potential of poloxamer (P407) gel as a vehicle for the novel lipid base particulate system (cubosome dispersions) of ALA. Cubosome dispersions were formulated by two different approaches, emulsification of glyceryl monoolein (GMO) and poloxamer (P407) in water followed by ultrasonication, and the dilution method using a hydrotrope. Three different concentrations of GMO were used to formulate the cubosome dispersions using the first method, 5% (D1), 10% (D2) and 15% w/w (D3). In the second technique an isotropic liquid was produced by combining GMO with ethanol, and this isotropic liquid was then diluted with a P407 solution (D4). The dispersions were characterized by zeta potential, light scattering techniques, optical and transmission electron microscopy, encapsulation efficiency and in vitro drug release. Results showed that D4 was not a uniform dispersion and that D1, D2 and D3 were uniform dispersions, in which by increasing the GMO content in the dispersion, the size of the cubosomes decreased, zeta potential became more negative, encapsulation efficiency increased up to 86.48% and the drug release rate was slower. P407 gels were prepared using the cold method. Two concentrations of P407 gel were fabricated, 20 and 30% w/w. P407 gels were loaded with either ALA or dispersions containing ALA cubosomes. P407 gels were characterized by critical gelation temperature, rheological measurements and in vitro drug release studies. Results suggested that by increasing P407 concentration, the gelation temperature decreases and viscosity increases. Drug release in both cases was found to follow the Higuchi square root model. Gel loaded with ALA cubosomes provided a significantly lower release rate than the gel loaded with the un-encapsulated ALA. A double blinded placebo controlled clinical study was conducted, aiming to evaluate the efficacy

  20. Enantiomer-selective pharmacokinetics, oral bioavailability, and sex effects of various alpha-lipoic acid dosage forms.


    Hermann, Robert; Mungo, Julius; Cnota, Peter Jürgen; Ziegler, Dan


    The present study aimed to examine the enantiomer-selective pharmacokinetics (PK), relative bioavailability (Frel), and sex effects of various oral dosage forms of racemic alpha-lipoic acid (ALA). In an open-label, randomized, four-period, four-sequence crossover study, 24 healthy adult subjects (12 males and 12 females) received single doses of 600 mg of ALA in fasted state at four different occasions as follows: three 200 mg tablets (T 200); two 300 mg tablets (T 300); one 600 mg tablet (T 600); and a racemic ALA solution (OS). All tablet formulations (Thioctacid HR) were considered test treatments, while the OS (Thioctacid, 600 T) served as the reference treatment. Serial blood samples were collected over 8 hours postdose to quantify R-(+)- and S-(-)-ALA enantiomer plasma concentrations for the PK evaluation. The maximum observed plasma concentration (Cmax) and total exposure (area under the curve [AUC]0-t) were compared between treatments by analysis of variance. Weight-normalized Cmax and the AUC data of male and female study subjects were applied to examine the presence of sex effects. All treatments displayed rapid absorption of both enantiomers with median time to maximum concentration (tmax) values ranging from 0.33-0.5 hours. The Frel of all tablet formulations was comparable, with R-(+)-enantiomer Cmax test/reference ratios ranging from 36% (T 600) to 43% (T 200), and R-(+)-enantiomer AUC test/reference ratios ranging from 64% (T 600) to 79% (T 300), indicating a favorable Frel of all tablet formulations, especially in terms of the total extent of absorption (AUC). An examination of weight-normalized female/male Cmax and AUC sex ratios for both ALA enantiomers indicated the absence of a significant sex effect for Cmax, as well as 20%-26% and 25%-32% higher R-(+)- and S-(-)-ALA enantiomer AUC outcomes in females when compared to males. The observed modest sex effect was comparable for both ALA enantiomers and across all formulations, and it did not appear

  1. α-Lipoic acid reduces neurogenic hypertension by blunting oxidative stress-mediated increase in ADAM17.


    de Queiroz, Thyago M; Xia, Huijing; Filipeanu, Catalin M; Braga, Valdir A; Lazartigues, Eric


    We previously reported that type 2 angiotensin-converting enzyme (ACE2) compensatory activity is impaired by the disintegrin and metalloprotease 17 (ADAM17), and lack of ACE2 is associated with oxidative stress in neurogenic hypertension. To investigate the relationship between ADAM17 and oxidative stress, Neuro2A cells were treated with ANG II (100 nM) 24 h after vehicle or α-lipoic acid (LA, 500 μM). ADAM17 expression was increased by ANG II (120.5 ± 9.1 vs. 100.2 ± 0.8%, P < 0.05) and decreased after LA (69.0 ± 0.3 vs. 120.5 ± 9.1%, P < 0.05). In another set of experiments, LA reduced ADAM17 (92.9 ± 5.3 vs. 100.0 ± 11.2%, P < 0.05) following its overexpression. Moreover, ADAM17 activity was reduced by LA in ADAM17-overexpressing cells [109.5 ± 19.8 vs. 158.0 ± 20.0 fluorescence units (FU)·min(-1)·μg protein(-1), P < 0.05], in which ADAM17 overexpression increased oxidative stress (114.1 ± 2.5 vs. 101.0 ± 1.0%, P < 0.05). Conversely, LA-treated cells attenuated ADAM17 overexpression-induced oxidative stress (76.0 ± 9.1 vs. 114.1 ± 2.5%, P < 0.05). In deoxycorticosterone acetate (DOCA)-salt hypertensive mice, a model in which ADAM17 expression and activity are increased, hypertension was blunted by pretreatment with LA (119.0 ± 2.4 vs. 131.4 ± 2.2 mmHg, P < 0.05). In addition, LA improved dysautonomia and baroreflex sensitivity. Furthermore, LA blunted the increase in NADPH oxidase subunit expression, as well as the increase in ADAM17 and decrease in ACE2 activity in the hypothalamus of DOCA-salt hypertensive mice. Taken together, these data suggest that LA might preserve ACE2 compensatory activity by breaking the feedforward cycle between ADAM17 and oxidative stress, resulting in a reduction of neurogenic hypertension. Copyright © 2015 the American Physiological Society.

  2. α-Lipoic acid reduces neurogenic hypertension by blunting oxidative stress-mediated increase in ADAM17

    PubMed Central

    de Queiroz, Thyago M.; Xia, Huijing; Filipeanu, Catalin M.; Braga, Valdir A.


    We previously reported that type 2 angiotensin-converting enzyme (ACE2) compensatory activity is impaired by the disintegrin and metalloprotease 17 (ADAM17), and lack of ACE2 is associated with oxidative stress in neurogenic hypertension. To investigate the relationship between ADAM17 and oxidative stress, Neuro2A cells were treated with ANG II (100 nM) 24 h after vehicle or α-lipoic acid (LA, 500 μM). ADAM17 expression was increased by ANG II (120.5 ± 9.1 vs. 100.2 ± 0.8%, P < 0.05) and decreased after LA (69.0 ± 0.3 vs. 120.5 ± 9.1%, P < 0.05). In another set of experiments, LA reduced ADAM17 (92.9 ± 5.3 vs. 100.0 ± 11.2%, P < 0.05) following its overexpression. Moreover, ADAM17 activity was reduced by LA in ADAM17-overexpressing cells [109.5 ± 19.8 vs. 158.0 ± 20.0 fluorescence units (FU)·min−1·μg protein−1, P < 0.05], in which ADAM17 overexpression increased oxidative stress (114.1 ± 2.5 vs. 101.0 ± 1.0%, P < 0.05). Conversely, LA-treated cells attenuated ADAM17 overexpression-induced oxidative stress (76.0 ± 9.1 vs. 114.1 ± 2.5%, P < 0.05). In deoxycorticosterone acetate (DOCA)-salt hypertensive mice, a model in which ADAM17 expression and activity are increased, hypertension was blunted by pretreatment with LA (119.0 ± 2.4 vs. 131.4 ± 2.2 mmHg, P < 0.05). In addition, LA improved dysautonomia and baroreflex sensitivity. Furthermore, LA blunted the increase in NADPH oxidase subunit expression, as well as the increase in ADAM17 and decrease in ACE2 activity in the hypothalamus of DOCA-salt hypertensive mice. Taken together, these data suggest that LA might preserve ACE2 compensatory activity by breaking the feedforward cycle between ADAM17 and oxidative stress, resulting in a reduction of neurogenic hypertension. PMID:26254330

  3. Co-administration of α-lipoic acid and glutathione is associated with no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels during the treatment of neuroborreliosis with intravenous ceftriaxone.


    Puri, Basant K; Hakkarainen-Smith, Jaana S; Derham, Anne; Monro, Jean A


    While pharmacotherapy with intravenous ceftriaxone, a third-generation cephalosporin, is a potential treatment of Lyme neuroborreliosis, there is concern that it can cause the formation of biliary sludge, leading to hepatobiliary complications such as biliary colic, jaundice and cholelithiasis, which are reflected in changes in serum levels of bilirubin and markers of cholestatic liver injury (alkaline phosphatase and γ-glutamyltranspeptidase). It has been suggested that the naturally occurring substances α-lipoic acid and glutathione may be helpful in preventing hepatic disease. α-Lipoic acid exhibits antioxidant, anti-inflammatory and anti-apoptotic activities in the liver, while glutathione serves as a sulfhydryl buffer. The aim of this study was to determine whether co-administration of α-lipoic acid and glutathione is associated with significant changes in serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase during the treatment of Lyme neuroborreliosis with long-term intravenous ceftriaxone. Serum levels of bilirubin, alkaline phosphatase and γ-glutamyltranspeptidase were measured in 42 serologically positive Lyme neuroborreliosis patients before and after long-term treatment with intravenous ceftriaxone (2-4 g daily) with co-administration of oral/intravenous α-lipoic acid (600 mg daily) and glutathione (100 mg orally or 0.6-2.4 g intravenously daily). None of the patients developed biliary colic and there were no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels over the course of the intravenous ceftriaxone treatment (mean length 75.0 days). Co-administration of α-lipoic acid and glutathione is associated with no significant changes in serum bilirubin, alkaline phosphatase or γ-glutamyltranspeptidase levels during the treatment of neuroborreliosis with intravenous ceftriaxone.

  4. Stability of vitamin C derivatives in topical formulations containing lipoic acid, vitamins A and E.


    Segall, A I; Moyano, M A


    The stability of ascorbyl palmitate, sodium ascorbyl phosphate and magnesium ascorbyl phosphate in topical formulations was investigated by direct reverse phase high performance liquid chromatography after sample dilution with a suitable buffer - organic solvent mixture. Ascorbyl palmitate, sodium ascorbyl phosphate and magnesium ascorbyl phosphate are derivatives of ascorbic acid which differ in hydrolipophilic properties. They are widely used in cosmetic and pharmaceutical preparations. According to the results, ascorbyl esters showed significant differences: sodium ascorbyl phosphate and magnesium ascorbyl phosphate are more stable derivatives of vitamin C than ascorbyl palmitate and may be easily used in cosmetic products.

  5. Nucleic acids encoding human trithorax protein


    Evans, Glen A.; Djabali, Malek; Selleri, Licia; Parry, Pauline


    In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

  6. The effects of α-lipoic acid on liver oxidative stress and free fatty acid composition in methionine-choline deficient diet-induced NAFLD.


    Stanković, Milena N; Mladenović, Dušan; Ninković, Milica; Ethuričić, Ivana; Sobajić, Slađana; Jorgačević, Bojan; de Luka, Silvio; Vukicevic, Rada Jesic; Radosavljević, Tatjana S


    Development of nonalcoholic fatty liver disease (NAFLD) occurs through initial steatosis and subsequent oxidative stress. The aim of this study was to examine the effects of α-lipoic acid (LA) on methionine-choline deficient (MCD) diet-induced NAFLD in mice. Male C57BL/6 mice (n=21) were divided into three groups (n=7 per group): (1) control fed with standard chow, (2) MCD2 group--fed with MCD diet for 2 weeks, and (3) MCD2+LA group--2 weeks on MCD receiving LA i.p. 100 mg/kg/day. After the treatment, liver samples were taken for pathohistology, oxidative stress parameters, antioxidative enzymes, and liver free fatty acid (FFA) composition. Mild microvesicular hepatic steatosis was found in MCD2 group, while it was reduced to single fat droplets evident in MCD2+LA group. Lipid peroxidation and nitrosative stress were increased by MCD diet, while LA administration induced a decrease in liver malondialdehyde and nitrates+nitrites level. Similary, LA improved liver antioxidative capacity by increasing total superoxide dismutase (tSOD), manganese SOD (MnSOD), and copper/zinc-SOD (Cu/ZnSOD) activity as well as glutathione (GSH) content. Liver FFA profile has shown a significant decrease in saturated acids, arachidonic, and docosahexaenoic acid (DHA), while LA treatment increased their proportions. It can be concluded that LA ameliorates lipid peroxidation and nitrosative stress in MCD diet-induced hepatic steatosis through an increase in SOD activity and GSH level. In addition, LA increases the proportion of palmitic, stearic, arachidonic, and DHA in the fatty liver. An increase in DHA may be a potential mechanism of anti-inflammatory and antioxidant effects of LA in MCD diet-induced NAFLD.

  7. The Effects of α-Lipoic Acid on Liver Oxidative Stress and Free Fatty Acid Composition in Methionine–Choline Deficient Diet-Induced NAFLD

    PubMed Central

    Stanković, Milena N.; Mladenović, Dušan; Ninković, Milica; Ðuričić, Ivana; Šobajić, Slađana; Jorgačević, Bojan; de Luka, Silvio; Vukicevic, Rada Jesic


    Abstract Development of nonalcoholic fatty liver disease (NAFLD) occurs through initial steatosis and subsequent oxidative stress. The aim of this study was to examine the effects of α-lipoic acid (LA) on methionine–choline deficient (MCD) diet-induced NAFLD in mice. Male C57BL/6 mice (n=21) were divided into three groups (n=7 per group): (1) control fed with standard chow, (2) MCD2 group—fed with MCD diet for 2 weeks, and (3) MCD2+LA group—2 weeks on MCD receiving LA i.p. 100 mg/kg/day. After the treatment, liver samples were taken for pathohistology, oxidative stress parameters, antioxidative enzymes, and liver free fatty acid (FFA) composition. Mild microvesicular hepatic steatosis was found in MCD2 group, while it was reduced to single fat droplets evident in MCD2+LA group. Lipid peroxidation and nitrosative stress were increased by MCD diet, while LA administration induced a decrease in liver malondialdehyde and nitrates+nitrites level. Similary, LA improved liver antioxidative capacity by increasing total superoxide dismutase (tSOD), manganese SOD (MnSOD), and copper/zinc-SOD (Cu/ZnSOD) activity as well as glutathione (GSH) content. Liver FFA profile has shown a significant decrease in saturated acids, arachidonic, and docosahexaenoic acid (DHA), while LA treatment increased their proportions. It can be concluded that LA ameliorates lipid peroxidation and nitrosative stress in MCD diet-induced hepatic steatosis through an increase in SOD activity and GSH level. In addition, LA increases the proportion of palmitic, stearic, arachidonic, and DHA in the fatty liver. An increase in DHA may be a potential mechanism of anti-inflammatory and antioxidant effects of LA in MCD diet-induced NAFLD. PMID:24325457

  8. α-lipoic acid ameliorates n-3 highly-unsaturated fatty acids induced lipid peroxidation via regulating antioxidant defenses in grass carp (Ctenopharyngodon idellus).


    Shi, Xiao-Chen; Jin, Ai; Sun, Jian; Yang, Zhou; Tian, Jing-Jing; Ji, Hong; Yu, Hai-Bo; Li, Yang; Zhou, Ji-Shu; Du, Zhen-Yu; Chen, Li-Qiao


    This study evaluated the protective effect of α-lipoic acid (LA) on n-3 highly unsaturated fatty acids (HUFAs)-induced lipid peroxidation in grass carp. The result indicated that diets with n-3 HUFAs increased the production of malondialdehyde (MDA) (P < 0.05), thereby inducing lipid peroxidation in liver and muscle of grass carp. Meanwhile, compared with control group, the hepatosomatic index (HSI) and kidney index (KI) of grass carp were markedly increased in n-3 HUFAs-only group. However, diets with LA remarkably inhibited the n-3 HUFAs-induced increase of HSI, KI, and MDA level in serum, liver and muscle (P < 0.05). Interestingly, LA also significantly elevated the ratio of total n-3 HUFAs in fatty acid composition of muscle and liver (P < 0.05). Furthermore, LA significantly promoted the activity of antioxidant enzymes in serum, muscle and liver of grass carp (P < 0.05), including superoxide dismutase (SOD), catalase (CAT), and glutathione s-transferase (GST). The further results showed that LA significantly elevated mRNA expression of antioxidant enzymes with promoting the mRNA expression of NF-E2-related nuclear factor 2 (Nrf2) and decreasing Kelch-like-ECH-associated protein 1 (Keap1) mRNA level. From the above, these results suggested that LA could attenuate n-3 HUFAs-induced lipid peroxidation, remit the toxicity of the lipid peroxidant, and protect n-3 HUFAs against lipid peroxidation to promote its deposition in fish, likely strengthening the activity of antioxidant enzymes through regulating mRNA expressions of antioxidant enzyme genes via mediating Nrf2-Keap1 signaling pathways. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Lipoic acid stimulates cAMP production via the EP2 and EP4 prostanoid receptors and inhibits IFN gamma synthesis and cellular cytotoxicity in NK cells

    PubMed Central

    Salinthone, Sonemany; Schillace, Robynn V.; Marracci, Gail H.; Bourdette, Dennis N.; Carr, Daniel W.


    The antioxidant lipoic acid (LA) treats and prevents the animal model of multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE). In an effort to understand the therapeutic potential of LA in MS, we sought to define the cellular mechanisms that mediate the effects of LA on human natural killer (NK) cells, which are important in innate immunity as the first line of defense against invading pathogens and tumor cells. We discovered that LA stimulates cAMP production in NK cells in a dose-dependent manner. Studies using pharmacological inhibitors and receptor transfection experiments indicate that LA stimulates cAMP production via activation of the EP2 and EP4 prostanoid receptors and adenylyl cyclase. In addition, LA suppressed interleukin (IL)-12/IL-18 induced IFNγ secretion and cytotoxicity in NK cells. These novel findings suggest that LA may inhibit NK cell function via the cAMP signaling pathway. PMID:18562016

  10. Lipoic acid stimulates cAMP production via the EP2 and EP4 prostanoid receptors and inhibits IFN gamma synthesis and cellular cytotoxicity in NK cells.


    Salinthone, Sonemany; Schillace, Robynn V; Marracci, Gail H; Bourdette, Dennis N; Carr, Daniel W


    The antioxidant lipoic acid (LA) treats and prevents the animal model of multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE). In an effort to understand the therapeutic potential of LA in MS, we sought to define the cellular mechanisms that mediate the effects of LA on human natural killer (NK) cells, which are important in innate immunity as the first line of defense against invading pathogens and tumor cells. We discovered that LA stimulates cAMP production in NK cells in a dose-dependent manner. Studies using pharmacological inhibitors and receptor transfection experiments indicate that LA stimulates cAMP production via activation of the EP2 and EP4 prostanoid receptors and adenylyl cyclase. In addition, LA suppressed interleukin (IL)-12/IL-18 induced IFNgamma secretion and cytotoxicity in NK cells. These novel findings suggest that LA may inhibit NK cell function via the cAMP signaling pathway.

  11. The combination of exercise training and alpha-lipoic acid treatment has therapeutic effects on the pathogenic phenotypes of Alzheimer's disease in NSE/APPsw-transgenic mice.


    Cho, Joon Y; Um, Hyun S; Kang, Eun B; Cho, In H; Kim, Chul H; Cho, Jung S; Hwang, Dae Y


    Exercise training was suggested as a practical therapeutic strategy for human subjects suffering from Alzheimer's disease (AD) in our previous study. Therefore, the purpose of this study was to investigate the effects of combining exercise training with the administration of antioxidants on the pathological phenotype of AD. To accomplish this, non-transgenic mice (Non-Tg) and NSE/APPsw Tg mice were treated with alpha-lipoic acid and treadmill exercised for 16 weeks, after which their brains were evaluated to determine whether any changes in the pathological phenotype-related factors occurred. The results indicated that (i) the combination-applied (COMA) Tg group with exercise training (ET) and alpha-lipoic acid administration (LA) showed ameliorated spatial learning and memory compared to the sedentary (SED)-Tg and single-treatment groups; (ii) there were no differences in the level of Abeta-42 peptides across groups; (iii) the level of glucose transporter-1 and brain-derived neurotrophic factor proteins were highly increased in the COMA group, (iv) ET and LA did not induce a synergistic effect on the expression of heat shock protein-70 and apoptotic proteins including Bax and caspase-3; (v) the levels of SOD-1 and CAT suppressing oxidative stress were extensively higher in the COMA than in the single-treated groups and (vi) there were no significant differences across groups regarding these serum characteristics, although these levels were lower than the SED-Tg group. Taken together, these results suggest that the combination with ET and LA may contribute to protect the neuron injury induced by Abeta peptides and may be considered an effective therapeutic strategy for human subjects suffering from AD.

  12. The Antioxidant Additive Approach for Alzheimer's Disease Therapy: New Ferulic (Lipoic) Acid Plus Melatonin Modified Tacrines as Cholinesterases Inhibitors, Direct Antioxidants, and Nuclear Factor (Erythroid-Derived 2)-Like 2 Activators.


    Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane


    Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.

  13. Early vs. late intervention of high fat/low dose streptozotocin treated C57Bl/6J mice with enalapril, α-lipoic acid, menhaden oil or their combination: Effect on diabetic neuropathy related endpoints.


    Yorek, Matthew S; Obrosov, Alexander; Shevalye, Hanna; Coppey, Lawrence J; Kardon, Randy H; Yorek, Mark A


    We have previously demonstrated that enalapril, α-lipoic acid and menhaden (fish) oil has potential as a treatment for diabetic peripheral neuropathy. In this study we sought to determine the efficacy of these treatments individually or in combination on multiple neuropathic endpoints in a high fat fed low dose streptozotocin treated mouse, a model of type 2 diabetes, following early or late intervention. Four or twelve weeks after the onset of hyperglycemia, diabetic mice were treated with enalapril, α-lipoic acid, menhaden oil or their combination for 12 weeks. Afterwards, endpoints including glucose tolerance, motor and sensory nerve conduction velocity, thermal nociception, and intraepidermal and cornea nerve fiber density was determined. Glucose clearance was impaired in diabetic mice and significantly improved only with combination treatment and early intervention. Diabetes caused steatosis, slowing of motor and sensory nerve conduction velocity, thermal hypoalgesia and reduction in intraepidermal and cornea nerve fiber density. Treating diabetic mice with enalapril, α-lipoic acid or menhaden oil partially protected diabetic mice from these deficits, whereas the combination of these three treatments was more efficacious following early or late intervention. These studies suggest that a combination therapy may be more effective for treating neural complications of type 2 diabetes.

  14. Intervention of mitochondrial dysfunction-oxidative stress-dependent apoptosis as a possible neuroprotective mechanism of α-lipoic acid against rotenone-induced parkinsonism and L-dopa toxicity.


    Abdin, Amany A; Sarhan, Naglaa I


    The current study evidenced hypothesis that mitochondrial dysfunction-oxidative stress-dependent apoptotic pathways play a critical role in degeneration of dopaminergic neurons in Parkinson's disease. Model of rotenone-induced parkinsonism in rats produced decrease in striatal complex I activity and reduced glutathione with increase in nitrites concentration and caspase-3 activity. This was confirmed by significant correlation of catalepsy score with neurochemical parameters. Moreover, electron microscopic examination of striatal neurons displayed ultrastructure affection as hyperchromatic nuclei and disrupted mitochondria that are typical features of undergoing apoptosis. Administration of L-dopa as replacement therapy, although caused symptomatic improvement in catalepsy score, but further worsening in neurochemical parameters. Therefore, efforts are not only to improve effect of L-dopa, but also to introduce drugs provide antiparkinsonian and neuroprotective effects. In this study, α-lipoic acid exhibited noticeable neuroprotective effects by a mechanism via intervention of mitochondrial dysfunction-oxidative stress-dependent apoptotic pathways. Combination of α-lipoic acid efficiently halting deleterious toxic effects of L-dopa, revealed normalization of catalepsy score in addition to amelioration of neurochemical parameters and apparent preservation of striatal ultrastructure integrity, indicating benefit of both symptomatic and neuroprotective therapy. In conclusion, α-lipoic acid could be recommended as a disease-modifying therapy when given with L-dopa early in course of Parkinson's disease.

  15. The effect of alpha-lipoic acid on the neurovascular reflex arc in patients with diabetic neuropathy assessed by capillary microscopy.


    Haak, E S; Usadel, K H; Kohleisen, M; Yilmaz, A; Kusterer, K; Haak, T


    Patients with diabetic polyneuropathy are known to have an impaired neurovascular reflex arc compared to healthy controls. This is seen in a delayed decrease in microcirculation of the ipsilateral hand after cooling of the contralateral hand. The aim of this pilot study was to investigate whether intravenous alpha-lipoic acid (ALA) (Thioctacid, Asta Medica) therapy might be able to improve this impaired neurovascular reflex arc in patients with diabetic neuropathy. In addition, clinical effects were evaluated with the aid of the neuropathy symptom score (NSS) and the neuropathy disability score (NDS). Ten patients with diabetes mellitus and polyneuropathy (5 females, 5 males, 2 smokers, 5 IDDM, 5 NIDDM, body mass index 26.1 +/- 1.0 kg/m2, age 58.3 +/- 9.5 years, diabetes duration 15.7 +/- 11.2 years, Hb A1c 6.8 +/- 0.3%) were investigated by nail-fold capillaroscopy after contralateral cooling before and after intravenous therapy with 600 mg alpha-lipoic acid per day over 3 weeks. Cardiac autonomic neuropathy was excluded by beat-to-beat variation analysis. Symptoms of diabetic neuropathy were evaluated before and after therapy with the aid of the NSS and NDS. Capillary blood cell velocity (CBV) of the hand was determined before, during, and for the following 30 min after cooling (3 min at 15 degrees C) of the contralateral hand. Blood pressure, heart rate, and local skin temperature were monitored at 2-min intervals. ALA therapy resulted in a significant improvement of the microcirculatory response to cooling, as seen by an immediate decrease in CBV of 12. 3% (P < 0.02 vs before treatment), which was absent before therapy. Blood pressure, heart rate, and local skin temperature were not different between investigations. There was a significant improvement of the NSS after therapy (5.4 +/- 1.1 vs 8.6 +/- 1.1 points, P < 0.01). These results demonstrate that intravenous therapy with ALA has a positive influence on the impaired neurovascular reflex arc in patients

  16. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells

    PubMed Central

    Choi, Ji Hyun; Cho, Soon Ok


    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation. PMID:26632410

  17. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells.


