Sample records for encoding lipoic acid

  1. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail


    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  2. Lipoic Acid Metabolism in Microbial Pathogens

    PubMed Central

    Spalding, Maroya D.; Prigge, Sean T.


    Summary: Lipoic acid [(R)-5-(1,2-dithiolan-3-yl)pentanoic acid] is an enzyme cofactor required for intermediate metabolism in free-living cells. Lipoic acid was discovered nearly 60 years ago and was shown to be covalently attached to proteins in several multicomponent dehydrogenases. Cells can acquire lipoate (the deprotonated charge form of lipoic acid that dominates at physiological pH) through either scavenging or de novo synthesis. Microbial pathogens implement these basic lipoylation strategies with a surprising variety of adaptations which can affect pathogenesis and virulence. Similarly, lipoylated proteins are responsible for effects beyond their classical roles in catalysis. These include roles in oxidative defense, bacterial sporulation, and gene expression. This review surveys the role of lipoate metabolism in bacterial, fungal, and protozoan pathogens and how these organisms have employed this metabolism to adapt to niche environments. PMID:20508247

  3. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  4. A new regulatory mechanism for bacterial lipoic acid synthesis.


    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  5. Nanoencapsulation improves the in vitro antioxidant activity of lipoic acid.


    Külkamp, Irene C; Rabelo, Bruna D; Berlitz, Simone J; Isoppo, Mateus; Bianchin, Mariana D; Schaffazick, Scheila R; Pohlmann, Adriana R; Guterres, Sílvia S


    Lipoic acid is a widely studied substance, whose therapeutic effects are related to its antioxidant activity. Our objective was to develop lipoic acid-loaded lipid-core nanocapsules and evaluate their in vitro antioxidant effect against lipid peroxidation induced by ascorbyl free radicals, using soybean lecithin liposomes as the substrate. The nanocapsule suspensions were prepared by interfacial deposition of poly(epsilon-caprolactone) and characterized by particle size and polydispersion index (photon correlation spectroscopy), zeta potencial (eletrophoretic mobility), drug content and encapsulation efficiency (HPLC). The extent of lipid peroxidation was determined (TBARS). The nanostrucutures presented mean diameters of between 191 and 349 nm, zeta potential values from -14.1 +/- 4.5 to -10.4 +/- 0.6, and high lipoic acid encapsulation. A significant increase in the antioxidant activity of lipoic acid was achieved through nanoencapsulation or by increasing its concentration in the formulation. The protection results ranged from 48.9 +/- 3.4 to 57.4 +/- 9.1% for lipoic acid-loaded lipid-core nanocapsules. The lipoic acid release from nanostrucutures significantly decreased with increasing polymer concentration. Also, it was observed an increasing in the antioxidant activity as the lipoic acid release time decreased. The co-encapsulation of lipoic acid with melatonin in lipid-core nanocapsules did not improve the protection against lipid peroxidation. The results obtained demonstrate the optimal concentrations of polymer and lipoic acid in the formulations in terms of enhancing the antioxidant activity. Furthermore, by the strategy applied, it was verified that nanoencapsulation is an efficient alternative to increase the antioxidant effect of lipoic acid, representing a potential approach for therapeutic applications.

  6. Antioxidant capacity and stability of liposomes containing a triglyceride derivative of lipoic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The multi-functional nutritional agent lipoic acid offers numerous beneficial effects to oxidatively stressed tissues. Lipoic acid was enzymatically incorporated into a triglyceride in conjunction with oleic acid, creating lipoyl dioleoylglycerol, and then chemically reduced to form dihydrolipoyl d...

  7. Effect of alpha lipoic acid on leukotriene A4 hydrolase.


    Torres, María José; Fierro, Angélica; Pessoa-Mahana, C David; Romero-Parra, Javier; Cabrera, Gonzalo; Faúndez, Mario


    Leukotriene A4 hydrolase is a soluble enzyme with epoxide hydrolase and aminopeptidase activities catalysing the conversion of leukotriene A4 to leukotriene B4 and the hydrolysis of the peptide proline-glycine-proline. Imbalances in leukotriene B4 synthesis are related to several pathologic conditions. Currently there are no available drugs capable to modulate the synthesis of leukotriene B4 or to block its receptors. Here we show the inhibitory profile of alpha lipoic acid on the activity of leukotriene A4 Hydrolase. Alpha lipoic acid inhibited both activities of the enzyme at concentrations lower than 10μM. The 5-lipoxygenase inhibitor zileuton, or the 5-lipoxygenase activating protein inhibitor MK-886, were unable to inhibit the activity of the enzyme. Acute promyelocytic leukaemia HL-60 cells were differentiated to leukotriene A4 hydrolase expressing neutrophil-like cells. Alpha lipoic acid inhibited the aminopeptidase activity of the cytosolic fraction from neutrophil-like cells but had no effect on the cytosolic fraction from undifferentiated cells. Docking and molecular dynamic approximations revealed that alpha lipoic acid participates in electrostatic interactions with K-565 and R-563, which are key residues for the carboxylate group recognition of endogenous substrates by the enzyme. Alpha lipoic acid is a compound widely used in clinical practice, most of its therapeutic effects are associated with its antioxidants properties, however, antioxidant effect alone is unable to explain all clinical effects observed with alpha lipoic acid. Our results invite to evaluate the significance of the inhibitory effect of alpha lipoic acid on the catalytic activity of leukotriene A4 hydrolase using in vivo models.

  8. A Novel Two-Gene Requirement for the Octanoyltransfer Reaction of Bacillus subtilis Lipoic Acid Biosynthesis

    PubMed Central

    Martin, Natalia; Christensen, Quin H.; Mansilla, María C.; Cronan, John E.; de Mendoza, Diego


    SUMMARY The Bacillus subtilis genome encodes three apparent lipoyl ligase homologues: yhfJ, yqhM, and ywfL which we have renamed lplJ, lipM and lipL, respectively. We show that LplJ encodes the sole lipoyl ligase of this bacterium. Physiological and biochemical characterization of a ΔlipM strain showed that LipM is absolutely required for the endogenous lipoylation of all lipoate-dependent proteins, confirming its role as the B. subtilis octanoyltransferase. However, we also report that in contrast to E. coli, B. subtilis requires a third protein for lipoic acid assembly, LipL. B. subtilis ΔlipL strains are unable to synthesize lipoic acid despite the presence of LipM and the sulfur insertion enzyme, LipA, which should suffice for lipoic acid biosynthesis based on the E. coli model. LipM is only required for the endogenous lipoylation pathway, whereas LipL also plays a role in lipoic acid scavenging. Expression of E. coli lipB allows growth of B. subtilis ΔlipL or ΔlipM strains in the absence of supplements. In contrast, growth of an E. coli ΔlipB strain can be complemented with lipM, but not lipL. These data together with those of the companion paper (Christensen et al., 2011) provide evidence that LipM and LipL catalyze sequential reactions in a novel pathway for lipoic acid biosynthesis. PMID:21338420

  9. [Pharmacological significance of alpha lipoic acid in up to date treatment of diabetic neuropathy].


    Becić, Fahir; Kapić, Elvedina; Rakanović-Todić, Maida


    Alpha lipoic acid is important intramolecular redox system. It is coenzyme of piruvate dehydrogenase and ketoglutarate dehydrogenase. Alpha lipoic acid has enzymatic and cytoprotective effect. It has key role in citric acid cycle, as a coenzyme. Therapeutic efficacy of alpha lipoic acid in diabetic neuropathy is based on reaction with free radicals and lipophylic antioxydans properties. Clinical studies results showed efficacy and safety of alpha liponic acid application in patients with diabetic neuropathy.

  10. Nonlinear Optical Properties of Au-Nanoparticles Conjugated with Lipoic Acid in Water

    NASA Astrophysics Data System (ADS)

    Trejo-Durán, M.; Cornejo-Monroy, D.; Alvarado-Méndez, E.; Olivares-Vargas, A.; Castano, V. M.


    Gold nanoparticles were chemically conjugated with lipoic acid to control their optical properties. Z-scan and other optical techniques were used to characterize the non-linear behavior of the resulting nanostructured materials. The results show that the nonlinearity is of thermal origin, which can be controlled by the use of lipoic acid as well as other organic molecules conjugated onto metal nanoparticles. In particular, the presence of lipoic acid increases n_2 and dn/dT.

  11. Comparison of antioxidant effectiveness of lipoic acid and dihydrolipoic acid.


    Zhao, Feng; Liu, Zai-Qun


    The abilities of dihydrolipoic acid (DHLA) to scavenge peroxynitrite (ONOO(-) ), galvinoxyl radical, 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonate) cation radical (ABTS(+•) ), and 2,2'-diphenyl-1-picrylhydrazyl radical (DPPH) were higher than those of lipoic acid (LA). The effectiveness of DHLA to protect methyl linoleate against 2,2'-azobis(2-amidinopropane hydrochloride) (AAPH)-induced oxidation was about 2.2-fold higher than that of LA, and DHLA can retard the autoxidation of linoleic acid (LH) in the β-carotene-bleaching test. DHLA can also trap ∼0.6 radicals in AAPH-induced oxidation of LH. Moreover, DHLA can scavenge ∼2.0 radicals in AAPH-induced oxidation of DNA and AAPH-induced hemolysis of erythrocytes, whereas LA can scavenge ∼1.5 radicals at the same experimental conditions. DHLA can protect erythrocytes against hemin-induced hemolysis, but accelerate the degradation of DNA in the presence of Cu(2+) . Therefore, the antioxidant capacity of -SH in DHLA is higher than S-S in LA.

  12. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.


    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  13. Multisite clickable modification of proteins using lipoic acid ligase.


    Plaks, Joseph G; Falatach, Rebecca; Kastantin, Mark; Berberich, Jason A; Kaar, Joel L


    Approaches that allow bioorthogonal and, in turn, site-specific chemical modification of proteins present considerable opportunities for modulating protein activity and stability. However, the development of such approaches that enable site-selective modification of proteins at multiple positions, including internal sites within a protein, has remained elusive. To overcome this void, we have developed an enzymatic approach for multisite clickable modification based on the incorporation of azide moieties in proteins using lipoic acid ligase (LplA). The ligation of azide moieties to the model protein, green fluorescent protein (GFP), at the N-terminus and two internal sites using lipoic acid ligase was shown to proceed efficiently with near-complete conversion. Modification of the ligated azide groups with poly(ethylene glycol) (PEG), α-d-mannopyranoside, and palmitic acid resulted in highly homogeneous populations of protein-polymer, protein-sugar, and protein-fatty acid conjugates. The homogeneity of the conjugates was confirmed by mass spectrometry (MALDI-TOF) and SDS-PAGE electrophoresis. In the case of PEG attachment, which involved the use of strain-promoted azide-alkyne click chemistry, the conjugation reaction resulted in highly homogeneous PEG-GFP conjugates in less than 30 min. As further demonstration of the utility of this approach, ligated GFP was also covalently immobilized on alkyne-terminated self-assembled monolayers. These results underscore the potential of this approach for, among other applications, site-specific multipoint protein PEGylation, glycosylation, fatty acid modification, and protein immobilization.

  14. Long-term physical and oxidative stability of liposomes containing glycerides of lipoic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The acyl glycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Accelerated storage testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phosp...

  15. Effects of two antioxidants; α-lipoic acid and fisetin against diabetic cataract in mice.


    Kan, Emrah; Kiliçkan, Elif; Ayar, Ahmet; Çolak, Ramis


    The purpose of this study was to determine whether α-lipoic acid and fisetin have protective effects against cataract in a streptozotocin-induced experimental cataract model. Twenty-eight male BALB/C mice were made diabetic by the intraperitoneal administration of streptozotocin (200 mg/kg). Three weeks after induction of diabetes, mice were divided randomly into 4 groups in which each group contained 7 mice; fisetin-treated group (group 1), α-lipoic acid-treated group (group 2), fisetin placebo group (group 3), α-lipoic acid placebo group (group 4). Fisetin and α-lipoic acid were administered intraperitoneally weekly for 5 weeks. Cataract development was assessed at the end of 8 weeks by slit lamp examination, and cataract formation was graded using a scale. All groups developed at least grade 1 cataract formation. In the fisetin-treated group, the cataract stages were significantly lower than in the placebo group (p = 0.02). In the α-lipoic acid-treated group, the cataract stages were lower than in the placebo group but it did not reach to a significant value. Both fisetin and α-lipoic acid had a protective effect on cataract development in a streptozotocin-induced experimental cataract model. The protective effect of fisetin appears as though more effective than α-lipoic acid.

  16. Alpha-lipoic acid prevents mitochondrial damage and neurotoxicity in experimental chemotherapy neuropathy.


    Melli, Giorgia; Taiana, Michela; Camozzi, Francesca; Triolo, Daniela; Podini, Paola; Quattrini, Angelo; Taroni, Franco; Lauria, Giuseppe


    The study investigates if alpha-lipoic acid is neuroprotective against chemotherapy induced neurotoxicity, if mitochondrial damage plays a critical role in toxic neurodegenerative cascade, and if neuroprotective effects of alpha-lipoic acid depend on mitochondria protection. We used an in vitro model of chemotherapy induced peripheral neuropathy that closely mimic the in vivo condition by exposing primary cultures of dorsal root ganglion (DRG) sensory neurons to paclitaxel and cisplatin, two widely used and highly effective chemotherapeutic drugs. This approach allowed investigating the efficacy of alpha-lipoic acid in preventing axonal damage and apoptosis and the function and ultrastructural morphology of mitochondria after exposure to toxic agents and alpha-lipoic acid. Our results demonstrate that both cisplatin and paclitaxel cause early mitochondrial impairment with loss of membrane potential and induction of autophagic vacuoles in neurons. Alpha-lipoic acid exerts neuroprotective effects against chemotherapy induced neurotoxicity in sensory neurons: it rescues the mitochondrial toxicity and induces the expression of frataxin, an essential mitochondrial protein with anti-oxidant and chaperone properties. In conclusion mitochondrial toxicity is an early common event both in paclitaxel and cisplatin induced neurotoxicity. Alpha-lipoic acid protects sensory neurons through its anti-oxidant and mitochondrial regulatory functions, possibly inducing the expression of frataxin. These findings suggest that alpha-lipoic acid might reduce the risk of developing peripheral nerve toxicity in patients undergoing chemotherapy and encourage further confirmatory clinical trials.

  17. Neuroprotective role of lipoic acid against acute toxicity of N-acetylaspartic acid.


    Pederzolli, Carolina Didonet; Rosa, Andrea Pereira; de Oliveira, Amanda Szekir; Coelho, Juliana G; Becker, Débora da Luz; Dalazen, Giovana Reche; Moraes, Tarsila Barros; Dutra-Filho, Carlos S


    N-Acetylaspartic acid (NAA) accumulates in Canavan disease, a severe inherited neurometabolic disorder clinically characterized by mental retardation, hypotonia, macrocephaly, and seizures. The mechanisms of brain damage in this disease remain poorly understood. Recent studies developed by our research group showed that NAA induces oxidative stress in vitro and in vivo in cerebral cortex of rats. Lipoic acid is considered as an efficient antioxidant which can easily cross the blood-brain barrier. Considering the absence of specific treatment to Canavan disease, this study evaluates the possible prevention of the oxidative stress promoted by NAA in vivo by the antioxidant lipoic acid to preliminarily evaluate lipoic acid efficacy against pro-oxidative effects of NAA. Fourteen-day-old Wistar rats received an acute administration of 0.6 mmol NAA/g body weight with or without lipoic acid (40 mg/kg body weight). Catalase (CAT), glutathione peroxidase (GPx), and glucose 6-phosphate dehydrogenase activities, hydrogen peroxide content, thiobarbituric acid-reactive substances (TBA-RS), spontaneous chemiluminescence, protein carbonyl content, total antioxidant potential, and DNA-protein cross-links were assayed in the cerebral cortex of rats. CAT, GPx activities, and total antioxidant potential were significantly reduced, while hydrogen peroxide content, TBA-RS, spontaneous chemiluminescence, and protein carbonyl content were significantly enhanced by acute administration of NAA. Those effects were all prevented by lipoic acid pretreatment. Our results clearly show that lipoic acid may protect against the oxidative stress promoted by NAA. This could represent a new therapeutic approach to the patients affected by Canavan disease.

  18. Pharmacokinetic study of lipoic acid in multiple sclerosis: comparing mice and human pharmacokinetic parameters.


    Yadav, Vijayshree; Marracci, Gail H; Munar, Myrna Y; Cherala, Ganesh; Stuber, Lauren E; Alvarez, Lilia; Shinto, Lynne; Koop, Dennis R; Bourdette, Dennis N


    Lipoic acid is a natural antioxidant available as an oral supplement from a number of different manufacturers. Lipoic acid administered subcutaneously is an effective therapy for murine experimental autoimmune encephalomyelitis, a model of multiple sclerosis. The aim of this study was to compare serum lipoic acid levels with oral dosing in patients with multiple sclerosis with serum levels in mice receiving subcutaneous doses of lipoic acid. We performed serum pharmacokinetic studies in patients with multiple sclerosis after a single oral dose of 1200 mg lipoic acid. Patients received one of the three different racemic formulations randomly: tablet (Formulation A) and capsules (Formulations B and C). Mice pharmacokinetic studies were performed with three different subcutaneous doses (20, 50 and 100 mg/kg racemic lipoic acid). The pharmacokinetic parameters included Maximum Serum Concentrations (C(max) in microg/ml) and area under the curve (0-infinity) (AUC ( 0-infinity) in microg*min/ml). We found mean C(max) and AUC (0-infinity) in patients with multiple sclerosis as follows: group A (N = 7) 3.8 +/- 2.6 and 443.1 +/- 283.9; group B (N = 8) 9.9 +/- 4.5 and 745.2 +/- 308.7 and group C (N = 8) 10.3 +/- 3.8 and 848.8 +/- 360.5, respectively. Mean C(max) and AUC (0-infinity) in the mice were: 100 mg/kg lipoic acid: 30.9 +/- 2.9 and 998 +/- 245; 50 mg/kg lipoic acid: 7.6 +/- 1.4 and 223 +/- 20; 20 mg/kg lipoic acid: 2.7 +/- 0.7 and 119 +/- 33. We conclude that patients taking 1200 mg of lipoic acid from two of the three oral formulations achieved serum C(max) and AUC levels comparable to that observed in mice receiving 50 mg/kg subcutaneous dose of lipoic acid, which is a highly therapeutic dose in experimental autoimmune encephalomyelitis. A dose of 1200 mg oral lipoic acid can achieve therapeutic serum levels in patients with multiple sclerosis.

  19. Repurposing lipoic acid changes electron flow in two important metabolic pathways of Escherichia coli.


    Feeney, Morgan Anne; Veeravalli, Karthik; Boyd, Dana; Gon, Stéphanie; Faulkner, Melinda Jo; Georgiou, George; Beckwith, Jonathan


    In bacteria, cysteines of cytoplasmic proteins, including the essential enzyme ribonucleotide reductase (RNR), are maintained in the reduced state by the thioredoxin and glutathione/glutaredoxin pathways. An Escherichia coli mutant lacking both glutathione reductase and thioredoxin reductase cannot grow because RNR is disulfide bonded and nonfunctional. Here we report that suppressor mutations in the lpdA gene, which encodes the oxidative enzyme lipoamide dehydrogenase required for tricarboxylic acid (TCA) cycle functioning, restore growth to this redox-defective mutant. The suppressor mutations reduce LpdA activity, causing the accumulation of dihydrolipoamide, the reduced protein-bound form of lipoic acid. Dihydrolipoamide can then provide electrons for the reactivation of RNR through reduction of glutaredoxins. Dihydrolipoamide is oxidized in the process, restoring function to the TCA cycle. Thus, two electron transfer pathways are rewired to meet both oxidative and reductive needs of the cell: dihydrolipoamide functionally replaces glutathione, and the glutaredoxins replace LpdA. Both lipoic acid and glutaredoxins act in the reverse manner from their normal cellular functions. Bioinformatic analysis suggests that such activities may also function in other bacteria.

  20. Overproduction of α-Lipoic Acid by Gene Manipulated Escherichia coli

    PubMed Central

    Sun, Yirong; Zhang, Wenbin; Ma, Jincheng; Pang, Hongshen; Wang, Haihong


    Alpha-lipoic acid (LA) is an important enzyme cofactor widely used by organisms and is also a natural antioxidant for the treatment of pathologies driven by low levels of endogenous antioxidants. In order to establish a safer and more efficient process for LA production, we developed a new biological method for LA synthesis based on the emerging knowledge of lipoic acid biosynthesis. We first cloned the lipD gene, which encodes the lipoyl domain of the E2 subunit of pyruvate dehydrogenase, allowing high levels of LipD production. Plasmids containing genes for the biosynthesis of LA were subsequently constructed utilizing various vectors and promotors to produce high levels of LA. These plasmids were transformed into the Escherichia coli strain BL21. Octanoic acid (OA) was used as the substrate for LA synthesis. One transformant, YS61, which carried lipD, lplA, and lipA, produced LA at levels over 200-fold greater than the wild-type strain, showing that LA could be produced efficiently in E. coli using genetic engineering methods. PMID:28068366

  1. Molecular mechanisms of lipoic acid modulation of T-type calcium channels in pain pathway

    PubMed Central

    Lee, Woo Yong; Orestes, Peihan; Latham, Janelle; Naik, Ajit K.; Nelson, Michael T.; Vitko, Iuliia; Perez-Reyes, Edward; Jevtovic-Todorovic, Vesna; Todorovic, Slobodan M.


    α-Lipoic acid (1,2-dithiolane-3-pentanoic acid; lipoic acid) is an endogenous compound used to treat pain disorders in humans, but its mechanisms of analgesic action are not well understood. Here we show that lipoic acid selectively inhibited native CaV3.2 T-type calcium currents (T-currents) and diminished T-channel-dependent cellular excitability in acutely isolated rat sensory neurons. Lipoic acid locally injected into peripheral receptive fields of pain-sensing sensory neurons (nociceptors) in vivo decreased sensitivity to noxious thermal and mechanical stimuli in wild-type but not CaV3.2 knockout mice. Ensuing molecular studies demonstrated that lipoic acid inhibited recombinant CaV3.2 channels heterologously expressed in human embryonic kidney 293 cells by oxidating specific thiol residues on the cytoplasmic face of the channel. This study provides the first mechanistic demonstration of a nociceptive ion channel modulation that may contribute to the documented analgesic properties of lipoic acid in vivo. PMID:19641113

  2. Yeast display evolution of a kinetically efficient 13-amino acid substrate for lipoic acid ligase

    PubMed Central

    Puthenveetil, Sujiet; Liu, Daniel S.; White, Katharine A.; Thompson, Samuel; Ting, Alice Y.


    E. coli lipoic acid ligase (LplA) catalyzes ATP-dependent covalent ligation of lipoic acid onto specific lysine sidechains of three acceptor proteins involved in oxidative metabolism. Our lab has shown that LplA and engineered mutants can ligate useful small-molecule probes such as alkyl azides (Nat. Biotechnol. 2007, 25, 1483–1487) and photocrosslinkers (Angew. Chem Int. Ed Engl. 2008, 47, 7018–7021) in place of lipoic acid, facilitating imaging and proteomic studies. Both to further our understanding of lipoic acid metabolism, and to improve LplA’s utility as a biotechnological platform, we have engineered a novel 13-amino acid peptide substrate for LplA. LplA’s natural protein substrates have a conserved β-hairpin structure, a conformation that is difficult to recapitulate in a peptide, and thus we performed in vitro evolution to engineer the LplA peptide substrate, called “LplA Acceptor Peptide” (LAP). A ~107 library of LAP variants was displayed on the surface of yeast cells, labeled by LplA with either lipoic acid or bromoalkanoic acid, and the most efficiently labeled LAP clones were isolated by fluorescence activated cell sorting. Four rounds of evolution followed by additional rational mutagenesis produced a “LAP2” sequence with a kcat/Km of 0.99 μM−1min−1, >70-fold better than our previous rationally-designed 22-amino acid LAP1 sequence (Nat. Biotechnol. 2007, 25, 1483–1487), and only 8-fold worse than the kcat/Km values of natural lipoate and biotin acceptor proteins. The kinetic improvement over LAP1 allowed us to rapidly label cell surface peptide-fused receptors with quantum dots. PMID:19863063

  3. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis


    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

  4. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid.


    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna


    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1-10 μmol L(-1). Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5-50 μmol L(-1). Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value.

  5. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid

    PubMed Central

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna


    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1–10 μmol L−1. Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5–50 μmol L−1. Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  6. Synthesis of new lipoic acid conjugates and evaluation of their free radical scavenging and neuroprotective activities.


    Bolognesi, Maria Laura; Bergamini, Christian; Fato, Romana; Oiry, Joël; Vasseur, Jean-Jacques; Smietana, Michael


    A series of new lipoic acid derivatives were designed and synthesized as multitarget ligands against Alzheimer's disease. In particular, analogues combining both lipoic acid and cysteine core structures were synthesized. The antioxidant properties of these compounds were evaluated by 1,1-diphenyl-2-picrylhydrazyl (DPPH), 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS(•+) ) radical cation scavenging assays and ferrous ion chelation. The antioxidant potential of the synthesized compounds was also evaluated in a cellular context and compared to α-lipoic acid and its reduced form, dihydrolipoic acid. The antioxidant effects observed for these compounds in vitro confirmed the importance of free thiol functions for effective antioxidant capacities. However, these promising in vitro results were not mirrored by the antioxidant activity in T67 cell line. This suggests that multiple factors are at stake and warrant further investigations.

  7. A Study of the Antioxidant Effect of Alpha Lipoic Acids on Sperm Quality

    PubMed Central

    Ibrahim, Siti Fatimah; Osman, Khairul; Das, Srijit; Othman, Abas Mazni; Majid, Norzaiti Abdul; Rahman, Mohd Padzil Abdul


    OBJECTIVE Assisted reproductive techniques are useful in helping infertile couples achieve successful conception. Initial studies have shown that sperm cryopreservation, one step in assisted reproduction, causes a dramatic reduction in sperm quality. This has been attributed to, among other things, free radical activities. The aim of the present study was to minimize this oxidative attack by adding an antioxidant into the sperm microenvironment. Alpha lipoic acids were selected for this purpose for their efficient free radical scavenging properties and solubility in lipid and aqueous phases. METHODS For this investigation, semen from six Boer bucks was pooled. Seminal analysis of the baseline prior to incubation of samples with different concentrations of Alpha lipoic acids (0.00625, 0.0125, 0.025, 0.05, 0.1 mmol/ml) was performed, and post-seminal analysis was conducted after a one-hour incubation. The comet assay was used to observe the effect of Alpha lipoic acids on sperm DNA integrity. Statistical analysis using an unpaired t-test with a significance level of p<0.05 was then performed. RESULTS Our results indicate that the sperm motility rate was improved after incubation with Alpha lipoic acids at a concentration of 0.02 mmol/ml. This concentration was also capable of reducing DNA damage. CONCLUSION In conclusion, Alpha lipoic acids renders cryoprotection to sperm, thereby improving sperm quality. PMID:18719769

  8. α-lipoic acid can improve endothelial dysfunction in subjects with impaired fasting glucose.


    Xiang, Guangda; Pu, Jinhui; Yue, Ling; Hou, Jie; Sun, Huiling


    Several studies showed that impairment of endothelium-dependent arterial dilation (EDAD) exists in subjects with impaired fasting glucose (IFG). The crucial mechanism of this endothelial dysfunction remains unclear. We hypothesized that oxidative stress may be partially responsible for the impairment in EDAD in subjects with IFG. Thus, the present study was designed to assess whether the antioxidant α-lipoic acid can improve endothelial dysfunction in subjects with IFG. Sixty subjects with newly diagnosed IFG and 32 healthy individuals with normal glucose tolerance were enrolled. Subjects were randomized into 2 groups: untreated experimental group (n = 30) and α-lipoic acid treatment group (n = 30, α-lipoic acid 600 mg via intravenous infusion once a day for 3 weeks). We measured EDAD at baseline and after 3 weeks of intervention. At baseline, EDADs in α-lipoic acid and untreated experimental groups were 4.03% and 4.14%, respectively, which were significantly lower than that in controls (5.72%) (P < .001). After 3 weeks of intervention, there was a remarkable increase in EDAD (reaching 5.10%; ΔEDAD, 26.5%) (P < .01) and a significant decrease in plasma thiobarbituric acid reactive substances (TBARS) (29.1%) (P < .05) in IFG subjects treated with α-lipoic acid. Endothelium-dependent arterial dilation and TBARS remained unchanged before and after intervention in the untreated experimental group. The absolute changes in EDAD showed a significant negative correlation with the changes in TBARS (r = -0.444, P = .014). Our data showed that IFG subjects have impaired endothelial function and that antioxidant α-lipoic acid can improve endothelial function through a decrease of oxygen-derived free radicals.

  9. [α-Lipoic acid as the main pharmacological drug for in- and outpatient treatment of diabetic polyneuropathy].


    Strokov, I A; Phokina, A S


    α-Lipoic acid, or thioctic acid, (ALA) is the most applicable pharmacological drug for treatment of diabetic polyneuropathy. The article explores the results of experimental studies on the α-lipoic acid effect on mechanisms of peripheral nerves affection in hyperglycemia as well as the data of numerous randomized controlled trials and meta-analyses on studying ALA efficacy in symptomatic diabetic polyneuropathy. It has been shown that amelioration of patients with diabetic polyneuropathy is observed both for ALA infusions and tableted form of the drug. The authors conclude that α-lipoic acid is a drug for treatment of pathogenetic development mechanisms of diabetic polyneuropathy with the best proven efficacy.

  10. Radiation-induced cognitive dysfunction and cerebellar oxidative stress in mice: protective effect of alpha-lipoic acid.


    Manda, Kailash; Ueno, Megumi; Moritake, Takashi; Anzai, Kazunori


    Reactive oxygen species are implicated in neurodegeneration and cognitive disorders due to higher vulnerability of neuronal tissues. The cerebellum is recently reported to be involved in cognitive function. Therefore, present study aimed at investigating the role alpha-lipoic acid against radiation-induced oxidative stress and antioxidant status in cerebellum and its correlation with cognitive dysfunction. We observed spontaneous motor activities and spatial memory task of mice using pyroelectric infrared sensor and programmed video tracking system, respectively. Whole body X-irradiation (6 Gy) of mice substantially impaired the reference memory and motor activities of mice. However, acute intraperitoneal treatment of mice with alpha-lipoic acid prior to irradiation significantly attenuated such cognitive dysfunction. Alpha-lipoic acid pretreatment exerted a very high magnitude of protection against radiation-induced augmentation of protein carbonyls and thiobarbituric acid reactive substance (TBARS) in mice cerebellum. Further, radiation-induced deficit of total, nonprotein and protein-bound sulfhydryl (T-SH, NP-SH, PB-SH) contents of cerebellum and plasma ferric reducing power (FRAP) was also inhibited by alpha-lipoic acid pre-treatment. Moreover, alpha-lipoic acid treated mice showed an intact cytoarchitecture of cerebellum, higher counts of intact Purkinje cells and granular cells in comparison to untreated irradiated mice. Results clearly indicate that alpha-lipoic acid is potent neuroprotective antioxidant.

  11. Lipoic Acid Gold Nanoparticles Functionalized with Organic Compounds as Bioactive Materials

    PubMed Central

    Turcu, Ioana; Zarafu, Irina; Popa, Marcela; Chifiriuc, Mariana Carmen; Bleotu, Coralia; Culita, Daniela; Ghica, Corneliu; Ionita, Petre


    Water soluble gold nanoparticles protected by lipoic acid were obtained and further functionalized by standard coupling reaction with 1-naphtylamine, 4-aminoantipyrine, and 4′-aminobenzo-15-crown-5 ether. Derivatives of lipoic acid with 1-naphtylamine, 4-aminoantipyrine, and 4′-aminobenzo-15-crown-5 ether were also obtained and characterized. All these were tested for their antimicrobial activity, as well as for their influence on mammalian cell viability and cellular cycle. In all cases a decreased antimicrobial activity of the obtained bioactive nanoparticles was observed as compared with the organic compounds, proving that a possible inactivation of the bioactive groups could occur during functionalization. However, both the gold nanoparticles as well as the functionalized bioactive nanosystems proved to be biocompatible at concentrations lower than 50 µg/mL, as revealed by the cellular viability and cell cycle assay, demonstrating their potential for the development of novel antimicrobial agents. PMID:28336877

  12. Lipoic acid inhibits caspase-dependent and -independent cell death pathways and is neuroprotective against hippocampal damage after pilocarpine-induced seizures.


    dos Santos, Pauline Sousa; Feitosa, Chistiane Mendes; Saldanha, Gláucio Barros; Tomé, Adriana da Rocha; Feng, Dejiang; de Freitas, Rivelilson Mendes


    Alpha-lipoic acid has some neuroprotective properties, but this action has not been investigated in models of epilepsy. The aim of the present study was to investigate the protective efficacy of α-lipoic acid (lipoic acid) against pilocarpine-induced cell death through the caspase-dependent or -independent mitochondrial apoptotic pathways. Wistar rats were injected intraperitoneally with 0.9% saline (control group), pilocarpine (400 mg/kg, pilocarpine group) alone, or α-lipoic acid (20 mg/kg) in association with pilocarpine (400 mg/kg) 30 min before administration of α-lipoic acid. After the treatments all groups were observed for 24 h. Cell death was reduced in lipoic acid-treated rats. Cytosolic translocation of cytochrome c and subsequent activation of caspase-3 were reduced by lipoic acid treatment. AIF nuclear translocation and subsequent large-scale DNA fragmentation were also decreased in lipoic acid-treated rats. Our study suggests that lipoic acid inhibits both caspase-dependent and -independent apoptotic pathways and may be neuroprotective against hippocampal damage during pilocarpine-induced seizures.

  13. Oxidative modification of lipoic acid by HNE in Alzheimer disease brain.


    Hardas, Sarita S; Sultana, Rukhsana; Clark, Amy M; Beckett, Tina L; Szweda, Luke I; Murphy, M Paul; Butterfield, D Allan


    Alzheimer disease (AD) is an age-related neurodegenerative disease characterized by the presence of three pathological hallmarks: synapse loss, extracellular senile plaques (SP) and intracellular neurofibrillary tangles (NFTs). The major component of SP is amyloid β-peptide (Aβ), which has been shown to induce oxidative stress. The AD brain shows increased levels of lipid peroxidation products, including 4-hydroxy-2-nonenal (HNE). HNE can react covalently with Cys, His, or Lys residues on proteins, altering structure and function of the latter. In the present study we measured the levels of the HNE-modified lipoic acid in brain of subjects with AD and age-matched controls. Lipoic acid is a key co-factor for a number of proteins including pyruvate dehydrogenase and α-ketoglutarate dehydrogenase, key complexes for cellular energetics. We observed a significant decrease in the levels of HNE-lipoic acid in the AD brain compared to that of age-matched controls. To investigate this phenomenon further, the levels and activity of lipoamide dehydrogenase (LADH) were measured in AD and control brains. Additionally, LADH activities were measured after in-vitro HNE-treatment to mice brains. Both LADH levels and activities were found to be significantly reduced in AD brain compared to age-matched control. HNE-treatment also reduced the LADH activity in mice brain. These data are consistent with a two-hit hypothesis of AD: oxidative stress leads to lipid peroxidation that, in turn, causes oxidative dysfunction of key energy-related complexes in mitochondria, triggering neurodegeneration. This study is consonant with the notion that lipoic acid supplementation could be a potential treatment for the observed loss of cellular energetics in AD and potentiate the antioxidant defense system to prevent or delay the oxidative stress in and progression of this devastating dementing disorder.

  14. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha-lipoic acid (ALA) is known as a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar sperm and the antioxidant effect of ALA on boar sperm during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0, and 10.0, mg/m...

  15. Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2’-bipyridyl, lipoic, kojic and picolinic acids

    PubMed Central

    Çevik, Kübra; Ulusoy, Seyhan


    Objective(s): The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. Materials and Methods: The inhibitory activity of 2,2’-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. Results: The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. Conclusion: It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation. PMID:26557964

  16. Adverse effects of high doses of intravenous alpha lipoic Acid on liver mitochondria.


    Vigil, Michael; Berkson, Burton M; Garcia, Ana Patricia


    Alpha lipoic acid (ALA, thioctic acid), among other actions, is an essential coenzyme in the conversion of pyruvate to acetyl co-enzyme A. Therefore, it is necessary for the production of energy for aerobic organisms. Scientists have found that it can be used medically to help regenerate liver tissue, reverse the complications of diabetes mellitus, slow or stop the growth of cancer cells, and chelate heavy metals, among other actions. In this article, the authors describe the cellular mitochondrial damage from excessively high doses of this beneficial agent.

  17. Possible role of alpha-lipoic acid in the treatment of peripheral nerve injuries

    PubMed Central


    Recent findings on the antioxidant effects of pretreatment with α-lipoic acid (α-LA) on the crush injury of rat sciatic nerve confirm the possible usefulness of α-LA administration in humans with peripheral nerve injuries. We discussed this issue in relation with our recent results in which the combined employment of α-LA and γ-linolenic acid with a rehabilitation program for six weeks reduced sensory symptoms and neuropathic pain in patients with compressive radiculopathy syndrome from disc-nerve root conflict in comparison with patients submitted to rehabilitation program alone for six weeks. PMID:20807428

  18. [Alpha-lipoic acid triggers elimination of cells with abnormal nuclei in human carcinoma epidermoid cell line].


    Kisurina-Evgen'eva, O P; Onishchenko, G E


    The skin is usually exposed to adverse environmental conditions that may cause pathological cell proliferation and cellular transformations leading to the formation of malignant cells. Antioxidants may affect these processes and induce the elimination of transformed cell. The purpose of this work was to investigate the effect of alfa-lipoic acid on human carcinoma epidermoid cell line A431. Our results showed that alfa-lipoic acid induced inhibition of cell proliferation or stimulated apoptotic cell death. Cells with abnormal nuclei were eliminated by apoptosis. Electron microscopy showed that survived cells had typical for control cells shape and organization of the nuclei, organization of the cytoplasm and organelles. Thus, alfa-lipoic acid not only triggered apoptosis of carcinoma cells, but it may also activate the mechanism of elimination of cells with abnormal chromosome number.


    PubMed Central

    Cichewicz, Allie; Pacleb, Chelsea; Connors, Ashley; Hass, Martha A.; Lopes, Luciana B.


    Objectives To assess whether the composition and charge of microemulsions affect their ability to simultaneously deliver α-tocopherol and lipoic acid into viable skin layers. Methods α-tocopherol and lipoic acid were added (1.1 and 0.5% w/w, respectively) to decylglucoside-based microemulsions containing mono-dicaprylin. Microemulsions containing surfactant:oil:water (w/w/w) at 60:30:10 (ME-O) and 46:23:31 (ME-W), as well as a cationic form of ME-W containing 1% phytosphingosine (ME-Wphy) were characterized, and their ability to disrupt the skin barrier and deliver the antioxidants in vitro in the skin was evaluated. Antioxidant activity in ME-Wphy-treated skin was assessed using the thiobarbituric acid-reactive substances (TBARS) assay. Key findings internal phase diameters of microemulsions ranged between 47.0–53.2 nm; phytosphingosine addition and pH adjustment to 5.0 increased zeta potential from −4.3 to +29.1 mV. ME-O displayed w/o structure, whereas ME-W and ME-Wphy were consistent with o/w. Microemulsions affected skin electrical resistance and transepidermal water loss, but did not affect lipoic acid penetration. α-Tocopherol delivery increased following the order ME-O

  20. Ibuprofen and lipoic acid diamides as potential codrugs with neuroprotective activity.


    Sozio, Piera; D'Aurizio, Eleonora; Iannitelli, Antonio; Cataldi, Amelia; Zara, Susi; Cantalamessa, Franco; Nasuti, Cinzia; Di Stefano, Antonio


    Current evidences support the hypothesis that non-steroidal anti-inflammatory drugs (NSAIDs) and antioxidant therapy might protect against the development of Alzheimer's disease (AD). In the present work, our attention was focused on ibuprofen (IBU) used in clinical trails to prevent Alzheimer's disease, and (R)-alpha-lipoic acid (LA) considered as a potential neuroprotective agent in AD therapy. In particular, we investigated a series of lipophilic molecular combinations obtained by joining (R)-alpha-lipoic acid and ibuprofen via an amide bond. These new entities might allow targeted delivery of the parent drugs to neurons, where cellular oxidative stress and inflammation seem related to Alzheimer's disease. Our study included the synthesis of conjugates 1-3 and the evaluation of their physicochemical and in-vitro antioxidant properties. The new compounds are extremely stable in aqueous buffer solutions (pH = 1.3 and 7.4), and in rat and human plasma they showed a slow bioconversion to ibuprofen and (R)-alpha-lipoic acid. Codrugs 1-3 displayed in vitro free radical scavenging activity and were hydrolyzed more rapidly in brain tissue than in rat serum indicating that these new entities might allow targeted delivery of the parent drugs to neurons. The immunohistochemical analysis of Abeta (1-40) protein showed that Abeta-injected cerebral cortices treated with ibuprofen or compound 1 showed few plaques within capillary vessels and, in particular, Abeta (1-40) protein was less expressed in codrug-1-treated than in ibuprofen-treated cerebral cortex.

  1. Effect of α-lipoic acid and exercise training on cardiovascular disease risk in obesity with impaired glucose tolerance.


    McNeilly, Andrea M; Davison, Gareth W; Murphy, Marie H; Nadeem, Nida; Trinick, Tom; Duly, Ellie; Novials, Anna; McEneny, Jane


    Obese subjects with impaired glucose tolerance (IGT) are more susceptible than healthy individuals to oxidative stress and cardiovascular disease. This randomised controlled investigation was designed to test the hypothesis that α-lipoic acid supplementation and exercise training may elicit favourable clinical changes in obese subjects with IGT. All data were collected from 24 obese (BMI ≥ 30 kg/m2) IGT patients. Following participant randomisation into two groups, fasting venous blood samples were obtained at baseline, and before and following intervention. The first group consisted of 12 participants who completed a 12 week control phase followed by 12 weeks of chronic exercise at 65% HRmax for 30 minutes a day, 5 days per week, while ingesting 1 gram per day of α-lipoic acid for 12 weeks. The second group consisted of 12 participants who completed the same 12 week control phase, but this was followed by 12 weeks of 1 gram per day of α-lipoic acid supplementation only (no exercise). The main findings show a comparatively greater rate of low density lipoprotein (LDL) oxidation in the group consisting of α-lipoic acid only (p < 0.05 vs. pre intervention), although total oxidant status was lower post intervention (p < 0.05 vs. baseline) in this group. However, exercise and α-lipoic acid in combination attenuates LDL oxidation. Furthermore, in the α-lipoic acid supplement plus exercise training group, total antioxidant capacity was significantly increased (p < 0.05 vs. baseline and pre intervention). Body fat percentage and waist and hip circumference decreased following exercise training (p < 0.05 vs. post intervention). There were no selective treatment differences for a range of other clinical outcomes including glycaemic regulation (p > 0.05). These findings report that α-lipoic acid ingestion may increase the atherogenicity of LDL when ingested in isolation of exercise, suggesting that in IGT the use of this antioxidant treatment does not ameliorate

  2. α-Lipoic acid treatment prevents cystine urolithiasis in a mouse model of cystinuria.


    Zee, Tiffany; Bose, Neelanjan; Zee, Jarcy; Beck, Jennifer N; Yang, See; Parihar, Jaspreet; Yang, Min; Damodar, Sruthi; Hall, David; O'Leary, Monique N; Ramanathan, Arvind; Gerona, Roy R; Killilea, David W; Chi, Thomas; Tischfield, Jay; Sahota, Amrik; Kahn, Arnold; Stoller, Marshall L; Kapahi, Pankaj


    Cystinuria is an incompletely dominant disorder characterized by defective urinary cystine reabsorption that results in the formation of cystine-based urinary stones. Current treatment options are limited in their effectiveness at preventing stone recurrence and are often poorly tolerated. We report that the nutritional supplement α-lipoic acid inhibits cystine stone formation in the Slc3a1(-/-) mouse model of cystinuria by increasing the solubility of urinary cystine. These findings identify a novel therapeutic strategy for the clinical treatment of cystinuria.

  3. UPEI-300, a conjugate of lipoic acid and edaravone, mediates neuroprotection in ischemia/reperfusion.


    Connell, Barry J; Saleh, Monique C; Kucukkaya, Inan; Abd-El-Aziz, Alaa S; Khan, Bobby V; Saleh, Tarek M


    Edaravone, an electron spin trapper with radical scavenging activity, has been shown to be effective in reducing infarct volume in humans following ischemic stroke. However, concerns of edaravone-induced renal toxicity have limited its clinical adoption. Previous work has demonstrated that edaravone produced significant neuroprotection when injected prior to a period of ischemia and/or reperfusion. The current investigation was designed to determine if a newly synthesized co-drug consisting of lipoic acid and edaravone, named UPEI-300, could produce neuroprotection in in vitro and/or an in vivo rodent model of stroke. UPEI-300 produced dose-dependent neuroprotection in vitro and was subsequently tested in vivo. Male rats were anaesthetized and the middle cerebral artery was occluded for 30 min followed by 5.5 h of reperfusion (ischemia/reperfusion; I/R). Pre-administration of UPEI-300 dose-dependently decreased infarct volume. Significant neuroprotection was also observed when UPEI-300 (1.0 mg/kg) was injected during the 30 min period of ischemia as well as up to 60 min following the start of reperfusion. These results indicate that a co-drug consisting of edaravone and lipoic acid is a potent neuroprotectant, and clinically, the use of such a novel co-drug following an ischemic stroke might maintain neuroprotection while potentially decreasing edaravone associated renal toxicity.

  4. α-Lipoic acid protects against cholecystokinin-induced acute pancreatitis in rats

    PubMed Central

    Park, Sung-Joo; Seo, Sang-Wan; Choi, Ok-Sun; Park, Cheung-Seog


    AIM: α-Lipoic acid (ALA) has been used as an antioxidant. The aim of this study was to investigate the effect of α-lipoic acid on cholecystokinin (CCK)-octapeptide induced acute pancreatitis in rats. METHODS: ALA at 1 mg/kg was intra-peritoneally injected, followed by 75 μg/kg CCK-octapeptide injected thrice subcutaneously after 1, 3, and 5 h. This whole procedure was repeated for 5 d. We checked the pancreatic weight/body weight ratio, the secretion of pro-inflammatory cytokines and the levels of lipase, amylase of serum. Repeated CCK octapeptide treatment resulted in typical laboratory and morphological changes of experimentally induced pancreatitis. RESULTS: ALA significantly decreased the pancreatic weight/body weight ratio and serum amylase and lipase in CCK octapeptide-induced acute pancreatitis. However, the secretion of IL-1β, IL-6, and TNF-α were comparable in CCK octapeptide-induced acute pancreatitis. CONCLUSION: ALA may have a protective effect against CCK octapeptide-induced acute pancreatitis. PMID:16097064

  5. Homology modeling of Homo sapiens Lipoic acid Synthase: substrate docking and insights on its binding mode.


    Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay


    Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X - ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS - SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein.

  6. Alpha lipoic acid efficacy in burning mouth syndrome. A controlled clinical trial

    PubMed Central

    Palacios-Sánchez, Begoña; Cerero-Lapiedra, Rocío; Llamas-Martínez, Silvia; Esparza-Gómez, Germán


    Background A double-blind placebo-controlled trial was conducted in order to evaluate the efficacy of alpha lipoic acid (ALA) and determine the statistical significance of the outcome variables. Burning mouth syndrome (BMS) is defined as an oral burning sensation in the absence of clinical signs which could justify the syndrome. Recent studies suggest the existence of neurological factors as a possible cause of the disease. Material and Methods 60 patients with BMS, in two groups: case group with 600 mg/day and placebo as control group; with follow up of 2 months. Results 64% of ALA patients reported some level of improvement, with a level of maintenance of 68.75% one month after treatment. 27.6% of the placebo group also demonstrated some reduction in BMS symptoms. Conclusions Long-term evolution and the intensity of symptoms are variables that reduce the probability of improvement with ALA treatment. Key words: Burning mouth syndrome, neuropathy, alpha lipoic acid. PMID:26034927

  7. Alteration of fatty acid profile and nucleotide-related substances in post-mortem breast meat of α-lipoic acid-fed broiler chickens.


    Hamano, Y


    The present study was conducted to determine the effects of α-lipoic acid supplementation on post-mortem changes in the fatty acid profile and concentrations of nucleotide-related substances, especially those of a taste-active compound, inosine 5'-monophosphate, in chicken meat. Mixed-sex broiler chicks aged 14 d were divided into three groups of 16 birds each and were fed on diets supplemented with α-lipoic acid at levels of 0, 100 or 200 mg/kg for 4 weeks. Blood and breast muscle samples were taken at 42 d of age under the fed condition and then after fasting for 18 h. The breast muscle obtained from fasted chickens was subsequently refrigerated at 2°C for one and 3 d. α-Lipoic acid supplementation did not affect any plasma metabolite concentration independently of feeding condition, while a slight increase in plasma glucose concentration was shown with both administration levels of α-lipoic acid. In early post-mortem breast muscle under the fed condition, α-lipoic acid had no effect on concentrations of fatty acids or nucleotides of ATP, ADP, and AMP. In post-mortem breast tissues obtained from fasted chickens, total fatty acid concentrations were markedly increased by α-lipoic acid feeding at 200 mg/kg irrespective of length of refrigeration. This effect was dependent on stearic acid, oleic acid, linoleic acid and linolenic acid. However, among fatty acids, the only predominantly increased unsaturated fatty acid was oleic acid. Dietary supplementation with α-lipoic acid at 200 mg/kg increased the inosine 5'-monophosphate concentration in breast meat and, in contrast, reduced the subsequent catabolites, inosine and xanthine, regardless of the length of refrigeration. Therefore, the present study suggests that α-lipoic acid administration altered the fatty acid profile and improved meat quality by increasing taste-active substances in the post-mortem meat obtained from fasted chickens.

  8. Vitamin A palmitate and α-lipoic acid stability in o/w emulsions for cosmetic application.


    Moyano, M A; Segall, A


    Skin becomes thin, dry, pale, and finely wrinkled with age. Retinoids are a large class of compounds that are important in modern therapy for dermatological treatment of wrinkled skin. Of the retinoids, retinol and vitamin A palmitate are thought to induce thickening of the epidermis and to be effective for treatment of skin diseases. Accordingly, α-lipoic acid or the reduced form, dihydrolipoate, are potent scavengers of hydroxyl radicals, superoxide radicals, peroxyl radicals, singlet oxygen, and nitric oxide with anti-inflammatory properties (1). Cosmetic ingredient stability prediction relies on kinetic quantitative chemical analysis of active components at different temperatures. Vitamin A palmitate and α-lipoic acid, are known to be unstable to light or heat (2). The aims of this study were to evaluate the stability of α-lipoic acid and vitamin A palmitate in the presence of vitamin E (acetate) and other antioxidants in lipophilic/hydrophilic medium (O/W emulsions) at pH 3.0, 5.0, and 7.0. The formulations that were investigated contained 0.12% (w/w) vitamin A palmitate, 0.4% (w/w) vitamin E acetate, and 0.5 % α-lipoic acid (formulation A), supplemented with ascorbyl palmitate, magnesium ascorbyl phosphate, and vitamin C (formulation B) or with butylhydroxytoluene (BHT, formulation C) or ascorbyl palmitate (formulation D). The chemical analyses of α-lipoic acid and vitamin A palmitate were carried out by HPLC. Formulations C and D at pH 7.0 were selected as the most stable for these components. The purpose of this paper is the selection of the most stable formulations for their application in in vivo studies.