    Choi, Ji Hyun; Cho, Soon Ok; Kim, Hyeyoung


    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation.

  18. Modulatory effects of vitamin E, acetyl-L-carnitine and α-lipoic acid on new potential biomarkers for Alzheimer's disease in rat model.


    Ahmed, Hanaa H


    Alzheimer's disease (AD) is the most common chronic neurodegenerative disorder associated with aging. This study aimed to explore new markers for AD as total homocysteine (tHcy), insulin, insulin like growth factor-1 (IGF-1), interlukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α); to determine the modulatory effects of vitamin E (VE), acetyl-L-carnitine (ALC) and α-lipoic acid (LA) on the investigated parameters and to evaluate the possible therapeutic role of these nutraceutical in AD-induced in rats. Our results revealed that brain acetylcholine esterase (AChE) activity and tHcy levels were significantly increased in AD model. Folic acid, vitamin B(12) levels and Na(+)/K(+) ATPase activity were markedly reduced. Plasma insulin and IGF-1 levels were noticeably decreased but plasma TNF-α and IL-1β concentrations were significantly increased, confirming that abnormal inflammatory response is associated with AD. Treatment by VE, ALC and LA restored the above mentioned parameters to about normal levels comparable to those of donepezil, indicating that tHcy, insulin, IGF-1, IL-1β and TNF-α may be considered as new biomarkers for AD. The study points to the potential restoring effects of VE, ALC and LA in AD model. Our study provides evidence for the importance of dietary supplementation in delaying the progression of age-related neurodegenerative diseases.

  19. Combined R-alpha-lipoic acid and acetyl-L-carnitine exerts efficient preventative effects in a cellular model of Parkinson's disease.


    Zhang, Hongyu; Jia, Haiqun; Liu, Jianghai; Ao, Ni; Yan, Bing; Shen, Weili; Wang, Xuemin; Li, Xin; Luo, Cheng; Liu, Jiankang


    Mitochondrial dysfunction and oxidative damage are highly involved in the pathogenesis of Parkinson's disease (PD). Some mitochondrial antioxidants/nutrients that can improve mitochondrial function and/or attenuate oxidative damage have been implicated in PD therapy. However, few studies have evaluated the preventative effects of a combination of mitochondrial antioxidants/nutrients against PD, and even fewer have sought to optimize the doses of the combined agents. The present study examined the preventative effects of two mitochondrial antioxidant/nutrients, R-alpha-lipoic acid (LA) and acetyl-L-carnitine (ALC), in a chronic rotenone-induced cellular model of PD. We demonstrated that 4-week pretreatment with LA and/or ALC effectively protected SK-N-MC human neuroblastoma cells against rotenone-induced mitochondrial dysfunction, oxidative damage and accumulation of alpha-synuclein and ubiquitin. Most notably, we found that when combined, LA and ALC worked at 100-1000-fold lower concentrations than they did individually. We also found that pretreatment with combined LA and ALC increased mitochondrial biogenesis and decreased production of reactive oxygen species through the up-regulation of the peroxisome proliferator-activated receptor-gamma coactivator 1alpha as a possible underlying mechanism. This study provides important evidence that combining mitochondrial antioxidant/nutrients at optimal doses might be an effective and safe prevention strategy for PD.

  20. Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets.


    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng


    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens.

  1. The effect of acetyl-L-carnitine and R-alpha-lipoic acid treatment in ApoE4 mouse as a model of human Alzheimer's disease.


    Shenk, Justin C; Liu, Jiankang; Fischbach, Kathryn; Xu, Kui; Puchowicz, Michel; Obrenovich, Mark E; Gasimov, Eldar; Alvarez, Ludis Morales; Ames, Bruce N; Lamanna, Joseph C; Aliev, Gjumrakch


    We measured age-dependent effects of human ApoE4 on cerebral blood flow (CBF) using ApoE4 transgenic mice compared to age-matched wild-type (WT) mice by use of [(14)C] iodoantipyrene autoradiography. ApoE4 associated factors reduce CBF gradually to create brain hypoperfusion when compared to WT, and the differences in CBF are greatest as animals age from 6-weeks to 12-months. Transmission electron microscopy with colloidal gold immunocytochemistry showed structural damage in young and aged microvessel endothelium of ApoE4 animals extended to the cytoplasm of perivascular cells, perivascular nerve terminals and hippocampal neurons and glial cells. These abnormalities coexist with mitochondrial structural alteration and mitochondrial DNA overproliferation and/or deletion in all brain cellular compartments. Spatial memory and temporal memory tests showed a trend in improving cognitive function in ApoE4 mice fed selective mitochondrial antioxidants acetyl-l-carnitine and R-alpha-lipoic acid. Our findings indicate that ApoE4 genotype-induced mitochondrial changes and associated structural damage may explain age-dependent pathology seen in AD, indicating potential for novel treatment strategies in the near future.

  2. Alpha-Lipoic Acid Downregulates IL-1β and IL-6 by DNA Hypermethylation in SK-N-BE Neuroblastoma Cells.


    Dinicola, Simona; Proietti, Sara; Cucina, Alessandra; Bizzarri, Mariano; Fuso, Andrea


    Alpha-lipoic acid (ALA) is a pleiotropic molecule with antioxidant and anti-inflammatory properties, of which the effects are exerted through the modulation of NF-kB. This nuclear factor, in fact, modulates different inflammatory cytokines, including IL-1b and IL-6, in different tissues and cell types. We recently showed that IL-1b and IL-6 DNA methylation is modulated in the brain of Alzheimer's disease patients, and that IL-1b expression is associated to DNA methylation in the brain of patients with tuberous sclerosis complex. These results prompted us to ask whether ALA-induced repression of IL-1b and IL-6 was dependent on DNA methylation. Therefore, we profiled DNA methylation in the 5'-flanking region of the two aforementioned genes in SK-N-BE human neuroblastoma cells cultured in presence of ALA 0.5 mM. Our experimental data pointed out that the two promoters are hypermethylated in cells supplemented with ALA, both at CpG and non-CpG sites. Moreover, the observed hypermethylation is associated with decreased mRNA expression and decreased cytokine release. These results reinforce previous findings indicating that IL-1b and IL-6 undergo DNA methylation-dependent modulation in neural models and pave the road to study the epigenetic mechanisms triggered by ALA.

  3. Colonic and Hepatic Modulation by Lipoic Acid and/or N-Acetylcysteine Supplementation in Mild Ulcerative Colitis Induced by Dextran Sodium Sulfate in Rats

    PubMed Central

    Moura, Fabiana Andréa; de Andrade, Kívia Queiroz; de Araújo, Orlando Roberto Pimentel; Santos, Juliana Célia de Farias


    Lipoic acid (LA) and N-acetylcysteine (NAC) are antioxidant and anti-inflammatory agents that have not yet been tested on mild ulcerative colitis (UC). This study aims to evaluate the action of LA and/or NAC, on oxidative stress and inflammation markers in colonic and hepatic rat tissues with mild UC, induced by dextran sodium sulfate (DSS) (2% w/v). LA and/or NAC (100 mg·kg·day−1, each) were given, once a day, in the diet, in a pretreatment phase (7 days) and during UC induction (5 days). Colitis induction was confirmed by histological and biochemical analyses (high performance liquid chromatography, spectrophotometry, and Multiplex®). A redox imbalance occurred before an immunological disruption in the colon. NAC led to a decrease in hydrogen peroxide (H2O2), malondialdehyde (MDA) levels, and myeloperoxidase activity. In the liver, DSS did not cause damage but treatments with both antioxidants were potentially harmful, with LA increasing MDA and LA + NAC increasing H2O2, tumor necrosis factor alpha, interferon gamma, and transaminases. In summary, NAC exhibited the highest colonic antioxidant and anti-inflammatory activity, while LA + NAC caused hepatic damage. PMID:27957238

  4. Myoinositol combined with alpha-lipoic acid may improve the clinical and endocrine features of polycystic ovary syndrome through an insulin-independent action.


    De Cicco, Simona; Immediata, Valentina; Romualdi, Daniela; Policola, Caterina; Tropea, Anna; Di Florio, Christian; Tagliaferri, Valeria; Scarinci, Elisa; Della Casa, Silvia; Lanzone, Antonio; Apa, Rosanna


    The aim of our study was to investigate the effects of a combined treatment with alpha-lipoic acid (ALA) and myoinositol (MYO) on clinical, endocrine and metabolic features of women affected by polycystic ovary syndrome (PCOS). In this pilot cohort study, forty women with PCOS were enrolled and clinical, hormonal and metabolic parameters were evaluated before and after a six-months combined treatment with ALA and MYO daily. Studied patients experienced a significant increase in the number of cycles in six months (p < 0.01). The free androgen index (FAI), the mean androstenedione and DHEAS levels significantly decreased after treatment (p < 0.05). Mean SHBG levels significantly raised (p < 0.01). A significant improvement in mean Ferriman-Gallwey (F-G) score (p < 0.01) and a significant reduction of BMI (p < 0.01) were also observed. A significant reduction of AMH levels, ovarian volume and total antral follicular count were observed in our studied women (p< 0.05). No significant changes occurred in gluco-insulinaemic and lipid parameters after treatment. The combined treatment of ALA and MYO is able to restore the menstrual pattern and to improve the hormonal milieu of PCOS women, even in the absence of apparent changes in insulin metabolism.

  5. Multiple protective mechanisms of alpha-lipoic acid in oxidation, apoptosis and inflammation against hydrogen peroxide induced toxicity in human lymphocytes.


    Rahimifard, Mahban; Navaei-Nigjeh, Mona; Baeeri, Maryam; Maqbool, Faheem; Abdollahi, Mohammad


    The naturally antioxidant and coenzyme, alpha-lipoic acid (α-LA), has gained considerable attention regarding different functions and therapeutically effective in treating oxidative stress-associated diseases in the human body. This study was designed to examine the protective effect of α-LA against H2O2-induced oxidative stress and apoptosis in human lymphoid cells. Human peripheral blood lymphocytes were preincubated with α-LA and then exposed to H2O2. After that, the viability of the cells, rate of apoptosis, oxidative stress biomarkers such as reactive oxygen species (ROS) and level of lipid peroxidation (LPO), and also tumor necrosis factor-α (TNF-α) were studied. Pretreatment of lymphocytes with α-LA, dramatically enhanced viability of the cells and decreased apoptosis. Investigation of caspases gives a clear picture of the mechanism by which α-LA decreases ROS and causes a reduction in apoptosis through caspase-9-dependent mitochondrial pathway. Furthermore, α-LA dose dependently decreased oxidative stress by a reduction in level of LPO, and the dose of 1000 µM indicates a significant decrease (p < 0.01) in TNF-α level. Collectively, the present data show that α-LA is an ideal compound which has profound protective effects on oxidation, inflammation, and apoptosis. As a result, α-LA may indicate a new way toward the development of antioxidant therapy.

  6. Reversal of corticosterone-induced BDNF alterations by the natural antioxidant alpha-lipoic acid alone and combined with desvenlafaxine: Emphasis on the neurotrophic hypothesis of depression.


    de Sousa, Caren Nádia Soares; Meneses, Lucas Nascimento; Vasconcelos, Germana Silva; Silva, Márcia Calheiros Chaves; da Silva, Jéssica Calheiros; Macêdo, Danielle; de Lucena, David Freitas; Vasconcelos, Silvânia Maria Mendes


    Brain derived neurotrophic factor (BDNF) is linked to the pathophysiology of depression. We hypothesized that BDNF is one of the neurobiological pathways related to the augmentation effect of alpha-lipoic acid (ALA) when associated with antidepressants. Female mice were administered vehicle or CORT 20mg/kg during 14 days. From the 15th to 21st days the animals were divided in groups that were further administered: vehicle, desvenlafaxine (DVS) 10 or 20mg/kg, ALA 100 or 200mg/kg or the combinations of DVS10+ALA100, DVS20+ALA100, DVS10+ALA200 or DVS20+ALA200. ALA or DVS alone or in combination reversed CORT-induced increase in immobility time in the forced swimming test and decrease in sucrose preference, presenting, thus, an antidepressant-like effect. DVS10 alone reversed CORT-induced decrease in BDNF in the prefrontal cortex (PFC), hippocampus (HC) and striatum (ST). The same was observed in the HC and ST of ALA200 treated animals. The combination of DVS and ALA200 reversed CORT-induced alterations in BDNF and even, in some cases, increased the levels of this neurotrophin when compared to vehicle-treated animals in HC and ST. Taken together, these results suggest that the combination of the DVS+ALA may be valuable for treating conditions in which BDNF levels are decreased, such as depression. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Synergistic ameliorative effects of sesame oil and alpha-lipoic acid against subacute diazinon toxicity in rats: hematological, biochemical, and antioxidant studies.


    Abdel-Daim, Mohamed M; Taha, Ramadan; Ghazy, Emad W; El-Sayed, Yasser S


    Diazinon (DZN) is a common organophosphorus insecticide extensively used for agriculture and veterinary purposes. DZN toxicity is not limited to insects; it also induces harmful effects in mammals and birds. Our experiment evaluated the protective and antioxidant potential of sesame oil (SO) and (or) alpha-lipoic acid (ALA) against DZN toxicity in male Wistar albino rats. DZN-treated animals exhibited macrocytic hypochromic anemia and significant increases in serum biochemical parameters related to liver injury, including aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), γ-glutamyl transferase (γGT), cholesterol, and triglycerides. They also had elevated levels of markers related to cardiac injury, such as lactate dehydrogenase (LDH) and creatine phosphokinase (CPK), and increased biomarkers of renal injury, urea and creatinine. DZN also increased hepatic, renal, and cardiac lipid peroxidation and decreased antioxidant biomarker levels. SO and (or) ALA supplementation ameliorated the deleterious effects of DZN intoxication. Treatment improved hematology and serum parameters, enhanced endogenous antioxidant status, and reduced lipid peroxidation. Importantly, they exerted synergistic hepatoprotective, nephroprotective, and cardioprotective effects. Our findings demonstrate that SO and (or) ALA supplementation can alleviate the toxic effects of DZN via their potent antioxidant and free radical-scavenging activities.

  8. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy

    PubMed Central

    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin


    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  9. The Influence of α-Lipoic Acid and Garlic Administration on Biomarkers of Oxidative Stress and Inflammation in Rabbits Exposed to Oxidized Nutrition Oils

    PubMed Central

    Zalejska-Fiolka, Jolanta; Wielkoszyński, Tomasz; Rokicki, Wojciech; Dąbrowska, Natalia; Strzelczyk, Joanna Katarzyna; Kasperczyk, Aleksandra; Błaszczyk, Urszula; Kasperczyk, Sławomir; Stawiarska-Pięta, Barbara; Birkner, Ewa; Gamian, Andrzej


    We hypothesized that addition of substances with antioxidant activity could decrease the concentrations of biomarkers of oxidative stress and inflammatory process, thus inhibiting nonalcoholic steatohepatitis development. We investigated the influence of α-lipoic acid (ALA) and garlic administration on the development of adverse changes in rabbit liver and serum under oxidative stress conditions induced with HFD from oxidized oils. We determined 8-hydroxy-2′-deoxyguanosine (8OHdG) and malondialdehyde (MDA) in liver homogenates, total oxidant status (TOS), lipid peroxides (LOO) and tumor necrosis factor alpha (TNFα) in blood serum, and TNFα and IL-1α genes expression in liver. The results indicate that the intake of dietary ALA and garlic was significantly associated with decreases of 8OHdG and MDA levels in rabbits' liver tissue as well as TOS and LOO levels in rabbits' serum. Similarly, TNFα and IL-1α gene expressions were suppressed due to ALA and garlic supplementation. The histopathological analysis confirmed that HFD results in liver disorder leading to steatosis. This adverse effect of HFD was ameliorated by the supplementation of ALA and garlic. The obtained results indicate a beneficial effect of ALA and garlic administration by reducing the oxidative stress intensity and the levels of some proinflammatory cytokines in rabbits fed HFD. PMID:26634212

  10. Combination of N-acetylcysteine, α-lipoic acid and α-tocopherol substantially prevents the brain synaptosomal alterations and memory and learning deficits of aged rats.


    Thakurta, Ishita Guha; Banerjee, Priyanjalee; Bagh, Maria Bindu; Ghosh, Arindam; Sahoo, Arghyadip; Chattopadhyay, Sita; Chakrabarti, Sasanka


    This study has compared several synaptosomal parameters in three groups of rats: young (46 months), aged (22-24 months) and antioxidant supplemented aged rats (antioxidant supplementation given with the diet as a combination of N-acetylcysteine, α-lipoic acid and α-tocopherol from 18 months onwards till 22-24 months). The synaptosomes from aged rat brain, in comparison to those of young animals, exhibit an increased membrane potential with altered contents of Na(+) and K(+) under basal incubation condition and in the presence of depolarizing agents. The intrasynaptosomal Ca(2+) is also higher in aged than in young rat. These age-dependent changes in synaptosomal parameters are prevented markedly in the antioxidant supplemented group. When examined on T-maze, the aged animals are noticeably impaired in learning and memory functions, but the deficit is remarkably prevented in the antioxidant supplemented aged animals. It is suggested that the synaptosomal alterations partly contribute to the cognitive deficits of aged animals, and both are rescued by long-term antioxidant supplementation.

  11. Ameliorative effects of α-lipoic acid on high-fat diet-induced oxidative stress and glucose uptake impairment of T cells.


    Cui, Jue; Huang, Dejian; Zheng, Yi


    The incidence of obesity and metabolic disease continues to rise, mainly associated with consumption of a high-fat diet (HFD). Previous studies have indicated that HFD could disturb the immune system, leading to immunodeficiency and inflammation. Several mechanisms have been postulated to account for immunodeficiency associated with HFD, one being oxidative stress. To further investigate the effects of HFD on glucose metabolism and proliferative capability of T cells and the protective effects of α-lipoic acid (LA), male C57BL/6J mice were fed a normal chow (10% fat), an HFD (60% fat), an LA supplement (HFD +0.1%LA), and a N-acetyl-L-cysteine supplement (HFD +0.1% NAC) for 10 weeks. Results showed that 10-week HFD increased intracellular reactive oxygen species (ROS) production, induced oxidative stress state formation, inhibited glucose uptake, decreased ATP concentration, reduced proliferative rate, and dampened IL-2 production of T cells of mice. Administration of LA significantly alleviated these changes induced by HFD. These findings reveal that oxidative stress of T cells caused by HFD may be a key factor leading to glucose metabolism reduction and proliferative capability and function impairment of T cells. LA, as a potent agonist, could promote Nrf2 nuclear translocation and up-regulate expression of Nrf2 target genes (Ho-1 and Prdx1), which can eliminate excess ROS and restore redox balance of cells.

  12. Revisiting the ALA/N (alpha-lipoic acid/low-dose naltrexone) protocol for people with metastatic and nonmetastatic pancreatic cancer: a report of 3 new cases.


    Berkson, Burton M; Rubin, Daniel M; Berkson, Arthur J


    The authors, in a previous article, described the long-term survival of a man with pancreatic cancer and metastases to the liver, treated with intravenous alpha-lipoic acid and oral low-dose naltrexone (ALA/N) without any adverse effects. He is alive and well 78 months after initial presentation. Three additional pancreatic cancer case studies are presented in this article. At the time of this writing, the first patient, GB, is alive and well 39 months after presenting with adenocarcinoma of the pancreas with metastases to the liver. The second patient, JK, who presented to the clinic with the same diagnosis was treated with the ALA/N protocol and after 5 months of therapy, PET scan demonstrated no evidence of disease. The third patient, RC, in addition to his pancreatic cancer with liver and retroperitoneal metastases, has a history of B-cell lymphoma and prostate adenocarcinoma. After 4 months of the ALA/N protocol his PET scan demonstrated no signs of cancer. In this article, the authors discuss the poly activity of ALA: as an agent that reduces oxidative stress, its ability to stabilize NF(k)B, its ability to stimulate pro-oxidant apoptosic activity, and its discriminative ability to discourage the proliferation of malignant cells. In addition, the ability of lowdose naltrexone to modulate an endogenous immune response is discussed. This is the second article published on the ALA/N protocol and the authors believe the protocol warrants clinical trial.

  13. Prevention and partial reversal of diabetes-induced changes in enteric nerves of the rat ileum by combined treatment with alpha-lipoic acid and evening primrose oil.


    Shotton, Hannah R; Broadbent, Steven; Lincoln, Jill


    Treatment with alpha-lipoic acid (LA) or evening primrose oil (EPO), individually, fails to prevent diabetes-induced changes in enteric nerves. Since synergy between these treatments has been reported, the aim was to investigate the effectiveness of combined LA/EPO treatment. LA and EPO were administered in the diet (approximately 80 and 200 mg/kg/day, respectively) to control and diabetic (induced by streptozotocin, 65 mg/kg, i.p.) rats. For prevention, treatment started after 1 week and lasted 7 weeks. For reversal, treatment lasted 4 weeks and was initiated after 8 weeks. Nerves supplying the ileum containing vasoactive intestinal polypeptide (VIP), calcitonin gene-related peptide (CGRP) and noradrenaline (NA) were examined immunohistochemically or biochemically. Diabetes caused a significant increase in VIP-containing cell bodies (p<0.001), decrease in NA content (p<0.01) and loss of CGRP-immunoreactivity. LA/EPO treatment totally prevented diabetes-induced changes in VIP (p<0.001) and CGRP and partially reversed (p<0.05) these changes once they had been allowed to develop. In contrast, treatment had no effect on diabetes-induced changes in NA-containing nerves. Therefore, LA and EPO are only effective at treating diabetes-induced changes in some enteric nerves when administered in combination. However, diabetes-induced changes in NA-containing nerves are resistant to treatment.

  14. Regeneration of glutathione by α-lipoic acid via Nrf2/ARE signaling pathway alleviates cadmium-induced HepG2 cell toxicity.


    Zhang, Jiayu; Zhou, Xue; Wu, Wenbo; Wang, Jiachun; Xie, Hong; Wu, Zhigang


    Alpha-lipoic acid (α-LA) is an important antioxidant that is capable of regenerating other antioxidants, such as glutathione (GSH). However, the underlying molecular mechanism by which α-LA regenerates GSH remains poorly understood. The current study aimed to investigate whether α-LA regenerates GSH by activation of Nrf2 to alleviate cadmium-induced cytotoxicity in HepG2 cells. In the present study, we found that cadmium induced cell death by depletion of GSH through inactivation of Nrf2. Addition of α-LA to cadmium-treated cells reactivated Nrf2 and regenerated GSH through elevating the Nrf2-downstream genes γ-glutamate-cysteine ligase (γ-GCL) and GR, both of which are key enzymes for GSH synthesis. However, blocking Nrf2 with brusatol in the cells co-treated with α-LA and cadmium reduced the mRNA and the protein levels of γ-GCL and GR, thus suppressed GSH regeneration by α-LA. Our results indicated that α-LA activated Nrf2 signaling pathway, which upregulated the transcription of the enzymes for GSH synthesis and therefore GSH contents to alleviate cadmium-induced cytotoxicity in HepG2 cells. Copyright © 2017. Published by Elsevier B.V.

  15. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading

    PubMed Central

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan


    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with Identifier: NCT02439879. PMID:26345602

  16. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading.


    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan


    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with Identifier: NCT02439879.

  17. Triple-combination treatment with oral α-lipoic acid, betamethasone injection, and NB-UVB for non-segmental progressive vitiligo.


    Li, Li; Li, Lu; Wu, Yan; Gao, Xing-Hua; Chen, Hong-Duo


    Vitiligo is an acquired depigmenting disease with uncertain etiopathogenesis and the treatment modalities need to be consistently updated. To evaluate a triple-combination treatment with oral α-lipoic acid (ALA), betamethasone injection, and narrowband ultraviolet B (NB-UVB) on vitiligo. Patients with non-segmental and progressive vitiligo lesions were randomly assigned to two groups. The treatment group and the control group were respectively treated with oral ALA and placebo, in combination with betamethasone injection and NB-UVB. The effectiveness and adverse events were evaluated by investigators and patients before and after treatment. Fifty non-segmental progressive vitiligo patients were enrolled in the study. The treatment period was 6 months. In treatment group, over 40% patients achieved > 50% improvement and ≥ 5 satisfaction score by 3-month therapy (M3). This percentage increased to 90% at M6. Treatment group achieved better efficacy than control group at M3, while no difference was seen at M6. The combined treatment with oral ALA, betamethasone injection, and NB-UVB was effective and safe on non-segmental progressive vitiligo. ALA could accelerate the initial response of repigmentation.

  18. Efficacy of DL-alpha-lipoic acid on methanol induced free radical changes, protein oxidative damages and hsp70 expression in folate deficient rat nervous tissue.