  9. Dispersive liquid-liquid microextraction combined with microwave-assisted derivatization for determining lipoic acid and its metabolites in human urine.


    Tsai, Chia-Ju; Chen, Yen-Ling; Feng, Chia-Hsien


    This study explored dispersive liquid-liquid microextraction for extraction and concentration of lipoic acid in human urine. To improve the detection of lipoic acid by both capillary liquid chromatography (CapLC) with UV detection and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS), microwave-assisted derivatization with 4-bromomethyl-6,7-dimethoxycoumarin was performed to render lipoic acid chromophores for UV detection and also high ionization efficiency in MALDI. All parameters that affected lipoic acid extraction and derivatization from urine were investigated and optimized. In the analyses of human urine samples, the two methods had a linear range of 0.1-20 μM with a correlation coefficient of 0.999. The detection limits of CapLC-UV and MALDI-TOF MS were 0.03 and 0.02 μM (S/N ≧ 3), respectively. The major metabolites of lipoic acid, including 6,8-bismethylthio-octanoic acid, 4,6-bismethylthio-hexanoic acid, and 2,4-bismethylthio-butanoic acid were also extracted by dispersive liquid-liquid microextraction and detected by MALDI-TOF MS. The minor metabolites (undetectable by MALDI-TOF MS), bisnorlipoic acid and tetranorlipoic acid were also extracted by dispersive liquid-liquid microextraction and identified with an LTQ Orbitrap mass spectrometer. After dispersive liquid-liquid microextraction and microwave-assisted derivatization, all lipoic acid derivatizations and metabolites were structurally confirmed by LTQ Orbitrap.

  10. {alpha}-Lipoic acid exhibits anti-amyloidogenicity for {beta}-amyloid fibrils in vitro

    SciTech Connect

    Ono, Kenjiro; Hirohata, Mie; Yamada, Masahito . E-mail:


    Inhibition of the formation of {beta}-amyloid fibrils (fA{beta}), as well as the destabilization of preformed fA{beta} in the CNS would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of {alpha}-lipoic acid (LA) and the metabolic product of LA, dihydrolipoic acid (DHLA), on the formation, extension, and destabilization of fA{beta} at pH 7.5 at 37 {sup o}C in vitro. LA and DHLA dose-dependently inhibited fA{beta} formation from amyloid {beta}-protein, as well as their extension. Moreover, they destabilized preformed fA{beta}s. LA and DHLA could be key molecules for the development of therapeutics for AD.

  11. Ginger and alpha lipoic acid ameliorate age-related ultrastructural changes in rat liver.


    Mahmoud, Y I; Hegazy, H G


    Because of the important role that oxidative stress is thought to play in the aging process, antioxidants could be candidates for preventing its related pathologies. We investigated the ameliorative effects of two antioxidant supplements, ginger and alpha lipoic acid (ALA), on hepatic ultrastructural alterations in old rats. Livers of young (4 months) and old (24 months) Wistar rats were studied using transmission electron microscopy. Livers of old rats showed sinusoidal collapse and congestion, endothelial thickening and defenestration, and inconsistent perisinusoidal extracellular matrix deposition. Aged hepatocytes were characterized by hypertrophy, cytoplasmic vacuolization and a significant increase in the volume densities of the nuclei, mitochondria and dense bodies. Lipofuscin accumulation and decreased microvilli in bile canaliculi and space of Disse also were observed. The adverse alterations were ameliorated significantly by both ginger and ALA supplementation; ALA was more effective than ginger. Ginger and ALA appear to be promising anti-aging agents based on their amelioration of ultrastructural alterations in livers of old rats.

  12. Synthesis of lipoic acid-peptide conjugates and their effect on collagen and melanogenesis.


    Lu, Chichong; Kim, Bo Mi; Lee, Duckhee; Lee, Min Hee; Kim, Jin Hwa; Pyo, Hyeong-Bae; Chai, Kyu Yun


    We report new examples of lipoic acid (LA)-peptide conjugates, their potential as codrugs having anti-melanogenic and anti-aging properties was evaluated. These multifunctional molecules were prepared by linking lipophilic moiety (LA) to the pentapeptide KTTKS. The inhibitory effect of LA-peptide conjugates on melanin synthesis and tyrosinase activity is stronger than that of LA or the pentapeptide alone. Importantly, the conjugates display no cytotoxicity at a high concentration. LA-KTTKS and LA-PEG-KTTKS also inhibit UV-induced matrix metalloproteinase-1 expression up to 49.5% and 69.5% at 0.5 mM, respectively. LA-peptide conjugates stimulate collagen biosynthesis in fibroblasts more efficiently than their parent molecules do. These data suggest that LA-peptide conjugates may have cosmeceutical application as anti-melanogenic and anti-aging agents.

  13. Alpha-lipoic acid improves acute deltamethrin-induced toxicity in rats.


    Abdou, Rania H; Abdel-Daim, Mohamed M


    Alpha-lipoic acid (ALA) is a natural dithiol compound, with a free radical scavenger and biological antioxidant properties. The purpose of the current study was to investigate the protective effects of ALA on biochemical alteration and oxidative stress induced by acute deltamethrin intoxication in rats. Markers of liver and kidney injuries in serum of deltamethrin-intoxicated as well as ALA-pretreated rats were analyzed. Moreover, serum and (or) tissue lipid peroxidation, malondialdehyde and antioxidant markers, reduced glutathione, catalase, superoxide dismutase activity, and total antioxidant capacity were evaluated. The results showed that all parameters were altered in the intoxicated group, indicating hepatorenal oxidative damage of deltamethrin. Pre-treatment with ALA reversed the changes in most of the studied parameters in a dose-dependent manner. Histopathological and biochemical findings were parallel. It can be concluded that ALA may be a promising therapeutic option for prevention and (or) treatment of deltamethin toxicity.

  14. Alpha-lipoic acid treatment ameliorates metabolic parameters, blood pressure, vascular reactivity and morphology of vessels already damaged by streptozotocin-diabetes.


    Koçak, G; Aktan, F; Canbolat, O; Ozoğul, C; Elbeğ, S; Yildizoglu-Ari, N; Karasu, C


    The present study investigated the effects of alpha-lipoic acid treatment (50 mg/kg/day) on the metabolism and vascular condition already damaged by streptozotocin (STZ)-diabetes in rats. Carbohydrate and lipid metabolism, oxidative stress and antioxidant status were assessed in non-diabetic controls, 12-week untreated diabetic and 12-week treated diabetic (untreated for 6 weeks and then treated with alpha-lipoic acid for the last 6 weeks) rats. Blood pressures of rats were measured by tail-cuff method. Vascular reactivity was evaluated in isolated aortic rings. Morphology of aorta was examined by electron microscopy technique. Alpha-lipoic acid treatment effectively reversed body weight, blood glucose, plasma insulin, cholesterol, triglycerides and lipid peroxidation levels of diabetic animals. STZ-diabetes resulted in increased blood pressure, which was partially improved by alpha-lipoic acid treatment. Although the superoxide dismutase (SOD) activity in aortic homogenates was not changed by diabetes or antioxidant treatment, catalase or glutathione peroxidase (GPx) activity significantly increased in untreated diabetic rats. Alpha-lipoic acid treatment improved catalase activity in diabetic aorta. The contractile effect of phenylephrine markedly increased in diabetic rings, which was completely reversed by alpha-lipoic acid treatment. The maximum vasorelaxant response of pre-contracted aortic rings exposed to cumulatively increased concentrations of acetylcholine was unaffected by diabetes or antioxidant treatment. Sodium nitroprusside-induced endothelium-independent relaxations were similar in all experimental groups. Various alterations caused by STZ-diabetes in aorta structure were partially ameliorated by alpha-lipoic acid treatment. The potency of alpha-lipoic acid on the reversal of hypertension by affecting vascular reactivity and morphology as well as general metabolism of diabetic rats confirms the importance of hyperglycemia-induced oxidative stress in

  15. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.


    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem


    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion.

  16. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study

    PubMed Central

    Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem


    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  17. Oral co-administration of α-lipoic acid, quercetin and captopril prevents gallium arsenide toxicity in rats.


    Bhatt, Kapil; Flora, S J S


    Gallium arsenide (GaAs), an inter-metallic semiconductor, known to exhibit superior optical and electronic properties compared to silicon, promotes its use in semiconductor industries. Extensive use of GaAs will inevitably lead to an increase in the exposure of workers manufacturing these products. Antioxidants are exogenous or endogenous compounds acting in several ways, including scavenging reactive oxygen species (ROS) or their precursors, inhibiting ROS formation, and binding metal ions needed for the catalysis of ROS generation. In the present study we investigated the protective efficacy of α-lipoic acid, quercetin and captopril individually against gallium arsenide exposure. Co-administration of α-lipoic acid with GaAs was most effective in reducing GaAs induced inhibition of blood δ-aminolevulinic acid dehydratase (ALAD) activity, liver, kidney and brain reduced glutathione (GSH) level and elevation of oxidized glutathione (GSSG). Captopril, on the other hand was effective in reducing thiobarbituric acid reactive substance (TBARS) levels, while quercetin reduced ROS in liver and kidney. The results suggest comparatively better preventive efficacy of concomitant α-lipoic acid administration during Gallium arsenide exposure compared to quercetin and captopril in preventing GaAs induced oxidative stress.

  18. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    SciTech Connect

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory


    Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks.

  19. Effects of combined lipoic acid and pyridoxine on albuminuria, advanced glycation end-products, and blood pressure in diabetic nephropathy.


    Noori, Nazanin; Tabibi, Hadi; Hosseinpanah, Farhad; Hedayati, Mehdi; Nafar, Mohsen


    This study was designed to investigate the effects of combined administration of lipoic acid and pyridoxine on albuminuria, oxidative stress, blood pressure, serum advanced glycation end-products, nitric oxide (NO), and endothelin-1 in patients with diabetic nephropathy. Thirty-four patients were randomly assigned to either a supplement group or a placebo group. The patients in the supplement group received 800 mg lipoic acid and 80 mg pyridoxine daily for 12 weeks, whereas the placebo group received corresponding placebos. Urinary albumin, serum malondialdehyde (MDA), and systolic blood pressure decreased significantly in the supplement group compared to the placebo group (p < 0.05). Serum NO increased in the supplement group compared to the placebo group (p < 0.05). Serum pentosidine and carboxymethyl lysine decreased significantly in the supplement group at the end of week 12 compared to baseline (p < 0.05). No statistically significant differences were observed between the two groups in mean changes of serum endothelin-1, glucose, and diastolic blood pressure. The present study indicates that combined administration of lipoic acid and pyridoxine improves albuminuria in patients with diabetic nephropathy by reducing oxidative stress, advanced glycation end-products, and systolic blood pressure. The reduction in microalbuminuria may be of benefit in retarding the progression of diabetic nephropathy.

  20. α-Lipoic acid inhibits sevoflurane-induced neuronal apoptosis through PI3K/Akt signalling pathway.


    Ma, Rong; Wang, Xiang; Peng, Peipei; Xiong, Jingwei; Dong, Hongquan; Wang, Lixia; Ding, Zhengnian


    Sevoflurane is a widely used anaesthetic agent, including in anaesthesia of children and infants. Recent studies indicated that the general anaesthesia might cause the cell apoptosis in the brain. This issue raises the concerns about the neuronal toxicity induced by the application of anaesthetic agents, especially in the infants and young children. In this study, we used Morris water maze, western blotting and immunohistochemistry to elucidate the role of α-lipoic acid in the inhibition of neuronal apoptosis. We found that sevoflurane led to the long-term cognitive impairment in the young rats. This adverse effect may be caused by the neuronal death in the hippocampal region, mediated through PI3K/Akt signalling pathway. We also showed that α-lipoic acid offset the effect of sevoflurane on the neuronal apoptosis and cognitive dysfunction. This study elucidated the potential clinical role of α-lipoic acid, providing a promising way in the prevention and treatment of long-term cognitive impairment induced by sevoflurane general anesthesia.

  1. The effect of alpha-lipoic acid on temporary threshold shift in humans: a preliminary study.


    Quaranta, N; Dicorato, A; Matera, V; D'Elia, A; Quaranta, A


    Noise-induced hearing loss (NHIL) is a significant source of hearing loss in industrialized countries. Recent research on the cellular bases of NIHL has led to new avenues for protection through prophylactic drugs. Although in experimental animal models several compounds have shown a protective effect in NIHL, limited data are available in humans. Many authors are focusing their attention on the role of antioxidant on hearing protection. Alpha-lipoic acid (ALA), an essential cofactor in mitochondrial enzymes, is a novel biological antioxidant and a potent free radical scavenger and, in animal models, it has been shown to protect from age-induced and cisplatin-induced hearing loss. The aim of our study was to evaluate the effect of alpha-lipoic acid on temporary threshold shift measured 2 minutes after the end of exposure (TTS(2)) induced by a 3 kHz tone in young normally hearing subjects. Thirty young normal hearing volunteers served as control subjects. Individuals were randomly assigned to three groups. Group A (10 subjects) subjects were exposed to a 90 dB HL 3 kHz pure tone for 10 min. Group B (10 subjects) subjects were exposed to a 90 dB HL 3 kHz pure tone one hour after oral ingestion of 600 mg of ALA. Group C (10 subjects) were exposed to a 90 dB HL 3 kHz pure tone after 10 days of oral ingestion of 600 mg of ALA. Statistical analysis showed that prior to the exposure the hearing thresholds did not differ significantly among the three groups. TTS(2) of group C was significantly lower that TTS2 of Groups A and B at 6 kHz (p 0.03), and TEOAEs amplitude change after noise exposure was lower for group C compared to Groups A (p = 0.089) and B (p = 0.03). ALA is a powerful lipophilic antioxidant and free radical scavenger currently used in clinical practice. A single dose of 600 mg of dose ALA did not induce any protection on the TTS(2) induced by a 90 dB HL 3 kHz tone, while 10 days of therapeutic dosage assumption of ALA was associated with significant

  2. Effects of α-lipoic acid and L-carnosine supplementation on antioxidant activities and lipid profiles in rats

    PubMed Central

    Kim, Mi Young; Kim, Eun Jin; Kim, Young-Nam; Choi, Changsun


    α-Lipoic acid and L-carnosine are powerful antioxidants and are often used as a health supplement and as an ergogenic aid. The objective of this study was to investigate the effects of α-lipoic acid and/or L-carnosine supplementation on antioxidant activity in serum, skin, and liver of rats and blood lipid profiles for 6 weeks. Four treatment groups received diets containing regular rat chow diet (control, CON), 0.5% α-lipoic acid (ALA), 0.25% α-lipoic acid + 0.25% L-carnosine (ALA + LC), or 0.5% L-carnosine (LC). Superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) and lipid peroxidation products, malondialdehyde (MDA) concentrations, were analyzed in serum, skin, and liver. Blood lipid profiles were measured, including triglycerides (TG), total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), and low density lipoprotein cholesterol (LDL-C). Skin and liver SOD activities of the ALA and LC groups were higher than those of the CON group (P < 0.05), but serum SOD activity was higher only in the LC group compared to that in the CON group (P < 0.05). Additionally, only liver GSH-Px activity in the LC group was higher than that of the CON and the other groups. Serum and skin MDA levels in the ALA and LC groups were lower than those in the CON group (P < 0.05). Serum TG and TC in the ALA and ALA + LC groups were lower than those in the CON and LC groups (P < 0.05). The HDL-C level in the LC group was higher than that in any other group (P < 0.05). LDL-C level was lower in the ALA + LC and LC groups than that in the CON group (P < 0.05). Thus, α-lipoic acid and L-carnosine supplementation increased antioxidant activity, decreased lipid peroxidation in the serum, liver, and skin of rats and positively modified blood lipid profiles. PMID:22125679

  3. Alpha-lipoic acid as a dietary supplement: Molecular mechanisms and therapeutic potential

    PubMed Central

    Shay, Kate Petersen; Moreau, Régis F.; Smith, Eric J.; Smith, Anthony R.; Hagen, Tory M.


    Alpha-lipoic acid (LA) has become a common ingredient in multivitamin formulas, anti-aging supplements, and even pet food. It is well-defined as a therapy for preventing diabetic polyneuropathies, and scavenges free radicals, chelates metals, and restores intracellular glutathione levels which otherwise decline with age. How do the biochemical properties of LA relate to its biological effects? Herein, we review the molecular mechanisms of LA discovered using cell and animal models, and the effects of LA on human subjects. Though LA has long been touted as an antioxidant, it has also been shown to improve glucose and ascorbate handling, increase eNOS activity, activate Phase II detoxification via the transcription factor Nrf2, and lower expression of MMP-9 and VCAM-1 through repression of NF-kappa-B. LA and its reduced form, dihydrolipoic acid, may use their chemical properties as a redox couple to alter protein conformations by forming mixed disulfides. Beneficial effects are achieved with low micromolar levels of LA, suggesting that some of its therapeutic potential extends beyond the strict definition of an antioxidant. Current trials are investigating whether these beneficial properties of LA make it an appropriate treatment not just for diabetes, but also for the prevention of vascular disease, hypertension, and inflammation. PMID:19664690

  4. Is it time to reassess alpha lipoic acid and niacinamide therapy in schizophrenia?


    Seybolt, Sheila E J


    As sulfur containing thiols, alpha lipoic acid (ALA) and its reduced form dihydrolipoic acid (DHLA) are powerful antioxidants and free radical scavengers capable of performing many of the same functions as glutathione (GSH). ALA supplementation may help protect mitochondria from oxidative stress, a possible mechanism contributing to certain forms of brain diseases called schizophrenia. Shortly before the advent of antipsychotic medications, two small studies found ALA relieved psychiatric symptoms in schizophrenia. More recently, animal studies have shown ALA augmentation improves mitochondrial function. At pharmaceutical levels, niacinamide helps preserve mitochondrial membrane integrity and acts as an antioxidant. ALA is a precursor for lipoamide, an essential mitochondrial coenzyme and niacinamide is a component of niacinamide adenine dinucleotide (NAD). NADH, the reduced form of NAD, is involved in the reduction of ALA to DHLA within the mitochondria. This is relevant to contemporary research because DHLA increases GSH and low GSH levels contribute to mitochondrial dysfunction and oxidative stress which have been implicated in the pathophysiology of schizophrenia.

  5. Alpha-lipoic acid and alpha-lipoamide prevent oxidant-induced lysosomal rupture and apoptosis.


    Persson, H L; Svensson, A I; Brunk, U T


    Alpha-lipoic acid (LA) and its corresponding derivative, alpha-lipoamide (LM), have been described as antioxidants, but the mechanisms of their putative antioxidant effects remain largely uncharacterised. The vicinal thiols present in the reduced forms of these compounds suggest that they might possess metal chelating properties. We have shown previously that cell death caused by oxidants may be initiated by lysosomal rupture and that this latter event may involve intralysosomal iron which catalyzes Fenton-type chemistry and resultant peroxidative damage to lysosomal membranes. Here, using cultured J774 cells as a model, we show that both LA and LM stabilize lysosomes against oxidative stress, probably by chelating intralysosomal iron and, consequently, preventing intralysosomal Fenton reactions. In preventing oxidant-mediated apoptosis, LM is significantly more effective than LA, as would be expected from their differing capacities to enter cells and concentrate within the acidic lysosomal compartment. As previously reported, the powerful iron-chelator, desferrioxamine (Des) (which also locates within the lysosomal compartment), also provides protection against oxidant-mediated cell death. Interestingly, although Des enhances the partial protection afforded by LA, it confers no additional protection when added with LM. Therefore, the antioxidant actions of LA and LM may arise from intralysosomal iron chelation, with LM being more effective in this regard.

  6. Ethacrynic and alpha-lipoic acids inhibit vaccinia virus late gene expression.


    Spisakova, Martina; Cizek, Zdenek; Melkova, Zora


    Smallpox was declared eradicated in 1980. However recently, the need of agents effective against poxvirus infection has emerged again. In this paper, we report an original finding that two redox-modulating agents, the ethacrynic and alpha-lipoic acids (EA, LA), inhibit growth of vaccinia virus (VACV) in vitro. The effect of EA and LA was compared with those of beta-mercaptoethanol, DTT and ascorbic acid, but these agents increased VACV growth in HeLa G cells. The inhibitory effects of EA and LA on the growth of VACV were further confirmed in several cell lines of different embryonic origin, in epithelial cells, fibroblasts, macrophages and T-lymphocytes. Finally, we have analyzed the mechanism of action of the two agents. They both decreased expression of VACV late genes, as demonstrated by western blot analysis and activity of luciferase expressed under control of different VACV promoters. In contrast, they did not inhibit virus entry into the cell, expression of VACV early genes or VACV DNA synthesis. The results suggest new directions in development of drugs effective against poxvirus infection.

  7. Alpha-lipoic acid: molecular mechanisms and therapeutic potential in diabetes.


    Rochette, Luc; Ghibu, Steliana; Muresan, Adriana; Vergely, Catherine


    Diabetes is a chronic metabolic disease with a high prevalence worldwide. Diabetes and insulin resistance are associated with the development of cardiovascular and nervous diseases. The development of these disorders reflects complex pathological processes in which the oxidative stress caused by reactive oxygen species (ROS) and reactive nitrogen species (RNS) plays a pivotal role. It is widely accepted that diabetes impairs endothelial nitric oxide synthase (eNOS) activity and increases the production of ROS, thus resulting in diminished NO bioavailability and increased oxidative stress. Alpha-lipoic acid (LA) possesses beneficial effects both in the prevention and in the treatment of diabetes. LA is a potent antioxidant with insulin-mimetic and anti-inflammatory activity. LA in the diet is quickly absorbed, transported to the intracellular compartments, and reduced to dihydrolipoic acid (DHLA) under the action of enzymes. LA, which plays an essential role in mitochondrial bioenergetic reactions, has drawn considerable attention as an antioxidant for use in managing diabetic complications such as retinopathy, neuropathy and other vascular diseases.

  8. Alpha-lipoic acid potently inhibits peroxynitrite-mediated DNA strand breakage and hydroxyl radical formation: implications for the neuroprotective effects of alpha-lipoic acid.


    Jia, Zhenquan; Zhu, Hong; Vitto, Michael J; Misra, Bhaba R; Li, Yunbo; Misra, Hara P


    Alpha-lipoic acid (LA) has recently been reported to afford protection against neurodegenerative disorders in humans and experimental animals. However, the mechanisms underlying LA-mediated neuroprotection remain an enigma. Because peroxynitrite has been extensively implicated in the pathogenesis of various forms of neurodegenerative disorders, this study was undertaken to investigate the effects of LA in peroxynitrite-induced DNA strand breaks, a critical event leading to peroxynitrite-elicited cytotoxicity. Incubation of phi X-174 plasmid DNA with the 3-morpholinosydnonimine (SIN-1), a peroxynitrite generator, led to the formation of both single- and double-stranded DNA breaks in a concentration- and time-dependent fashion. The presence of LA at 100-1,600 microM was found to significantly inhibit SIN-1-induced DNA strand breaks in a concentration-dependent manner. The consumption of oxygen induced by 250 microM SIN-1 was found to be decreased in the presence of high concentrations of LA (400-1,600 microM), indicating that LA at these concentrations may affect the generation of peroxynitrite from auto-oxidation of SIN-1. It is observed that incubation of the plasmid DNA with authentic peroxynitrite resulted in a significant formation of DNA strand breaks, which could also be dramatically inhibited by the presence of LA (100-1,600 microM). EPR spectroscopy in combination with spin-trapping experiments, using 5,5-dimethylpyrroline-N-oxide (DMPO) as spin trap, resulted in the formation of DMPO-hydroxyl radical adduct (DMPO-OH) from authentic peroxynitrite and LA at 50-1,600 microM inhibited the adduct signal. Taken together, these studies demonstrate for the first time that LA can potently inhibit peroxynitrite-mediated DNA strand breakage and hydroxyl radical formation. In view of the critical involvement of peroxynitrite in the pathogenesis of various neurodegenerative diseases, the inhibition of peroxynitrite-mediated DNA damage by LA may be responsible, at least

  9. Effects of dietary supplementation with EPA and/or α-lipoic acid on adipose tissue transcriptomic profile of healthy overweight/obese women following a hypocaloric diet.


    Huerta, Ana E; Prieto-Hontoria, Pedro L; Fernández-Galilea, Marta; Escoté, Xavier; Martínez, J Alfredo; Moreno-Aliaga, María J


    In obesity, the increment of adiposity levels disrupts the whole body homeostasis, promoting an over production of oxidants and inflammatory mediators. The current study aimed to characterize the transcriptomic changes promoted by supplementation with eicosapentaenoic acid (EPA, 1.3 g/day), α-lipoic acid (0.3 g/day), or both (EPA + α-lipoic acid, 1.3 g/day + 0.3 g/day) in subcutaneous abdominal adipose tissue from overweight/obese healthy women, who followed a hypocaloric diet (30% of total energy expenditure) during ten weeks, by using a microarray approach. At the end of the intervention, a total of 33,297 genes were analyzed using Affymetrix GeneChip arrays. EPA promoted changes in extracellular matrix remodeling gene expression, besides a rise of genes associated with either chemotaxis or wound repair. α-Lipoic acid decreased expression of genes related with cell adhesion and inflammation. Furthermore, α-lipoic acid, especially in combination with EPA, upregulated the expression of genes associated with lipid catabolism while downregulated genes involved in lipids storage. Together, all these data suggest that some of the metabolic effects of EPA and α-lipoic acid could be related to their regulatory actions on adipose tissue metabolism. © 2016 BioFactors, 43(1):117-131, 2017.

  10. Adding a combination of hydroxycitrate and lipoic acid (METABLOC™) to chemotherapy improves effectiveness against tumor development: experimental results and case report.


    Guais, Adeline; Baronzio, GianFranco; Sanders, Edward; Campion, Frédéric; Mainini, Carlo; Fiorentini, Giammaria; Montagnani, Francesco; Behzadi, Mahsa; Schwartz, Laurent; Abolhassani, Mohammad


    Altered metabolism of cancer first highlighted by Otto Warburg has a long history. Although ignored for a considerable amount of time, it is now receiving substantial attention. We recently published results obtained with a combination of two drugs, lipoic acid and hydroxycitrate, targeting metabolic enzymes particularly affected in cancer: ATP citrate lyase and pyruvate dehydrogenase kinase. This treatment was as efficient as chemotherapy in the three mouse cancer models that were tested. In this work, we asked if our drug combination could be used in conjunction with standard cytotoxic chemotherapy, in particular cisplatin, to improve basic protocol efficacy. A combination of lipoic acid and hydroxycitrate was administered to mice implanted with syngeneic cancer cells, LL/2 lung carcinoma and MBT-2 bladder carcinoma, concommitantly with classical chemotherapy (cisplatin or methotrexate). We demonstrate that the triple combination lipoic acid + hydroxycitrate + cisplatin or methotrexate is more efficient than cisplatin or methotrexate used individually or the combination of lipoic acid and hydroxycitrate administered alone. Of particular note are the results obtained in the treatment of an 80 year-old female who presented with ductal adenocarcinoma of the pancreas accompanied by liver metastases. A treatment course using gemcitabine plus α-lipoic acid and hydroxycitrate gave highly promising results. The in vivo data, coupled with the case study results, suggest a possible advantage in using a treatment targeted at cancer metabolism in association with classical chemotherapy.

  11. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    PubMed Central

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen


    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  12. Effects of lipoic acid on growth and biochemical responses of common carp fed with carbohydrate diets.


    Santos, R A; Caldas, S; Primel, E G; Tesser, M B; Monserrat, J M


    Lipoic acid (LA) is an antioxidant that also favors glucose uptake in mammals. Until now, there are no studies evaluating the potential effect of this molecule on glycemic control in fish. It was evaluated LA effects on glucose uptake in common carp Cyprinus carpio fed with carbohydrate diets from two carbohydrate sources: glucose (GLU) and starch (STA), and supplemented or not with LA, being the diets: +GLU/-LA (GLU); +GLU/+LA (GLU + LA); +STA/-LA (STA); and +STA/+LA (STA + LA). Carp juveniles (6.5 ± 0.1 g) were fed with each diet ad libitum 4 times a day, during 68 days. Muscle glycogen concentration was higher (p < 0.05) in GLU and GLU + LA than in STA and STA + LA groups. On fish fed with starch, muscle cholesterol and triglyceride concentrations were higher (p < 0.05) in fish fed diets supplemented with LA. Muscle protein levels were higher in fish fed with LA, independent of the diet carbohydrate source. Lipid peroxidation was significantly reduced (p < 0.05) in fish muscle on fish fed the STA + LA diets when compared with the STA diet. Our findings indicate that LA modulates lipid, proteins and carbohydrate metabolism together with the well-known antioxidant effect. Also, LA showed to enhance starch utilization taking into account muscle cholesterol and triglyceride levels.

  13. Effect of α-Lipoic Acid on Platelet Reactivity in Type 1 Diabetic Patients

    PubMed Central

    Mollo, Roberto; Zaccardi, Francesco; Scalone, Giancarla; Scavone, Giuseppe; Rizzo, Paola; Navarese, Eliano Pio; Manto, Andrea; Pitocco, Dario; Lanza, Gaetano Antonio; Ghirlanda, Giovanni; Crea, Filippo


    OBJECTIVE Type 1 diabetes is associated with increased platelet reactivity. We investigated whether α-lipoic acid (ALA) has any effect on platelet reactivity in these patients. RESEARCH DESIGN AND METHODS We randomly assigned 51 type 1 diabetic patients to ALA (600 mg once daily) or placebo for 5 weeks. Platelet reactivity was evaluated by the PFA-100 method and by measuring CD41 and CD62 platelet expression. C-reactive protein (CRP) and 8-iso-prostaglandin F2α serum levels also were measured. RESULTS Baseline variables were similar in the two groups. After treatment, closure time was longer (P = 0.006) and CD62P platelet expression was lower, both before (P = 0.002) and after (P = 0.009) ADP stimulation in the ALA group compared with the placebo group. CRP and 8-iso-prostaglandin F2α levels showed no differences between the two groups. CONCLUSIONS Our data show that ALA reduces measures of platelet reactivity ex vivo in type 1 diabetic patients, independently of antioxidant or anti-inflammatory effects. PMID:22228743

  14. Lipoic acid suppresses compound 48/80-induced anaphylaxis-like reaction

    PubMed Central

    Choi, Yun Ho; Chai, Ok Hee; Han, Eui-Hyeog; Choi, Su-Young; Kim, Hyoung Tae


    Alpha-lipoic acid (LA), a naturally occurring dithiol compound, is an essential cofactor in metabolic reactions involved in energy utilization. LA improves glycemic control, reduces diabetic polyneuropathies, atherosclerosis, and allergic inflammation. The effects of LA on mast cell-mediated anaphylactic reactions, however, are unknown. LA dose-dependently inhibited systemic and passive cutaneous anaphylaxis-like reactions in mice induced by compound 48/80, a condensation product of N-methyl-p-methoxyphenethylamine and formaldehyde. Pretreatment with LA, prior to induction of the systemic anaphylaxis-like reaction with compound 48/80, reduced plasma histamine levels in a dose-dependent manner. In our in vitro study, LA decreased histamine release from rat peritoneal mast cells (RPMCs) triggered by compound 48/80. Moreover, an increase in calcium uptake activated by compound 48/80 was inhibited by LA. LA also significantly elevated intracellular cyclic adenosine-3',5' monophosphate (cAMP) levels in RPMCs. This inhibition of mediator release from RPMCs may be due to inhibition of calcium uptake and augmentation of intracellular cAMP levels. Based on these results, we suggest that LA may be a potential remedy for allergy-related diseases. PMID:21267406

  15. α-lipoic acid reduces hypertension and increases baroreflex sensitivity in renovascular hypertensive rats.


    Queiroz, Thyago M; Guimarães, Drielle D; Mendes-Junior, Leônidas G; Braga, Valdir A


    Renovascular hypertension has robust effects on control of blood pressure, including an impairment in baroreflex mechanisms, which involves oxidative stress. Although α-lipoic acid (LA) has been described as a potent antioxidant, its effect on renovascular hypertension and baroreflex sensitivity (BRS) has not been investigated. In the present study we analyzed the effects caused by chronic treatment with LA on blood pressure, heart rate and baroreflex sensitivity (sympathetic and parasympathetic components) in renovascular hypertensive rats. Male Wistar rats underwent 2-Kidney-1-Clip (2K1C) or sham surgery and were maintained untouched for four weeks to develop hypertension. Four weeks post-surgery, rats were treated with LA (60 mg/kg) or saline for 14 days orally. On the 15th day mean arterial pressure (MAP) and heart rate (HR) were recorded. In addition, baroreflex sensitivity test using phenylephrine (8 µg/kg, i.v.) and sodium nitroprusside (25 µg/kg, i.v.) was performed. Chronic treatment with LA decreased blood pressure in hypertensive animals; however, no significant changes in baseline HR were observed. Regarding baroreflex, LA treatment increased the sensitivity of both the sympathetic and parasympathetic components. All parameters studied were not affected by treatment with LA in normotensive animals. Our data suggest that chronic treatment with LA promotes antihypertensive effect and improves baroreflex sensitivity in rats with renovascular hypertension.

  16. The impact of alpha-lipoic acid on amikacin-induced nephrotoxicity.


    Asci, Halil; Saygin, Mustafa; Cankara, Fatma Nihan; Bayram, Dilek; Yesilot, Sukriye; Candan, Ibrahim Aydin; Ilhan, Ilter


    Amikacin (AK) is an antibacterial drug, but it has remarkable nephrotoxic and ototoxic side effects due to increase in reactive oxygen radicals. This study was established to determine the possible protective effects of alpha-lipoic acid (ALA), a powerful antioxidant, on AK-induced nephrotoxicity. Three different groups of rats (n = 6) were administered saline (control), AK (1.2 g/kg, intraperitoneally), ALA (100 mg/kg, p.o.) and AK combination (ALA one day before the AK for five days). Renal function, oxidative stress markers and histological changes were evaluated at the end of the experiment. Malondialdehyde was increased as an indicator of free radical formation in AK-induced group and decreased with ALA treatment. While catalase activity was increased significantly, superoxide dismutase and glutathione peroxidase activities were not statistically significant increased with ALA treatment. The result showed that AK enhanced levels of urea, creatinine and blood urea nitrogen in serum significantly. Administration of ALA reduced these levels of biochemical markers. Histopathological observations were confirmed by biochemical findings. In conclusion, ALA is suggested to be a potential candidate to ameliorate AK-induced nephrotoxicity.

  17. Protective effects of alpha lipoic acid versus N-acetylcysteine on ifosfamide-induced nephrotoxicity.


    El-Sisi, Alaa El-Din E; El-Syaad, Magda E; El-Desoky, Karima I; Moussa, Ethar A


    Ifosfamide (IFO) is a highly effective chemotherapeutic agent for treating a variety of pediatric solid tumors. However, its use is limited due to its serious side effect on kidneys. The side-chain oxidation of IFO in renal tubular cells produces a reactive toxic metabolite that is believed to be responsible for its nephrotoxic effect. Therefore, this study was carried out to investigate the possible underlying mechanisms that may be involved in IFO-induced nephrotoxicity, including free radical generation and the possible role of alpha lipoic acid (ALA) versus N-acetylcysteine (NAC) in protection against this toxicity. Male albino rats were injected intraperitoneally with saline, IFO (50 mg/kg daily for 5 days), IFO + ALA (100 mg/kg daily for 8 days) and IFO + NAC (200 mg/kg daily for 8 days). Kidney malondialdehyde, nitric oxide and glutathione contents and serum biochemical parameters and histopathological analysis were determined. Both ALA and NAC markedly reduced the severity of renal dysfunction induced by IFO. NAC was more nephroprotective than ALA. This study suggests that oxidative stress is possibly involved in the IFO-induced nephrotoxicity in rats. The study also suggests the potential therapeutic role for ALA and NAC against IFO-induced nephrotoxicity.

  18. Effect of alpha-lipoic acid on radiation-induced small intestine injury in mice

    PubMed Central

    Jeong, Bae Kwon; Song, Jin Ho; Jeong, Hojin; Choi, Hoon Sik; Jung, Jung Hwa; Hahm, Jong Ryeal; Woo, Seung Hoon; Jung, Myeong Hee; Choi, Bong-Hoi; Kim, Jin Hyun; Kang, Ki Mun


    Purpose Radiation therapy is a highly effective treatment for patients with solid tumors. However, it can cause damage and inflammation in normal tissues. Here, we investigated the effects of alpha-lipoic acid (ALA) as radioprotection agent for the small intestine in a mouse model. Materials and Methods Whole abdomen was evenly irradiated with total a dose of 15 Gy. Mice were treated with either ALA (100 mg/kg, intraperitoneal injection [i.p.]) or saline (equal volume, i.p.) the prior to radiation as 100 mg/kg/day for 3 days. Body weight, food intake, histopathology, and biochemical parameters were evaluated. Results Significant differences in body weight and food intake were observed between the radiation (RT) and ALA + RT groups. Moreover, the number of crypt cells was higher in the ALA + RT group. Inflammation was decreased and recovery time was shortened in the ALA + RT group compared with the RT group. The levels of inflammation-related factors (i.e., phosphorylated nuclear factor kappa B and matrix metalloproteinase-9) and mitogen-activated protein kinases were significantly decreased in the ALA + RT group compared with those in the RT group. Conclusions ALA treatment prior to radiation decreases the severity and duration of radiation-induced enteritis by reducing inflammation, oxidative stress, and cell death. PMID:26943777

  19. Protective effects of alpha lipoic acid on radiation-induced salivary gland injury in rats

    PubMed Central

    Kim, Jin Hyun; Kim, Kyung Mi; Jung, Myeong Hee; Jung, Jung Hwa; Kang, Ki Mun; Jeong, Bae Kwon; Kim, Jin Pyeong; Park, Jung Je; Woo, Seung Hoon


    Purpose Radiation therapy is a treatment for patients with head and neck (HN) cancer. However, radiation exposure to the HN often induces salivary gland (SG) dysfunction. We investigated the effect of α-lipoic acid (ALA) on radiation-induced SG injury in rats. Results ALA preserved acinoductal integrity and acinar cell secretary function following irradiation. These results are related to the mechanisms by which ALA inhibits oxidative stress by inhibiting gp91 mRNA and 8-OHdG expression and apoptosis of acinar cells and ductal cells by inactivating MAPKs in the early period and expression of inflammation-related factors including NF-κB, IκB-α, and TGF-β1 and fibrosis in late irradiated SG. ALA effects began in the acute phase and persisted for at least 56 days after irradiation. Materials and Methods Rats were assigned to followings: control, ALA only (100 mg/kg, i.p.), irradiated, and ALA administered 24 h and 30 min prior to irradiation. The neck area including the SG was evenly irradiated with 2 Gy per minute (total dose, 18 Gy) using a photon 6-MV linear accelerator. Rats were killed at 4, 7, 28, and 56 days after radiation. Conclusions Our results show that ALA could be used to ameliorate radiation-induced SG injury in patients with HN cancer. PMID:27072584

  20. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail:


    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  1. Beneficial effect of supplemental lipoic acid on diabetes-induced pregnancy loss in the mouse.


    Padmanabhan, Rengasamy; Mohamed, Shafiullah; Singh, Sarabjit


    Uncontrolled diabetes mellitus (DM) is an etiological factor for recurrent pregnancy loss, fetal growth disorders, and major congenital malformations in the offspring. Antioxidant therapy has been advocated to overcome the oxidant-antioxidant disequilibrium inherent in diabetes. The objective of this article was to evaluate the beneficial effects of alpha-lipoic acid (LA) on fetal outcome in a mouse model of streptozotocin (STZ)-induced DM. Timed pregnant mice were made diabetic by intraperitoneal (IP) injection of a single dose of STZ (200 mg/kg) on gestation day (GD) 2. Diabetic animals were supplemented daily with an IP injection of 15 mg/kg of LA starting on GD 4 and continued through GD 12. Fetuses were examined on GD 18 for malformations and growth restriction. Some diabetic mice injected with Evans blue were examined on GD 3.5 and GD 6.5 to evaluate frequency of implantations. STZ-treated mice had all cardinal signs of DM. LA treatment did not normalize blood glucose levels of DM mice. Rates of pregnancy in saline control, DM, and DM + LA groups were 90%, 28%, and 64%, respectively, indicating that LA promotes pregnancy in DM animals. However, postimplantation resorption showed a threefold increase in the DM + LA group. Rates of intrauterine growth restriction and major congenital malformations were also augmented thus indicating that the interaction between DM and LA has deleterious effects on postimplantation embryos.

  2. Effect of alpha lipoic acid on ifosfamide-induced central neurotoxicity in rats.


    Ozturk, Gulfer; Ginis, Zeynep; Kurt, Sefika Nur; Albayrak, Aynur; Bilen, Sule; Fadillioglu, Ersin


    Ifosfamide (IFOS) which is a cytotoxic alkylating agent may cause central nervous system toxicity. Alpha-lipoic acid (ALA) has a strong antioxidant effects. We hypothesized that ALA could attenuate on ifosfamide-induced central neurotoxicity in rats. Rats were divided into Control, IFOS, ALA and IFOS+ALA groups. The toxic effects of IFOS were analyzed by oxidative parameters and caspase 3 immunohistochemical examinations of brain tissue. The catalase activity of IFOS group significantly reduced in comparison with control groups (p < 0.05). The malondialdehyde (MDA) level and protein carbonyl (PC) content in brain tissue were significantly higher in IFOS group than in the other groups (p < 0.05). ALA treatments significantly prevented the increase in MDA level (p < 0.001) and PC content (p < 0.05) in brain tissue. IFOS group showed profound activation of caspase 3. The control, ALA and IFOS+ALA groups did not show caspase 3 activation. It was concluded that ALA treatments may have beneficial effects protecting neurons from central neurotoxicity caused by IFOS.

  3. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing.


    Shen, Tao; Jiang, Zhong-Liang; Li, Cong-Jun; Hu, Xiao-Chen; Li, Qing-Wang


    Alpha-lipoic acid (ALA) is known to be a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar spermatozoa and its antioxidant effect on boar spermatozoa during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0 or 10.0 mg/ml) of ALA were added to the extender used to freeze boar semen, and the effects on the quality and endogenous antioxidant enzyme activities of frozen-thawed spermatozoa were assessed. The results indicated that the addition of ALA to the extender resulted in a higher percentage of motile spermatozoa post-thaw (P < 0.05). The activities of superoxide dismutase, lactate dehydrogenase, glutamic-oxaloacetic transaminase and catalase improved after adding ALA to the extender (P < 0.05). Artificial insemination results showed that pregnancy rate and litter size were significantly higher at 6.0 mg/ml in the ALA group than in the control group (P < 0.05). In conclusion, ALA conferred a cryoprotective capacity to the extender used for boar semen during the process of freezing-thawing, and the optimal concentration of ALA for the frozen extender was 6.0 mg/ml.

  4. Alpha-lipoic acid protects cardiomyocytes against hypoxia/reoxygenation injury by inhibiting autophagy

    SciTech Connect

    Cao, Xueming; Chen, Aihua Yang, Pingzhen; Song, Xudong; Liu, Yingfeng; Li, Zhiliang; Wang, Xianbao; Wang, Lizi; Li, Yunpeng


    Highlights: •We observed the cell viability and death subjected to H/R in H9c2 cardiomyocytes. •We observed the degree of autophagy subjected to H/R in H9c2 cardiomyocytes. •LA inhibited the degree of autophagy in parallel to the enhanced cell survival. •LA inhibited the autophagy in parallel to the decreased total cell death. •We concluded that LA protected cardiomyocytes against H/R by inhibiting autophagy. -- Abstract: Hypoxia/reoxygenation (H/R) is an important in vitro model for exploring the molecular mechanisms and functions of autophagy during myocardial ischemia/reperfusion (I/R). Alpha-lipoic acid (LA) plays an important role in the etiology of cardiovascular disease. Autophagy is widely implicated in myocardial I/R injury. We assessed the degree of autophagy by pretreatment with LA exposed to H/R in H9c2 cell based on the expression levels of Beclin-1, LC3II/LC3I, and green fluorescent protein-labeled LC3 fusion proteins. Autophagic vacuoles were confirmed in H9c2 cells exposed to H/R using transmission electron microscopy. Our findings indicated that pretreatment with LA inhibited the degree of autophagy in parallel to the enhanced cell survival and decreased total cell death in H9c2 cells exposed to H/R. We conclude that LA protects cardiomyocytes against H/R injury by inhibiting autophagy.

  5. Enzymatic hybridization of α-lipoic acid with bioactive compounds in ionic solvents.


    Papadopoulou, Athena A; Katsoura, Maria H; Chatzikonstantinou, Alexandra; Kyriakou, Eleni; Polydera, Angeliki C; Tzakos, Andreas G; Stamatis, Haralambos


    The lipase-catalyzed molecular hybridization of α-lipoic acid (LA) with bioactive compounds pyridoxine, tyrosol and tyramine was performed in ionic solvents and deep eutectic solvents. The biocatalytic reactions were catalyzed by Candida antarctica lipase B immobilized onto various functionalized multi-walled carbon nanotubes (f-CNTs-CaLB), as well as by commercial Novozym 435. The use of f-CNTs-CaLB leads, in most cases, to higher conversion yields as compared to Novozym 435. The nature and ion composition of ionic solvents affect the performance of the biocatalytic process. The highest conversion yield was observed in (mtoa)NTf2. The high enzyme stability and the relatively low solubility of substrates in specific media account for the improved biocatalytic synthesis of molecular hybrids of LA. Principal component analysis was used to screen for potential lipoxygenase inhibitors. In vitro studies showed that the synthesized compounds exhibit up to 10-fold increased inhibitory activity on lipoxygenase mediated lipid peroxidation as compared to parent molecules.

  6. [The blood glutathione system in cerebral vascular diseases and its treatment with alpha-lipoic acid].


    Kolesnichenko, L S; Kulinskiĭ, V I; Shprakh, V V; Bardymov, V V; Verlan, N V; Gubina, L P; Pensionerova, G A; Sergeeva, M P; Stanevich, L M; Filippova, G T


    The changes of glutathione metabolism are rare in dyscirculatory encephalopathy and ischemic stroke (IS) of mild severity. The frequent and considerable changes have been revealed in IS of moderate and high severity as well as in hemorrhagic stroke. An increase of activities of glutathione peroxidase and glutathione transferase is the most typical. The increase of enzyme activity was not observed at the beginning of treatment after 3 days and in patients with severe degree of disease who died later. A standard therapy decreased the quantity and/or expression of changes of the glutathione metabolism in patients with IS of moderate and high severity while the addition of alpha-lipoic acid (alpha-LA) led to the complete normalization in IS of moderate severity and normalization of most parameters in IS of high severity. The increase of functional activity of the glutathione system at the early stage of treatment of IS and the favorable changes during the treatment, in particular after the addition of alpha-LA, were correlated with the improvement of neurological status assessed with the NIHSS. It has been confirmed that the glutathione system plays an important role in the tolerance to brain ischemia.

  7. Treatment with alpha-lipoic acid reduces asymmetric dimethylarginine in patients with type 2 diabetes mellitus.


    Mittermayer, Friedrich; Pleiner, Johannes; Francesconi, Mario; Wolzt, Michael


    Elevated asymmetric dimethylarginine (ADMA) concentrations predict cardiovascular events in patients with type 2 diabetes mellitus (T2DM). It has been shown that alpha-lipoic acid (ALA) improves endothelial function and oxidative stress in these patients. The present study investigated if ALA reduces ADMA in patients with T2DM. Plasma concentrations of ADMA, L-arginine and symmetric dimethylarginine (SDMA) were determined in a double-blind, randomized, placebo-controlled study in patients with T2DM. Intravenous ALA (n = 16) or placebo (n = 14) was administered daily for 3 weeks. ALA reduced ADMA while no change was observed with placebo (mean change -0.05 micromol/1[95% CI: -0.01; -0.09] vs. 0.01 micromol/1 [95% CI: -0.05; -0.03]; ANOVA p = 0.031). SDMA and L-arginine were not affected by ALA. In conclusion ALA treatment reduces ADMA in patients with T2DM. Long-term studies need to demonstrate if ALA may cause cardiovascular risk reduction.

  8. Tumour microenvironment-responsive lipoic acid nanoparticles for targeted delivery of docetaxel to lung cancer

    PubMed Central

    Gu, Fenfen; Hu, Chuling; Tai, Zhongguang; Yao, Chong; Tian, Jing; Zhang, Lijuan; Xia, Qingming; Gong, Chunai; Gao, Yuan; Gao, Shen


    In the present study, we developed a novel type of reduction-sensitive nanoparticles (NPs) for docetaxel (DTX) delivery based on cross-linked lipoic acid NPs (LANPs). The physicochemical properties, cellular uptake and in vitro cytotoxicity of DTX loaded LANPs (DTX-LANPs) on A549 cells were investigated. Furthermore, the in vivo distribution and in vivo efficacy of DTX-LANPs was evaluated. The results showed that DTX-LANPs had a particle size of 110 nm and a negative zeta potential of −35 mv with excellent colloidal stability. LANPs efficiently encapsulated DTX with a high drug loading of 4.51% ± 0.49% and showed remarkable reduction-sensitive drug release in vitro. Cellular uptake experiments demonstrated that LANPs significantly increased intracellular DTX uptake by about 10 fold as compared with free DTX. The cytotoxicity of DTX-LANPs showed significantly higher potency in inhibiting A549 cell growth than free DTX, while blank LANPs had a good biocompatibility. In addition, in vivo experiments demonstrated that DTX-LANPs could enhance tumour targeting and anti-tumour efficacy with low systemic toxicity. In conclusion, LANPs may prove to be a potential tumour microenvironment-responsive delivery system for cancer treatment, with the potential for commercialization due to the simple component, controllable synthesis, stability and economy. PMID:27805051

  9. Alpha-lipoic acid ameliorates the epithelial mesenchymal transition induced by unilateral ureteral obstruction in mice

    PubMed Central

    Cho, Hyun Seop; Kim, Jin Hyun; Jang, Ha Nee; Lee, Tae Won; Jung, Myeong Hee; Kim, Tae Ho; Chang, Se-Ho; Park, Dong Jun


    The epithelial-to-mesenchymal transition (EMT) is one of mechanisms that induce renal interstitial fibrosis. Understanding EMT in renal fibrosis has important therapeutic implications for patients with kidney disease. Alpha-lipoic acid (ALA) is a natural compound with antioxidant properties. Studies for ALA are performed in acute kidney injury with renal tubular apoptosis, renal inflammation, and oxidative stress. We investigated the effects of ALA on EMT-mediated renal interstitial fibrosis in mice with unilateral ureteral obstruction (UUO). UUO mice developed severe tubular atrophy and tubulointerstitial fibrosis, with a robust EMT response and ECM deposition after 7 postoperative days. In contrast, ALA-treated UUO mice showed only moderate injury and minimal fibrosis and also larger reductions in the expression of ECM proteins, inflammatory factors, and EMT markers. ALA was shown to be involved in the suppression of infiltrating macrophages associated with EMT and the progression of interstitial fibrosis. It also lessened the destruction of the tubular basement membrane, by reducing the expression of matrix metalloproteinases. This is the first study to show that ALA modulates EMT in a UUO mouse model. Our results suggest that ALA merits further exploration as a therapeutic agent in the prevention and treatment of chronic kidney disease. PMID:28378840

  10. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade.