    Rajamani, Rathinam; Muthuvel, Arumugam; Manikandan, Sundaramahalingam; Srikumar, Ramasundaram; Sheeladevi, Rathinasamy


    DL-alpha-Lipoic acid (LPA) was reported to be effective in reducing free radicals generated by oxidative stress. The protective of effect of LPA on methanol (MeOH) induced free radical changes and oxidative damages in discrete regions of rat brain have been reported in this study. Folate deficient rat (FDD) model was used. The five animal groups (saline control, FDD control, FDD+MeOH, FDD+LPA+MeOH, LPA control) were used. The FDD+MeOH and FDD+LPA+MeOH animals were injected intraperitoneally with methanol (3gm/kg). After 24h, the level of free radical scavengers such as, superoxide dismutase, catalase, glutathione peroxidase, reduced glutathione was estimated in six discrete regions of brain, retina and optic nerve. Level of protein thiol, protein carbonyl and lipid peroxidation was also estimated. Expression of heat shock protein 70 mRNA (hsp70) was studied in the cerebellum and hippocampus by reverse transcriptase PCR. All the samples showed elevation in the level of free radical scavenging enzymes and reduced level of glutathione in the FDD+MeOH group in relation to the other groups. hsp70 expression was more in FDD+MeOH group when compared to FDD+LPA+MeOH group. In conclusion, MeOH exposure leads to increased free radical generation and protein oxidative damages in the rat nervous tissue. Treatment with LPA prevents oxidative damage induced by MeOH exposure.

  19. [Effects of sustained-release alpha-lipoic acid tablet on blood lipid, blood sugar and insulin in hyperlipidemic New Zealand rabbits].


    Chen, Xie-sheng; Liu, Hong; Ji, Ai-min; Yang, Yue-lian; Yao, Yu-fa; Sun, Liang; Che, Ou


    To evaluate the effect of sustained-release alpha-lipoic acid tablets (SRLA) on blood lipid, glucose and insulin levels in hyperlipidemic New Zealand rabbits. Twenty-four New Zealand rabbits were randomized into normal diet group, high-fat diet group, and high-fat diet + SRLA (300 mg/tablet) group with corresponding feed. At the beginning and 4 weeks after the feeding, the serum levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), blood glucose, and serum insulin were measured, and insulin sensitivity index (ISI) was calculated. Four weeks after feeding with high-fat diet, the insulin levels was elevated and the ISI lowered in the New Zealand rabbits, indicating successful establishment of the animal model of hyperlipidemia. Compared with the high-fat diet group, the serum levels of TG, TC, LDL-C and insulin were significantly reduced (P<0.05), and the ISI was significantly increased (P<0.05) in high fat diet + SRLA group. But no statistically significant difference was found in the blood glucose among the 3 groups. SRLA can significantly correct blood lipid and insulin disorders in hyperlipidemic New Zealand rabbits and prevent the occurrence of insulin resistance and hyperlipidemia.

  20. Synergic prooxidant, apoptotic and TRPV1 channel activator effects of alpha-lipoic acid and cisplatin in MCF-7 breast cancer cells.


    Nur, Gökhan; Nazıroğlu, Mustafa; Deveci, Haci Ahmet


    Resistance to cisplatin (Cisp) in the treatment of breast cancer is a major obstacle. Alpha-lipoic acid (ALA) has both antioxidant and oxidant properties. ALA has been used on stimulation mechanisms of apoptosis and oxidative stress in the treatment of cancer with a combination of chemotherapeutic agents, although its role on molecular mechanisms in the cancer cells has not been clarified yet. The aim of this study was to evaluate if a combination therapy of ALA with Cisp can alter the effect of this chemotherapy drug in the MCF-7 breast cancer cells. The MCF-7 cells were divided into four treatment groups as control, Cisp (0.025 mM), ALA (0.05 mM), and Cisp + ALA. Apoptosis, mitochondrial membrane depolarization, reactive oxygen species (ROS) production, lipid peroxidation, PARP1, caspase 3 and 9 expression levels are increased through activating TRPV1 in the cells by the Cisp and ALA treatments, although cell viability, reduced glutathione and glutathione peroxidase (GPx) values were decreased by the treatments. The Cisp and ALA-induced increase of intracellular free Ca(2+) concentration was decreased with the TRPV1 blocker, capsazepine. Apoptosis and oxidant effects of Cisp were increased by activation of TRPV1 channels, but its action on the values was further increased by the ALA treatment. Combination therapy of ALA and Cisp could be used as an effective strategy in the treatment of breast cancer.

  1. Alpha-lipoic acid supplementation reduces mTORC1 signaling in skeletal muscle from high fat fed, obese Zucker rats.


    Li, Zhuyun; Dungan, Cory M; Carrier, Bradley; Rideout, Todd C; Williamson, David L


    The mammalian target of rapamycin (mTOR) signaling pathway is hyperactive in liver, adipose and skeletal muscle tissues of obese rodents. Alpha-lipoic acid (αLA) has been well accepted as a weight-loss treatment, though there are limited studies on its effect on mTOR signaling in high-fat fed, obese rodents. Therefore, the goal of this study was to determine mTOR signaling and oxidative protein alterations in skeletal muscle of high-fat fed, obese rats after αLA supplementation. Phosphorylation of the mTOR substrate, eukaryotic initiation factor (eIF) 4E-binding protein 1 (4E-BP1) and eIF4B were significantly reduced (p < 0.05) in muscle from αLA supplemented rats. Activation of AMP-activated protein kinase (AMPK), an mTOR inhibitory kinase, was higher (p < 0.05) in the αLA group. Protein expression of markers of oxidative metabolism, acetyl CoA carboxylase (ACC), cytochrome c oxidase IV (COX IV), peroxisome proliferator-activated receptor (PPAR), and PPAR gamma coactivator 1-alpha (PGC-1α) were significantly higher (p < 0.05) after αLA supplementation compared to non-supplemented group. Our findings show that αLA supplementation limits the negative ramifications of consuming a high fat diet on skeletal muscle markers of oxidative metabolism and mTORC1 signaling.

  2. Antioxidative effects of N-acetylcysteine, lipoic acid, taurine, and curcumin in the muscle of Cyprinus carpio L. exposed to cadmium.


    Sevgiler, Yusuf; Karaytug, Sahire; Karayakar, Fahri


    We investigated the muscle tissue of a teleost Cyprinus carpio L. to find out whether N-acetylcysteine (NAC), alpha-lipoic acid (LA), taurine (TAU), and curcumin (CUR) were able to counteract oxidative stress induced by acute exposure to cadmium (Cd). The muscle tissue was dissected 96 h after a single intraperitoneal injection of Cd (5 mg kg(-1)) and of antioxidant substances (50 mg kg(-1)). Using spectrophotometry, we determined the glutathione redox status, lipid peroxidation levels and the activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), and glutathione disulphide reductase (GR). Accumulation of Cd in the muscle was analysed using inductively coupled plasma - optical emission spectrometry (ICP-OES).All substances lowered Cd levels in the following order of efficiency; LA=NAC>TAU=CUR. Cadmium increased SOD activity, but CAT activity declined, regardless of antioxidant treatment. Treatment with CUR induced GPx activity. Treatment with TAU lowered Cd due to higher total glutathione (tGSH). The most effective substances on lipid peroxidation were LA and NAC due to a greater Cd-lowering potential. It seems that the protective role of TAU, LA, and NAC is not necessarily associated with antioxidant enzymes, but rather with their own activity.

  3. Effects of Lipoic Acid on Immune Function, the Antioxidant Defense System, and Inflammation-Related Genes Expression of Broiler Chickens Fed Aflatoxin Contaminated Diets

    PubMed Central

    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng


    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens. PMID:24699046

  4. Short-term supplementation with acetyl-L-carnitine and lipoic acid alters plasma protein carbonyl levels but does not improve cognition in aged beagles

    PubMed Central

    Christie, Lori-Ann; Opii, Wycliffe O.; Head, Elizabeth; Araujo, Joseph A.; De Rivera, Christina; Milgram, Norton W.; Cotman, Carl W.


    Previous work has shown that a diet enriched with antioxidants and mitochondrial co-factors improves cognition in aged dogs, which was accompanied by a reduction oxidative damage in the brain. The objective of the present study was to assess the effects of supplementation with mitochondrial co-factors on cognition and plasma protein carbonyl levels in aged dogs. Specifically, we aimed to test whether the individual or combined action of lipoic acid (LA) and acetyl-L-carnitine (ALCAR) could account for the beneficial effects of the enriched diet that contained both plus antioxidants. Dogs were given LA or ALCAR, alone and then in combination and cognition was assessed using a spatial learning task and two discrimination and reversal paradigms. Dogs receiving the ALCAR supplement showed an increase in protein carbonyl levels that was associated with increased error scores on the spatial task, and which was reduced upon additional supplementation with LA. We did not observe significant positive effects on cognition. The present findings suggest that short-term supplementation with LA and ALCAR is insufficient to improve cognition in aged dogs, and that the beneficial effects of the full spectrum diet arose from either the cellular antioxidants alone or their interaction with LA and ALCAR. PMID:19735717

  5. Gas-saturated solution process to obtain microcomposite particles of alpha lipoic acid/hydrogenated colza oil in supercritical carbon dioxide.


    Mishima, Kenji; Honjo, Masatoshi; Sharmin, Tanjina; Ito, Shota; Kawakami, Ryo; Kato, Takafumi; Misumi, Makoto; Suetsugu, Tadashi; Orii, Hideaki; Kawano, Hiroyuki; Irie, Keiichi; Sano, Kazunori; Mishima, Kenichi; Harada, Takunori; Ouchi, Mikio


    Alpha lipoic acid (ALA), an active substance in anti-aging products and dietary supplements, need to be masked with an edible polymer to obscure its unpleasant taste. However, the high viscosity of the ALA molecules prevents them from forming microcomposites with masking materials even in supercritical carbon dioxide (scCO2). Therefore, the purpose of this study was to investigate and develop a novel production method for microcomposite particles for ALA in hydrogenated colza oil (HCO). Microcomposite particles of ALA/HCO were prepared by using a novel gas-saturated solution (PGSS) process in which the solid-dispersion method is used along with stepwise temperature control (PGSS-STC). Its high viscosity prevents the formation of microcomposites in the conventional PGSS process even under strong agitation. Here, we disperse the solid particles of ALA and HCO in scCO2 at low temperatures and change the temperature stepwise in order to mix the melted ALA and HCO in scCO2. As a result, a homogeneous dispersion of the droplets of ALA in melted HCO saturated with CO2 is obtained at high temperatures. After the rapid expansion of the saturated solution through a nozzle, microcomposite particles of ALA/HCO several micrometers in diameter are obtained.

  6. The protective role of DL-alpha-lipoic acid in the oxidative vulnerability triggered by Abeta-amyloid vaccination in mice.


    Jesudason, E Philip; Masilamoni, J Gunasingh; Jesudoss, K Samuel; Jayakumar, R


    Recent reports indicate that beta-amyloid peptide (Abeta) vaccine based therapy for Alzheimer's disease (AD) may be on the horizon. There are however, concerns about the safety of this approach. Immunization with Abeta has several disadvantages, because it crosses the blood brain barrier and cause inflammation and neurotoxicity. The present work is aimed to study the protective effective of alpha-lipoic acid (LA) in the oxidative vulnerability of beta-amyloid in plasma, liver, spleen and brain, when Abeta fibrils are given intraperitoneally in inflammation induced mice. Result shows that reactive oxygen species (ROS) in the astrocytes of inflammation induced mice along with Abeta (IA) has shown 2.5-fold increase when compared with LA treated mice. The increased level of lipid peroxidase (LPO) (p < 0.05) and decreased antioxidant status (p < 0.05) were observed in the plasma, liver, spleen and brain of LA induced mice when compared with LA treated mice. Data shows that there were no significant changes observed between the control and LA treated mice. Our biochemical and histological results highlight that significant oxidative vulnerability was observed in IA treated mice, which was prevented by LA therapy. Our findings suggest that the antioxidant effect of LA when induced with Abeta may serve as a potent therapeutic tool for inflammatory AD models.

  7. The Protective Effect of Alpha-Lipoic Acid in Lipopolysaccharide-Induced Acute Lung Injury Is Mediated by Heme Oxygenase-1

    PubMed Central

    Lin, Yu-Chieh; Lai, Yuan-Shu; Chou, Tz-Chong


    Alpha-lipoic acid (ALA), occurring naturally in human food, is known to possess antioxidative and anti-inflammatory activities. Induction of heme oxygenase-1 (HO-1) has been reported to exhibit a therapeutic effect in several inflammatory diseases. The aim of study was to test the hypothesis that the protection of ALA against lipopolysaccharide-(LPS-) induced acute lung injury (ALI) is mediated by HO-1. Pre- or posttreatment with ALA significantly inhibited LPS-induced histological alterations of ALI, lung tissue edema, and production of proinflammatory cytokine, cytokine inducible neutrophil chemoattractant-3, and nitrite/nitrate in bronchoalveolar lavage fluid. In addition, the inflammatory responses including elevation of superoxide formation, myeloperoxidase activity, polymorphonuclear neutrophils infiltration, nitrotyrosine, inducible nitric oxide synthase expression and nuclear factor-kappa B (NF-κB) activation in lung tissues of LPS-instilled rats were also markedly reduced by ALA. Interestingly, treatment with ALA significantly increased nuclear factor-erythroid 2-related factor 2 (Nrf2) activation and HO-1 expression in lungs of ALI. However, blocking HO-1 activity by tin protoporphyrin IX (SnPP), an HO-1 inhibitor, markedly abolished these beneficial effects of ALA in LPS-induced ALI. These results suggest that the protection mechanism of ALA may be through HO-1 induction and in turn suppressing NF-κB-mediated inflammatory responses. PMID:23573137

  8. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  9. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  10. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  11. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  12. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  13. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  14. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  15. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  16. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  17. Isolated menthone reductase and nucleic acid molecules encoding same


    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L


    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  18. Chemical derivatization combined with capillary LC or MALDI-TOF MS for trace determination of lipoic acid in cosmetics and integrated protein expression profiling in human keratinocytes.


    Tsai, Chia-Ju; Lin, Ying-Chi; Chen, Yen-Ling; Feng, Chia-Hsien


    Lipoic acid (LA) is an essential cofactor in mitochondrial enzymes and an ideal antioxidant in prokaryotic and eukaryotic cells. Capillary liquid chromatography coupled with ultraviolet detection (CapLC-UV) and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) are two environmentally friendly methods for determining LA. In this study, a pre-column microwave-assisted derivatization with 4-bromomethyl-6,7-dimethoxycoumarin enhanced the UV absorbance of LA and was monitored at 345 nm by CapLC-UV. Gradient separation was performed using a reversed-phase C18 column with a mobile phase consisting of acetonitrile-0.1% formic acid solution. The ionization of LA was increased, and the LA derivative was detected by MALDI-TOF MS at m/z 683 with an α-cyano-4-hydroxycinnamic acid matrix. The linear response ranged from 0.1 to 40 μM with a correlation coefficient of 0.999. The CapLC-UV and MALDI-TOF MS had detection limits of 5 and 4 fmol, respectively. These methods effectively detected LA in dietary supplements and cosmetics. Cellular proteomes of a human keratinocyte cell line (HaCaT) irradiated with UV radiation were also compared with and without LA treatment. The cellular proteomes were identified by nanoultra performance LC with LTQ Orbitrap system after trypsin digestion. Protein identification was performed by simultaneous peptide sequencing and MASCOT search. The analysis revealed changes in several proteins, including CDC42, TPI1, HNRPA2B1, PRDX1, PTGES3 and MYL6. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Alpha-Lipoic Acid Reduces LDL-Particle Number and PCSK9 Concentrations in High-Fat Fed Obese Zucker Rats

    PubMed Central

    Carrier, Bradley; Wen, Shin; Zigouras, Sophia; Browne, Richard W.; Li, Zhuyun; Patel, Mulchand S.; Williamson, David L.; Rideout, Todd C.


    We characterized the hypolipidemic effects of alpha-lipoic acid (LA, R-form) and examined the associated molecular mechanisms in a high fat fed Zucker rat model. Rats (n = 8) were assigned to a high fat (HF) diet or the HF diet with 0.25% LA (HF-LA) for 30 days and pair fed to remove confounding effects associated with the anorectic properties of LA. Compared with the HF controls, the HF-LA group was protected against diet-induced obesity (102.5±3.1 vs. 121.5±3.6,% change BW) and hypercholesterolemia with a reduction in total-C (−21%), non-HDL-C (−25%), LDL-C (−16%), and total LDL particle number (−46%) and an increase in total HDL particles (∼22%). This cholesterol-lowering response was associated with a reduction in plasma PCSK9 concentration (−70%) and an increase in hepatic LDLr receptor protein abundance (2 fold of HF). Compared with the HF-fed animals, livers of LA-supplemented animals were protected against TG accumulation (−46%), likely through multiple mechanisms including: a suppressed lipogenic response (down-regulation of hepatic acetyl-CoA carboxylase and fatty acid synthase expression); enhanced hepatic fat oxidation (increased carnitine palmitoyltransferase Iα expression); and enhanced VLDL export (increased hepatic diacylglycerol acyltransferase and microsomal triglyceride transfer protein expression and elevated plasma VLDL particle number). Study results also support an enhanced fatty acid uptake (2.8 fold increase in total lipase activity) and oxidation (increased CPT1β protein abundance) in muscle tissue in LA-supplemented animals compared with the HF group. In summary, in the absence of a change in caloric intake, LA was effective in protecting against hypercholesterolemia and hepatic fat accumulation under conditions of strong genetic and dietary predisposition toward obesity and dyslipidemia. PMID:24595397

  20. α-Lipoic acid treatment increases mitochondrial biogenesis and promotes beige adipose features in subcutaneous adipocytes from overweight/obese subjects.


    Fernández-Galilea, Marta; Pérez-Matute, Patricia; Prieto-Hontoria, Pedro L; Houssier, Marianne; Burrell, María A; Langin, Dominique; Martínez, J Alfredo; Moreno-Aliaga, María J


    α-Lipoic acid (α-Lip) is a natural occurring antioxidant with beneficial anti-obesity properties. The aim of this study was to investigate the putative effects of α-Lip on mitochondrial biogenesis and the acquirement of brown-like characteristics by subcutaneous adipocytes from overweight/obese subjects. Thus, fully differentiated human subcutaneous adipocytes were treated with α-Lip (100 and 250μM) for 24h for studies on mitochondrial content and morphology, mitochondrial DNA (mtDNA) copy number, fatty acid oxidation enzymes and brown/beige characteristic genes. The involvement of the Sirtuin1/Peroxisome proliferator-activated receptor gamma, coactivator 1 alpha (SIRT1/PGC-1α) pathway was also evaluated. Our results showed that α-Lip increased mitochondrial content in cultured human adipocytes as revealed by electron microscopy and by mitotracker green labeling. Moreover, an enhancement in mtDNA content was observed. This increase was accompanied by an up-regulation of SIRT1 protein levels, a decrease in PGC-1α acetylation and up-regulation of Nuclear respiratory factor 1 (Nrf1) and Mitochondrial transcription factor (Tfam) transcription factors. Enhanced oxygen consumption and fatty acid oxidation enzymes, Carnitine palmitoyl transferase 1 and Acyl-coenzyme A oxidase (CPT-1 and ACOX) were also observed. Mitochondria from α-Lip-treated adipocytes exhibited some morphological characteristics of brown mitochondria, and α-Lip also induced up-regulation of some brown/beige adipocytes markers such as cell death-inducing DFFA-like effector a (Cidea) and T-box 1 (Tbx1). Moreover, α-Lip up-regulated PR domain containing 16 (Prdm16) mRNA levels in treated adipocytes. Therefore, our study suggests the ability of α-Lip to promote mitochondrial biogenesis and brown-like remodeling in cultured white subcutaneous adipocytes from overweight/obese donors. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. R-alpha-lipoic acid and acetyl-L-carnitine complementarily promote mitochondrial biogenesis in murine 3T3-L1 adipocytes.


    Shen, W; Liu, K; Tian, C; Yang, L; Li, X; Ren, J; Packer, L; Cotman, C W; Liu, J


    The aim of the study was to address the importance of mitochondrial function in insulin resistance and type 2 diabetes, and also to identify effective agents for ameliorating insulin resistance in type 2 diabetes. We examined the effect of two mitochondrial nutrients, R-alpha-lipoic acid (LA) and acetyl-L-carnitine (ALC), as well as their combined effect, on mitochondrial biogenesis in 3T3-L1 adipocytes. Mitochondrial mass and oxygen consumption were determined in 3T3-L1 adipocytes cultured in the presence of LA and/or ALC for 24 h. Mitochondrial DNA and mRNA from peroxisome proliferator-activated receptor gamma and alpha (Pparg and Ppara) and carnitine palmitoyl transferase 1a (Cpt1a), as well as several transcription factors involved in mitochondrial biogenesis, were evaluated by real-time PCR or electrophoretic mobility shift (EMSA) assay. Mitochondrial complexes proteins were measured by western blot and fatty acid oxidation was measured by quantifying CO2 production from [1-14C]palmitate. Treatments with the combination of LA and ALC at concentrations of 0.1, 1 and 10 micromol/l for 24 h significantly increased mitochondrial mass, expression of mitochondrial DNA, mitochondrial complexes, oxygen consumption and fatty acid oxidation in 3T3L1 adipocytes. These changes were accompanied by an increase in expression of Pparg, Ppara and Cpt1a mRNA, as well as increased expression of peroxisome proliferator-activated receptor (PPAR) gamma coactivator 1 alpha (Ppargc1a), mitochondrial transcription factor A (Tfam) and nuclear respiratory factors 1 and 2 (Nrf1 and Nrf2). However, the treatments with LA or ALC alone at the same concentrations showed little effect on mitochondrial function and biogenesis. We conclude that the combination of LA and ALC may act as PPARG/A dual ligands to complementarily promote mitochondrial synthesis and adipocyte metabolism.

  2. Genetically encoded fluorescent coumarin amino acids


    Wang, Jiangyun [San Diego, CA; Xie, Jianming [San Diego, CA; Schultz, Peter G [La Jolla, CA


    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  3. Genetically encoded fluorescent coumarin amino acids


    Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.


    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl) ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  4. Lipoic acid inhibits the DNA repair protein O 6-methylguanine-DNA methyltransferase (MGMT) and triggers its depletion in colorectal cancer cells with concomitant autophagy induction.


    Göder, Anja; Nagel, Georg; Kraus, Alexander; Dörsam, Bastian; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg


    Alkylating agents are present in food and tobacco smoke, but are also used in cancer chemotherapy, inducing the DNA lesion O (6)-methylguanine. This critical adduct is repaired by O (6)-methylguanine-DNA methyltransferase (MGMT), resulting in MGMT inactivation and degradation. In the present study, we analyzed the effects of the natural disulfide compound lipoic acid (LA) on MGMT in vitro and in colorectal cancer cells. We show that LA, but not its reduced form dihydrolipoic acid, potently inhibits the activity of recombinant MGMT by interfering with its catalytic Cys-145 residue, which was partially reversible by N-acetyl cysteine. Incubation of HCT116 colorectal cancer cells with LA altered their glutathione pool and caused a decline in MGMT activity. This was mirrored by LA-induced depletion of MGMT protein, which was not attributable to changes in MGMT messenger RNA levels. Loss of MGMT protein coincided with LA-induced autophagy, a process resulting in lysosomal degradation of proteins, including presumably MGMT. LA-stimulated autophagy in a p53-independent manner as revealed by the response of isogenic HCT116 cell lines. Knockdown of the crucial autophagy component beclin-1 and chemical inhibitors blocked LA-induced autophagy, but did not abrogate LA-triggered MGMT degradation. Concomitant with MGMT depletion, LA pretreatment resulted in enhanced O (6)-methylguanine levels in DNA. It also increased the cytotoxicity of the alkylating anticancer drug temozolomide in temozolomide-resistant colorectal cancer cells. Taken together, our study showed that the natural compound LA inhibits MGMT and induces autophagy. Furthermore, LA enhanced the cytotoxic effects of temozolomide, which makes it a candidate for a supplement in cancer therapy.

  5. Antioxidant properties of alpha-lipoic acid: effects on red blood membrane permeability and adaptation of isolated rat heart to reversible ischemia.


    Ghibu, S; Lauzier, B; Delemasure, S; Amoureux, S; Sicard, P; Vergely, C; Muresan, A; Mogosan, C; Rochette, L


    The aim of our work was to study (1) the antioxidant properties of lipoic acid (LA) and its reduced metabolite dihydrolipoic acid (DHLA) formed by reduction of LA and (2) the effects of treatment with LA and DHLA on (a) K(+) efflux from human red blood cells and (b) post-ischemic recovery and oxidative stress in isolated perfused rat hearts challenged with an ischemia-reperfusion (IR) sequence. In vitro, we used xanthine and xanthine oxidase to generate superoxide anion, which is not directly measurable by electron paramagnetic resonance (EPR), but specifically oxidizes the spin probe CPH into an EPR-detectable long lasting CP(*) nitroxide radical. While 5 mM of LA was ineffective in reducing the kinetics of CP(*) nitroxide formation, DHLA was shown to lessen this rate in a dose-dependent manner and at 30 mM was even more efficient than 300 UI/ml SOD. These results are in agreement with the fact that DHLA is able to directly scavenge superoxide anion. Red cells are a good model to investigate oxidative damage in biological membranes; hence, we used a suspension of erythrocytes incubated with 2,2(')-azobis(2-amidinopropane) hydrochloride (AAPH) which generates in vitro free radicals. DHLA provided more effective protection of red cells membranes than LA; DHLA was comparable to Trolox for its antioxidant potency. In vivo, treatment of rats (50 mg/kg/day i.p. for 7 days) with LA induced a slight increase in coronary flow (CF) in isolated perfused hearts, after 30 min of global total ischemia. This effect was not associated with an improvement in contractile function and reduction of myocardial oxidative stress. In conclusion, because of their ability to scavenge free radicals, LA and to an even greater degree DHLA were able to protect the membranes of red blood cells. This finding suggests that LA and DHLA might be useful in the treatment of diseases associated with oxidative stress such as diabetes.

  6. Nucleic acids encoding metal uptake transporters and their uses


    Schroeder, Julian I.; Antosiewicz, Danuta M.; Schachtman, Daniel P.; Clemens, Stephan


    The invention provides LCT1 nucleic acids which encode metal ion uptake transporters. The invention also provides methods of modulating heavy metal and alkali metal uptake in plants. The methods involve producing transgenic plants comprising a recombinant expression cassette containing an LCT1 nucleic acid linked to a plant promoter.