    El-Gowelli, Hanan M; Saad, Evan I; Abdel-Galil, Abdel-Galil A; Ibrahim, Einas R


    In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associated with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients.

  11. Behavioral and Neurochemical Effects of Alpha-Lipoic Acid in the Model of Parkinson's Disease Induced by Unilateral Stereotaxic Injection of 6-Ohda in Rat

    PubMed Central

    de Araújo, Dayane Pessoa; De Sousa, Caren Nádia Soares; Araújo, Paulo Victor Pontes; Menezes, Carlos Eduardo de Souza; Sousa Rodrigues, Francisca Taciana; Escudeiro, Sarah Souza; Lima, Nicole Brito Cortez; Patrocínio, Manoel Claúdio Azevedo; Aguiar, Lissiana Magna Vasconcelos; Viana, Glauce Socorro de Barros; Vasconcelos, Silvânia Maria Mendes


    This study aimed to investigate behavioral and neurochemical effects of α-lipoic acid (100 mg/kg or 200 mg/kg) alone or associated with L-DOPA using an animal model of Parkinson's disease induced by stereotaxic injection of 6-hydroxydopamine (6-OHDA) in rat striatum. Motor behavior was assessed by monitoring body rotations induced by apomorphine, open field test and cylinder test. Oxidative stress was accessed by determination of lipid peroxidation using the TBARS method, concentration of nitrite and evaluation of catalase activity. α-Lipoic acid decreased body rotations induced by apomorphine, as well as caused an improvement in motor performance by increasing locomotor activity in the open field test and use of contralateral paw (in the opposite side of the lesion produced by 6-OHDA) at cylinder test. α-lipoic acid showed antioxidant effects, decreasing lipid peroxidation and nitrite levels and interacting with antioxidant system by decreasing of endogenous catalase activity. Therefore, α-lipoic acid prevented the damage induced by 6-OHDA or by chronic use of L-DOPA in dopaminergic neurons, suggesting that α-lipoic could be a new therapeutic target for Parkinson's disease prevention and treatment. PMID:24023579

  12. The impact of high fructose on cardiovascular system: Role of α-lipoic acid.


    Saygin, M; Asci, H; Cankara, F N; Bayram, D; Yesilot, S; Candan, I A; Alp, H H


    The aim of this study was to evaluate the role of α-lipoic acid (α-LA) on oxidative damage and inflammation that occur in endothelium of aorta and heart while constant consumption of high-fructose corn syrup (HFCS). The rats were randomly divided into three groups with each group containing eight rats. The groups include HFCS, HFCS + α-LA treatment, and control. HFCS was given to the rats at a ratio of 30% of F30 corn syrup in drinking water for 10 weeks. α-LA treatment was given to the rats at a dose of 100 mg/kg/day orally for the last 6 weeks. At the end of the experiment, the rats were killed by cervical dislocation. The blood samples were collected for biochemical studies, and the aortic and cardiac tissues were collected for evaluation of oxidant-antioxidant system, tissue bath, and pathological examination. HFCS had increased the levels of malondialdehyde, creatine kinase MB, lactate dehydrogenase, and uric acid and showed significant structural changes in the heart of the rats by histopathology. Those changes were improved by α-LA treatment as it was found in this treatment group. Immunohistochemical expressions of tumor necrosis factor α and inducible nitric oxide synthase were increased in HFCS group, and these receptor levels were decreased by α-LA treatment. All the tissue bath studies supported these findings. Chronic consumption of HFCS caused several problems like cardiac and endothelial injury of aorta by hyperuricemia and induced oxidative stress and inflammation. α-LA treatment reduced uric acid levels, oxidative stress, and corrected vascular responses. α-LA can be added to cardiac drugs due to its cardiovascular protective effects against the cardiovascular diseases.

  13. [Evaluation of the actiom of lipoic acid in ischemia and hypertension].


    Borets, V M; Kishkovich, V P; Lis, M A; Butkevich, N D; Kalkun, D P


    A total of 203 patients, 48 -- with ischemic and 155 -- with hypertensive disease in the 11A and 11B stages, were examined. The effect of lipoic acid (LA) was assessed on the ground of the dynamics in the clinical picture of the patients, some vitamins allowance figures and the activity of a number of enzymes in leucocytes, erythrocytes and in the blood serum. The LA was administered in the form of tablets, in a dose of 75 mg per day, for 10 dyas. As controls served 90 patients with ischemic and hypertensive diseases. Investigations showed the LA to have but a little influence on the clinical picture of the disease, raising somewhat the beta-lipoproteids level in patients with hypertensive and ischemic disease, irrespective of their age, and increasing the level of free fatty acids in patients over 50, forcing it down in those below 50. An age-specific effect of the LA on the blood proteinic spectrum was disclosed, viz. in patients below 55 it increased the proportion of albumins and reduced that of gamma-globulins, whereas in those aged above 55 reverse picture was in evidence. In the young LA had the tendency of bringing down the coagulating activity of the blood; whereas disaggregation of thrombocytes changed not depending upon the age, but on the form of the affection, decreasing in patients with hypertensive disease and remaining unchanged in those with ischemic heart disease. The LA helped normalize the thiamine metabolism in the organism and that of the thiamine-diphosphate containing enzymes with concurrently disturbed utilization of riboflavin in the examined patients.

  14. A Clinical Trial about a Food Supplement Containing α-Lipoic Acid on Oxidative Stress Markers in Type 2 Diabetic Patients

    PubMed Central

    Derosa, Giuseppe; D’Angelo, Angela; Romano, Davide; Maffioli, Pamela


    The aim of this study was to evaluate the effect of a food supplement containing α-lipoic acid and of a placebo on glyco-metabolic control and on oxidative stress markers in type 2 diabetics. We randomized 105 diabetics to either a supplementation containing 600 mg of α-lipoic acid, 165 mg of L-carnosin, 7.5 mg of zinc, and vitamins of group B, or a placebo, for three months. We evaluated body mass index, fasting plasma glucose (FPG), post-prandial-glucose (PPG), glycated hemoglobin (HbA1c), fasting plasma insulin (FPI), HOMA-index (HOMA-IR), lipid profile, high sensitivity C-reactive protein (Hs-CRP), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA). There was a reduction of FPG, PPG, and HbA1c with the food supplement containing α-lipoic acid compared with a baseline, and with the placebo. Concerning lipid profile, we observed a reduction of LDL-C, and Tg with the food supplement, compared with both the baseline, and the placebo. There was a reduction of Hs-CRP with the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. An increase of SOD, and GSH-Px, and a decrease of MDA were reached by the food supplement containing α-lipoic acid, both compared with the baseline and the placebo. We can conclude that the food supplement containing α-lipoic acid, L-carnosin, zinc, and vitamins of group B improved glycemic control, lipid profile, and anti-oxidative stress markers. PMID:27801825


    PubMed Central

    Bharucha, Adil E.; Choi, Kyoung Moo; Saw, Jessica; Gibbons, Simon J.; Farrugia, Gianrico; Carlson, David; Zinsmeister, Alan R


    SUMMARY Background Heme-oxygenase 1 (HO-1) degrades heme and protects against oxidative stress. In vitro and animal models suggest that HO-1 is beneficial in several diseases (e.g., post-operative ileus, gastroparesis, acute pancreatitis, and colitis). However the only drugs (i.e., hemin and heme arginate) which pharmacologically up-regulate HO-1 in humans are expensive and can only be administered intravenously. Our aims were to compare the effects of placebo, aspirin and simvastatin alone, and with α-lipoic acid, on HO-1 protein concentration and activity in humans. Methods This randomized, double-blind, placebo-controlled study compared the effects of 3 oral regimens administered for 7 days, ie, placebo; aspirin (325 mg twice daily) and simvastatin (40 mg twice daily); aspirin, simvastatin, and the sodium salt of R-α-lipoic acid (NaRLA, 600 mg three times daily) on markers of HO-1 activation (i.e., plasma HO-1 protein concentration and venous monocyte HO-1 protein activity) in 18 healthy subjects (14 females). Markers of HO-1 activation were evaluated at baseline, days 2 and 7. Key Results Baseline HO-1 protein concentrations and activity were similar amongst the three groups. Compared to placebo, aspirin and simvastatin combined, or together with NaRLA did not affect HO-1 protein concentration or activity at 2 or 7 days. HO-1 protein concentrations and activity were correlated on day 7 (r = 0.75, p = 0.0004) but not at baseline and on day 2. Conclusions At therapeutic doses, aspirin, simvastatin, and α-lipoic acid do not increase plasma HO-1 protein concentration or venous monocyte HO-1 activity in healthy humans. PMID:25093998

  16. Stability, cutaneous delivery and antioxidant potential of a lipoic acid and α-tocopherol co-drug incorporated in microemulsions

    PubMed Central

    Thomas, Siji; Vieira, Camila S.; Hass, Martha A.; Lopes, Luciana B.


    The aim of this study was to assess the skin penetration, stability and antioxidant effects of a α-tocopherol-lipoic acid co-drug. To enhance penetration, we evaluated three microemulsions varying in water content and composition of the oil phase (isopropyl myristate with either monocaprylin or oleic acid). The co-drug was incorporated at 1% (w/w). Co-drug hydrolysis in the microemulsion increased with increases in time (up to 48 h) and formulation water content (10–30%, w/w). Microemulsions increased the co-drug delivery into viable layers of porcine ear skin by 2.9–7.8–fold compared to a control formulation (20% monocaprylin in isopropyl myristate) after 24 h. Penetration enhancement was influenced by the oil phase, with the formulation containing monocaprylin displaying the most pronounced effect. Antioxidant activity, assessed in skin bioequivalents using the thiobarbituric acid-reactive substances (TBARS) assay, demonstrated that TBARS levels decreased by 39% after treatment with the co-drug-containing microemulsion compared to the unloaded formulation. In addition to the co-drug, tocopherol (8.2 ± 0.6 μg/cm2) was detected in the viable bioequivalent tissues, suggesting that the co-drug was partly hydrolyzed after 12 h. Taken together, these results support the potential of nanodispersed formulations containing a tocopherol-lipoic acid co-drug to improve skin antioxidant activity. PMID:24961388

  17. Attenuation of uremia by orally feeding alpha-lipoic acid on acetaminophen induced uremic rats.


    Pradhan, Shrabani; Mandal, Shreya; Roy, Suchismita; Mandal, Arpita; Das, Koushik; Nandi, Dilip K


    Uremia means excess nitrogenous waste products in the blood & their toxic effects. An acute acetaminophen (paracetamol, N-acetyl p-aminophenol; APAP) overdose may result into potentially fatal hepatic and renal necrosis in humans and experimental animals. The aims of this present study were to investigate the protective effect of alpha-lipoic acid (ALA) on oxidative stress & uremia on male albino rats induced by acetaminophen. The study was performed by 24 albino male Wister strain rats which were randomly divided into four groups: Group I, control - receives normal food and water, Groups II, III & IV receive acetaminophen interperitoneally at the dose of 500 mg/kg/day for 10 days, from 11th day Groups III & IV were treated with ALA at the dose of 5 mg & 10 mg/100 g/day for 15 days, respectively. After 25 days of treatment, it was observed that there was a significant increase in plasma urea, creatinine, sodium and malondialdehyde (MDA) levels (p < 0.05) but a significant decrease in super oxide dismutase (SOD) & catalase activity & potassium level in uremic group is compared with control group & there was a significant increase in SOD & catalase (p < 0.05) & a significant decrease in serum urea, creatinine & Na and MDA (p < 0.05) in Group III & Group IV is compared with Group II & significant changes were observed in high ALA dose group. In conclusion it was observed that the ALA has nephroprotective activities by biochemical observations against acetaminophen induced uremic rats.

  18. The oxidative damage and inflammation caused by pesticides are reverted by lipoic acid in rat brain.


    Astiz, Mariana; de Alaniz, María J T; Marra, Carlos Alberto


    We have previously demonstrated that the administration of low doses of dimethoate, glyphosate and zineb to rats (i.p. 1/250 LD50, three times a week for 5weeks) provokes severe oxidative stress (OS) in specific brain regions: substantia nigra, cortex and hippocampus. These effects were also observed in plasma. Lipoic acid (LA) is considered an "ideal antioxidant" due to its ability to scavenge reactive species, reset antioxidant levels and cross the blood-brain barrier. To investigate its protective effect we administered LA (i.p. 25, 50 and 100mg/kg) simultaneously with the pesticide mixture (PM) for 5weeks. After suppression of PM administration, we evaluated the restorative effect of LA for a further 5weeks. LA prevented OS and the production of nitrites+nitrates [NOx] caused by PM in a dose-dependent manner. The PM-induced decrease in reduced glutathione and α-tocopherol levels in all brain regions was completely restored by LA at both high doses. PM administration also caused an increase in prostaglandins E(2) and F(2α) in brain that was reduced by LA in a dose-dependent fashion. Taking into account the relationship between OS, inflammation and apoptosis, we measured caspase and calpain activity. Only milli- and micro-calpain isoforms were increased in the PM-treated group and LA reduced the activities to basal levels. We also demonstrated that interrupting PM administration is not enough to restore the levels of all the parameters measured and that LA is necessary to achieve basal status. In our experimental model LA displayed a protective role against pesticide-induced damage, suggesting that LA administration is a promising therapeutic strategy to cope with disorders suspected to be caused by OS generators, especially in brain.

  19. Lipoic Acid Use and Functional Outcomes after Thrombolysis in Patients with Acute Ischemic Stroke and Diabetes

    PubMed Central

    Choi, Kang-Ho; Kim, Joon-Tae; Kim, Hyung-Seok; Kim, Ja-Hae; Nam, Tai-Seung; Choi, Seong-Min; Lee, Seung-Han; Kim, Byeong-Chae; Kim, Myeong-Kyu; Cho, Ki-Hyun


    Background Alpha-lipoic acid (aLA) is a strong antioxidant commonly used for treating diabetic polyneuropathy. Previously, we demonstrated the neurorestorative effects of aLA after cerebral ischemia in rats. However, its effects on patients with stroke remain unknown. We investigated whether patients treated with aLA have better functional outcomes after acute ischemic stroke (AIS) and reperfusion therapy than patients not receiving aLA. Methods In this retrospective study of 172 prospectively registered patients with diabetes and AIS treated with tissue plasminogen activator (tPA), we investigated the relationship between aLA use and functional outcome both after 3 months and after 1 year. The functional outcomes included occurrence of hemorrhagic transformation (HT), early neurological deterioration (END), and early clinical improvement (ECI). Favorable outcomes were defined as modified Rankin Scale (mRS) scores of 0–2. Results Of the 172 patients with AIS and diabetes, 47 (27.3%) used aLA. In the entire cohort, favorable outcomes occurred at significantly higher rates both at 3 months and at 1 year in those treated with aLA. The risks for END and HT were lower and the occurrence of ECI was higher in patients treated with aLA. In multivariable analysis, aLA use was associated with favorable outcomes both at 3 months and at 1 year. Age, HT, and increased National Institutes of Health Stroke Scale scores were negative predictors of a favorable outcome. Conclusions The use of aLA in patients with AIS and diabetes who are treated with tPA is associated with favorable outcomes. These results indicate that aLA could be a useful intervention for the treatment of AIS after reperfusion therapy. PMID:27677185

  20. Alpha-lipoic acid protects against potassium cyanide-induced seizures and mortality.


    Abdel-Zaher, Ahmed O; Abdel-Hady, Randa H; Abdel Moneim, Wafaa M; Salim, Safa Y


    This study was proposed to investigate the potential protective effect of alpha-lipoic acid (α-LA) against potassium cyanide (KCN)-induced seizures and lethality in mice. The intraperitoneal ED(50) value of KCN, as measured by induction of clonic and tonic seizures was increased by pretreatment of mice with α-LA (25, 50 and 100 mg/kg) intraperitoneally in a dose-dependent manner. Similarly, the intraperitoneal LD(50) value of KCN, based on 24h mortality, was increased by pretreatment with α-LA in a dose-dependent manner. Intraperitoneal injection of the estimated ED(50) of KCN (4.8 mg/kg) into mice increased, 1h later, nitric oxide (NO) production and brain glutamate and malondialdehyde (MDA) levels. The estimated ED(50) of KCN also decreased brain intracellular reduced glutathione (GSH) level and glutathione peroxidase (GSH-Px) activity in these animals. Administration of the estimated LD(50) of KCN (6 mg/kg) produced, 24h later, similar marked biochemical alterations in surviving animals. Pretreatment of mice with α-LA inhibited; dose-dependently KCN (ED(50) and LD(50))-induced an increase in NO production and brain MDA level as well as a decrease in brain intracellular GSH level and GSH-Px activity. The elevation induced by KCN in brain glutamate level was not inhibited by α-LA. It can be concluded that the protective effect of α-LA against KCN-induced seizures and lethality may be due to inhibition of NO overproduction and maintenance of intracellular antioxidant defense mechanisms.

  1. Effect of alpha-lipoic acid on relieving ammonia stress and hepatic proteomic analyses of broilers.


    Lu, M; Bai, J; Xu, B; Sun, Q Y; Wei, F X; Tang, X F; Zhang, H F; Li, J; Wang, G L; Yin, Q Q; Li, S Y


    Ammonia in poultry houses not only affects worker health but also induces a variety of poultry diseases. Alpha-lipoic acid (LA) is an effective antioxidant that protects cells against oxidative injury during various toxic and pathological processes. This study was designed to evaluate the mitigating effects of LA supplementation on ammonia stress and hepatic proteome changes in broilers. Male broilers (22 d old) were allocated to 3 groups: (1) a control group without ammonia stress (CTRL); (2) exposure to 70 ppm ammonia (AM); and (3) exposure to 70 ppm ammonia and dietary administration of 300 mg/kg LA (AM+LA). Ammonia exposure significantly decreased broiler growth performance and plasma glutathione peroxidase activity (P < 0.05), and increased plasma malondialdehyde content and glutamic-pyruvic transaminase activity (P < 0.05). These negative effects were eliminated by LA supplementation. Comparative proteomic analyses revealed 291 differentially expressed proteins in the AM group compared to the CTRL and AM+LA groups. A total of 30 proteins were differentially expressed between the AM/CTRL and (AM+LA)/AM groups. The addition of LA restored 24 of these proteins to control levels; these proteins were mainly related to transcription regulation, detoxification, protein translation and degradation, and immune and stress responses. The differentially expressed proteins included the high mobility group box (HMGB) and glutathione S-transferase (GST), which is closely related to immune response and oxidative stress, and collagens, which are implicated in liver injury. The addition of LA to broiler diet may reduce ammonia toxicity by maintaining the antioxidant system, xenobiotic metabolism, and metabolic pathways.

  2. Interaction of α-Lipoic Acid with the Human Na+/Multivitamin Transporter (hSMVT).


    Zehnpfennig, Britta; Wiriyasermkul, Pattama; Carlson, David A; Quick, Matthias


    The human Na(+)/multivitamin transporter (hSMVT) has been suggested to transport α-lipoic acid (LA), a potent antioxidant and anti-inflammatory agent used in therapeutic applications, e.g. in the treatment of diabetic neuropathy and Alzheimer disease. However, the molecular basis of the cellular delivery of LA and in particular the stereospecificity of the transport process are not well understood. Here, we expressed recombinant hSMVT in Pichia pastoris and used affinity chromatography to purify the detergent-solubilized protein followed by reconstitution of hSMVT in lipid bilayers. Using a combined approach encompassing radiolabeled LA transport and equilibrium binding studies in conjunction with the stabilized R-(+)- and S-(-)-enantiomers and the R,S-(+/-) racemic mixture of LA or lipoamide, we identified the biologically active form of LA, R-LA, to be the physiological substrate of hSMVT. Interaction of R-LA with hSMVT is strictly dependent on Na(+). Under equilibrium conditions, hSMVT can simultaneously bind ~2 molecules of R-LA in a biphasic binding isotherm with dissociation constants (Kd) of 0.9 and 7.4 μm. Transport of R-LA in the oocyte and reconstituted system is exclusively dependent on Na(+) and exhibits an affinity of ~3 μm. Measuring transport with known amounts of protein in proteoliposomes containing hSMVT in outside-out orientation yielded a catalytic turnover number (kcat) of about 1 s(-1), a value that is well in agreement with other Na(+)-coupled transporters. Our data suggest that hSMVT-mediated transport is highly specific for R-LA at our tested concentration range, a finding with wide ramifications for the use of LA in therapeutic applications.

  3. Lipoic acid as an anti-inflammatory and neuroprotective treatment for Alzheimer's disease.


    Maczurek, Annette; Hager, Klaus; Kenklies, Marlene; Sharman, Matt; Martins, Ralph; Engel, Jürgen; Carlson, David A; Münch, Gerald


    Alzheimer's disease (AD) is a progressive neurodegenerative disorder that destroys patient memory and cognition, communication ability with the social environment and the ability to carry out daily activities. Despite extensive research into the pathogenesis of AD, a neuroprotective treatment - particularly for the early stages of disease - remains unavailable for clinical use. In this review, we advance the suggestion that lipoic acid (LA) may fulfil this therapeutic need. A naturally occurring cofactor for the mitochondrial enzymes pyruvate dehydrogenase and alpha-ketoglutarate dehydrogenase, LA has been shown to have a variety of properties which can interfere with the pathogenesis or progression of AD. For example, LA increases acetylcholine (ACh) production by activation of choline acetyltransferase and increases glucose uptake, thus supplying more acetyl-CoA for the production of ACh. LA chelates redox-active transition metals, thus inhibiting the formation of hydroxyl radicals and also scavenges reactive oxygen species (ROS), thereby increasing the levels of reduced glutathione. In addition, LA down-regulates the expression of redox-sensitive pro-inflammatory proteins including TNF and inducible nitric oxide synthase. Furthermore, LA can scavenge lipid peroxidation products such as hydroxynonenal and acrolein. In human plasma, LA exists in an equilibrium of free and plasma protein bound form. Up to 150 muM, it is bound completely, most likely binding to high affinity fatty acid sites on human serum albumin, suggesting that one large dose rather than continuous low doses (as provided by "slow release" LA) will be beneficial for delivery of LA to the brain. Evidence for a clinical benefit for LA in dementia is yet limited. There are only two published studies, in which 600 mg LA was given daily to 43 patients with AD (receiving a standard treatment with choline-esterase inhibitors) in an open-label study over an observation period of up to 48 months. Whereas

  4. The role of lipoic acid in the protection against of metallic pollutant effects in the shrimp Litopenaeus vannamei (Crustacea, Decapoda).


    Lobato, Roberta Oliveira; Nunes, Silvana Manske; Wasielesky, Wilson; Fattorini, Daniele; Regoli, Francesco; Monserrat, José Marìa; Ventura-Lima, Juliane


    The effects of cadmium (Cd) and arsenic (As), dosed alone or in combination have been poorly investigated in crustaceans. Besides, it is not known if dietary supplementation of exogenous antioxidants, like lipoic acid (LA), might prevent or even reverse toxic effects of Cd and As. The objective of the present study was to evaluate the role of lipoic acid in modulating biochemical responses after Cd and As exposures in Litopenaeus vannamei. Muscle from shrimp exposed to Cd alone or Cd+As showed a decrease in glutathione (GSH) levels, while the pre-treatment with LA reversed this situation. In this tissue, the pre-treatment with LA also induced an increase in glutathione-S-transferase (GST) activity in all groups. In hepatopancreas it was observed a marked accumulation of Cd and As, a decrease in the reactive oxygen species (ROS) concentration in response to Cd exposure alone (-LA); concomitant in the same group it was observed an increment of metallothionein-like content. As exposure induced an increase in GSH levels but LA reversed this increase. Also, LA showed to increase the GST activity in all groups treated. Besides, in this organ LA showed to augment total antioxidant competence. Obtained results indicate that LA can be used as a chemo-protectant against oxidative insults in shrimp.

  5. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury

    PubMed Central

    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue


    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries. PMID:27314327

  6. Acetyl-L-carnitine and α-lipoic acid affect rotenone-induced damage in nigral dopaminergic neurons of rat brain, implication for Parkinson's disease therapy.


    Zaitone, Sawsan A; Abo-Elmatty, Dina M; Shaalan, Aly A


    Although the mechanisms of neurodegeneration in Parkinson's disease are not fully understood, mitochondrial dysfunction, oxidative stress and environmental toxins may be involved. The current research was directed to investigate the protective role of two bioenergetic antioxidants, acetyl-L-carnitine and α-lipoic acid, in rotenone-parkinsonian rats. Ninety six male rats were divided into five groups. Group I is the vehicle-injected group, group II is the disease control group and was injected with six doses of rotenone (1.5 mg/kg/48 h, s.c.). Groups III, IV and V received rotenone in addition to acetyl-L-carnitine (100 mg/kg/day, p.o.), α-lipoic acid (50 mg/kg/day, p.o.) or their combination, respectively. Results showed that rotenone-treated rats exhibited bradykinesia and motor impairment in the open-field and square bridge tests. In addition, ATP level was decreased whereas lipid peroxides and protein carbonyls increased in the striata of rotenone-treated rats as compared to vehicle-treated rats. Treatment with acetyl-L-carnitine or α-lipoic acid improved the motor performance and reduced the level of lipid peroxides in rat brains as compared to rotenone group. Further, ATP production was enhanced along with acetyl-L-carnitine treatments (p≤0.05). Taken together, our study reinforces the view that acetyl-L-carnitine and α-lipoic acid are promising candidates for neuroprotection in Parkinson's disease.

  7. Effect of alpha lipoic acid on retinal ganglion cell survival in an optic nerve crush model

    PubMed Central

    Liu, Ruixing; Wang, Yanling; Pu, Mingliang


    Purpose This study was conducted to determine whether alpha lipoic acid (ALA) promotes the survival of retinal ganglion cells (RGCs) in a rat model of optic nerve crush (ONC) injury and to investigate the neuroprotective mechanisms of ALA in the retina in this ONC injury model. Methods Adult male Sprague-Dawley rats (180–220 g) were subjected to ONC injury surgery. ALA (63 mg/kg) was injected intravenously 1 day before or after the ONC injury. Animals were euthanized after 10 days, and the number of ganglion cells positive for RNA-binding protein with multiple splicing (Rbpms), which is an RGC marker, were counted on the whole mount retinas. In addition, immunofluorescence and immunoblotting were performed to examine the localization and levels of erythropoietin receptor (EPOR) and neurotrophin-4/5 (NT4/5) in the retinas in all experimental groups. To determine whether the EPO/EPOR signaling pathway was involved in the ALA antioxidant pathway, the rats were subjected to ruxolitinib (INCB018424, 0.25 mg/kg, bid, intraperitoneal, i.p.) treatment after the animals were injected intravenously with ALA 1 day before ONC injury. Results The average number of Rbpms-positive cells/mm2 in the control group (sham-operated group), the ONC group, the ALA-ONC group, and the ONC-ALA group retinas was 2219±28, 418±8, 848±22, and 613±18/mm2, respectively. The ALA-ONC and ONC-ALA groups showed a statistically significantly increased RGC survival rate compared to the ONC group. There were statistical differences in the RGC survival rates between the ALA-ONC (39%) and ONC-ALA groups (28%; p<0.05). Immunofluorescent labeling showed that EPOR and NT4/5 expression was significant in the retinal ganglion cell layer (GCL). At the same time, western blot analysis revealed that ALA induced upregulation of EPOR protein and NT4/5 protein expression in the retina after ONC injury. However, INCB018424 reversed the protective effects of ALA on the ONC retinas. Conclusions ALA has

  8. Alpha Lipoic Acid Attenuates Radiation-Induced Thyroid Injury in Rats

    PubMed Central

    Jung, Jung Hwa; Jung, Jaehoon; Kim, Soo Kyoung; Woo, Seung Hoon; Kang, Ki Mun; Jeong, Bae-Kwon; Jung, Myeong Hee; Kim, Jin Hyun; Hahm, Jong Ryeal


    Exposure of the thyroid to radiation during radiotherapy of the head and neck is often unavoidable. The present study aimed to investigate the protective effect of α-lipoic acid (ALA) on radiation-induced thyroid injury in rats. Rats were randomly assigned to four groups: healthy controls (CTL), irradiated (RT), received ALA before irradiation (ALA + RT), and received ALA only (ALA, 100 mg/kg, i.p.). ALA was treated at 24 h and 30 minutes prior to irradiation. The neck area including the thyroid gland was evenly irradiated with 2 Gy per minute (total dose of 18 Gy) using a photon 6-MV linear accelerator. Greater numbers of abnormal and unusually small follicles in the irradiated thyroid tissues were observed compared to the controls and the ALA group on days 4 and 7 after irradiation. However, all pathologies were decreased by ALA pretreatment. The quantity of small follicles in the irradiated rats was greater on day 7 than day 4 after irradiation. However, in the ALA-treated irradiated rats, the numbers of small and medium follicles were significantly decreased to a similar degree as in the control and ALA-only groups. The PAS-positive density of the colloid in RT group was decreased significantly compared with all other groups and reversed by ALA pretreatment. The high activity index in the irradiated rats was lowered by ALA treatment. TGF-ß1 immunoreactivity was enhanced in irradiated rats and was more severe on the day 7 after radiation exposure than on day 4. Expression of TGF-ß1 was reduced in the thyroid that had undergone ALA pretreatment. Levels of serum pro-inflammatory cytokines (TNF-α, IL-1ß and IL-6) did not differ significantly between the all groups. This study provides that pretreatment with ALA decreased the severity of radiation-induced thyroid injury by reducing inflammation and fibrotic infiltration and lowering the activity index. Thus, ALA could be used to ameliorate radiation-induced thyroid injury. PMID:25401725

  9. Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant potential and lipid stability of meat

    PubMed Central


    Background Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. Methods The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. Results The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010–11 & 2011–12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. Conclusion In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio

  10. EPA, DHA, and Lipoic Acid Differentially Modulate the n-3 Fatty Acid Biosynthetic Pathway in Atlantic Salmon Hepatocytes.


    Bou, Marta; Østbye, Tone-Kari; Berge, Gerd M; Ruyter, Bente


    The aim of the present study was to investigate how EPA, DHA, and lipoic acid (LA) influence the different metabolic steps in the n-3 fatty acid (FA) biosynthetic pathway in hepatocytes from Atlantic salmon fed four dietary levels (0, 0.5, 1.0 and 2.0%) of EPA, DHA or a 1:1 mixture of these FA. The hepatocytes were incubated with [1-(14)C] 18:3n-3 in the presence or absence of LA (0.2 mM). Increased endogenous levels of EPA and/or DHA and LA exposure both led to similar responses in cells with reduced desaturation and elongation of [1-(14)C] 18:3n-3 to 18:4n-3, 20:4n-3, and EPA, in agreement with reduced expression of the Δ6 desaturase gene involved in the first step of conversion. DHA production, on the other hand, was maintained even in groups with high endogenous levels of DHA, possibly due to a more complex regulation of this last step in the n-3 metabolic pathway. Inhibition of the Δ6 desaturase pathway led to increased direct elongation to 20:3n-3 by both DHA and LA. Possibly the route by 20:3n-3 and then Δ8 desaturation to 20:4n-3, bypassing the first Δ6 desaturase step, can partly explain the maintained or even increased levels of DHA production. LA increased DHA production in the phospholipid fraction of hepatocytes isolated from fish fed 0 and 0.5% EPA and/or DHA, indicating that LA has the potential to further increase the production of this health-beneficial FA in fish fed diets with low levels of EPA and/or DHA.

  11. Alpha-Lipoic acid increases energy expenditure by enhancing adenosine monophosphate-activated protein kinase-peroxisome proliferator-activated receptor-gamma coactivator-1alpha signaling in the skeletal muscle of aged mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle mitochondrial dysfunction is associated with aging and diabetes, which decreases respiratory capacity and increases reactive oxygen species. Lipoic acid (LA) possesses antioxidative and antidiabetic properties. Metabolic action of LA is mediated by activation of adenosine monophospha...

  12. Design, synthesis and evaluation of PEGylated lipoic acid derivatives with functionality as potent anti-melanogenic agents.


    Lu, Chichong; Kim, Bo-Mi; Chai, Kyu Yun


    The novel PEGylated lipoic acid (LA) derivatives with functionality were synthesized in satisfactory yield by simple procedures and evaluated about its anti-melanogenic activity on the B16F10 melanoma cells. Grafting a PEG moiety onto the carboxyl group of LA has reduced the cell cytotoxicity and provided the water solubility and functionality to incorporate the other bioactive moieties. We have found that derivatives showed inhibition of melanin formation by up to 36.5% at 0.1 mM, whereas LA decreased the melanin formation by 8.6%. In addition, it also inhibits at least 86.4% UV-induced MMP-1 expression at 0.1 mM which is higher than LA. These data suggest that the novel PEGylated LA derivatives with functionality may thus serve as a potentially effective anti-melanogenic and anti-aging agent.

  13. The protective effect of lipoic acid on selected cardiovascular diseases caused by age-related oxidative stress.


    Skibska, Beata; Goraca, Anna


    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system.

  14. Simultaneous determination of the endogenous free α-lipoic acid and dihydrolipoic acid in human plasma and erythrocytes by RP-HPLC coupled with electrochemical detector.


    Khan, Muhammad Imran; Iqbal, Zafar; Khan, Abad


    A highly sensitive, precise, and accurate reversed-phase high performance liquid-chromatography/electrochemical detection method for simultaneous determination of the endogenous free α-lipoic acid and dihydrolipoic acid in biological matrices is presented. The two analytes are extracted from samples with acetonitrile-10% m-phosphoric acid solution(aqueous) (50:50 v/v). To determine the total lipoic acid, samples are treated with tris(2-carboxyethyl)phosphine solution in phosphate buffer: pH 2.5 with 85% o-phosphoric acid prior to deproteination. The two analytes are separated on a C18 (150 × 4.6 mm, 5 μm) analytical column using acetonitrile-50 mM phosphate buffer: pH 2.5 with 85% o-phosphoric acid (35:65 v/v) as the isocratic mobile phase pumped at a flow rate of 2.0 ml/min at the column oven temperature of 35 °C. The column eluents are monitored at a potential of 0.9 V. These analytes are efficiently resolved in <7 min.

  15. Palladium alpha-lipoic acid complex formulation enhances activities of Krebs cycle dehydrogenases and respiratory complexes I-IV in the heart of aged rats.


    Sudheesh, N P; Ajith, T A; Janardhanan, K K; Krishnan, C V


    Age-related decline in the capacity to withstand stress, such as ischemia and reperfusion, results in congestive heart failure. Though the mechanisms underlying cardiac decay are not clear, age dependent somatic damages to mitochondrial DNA (mtDNA), loss of mitochondrial function, and a resultant increase in oxidative stress in heart muscle cells may be responsible for the increased risk for cardiovascular diseases. The effect of a safe nutritional supplement, POLY-MVA, containing the active ingredient palladium alpha-lipoic acid complex, was evaluated on the activities of the Krebs cycle enzymes such as isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, and malate dehydrogenase as well as mitochondrial complexes I, II, III, and IV in heart mitochondria of aged male albino rats of Wistar strain. Administration of 0.05 ml/kg of POLY-MVA (which is equivalent to 0.38 mg complexed alpha-lipoic acid/kg, p.o), once daily for 30 days, was significantly (p<0.05) effective to enhance the Krebs cycle dehydrogenases, and mitochondrial electron transport chain complexes. The unique electronic and redox properties of palladium alpha-lipoic acid complex appear to be a key to this physiological effectiveness. The results strongly suggest that this formulation might be effective to protect the aging associated risk of cardiovascular and neurodegenerative diseases.

  16. The use of alpha-lipoic acid (ALA), gamma linolenic acid (GLA) and rehabilitation in the treatment of back pain: effect on health-related quality of life.


    Ranieri, M; Sciuscio, M; Cortese, A M; Santamato, A; Di Teo, L; Ianieri, G; Bellomo, R G; Stasi, M; Megna, M


    The aim of this trial was to evaluate the effects of alpha-lipoic acid (ALA) and gamma-linolenic acid (GLA) and the beneficial effect of physical exercise on positive sensory symptoms and neuropathic pain in patients with compressive radiculopathy syndrome from disc-nerve root conflict. Often these painful syndromes after the acute event, tend to recurr becoming subacute or chronic syndromes that become for the period of interest disabiling is an event very important in these cases proper prevention, based on a maintenance drug therapy and the strengthening exercises of paravertebral muscles, flexibility exercises on the spine and when needed on the reduction of body weight. In this Observational Cohort, two-arm trial, 203 patients were enrolled and divided into two groups, the first, ALA and GLA group, (n = 101) received oral dose of 600 mg of alpha-lipoic acid (ALA) and 360 mg of gamma-linolenic acid (GLA) and a rehabilitation program for six weeks, the second (n = 102) treated with only rehabilitation program. Patients were recruited at the centre of Physical Medicine and Rehabilitation, they underwent a physiatric examination at the primary outcome (t0) and secondary outcomes were recorded at monitoring visits scheduled at two weeks = t1, four weeks = t2, six weeks = t3, and at the same has been administered the following scale: VAS scale, SF-36, Oswestry Low Back Pain Disability Questionnaire, Aberdeen Back Pain Scale (ABPS), Revised Leeds Disability Questionnaire (LDQ), Roland and Morris Disability Questionnaire. Significant improvements was noted in the ALA and GLA group for paresthesia, stabbing and burning pain, as showed by VAS (Visual Analogue Scale), Oswestry Low Back Pain Disability Questionnaire, Aberdeen Low Back Pain Scale; also, improvements of quality of life has been noted, in the same group, as showed by SF-36, LDQ (Revised Leeds Disability Questionnaire), Roland and Morris disability questionnaire. All these outcome measure showed statistically

  17. Prophylactic action of lipoic acid on oxidative stress and growth performance in broilers at risk of developing ascites syndrome.


    Díaz-Cruz, Antonio; Serret, Maurilio; Ramírez, Guadalupe; Avila, Ernesto; Guinzberg, Raquel; Piña, Enrique


    The objective of this study was to assess the effects of dietary supplementation with lipoic acid (LA) on broilers maintained at 2235 m above sea level with high risk to develop ascites syndrome (AS). A total of 2040 chicks were fed under commercial conditions with water and specific diets ad libitum during 7 weeks in two consecutive experiments. Mortality and indicators of performance and oxidative stress were compared weekly in broilers fed a basal diet plus 0, 10, 20, or 40 parts/10(6) LA. The effects of LA at 40 parts/10(6) were also studied during the initial 3 weeks or the last 4 weeks of the production cycle. Diets supplemented with 40 parts/10(6) of LA during 7 weeks significantly improved feed conversion, decreased general mortality and mortality attributable to AS, and lowered thiobarbituric acid reactive substances and hydroxyl radicals in liver, and increased total glutathione pool. Smaller doses or shorter periods of exposure to LA were partially effective. In conclusion, LA under our experimental conditions has a prophylactic action in broilers with high risk to develop AS due to oxygen availability limitation.

  18. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    PubMed Central

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory


    It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks. PMID:24944020

  19. Effect of γ-Cyclodextrin Inclusion Complex on the Absorption of R-α-Lipoic Acid in Rats

    PubMed Central

    Uchida, Ryota; Iwamoto, Kosuke; Nagayama, Suetada; Miyajima, Atsushi; Okamoto, Hinako; Ikuta, Naoko; Fukumi, Hiroshi; Terao, Keiji; Hirota, Takashi


    R-α-lipoic acid (RLA) is an endogenous organic acid, and works as a cofactor for mitochondrial enzymes and as a kind of antioxidant. Inclusion complexes of RLA with α-, β- or γ-cyclodextrins (CD) were prepared and orally administered as a suspension to rats. Among them, RLA/γ-CD showed the highest plasma exposure, and its area under the plasma concentration-time curve (AUC) of RLA was 2.2 times higher than that after oral administration of non-inclusion RLA. On the other hand, the AUC after oral administration of non-inclusion RLA and RLA/γ-CD to pylorus-ligated rats did not differ. However, the AUC after intraduodenal administration of RLA/γ-CD was 5.1 times higher than that of non-inclusion RLA, and was almost comparable to the AUC after intraduodenal administration of RLA-Na solution. Furthermore, the AUC after intraduodenal administration of RLA/γ-CD was not affected by biliary ligation or co-administration of an amylase inhibitor. These findings demonstrated that RLA was absorbed from the small intestine effectively when orally administered as a γ-CD inclusion complex, which could be easily dissolved in the lumen of the intestine. In conclusion, γ-CD inclusion complex is an appropriate formulation for supplying RLA as a drug or nutritional supplement with respect to absorption. PMID:25946345

  20. The protective effect of alpha lipoic acid on Schwann cells exposed to constant or intermittent high glucose.


    Sun, Lian-Qing; Chen, Ying-Ying; Wang, Xuan; Li, Xiao-Jin; Xue, Bing; Qu, Ling; Zhang, Ting-Ting; Mu, Yi-Ming; Lu, Ju-Ming


    Diabetic peripheral neuropathy (DPN) is one of the most common and costly microvascular complications of diabetes, and no effective therapy exists. Previous studies have demonstrated that oxidative stress may be the unifying factor for the damaging effect of hyperglycemia. The aim of this study was to examine the impact of treatment with Alpha lipoic acid (ALA) on the intermittent high glucose (IHG) or high glucose (HG)-induced oxidative stress-induced mitochondrial pathway activation and Schwann cells (SCs) apoptosis in vitro. Our results suggested that IHG and HG induced SCs apoptosis in both caspase-dependent and caspase-independent pathways related to oxidative stress. More importantly, the cytotoxic effect of IHG was significantly more potent than that of HG. Treatment with ALA inhibited the IHG and HG-induced oxidative stress and apoptosis in SCs. Furthermore, treatment with ALA down-regulated the Bax expression and the release of cytochrome c and AIF translocation, but up-regulated the Bcl-2 expression in SCs. Treatment with ALA attenuated the activation of caspase-3 and caspase-9 and minimized the cleavage of PARP in SCs. These findings suggest that variability in glycemic control could be more deleterious than a constant HG and ALA antagonized the IHG-induced oxidative stress, activation of mitochondrial pathway and apoptosis in SCs.

  1. Modulation of antioxidant and detoxifying capacity in fish Cyprinus carpio (Cyprinidae) after treatment with nanocapsules containing lipoic acid.


    Longaray-Garcia, Márcia; Flores, Juliana Artigas; Külkamp-Guerreiro, Irene Clemes; Guterres, Sílvia Stanisçuaski; Pereira, Talita Carneiro Brandão; Bogo, Maurício Reis; Monserrat, José Maria


    Lipoic acid (LA) is a water- and lipid-soluble molecule with capacity to pass through cell membranes and with several antioxidant properties. Previous studies have shown that polymeric nanocapsules with LA favor the protection of this antioxidant, increasing their physical and chemical stability compared to formulations containing free LA. The aim of this study was to evaluate and compare the effect of free LA and LA-nanocapsules on antioxidant enzymes, the concentration of reduced glutathione (GSH) and a by-product of lipid peroxidation (malondialdehyde), as well as the expression of gene coding for different forms of glutathione-S-transferase (GST) in model fish. For this, carp Cyprinus carpio (Cyprinidae) were exposed (i.p.) to different forms of LA (free and in nanocapsules) for different times (48h, 96h and 1week) and the brain, liver and muscle were analyzed. Results indicated that the organs respond differently depending on the time and form in which LA was delivered. After 96h and 1week, a better antioxidant response was found generally in the formulation with nanocapsules. The nanocapsule composition showed to be a factor to be considered in future studies, because in some organs and exposure times empty nanocapsules promoted an antioxidant effect and in others a pro-oxidant effect.

  2. Biochemical responses over time in common carp Cyprinus carpio (Teleostei, Cyprinidae) during fed supplementation with α-lipoic acid.


    Enamorado, Alain D; Martins, Atila C; Flores, Juliana A; Tesser, Marcelo Borges; Caldas, Sergiane S; Primel, Ednei G; Monserrat, José Maria


    The current study aimed to evaluate the influence of lipoic acid (LA) supplementation (439.84±6.71 mg LA/kg feed) on antioxidants responses throughout the time in intestine, liver and muscle of juvenile common carp Cyprinus carpio. Two experimental groups were fed during four weeks with a diet with or without LA. Glutathione-S-transferase (GST) activity, glutathione (GSH) content, antioxidant capacity against peroxyl radicals (ACAP) and lipid peroxidation (TBARS) were evaluated in these organs. Also, a technique to measure protein disulfide bonds and sulfhydryl groups was optimized for intestine samples. GST activity was significantly higher (p<0.05) in intestine after two weeks of supplementation. GSH content was also significantly higher (p<0.05) in intestine, liver and muscle of fish fed with LA after two and three weeks, respectively. Total capacity antioxidant against peroxyl radicals was significantly increased (p<0.05) in the muscle of animals fed with LA after the fourth week. Concentration of disulfide bonds was higher in the intestine of fish fed with LA but this group also showed higher concentration of sulfhydryl groups (p<0.05). It is concluded that supplementation with LA is a safe strategy to induce antioxidant responses and improves the antioxidant status in different organs of common carp. Two week of supplementation are required to induce antioxidant responses in intestine and liver and three week for muscle.

  3. Alfa-lipoic acid protects testosterone secretion pathway and sperm quality against 4-tert-octylphenol induced reproductive toxicity.


    Othman, Azza I; El-Missiry, Mohamed A; Koriem, Khaled M; El-Sayed, Aml A


    The protective effect of α-lipoic acid (LA) (50 mg/kg bw) against 4-tert-octylphenol (OP) (50 mg/kg bw) induced reproductive toxicity in male rats was studied. LA was injected 1h prior to OP administration three times a week. OP caused significant increase in oxidative stress in hypothalamus and epididymal sperm, disturbed hormonal levels in serum, decreased sperm quality, increased DNA fragmentation and loss of 35 and 95 kDa proteins in sperm, as well as elevated proliferating index in testis. LA protected against oxidative stress through promoting the levels of glutathione and glutathione-S-transferase in hypothalamus and sperm. In addition, LA prevented the decrease in testosterone, dehydroepiandrosterone sulfate, 3β-hydroxysteroid dehydrogenase, and inhibited the elevations in sex-hormone-binding globulin levels and showed normal sperm quality. LA modulated proliferation of germ cell, protected against DNA fragmentation and maintained membrane protein organization in the sperm. In conclusion, LA normalized oxidative stress and protected testosterone synthesis pathway across hypothalamus-testicular axis and sperm quality indicating its defensive influence against OP-induced oxidative reproductive dysfunction in male rats.

  4. Tolerability in the elderly population of high-dose alpha lipoic acid: a potential antioxidant therapy for the eye

    PubMed Central

    Sarezky, Daniel; Raquib, Aaishah R; Dunaief, Joshua L; Kim, Benjamin J


    Purpose Alpha lipoic acid (ALA) is an antioxidant and iron-chelating supplement that has potential benefits for geographic atrophy in dry age-related macular degeneration as well as other eye diseases. The purpose of this study was to determine the tolerability of ALA in the elderly population. Patients and methods Fifteen subjects, age ≥65 years, took sequential ALA doses of 600, 800, and 1,200 mg. Each dose was taken once daily with a meal for 5 days. After each dose was taken by the subjects for 5 days, the subjects were contacted by phone, a review of systems was performed, and they were asked if they thought they could tolerate taking that dose of ALA for an extended period of time. Results The 600 mg dose was well tolerated. At the 800 mg dose, one subject had an intolerable flushing sensation. At the 1,200 mg dose, two subjects had intolerable upper gastrointestinal side effects and one subject had an intolerable flushing sensation. Subjects taking gastrointestinal prophylaxis medications had no upper gastrointestinal side effects. Conclusion High-dose ALA is not completely tolerated by the elderly. These preliminary data suggest that gastrointestinal prophylaxis may improve tolerability. (, NCT02613572). PMID:27729766

  5. The neuroprotective benefit from pioglitazone (PIO) addition on the alpha lipoic acid (ALA)-based treatment in experimental diabetic rats.


    Jin, Heung Yong; Lee, Kyung Ae; Wu, Jin Zu; Baek, Hong Sun; Park, Tae Sun


    In this study, we investigated the combined effect of pioglitazone (PIO) with alpha lipoic acid (ALA) on the peripheral nerves of diabetic rats. Animals were divided into 8 groups (N = 6-8) and designated according to ALA (100 mg/kg/day) and PIO (10 mg/kg/day) treatment: Normal, Normal + ALA, Normal + PIO, Normal + ALA + PIO, DM, DM + ALA, DM + PIO, and DM + ALA + PIO. After 24 weeks, current perception threshold, mechanical allodynia, oxidative stresses, intraepidermal nerve fiber density (IENFD), and axonal morphology in the sciatic nerve were compared among groups. IENFD in the DM + ALA + PIO group was significantly less reduced than in other DM groups (7.61 ± 0.52 vs. 5.62 ± 0.96, 5.56 ± 0.60, and 7.10 ± 0.70 for DM, DM + ALA, and DM + PIO, respectively P < 0.05). The mean myelinated axonal area in the sciatic nerves was significantly higher in the DM + ALA + PIO group compared with non-treated DM group (70.2 ± 3.46 vs. 61.1 ± 2.91, P < 0.05) although significant differences were not present between combination therapy and monotherapy independent of ALA or PIO. Our results demonstrated that combination therapy using PIO based on ALA can give an additional benefit in peripheral nerve preservation in diabetes. Moreover, PIO can be preferentially considered when additional glucose-lowering agent is required in DPN patients treated with ALA.

  6. Lipoic acid and haloperidol-induced vacuous chewing movements: Implications for prophylactic antioxidant use in tardive dyskinesia.