  7. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    NASA Astrophysics Data System (ADS)

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves, H. James, II


    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or ``chemistry space.'' Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set.

  8. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    PubMed Central

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves II, H. James


    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or “chemistry space.” Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set. PMID:25802223

  9. Fluorescence upconversion microbarcodes for multiplexed biological detection: nucleic acid encoding.


    Zhang, Fan; Shi, Qihui; Zhang, Yichi; Shi, Yifeng; Ding, Kunlun; Zhao, Dongyuan; Stucky, Galen D


    Fluoride rare-earth-doped upconversion microbarcodes have been successfully developed for multiplexed signaling and nucleic-acid encoding. This kind of novel barcode material can be used for rapid and sensitive analysis of nucleic acids and antigens, which would have many potential applications in clinical, food, and environment detection.

  10. Alpha-lipoic acid and N-acetylcysteine protects intensive swimming exercise-mediated germ-cell depletion, pro-oxidant generation, and alteration of steroidogenesis in rat testis.


    Jana, Kuladip; Dutta, Ananya; Chakraborty, Pratip; Manna, Indranil; Firdaus, Syed Benazir; Bandyopadhyay, Debasish; Chattopadhyay, Ratna; Chakravarty, Baidyanath


    Prolonged and strenuous exercise has been proposed as a possible source of male-factor infertility. Forced intensive swimming has also been identified as one source of a dysfunctional male reproduction system. The present study evaluated the possible protective role of α-lipoic acid and N-acetylcysteine (NAC) on intensive swimming-induced germ-cell depletion in adult male rats. Forced exhaustive swimming of 1 hr/day, 6 days/week for 8 consecutive weeks resulted in a significant (P < 0.05) reduction in epididymal sperm; testicular androgenic enzyme activities; and plasma and intra-testicular testosterone; and produced different types of germ cells in the seminiferous epithelium cycle. Conversely, plasma corticosterone levels and sperm-head abnormalities increased. Western-blot analysis showed a considerable decrease in testicular StAR protein expression whereas reverse-transcriptase PCR analysis showed no significant change in cytochrome P450scc (Cyp11a1) gene expression. Significant (P < 0.05) elevation in testicular reactive oxygen species (ROS), lipid peroxidation, protein carbonyl content versus reduction in glucose-6-phosphate dehydrogenase, glutathione peroxidase, glutathione S-transferase, and caspase-3 activities along with a depletion in the glutathione pool, mitochondrial membrane potential (▵ψm ), and intracellular ATP generation. A considerable level of DNA damage in testicular spermatogenic cells were also noted following forced extensive swimming. Alpha-lipoic acid and NAC supplementation prevented the swimming-induced testicular spermatogenic and steroidogenic disorders by lowering ROS generation. We therefore conclude that intensive forced swimming causes germ-cell depletion through the generation of ROS and depletion of steroidogenesis in the testis, which can be protected by the co-administration of α-lipoic acid and NAC.

  11. The antioxidant effect of DL-alpha-lipoic acid on copper-induced acute hepatitis in Long-Evans Cinnamon (LEC) rats.


    Yamamoto, H; Watanabe, T; Mizuno, H; Endo, K; Fukushige, J; Hosokawa, T; Kazusaka, A; Fujita, S


    The Long-Evans Cinnamon (LEC) rats, due to a genetic defect, accumulate excess copper (Cu) in the liver in a manner similar to patients with Wilson's disease and spontaneously develop acute hepatitis with severe jaundice. In this study we examined the protective effect of DL-alpha-Lipoic acid (LA) against acute hepatitis in LEC rats. LA was administered to LEC rats by gavage in doses of 10, 30 and 100 mg/kg five times per week, starting at 8-weeks-old and continuing till 12-weeks-old. Although LA had little effect against the increases in serum transaminase activities, it suppressed the loss of body weight and prevented severe jaundice in a dose-dependent manner. Antioxidant system analyses in liver showed that LA treatment significantly suppressed the inactivations of catalase and glutathione peroxidase, and the induction of heme oxygenase-1, an enzyme which is inducible under oxidative stress. Furthermore, LA showed dose-dependent suppressive effect against increase in nonheme iron contents of both cytosolic and crude mitochondrial fractions in a dose-dependent manner. Although at the highest dose, LA slightly suppressed the accumulation of Cu in crude mitochondrial fraction, it had no effect on the accumulation of Cu in cytosolic fraction. While LA completely suppressed the increase in lipid peroxidation (LPO) in the microsomal fraction at the highest dose, the suppressive effect against LPO in crude mitochondrial fractions was slight. From these results, it is concluded that LA has antioxidant effects at the molecular level against the development of Cu-induced hepatitis in LEC rats. Moreover, mitochondrial oxidative damage might be involved in the development of acute hepatitis in LEC rats.

  12. Fabrication of an α-lipoic acid-eluting poly-(D,L-lactide-co-caprolactone) cuff for the inhibition of neointimal formation

    PubMed Central

    Lee, Hyo Jeong; Choi, Seung Hee; Nah, Mun Hee


    The purpose of this study was to develop a novel polymer cuff for the local delivery of α-lipoic acid (ALA) to inhibit neointimal formation in vivo. The polymer cuff was fabricated by incorporating the ALA into poly-(D,L-lactide-co-caprolactone) 40:60 (PLC), with or without methoxy polyethylene glycol (MethoxyPEG). The release kinetics of ALA and in vitro degradation by hydrolysis were analyzed by HPLC and field emission scanning electron microscopy (FE-SEM), respectively. In vivo evaluation of the effect of the ALA-containing polymer cuff was carried out using a rat femoral artery cuff injury model. At 24 h, 48% or 87% of the ALA was released from PCL cuffs with or without MethoxyPEG. FE-SEM results indicated that ALA was blended homogenously in the PLC with MethoxyPEG, whereas ALA was distributed on the surface of the PLC cuff without MethoxyPEG. The PLC cuff with MethoxyPEG showed prolonged and controlled release of ALA in PBS, in contrast to the PLC cuff without MethoxyPEG. Both ALA-containing polymer cuffs had a significant effect on the inhibition of neointimal formation in rat femoral artery. Novel ALA-containing polymer cuffs made of PLC were found to be biocompatible and effective in inhibiting neointimal formation in vivo. Polymer cuffs containing MethoxyPEG allowed the release of ALA for one additional week, and the rate of drug release from the PLC could be controlled by changing the composition of the polymer. These findings demonstrate that polymer cuffs may be an easy tool for the evaluation of anti-restenotic agents in animal models. PMID:19287197

  13. α-lipoic acid protects against hypoxia/reoxygenation-induced injury in human umbilical vein endothelial cells through suppression of apoptosis and autophagy

    PubMed Central



    α-lipoic acid (ALA) is known as a powerful antioxidant, which has been reported to have protective effects against various cardiovascular diseases. The present study aimed to determine whether ALA pre- or post-treatment induced protective effects against hypoxia/reoxygenation-induced injury via inhibition of apoptosis and autophagy in human umbilical vein endothelial cells (HUVECs). In order to simulate the conditions of hypoxia/reoxygenation, HUVECs were subjected to 4 h of oxygen-glucose deprivation (OGD) followed by 12 h of reoxygenation. For the pre-treatment, ALA was added to the buffer 12 h prior to OGD, whereas for the post-treatment, ALA was added at the initiation of reoxygenation. The results demonstrated that ALA pre- or post-treatment significantly reduced lactate dehydrogenase (LDH) release induced through hypoxia/reoxygenation in HUVECs in a dose-dependent manner; of note, 1 mM ALA pre- or post-treatment exhibited the most potent protective effects. In addition, ALA significantly reduced hypoxia/reoxygenation-induced loss of mitochondrial membrane potential, apoptosis and the expression of cleaved caspase-3 in HUVECs. In the presence of the specific autophagy inhibitor 3-methyladenine, hypoxia/reoxygenation-induced apoptosis was significantly reduced. Furthermore, the formation of autophagosomes, cytosolic microtubule-associated protein 1A/1B-light chain 3 ratio and beclin1 levels significantly increased following hypoxia/reoxygenation injury; however, all of these effects were ameliorated following pre- or post-treatment with ALA. The results of the present study suggested that ALA may provide beneficial protection against hypoxia/reoxygenation-induced injury via attenuation of apoptosis and autophagy in HUVECs. PMID:25684163

  14. Lipoic acid mitigates oxidative stress and recovers metabolic distortions in salt-stressed wheat seedlings by modulating ion homeostasis, the osmo-regulator level and antioxidant system.


    Gorcek, Zeynep; Erdal, Serkan


    Soil salinity is one of the most detrimental environmental factors affecting the growth of plants and limiting their agricultural productivity. This study investigated whether exogenous lipoic acid (LA) pretreatment plays a role in promoting salt tolerance in wheat seedlings. The seedlings were treated with LA (1.75 mmol L(-1)) and salt (100 mmol L(-1) NaCl) separately and a combination of them. Salt stress significantly reduced relative water content, leaf surface area, ribulose bisphosphate carboxylase expression, and chlorophyll content but increased the content of osmo-regulator protein, carbohydrates and proline. In addition, salinity led to an imbalance in the inorganic composition of wheat leaves. While it elevated Na(+) content compared to control, Ca content and K(+)/Na(+) ratio were reduced. Under saline conditions, despite increases in antioxidant enzyme activity and levels of antioxidant compounds (ascorbate and glutathione), the content of reactive oxygen species (superoxide anion, hydrogen peroxide) and malondialdehyde were higher than in control seedlings. LA significantly promoted osmo-regulator level and antioxidant enzyme activities compared to stressed seedlings alone. Also, it both increased levels of ascorbate and glutathione and regenerated their oxidised forms, thus contributing to maintaining cellular redox status. Similarly, LA prevented excessive accumulation of Na(+) and promoted K(+)/Na(+) ratio and Ca content. Reactive oxygen species content was significantly reduced, and the inhibitions in the above parameters markedly recovered. LA reduced salinity-induced oxidative damage and thus contributed to the growth and development of plants in saline soils by modulating ion homeostasis between plant and soil as well as in osmo-regulator content and antioxidant system. © 2014 Society of Chemical Industry.

  15. Vaginal alpha-lipoic acid shows an anti-inflammatory effect on the cervix, preventing its shortening after primary tocolysis. A pilot, randomized, placebo-controlled study.


    Grandi, Giovanni; Pignatti, Lucrezia; Ferrari, Francesca; Dante, Giulia; Neri, Isabella; Facchinetti, Fabio


    Inflammation might be an important underlying cause of preterm birth. Our aim is to explore whether vaginal administration α-lipoic acid reduces cervical inflammation and shortening after primary tocolysis. Singleton pregnancies between 24-30 weeks remaining undelivered after hospitalization for preterm labor were randomly allocated to placebo (20 women, 15 analyzed) or vaginal ALA 400 mg (active ingredient 10 mg) daily (20 women, 17 analyzed) for 30 days. A cervical swab to quantify pro-inflammatory (IL1, IL2, IL6, IL8, TNFα) and anti-inflammatory (IL4, IL10) cytokines as well as transvaginal ultrasound cervical length measurement (CL) were performed before and after treatment. The % changes of pro-inflammatory cytokines do not differ between treatment groups, while IL4 significantly increases by vaginal ALA in comparison to placebo (118.0 ± 364.3% versus 29.9 ± 103.5%, p = 0.012). Combined anti-inflammatory cytokines show same trend (292.5 ± 208.5% versus 64.5 ± 107.4, p = 0.03). CL remains similar in vaginal ALA group (from 23.1 ± 6.6 to 20.80 ± 7.9 mm), while it significantly decreased in placebo group (from 20.4 ± 6.5 to 13.8 ± 7.5 mm, p < 0.001 versus Baseline; p = 0.003 versus vaginal ALA). Vaginal ALA significantly stimulates anti-inflammatory ILs in the cervix of undelivered women after a preterm labor episode. This effect is associated with a stabilization of the CL.

  16. [Biochemical changes in cavernosal tissue caused by single sided cavernosal nerve resection and the effects of alpha lipoic acid on these changes].


    Alan, C; Kocoglu, H; Resit Ersay, A; Anil Kurt, H; Ertung, Y; Alan, H


    One of the most important complications of radical prostatectomy operation is erectile disfunction (ED). Oxidative stress patterns and apoptotic changes may happen in smooth muscles and endothelial cells of corpus cavernosum after neuropraxia or neurectomy. Alpha lipoic acid (ALA) shows its antioxidant properties by eliminating free radicals. In this experimental study we investigated the effects of ALA on rehabilitation of cavernosal tissue and nitric oxide synthase (NOS) containing nerve fibers on erectile tissue. In this study four groups were formed by inclusion of 63 adult fertile rats. Control group (n: 9), sham operation group (n: 18), 18 rats underwent unilateral neurectomy of a 5-mm. segment of the cavernous nerve (group DI) and another 18 rats group which ALA received after unilateral neurectomy (group DII). Assessments were done 3 weeks after neurectomy. We assessed number of NOS containing nerve fibers via nicotinamide adenine dinucleotide phosphate (NADPH) diaphorase staining. According to NADPH diaphorase staining group DII significantly recovered comparing group DI (48.89±19.00 and 17.22±6.67 respectively) (p<0.05). SOD activity is reduced in both; group DI and group DII (31.42±6.06 and 40.38±4.24). Nitrite+nitrate levels were elevated significantly in both group DI and group DII (0.52±0.05 and 0.44±0.02 micromole/gr wet tissue respectively) when compared with other groups (p<0.05). There is no statistical difference between results of group DI and Group DII (p>0.05). This study confirms that neurectomy caused decrease of intracavernous pressure and number of NOS fibers. Neurectomy and surgical trauma caused oxidative stress in rat corpus cavernosum. As a potent antioxidant ALA has positive effects on cavernosal tissue regeneration and rehabilitation by reducing oxidative stress. In this aspect, ALA may have a potential advantage in penile rehabilitation after radical prostatectomy.

  17. Various levels and forms of dietary α-lipoic acid in broiler chickens: Impact on blood biochemistry, stress response, liver enzymes, and antibody titers.


    Kim, D W; Mushtaq, M M H; Parvin, R; Kang, H K; Kim, J H; Na, J C; Hwangbo, J; Kim, J D; Yang, C B; Park, B J; Choi, H C


    The present experiment was conducted to evaluate the impact of various levels and forms of α-lipoic acid (ALA) on blood biochemistry, immune and stress response, and antibody titers in broiler chickens. The four levels (7.5, 15, 75, and 150 ppm) and 2 sources (powder, P-ALA and encapsulated, E-ALA) of ALA along with negative (C-) and positive control (C+; contains antibiotics) diets consisted of 10 dietary treatments, and these treatments were allocated to 1,200 1-d-old chicks and were replicated 12 times with 10 birds per replicate. Among the blood biochemistry parameters, creatinine levels were almost 3 times lower in E-ALA-supplemented diets compared to the C- diet (0.09 vs. 0.25 mg/dL; P<0.0001). Neither level nor source of ALA affected blood urea nitrogen (BUN), total protein (TP), albumin, globulin, or albumin to globulin ratio (AGR). The supplemented diets decreased serum levels of the liver enzymes aspartate-aminotransferase (AST; P<0.006) and alanine-aminotransferase (ALT; P<0.0003). The Newcastle disease virus (NDV) antibody response in supplemented groups was poor at day zero (P<0.0001) but increased by d 14 (P<0.03). Birds did not respond to infectious bronchitis virus (IBV) vaccination at any observed stage (P>0.05). The concentration of cortisol was reduced in chickens fed ALA-supplemented diets as compared to the C- diet (P<0.001). Results suggest that ALA-supplemented diets ameliorated blood biochemistry profiles and immune responses and reduced stress in broiler chickens. The encapsulated form of ALA was more effective than the powder form. © 2015 Poultry Science Association Inc.

  18. Electroencephalographic study of chlorpromazine alone or combined with alpha-lipoic acid in a model of schizophrenia induced by ketamine in rats.


    Sampaio, Luis Rafael Leite; Borges, Lucas Teixeira Nunes; Barbosa, Talita Matias; Matos, Natalia Castelo Branco; Lima, Ricardo de Freitas; Oliveira, Mariana Nascimento de; Gularte, Viviane Nóbrega; Patrocínio, Manoel Cláudio Azevedo; Macêdo, Danielle; Vale, Otoni Cardoso do; Vasconcelos, Silvânia Maria Mendes de


    Schizophrenia is characterized by behavioral symptoms, brain function impairments and electroencephalographic (EEG) changes. Dysregulation of immune responses and oxidative imbalance underpins this mental disorder. The present study aimed to investigate the effects of the typical antipsychotic chlorpromazine (CP) alone or combined with the natural antioxidant alpha-lipoic acid (ALA) on changes in the hippocampal average spectral power induced by ketamine (KET). Three days after stereotactic implantation of electrodes, male Wistar rats were divided into groups treated for 10 days with saline (control) or KET (10 mg/kg, IP). CP (1 or 5 mg/kg, IP) alone or combined with ALA (100 mg/kg, P.O.) was administered 30 min before KET or saline. Hippocampal EEG recordings were taken on the 1st, 5th and 10th days of treatment immediately after the last drug administration. KET significantly increased average spectral power of delta and gamma-high bands on the 5th and 10th days of treatment when compared to control. Gamma low-band significantly increased on the 1st, 5th and 10th days when compared to control group. This effect of KET was prevented by CP alone or combined with ALA. Indeed, the combination of ALA 100 + CP1 potentiated the inhibitory effects of CP1 on gamma low-band oscillations. In conclusion, our results showed that KET presents excitatory and time-dependent effects on hippocampal EEG bands activity. KET excitatory effects on EEG were prevented by CP alone and in some situations potentiated by its combination with ALA. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Inhibitory effect of α-lipoic acid on thioacetamide-induced tumor promotion through suppression of inflammatory cell responses in a two-stage hepatocarcinogenesis model in rats.


    Fujii, Yuta; Segawa, Risa; Kimura, Masayuki; Wang, Liyun; Ishii, Yuji; Yamamoto, Ryuichi; Morita, Reiko; Mitsumori, Kunitoshi; Shibutani, Makoto


    To investigate the protective effect of α-lipoic acid (a-LA) on the hepatocarcinogenic process promoted by thioacetamide (TAA), we used a two-stage liver carcinogenesis model in N-diethylnitrosamine (DEN)-initiated and TAA-promoted rats. We examined the modifying effect of co-administered a-LA on the liver tissue environment surrounding preneoplastic hepatocellular lesions, with particular focus on hepatic macrophages and the mechanism behind the decrease in apoptosis of cells surrounding preneoplastic hepatocellular lesions during the early stages of hepatocellular tumor promotion. TAA increased the number and area of glutathione S-transferase placental form (GST-P)(+) liver cell foci and the numbers of proliferating and apoptotic cells in the liver. Co-administration with a-LA suppressed these effects. TAA also increased the numbers of ED2(+), cyclooxygenase-2(+), and heme oxygenase-1(+) hepatic macrophages as well as the number of CD3(+) lymphocytes. These effects were also suppressed by a-LA. Transcript levels of some inflammation-related genes were upregulated by TAA and downregulated by a-LA in real-time RT-PCR analysis. Outside the GST-P(+) foci, a-LA reduced the numbers of apoptotic cells, active caspase-8(+) cells and death receptor (DR)-5(+) cells. These results suggest that hepatic macrophages producing proinflammatory factors may be activated in TAA-induced tumor promotion. a-LA may suppress tumor-promoting activity by suppressing the activation of these macrophages and the subsequent inflammatory responses. Furthermore, a-LA may suppress tumor-promoting activity by suppressing the DR5-mediated extrinsic pathway of apoptosis and the subsequent regeneration of liver cells outside GST-P(+) foci.

  20. Effect of In Vitro Maturation Technique and Alpha Lipoic Acid Supplementation on Oocyte Maturation Rate: Focus on Oxidative Status of Oocytes

    PubMed Central

    Zavareh, Saeed; Karimi, Isaac; Salehnia, Mojdeh; Rahnama, Ali


    Background Therapeutic potential of in vitro maturation (IVM) in infertility is growing with great promise. Although significant progress is obtained in recent years, existing IVM protocols are far from favorable results. The first aim of this study was to investigate whether two step IVM manner change reactive oxygen species (ROS) and total anti- oxidant capacity (TAC) levels. The second aim was to find the effect of alpha lipoic acid (ALA) supplementation on oocyte maturation rate and on ROS/TAC levels during IVM. Materials and Methods In this experimental study, mouse germinal vesicle (GV) oocytes divided into cumulus denuded oocytes (DOs) and cumulus oocyte complexes (COCs) groups. GVs were matured in vitro in the presence or absence of ALA only for 18 hours (control) or with pre-culture of forskolin plus cilostamide for an additional 18 hours. Matured oocytes obtained following 18 and 36 hours based on experimental design. In parallel, the ROS and TAC levels were measured at different time (0, 18 and 36 hours) by 2',7'-dichlorodihydrofluorescein (DCFH) probe and ferric reducing/antioxidant power (FRAP) assay, respectively. Results Maturation rate of COCs was significantly higher than DOs in control group (P<0.05), while there was no significant difference between COCs and DOs when were pre-cultured with forskolin plus cilostamide. ROS and TAC levels was increased and decreased respectively in DOs after 18 hours while in COCs did not change at 18 hours and showed a significant increase and decrease respectively at 36 hours (P<0.05). ROS and TAC levels in the presence of ALA were significantly decreased and increased respectively after 36 hours (P<0.05) whereas, maturation rates of COCs and DOs were similar to their corresponding control groups. Conclusion ALA decreased ROS and increased TAC but could not affect maturation rate of both COCs and DOs in one or two step IVM manner. PMID:26985332

  1. Brain antioxidant effect of mirtazapine and reversal of sedation by its combination with alpha-lipoic acid in a model of depression induced by corticosterone.


    Oliveira, Tatiana de Queiroz; Sousa, Caren Nádia Soares de; Vasconcelos, Germana Silva; de Sousa, Luciene Costa; de Oliveira, Anneheydi Araújo; Patrocínio, Cláudio Felipe Vasconcelos; Medeiros, Ingridy da Silva; Honório Júnior, José Eduardo Ribeiro; Maes, Michael; Macedo, Danielle; Vasconcelos, Silvânia Maria Mendes


    Depression is accompanied by activated neuro-oxidative and neuro-nitrosative pathways, while targeting these pathways has clinical efficacy in depression. This study aimed to investigate the effects of mirtazapine (MIRT) alone and combined with alpha-lipoic acid (ALA) against corticosterone (CORT) induced behavioral and oxidative alterations. Male mice received vehicle or CORT 20mg/kg during 14 days. From the 15th to 21st days they were divided in groups administered: vehicle, MIRT 3mg/kg or the combinations MIRT+ALA100 or MIRT+ALA200. On the 21st day of treatment, the animals were subjected to behavioral tests. Twenty-four hours after the last drug administration hippocampus (HC) and striatum (ST) were dissected for the determination reduced glutathione (GSH), lipid peroxidation (LP) and nitrite levels. CORT induced anxiety- and depressive-like behaviors as observed by increased immobility time in the tail suspension test and decreased sucrose consumption. MIRT or MIRT+ALA are effective in reversing anxiety- and depressive-like behaviors induced by CORT. CORT and MIRT alone prolonged sleeping time and this effect was reversed by MIRT+ALA. CORT significantly increased LP, which was reversed by MIRT or MIRT+ALA. Nitrite levels were increased in CORT-treated animals and reversed by MIRT+ALA200 (HC), MIRT or MIRT+ALA (ST). A relative small sample size and lack of a washout period between drug administration and behavioral testing. MIRT or MIRT+ALA reverse CORT-induced anxiety- and depressive-like behaviors probably via their central antioxidant effects. Augmentation of MIRT with ALA may reverse sedation, an important side effect of MIRT. Randomized controlled studies are needed to examine the clinical efficacy of this combination in human depression. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Acquisition and reconditioning of ethanol-induced conditioned place preference in mice is blocked by the H₂O₂ scavenger alpha lipoic acid.


    Ledesma, Juan Carlos; Aragon, Carlos M G


    Hydrogen peroxide (H2O2) is the co-substrate used by catalase to metabolize ethanol to acetaldehyde in the brain. This centrally formed acetaldehyde has been involved in several ethanol-related behaviors. The present research evaluated the effect of the H2O2 scavenger, alpha lipoic acid (LA), on the acquisition and reconditioning of ethanol-induced conditioned place preference (CPP). Mice received pairings of a distinctive floor stimulus (CS+) associated with intraperitoneal injections of ethanol (2.5 g/kg). On alternate days, animals received pairings of a different floor stimulus (CS-) associated with saline injections. A different group of animals received pairings with the (CS-) associated with saline injections, and on alternate days they received LA (100 mg/kg) injected 30 min prior to ethanol (2.5 g/kg) administration paired with the (CS+). A preference test assessed the effect of LA on the acquisition of ethanol-induced CPP. A similar procedure was followed to study the effect of LA on the acquisition of cocaine- and morphine-induced CPP. A separate experiment evaluated the effect of LA on the reconditioning of ethanol-induced CPP. In addition, we investigated the consequence of LA administration on central H2O2 levels. LA selectively blocked the acquisition of ethanol-induced CPP. Moreover, this compound impaired the reconditioning of ethanol-induced CPP. Additionally, we found that LA diminished H2O2 levels in the brain. These data suggest that a decline in H2O2 availability by LA might impede the formation of brain ethanol-derived acetaldehyde by catalase, which results in an impairment of the rewarding properties of ethanol.

  3. The impact of α-Lipoic acid on cell viability and expression of nephrin and ZNF580 in normal human podocytes.


    Leppert, Ulrike; Gillespie, Allan; Orphal, Miriam; Böhme, Karen; Plum, Claudia; Nagorsen, Kaj; Berkholz, Janine; Kreutz, Reinhold; Eisenreich, Andreas


    Human podocytes (hPC) are essential for maintaining normal kidney function and dysfunction or loss of hPC play a pivotal role in the manifestation and progression of chronic kidney diseases including diabetic nephropathy. Previously, α-Lipoic acid (α-LA), a licensed drug for treatment of diabetic neuropathy, was shown to exhibit protective effects on diabetic nephropathy in vivo. However, the effect of α-LA on hPC under non-diabetic conditions is unknown. Therefore, we analyzed the impact of α-LA on cell viability and expression of nephrin and zinc finger protein 580 (ZNF580) in normal hPC in vitro. Protein analyses were done via Western blot techniques. Cell viability was determined using a functional assay. hPC viability was dynamically modulated via α-LA stimulation in a concentration-dependent manner. This was associated with reduced nephrin and ZNF580 expression and increased nephrin phosphorylation in normal hPC. Moreover, α-LA reduced nephrin and ZNF580 protein expression via 'kappa-light-chain-enhancer' of activated B-cells (NF-κB) inhibition. These data demonstrate that low α-LA had no negative influence on hPC viability, whereas, high α-LA concentrations induced cytotoxic effects on normal hPC and reduced nephrin and ZNF580 expression via NF-κB inhibition. These data provide first novel information about potential cytotoxic effects of α-LA on hPC under non-diabetic conditions. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Enhancement of lipid stability of broiler breast meat and meat products fed on alpha lipoic acid and alpha tocopherol acetate supplemented feed.


    Sohaib, Muhammad; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Arshad, Muhammad Sajid; Shahid, Muhammad


    This study was designed to investigate the effect of alpha lipoic acid (ALA) and alpha tocopherol acetate (ATA) on the antioxidant potential, lipid stability and the quality of the broiler breast meat and meat products. The treatment plan was as (T1=control feed, T2=200 mg ATA + 25 mg ALA/kg feed, T3=200 mg ATA + 75 mg ALA/kg feed, T4=200 mg ATA +150 mg ALA/kg feed, T5=Oxidized oil (4%), T6=200 mg ATA + 150 mg ALA + Oxidized oil (4%)/kg feed). After two weeks of acclimatization the birds were fed with ALA and ATA enriched diet. The results revealed that maximum deposition of ALA took place in T4 which contain maximum dose of ALA. The TBARS and DPPH values of the broiler breast meat were in T4 (0.14 ± 0.01 MDA/kg of meat, 76.69 ± 0.14%) and in T5 were (0.24 ± 0.15 MDA/Kg of meat, 44.98 ± 0.04%) accordingly. ATA concentration were also highest in T4 (206.43 ± 0.22 mg/g of meat) and lowest in T5 (79.09 ± 0.06 mg/g of meat). Sensory evaluation results showed that nuggets and patties made of T5 containing oxidized oil were least liked and T4 got highest score. In a nutshell, 150 mg/kg feed dietary supplementation of ALA with constant level of ATA can ameliorate the antioxidant potential, lipid stability and nutritional qualities of broiler breast meat and meat products.

  5. α-Lipoic Acid Treatment Improves Vision-Related Quality of Life in Patients with Dry Age-Related Macular Degeneration.


    Tao, Yuan; Jiang, Pengfei; Wei, Yuhua; Wang, Ping; Sun, Xiaoling; Wang, Hong


    Dry form of age-related macular degeneration (AMD) constitutes 90% of AMD cases, and it is characterized by the formation of drusen under the retina and the slow breakdown of the light-sensing cells in the macula, which causes a gradual loss of central vision. Since oxidative stress is involved in the pathogenesis of dry AMD, α-lipoic acid (LA) with antioxidant properties was selected, and its effect on anti-oxidative markers and visual quality in patients with dry AMD was assessed. A total of 100 dry AMD patients (60-83 years old) were randomly assigned to LA treatment group (n = 50) and placebo control group (n = 50). We measured the serum superoxide dismutase (SOD) activity, an important marker of antioxidant defense, best-corrected visual acuity (BCVA), contrast sensitivity, and Chinese-Version Low Vision Quality of Life (CLVQOL) before and after LA or placebo intervention. Pearson correlation coefficients were calculated to explore the relationship between contrast sensitivity values and CLVQOL scores. There was a statistically significant increase in serum SOD activity after LA intervention. The CLVQOL score was improved significantly after LA treatment. The contrast sensitivity measured at middle and low spatial frequency was significantly higher after LA treatment. CLVQOL scores were positively correlated with contrast sensitivity at low spatial frequency (3 cyc/degree) in LA-treated group. These results indicate that LA treatment improves vision-related quality of life in patients with dry AMD probably by increasing antioxidant activity. Thus, LA can be regarded as a promising agent for the treatment of AMD.

  6. Acetyl-L-carnitine and lipoic acid improve mitochondrial abnormalities and serum levels of liver enzymes in a mouse model of nonalcoholic fatty liver disease.


    Kathirvel, Elango; Morgan, Kengathevy; French, Samuel W; Morgan, Timothy R


    Mitochondrial abnormalities are suggested to be associated with the development of nonalcoholic fatty liver. Liver mitochondrial content and function have been shown to improve in oral feeding of acetyl-L-carnitine (ALC) to rodents. Carnitine is involved in the transport of acyl-coenzyme A across the mitochondrial membrane to be used in mitochondrial β-oxidation. We hypothesized that oral administration ALC with the antioxidant lipoic acid (ALC + LA) would benefit nonalcoholic fatty liver. To test our hypothesis, we fed Balb/C mice a standard diet (SF) or SF with ALC + LA or high-fat diet (HF) or HF with ALC + LA for 6 months. Acetyl-L-carnitine and LA were dissolved at 0.2:0.1% (wt/vol) in drinking water, and mice were allowed free access to food and water. Along with physical parameters, insulin resistance (blood glucose, insulin, glucose tolerance), liver function (alanine transaminase [ALT], aspartate transaminase [AST]), liver histology (hematoxylin and eosin), oxidative stress (malondialdehyde), and mitochondrial abnormalities (carbamoyl phosphate synthase 1 and electron microscopy) were done. Compared with SF, HF had higher body, liver, liver-to-body weight ratio, white adipose tissue, ALT, AST, liver fat, oxidative stress, and insulin resistance. Coadministration of ALC + LA to HF animals significantly improved the mitochondrial marker carbamoyl phosphate synthase 1 and the size of the mitochondria in liver. Alanine transaminase and AST levels were decreased. In a nonalcoholic fatty liver mice model, ALC + LA combination improved liver mitochondrial content, size, serum ALT, and AST without significant changes in oxidative stress, insulin resistance, and liver fat accumulation.

  7. Dietary fructose accelerates the development of diabetes in UCD-T2DM rats: amelioration by the antioxidant, α-lipoic acid

    PubMed Central

    Cummings, Bethany P.; Stanhope, Kimber L.; Graham, James L.; Evans, Joseph L.; Baskin, Denis G.; Griffen, Steven C.


    Sustained fructose consumption has been shown to induce insulin resistance and glucose intolerance, in part, by promoting oxidative stress. Alpha-lipoic acid (LA) is an antioxidant with insulin-sensitizing activity. The effect of sustained fructose consumption (20% of energy) on the development of T2DM and the effects of daily LA supplementation in fructose-fed University of California, Davis-Type 2 diabetes mellitus (UCD-T2DM) rats, a model of polygenic obese T2DM, was investigated. At 2 mo of age, animals were divided into three groups: control, fructose, and fructose + LA (80 mg LA·kg body wt−1·day−1). One subset was followed until diabetes onset, while another subset was euthanized at 4 mo of age for tissue collection. Monthly fasted blood samples were collected, and an intravenous glucose tolerance test (IVGTT) was performed. Fructose feeding accelerated diabetes onset by 2.6 ± 0.5 mo compared with control (P < 0.01), without affecting body weight. LA supplementation delayed diabetes onset in fructose-fed animals by 1.0 ± 0.7 mo (P < 0.05). Fructose consumption lowered the GSH/GSSG ratio, while LA attenuated the fructose-induced decrease of oxidative capacity. Insulin sensitivity, as assessed by IVGTT, decreased in both fructose-fed and fructose + LA-supplemented rats. However, glucose excursions in fructose-fed LA-supplemented animals were normalized to those of control via increased glucose-stimulated insulin secretion. Fasting plasma triglycerides were twofold higher in fructose-fed compared with control animals at 4 mo, and triglyceride exposure during IVGTT was increased in both the fructose and fructose + LA groups compared with control. In conclusion, dietary fructose accelerates the onset of T2DM in UCD-T2DM rats, and LA ameliorates the effects of fructose by improving glucose homeostasis, possibly by preserving β-cell function. PMID:20147607

  8. Staphylococcus aureus SufT: an essential iron-sulphur cluster assembly factor in cells experiencing a high-demand for lipoic acid.


    Mashruwala, Ameya A; Roberts, Christina A; Bhatt, Shiven; May, Kerrie L; Carroll, Ronan K; Shaw, Lindsey N; Boyd, Jeffrey M


    Staphylococcus aureus SufT is composed solely of the domain of unknown function 59 (DUF59) and has a role in the maturation of iron-sulphur (Fe-S) proteins. We report that SufT is essential for S. aureus when growth is heavily reliant upon lipoamide-utilizing enzymes, but dispensable when this reliance is decreased. LipA requires Fe-S clusters for lipoic acid (LA) synthesis and a ΔsufT strain had phenotypes suggestive of decreased LA production and decreased activities of lipoamide-requiring enzymes. Fermentative growth, a null clpC allele, or decreased flux through the TCA cycle diminished the demand for LA and rendered SufT non-essential. Abundance of the Fe-S cluster carrier Nfu was increased in a ΔclpC strain and a null clpC allele was unable to suppress the LA requirement of a ΔsufT Δnfu strain. Over-expression of nfu suppressed the LA requirement of the ΔsufT strain. We propose a model wherein SufT, and by extension the DUF59, is essential for the maturation of holo-LipA in S. aureus cells experiencing a high demand for lipoamide-dependent enzymes. The findings presented suggest that the demand for products of Fe-S enzymes is a factor governing the usage of one Fe-S cluster assembly factor over another in the maturation of apo-proteins. © 2016 John Wiley & Sons Ltd.

  9. α-Lipoic acid attenuates vascular calcification via reversal of mitochondrial function and restoration of Gas6/Axl/Akt survival pathway

    PubMed Central

    Kim, Hyunsoo; Kim, Han-Jong; Lee, Kyunghee; Kim, Jin-Man; Kim, Hee Sun; Kim, Jae-Ryong; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Kim, Joon-Young; Harris, Robert A; Jeong, Daewon; Lee, In-Kyu


    Abstract Vascular calcification is prevalent in patients with chronic kidney disease and leads to increased cardiovascular morbidity and mortality. Although several reports have implicated mitochondrial dysfunction in cardiovascular disease and chronic kidney disease, little is known about the potential role of mitochondrial dysfunction in the process of vascular calcification. This study investigated the effect of α-lipoic acid (ALA), a naturally occurring antioxidant that improves mitochondrial function, on vascular calcification in vitro and in vivo. Calcifying vascular smooth muscle cells (VSMCs) treated with inorganic phosphate (Pi) exhibited mitochondrial dysfunction, as demonstrated by decreased mitochondrial membrane potential and ATP production, the disruption of mitochondrial structural integrity and concurrently increased production of reactive oxygen species. These Pi-induced functional and structural mitochondrial defects were accompanied by mitochondria-dependent apoptotic events, including release of cytochrome c from the mitochondria into the cytosol, subsequent activation of caspase-9 and -3, and chromosomal DNA fragmentation. Intriguingly, ALA blocked the Pi-induced VSMC apoptosis and calcification by recovery of mitochondrial function and intracellular redox status. Moreover, ALA inhibited Pi-induced down-regulation of cell survival signals through the binding of growth arrest-specific gene 6 (Gas6) to its cognate receptor Axl and subsequent Akt activation, resulting in increased survival and decreased apoptosis. Finally, ALA significantly ameliorated vitamin D3-induced aortic calcification and mitochondrial damage in mice. Collectively, the findings suggest ALA attenuates vascular calcification by inhibiting VSMC apoptosis through two distinct mechanisms; preservation of mitochondrial function via its antioxidant potential and restoration of the Gas6/Axl/Akt survival pathway. PMID:21362131

  10. The effect of dietary α-lipoic acid, betaine, l-carnitine, and swimming on the obesity of mice induced by a high-fat diet.


    Jang, Aera; Kim, Dongwook; Sung, Ki-Seung; Jung, Samooel; Kim, Hyun Joo; Jo, Cheorun


    We evaluate the effect of supplementation, at 300 mg kg(-1) body weight (BW), with the antioxidants α-lipoic acid (AL), betaine (BT), l-carnitine (LC), and the combination of these and exercise on obesity induced by a 9 week high-fat diet (HFD) in mice. Healthy 5 week-old male C57BL/6J mice were divided into 9 groups: (1) CON, control group fed with a commercial mice chow containing 10% crude fat; (2) HFD, high fat diet group fed with a commercial mice chow containing 60% crude fat; (3) HFD-AL, HFD group fed with AL; (4) HFD-BT, HFD group fed with BT; (5) HFD-LC, HFD group fed with LC; (6) HFD-SW, HFD with swimming as an exercise; (7) HFD-SWAL, HFD-AL with swimming; (8) HFD-SWBT, HFD-BT with swimming, and (9) HFD-SWLC, HFD-LC with swimming. The BW of mice with LC and swimming reduced the increase of BW after 9 weeks. Relative adipose tissue weights were reduced by the combinations of antioxidant supplementation and swimming. Levels of serum glucose and leptin were reduced in the HFD-SWLC group when compared with the HFD group. Serum triglyceride and total cholesterol and the size of adipose were also decreased in the HFD-LC and HFD-SWLC groups. These results show that LC at a dose of 300 mg kg(-1) BW was the most effective for reducing fat accumulation in mice with HFD for 9 weeks. In addition, exercise should be given in combination to enhance the BW reduction and serum lipid level.

  11. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same


    Croteau, Rodney Bruce; Burke, Charles Cullen


    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  12. Nucleic acids encoding antifungal polypeptides and uses thereof


    Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser


    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  13. Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof


    Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser


    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  14. Human jagged polypeptide, encoding nucleic acids and methods of use


    Li, Linheng; Hood, Leroy


    The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

  15. Effects of a medium chain triglyceride oil mixture and alpha-lipoic acid diet on body composition, antioxidant status, and plasma lipid levels in the Golden Syrian hamster.


    Wollin, Stephanie D; Wang, Yanwen; Kubow, Stan; Jones, Peter J H


    The objective of this study was to examine the effects of the antioxidant alpha-lipoic acid (ALP) versus a medium chain triglyceride oil mixture (MCTo), which was designed to increase energy expenditure and to improve lipid profiles containing medium chain triglycerides, phytosterols, and omega-3 fatty acids in the form of flaxseed oil. A total of 48 hamsters were fed a) hypercholesterolemic (HC) control, b) HC MCTo, c) HC ALP, or d) HC MCTo/ALP diet for 4 weeks. No differences were observed on food intake, body weight, total body water, lean and fat mass, and tissue thiobarbituric acid reactive substances (TBARS). ALP alone had no effect on total cholesterol (TC); however, MCTo feeding increased TC with (P < 0.03) and without (P < 0.003) ALP when compared with control. ALP increased HDL levels compared with control (P < 0.04) and MCTo/ALP (P < 0.007) groups. MCTo, with (P < 0.0001) or without (P < 0.006) ALP, increased non-HDL cholesterol levels versus control. The non-HDL:HDL cholesterol ratio was decreased by ALP compared with MCTo (45%) and MCTo/ALP (68%) (P < 0.0001), a similar trend was seen when compared with the HC control (22%) group (P < 0.14). Triglyceride levels were not altered by any dietary treatment. Liver and heart tissue reduced glutathione (GSH) was increased (P < 0.05) by all three treatments when compared with control. Both tissues showed an increase (P < 0.05) in oxidized glutathione (GSSG) when fed ALP as compared with other treatments. Hamsters fed ALP had a lower (P < 0.05) GSH/GSSG ratio compared with other treatment groups. In conclusion, MCTo feeding does not elicit beneficial effects on circulating plasma lipids and measures of body composition. In addition, our results do not clearly support an improvement in oxidative status through supplementation of ALP. However, our results do support the existence of beneficial effects of ALP on circulating lipoprotein content in the hamster.

  16. Safety and efficacy of an add-on therapy with curcumin phytosome and piperine and/or lipoic acid in subjects with a diagnosis of peripheral neuropathy treated with dexibuprofen

    PubMed Central

    Di Pierro, Francesco; Settembre, Roberto


    We conducted an 8-week, open, randomized controlled clinical trial on 141 subjects affected by neuropathic pain to investigate the role of an adjunctive therapy added to the administration of dexibuprofen (400 mg twice a day) and based on a multi-ingredient formula (Lipicur), consisting of lipoic acid plus curcumin phytosome and piperine, in patients with a diagnosis of lumbar sciatica, lumbar disk herniation, and/or lumbar canal stenosis (96 subjects), or with carpal tunnel syndrome (45 subjects). A total of 135 participants completed the study. Treatment with the multi-ingredient formula (Lipicur) reduced neuropathic pain by more than 66% in both conditions (subjects with lumbar sciatica and with carpal tunnel syndrome), and these reductions were statistically significant. Moreover, the treatment reduced dexibuprofen use by about 40%. An add-on therapy with only lipoic acid has not shown any significant results. On the basis of its safety and efficacy, Lipicur could be considered an effective complementary therapy to be added to conventional treatments to achieve better efficacy in reducing neuropathic pain. PMID:23861596

  17. Antioxidant alpha-lipoic acid inhibits osteoclast differentiation by reducing nuclear factor-kappaB DNA binding and prevents in vivo bone resorption induced by receptor activator of nuclear factor-kappaB ligand and tumor necrosis factor-alpha.


    Kim, Hyon Jong; Chang, Eun-Ju; Kim, Hyun-Man; Lee, Seung Bok; Kim, Hyun-Duck; Su Kim, Ghi; Kim, Hong-Hee


    The relationship between oxidative stress and bone mineral density or osteoporosis has recently been reported. As bone loss occurring in osteoporosis and inflammatory diseases is primarily due to increases in osteoclast number, reactive oxygen species (ROS) may be relevant to osteoclast differentiation, which requires receptor activator of nuclear factor-kappaB ligand (RANKL). Tumor necrosis factor-alpha (TNF-alpha) frequently present in inflammatory conditions has a profound synergy with RANKL in osteoclastogenesis. In this study, we investigated the effects of alpha-lipoic acid (alpha-LA), a strong antioxidant clinically used for some time, on osteoclast differentiation and bone resorption. At concentrations showing no growth inhibition, alpha-LA potently suppressed osteoclastogenesis from bone marrow-derived precursor cells driven either by a high-dose RANKL alone or by a low-dose RANKL plus TNF-alpha (RANKL/TNF-alpha). alpha-LA abolished ROS elevation by RANKL or RANKL/TNF-alpha and inhibited NF-kappaB activation in osteoclast precursor cells. Specifically, alpha-LA reduced DNA binding of NF-kappaB but did not inhibit IKK activation. Furthermore, alpha-LA greatly suppressed in vivo bone loss induced by RANKL or TNF-alpha in a calvarial remodeling model. Therefore, our data provide evidence that ROS plays an important role in osteoclast differentiation through NF-kappaB regulation and the antioxidant alpha-lipoic acid has a therapeutic potential for bone erosive diseases.

  18. Safety and efficacy of an add-on therapy with curcumin phytosome and piperine and/or lipoic acid in subjects with a diagnosis of peripheral neuropathy treated with dexibuprofen.


    Di Pierro, Francesco; Settembre, Roberto


    We conducted an 8-week, open, randomized controlled clinical trial on 141 subjects affected by neuropathic pain to investigate the role of an adjunctive therapy added to the administration of dexibuprofen (400 mg twice a day) and based on a multi-ingredient formula (Lipicur), consisting of lipoic acid plus curcumin phytosome and piperine, in patients with a diagnosis of lumbar sciatica, lumbar disk herniation, and/or lumbar canal stenosis (96 subjects), or with carpal tunnel syndrome (45 subjects). A total of 135 participants completed the study. Treatment with the multi-ingredient formula (Lipicur) reduced neuropathic pain by more than 66% in both conditions (subjects with lumbar sciatica and with carpal tunnel syndrome), and these reductions were statistically significant. Moreover, the treatment reduced dexibuprofen use by about 40%. An add-on therapy with only lipoic acid has not shown any significant results. On the basis of its safety and efficacy, Lipicur could be considered an effective complementary therapy to be added to conventional treatments to achieve better efficacy in reducing neuropathic pain.

  19. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same


    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  20. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same


    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  1. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  2. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  3. Effects of dietary α-lipoic acid, acetyl-l-carnitine, and sex on antioxidative ability, energy, and lipid metabolism in broilers.


    Jia, R; Bao, Y H; Zhang, Y; Ji, C; Zhao, L H; Zhang, J Y; Gao, C Q; Ma, Q G


    An experiment was conducted to evaluate the effects of dietary α-lipoic acid (LA), acetyl-l-carnitine (ALC), and sex on antioxidative ability, energy, and lipid metabolism in broilers. A total of 972 one-day-old broilers with equal sex were randomly assigned in a 3 × 3 × 2 factorial design using 3 LA, 3 ALC levels, and 2 sexes (6 replications, 9 birds/replication). The LA and ALC levels were 0, 50, and 100 mg/kg, respectively. Results showed that increased LA or ALC resulted in increased total antioxidant capacity and superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities and decreased levels of malondialdehyde in serum and liver of birds (P < 0.05). In addition, with increasing addition of LA or ALC, an increased (P < 0.01) level of insulin (Ins), as well as decreased (P < 0.05) levels of glucose and glucagon (Glu), were observed in serum of broilers. Total cholesterol and triglyceride (TG) levels decreased (P < 0.05) and nonesterified fatty acid, lipoprotein lipase, and lipase levels increased (P < 0.05) in serum with increased administration of LA or ALC. Moreover, a significant (P < 0.05) interaction of LA × ALC was observed for serum and liver SOD, serum GSH-Px, glucose, and TG levels. Birds fed diets containing 50 mg/kg of LA and 50 mg/kg of ALC had higher serum and liver SOD activities and lower serum glucose and TG levels than those fed diets containing 100 mg/kg of LA or ALC alone. The main effect of sex and all interactions among main effects (except LA × ALC) were not significant (P > 0.05) for all of the above parameters. Overall, the present data indicate that LA or ALC supplementation, or both, at low levels (50 or 100 mg/kg) improved antioxidative ability, energy metabolism, and lipid metabolism in broilers, and synergistic effects by the combined supplementation of LA and ALC were indicated by serum and liver SOD activities and serum glucose and TG levels.

  4. Enhancement of lipid stability of broiler breast meat and meat products fed on alpha lipoic acid and alpha tocopherol acetate supplemented feed

    PubMed Central


    This study was designed to investigate the effect of alpha lipoic acid (ALA) and alpha tocopherol acetate (ATA) on the antioxidant potential, lipid stability and the quality of the broiler breast meat and meat products. The treatment plan was as (T1 = control feed, T2 = 200 mg ATA + 25 mg ALA/kg feed, T3 = 200 mg ATA + 75 mg ALA/kg feed, T4 = 200 mg ATA + 150 mg ALA/kg feed, T5 = Oxidized oil (4%), T6 = 200 mg ATA + 150 mg ALA + Oxidized oil (4%)/kg feed). After two weeks of acclimatization the birds were fed with ALA and ATA enriched diet. The results revealed that maximum deposition of ALA took place in T4 which contain maximum dose of ALA. The TBARS and DPPH values of the broiler breast meat were in T4 (0.14 ± 0.01 MDA/kg of meat, 76.69 ± 0.14%) and in T5 were (0.24 ± 0.15 MDA/Kg of meat, 44.98 ± 0.04%) accordingly. ATA concentration were also highest in T4 (206.43 ± 0.22 mg/g of meat) and lowest in T5 (79.09 ± 0.06 mg/g of meat). Sensory evaluation results showed that nuggets and patties made of T5 containing oxidized oil were least liked and T4 got highest score. In a nutshell, 150 mg/kg feed dietary supplementation of ALA with constant level of ATA can ameliorate the antioxidant potential, lipid stability and nutritional qualities of broiler breast meat and meat products. PMID:22640892

  5. Cardioprotective effects of lipoic acid, quercetin and resveratrol on oxidative stress related to thyroid hormone alterations in long-term obesity.


    Cheserek, Maureen Jepkorir; Wu, Guirong; Li, Longnan; Li, Lirong; Karangwa, Eric; Shi, Yonghui; Le, Guowei


    This study investigated possible mechanisms for cardioprotective effects of lipoic acid (LA), quercetin (Q) and resveratrol (R) on oxidative stress related to thyroid hormone alterations in long-term obesity. Female C57BL/6 mice were fed on high-fat diet (HFD), HFD+LA, HFD+R, HFD+Q and normal diet for 26weeks. Body weight, blood pressure, thyroid hormones, oxidative stress markers, angiotensin converting enzyme (ACE), nitric oxide synthase (NOS) and ion pump activities were measured, and expression of cardiac genes was analyzed by real-time polymerase chain reaction. HFD induced marked increase (P<.05) in body weight, blood pressure and oxidative stress, while plasma triidothyronine levels reduced. ACE activity increased (P<.05) in HFD mice (0.69±0.225U/mg protein) compared with controls (0.28±0.114U/mg protein), HFD+LA (0.231±0.02U/mg protein) and HFD+Q (0.182±0.096U/mg protein) at 26weeks. Moreover, Na(+)/K(+)-ATPase and Ca(2+)-ATPase activities increased in HFD mice whereas NOS reduced. A 1.5-fold increase in TRα1 and reduction in expression of the deiodinase iodothyronine DIO1, threonine protein kinase and NOS3 as well as up-regulation of AT1α, ACE, ATP1B1, GSK3β and Cja1 genes also occurred in HFD mice. Conversely, LA, Q and R inhibited weight gain; reduced TRα1 expression as well as increased DIO1; reduced ACE activity and AT1α, ATP1B1 and Cja1 gene expression as well as inhibited GSK3β; increased total antioxidant capacity, GSH and catalase activity; and reduced blood pressure. In conclusion, LA, resveratrol and quercetin supplementation reduces obesity thereby restoring plasma thyroid hormone levels and attenuating oxidative stress in the heart and thus may have therapeutic potential in heart diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Differential effects of coenzyme Q10 and α-lipoic acid on two models of in vitro oxidative damage to the rabbit urinary bladder.