    Lister, Joshua; Andreazza, Ana C; Navaid, Bushra; Wilson, Virginia S; Teo, Celine; Nesarajah, Yasika; Wilson, Alan A; Nobrega, José N; Fletcher, Paul J; Remington, Gary


    Tardive dyskinesia (TD), a potentially irreversible antipsychotic (AP)-related movement disorder, is a risk with all currently available antipsychotics. AP-induced vacuous chewing movements (VCMs) in rats, a preclinical model of TD, can be attenuated by antioxidant-based treatments although there is a shortage of well-designed studies. Lipoic acid (LA) represents a candidate antioxidant for the treatment of oxidative stress-related nervous system disorders; accordingly, its effects on AP-induced VCMs and striatal oxidative stress were examined. Rats treated with haloperidol decanoate (HAL; 21mg/kg every 3weeks, IM) for 12weeks were concurrently treated with LA (10 or 20mg/kg, PO). VCMs were assessed weekly by a blinded rater, and locomotor activity was evaluated as were striatal lipid peroxidation markers and serum HAL levels. VCMs were decreased by the lower dose (nonsignificant), whereas a significant increase was recorded with the higher dose of LA. HAL decreased locomotor activity and this was unaffected by LA. Striatal malondialdehyde (MDA) levels in HAL-treated rats were reduced by both LA doses, while 4-hydroxynonenal (4-HNE) levels were predictive of final VCM scores (averaged across weeks 10-12). Study limitations include differences between antipsychotics in terms of oxidative stress, LA dosing, choice of biomarkers for lipid peroxidation, and generalizability to TD in humans. Collectively, current preclinical evidence does not support a "protective" role for antioxidants in preventing TD or its progression, although clinical evidence offers limited evidence supporting such an approach.

  7. Differential efficiency of simvastatin and lipoic acid treatments on Bothrops jararaca envenomation-induced acute kidney injury in mice.


    Barone, Juliana Marton; Alponti, Rafaela Fadoni; Frezzatti, Rodrigo; Zambotti-Villela, Leonardo; Silveira, Paulo Flávio


    Snake bite accidents by Bothrops genus is an important public health issue in Brazil and one of its most serious complications is the acute kidney injury (AKI). Here we evaluated the effects of Bothrops jararaca venom (vBj) and the treatments with lipoic acid (LA) and simvastatin (SA) on renal function, aminopeptidase (AP) activities and renal redox status. Primordial events for establishment of AKI by vBj were hyperuricemia, hypercreatinemia, urinary hyperosmolality, renal oxidative stress and reduction of hematocrit and protein content in the membrane of renal cortex and medulla and in the plasma. In the renal cortex and medulla the changes caused by vBj in soluble and membrane-bound AP activities had a similar pattern. The beneficial effects of LA and SA on envenomed mice were similar on the hyperuricemia, renal oxidative stress and reduction of hematocrit. LA mitigated the hypercreatinemia, but exacerbated the urinary urea and creatinine, whereas SA mitigated the decrease of plasma urea, urinary hyperosmolality and hypercreatinuria induced by vBj. The beneficial effects of LA and especially of SA on renal effects of vBj open a new perspective for clinical investigations of these drugs as coadjuvant agents in the serotherapy of Bothrops envenomation.

  8. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B1-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers

    PubMed Central

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun


    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B1 (AFB1). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB1. In the AFB1 group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB1 group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  9. Ammonia-induced oxidative damage in neurons is prevented by resveratrol and lipoic acid with participation of heme oxygenase 1.


    Bobermin, Larissa Daniele; Wartchow, Krista Minéia; Flores, Marianne Pires; Leite, Marina Concli; Quincozes-Santos, André; Gonçalves, Carlos-Alberto


    Ammonia is a metabolite that, at high concentrations, is implicated in neurological disorders, such as hepatic encephalopathy (HE), which is associated with acute or chronic liver failure. Astrocytes are considered the primary target of ammonia toxicity in the central nervous system (CNS) because glutamine synthetase (GS), responsible for ammonia metabolism in CNS, is an astrocytic enzyme. Thus, neuronal dysfunction has been associated as secondary to astrocytic impairment. However, we demonstrated that ammonia can induce direct effects on neuronal cells. The cell viability was decreased by ammonia in SH-SY5Y cells and cerebellar granule neurons. In addition, ammonia induced increased reactive oxygen species (ROS) production and decreased GSH intracellular content, the main antioxidant in CNS. As ammonia neurotoxicity is strongly associated with oxidative stress, we also investigated the potential neuroprotective roles of the antioxidants, resveratrol (RSV) and lipoic acid (LA), against ammonia toxicity in cerebellar granule neurons. RSV and LA were able to prevent the oxidative damage induced by ammonia, maintaining the levels of ROS production and GSH close to basal values. Both antioxidants also decreased ROS production and increased GSH content under basal conditions (in the absence of ammonia). Moreover, we showed that heme oxygenase 1 (HO1), a protein associated with protection against stress conditions, is involved in the beneficial effects of RSV and LA in cerebellar granule neurons. Thus, this study reinforces the neuroprotective effects of RSV and LA. Although more studies in vivo are required, RSV and LA could represent interesting therapeutic strategies for the management of HE.

  10. α-Lipoic acid (α-LA) inhibits the transcriptional activity of interferon regulatory factor 1 (IRF-1) via SUMOylation.


    Sun, Tao; Gao, Fuyu; Lin, Xiaoyan; Yu, Ruixiang; Zhao, Yong; Luan, Jingjie; Li, Hongyan; Song, Mingzhu


    Osteoarthritis (OA), one of the most common joint disorders, is one of the leading causes of disability among the elderly. Proinflammatory cytokines, such as interleukin (IL)-1β, which is synthesized locally by synovial cells and chondrocytes, have been shown to play a critical role in sustaining cartilage damage in arthritis by creating an imbalance between cartilage degradation and the repair process. Alpha-lipoic acid (α-LA), which is synthesized in animal and plant tissues, has demonstrated its protective effects in a variety of diseases. However, whether or not LA has a protective effect in OA is still unknown. In this study, we found that α-LA inhibits the IL-1β-induced increase in matrix metallopeptidase 3 (MMP-3) and matrix metallopeptidase 13 (MMP-13) expression and activity. Our data also demonstrate that interferon regulatory factor 1 (IRF-1) participates in the induction of MMP-3 and MMP-13. However, α-LA treatment did not change IRF-1 levels. Importantly, we found that α-LA increases SUMOylation of IRF-1, which attenuates IRF-1's transcriptional activity. Finally, we found that α-LA treatment leads to an increase in SUMO-1, but not in SUMO-2 or SUMO-3. Taken together, this study shows that α-LA exerts anti-inflammatory effects in an IL-1β-stimulated chondrocyte model, thereby suggesting a potential protective effect of α-LA in OA.

  11. Proteomic and biochemical responses of canola (Brassica napus L.) exposed to salinity stress and exogenous lipoic acid.


    Yıldız, Mustafa; Akçalı, Nermin; Terzi, Hakan


    To evaluate the mitigating effects of exogenous lipoic acid (LA) on NaCl toxicity, proteomic, biochemical and physiological changes were investigated in the leaves of canola (Brassica napus L.) seedlings. Salinity stress decreased the growth parameters and contents of ascorbate (AsA) and glutathione (GSH), and increased the contents of malondialdehyde (MDA), proline, cysteine and the activities of antioxidant enzymes such as superoxide dismutase (SOD), guaiacol peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX). The foliar application of LA alleviated the toxic effects of salinity stress on canola seedlings and notably decreased MDA content and increased growth parameters, cysteine content, and activities of CAT and POD. In the proteomic analyses, total proteins from the leaves of control, LA, NaCl and NaCl+LA treated-seedlings were separated using two-dimensional gel electrophoresis (2-DE). A total of 28 proteins were differentially expressed. Of these, 21 proteins were successfully identified by MALDI-TOF/TOF MS. These proteins had functions related to photosynthesis, stress defense, energy metabolism, signal transduction, protein folding and stabilization indicating that LA might play important roles in salinity through the regulation of photosynthesis, stress defense and signal transduction related proteins. The proteomic findings have provided new insight to reveal the effect of LA on salinity stress for the first time.

  12. α-Lipoic Acid in Soluplus(®) Polymeric Nanomicelles for Ocular Treatment of Diabetes-Associated Corneal Diseases.


    Alvarez-Rivera, Fernando; Fernández-Villanueva, David; Concheiro, Angel; Alvarez-Lorenzo, Carmen


    α-Lipoic acid (ALA) is a powerful antioxidant valuable for prevention and treatment of ophthalmic complications such as diabetic keratopathy and retinopathy. The aim of this work was to develop micelle-based formulations that can enhance the solubility, stability, and corneal permeability of ALA. Compared to a conventional surfactant (sodium dioctylsulfosuccinate), Soluplus(®) (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol copolymer) led to smaller micelles (70-80 vs. 240-528 nm) with improved ability to solubilize ALA, maintaining ocular compatibility (Hens Egg Test on the Chorio-Allantoic Membrane). Soluplus nanomicelles enhanced more than 10-fold ALA solubility compared to common eye drops and withstood strong dilution in lachrymal fluid, filtration through sterilizing membranes, and freeze-drying. Interestingly, Soluplus nanomicelle formulation prepared with 1 or 2 mM block copolymer concentration exhibited in situ gelling capability and transformed into weak gels at 35°C, which is expected to increase corneal residence time. Bovine corneal permeability revealed that Soluplus nanomicelles notably enhanced ALA accumulation into the cornea as well as flux of drug toward the receptor chamber. Overall, these findings point out Soluplus nanomicelles as suitable carriers of ALA that may exhibit improved performance compared to currently available eye drop solutions.

  13. Kinetic modeling and scale up of lipoic acid (LA) production from Saccharomyces cerevisiae in a stirred tank bioreactor.


    Jayakar, Shilpa S; Singhal, Rekha S


    Scale up studies for production of lipoic acid (LA) from Saccharomyces cerevisiae have been reported in this paper for the first time. LA production in batch mode was carried out in a stirred tank bioreactor at varying agitation and aeration with maximum LA production of 512 mg/L obtained at 350 rpm and 25 % dissolved oxygen in batch culture conditions. Thus, LA production increased from 352 mg/L in shake flask to 512 mg/L in batch mode in a 5 L stirred tank bioreactor. Biomass production under these conditions was mathematically explained using logistic equation and data obtained for LA production and substrate utilization were successfully fitted using Luedeking-Piret and Mercier's models. The kinetic studies showed LA production to be growth associated. Further enhancement of LA production was carried out using fed-batch (variable volume) and semi-continuous modes of fermentation. Semi-continuous fermentation with three feeding cycles of sucrose effectively increased the production of LA from 512 to 725 mg/L.

  14. Quantification of lipoic acid from skin samples by HPLC using ultraviolet, electrochemical and evaporative light scattering detectors.


    Campos, Patrícia Mazureki; Praça, Fabíola Silva Garcia; Bentley, Maria Vitória Lopes Badra


    Lipoic acid (LA) is an endogenous organosulfur compound with potent antioxidant property. LA is often used as a drug for the treatment of skin disorders. For the accomplishment of topical applications of LA appropriate drug quantification methods are essential. Thus far, no HPLC methods have been reported for the measurement of LA extracted from skin. In this article we report on the development and validation of three sensitive and specific HPLC methods for LA and dihydrolipoic acid (DHLA) using ultraviolet (UV), electrochemical (EC) or evaporative light scattering (ELS) detection. These methods demonstrate different linearity ranges. The chromatographic separations were performed by RP-HPLC (250 × 4 mm, 5 μm) with isocratic elution using an acidic mobile phase for the three detection techniques. The lower limits of detection and quantification were 0.04 and 0.08 ng LA, respectively, for HPLC coupled to ELS, an innovative detector for LA with high sensitivity. The extraction of LA from skin samples showed recoveries greater than 71%. The recovered LA concentrations from stratum corneum and epidermis+dermis layers were: 5.41 ± 0.56 and 4.92 ± 0.33 μg/mL, respectively for HPLC/UV and 6.52 ± 0.49 and 5.01 ± 0.41 μg/mL, respectively, for HPLC/EC for the added LA concentration (6.67 μg/mL), and 8.88 ± 0.46 and 8.95 ± 0.08 μg/mL, respectively, for HPLC/ELS for the added LA concentration (10 μg/mL). These three optimized HPLC methods allowed for a simple, rapid and reliable determination of LA in human skin. They should be useful for the development of drug delivery systems for topical applications of LA.

  15. Mice with heterozygous deficiency of lipoic acid synthase have an increased sensitivity to lipopolysaccharide-induced tissue injury

    PubMed Central

    Yi, Xianwen; Kim, Kuikwon; Yuan, Weiping; Xu, Longquan; Kim, Hyung-Suk; Homeister, Jonathon W.; Key, Nigel S.; Maeda, Nobuyo


    α-Lipoic acid (1, 2-dithiolane-3-pentanoic acid; LA), synthesized in mitochondria by LA synthase (Lias), is a potent antioxidant and a cofactor for metabolic enzyme complexes. In this study, we examined the effect of genetic reduction of LA synthesis on its antioxidant and anti-inflammatory properties using a model of LPS-induced inflammation in Lias+/– mice. The increase of plasma proinflammatory cytokine, TNF-α, and NF-κB at an early phase following LPS injection was greater in Lias+/– mice compared with Lias+/+ mice. The circulating blood white blood cell (WBC) and platelet counts dropped continuously during the initial 4 h. The counts subsequently recovered partially in Lias+/+ mice, but the recovery was impaired totally in Lias+/– mice. Administration of exogenous LA normalized the recovery of WBC counts in Lias+/– mice but not platelets. Enhanced neutrophil sequestration in the livers of Lias+/– mice was associated with increased hepatocyte injury and increased gene expression of growth-related oncogene, E-selectin, and VCAM-1 in the liver and/or lung. Lias gene expression in tissues was 50% of normal expression in Lias+/– mice and reduced further by LPS treatment. Decreased Lias expression was associated with diminished hepatic LA and tissue oxidative stress. Finally, Lias+/– mice displayed enhanced mortality when exposed to LPS-induced sepsis. These data demonstrate the importance of endogenously produced LA for preventing leukocyte accumulation and tissue injury that result from LPS-induced inflammation. PMID:18845616

  16. Ibuprofen and lipoic acid diamide as co-drug with neuroprotective activity: pharmacological properties and effects in beta-amyloid (1-40) infused Alzheimer's disease rat model.


    Di Stefano, A; Sozio, P; Cerasa, L S; Iannitelli, A; Cataldi, A; Zara, S; Giorgioni, G; Nasuti, C


    Both oxidative stress and inflammation are elevated in brains of Alzheimer's disease patients, but their pathogenic significance still remains unclear. Current evidence support the hypothesis that non-steroidal anti-inflammatory drugs (NSAIDs) and antioxidant therapy might protect against the development of Alzheimer's disease, and ibuprofen has the strongest epidemiological support. In the present work our attention was focused on (R)-alpha-lipoic acid considered as a potential neuroprotective agent in Alzheimer's disease therapy. In particular, we investigated a new co-drug (1) obtained by joining (R)-alpha-lipoic acid and ibuprofen via a diamide bond, for evaluating its potential to antagonize the deleterious structural and cognitive effects of beta-amyloid (1-40) in an infused Alzheimer's disease rat model. Our results indicated that infusion of beta-amyloid (1-40) impairs memory performance through a progressive cognitive deterioration; however, ibuprofen and co-drug 1 seemed to protect against behavioural detriment induced by simultaneous administration of beta-amyloid (1-40) protein. The obtained data were supported by the histochemical findings of the present study: beta-amyloid protein was less expressed in 1-treated than in ibuprofen and (R)-alpha-lipoic acid alone-treated cerebral cortex. Taken together, the present findings suggest that co-drug 1 treatment may protect against the cognitive dysfunction induced by intracerebroventricular infusion of beta-amyloid (1-40) in rats. Thus, co-drug 1 could prove useful as a tool for controlling Alzheimer's disease-induced cerebral amyloid deposits and behavioural deterioration.

  17. Correlation of α-Lipoic Acid and S. Glutathione Level with Free Radical Excess in Tobacco Consumers

    PubMed Central

    Kaur, Manjinder; Suhalka, M.L.; Shrivastav, Chanchal


    Introduction Tobacco consumption is a serious health hazard and most important avoidable cause of death worldwide. Tobacco is recognized as lethal toxin, ripping off 7-11 minutes of human life with each cigarette through harmful compounds and inducing free radical synthesis and a high rate of lipid peroxidation. These free radicals are scavenged by the endogenous antioxidants viz. S. Glutathione (S.GSH) and S. α-Lipoic acid (S. α-LA), thus preventing the endothelial damage. Aim The present study was designed with an aim to find out the lipid peroxidative stress through S. Malondialdehyde (S.MDA) and its correlation with antioxidant levels like S. Glutathione (S. GSH) and S. α- Lipoic acid (S. α- LA) among tobacco users (in both smokers and chewers). Materials and Methods A case control cross-sectional study was carried out in the Department of Physiology among 200 subjects; aged 18-50 years of both sexes which were chosen randomly from institutional campus and healthy volunteers. The subjects were broadly divided into two groups (A & B); group A comprised of tobacco users (n=150) with history of smoking cigarette/biddies and chewing tobacco daily, for at least one year and group B had controls (non tobacco users) (n=50). S. MDA, S.GSH and S. α-LA levels were estimated by standardized methods. The data was analysed by unpaired student t-test and Pearson’s correlation coefficient (r) for finding the correlation between antioxidants and S.MDA in group-A and group-B. Results The present study reports the significantly higher (p<0.0001) levels of S.MDA and lower (p<0.0001) levels of S.GSH and S. α-LA in tobacco users as compared to nontobacco users. The observed value of S.MDA was (2.72±0.87, 1.39±0.47) nmol/ml, S. α-LA was (9.94±5.96, 14.24 ± 4.34) μg/ml and S.GSH was (23.24±7.04, 32.82±2.95) mg/dl respectively in group-A and group-B. A significant (p<0.01) strong negative correlation was observed between S. MDA and antioxidants (S.GSH and S.

  18. Efficacy and Safety of Antioxidant Treatment With α-Lipoic Acid Over 4 Years in Diabetic Polyneuropathy

    PubMed Central

    Ziegler, Dan; Low, Phillip A.; Litchy, William J.; Boulton, Andrew J.M.; Vinik, Aaron I.; Freeman, Roy; Samigullin, Rustem; Tritschler, Hans; Munzel, Ullrich; Maus, Joachim; Schütte, Klemens; Dyck, Peter J.


    OBJECTIVE To evaluate the efficacy and safety of α-lipoic acid (ALA) over 4 years in mild-to-moderate diabetic distal symmetric sensorimotor polyneuropathy (DSPN). RESEARCH DESIGN AND METHODS In a multicenter randomized double-blind parallel-group trial, 460 diabetic patients with mild-to-moderate DSPN were randomly assigned to oral treatment with 600 mg ALA once daily (n = 233) or placebo (n = 227) for 4 years. Primary end point was a composite score (Neuropathy Impairment Score [NIS]–Lower Limbs [NIS-LL] and seven neurophysiologic tests). Secondary outcome measures included NIS, NIS-LL, nerve conduction, and quantitative sensory tests (QSTs). RESULTS Change in primary end point from baseline to 4 years showed no significant difference between treatment groups (P = 0.105). Change from baseline was significantly better with ALA than placebo for NIS (P = 0.028), NIS-LL (P = 0.05), and NIS-LL muscular weakness subscore (P = 0.045). More patients showed a clinically meaningful improvement and fewer showed progression of NIS (P = 0.013) and NIS-LL (P = 0.025) with ALA than with placebo. Nerve conduction and QST results did not significantly worsen with placebo. Global assessment of treatment tolerability and discontinuations due to lack of tolerability did not differ between the groups. The rates of serious adverse events were higher on ALA (38.1%) than on placebo (28.0%). CONCLUSIONS Four-year treatment with ALA in mild-to-moderate DSPN did not influence the primary composite end point but resulted in a clinically meaningful improvement and prevention of progression of neuropathic impairments and was well tolerated. Because the primary composite end point did not deteriorate significantly in placebo-treated subjects, secondary prevention of its progression by ALA according to the trial design was not feasible. PMID:21775755

  19. Bacteriological analysis of water by potentiometric measurement of lipoic acid reduction: preliminary assays for selective detection of indicator organisms.

    PubMed Central

    Charriere, G; Jouenne, T; Lemeland, J F; Selegny, E; Junter, G A


    The practical task of adapting an original potentiometric technique to the bacteriological analysis of water is discussed. Various laboratory strains of organisms belonging to the usual aquatic flora were inoculated one by one in a minimal lactose broth supplied with lipoic (thioctic) acid. The time evolution of the redox potential of the cultures was followed during incubation by combined gold versus reference electrodes. When the incubation temperature was regulated at 36 degrees C, most organisms were able to grow and to reduce the coenzyme, generating changes in the redox potential of the culture. However, very few organisms developed significant reductive activity when the temperature was increased to 41 degrees C and when the broth was provided with sodium deoxycholate. Among the fecal coliform organisms, only Escherichia coli and Klebsiella pneumoniae exhibited early but reproducible potential-time responses. Positive potentiometric responses were also recorded with Acinetobacter calcoaceticus. E. coli showed rapid potentiometric signals as compared with K. pneumoniae. The time required for 100-mV shift of potential to be detected was related to the logarithm of the initial concentration of E. coli or K. pneumoniae in the culture broth. Experiments on natural surface water samples showed the the potentiometric method, associated with the selective incubation conditions, mainly detected E. coli among the bacterial flora of the tested environmental water. The calibration curve relating the time required for a 100-mV shift of potential to be detected to the number of fecal coliforms, as determined by control fecal coliform-selective plate counts, was consistent with the composite standard curve of detection times obtained with six different laboratory strains of E. coli.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:6421230

  20. Total Oxidative status of Mouse Vitrified Pre-Antral Follicles with Pre-Treatment of Alpha Lipoic Acid

    PubMed Central

    Hatami, Sahar; Zavareh, Saeed; Salehnia, Mojdeh; Lashkarbolouki, Taghi; Ghorbanian, Mohammad Taghi; Karimi, Isaac


    Background: Cryopreservation of pre-antral follicles is a hopeful technique to preserve female fertility. The aim of the present study was to evaluate reactive oxygen species (ROS) and total antioxidant capacity (TAC) levels of mouse vitrified pre-antral follicles in the presence of alpha lipoic acid (ALA). Methods: Isolated pre-antral follicles (140–150 µm in diameter) were divided into vitrified–warmed and fresh groups. Each group was subjected to in vitro maturation with or without ALA for 12 days, followed by adding human chronic gonadotropin to induce ovulation. In vitro fertilization was performed to evaluate their developmental competence. In parallel, the amount of ROS and TAC were assessed after 0, 24, 48, 72, and 96 h of culture by 2',7'-dichlorofluorescin assay and ferric reducing/antioxidant power assay, respectively. Results: The respective rates of survival, antrum formation, and metaphase II oocytes were significantly higher in ALA-supplemented groups compared to the groups not treated with ALA. TAC and ROS levels were significantly decreased and increased, respectively during the culture period up to 96 h in the absence of ALA in both vitrified and non-vitrified samples. However, with pretreatment of ALA, TAC levels were increased significantly and remained constant up to 96 h in vitrified-warmed pre-antral follicles, while ROS levels completely returned to the level of starting point after 96 h of culture in the presence of ALA. Conclusion: Pretreatment of ALA positively influences development of pre-antral follicles in vitrified and non-vitrified samples through increasing follicular TAC level and decreasing ROS levels. PMID:24842145

  1. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    PubMed Central

    Li, Y.; Ma, Q. G.; Zhao, L. H.; Guo, Y. Q.; Duan, G. X.; Zhang, J. Y.; Ji, C.


    Alpha-lipoic acid (α-LA) is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1). Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05) change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver. PMID:25050030

  2. Therapeutic Potential of Dioscorea Extract (DA-9801) in Comparison with Alpha Lipoic Acid on the Peripheral Nerves in Experimental Diabetes.


    Jin, Heung Yong; Kim, Sun Hee; Yu, Hea Min; Baek, Hong Sun; Park, Tae Sun


    DA-9801, a mixture of extracts from Dioscorea japonica Thunb. and Dioscorea nipponica Makino, was reported to have neurotrophic activity. Therefore, we investigated the therapeutic potential of DA-9801, in comparison with alpha lipoic acid (ALA), for peripheral nerves preservation in experimental diabetes. Experimental animals were divided into 4 groups, and each group was designated according to the type of treatment administered as follows: normal, DM, DM+DA-9801, and DM+ALA. After 16 weeks, response thresholds to tactile and thermal stimuli were higher in DM+DA-9801 group than in nontreated DM group. This degree of increase in DM+DA-9801 group indicates more therapeutic potency of DA-9801 than ALA. Western blot analysis showed more significant increase in NGF and decrease in TNF-α and IL-6 in DM+DA-9801 group than in DM or DM+ALA groups (P < 0.05). IENF density was reduced less significantly in the DM+DA-9801 group than in other DM groups (7.61 ± 0.32, 4.2 ± 0.26, and 6.5 ± 0.30 in DM+DA-9801, DM, and DM+ALA, resp., P < 0.05). Mean myelinated axonal area in the sciatic nerves was significantly greater in DM+DA-9801 group than in other DM groups (69.2 ± 5.76, 54.0 ± 6.32, and 63.1 ± 5.41 in DM+DA-9801, DM, and DM+ALA, resp., P < 0.05). Results of this study demonstrated potential therapeutic applications of DA-9801 for the treatment of diabetic peripheral neuropathy.