    Li, Hsin T; Schuler, Catherine; Leggett, Robert E; Levin, Robert M


    Partial bladder outlet obstruction (PBOO) in rabbits causes free radical production through ischemia and reperfusion within the bladder smooth muscle and mucosa. We had previously shown that pretreatment of rabbits with a combination of α-lipoic acid (αLA) and coenzyme Q10 (CoQ) protected the bladder from contractile and metabolic dysfunctions mediated by PBOO. In this study, we examined the ability of pretreatment with αLA and CoQ combination in rabbits to protect the bladder from contractile damage mediated by either hydrogen peroxide (H(2)O(2)) or in vitro ischemia-reperfusion (I/R) which represents two in vitro models of oxidative damage. Eight adult male New Zealand white rabbits were pretreated with CoQ and αLA orally for four weeks. Eight adult male control rabbits were given vehicle. Eight full-thickness bladder strips were isolated from each of 4 treated and 4 control rabbit bladders, and a dose-response curve to H(2)O(2) (0.1-0.8%) was generated. Similarly, isolated strips of bladder from the remaining 4 control and 4 treated rabbits were subjected to 1 h of ischemia (no oxygen without glucose) followed by 2 h of incubation in oxygenated buffer with glucose. The effects on the contractile responses to field stimulation (FS) at 2, 8, and 32 Hz, carbachol, and potassium chloride (KCl) were determined. H(2)O(2) reduced the contractile responses to KCl and carbachol to a significantly greater degree than to FS, whereas I/R reduced the contractile responses to FS to a significantly greater degree than to KCl and carbachol. Pretreatment of the rabbits with the combination of CoQ and αLA significantly protected the bladder from the damaging effects of I/R, but had virtually no effect on the damaging effects of H(2)O(2). Although both H(2)O(2) and I/R are in vitro models of oxidative free radical damage to bladder smooth muscle, they have significantly different methods of action and different sensitivities to antioxidants.

  7. Effects of Dietary Alpha-lipoic Acid and Acetyl-L-carnitine on Growth Performance and Meat Quality in Arbor Acres Broilers.


    Zhang, Yong; Jia, Ru; Ji, Cheng; Ma, Qiugang; Huang, Jin; Yin, Haicheng; Liu, Laiting


    An experiment was conducted to evaluate the effects of dietary alpha-lipoic acid (LA) and acetyl-L-carnitine (ALC) on growth performance, carcass characteristics and meat quality in Arbor Acres broilers. A total of 486 1-d-old male Arbor Acres broilers were randomly allocated to 9 dietary treatments, 9 treatments were group A (0 mg/kg LA and 0 mg/kg ALC), group B (50 mg/kg LA and 0 mg/kg ALC), group C (100 mg/kg LA and 0 mg/kg ALC), group D (0 mg/kg LA and 50 mg/kg ALC), group E (50 mg/kg LA and 50 mg/kg ALC), group F (100 mg/kg LA and 50 mg/kg ALC), group G (0 mg/kg LA and 100 mg/kg ALC), group H (50 mg/kg LA and 100 mg/kg ALC), group I (100 mg/kg LA and 100 mg/kg ALC). Birds were slaughtered at 42 days old. Average daily gain (ADG), average feed intake (AFI), feed conversion rate (FCR), eviscerated rate, breast muscle percentage, thigh muscle percentage, abdominal fat percentage, liver weight, muscle color (L* value, a* value, b* value), pH values at 45 min and 24 h postmortem were measured. Results showed that there existed an interaction between LA and ALC in growth performance of broilers, carcass traits and meat quality. The overall result is that high level of LA and ALC led to lower AFI, ADG (p<0.01), lower abdominal fat percentage, liver weight (p<0.01), lower L* value, a* value, and b* value of breast muscle, L* value of thigh muscle (p<0.05), and higher FCR (p<0.01), eviscerated rate (p<0.01), breast muscle percentage, thigh muscle percentage (p<0.05), a* value, pH 45 min and pH 24 h of thigh muscle (p<0.01). These results suggested that dietary LA and ALC contributed to the improvement of meat quality in broilers.

  8. Cell-targeted, dual reduction- and pH-responsive saccharide/lipoic acid-modified poly(L-lysine) and poly(acrylic acid) polyionic complex nanogels for drug delivery.


    How, Su-Chun; Chen, Yu-Fon; Hsieh, Pin-Lun; Wang, Steven S-S; Jan, Jeng-Shiung


    A cell-targeted, reduction-/pH-responsive polyionic complex (PIC) nanogel system was developed by simply mixing cationic lactobionolatone/lipoic acid-modified poly(L-lysine) (PLL-g-(Lipo-Lac)) and anionic poly(acrylic acid) (PAA), followed by disulfide cross-linking. The nanogels with sizes smaller than 150nm can be prepared at certain mixing ratio via forming interchain disulfide cross-link and helical PAA/PLL complexes. In vitro drug release study showed that Doxorubicin (Dox) release from the nanogels was significantly enhanced by increasing acidity and/or introducing disulfide cleaving agent. Carbohydrate-lectin binding and cellular uptake studies confirmed that Lac-conjugated nanogels can effectively bind to the cells bearing asialoglycoprotein receptors and subsequently afford efficient cell internalization. Cytotoxicity assays showed that Dox-loaded, Lac-conjugated nanogels exhibited efficient cell proliferation inhibition toward HepG2 cells, whereas the nanogels exhibited excellent biocompatibility. Furthermore, TUNEL assay was employed to detect apoptosis pertaining to the mechanism of cell death. This study highlights that polyionic complexation with subsequent cross-linking can be a simple approach to prepare multifunctional nanogels as drug delivery vehicles. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Augmentation of cholinesterases and ATPase activities in the cerebellum and pons-medulla oblongata, by a combination of antioxidants (resveratrol, ascorbic acid, alpha-lipoic acid and vitamin E), in acutely lindane intoxicated mice.


    Bist, Renu; Bhatt, Devendra Kumar


    In the present investigation neurotoxic effects of lindane and the protective potential of a combination of antioxidants against lindane-induced toxicity were evaluated in Swiss mice. The investigation was carried out on acetylcholinesterase (AChE), butyrylcholinesterase (BChE) and adenosine triphosphatase (ATPase) activities of the cerebellum and pons-medulla oblongata. Healthy mice, 7-8 weeks old were administered acute dose of lindane (40 mg/kg b.w.), antioxidants, both lindane and antioxidants, and vehicle in four separate groups, subcutaneously. Resveratrol (Res), ascorbic acid (C), alpha-lipoic acid (ALA) and vitamin E (E) were used in the combination for neuroprotection at the concentration of 5 mg/kg b.w., 50 mg/kg b.w., 20 mg/kg b.w. and 50 mg/kg b.w. respectively. Enzymatic activities were used as biochemical marker for manifestation of lindane-induced acute toxicity. Protective effects of antioxidants were also evaluated using the same parameters. Treatment of lindane to normal control animals resulted in a significant decrease in AChE, BChE and ATPase levels in crude homogenates of cerebellum and pons-medulla. Antioxidants treatment significantly increased the levels of enzymes. Critical difference (CD) of AChE, BChE and ATPase levels in various groups was found significant at 1% in cerebellum and pons-medulla both (i.e. P<0.01).

  10. An anti-oxidant, α-lipoic acid conjugated oleoyl-sn-phosphatidylcholineas a helper lipid in cationic liposomal formulations.


    Dharmalingam, Priya; Marrapu, Balakrishna; Voshavar, Chandrashekhar; Nadella, Rasagna; Rangasami, Vignesh Kumar; Shaji, R V; Abbas, Salar; Prasad, R B N; Kaki, Shiva Shanker; Marepally, Srujan


    Development of safe non-viral carrier systems for efficient intra-cellular delivery of drugs and genes hold promise in the area of translational research. Liposome based delivery systems have emerged as one of the attractive strategies for efficient delivery of drugs and nucleic acids. To this end, number of investigations was carried on liposomal formulations using lipids for achieving higher efficiency in transfection with lower cytotoxicities. In our efforts to develop safer and efficient liposomal delivery systems, we synthesized a novel anti-oxidant lipid, α-lipoyl, oleyl-sn-phosphatidylcholine (LOPC) and used as a helper lipid in combination with a cationic amphiphile, Di-Stearyl Dihydroxy Ethyl Ammonium Chloride (DSDEAC) and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) at varying concentrations of LOPC. DNA binding properties of the liposomal formulations (DS, DS LA1, DS LA2 and DS LA3) revealed that increasing the percentage of single aliphatic chain lipid LOPC, did not affect the DNA binding properties. But, transfection profiles of these liposomal formulations in 3 different cell lines (HeLa, HEK 293 and MCF7) showed difference in their efficacies. Results showed that optimal percentage of LOPC i.e. 25% in DSDEAC and DOPC at 1:1 molar ratio (DS LA1) enhanced transfection as compared to DSDEAC:DOPC alone. The endosomal escape studies with NBD labelled lysotracker and Rhodamine labelled liposomal formulations revealed that DS LA1 and DS LA2 facilitated the release of genetic cargo with a better efficiency than their counter parts. Reactive Oxygen Species (ROS), a key modulator of necroptosis were lowered with the treatment of DS LA1 than other liposomal formulations. Here in, we present a novel liposomal formulation using DSDEAC and DOPC at 1:1 molar ratio doped with 25-50% (mole ratio) LOPC as an efficient delivery system for enhanced transfection with quenching of ROS levels compared to formulations without LOPC.

  11. Mitochondrial fatty acid synthesis and respiration.


    Hiltunen, J Kalervo; Autio, Kaija J; Schonauer, Melissa S; Kursu, V A Samuli; Dieckmann, Carol L; Kastaniotis, Alexander J


    Recent studies have revealed that mitochondria are able to synthesize fatty acids in a malonyl-CoA/acyl carrier protein (ACP)-dependent manner. This pathway resembles bacterial fatty acid synthesis (FAS) type II, which uses discrete, nuclearly encoded proteins. Experimental evidence, obtained mainly through using yeast as a model system, indicates that this pathway is essential for mitochondrial respiratory function. Curiously, the deficiency in mitochondrial FAS cannot be complemented by inclusion of fatty acids in the culture medium or by products of the cytosolic FAS complex. Defects in mitochondrial FAS in yeast result in the inability to grow on nonfermentable carbon sources, the loss of mitochondrial cytochromes a/a3 and b, mitochondrial RNA processing defects, and loss of cellular lipoic acid. Eukaryotic FAS II generates octanoyl-ACP, a substrate for mitochondrial lipoic acid synthase. Endogenous lipoic acid synthesis challenges the hypothesis that lipoic acid can be provided as an exogenously supplied vitamin. Purified eukaryotic FAS II enzymes are catalytically active in vitro using substrates with an acyl chain length of up to 16 carbon atoms. However, with the exception of 3-hydroxymyristoyl-ACP, a component of respiratory complex I in higher eukaryotes, the fate of long-chain fatty acids synthesized by the mitochondrial FAS pathway remains an enigma. The linkage of FAS II genes to published animal models for human disease supports the hypothesis that mitochondrial FAS dysfunction leads to the development of disorders in mammals.

  12. Optimization of encoded hydrogel particles for nucleic acid quantification.


    Pregibon, Daniel C; Doyle, Patrick S


    The accurate quantification of nucleic acids is of utmost importance for clinical diagnostics, drug discovery, and basic science research. These applications require the concurrent measurement of multiple targets while demanding high-throughput analysis, high sensitivity, specificity between closely related targets, and a wide dynamic range. In attempt to create a technology that can simultaneously meet these demands, we recently developed a method of multiplexed analysis using encoded hydrogel particles. Here, we demonstrate tuning of hydrogel porosity with semi-interpenetrating networks of poly(ethylene glycol), develop a quantitative model to understand hybridization kinetics, and use the findings from these studies to enhance particle design for nucleic acid detection. With an optimized particle design and efficient fluorescent labeling scheme, we demonstrate subattomole sensitivity and single-nucleotide specificity for small RNA targets.

  13. Investigation of the role of α-lipoic acid on fatty acids profile, some minerals (zinc, copper, iron) and antioxidant activity against aluminum-induced oxidative stress in the liver of male rats.


    Sahin, Zafer; Ozkaya, Ahmet; Yilmaz, Okkes; Yuce, Abdurrauf; Gunes, Mehmet


    We have investigated the effects of α-lipoic acid (LA), a powerful antioxidant, on the fatty acid (FA) profiles, aluminum accumulation, antioxidant activity and some minerals such as zinc, copper and iron against aluminum chloride (AlCl3)-induced oxidative stress in rat liver. Twenty-eight male Wistar rats were divided into four groups as control, LA, AlCl3 and LA+AlCl3. For 30 days, LA was intraperitoneally administrated (50 mg/kg) and AlCl3 was given via orogastric gavage (1600 ppm) every other day. AlCl3-treated animals exhibited higher hepatic malondialdehyde concentration and lower glutathione peroxidase and catalase activity, whereas these alterations were restored by the LA supplementation. Total saturated FA of the AlCl3-treated group was higher than the LA supplementation groups. Moreover, total unsaturated FA level of the LA+AlCl3 group was higher than the AlCl3-treated group. Hepatic zinc level of the AlCl3-treated group was lower than the control group, whereas it was higher in the LA and the LA+AlCl3 groups. Hepatic copper levels did not significantly change in the experimental groups. Iron level was lower in the LA and LA+AlCl3 groups compared with the AlCl3-treated group. Moreover, the liver Al concentration was found to be lower in the LA and LA+AlCl3 groups compared to the AlCl3 group. These results indicate that AlCl3 treatment can induce oxidative stress in the liver. LA supplementation has a beneficial effect on the AlCl3-induced alterations such as high lipid peroxidation, Al accumulation, FA profile ratios and mineral concentrations.

  14. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by DL-α-Lipoic Acid.


    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester C S; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba


    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3-1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1-3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants DL-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3-MST

  15. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by dl-α-Lipoic Acid

    PubMed Central

    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester CS; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba


    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3–1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1–3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants dl-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3

  16. Determination of newly synthesized lipoic acid-niacin dimer in rat plasma by UPLC/electrospray ionization tandem mass spectrometry: assay development, validation and application to a pharmacokinetic study.


    Chen, Xiao; Gao, Jingwen; Jiang, Yiming; Huang, Ping; Xie, Yuhui; Pi, Rongbiao; Zhu, Shuzhen; Yao, Meicun


    A simple, sensitive and specific ultra-performance liquid chromatography/tandem mass spectrometry (UPLC-MS/MS) method was developed to determine the newly synthesized compound lipoic acid-niacin dimer (N2L) in plasma. Plasma samples were precipitated by methanol using tetrahydropalmatine as internal standard. Chromatographic separation was achieved on an Acquity BEH C18 (2.1 × 50 mm i.d., 1.7 µm) column; the mobile phase contains methanol and buffer solution (water with 0.5% formic acid and 10 mmol/L ammonium acetate). Multiple reaction monitoring (m/z 353.9 → 148.6 for N2L and m/z 356.0 → 192.0 for internal standard) was performed for detection and quantification. The method was validated to be rapid, specific, accurate and precise over the concentration range of 1-750 ng/mL; N2L was not stable on the bench-top or during freeze-freeze-thaw cycles in plasma, but was stable in the stock solution and after preparation in the autosampler for 24 h. The utility of the assay was confirmed by pharmacokinetic study of N2L in rats. Copyright © 2013 John Wiley & Sons, Ltd.

  17. α-Lipoic acid protects 3T3-L1 adipocytes from NYGGF4 (PID1) overexpression-induced insulin resistance through increasing phosphorylation of IRS-1 and Akt.


    Wang, Yu-mei; Lin, Xiao-fei; Shi, Chun-mei; Lu, Lan; Qin, Zhen-Ying; Zhu, Guan-zhong; Cao, Xin-guo; Ji, Chen-bo; Qiu, Jie; Guo, Xi-rong


    NYGGF4 (also called PID1) was demonstrated that it may be related to the development of obesity-related IR. We aimed in the present study to further elucidate the effects of NYGGF4 on IR and the underlying mechanisms through using α-Lipoic acid (LA) treatment, which could facilitate glucose transport and utilization in fully differentiated adipocytes. Our data showed that the LA pretreatment strikingly enhanced insulin-stimulated glucose uptake through increasing GLUT4 translocation to the PM in NYGGF4 overexpression adipocytes. The reactive oxygen species (ROS) levels in NYGGF4 overexpression adipocytes were strikingly enhanced, which could be decreased by the LA pretreatment. NYGGF4 overexpression resulted in significant inhibition of tyrosine phosphorylation of IRS-1 and serine phosphorylation of Akt, whereas incubation with LA strongly activated IRS-1 and Akt phosphorylation in NYGGF4 overexpression adipocytes. These results suggest that LA protects 3T3-L1 adipocytes from NYGGF4-induced IR partially through increasing phosphorylation of IRS-1 and Akt and provide evidence that NYGGF4 may be a potential target for the treatment of obesity and obesity-related IR.

  18. Amelioration of Behavioural, Biochemical, and Neurophysiological Deficits by Combination of Monosodium Glutamate with Resveratrol/Alpha-Lipoic Acid/Coenzyme Q10 in Rat Model of Cisplatin-Induced Peripheral Neuropathy

    PubMed Central

    Sanji, Tejaswi; Madakasira Guggilla, Hariprasad; Razdan, Rema


    Cisplatin or cis-diamminedichloroplatinum (II) (CDDP) is a cytotoxic chemotherapeutic agent with dose-dependent peripheral neuropathy as a foremost side effect characterised by ataxia, pain, and sensory impairment. Cumulative drug therapy of CDDP is known to produce severe oxidative damage. It mainly targets and accumulates in dorsal root ganglia that in turn cause damage resulting in secondary nerve fibre axonopathy. In the present study, we investigated the neuroprotective effect of the combination of monosodium glutamate (MSG) with three individual antioxidants, that is, resveratrol, alpha-lipoic acid (ALA), and coenzyme Q10 (CoQ10), in cisplatin (2 mg/kg i.p. twice weekly) induced peripheral neuropathy in rats. After 8 weeks of treatment the degree of neuroprotection was determined by measuring behavioral and electrophysiological properties and sciatic nerve lipid peroxidation, as well as glutathione and catalase levels. The results suggested that pretreatment with the combination of MSG (500 mg/kg/day po) with resveratrol (10 mg/kg/day i.p.) or ALA (20 mg/kg/day i.p.) or CoQ10 (10 mg/kg weekly thrice i.p.) exhibited neuroprotective effect. The maximum neuroprotection of MSG was observed in the combination with resveratrol. PMID:24489506

  19. The long-term survival of a patient with pancreatic cancer with metastases to the liver after treatment with the intravenous alpha-lipoic acid/low-dose naltrexone protocol.


    Berkson, Burton M; Rubin, Daniel M; Berkson, Arthur J


    The authors describe the long-term survival of a patient with pancreatic cancer without any toxic adverse effects. The treatment regimen includes the intravenous alpha-lipoic acid and low-dose naltrexone (ALA-N) protocol and a healthy lifestyle program. The patient was told by a reputable university oncology center in October 2002 that there was little hope for his survival. Today, January 2006, however, he is back at work, free from symptoms, and without appreciable progression of his malignancy. The integrative protocol described in this article may have the possibility of extending the life of a patient who would be customarily considered to be terminal. The authors believe that life scientists will one day develop a cure for metastatic pancreatic cancer, perhaps via gene therapy or another biological platform. But until such protocols come to market, the ALA-N protocol should be studied and considered, given its lack of toxicity at levels reported. Several other patients are on this treatment protocol and appear to be doing well at this time.

  20. The Combination of N-Acetyl Cysteine, Alpha-Lipoic Acid, and Bromelain Shows High Anti-Inflammatory Properties in Novel In Vivo and In Vitro Models of Endometriosis

    PubMed Central

    Agostinis, C.; Zorzet, S.; De Leo, R.; Zauli, G.; De Seta, F.; Bulla, R.


    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory “marker” VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis. PMID:25960622

  1. The combination of N-acetyl cysteine, alpha-lipoic acid, and bromelain shows high anti-inflammatory properties in novel in vivo and in vitro models of endometriosis.


    Agostinis, C; Zorzet, S; De Leo, R; Zauli, G; De Seta, F; Bulla, R


    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory "marker" VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis.

  2. Amelioration of behavioural, biochemical, and neurophysiological deficits by combination of monosodium glutamate with resveratrol/alpha-lipoic acid/coenzyme Q10 in rat model of cisplatin-induced peripheral neuropathy.


    Bhadri, Naini; Sanji, Tejaswi; Madakasira Guggilla, Hariprasad; Razdan, Rema


    Cisplatin or cis-diamminedichloroplatinum (II) (CDDP) is a cytotoxic chemotherapeutic agent with dose-dependent peripheral neuropathy as a foremost side effect characterised by ataxia, pain, and sensory impairment. Cumulative drug therapy of CDDP is known to produce severe oxidative damage. It mainly targets and accumulates in dorsal root ganglia that in turn cause damage resulting in secondary nerve fibre axonopathy. In the present study, we investigated the neuroprotective effect of the combination of monosodium glutamate (MSG) with three individual antioxidants, that is, resveratrol, alpha-lipoic acid (ALA), and coenzyme Q10 (CoQ10), in cisplatin (2 mg/kg i.p. twice weekly) induced peripheral neuropathy in rats. After 8 weeks of treatment the degree of neuroprotection was determined by measuring behavioral and electrophysiological properties and sciatic nerve lipid peroxidation, as well as glutathione and catalase levels. The results suggested that pretreatment with the combination of MSG (500 mg/kg/day po) with resveratrol (10 mg/kg/day i.p.) or ALA (20 mg/kg/day i.p.) or CoQ10 (10 mg/kg weekly thrice i.p.) exhibited neuroprotective effect. The maximum neuroprotection of MSG was observed in the combination with resveratrol.

  3. Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods


    Thompson, David N.; Thompson, Vicki S.; Schaller, Kastli D.; Apel, William A.; Lacey, Jeffrey A.; Reed, David W.


    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  4. Thermal and acid tolerant beta xylosidases, arabinofuranosidases, genes encoding, related organisms, and methods

    SciTech Connect

    Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A


    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  5. The effects of treatment with alpha-lipoic acid or evening primrose oil on vascular hemostatic and lipid risk factors, blood flow, and peripheral nerve conduction in the streptozotocin-diabetic rat.


    Ford, I; Cotter, M A; Cameron, N E; Greaves, M


    Oxidative stress and defective fatty acid metabolism in diabetes may lead to impaired nerve perfusion and contribute to the development of peripheral neuropathy. We studied the effects of 2-week treatments with evening primrose oil (EPO; n = 16) or the antioxidant alpha-lipoic acid (ALA; n = 16) on endoneurial blood flow, nerve conduction parameters, lipids, coagulation, and endothelial factors, in rats with streptozotocin-induced diabetes. Compared with their nondiabetic littermates, untreated diabetic rats had impaired sciatic motor and saphenous sensory nerve-conduction velocity (NCV; P <.001), reduced endoneurial blood flow (P <.001), and increased serum triglycerides (P <.01), cholesterol (P < 0.01), plasma factor VII (P <.0001), and von Willebrand factor (vWF; P <.0001). Plasma fibrinogen and serum high-density lipoprotein concentrations were not significantly different. Treatment with either ALA or EPO effectively corrected the deficits in NCV and endoneurial blood flow. ALA was associated with marked and statistically significant decreases in fibrinogen, factor VII, vWF, and triglycerides (P <.01, paired t tests before v after treatment). In contrast, EPO was associated with significant (P <.05) increases in fibrinogen, factor VII, vWF, triglycerides, and cholesterol and a significant decrease in high-density lipoprotein. Changes in levels of coagulation factors and lipids, qualitatively similar to those found with EPO, were obtained with a diet containing sunflower oil (to control for calorific and lipid content) or with a normal diet alone. Blood glucose and hematocrit levels were not significantly altered by treatments. These data suggest that although both ALA and EPO improve blood flow and nerve function, their actions on vascular factors differ. The marked effects of ALA in lowering lipid and hemostatic risk factors for cardiovascular disease indicate potential antithrombotic and antiatherosclerotic actions that could be of benefit in human diabetes

  6. Age-associated mitochondrial oxidative decay: Improvement of carnitine acetyltransferase substrate-binding affinity and activity in brain by feeding old rats acetyl-l- carnitine and/or R-α-lipoic acid

    PubMed Central

    Liu, Jiankang; Killilea, David W.; Ames, Bruce N.


    We test whether the dysfunction with age of carnitine acetyltransferase (CAT), a key mitochondrial enzyme for fuel utilization, is due to decreased binding affinity for substrate and whether this substrate, fed to old rats, restores CAT activity. The kinetics of CAT were analyzed by using the brains of young and old rats and of old rats supplemented for 7 weeks with the CAT substrate acetyl-l-carnitine (ALCAR) and/or the mitochondrial antioxidant precursor R-α-lipoic acid (LA). Old rats, compared with young rats, showed a decrease in CAT activity and in CAT-binding affinity for both substrates, ALCAR and CoA. Feeding ALCAR or ALCAR plus LA to old rats significantly restored CAT-binding affinity for ALCAR and CoA, and CAT activity. To explore the underlying mechanism, lipid peroxidation and total iron and copper levels were assayed; all increased in old rats. Feeding old rats LA or LA plus ALCAR inhibited lipid peroxidation but did not decrease iron and copper levels. Ex vivo oxidation of young-rat brain with Fe(II) caused loss of CAT activity and binding affinity. In vitro oxidation of purified CAT with Fe(II) inactivated the enzyme but did not alter binding affinity. However, in vitro treatment of CAT with the lipid peroxidation products malondialdehyde or 4-hydroxy-nonenal caused a decrease in CAT-binding affinity and activity, thus mimicking age-related change. Preincubation of CAT with ALCAR or CoA prevented malondialdehyde-induced dysfunction. Thus, feeding old rats high levels of key mitochondrial metabolites can ameliorate oxidative damage, enzyme activity, substrate-binding affinity, and mitochondrial dysfunction. PMID:11854488

  7. Effects of Lipoic Acid Supplementation on Activities of Cyclooxygenases and Levels of Prostaglandins E2 and F2α Metabolites, in the Offspring of Rats with Streptozotocin-Induced Diabetes

    PubMed Central

    Oriquat, Ghaleb A.; Abu-Samak, Mahmoud; Al Hanbali, Othman A.; Salim, Maher D.


    Background. Our aim was to evaluate the protective effect of lipoic acid (LA) on fetal outcome of diabetic mothers. Methods. Diabetes was induced in female rats using streptozotocin and rats were made pregnant. Pregnant control (group 1; n = 9; and group 2; n = 7) or pregnant diabetic (group 3; n = 10; and group 4; n = 8) rats were treated daily with either LA (groups 2 and 4) or vehicle (groups 1 and 3) between gestational days 0 and 15. On day 15 of gestation, the fetuses, placentas, and membranes were dissected, examined morphologically, and then homogenized, to measure cyclooxygenase (COX) activities and metabolisms of prostaglandin (PG) E2 (PGEM) and PGF2α (PGFM) levels. The level of total glutathione was measured in the maternal liver and plasma and in all fetuses. Results. Supplementation of diabetic rats with LA was found to significantly (p < 0.05) reduce resorption rates in diabetic rats and led to a significant (p < 0.05) increase in liver, plasma, and fetuses total glutathione from LA-TD rats as compared to those from V-TD. Decreased levels of PGEM and elevated levels of PGFM in the fetuses, placentas, and membranes were characteristic of experimental diabetic gestation associated with malformation. The levels of PGEM in malformed fetuses from LA-TD mothers was significantly (p < 0.05) higher than those in malformed fetuses from V-TD rats. Conclusions. LA treatment did not completely prevent the occurrence of malformations. Thus, other factors may be involved in the pathogenesis of the diabetes-induced congenital malformations. PMID:28042582

  8. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation.


    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed


    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue.

  9. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation

    PubMed Central

    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed


    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue. PMID:25891652

  10. Anti-inflammatory effects of the selective phosphodiesterase 3 inhibitor, cilostazol, and antioxidants, enzymatically-modified isoquercitrin and α-lipoic acid, reduce dextran sulphate sodium-induced colorectal mucosal injury in mice.


    Kangawa, Yumi; Yoshida, Toshinori; Abe, Hajime; Seto, Yoshiki; Miyashita, Taishi; Nakamura, Michi; Kihara, Tohru; Hayashi, Shim-Mo; Shibutani, Makoto


    Developing effective treatments and preventing inflammatory bowel disease (IBD) are urgent challenges in improving patients' health. It has been suggested that platelet activation and reactive oxidative species generation are involved in the pathogenesis of IBD. We examined the inhibitory effects of a selective phosphodiesterase-3 inhibitor, cilostazol (CZ), and two antioxidants, enzymatically modified isoquercitrin (EMIQ) and α-lipoic acid (ALA), against dextran sulphate sodium (DSS)-induced colitis. BALB/c mice were treated with 0.3% CZ, 1.5% EMIQ, and 0.2% ALA in their feed. Colitis was induced by administering 5% DSS in drinking water for 8days. The inhibitory effects of these substances were evaluated by measuring relevant clinical symptoms (faecal blood, diarrhoea, and body weight loss), colon length, plasma cytokine and chemokine levels, whole genome gene expression, and histopathology. Diarrhoea was suppressed by each treatment, while CZ prevented shortening of the colon length. All treatment groups exhibited decreased plasma levels of interleukin (IL)-6 and tumour necrosis factor (TNF)-α compared with the DSS group. Microarray analysis showed that cell adhesion, cytoskeleton regulation, cell proliferation, and apoptosis, which might be related to inflammatory cell infiltration and mucosal healing, were affected in all the groups. DSS-induced mucosal injuries such as mucosal loss, submucosal oedema, and inflammatory cell infiltration in the distal colon were prevented by CZ or antioxidant treatment. These results suggest that anti-inflammatory effects of these agents reduced DSS-induced mucosal injuries in mice and, therefore, may provide therapeutic benefits in IBD.

  11. BGL3 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  12. BGL4 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  13. BGL7 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  14. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  15. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  16. BGL6 .beta.-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  17. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  18. BGL3 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  19. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  20. BGL3 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  1. BGL7 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  2. BGL3 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  3. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  4. BGL4 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  5. BGL5 .beta.-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  6. Nucleic acids encoding mosaic clade M human immunodeficiency virus type 1 (HIV-1) envelope immunogens


    Korber, Bette T; Fischer, William; Liao, Hua-Xin; Haynes, Barton F; Letvin, Norman; Hahn, Beatrice H


    The present invention relates to nucleic acids encoding mosaic clade M HIV-1 Env polypeptides and to compositions and vectors comprising same. The nucleic acids of the invention are suitable for use in inducing an immune response to HIV-1 in a human.

  7. Binary-copolymer system base on low-density lipoprotein-coupled N-succinyl chitosan lipoic acid micelles for co-delivery MDR1 siRNA and paclitaxel, enhances antitumor effects via reducing drug.


    Yang, Shu-Di; Zhu, Wen-Jing; Zhu, Qiao-Ling; Chen, Wei-Liang; Ren, Zhao-Xiang; Li, Fang; Yuan, Zhi-Qiang; Li, Ji-Zhao; Liu, Yang; Zhou, Xiao-Feng; Liu, Chun; Zhang, Xue-Nong


    The development of effective and stable carriers of small interfering RNA (siRNA) is important for treating cancer with multidrug resistance (MDR). We developed a new gene and drug co-delivery system and checked its characteristics. Low-density lipoprotein (LDL) was coupled with N-succinyl chitosan (NSC) Lipoic acid (LA) micelles and co-delivered MDR1 siRNA and paclitaxel (PTX-siRNA/LDL-NSC-LA) to enhance antitumor effects by silencing the MDR gene of tumors (Li et al., Adv Mater 2014;26:8217-8224). In our study, we developed a new type of containing paclitaxel-loaded micelles and siRNA-loaded LDL nanoparticle. This "binary polymer" is pH and reduction dual-sensitive core-crosslinked micelles. PTX-siRNA/LDL-NSC-LA had an average particle size of (171.6 ± 6.42) nm, entrapment efficiency of (93.92 ± 1.06) %, and drug-loading amount of (12.35% ± 0.87) %. In vitro, MCF-7 cells, high expressed LDL receptor, were more sensitive to this delivery system than to taxol(®) and cell activity was inhibited significantly. Fluorescence microscopy showed that PTX-siRNA/LDL-NSC-LA was uptaken very conveniently and played a key role in antitumor activity. PTX-siRNA/LDL-NSC-LA protected the siRNA from degradation by macrophage phagocytosis and evidently down-regulated the level of mdr1 mRNA as well as the expression of P-gp. We tested the target ability of PTX-siRNA/LDL-NSC-LA in vivo in tumor-bearing nude mice. Results showed that this system could directly deliver siRNA and PTX to cancer cells. Thus, new co-delivering siRNA and antitumor drugs should be explored for solving MDR in cancer. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1114-1125, 2017. © 2016 Wiley Periodicals, Inc.

  8. Minimal genome encoding proteins with constrained amino acid repertoire

    PubMed Central

    Tsoy, Olga; Yurieva, Marina; Kucharavy, Andrey; O'Reilly, Mary; Mushegian, Arcady


    Minimal bacterial gene set comprises the genetic elements needed for survival of engineered bacterium on a rich medium. This set is estimated to include 300–350 protein-coding genes. One way of simplifying an organism with such a minimal genome even further is to constrain the amino acid content of its proteins. In this study, comparative genomics approaches and the results of gene knockout experiments were used to extrapolate the minimal gene set of mollicutes, and bioinformatics combined with the knowledge-based analysis of the structure-function relationships in these proteins and their orthologs, paralogs and analogs was applied to examine the challenges of completely replacing the rarest residue, cysteine. Among several known functions of cysteine residues, their roles in the active centers of the enzymes responsible for deoxyribonucleoside synthesis and transfer RNA modification appear to be crucial, as no alternative chemistry is known for these reactions. Thus, drastic reduction of the content of the rarest amino acid in a minimal proteome appears to be possible, but its complete elimination is challenging. PMID:23873957

  9. Symmetrical and Thermodynamic Properties of Phenotypic Graphs of Amino Acids Encoded by the Primeval RNY Code

    NASA Astrophysics Data System (ADS)

    José, Marco V.; Zamudio, Gabriel S.; Palacios-Pérez, Miryam; Bobadilla, Juan R.; de Farías, Sávio Torres


    The 12 different types of graphs of the 8 amino acids encoded by the presumably primeval RNY code are derived. The symmetry groups of these graphs are analyzed and coincide with the corresponding values of polar requirement for each amino acid. The symmetry groups at the codon level are partially carried over as a group or subgroup at the amino acid level. Measures of centrality of the 12 graphs indicate that all amino acids were equally relevant irrespective of its chronological order of its appearance. The elimination of any amino acid would be strongly selected against and therefore the genetic code at this stage was already frozen.

  10. The decarboxylation of the weak-acid preservative, sorbic acid, is encoded by linked genes in Aspergillus spp.


    Plumridge, Andrew; Melin, Petter; Stratford, Malcolm; Novodvorska, Michaela; Shunburne, Lee; Dyer, Paul S; Roubos, Johannes A; Menke, Hildegard; Stark, Jacques; Stam, Hein; Archer, David B


    The ability to resist anti-microbial compounds is of key evolutionary benefit to microorganisms. Aspergillus niger has previously been shown to require the activity of a phenylacrylic acid decarboxylase (encoded by padA1) for the decarboxylation of the weak-acid preservative sorbic acid (2,4-hexadienoic acid) to 1,3-pentadiene. It is now shown that this decarboxylation process also requires the activity of a putative 4-hydroxybenzoic acid (3-octaprenyl-4-hydroxybenzoic acid) decarboxylase, encoded by a gene termed ohbA1, and a putative transcription factor, sorbic acid decarboxylase regulator, encoded by sdrA. The padA1,ohbA1 and sdrA genes are in close proximity to each other on chromosome 6 in the A. niger genome and further bioinformatic analysis revealed conserved synteny at this locus in several Aspergillus species and other ascomycete fungi indicating clustering of metabolic function. This cluster is absent from the genomes of A. fumigatus and A. clavatus and, as a consequence, neither species is capable of decarboxylating sorbic acid. Copyright 2010 Elsevier Inc. All rights reserved.

  11. Recombinant host cells and nucleic acid constructs encoding polypeptides having cellulolytic enhancing activity


    Schnorr, Kirk; Kramer, Randall


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Rv0132c of Mycobacterium tuberculosis Encodes a Coenzyme F420-Dependent Hydroxymycolic Acid Dehydrogenase

    PubMed Central

    Purwantini, Endang; Mukhopadhyay, Biswarup


    The ability of Mycobacterium tuberculosis to manipulate and evade human immune system is in part due to its extraordinarily complex cell wall. One of the key components of this cell wall is a family of lipids called mycolic acids. Oxygenation of mycolic acids generating methoxy- and ketomycolic acids enhances the pathogenic attributes of M. tuberculosis. Thus, the respective enzymes are of interest in the research on mycobacteria. The generation of methoxy- and ketomycolic acids proceeds through intermediary formation of hydroxymycolic acids. While the methyl transferase that generates methoxymycolic acids from hydroxymycolic acids is known, hydroxymycolic acids dehydrogenase that oxidizes hydroxymycolic acids to ketomycolic acids has been elusive. We found that hydroxymycolic acid dehydrogenase is encoded by the rv0132c gene and the enzyme utilizes F420, a deazaflavin coenzyme, as electron carrier, and accordingly we called it F420-dependent hydroxymycolic acid dehydrogenase. This is the first report on the involvement of F420 in the synthesis of a mycobacterial cell envelope. Also, F420-dependent hydroxymycolic acid dehydrogenase was inhibited by PA-824, and therefore, it is a previously unknown target for this new tuberculosis drug. PMID:24349169

  13. Nucleic Acid Encoding A Lectin-Derived Progenitor Cell Preservation Factor


    Colucci, M. Gabriella; Chrispeels, Maarten J.; Moore, Jeffrey G.


    The invention relates to an isolated nucleic acid molecule that encodes a protein that is effective to preserve progenitor cells, such as hematopoietic progenitor cells. The nucleic acid comprises a sequence defined by SEQ ID NO:1, a homolog thereof, or a fragment thereof. The encoded protein has an amino acid sequence that comprises a sequence defined by SEQ ID NO:2, a homolog thereof, or a fragment thereof that contains an amino acid sequence TNNVLQVT. Methods of using the encoded protein for preserving progenitor cells in vitro, ex vivo, and in vivo are also described. The invention, therefore, include methods such as myeloablation therapies for cancer treatment wherein myeloid reconstitution is facilitated by means of the specified protein. Other therapeutic utilities are also enabled through the invention, for example, expanding progenitor cell populations ex vivo to increase chances of engraftation, improving conditions for transporting and storing progenitor cells, and facilitating gene therapy to treat and cure a broad range of life-threatening hematologic diseases.

  14. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 Gene Encodes an Aldehyde Dehydrogenase Involved in Ferulic Acid and Sinapic Acid Biosynthesis

    PubMed Central

    Nair, Ramesh B.; Bastress, Kristen L.; Ruegger, Max O.; Denault, Jeff W.; Chapple, Clint


    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP+-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall–esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes. PMID:14729911

  15. Nucleic acids encoding modified human immunodeficiency virus type 1 (HIV-1) group M consensus envelope glycoproteins


    Haynes, Barton F [Durham, NC; Gao, Feng [Durham, NC; Korber, Bette T [Los Alamos, NM; Hahn, Beatrice H [Birmingham, AL; Shaw, George M [Birmingham, AL; Kothe, Denise [Birmingham, AL; Li, Ying Ying [Hoover, AL; Decker, Julie [Alabaster, AL; Liao, Hua-Xin [Chapel Hill, NC


    The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens.

  16. Nucleotide sequence and the encoded amino acids of human apolipoprotein A-I mRNA.

    PubMed Central

    Law, S W; Brewer, H B


    The cDNA clones encoding the precursor form of human liver apolipoprotein A-I (apoA-I), preproapoA-I, have been isolated from a cDNA library. A 17-base synthetic oligonucleotide based on residues 108-113 of apoA-I and a 26-base primer-extended, dideoxynucleotide-terminated cDNA were used as hybridization probes to select for recombinant plasmids bearing the apoA-I sequence. The complete nucleic acid sequence of human liver preproapoA-I has been determined by analysis of the cloned cDNA. The sequence is composed of 801 nucleotides encoding 267 amino acid residues. PreproapoA-I contains an 18-amino-acid prepeptide and a 6-amino-acid propeptide connected to the amino terminus of the 243-amino acid mature apoA-I. Southern blotting analysis of chromosomal DNA obtained from peripheral blood indicated the apoA-I gene is contained in a 2.1-kilobase-pair Pst I fragment and there is no gross difference in structural organization between the normal apoA-I gene and the Tangier disease apoA-I gene. Images PMID:6198645

  17. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei


    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  18. The oxalic acid biosynthetic activity of Burkholderia mallei is encoded by a single locus.


    Nakata, Paul A


    Although it is known that oxalic acid provides a selective advantage to the secreting microbe our understanding of how this acid is biosynthesized remains incomplete. This study reports the identification, cloning, and partial characterization of the oxalic acid biosynthetic enzyme from the animal bacterial pathogen, Burkholderia mallei. The discovered gene was named oxalate biosynthetic component (obc)1. Complementation of Burkholderia oxalate defective (Bod)1, a Burkholderia glumae mutant that lacks expression of a functional oxalic acid biosynthetic operon, revealed that the obc1 was able to rescue the no oxalate mutant phenotype. This single gene rescue is in contrast to the situation found in B. glumae which required the expression of two genes, obcA and obcB, to achieve complementation. Enzyme assays showed that even though the two Burkholderia species differed in the number of genes required to encode a functional enzyme, both catalyzed the same acyl-CoA dependent biosynthetic reaction. In addition, mutagenesis studies suggested a similar domain structure of the assembled oxalate biosynthetic enzymes whether encoded by one or two genes. Published by Elsevier GmbH.

  19. Real Time Monitoring of Intracellular Bile Acid Dynamics Using a Genetically Encoded FRET-based Bile Acid Sensor.


    Van de Wiel, Sandra; Merkx, Maarten; Van de Graaf, Stan


    Förster Resonance Energy Transfer (FRET) has become a powerful tool for monitoring protein folding, interaction and localization in single cells. Biosensors relying on the principle of FRET have enabled real-time visualization of subcellular signaling events in live cells with high temporal and spatial resolution. Here, we describe the application of a genetically encoded Bile Acid Sensor (BAS) that consists of two fluorophores fused to the farnesoid X receptor ligand binding domain (FXR-LBD), thereby forming a bile acid sensor that can be activated by a large number of bile acids species and other (synthetic) FXR ligands. This sensor can be targeted to different cellular compartments including the nucleus (NucleoBAS) and cytosol (CytoBAS) to measure bile acid concentrations locally. It allows rapid and simple quantitation of cellular bile acid influx, efflux and subcellular distribution of endogenous bile acids without the need for labeling with fluorescent tags or radionuclei. Furthermore, the BAS FRET sensors can be useful for monitoring FXR ligand binding. Finally, we show that this FRET biosensor can be combined with imaging of other spectrally distinct fluorophores. This allows for combined analysis of intracellular bile acid dynamics and i) localization and/or abundance of proteins of interest, or ii) intracellular signaling in a single cell.

  20. Mutations of the Corynebacterium glutamicum NCgl1221 gene, encoding a mechanosensitive channel homolog, induce L-glutamic acid production.


    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki


    Corynebacterium glutamicum is a biotin auxotroph that secretes L-glutamic acid in response to biotin limitation; this process is employed in industrial L-glutamic acid production. Fatty acid ester surfactants and penicillin also induce L-glutamic acid secretion, even in the presence of biotin. However, the mechanism of L-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in L-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive L-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive L-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an L-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes L-glutamic acid secretion, causing an increase in the intracellular L-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased L-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an L-glutamic acid exporter. We propose that treatments that induce L-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export L-glutamic acid.

  1. Identification of amino acids in mitochondrially encoded proteins that correlate with lifespan.


    Mariadassou, Mahendra; Pellay, François-Xavier


    Animals show a huge diversity in their lifespan that can vary from a few weeks to over a hundred years in vertebrates. Size is a key element in this variation and the positive correlation between size and maximum lifespan can be observed in each class of vertebrate. Some groups and species clearly stand out in this size-lifespan relationship and the ones with exceptionally long lifespan have been studied to understand the biological causes of their low aging rate. Among the potential explanations of animals' lifespan variations, mitochondria and mitochondrially encoded genes have drawn attention because of their importance in the aging process. To understand both the extent of lifespan variations and their dependence to genes and amino acid variations in mitochondrial genes and DNA (mtDNA), we analyze in a systematic way all 13 proteins encoded by mitochondria in all vertebrates for which we had information on weight, maximum lifespan and mtDNA sequence. This comparison allows us to visualize positions, and even specific amino acids, in these sequences that correlate with lifespan. With this approach, we draw a map of 356 amino acid residues, at 296 positions within the sequence, that correlate with longer or shorter lifespan. We also compared this map with the human mitochondrial polymorphism to determine its potential as a predictive tool. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Characterization of the lys2 gene of Penicillium chrysogenum encoding alpha-aminoadipic acid reductase.


    Casqueiro, J; Gutiérrez, S; Bañuelos, O; Fierro, F; Velasco, J; Martín, J F


    A DNA fragment containing a gene homologous to LYS2 gene of Saccharomyces cerevisiae was cloned from a genomic DNA library of Penicillium chrysogenum AS-P-78. It encodes a protein of 1409 amino acids (Mr 154859) with strong similarity to the S. cerevisiae (49.9% identity) Schizosaccharomyces pombe (51.3% identity) and Candida albicans (48.12% identity) alpha-aminoadipate reductases and a lesser degree of identity to the amino acid-activating domains of the non-ribosomal peptide synthetases, including the alpha-aminoadipate-activating domain of the alpha-aminoadipyl-cysteinyl-valine synthetase of P. chrysogenum (12.4% identical amino acids). The lys2 gene contained one intron in the 5'-region and other in the 3'-region, as shown by comparing the nucleotide sequences of the cDNA and genomic DNA, and was transcribed as a 4.7-kb monocistronic mRNA. The lys2 gene was localized on chromosome III (7.5 Mb) in P. chrysogenum AS-P-78 and on chromosome IV (5.6 Mb) in strain P2, whereas the penicillin gene cluster is known to be located in chromosome I in both strains. The lys2-encoded protein is a member of the aminoacyladenylate-forming enzyme family with a reductase domain in its C-terminal region.

  3. Oxalic acid biosynthesis is encoded by an operon in Burkholderia glumae.


    Nakata, Paul A; He, Cixin


    Although the biosynthesis of oxalic acid is known to occur in a number of bacteria, the mechanism(s) regulating its production remains largely unknown. To date, there is no report on the identification of an oxalic acid biosynthetic pathway gene from bacteria. In an attempt to identify such a gene(s), a mutant screen was conducted using the simple oxalic acid-producing phytopathogenic bacterium, Burkholderia glumae. Four mutants that failed to produce oxalic acid were isolated from a transposon-mutagenized B. glumae library and named Burkholderia oxalate defective (Bod)1. DNA sequence analysis revealed that each mutant contained an insertion event at different sites in the same ORF, which we referred to as the oxalate biosynthetic component (obc)A locus. Complementation of the Bod1 mutant with the obcA gene, however, resulted only in a partial restoration of the oxalic acid-producing phenotype. Further complementation studies utilizing a larger DNA fragment encompassing the obcA locus coupled with deletion mutagenesis led to the identification of another ORF that we named the obcB locus, which was essential for higher levels of oxalic acid production. Transcript analysis indicated that both obcA and obcB are coexpressed and encoded on a single polycistron message.

  4. Nucleic acids encoding plant glutamine phenylpyruvate transaminase (GPT) and uses thereof


    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.


    Glutamine phenylpyruvate transaminase (GPT) proteins, nucleic acid molecules encoding GPT proteins, and uses thereof are disclosed. Provided herein are various GPT proteins and GPT gene coding sequences isolated from a number of plant species. As disclosed herein, GPT proteins share remarkable structural similarity within plant species, and are active in catalyzing the synthesis of 2-hydroxy-5-oxoproline (2-oxoglutaramate), a powerful signal metabolite which regulates the function of a large number of genes involved in the photosynthesis apparatus, carbon fixation and nitrogen metabolism.

  5. Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase


    Srienc, Friedrich; Jackson, John K.; Somers, David A.


    A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

  6. Nucleic acid encoding DS-CAM proteins and products related thereto

    SciTech Connect

    Korenberg, Julie R.


    In accordance with the present invention, there are provided Down Syndrome-Cell Adhesion Molecule (DS-CAM) proteins. Nucleic acid sequences encoding such proteins and assays employing same are also disclosed. The invention DS-CAM proteins can be employed in a variety of ways, for example, for the production of anti-DS-CAM antibodies thereto, in therapeutic compositions and methods employing such proteins and/or antibodies. DS-CAM proteins are also useful in bioassays to identify agonists and antagonists thereto.

  7. Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.


    Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin


    We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

  8. Nucleotide sequence of the luxC gene encoding fatty acid reductase of the lux operon from Photobacterium leiognathi.


    Lin, J W; Chao, Y F; Weng, S F


    The nucleotide sequence of the luxC gene (EMBL Accession No. 65156) encoding fatty acid reductase (FAR) of the lux operon from Photobacterium leiognathi PL741 was determined and the encoded amino acid sequence deduced. The fatty acid reductase is a component of the fatty acid reductase complex. The complex is responsible for converting fatty acid to aldehyde which serves as the substrate in the luciferase-catalyzed bioluminescent reaction. The protein comprises 478 amino acid residues and has a calculated M(r) of 53,858. Alignment and comparison of the fatty acid reductase of P. leiognathi with that of Vibrio harveyi B392 and Vibrio fischeri ATCC 7744 shows that there is 70% and 59% amino acid residues identity, respectively.

  9. Identification and Analysis of a Gene from Calendula officinalis Encoding a Fatty Acid Conjugase

    PubMed Central

    Qiu, Xiao; Reed, Darwin W.; Hong, Haiping; MacKenzie, Samuel L.; Covello, Patrick S.


    Two homologous cDNAs, CoFad2 and CoFac2, were isolated from a Calendula officinalis developing seed by a polymerase chain reaction-based cloning strategy. Both sequences share similarity to FAD2 desaturases and FAD2-related enzymes. In C. officinalis plants CoFad2 was expressed in all tissues tested, whereas CoFac2 expression was specific to developing seeds. Expression of CoFad2 cDNA in yeast (Saccharomyces cerevisiae) indicated it encodes a Δ12 desaturase that introduces a double bond at the 12 position of 16:1(9Z) and 18:1(9Z). Expression of CoFac2 in yeast revealed that the encoded enzyme acts as a fatty acid conjugase converting 18:2(9Z, 12Z) to calendic acid 18:3(8E, 10E, 12Z). The enzyme also has weak activity on the mono-unsaturates 16:1(9Z) and 18:1(9Z) producing compounds with the properties of 8,10 conjugated dienes. PMID:11161042

  10. L-lactic acid production from D-xylose with Candida sonorensis expressing a heterologous lactate dehydrogenase encoding gene.


    Koivuranta, Kari T; Ilmén, Marja; Wiebe, Marilyn G; Ruohonen, Laura; Suominen, Pirkko; Penttilä, Merja


    Bioplastics, like polylactic acid (PLA), are renewable alternatives for petroleum-based plastics. Lactic acid, the monomer of PLA, has traditionally been produced biotechnologically with bacteria. With genetic engineering, yeast have the potential to replace bacteria in biotechnological lactic acid production, with the benefits of being acid tolerant and having simple nutritional requirements. Lactate dehydrogenase genes have been introduced to various yeast to demonstrate this potential. Importantly, an industrial lactic acid producing process utilising yeast has already been implemented. Utilisation of D-xylose in addition to D-glucose in production of biochemicals such as lactic acid by microbial fermentation would be beneficial, as it would allow lignocellulosic raw materials to be utilised in the production processes. The yeast Candida sonorensis, which naturally metabolises D-xylose, was genetically modified to produce L-lactic acid from D-xylose by integrating the gene encoding L-lactic acid dehydrogenase (ldhL) from Lactobacillus helveticus into its genome. In microaerobic, CaCO3-buffered conditions a C. sonorensis ldhL transformant having two copies of the ldhL gene produced 31 g l-1 lactic acid from 50 g l-1 D-xylose free of ethanol.Anaerobic production of lactic acid from D-xylose was assessed after introducing an alternative pathway of D-xylose metabolism, i.e. by adding a xylose isomerase encoded by XYLA from Piromyces sp. alone or together with the xylulokinase encoding gene XKS1 from Saccharomyces cerevisiae. Strains were further modified by deletion of the endogenous xylose reductase encoding gene, alone or together with the xylitol dehydrogenase encoding gene. Strains of C. sonorensis expressing xylose isomerase produced L-lactic acid from D-xylose in anaerobic conditions. The highest anaerobic L-lactic acid production (8.5 g l-1) was observed in strains in which both the xylose reductase and xylitol dehydrogenase encoding genes had been

  11. High affinity of acid phosphatase encoded by PHO3 gene in Saccharomyces cerevisiae for thiamin phosphates.


    Nosaka, K


    The enzymatic properties of acid phosphatase (orthophosphoric-monoester phosphohydrolase, EC encoded by PHO3 gene in Saccharomyces cerevisiae, which is repressed by thiamin and has thiamin-binding activity at pH 5.0, were investigated to study physiological functions. The following results led to the conclusion that thiamin-repressible acid phosphatase physiologically catalyzes the hydrolysis of thiamin phosphates in the periplasmic space of S. cerevisiae, thus participating in utilization of the thiamin moiety of the phosphates by yeast cells: (a) thiamin-repressible acid phosphatase showed Km values of 1.6 and 1.7 microM at pH 5.0 for thiamin monophosphate and thiamin pyrophosphate, respectively. These Km values were 2-3 orders of magnitude lower than those (0.61 and 1.7 mM) for p-nitrophenyl phosphate; (b) thiamin exerted remarkable competitive inhibition in the hydrolysis of thiamin monophosphate (Ki 2.2 microM at pH 5.0), whereas the activity for p-nitrophenyl phosphate was slightly affected by thiamin; (c) the inhibitory effect of inorganic phosphate, which does not repress the thiamin-repressible enzyme, on the hydrolysis of thiamin monophosphate was much smaller than that of p-nitrophenyl phosphate. Moreover, the modification of thiamin-repressible acid phosphatase of S. cerevisiae with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide resulted in the complete loss of thiamin-binding activity and the Km value of the modified enzyme for thiamin monophosphate increased nearly to the value of the native enzyme for p-nitrophenyl phosphate. These results also indicate that the high affinity of the thiamin-repressible acid phosphatase for thiamin phosphates is due to the thiamin-binding properties of this enzyme.

  12. Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use


    Croteau, Rodney B.; Lange, Bernd M.


    A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

  13. The Saccharomyces Cerevisiae Spt7 Gene Encodes a Very Acidic Protein Important for Transcription in Vivo

    PubMed Central

    Gansheroff, L. J.; Dollard, C.; Tan, P.; Winston, F.


    Mutations in the SPT7 gene of Saccharomyces cerevisiae originally were identified as suppressors of Ty and {delta small} insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Other genes that have been identified in mutant hunts of this type have been shown to play a role in transcription. In this work we show that SPT7 is also important for proper transcription in vivo. We have cloned and sequenced the SPT7 gene and have shown that it encodes a large, acidic protein that is localized to the nucleus. The SPT7 protein contains a bromodomain sequence; a deletion that removes the bromodomain from the SPT7 protein causes no detectable mutant phenotype. Strains that contain an spt7 null mutation are viable but grow very slowly and have transcriptional defects at many loci including insertion mutations, Ty elements, the INO1 gene and the MFA1 gene. These transcriptional defects and other mutant phenotypes are similar to those caused by certain mutations in SPT15, which encodes the TATA binding protein (TBP). The similarity of the phenotypes of spt7 and spt15 mutants, including effects of spt7 mutations on the transcription start site of certain genes, suggests that SPT7 plays an important role in transcription initiation in vivo. PMID:7713415

  14. The Arabidopsis DELAYED DEHISCENCE1 Gene Encodes an Enzyme in the Jasmonic Acid Synthesis Pathway

    PubMed Central

    Sanders, Paul M.; Lee, Pei Yun; Biesgen, Christian; Boone, James D.; Beals, Thomas P.; Weiler, Elmar W.; Goldberg, Robert B.


    delayed dehiscence1 is an Arabidopsis T-DNA mutant in which anthers release pollen grains too late for pollination to occur. The delayed dehiscence1 defect is caused by a delay in the stomium degeneration program. The gene disrupted in delayed dehiscence1 encodes 12-oxophytodienoate reductase, an enzyme in the jasmonic acid biosynthesis pathway. We rescued the mutant phenotype by exogenous application of jasmonic acid and obtained seed set from previously male-sterile plants. In situ hybridization studies showed that during the early stages of floral development, DELAYED DEHISCENCE1 mRNA accumulated within all floral organs. Later, DELAYED DEHISCENCE1 mRNA accumulated specifically within the pistil, petals, and stamen filaments. DELAYED DEHISCENCE1 mRNA was not detected in the stomium and septum cells of the anther that are involved in pollen release. The T-DNA insertion in delayed dehiscence1 eliminated both DELAYED DEHISCENCE1 mRNA accumulation and 12-oxophytodienoate reductase activity. These experiments suggest that jasmonic acid signaling plays a role in controlling the time of anther dehiscence within the flower. PMID:10899973

  15. A gene encoding a protein modified by the phytohormone indoleacetic acid

    PubMed Central

    Walz, Alexander; Park, Seijin; Slovin, Janet P.; Ludwig-Müller, Jutta; Momonoki, Yoshie S.; Cohen, Jerry D.


    We show that the expression of an indole-3-acetic acid (IAA)-modified protein from bean seed, IAP1, is correlated to the developmental period of rapid growth during seed development. Moreover, this protein undergoes rapid degradation during germination. The gene for IAP1, the most abundant protein covalently modified by IAA (iap1, GenBank accession no. AF293023) was isolated and cloned from bush bean (Phaseolus vulgaris) seeds. The 957-bp sequence encodes a 35-kDa polypeptide. IAA-modified proteins represent a distinct class of conjugated phytohormones and appear in bean to be the major form of auxin in seeds. IAA proteins also are found at other stages of development in bean plants. Our immunological and analytical data suggest that auxin modification of a small class of proteins may be a feature common to many plants. PMID:11830675

  16. Protein Crosslinking by Genetically Encoded Noncanonical Amino Acids with Reactive Aryl Carbamate Side Chains.


    Xuan, Weimin; Shao, Sida; Schultz, Peter G


    The use of genetically encoded noncanonical amino acids (ncAAs) to construct crosslinks within or between proteins has emerged as a useful method to enhance protein stability, investigate protein-protein interactions, and improve the pharmacological properties of proteins. We report ncAAs with aryl carbamate side chains (PheK and FPheK) that can react with proximal nucleophilic residues to form intra- or intermolecular protein crosslinks. We evolved a pyrrolysyl-tRNA synthetase that incorporates site-specifically PheK and FPheK into proteins in both E. coli and mammalian cells. PheK and FPheK when incorporated into proteins showed good stability during protein expression and purification. FPheK reacted with adjacent Lys, Cys, and Tyr residues in thioredoxin in high yields. In addition, crosslinks could be formed between FPheK and Lys residue of two interacting proteins, including the heavy chain and light chain of an antibody Fab.

  17. Site-directed spin labeling of a genetically encoded unnatural amino acid

    PubMed Central

    Fleissner, Mark R.; Brustad, Eric M.; Kálai, Tamás; Altenbach, Christian; Cascio, Duilio; Peters, Francis B.; Hideg, Kálmán; Peuker, Sebastian; Schultz, Peter G.; Hubbell, Wayne L.


    The traditional site-directed spin labeling (SDSL) method, which utilizes cysteine residues and sulfhydryl-reactive nitroxide reagents, can be challenging for proteins that contain functionally important native cysteine residues or disulfide bonds. To make SDSL amenable to any protein, we introduce an orthogonal labeling strategy, i.e., one that does not rely on any of the functional groups found in the common 20 amino acids. In this method, the genetically encoded unnatural amino acid p-acetyl-L-phenylalanine (p-AcPhe) is reacted with a hydroxylamine reagent to generate a nitroxide side chain (K1). The utility of this scheme was demonstrated with seven mutants of T4 lysozyme, each containing a single p-AcPhe at a solvent-exposed helix site; the mutants were expressed in amounts qualitatively similar to the wild-type protein. In general, the EPR spectra of the resulting K1 mutants reflect higher nitroxide mobilities than the spectra of analogous mutants containing the more constrained disulfide-linked side chain (R1) commonly used in SDSL. Despite this increased flexibility, site dependence of the EPR spectra suggests that K1 will be a useful sensor of local structure and of conformational changes in solution. Distance measurements between pairs of K1 residues using double electron electron resonance (DEER) spectroscopy indicate that K1 will also be useful for distance mapping. PMID:19995976

  18. Garlic and alpha lipoic supplementation enhance the immune system of albino rats and alleviate implications of pesticides mixtures

    PubMed Central

    Elhalwagy, Manal EA; Darwish, Nevine S; Shokry, Dina A; El-Aal, Aly GE Abd; Abd-Alrahman, Sherif H; Nahas, Abd-Alhamed; Ziada, Reem M


    This study aimed to investigate age dependent immune-system response versus exposure to different doses of mixture of (chlorpyrifos, profenofose, and fenitrothion) and/or combined with 60 and 250 mg kg-1 alpha lipoic acid and garlic, respectively. 120 males of albino rats were divided to two groups according to age; weaning group (2 months age and 60-80 gm.), adult (6 months and 180-200 gm). Each age was divided into 6 subgroups treated orally for 3 months , G1 (control), G2 high dose (HDPM) CPF10 mg kg-1, PRO 3 mg kg-1, FEN 6 mg kg-1, G3 low dose (LDPM) CPF 1 mg kg-1, PFN 0.3 mg kg-1 and FEN 0.6 mg kg-1, G4 AOX (alpha lipoic + Garlic), G5 HDPM + AOX and G6 LDPM + AOX. Results showed significant inhibition in serum acetylcholinesterase (AChE), elevation in malondialdehyde (MDA) concurrent with reduction in total reduced glutathione (GSH) in both ages was recorded as well as, decrease in IGG, IGM, Lymphocyte transformation and Phagocytosis humeral and cellular immunity confirmed by alteration in lymph nodes architecture. This study was concluded that the supplementation with alpha lipoic acid and garlic improved previous alternations slightly to be more or less near the control level in both adult and weaning rats. It seems that, immune-responses of both adult and weaning rats were slightly similar. PMID:26221319

  19. Arabidopsis CYP707As encode (+)-abscisic acid 8'-hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid.


    Saito, Shigeki; Hirai, Nobuhiro; Matsumoto, Chiaki; Ohigashi, Hajime; Ohta, Daisaku; Sakata, Kanzo; Mizutani, Masaharu


    Abscisic acid (ABA) is involved in a number of critical processes in normal growth and development as well as in adaptive responses to environmental stresses. For correct and accurate actions, a physiologically active ABA level is controlled through fine-tuning of de novo biosynthesis and catabolism. The hydroxylation at the 8'-position of ABA is known as the key step of ABA catabolism, and this reaction is catalyzed by ABA 8'-hydroxylase, a cytochrome P450. Here, we demonstrate CYP707As as the P450 responsible for the 8'-hydroxylation of (+)-ABA. First, all four CYP707A cDNAs were cloned from Arabidopsis and used for the production of the recombinant proteins in insect cells using a baculovirus system. The insect cells expressing CYP707A3 efficiently metabolized (+)-ABA to yield phaseic acid, the isomerized form of 8'-hydroxy-ABA. The microsomes from the insect cells exhibited very strong activity of 8'-hydroxylation of (+)-ABA (K(m) = 1.3 microm and k(cat) = 15 min(-1)). The solubilized CYP707A3 protein bound (+)-ABA with the binding constant K(s) = 3.5 microm, but did not bind (-)-ABA. Detailed analyses of the reaction products confirmed that CYP707A3 does not have the isomerization activity of 8'-hydroxy-ABA to phaseic acid. Further experiments revealed that Arabidopsis CYP707A1 and CYP707A4 also encode ABA 8'-hydroxylase. The transcripts of the CYP707A genes increased in response to salt, osmotic, and dehydration stresses as well as ABA. These results establish that the CYP707A family plays a key role in regulating the ABA level through the 8'-hydroxylation of (+)-ABA.

  20. Acetic acid increases the phage-encoded enterotoxin A expression in Staphylococcus aureus

    PubMed Central


    Background The effects of acetic acid, a common food preservative, on the bacteriophage-encoded enterotoxin A (SEA) expression and production in Staphylococcus aureus was investigated in pH-controlled batch cultures carried out at pH 7.0, 6.5, 6.0, 5.5, 5.0, and 4.5. Also, genomic analysis of S. aureus strains carrying sea was performed to map differences within the gene and in the temperate phage carrying sea. Results The sea expression profile was similar from pH 7.0 to 5.5, with the relative expression peaking in the transition between exponential and stationary growth phase and falling during stationary phase. The levels of sea mRNA were below the detection limit at pH 5.0 and 4.5, confirmed by very low SEA levels at these pH values. The level of relative sea expression at pH 6.0 and 5.5 were nine and four times higher, respectively, in the transitional phase than in the exponential growth phase, compared to pH 7.0 and pH 6.5, where only a slight increase in relative expression in the transitional phase was observed. Furthermore, the increase in sea expression levels at pH 6.0 and 5.5 were observed to be linked to increased intracellular sea gene copy numbers and extracellular sea-containing phage copy numbers. The extracellular SEA levels increased over time, with highest levels produced at pH 6.0 in the four growth phases investigated. Using mitomycin C, it was verified that SEA was at least partially produced as a consequence of prophage induction of the sea-phage in the three S. aureus strains tested. Finally, genetic analysis of six S. aureus strains carrying the sea gene showed specific sea phage-groups and two versions of the sea gene that may explain the different sea expression and production levels observed in this study. Conclusions Our findings suggest that the increased sea expression in S. aureus caused by acetic acid induced the sea-encoding prophage, linking SEA production to the lifecycle of the phage. PMID:20487538

  1. Reactivity and chemical synthesis of L-pyrrolysine- the 22(nd) genetically encoded amino acid.


    Hao, Bing; Zhao, Gang; Kang, Patrick T; Soares, Jitesh A; Ferguson, Tsuneo K; Gallucci, Judith; Krzycki, Joseph A; Chan, Michael K


    L-pyrrolysine, the 22(nd) genetically encoded amino acid, was previously deduced to be (4R, 5R)-4-substituted-pyrroline-5-carboxylate attached to the epsilon-nitrogen of lysine based on the crystal structure of the M. barkeri monomethylamine methyltransferase (MtmB). To confirm L-pyrrolysine's identity, structures of MtmB have been determined following treatment with hydroxylamine, N-methylhydroxylamine, or dithionite. Analysis of these structures has provided additional support for the presence of the pyrroline ring and, together with previous mass spectroscopy data, has led us to assign the C(4)-substituent to a methyl group. Based on this assignment, synthetic L-pyrrolysine was prepared by chemical methods. Detailed study of this chemically synthesized L-pyrrolysine has allowed us to characterize its physical properties, to study its chemical stability, and to elucidate the role of its C(4) substituent. Future applications of this synthetic L-pyrrolysine include its in vivo incorporation into recombinant proteins.

  2. Chlorophenol Hydroxylases Encoded by Plasmid pJP4 Differentially Contribute to Chlorophenoxyacetic Acid Degradation

    PubMed Central

    Ledger, T.; Pieper, D. H.; González, B.


    Phenoxyalkanoic compounds are used worldwide as herbicides. Cupriavidus necator JMP134(pJP4) catabolizes 2,4-dichlorophenoxyacetate (2,4-D) and 4-chloro-2-methylphenoxyacetate (MCPA), using tfd functions carried on plasmid pJP4. TfdA cleaves the ether bonds of these herbicides to produce 2,4-dichlorophenol (2,4-DCP) and 4-chloro-2-methylphenol (MCP), respectively. These intermediates can be degraded by two chlorophenol hydroxylases encoded by the tfdBI and tfdBII genes to produce the respective chlorocatechols. We studied the specific contribution of each of the TfdB enzymes to the 2,4-D/MCPA degradation pathway. To accomplish this, the tfdBI and tfdBII genes were independently inactivated, and growth on each chlorophenoxyacetate and total chlorophenol hydroxylase activity were measured for the mutant strains. The phenotype of these mutants shows that both TfdB enzymes are used for growth on 2,4-D or MCPA but that TfdBI contributes to a significantly higher extent than TfdBII. Both enzymes showed similar specificity profiles, with 2,4-DCP, MCP, and 4-chlorophenol being the best substrates. An accumulation of chlorophenol was found to inhibit chlorophenoxyacetate degradation, and inactivation of the tfdB genes enhanced the toxic effect of 2,4-DCP on C. necator cells. Furthermore, increased chlorophenol production by overexpression of TfdA also had a negative effect on 2,4-D degradation by C. necator JMP134 and by a different host, Burkholderia xenovorans LB400, harboring plasmid pJP4. The results of this work indicate that codification and expression of the two tfdB genes in pJP4 are important to avoid toxic accumulations of chlorophenols during phenoxyacetic acid degradation and that a balance between chlorophenol-producing and chlorophenol-consuming reactions is necessary for growth on these compounds. PMID:16597983

  3. OsPAP26 Encodes a Major Purple Acid Phosphatase and Regulates Phosphate Remobilization in Rice.


    Gao, Wenwen; Lu, Linghong; Qiu, Wenmin; Wang, Chuang; Shou, Huixia


    During phosphate (Pi) starvation or leaf senescence, the accumulation of intracellular and extracellular purple acid phosphatases (PAPs) increases in plants in order to scavenge organic phosphorus (P). In this study, we demonstrated that a PAP-encoding gene in rice, OsPAP26, is constitutively expressed in all tissues. While the abundance of OsPAP26 transcript is not affected by Pi supply, it is up-regulated during leaf senescence. Furthermore, Pi deprivation and leaf senescence greatly increased the abundance of OsPAP26 protein. Overexpression or RNA interference (RNAi) of OsPAP26 in transgenic rice significantly increased or reduced APase activities, respectively, in leaves, roots and growth medium. Compared with wild-type (WT) plants, Pi concentrations of OsPAP26-overexpressing plants increased in the non-senescing leaves and decreased in the senescing leaves. The increased remobilization of Pi from the senescing leaves to non-senescing leaves in the OsPAP26-overexpressing plants resulted in better growth performance when plants were grown in Pi-depleted condition. In contrast, OsPAP26-RNAi plants retained more Pi in the senescing leaves, and were more sensitive to Pi starvation stress. OsPAP26 was found to localize to the apoplast of rice cells. Western blot analysis of protein extracts from callus growth medium confirmed that OsPAP26 is a secreted PAP. OsPAP26-overexpressing plants were capable of converting more ATP into inorganic Pi in the growth medium, which further supported the potential role of OsPAP26 in utilizing organic P in the rhizosphere. In summary, we concluded that OsPAP26 performs dual functions in plants: Pi remobilization from senescing to non-senescing leaves; and organic P utilization. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email:

  4. Inositol phosphatase activity of the Escherichia coli agp-encoded acid glucose-1-phosphatase.


    Cottrill, Michael A; Golovan, Serguei P; Phillips, John P; Forsberg, Cecil W


    When screening an Escherichia coli gene library for myo-inositol hexakisphosphate (InsP6) phosphatases (phytases), we discovered that the agp-encoded acid glucose-1-phosphatase also possesses this activity. Purified Agp hydrolyzes glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6 with pH optima, 6.5, 3.5, and 4.5, respectively, and was stable when incubated at pH values ranging from 3 to 10. Glucose-1-phosphate was hydrolyzed most efficiently at 55 degrees C. while InsP6 and p-nitrophenyl phosphate were hydrolyzed maximally at 60 degrees C. The Agp exhibited Km values of (0.39 mM, 13 mM, and 0.54 mM for the hydrolysis of glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6, respectively. High-pressure liquid chromatography (HPLC) analysis of inositol phosphate hydrolysis products of Agp demonstrated that the enzyme catalyzes the hydrolysis of phosphate from each of InsP6, D-Ins(1,2,3,4,5)P5, Ins(1,3,4,5,6)P5, and Ins(1,2,3,4,6)P5, producing D/L-Ins(1,2,4,5,6)P5. D-Ins(1,2,4,5)P4, D/L-Ins(1,4,5,6)P4 and D/L-Ins(1,2,4,6)P4, respectively. These data support the contention that Agp is a 3-phosphatase.

  5. The mae1 gene of Schizosaccharomyces pombe encodes a permease for malate and other C4 dicarboxylic acids.


    Grobler, J; Bauer, F; Subden, R E; Van Vuuren, H J


    The mae1 gene of the yeast Schizosaccharomyces pombe was identified on the basis of its ability to complement a mutant defective in the transport of malic acid. Analysis of the DNA sequence revealed an open reading frame of 1314 base pairs, encoding a polypeptide of 438 amino acids with a predicted molecular weight of 49 kDa. A hydropathy profile of the predicted amino acid sequence revealed a protein with ten membrane-spanning or associated domains and hydrophilic N- and C- termini. The predicted secondary structure of the protein in similar to models proposed for other integral membrane proteins from both prokaryotes and eukaryotes. The S. pombe mae1 gene encodes a single mRNA of 1.5 kb. The mea1 gene is expressed constitutively and is not subject to catabolite repression as was previously reported for the malate permease systems of Candida utilis and Hansenula anomala. The mae1 gene was mapped 2842 bp 5' to the MFml gene on chromosome I. Transport assays revealed that the mae1 gene encodes a permease involved in the uptake of L-malate, succinate and malonic acid.

  6. Relative catalytic efficiency of ldhL- and ldhD-encoded products is crucial for optical purity of lactic acid produced by lactobacillus strains.


    Zheng, Zhaojuan; Sheng, Binbin; Ma, Cuiqing; Zhang, Haiwei; Gao, Chao; Su, Fei; Xu, Ping


    NAD-dependent l- and d-lactate dehydrogenases coexist in Lactobacillus genomes and may convert pyruvic acid into l-lactic acid and d-lactic acid, respectively. Our findings suggest that the relative catalytic efficiencies of ldhL- and ldhD-encoded products are crucial for the optical purity of lactic acid produced by Lactobacillus strains.

  7. Chlorophenol hydroxylases encoded by plasmid pJP4 differentially contribute to chlorophenoxyacetic acid degradation.


    Ledger, T; Pieper, D H; González, B


    Phenoxyalkanoic compounds are used worldwide as herbicides. Cupriavidus necator JMP134(pJP4) catabolizes 2,4-dichlorophenoxyacetate (2,4-D) and 4-chloro-2-methylphenoxyacetate (MCPA), using tfd functions carried on plasmid pJP4. TfdA cleaves the ether bonds of these herbicides to produce 2,4-dichlorophenol (2,4-DCP) and 4-chloro-2-methylphenol (MCP), respectively. These intermediates can be degraded by two chlorophenol hydroxylases encoded by the tfdB(I) and tfdB(II) genes to produce the respective chlorocatechols. We studied the specific contribution of each of the TfdB enzymes to the 2,4-D/MCPA degradation pathway. To accomplish this, the tfdB(I) and tfdB(II) genes were independently inactivated, and growth on each chlorophenoxyacetate and total chlorophenol hydroxylase activity were measured for the mutant strains. The phenotype of these mutants shows that both TfdB enzymes are used for growth on 2,4-D or MCPA but that TfdB(I) contributes to a significantly higher extent than TfdB(II). Both enzymes showed similar specificity profiles, with 2,4-DCP, MCP, and 4-chlorophenol being the best substrates. An accumulation of chlorophenol was found to inhibit chlorophenoxyacetate degradation, and inactivation of the tfdB genes enhanced the toxic effect of 2,4-DCP on C. necator cells. Furthermore, increased chlorophenol production by overexpression of TfdA also had a negative effect on 2,4-D degradation by C. necator JMP134 and by a different host, Burkholderia xenovorans LB400, harboring plasmid pJP4. The results of this work indicate that codification and expression of the two tfdB genes in pJP4 are important to avoid toxic accumulations of chlorophenols during phenoxyacetic acid degradation and that a balance between chlorophenol-producing and chlorophenol-consuming reactions is necessary for growth on these compounds.

  8. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose.


    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc


    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products.

  9. Cellulases, nucleic acids encoding them and methods for making and using them


    Blum, David; Gemsch Cuenca, Joslin; Dycaico, Mark


    This invention relates to molecular and cellular biology and biochemistry. In one aspect, the invention provides polypeptides having cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts.

  10. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    SciTech Connect

    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  11. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    SciTech Connect

    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  12. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    SciTech Connect

    Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, s