  3. Alpha-lipoic acid affects the oxidative stress in various brain structures in mice with methionine and choline deficiency

    PubMed Central

    Veskovic, Milena; Mladenovic, Dusan; Jorgacevic, Bojan; Stevanovic, Ivana; de Luka, Silvio


    Deficiency in methionine or choline can induce oxidative stress in various organs such as liver, kidney, heart, and brain. This study was to examine the effects of alpha-lipoic acid (LA) on oxidative stress induced by methionine and choline deficiency (MCD) in several brain structures. Male mice C57BL/6 (n = 28) were divided into four groups: (1) control – continuously fed with standard chow; (2) LA – fed with standard chow and receiving LA; (3) MCD2 – fed with MCD diet for two weeks, and (4) MCD2+LA – fed with MCD diet for two weeks and receiving LA (100 mg/kg/day intraperitonealy [i.p.]). Brain tissue (cortex, hypothalamus, striatum and hippocampus) was taken for determination of oxidative stress parameters. MCD diet induced a significant increase in malondialdehyde and NOx concentration in all brain regions, while LA restored their content to normal values. Similar to this, in MCD2 group, activity of total SOD, MnSOD, and Cu/ZnSOD was reduced by MCD diet, while LA treatment improved their activities in all brain structures. Besides, in MCD2 group a decrease in catalase activity in cortex and GSH content in hypothalamus was evident, while LA treatment induced an increase in catalase activity in cortex and striatum and GSH content in hypothalamus. LA treatment can significantly reduce lipid peroxidation and nitrosative stress, caused by MCD diet, in all brain regions by restoring antioxidant enzymes activities, predominantly total SOD, MnSOD, and Cu/ZnSOD, and to a lesser extent by modulating catalase activity and GSH content. LA supplementation may be used in order to prevent brain oxidative injury induced by methionine and choline deficiency. PMID:25193852

  4. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: a pilot study.


    Keith, Dove J; Butler, Judy A; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L; Christensen, J Mark; Pereira, Cliff; Hagen, Tory M


    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age=32 years) and older adults (average age=79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen.

  5. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: A pilot study

    PubMed Central

    Keith, Dove J.; Butler, Judy A.; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L.; Christensen, J. Mark; Pereira, Cliff; Hagen, Tory M.


    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age = 32 years) and older adults (average age = 79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3 h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen. PMID:22609537

  6. Effects of α-lipoic acid on endothelial function in aged diabetic and high-fat fed rats

    PubMed Central

    Sena, C M; Nunes, E; Louro, T; Proença, T; Fernandes, R; Boarder, M R; Seiça, R M


    Background and purpose: This study was conducted to investigate the effects of α-lipoic acid (α-LA) on endothelial function in diabetic and high-fat fed animal models and elucidate the potential mechanism underlying the benefits of α-LA. Experimental approach: Plasma metabolites reflecting glucose and lipid metabolism, endothelial function, urinary albumin excretion (UAE), plasma and aortic malondialdehyde (MDA) and urinary 8-hydroxydeoxyguanosine (8-OHdG) were assessed in non-diabetic controls (Wistar rats), untreated Goto-Kakizaki (GK) diabetic and high-fat fed GK rats (fed with atherogenic diet only, treated with α-LA and treated with vehicle, for 3 months). Vascular eNOS, nitrotyrosine, carbonyl groups and superoxide anion were also assessed in the different groups. Key results: α-LA and soybean oil significantly reduced both total and non-HDL serum cholesterol and triglycerides induced by atherogenic diet. MDA, carbonyl groups, vascular superoxide and 8-OHdG levels were higher in GK and high-fat fed GK groups and fully reversed with α-LA treatment. High-fat fed GK diabetic rats showed significantly reduced endothelial function and increased UAE, effects ameliorated with α-LA. This endothelial dysfunction was associated with decreased NO production, decreased expression of eNOS and increased vascular superoxide production and nitrotyrosine expression. Conclusions and implications: α-LA restores endothelial function and significantly improves systemic and local oxidative stress in high-fat fed GK diabetic rats. Improved endothelial function due to α-LA was at least partially attributed to recoupling of eNOS and increased NO bioavailability and represents a pharmacological approach to prevent major complications associated with type 2 diabetes. PMID:17906683

  7. Lipoic acid induces p53-independent cell death in colorectal cancer cells and potentiates the cytotoxicity of 5-fluorouracil.


    Dörsam, Bastian; Göder, Anja; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg


    Alpha-lipoic acid (LA), which plays a pivotal role in mitochondrial energy metabolism, is an endogenous dithiol compound with an array of antioxidative functions. It has been shown that LA triggers cell death in tumor cell lines, whereas non-transformed cells are hardly affected. In the present study, we analyzed the cytotoxicity of LA on colorectal cancer (CRC) cells differing in their p53 status and investigated a putative synergistic effect with the anticancer drug 5-fluorouracil (5-FU). We show that LA induces a dose-dependent decrease in cell viability, which was independent of the p53 status as attested in isogenic p53-proficient and p53-deficient cell lines. This effect was largely attributable to cell death induction as revealed by Annexin-V/PI staining. LA-treated HCT116 cells underwent caspase-dependent and caspase-independent cell death, which was blocked by the pan-caspase inhibitor zVAD and the RIP-kinase inhibitor Necrostatin-1, respectively. In CaCO-2 and HT29 cells, LA induced caspase-dependent cell demise via activation of caspase-9, caspase-3 and caspase-7 with subsequent PARP-1 cleavage as demonstrated by immunoblot analysis, activity assays and pan-caspase inhibition. Interestingly, LA treatment did neither activate p53 nor induced genotoxic effects as shown by lack of DNA strand breaks and phosphorylation of histone 2AX. Finally, we provide evidence that LA increases the cytotoxic effect induced by the anticancer drug 5-FU as revealed by significantly enhanced cell death rates in HCT116 and CaCO-2 cells. Collectively, these findings demonstrate that LA induces CRC cell death independent of their p53 status and potentiates the cytotoxicity of 5-FU without causing DNA damage on its own, which makes it a candidate for tumor therapy.

  8. Nucleic acid compositions and the encoding proteins


    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.


    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  9. Clinical Usefulness of Oral Supplementation with Alpha-Lipoic Acid, Curcumin Phytosome, and B-Group Vitamins in Patients with Carpal Tunnel Syndrome Undergoing Surgical Treatment

    PubMed Central

    Pajardi, Giorgio; Bortot, Paola; Ponti, Veronica; Novelli, Chiara


    We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS), scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n = 60) served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n = 60) received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation). Patients in Group C (n = 60) received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05). Moreover, patients in Group B had a significantly lower number of positive Phalen's tests at 3 months compared with the other study groups (P < 0.05). We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve. PMID:24563654

  10. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging

    PubMed Central

    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida


    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA. PMID:26788510

  11. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging.


    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida


    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA.

  12. α-Lipoic acid reduces neurogenic hypertension by blunting oxidative stress-mediated increase in ADAM17

    PubMed Central

    de Queiroz, Thyago M.; Xia, Huijing; Filipeanu, Catalin M.; Braga, Valdir A.


    We previously reported that type 2 angiotensin-converting enzyme (ACE2) compensatory activity is impaired by the disintegrin and metalloprotease 17 (ADAM17), and lack of ACE2 is associated with oxidative stress in neurogenic hypertension. To investigate the relationship between ADAM17 and oxidative stress, Neuro2A cells were treated with ANG II (100 nM) 24 h after vehicle or α-lipoic acid (LA, 500 μM). ADAM17 expression was increased by ANG II (120.5 ± 9.1 vs. 100.2 ± 0.8%, P < 0.05) and decreased after LA (69.0 ± 0.3 vs. 120.5 ± 9.1%, P < 0.05). In another set of experiments, LA reduced ADAM17 (92.9 ± 5.3 vs. 100.0 ± 11.2%, P < 0.05) following its overexpression. Moreover, ADAM17 activity was reduced by LA in ADAM17-overexpressing cells [109.5 ± 19.8 vs. 158.0 ± 20.0 fluorescence units (FU)·min−1·μg protein−1, P < 0.05], in which ADAM17 overexpression increased oxidative stress (114.1 ± 2.5 vs. 101.0 ± 1.0%, P < 0.05). Conversely, LA-treated cells attenuated ADAM17 overexpression-induced oxidative stress (76.0 ± 9.1 vs. 114.1 ± 2.5%, P < 0.05). In deoxycorticosterone acetate (DOCA)-salt hypertensive mice, a model in which ADAM17 expression and activity are increased, hypertension was blunted by pretreatment with LA (119.0 ± 2.4 vs. 131.4 ± 2.2 mmHg, P < 0.05). In addition, LA improved dysautonomia and baroreflex sensitivity. Furthermore, LA blunted the increase in NADPH oxidase subunit expression, as well as the increase in ADAM17 and decrease in ACE2 activity in the hypothalamus of DOCA-salt hypertensive mice. Taken together, these data suggest that LA might preserve ACE2 compensatory activity by breaking the feedforward cycle between ADAM17 and oxidative stress, resulting in a reduction of neurogenic hypertension. PMID:26254330

  13. The clinical efficacy of cosmeceutical application of liquid crystalline nanostructured dispersions of alpha lipoic acid as anti-wrinkle.


    Sherif, Saly; Bendas, Ehab R; Badawy, Sabry


    Topical 5% alpha lipoic acid (ALA) has shown efficacy in treatment of photo-damaged skin. The aim of this work was to evaluate the potential of poloxamer (P407) gel as a vehicle for the novel lipid base particulate system (cubosome dispersions) of ALA. Cubosome dispersions were formulated by two different approaches, emulsification of glyceryl monoolein (GMO) and poloxamer (P407) in water followed by ultrasonication, and the dilution method using a hydrotrope. Three different concentrations of GMO were used to formulate the cubosome dispersions using the first method, 5% (D1), 10% (D2) and 15% w/w (D3). In the second technique an isotropic liquid was produced by combining GMO with ethanol, and this isotropic liquid was then diluted with a P407 solution (D4). The dispersions were characterized by zeta potential, light scattering techniques, optical and transmission electron microscopy, encapsulation efficiency and in vitro drug release. Results showed that D4 was not a uniform dispersion and that D1, D2 and D3 were uniform dispersions, in which by increasing the GMO content in the dispersion, the size of the cubosomes decreased, zeta potential became more negative, encapsulation efficiency increased up to 86.48% and the drug release rate was slower. P407 gels were prepared using the cold method. Two concentrations of P407 gel were fabricated, 20 and 30% w/w. P407 gels were loaded with either ALA or dispersions containing ALA cubosomes. P407 gels were characterized by critical gelation temperature, rheological measurements and in vitro drug release studies. Results suggested that by increasing P407 concentration, the gelation temperature decreases and viscosity increases. Drug release in both cases was found to follow the Higuchi square root model. Gel loaded with ALA cubosomes provided a significantly lower release rate than the gel loaded with the un-encapsulated ALA. A double blinded placebo controlled clinical study was conducted, aiming to evaluate the efficacy

  14. Enantiomer-selective pharmacokinetics, oral bioavailability, and sex effects of various alpha-lipoic acid dosage forms.


    Hermann, Robert; Mungo, Julius; Cnota, Peter Jürgen; Ziegler, Dan


    The present study aimed to examine the enantiomer-selective pharmacokinetics (PK), relative bioavailability (Frel), and sex effects of various oral dosage forms of racemic alpha-lipoic acid (ALA). In an open-label, randomized, four-period, four-sequence crossover study, 24 healthy adult subjects (12 males and 12 females) received single doses of 600 mg of ALA in fasted state at four different occasions as follows: three 200 mg tablets (T 200); two 300 mg tablets (T 300); one 600 mg tablet (T 600); and a racemic ALA solution (OS). All tablet formulations (Thioctacid HR) were considered test treatments, while the OS (Thioctacid, 600 T) served as the reference treatment. Serial blood samples were collected over 8 hours postdose to quantify R-(+)- and S-(-)-ALA enantiomer plasma concentrations for the PK evaluation. The maximum observed plasma concentration (Cmax) and total exposure (area under the curve [AUC]0-t) were compared between treatments by analysis of variance. Weight-normalized Cmax and the AUC data of male and female study subjects were applied to examine the presence of sex effects. All treatments displayed rapid absorption of both enantiomers with median time to maximum concentration (tmax) values ranging from 0.33-0.5 hours. The Frel of all tablet formulations was comparable, with R-(+)-enantiomer Cmax test/reference ratios ranging from 36% (T 600) to 43% (T 200), and R-(+)-enantiomer AUC test/reference ratios ranging from 64% (T 600) to 79% (T 300), indicating a favorable Frel of all tablet formulations, especially in terms of the total extent of absorption (AUC). An examination of weight-normalized female/male Cmax and AUC sex ratios for both ALA enantiomers indicated the absence of a significant sex effect for Cmax, as well as 20%-26% and 25%-32% higher R-(+)- and S-(-)-ALA enantiomer AUC outcomes in females when compared to males. The observed modest sex effect was comparable for both ALA enantiomers and across all formulations, and it did not appear

  15. Stability of vitamin C derivatives in topical formulations containing lipoic acid, vitamins A and E.


    Segall, A I; Moyano, M A


    The stability of ascorbyl palmitate, sodium ascorbyl phosphate and magnesium ascorbyl phosphate in topical formulations was investigated by direct reverse phase high performance liquid chromatography after sample dilution with a suitable buffer - organic solvent mixture. Ascorbyl palmitate, sodium ascorbyl phosphate and magnesium ascorbyl phosphate are derivatives of ascorbic acid which differ in hydrolipophilic properties. They are widely used in cosmetic and pharmaceutical preparations. According to the results, ascorbyl esters showed significant differences: sodium ascorbyl phosphate and magnesium ascorbyl phosphate are more stable derivatives of vitamin C than ascorbyl palmitate and may be easily used in cosmetic products.

  16. Nucleic acids encoding human trithorax protein


    Evans, Glen A.; Djabali, Malek; Selleri, Licia; Parry, Pauline


    In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

  17. Lipoic acid stimulates cAMP production via the EP2 and EP4 prostanoid receptors and inhibits IFN gamma synthesis and cellular cytotoxicity in NK cells

    PubMed Central

    Salinthone, Sonemany; Schillace, Robynn V.; Marracci, Gail H.; Bourdette, Dennis N.; Carr, Daniel W.


    The antioxidant lipoic acid (LA) treats and prevents the animal model of multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE). In an effort to understand the therapeutic potential of LA in MS, we sought to define the cellular mechanisms that mediate the effects of LA on human natural killer (NK) cells, which are important in innate immunity as the first line of defense against invading pathogens and tumor cells. We discovered that LA stimulates cAMP production in NK cells in a dose-dependent manner. Studies using pharmacological inhibitors and receptor transfection experiments indicate that LA stimulates cAMP production via activation of the EP2 and EP4 prostanoid receptors and adenylyl cyclase. In addition, LA suppressed interleukin (IL)-12/IL-18 induced IFNγ secretion and cytotoxicity in NK cells. These novel findings suggest that LA may inhibit NK cell function via the cAMP signaling pathway. PMID:18562016

  18. Lipoic acid stimulates cAMP production via the EP2 and EP4 prostanoid receptors and inhibits IFN gamma synthesis and cellular cytotoxicity in NK cells.


    Salinthone, Sonemany; Schillace, Robynn V; Marracci, Gail H; Bourdette, Dennis N; Carr, Daniel W


    The antioxidant lipoic acid (LA) treats and prevents the animal model of multiple sclerosis (MS), experimental autoimmune encephalomyelitis (EAE). In an effort to understand the therapeutic potential of LA in MS, we sought to define the cellular mechanisms that mediate the effects of LA on human natural killer (NK) cells, which are important in innate immunity as the first line of defense against invading pathogens and tumor cells. We discovered that LA stimulates cAMP production in NK cells in a dose-dependent manner. Studies using pharmacological inhibitors and receptor transfection experiments indicate that LA stimulates cAMP production via activation of the EP2 and EP4 prostanoid receptors and adenylyl cyclase. In addition, LA suppressed interleukin (IL)-12/IL-18 induced IFNgamma secretion and cytotoxicity in NK cells. These novel findings suggest that LA may inhibit NK cell function via the cAMP signaling pathway.

  19. The Antioxidant Additive Approach for Alzheimer's Disease Therapy: New Ferulic (Lipoic) Acid Plus Melatonin Modified Tacrines as Cholinesterases Inhibitors, Direct Antioxidants, and Nuclear Factor (Erythroid-Derived 2)-Like 2 Activators.


    Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane


    Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.

  20. Intervention of mitochondrial dysfunction-oxidative stress-dependent apoptosis as a possible neuroprotective mechanism of α-lipoic acid against rotenone-induced parkinsonism and L-dopa toxicity.


    Abdin, Amany A; Sarhan, Naglaa I


    The current study evidenced hypothesis that mitochondrial dysfunction-oxidative stress-dependent apoptotic pathways play a critical role in degeneration of dopaminergic neurons in Parkinson's disease. Model of rotenone-induced parkinsonism in rats produced decrease in striatal complex I activity and reduced glutathione with increase in nitrites concentration and caspase-3 activity. This was confirmed by significant correlation of catalepsy score with neurochemical parameters. Moreover, electron microscopic examination of striatal neurons displayed ultrastructure affection as hyperchromatic nuclei and disrupted mitochondria that are typical features of undergoing apoptosis. Administration of L-dopa as replacement therapy, although caused symptomatic improvement in catalepsy score, but further worsening in neurochemical parameters. Therefore, efforts are not only to improve effect of L-dopa, but also to introduce drugs provide antiparkinsonian and neuroprotective effects. In this study, α-lipoic acid exhibited noticeable neuroprotective effects by a mechanism via intervention of mitochondrial dysfunction-oxidative stress-dependent apoptotic pathways. Combination of α-lipoic acid efficiently halting deleterious toxic effects of L-dopa, revealed normalization of catalepsy score in addition to amelioration of neurochemical parameters and apparent preservation of striatal ultrastructure integrity, indicating benefit of both symptomatic and neuroprotective therapy. In conclusion, α-lipoic acid could be recommended as a disease-modifying therapy when given with L-dopa early in course of Parkinson's disease.

  1. Early vs. late intervention of high fat/low dose streptozotocin treated C57Bl/6J mice with enalapril, α-lipoic acid, menhaden oil or their combination: Effect on diabetic neuropathy related endpoints.


    Yorek, Matthew S; Obrosov, Alexander; Shevalye, Hanna; Coppey, Lawrence J; Kardon, Randy H; Yorek, Mark A


    We have previously demonstrated that enalapril, α-lipoic acid and menhaden (fish) oil has potential as a treatment for diabetic peripheral neuropathy. In this study we sought to determine the efficacy of these treatments individually or in combination on multiple neuropathic endpoints in a high fat fed low dose streptozotocin treated mouse, a model of type 2 diabetes, following early or late intervention. Four or twelve weeks after the onset of hyperglycemia, diabetic mice were treated with enalapril, α-lipoic acid, menhaden oil or their combination for 12 weeks. Afterwards, endpoints including glucose tolerance, motor and sensory nerve conduction velocity, thermal nociception, and intraepidermal and cornea nerve fiber density was determined. Glucose clearance was impaired in diabetic mice and significantly improved only with combination treatment and early intervention. Diabetes caused steatosis, slowing of motor and sensory nerve conduction velocity, thermal hypoalgesia and reduction in intraepidermal and cornea nerve fiber density. Treating diabetic mice with enalapril, α-lipoic acid or menhaden oil partially protected diabetic mice from these deficits, whereas the combination of these three treatments was more efficacious following early or late intervention. These studies suggest that a combination therapy may be more effective for treating neural complications of type 2 diabetes.

  2. The effect of alpha-lipoic acid on the neurovascular reflex arc in patients with diabetic neuropathy assessed by capillary microscopy.


    Haak, E S; Usadel, K H; Kohleisen, M; Yilmaz, A; Kusterer, K; Haak, T


    Patients with diabetic polyneuropathy are known to have an impaired neurovascular reflex arc compared to healthy controls. This is seen in a delayed decrease in microcirculation of the ipsilateral hand after cooling of the contralateral hand. The aim of this pilot study was to investigate whether intravenous alpha-lipoic acid (ALA) (Thioctacid, Asta Medica) therapy might be able to improve this impaired neurovascular reflex arc in patients with diabetic neuropathy. In addition, clinical effects were evaluated with the aid of the neuropathy symptom score (NSS) and the neuropathy disability score (NDS). Ten patients with diabetes mellitus and polyneuropathy (5 females, 5 males, 2 smokers, 5 IDDM, 5 NIDDM, body mass index 26.1 +/- 1.0 kg/m2, age 58.3 +/- 9.5 years, diabetes duration 15.7 +/- 11.2 years, Hb A1c 6.8 +/- 0.3%) were investigated by nail-fold capillaroscopy after contralateral cooling before and after intravenous therapy with 600 mg alpha-lipoic acid per day over 3 weeks. Cardiac autonomic neuropathy was excluded by beat-to-beat variation analysis. Symptoms of diabetic neuropathy were evaluated before and after therapy with the aid of the NSS and NDS. Capillary blood cell velocity (CBV) of the hand was determined before, during, and for the following 30 min after cooling (3 min at 15 degrees C) of the contralateral hand. Blood pressure, heart rate, and local skin temperature were monitored at 2-min intervals. ALA therapy resulted in a significant improvement of the microcirculatory response to cooling, as seen by an immediate decrease in CBV of 12. 3% (P < 0.02 vs before treatment), which was absent before therapy. Blood pressure, heart rate, and local skin temperature were not different between investigations. There was a significant improvement of the NSS after therapy (5.4 +/- 1.1 vs 8.6 +/- 1.1 points, P < 0.01). These results demonstrate that intravenous therapy with ALA has a positive influence on the impaired neurovascular reflex arc in patients

  3. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells

    PubMed Central

    Choi, Ji Hyun; Cho, Soon Ok


    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation. PMID:26632410

  4. Modulatory effects of vitamin E, acetyl-L-carnitine and α-lipoic acid on new potential biomarkers for Alzheimer's disease in rat model.


    Ahmed, Hanaa H


    Alzheimer's disease (AD) is the most common chronic neurodegenerative disorder associated with aging. This study aimed to explore new markers for AD as total homocysteine (tHcy), insulin, insulin like growth factor-1 (IGF-1), interlukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α); to determine the modulatory effects of vitamin E (VE), acetyl-L-carnitine (ALC) and α-lipoic acid (LA) on the investigated parameters and to evaluate the possible therapeutic role of these nutraceutical in AD-induced in rats. Our results revealed that brain acetylcholine esterase (AChE) activity and tHcy levels were significantly increased in AD model. Folic acid, vitamin B(12) levels and Na(+)/K(+) ATPase activity were markedly reduced. Plasma insulin and IGF-1 levels were noticeably decreased but plasma TNF-α and IL-1β concentrations were significantly increased, confirming that abnormal inflammatory response is associated with AD. Treatment by VE, ALC and LA restored the above mentioned parameters to about normal levels comparable to those of donepezil, indicating that tHcy, insulin, IGF-1, IL-1β and TNF-α may be considered as new biomarkers for AD. The study points to the potential restoring effects of VE, ALC and LA in AD model. Our study provides evidence for the importance of dietary supplementation in delaying the progression of age-related neurodegenerative diseases.

  5. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy

    PubMed Central

    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin


    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  6. The effect of acetyl-L-carnitine and R-alpha-lipoic acid treatment in ApoE4 mouse as a model of human Alzheimer's disease.


    Shenk, Justin C; Liu, Jiankang; Fischbach, Kathryn; Xu, Kui; Puchowicz, Michel; Obrenovich, Mark E; Gasimov, Eldar; Alvarez, Ludis Morales; Ames, Bruce N; Lamanna, Joseph C; Aliev, Gjumrakch


    We measured age-dependent effects of human ApoE4 on cerebral blood flow (CBF) using ApoE4 transgenic mice compared to age-matched wild-type (WT) mice by use of [(14)C] iodoantipyrene autoradiography. ApoE4 associated factors reduce CBF gradually to create brain hypoperfusion when compared to WT, and the differences in CBF are greatest as animals age from 6-weeks to 12-months. Transmission electron microscopy with colloidal gold immunocytochemistry showed structural damage in young and aged microvessel endothelium of ApoE4 animals extended to the cytoplasm of perivascular cells, perivascular nerve terminals and hippocampal neurons and glial cells. These abnormalities coexist with mitochondrial structural alteration and mitochondrial DNA overproliferation and/or deletion in all brain cellular compartments. Spatial memory and temporal memory tests showed a trend in improving cognitive function in ApoE4 mice fed selective mitochondrial antioxidants acetyl-l-carnitine and R-alpha-lipoic acid. Our findings indicate that ApoE4 genotype-induced mitochondrial changes and associated structural damage may explain age-dependent pathology seen in AD, indicating potential for novel treatment strategies in the near future.

  7. The Influence of α-Lipoic Acid and Garlic Administration on Biomarkers of Oxidative Stress and Inflammation in Rabbits Exposed to Oxidized Nutrition Oils

    PubMed Central

    Zalejska-Fiolka, Jolanta; Wielkoszyński, Tomasz; Rokicki, Wojciech; Dąbrowska, Natalia; Strzelczyk, Joanna Katarzyna; Kasperczyk, Aleksandra; Owczarek, Aleksander; Błaszczyk, Urszula; Kasperczyk, Sławomir; Stawiarska-Pięta, Barbara; Birkner, Ewa; Gamian, Andrzej


    We hypothesized that addition of substances with antioxidant activity could decrease the concentrations of biomarkers of oxidative stress and inflammatory process, thus inhibiting nonalcoholic steatohepatitis development. We investigated the influence of α-lipoic acid (ALA) and garlic administration on the development of adverse changes in rabbit liver and serum under oxidative stress conditions induced with HFD from oxidized oils. We determined 8-hydroxy-2′-deoxyguanosine (8OHdG) and malondialdehyde (MDA) in liver homogenates, total oxidant status (TOS), lipid peroxides (LOO) and tumor necrosis factor alpha (TNFα) in blood serum, and TNFα and IL-1α genes expression in liver. The results indicate that the intake of dietary ALA and garlic was significantly associated with decreases of 8OHdG and MDA levels in rabbits' liver tissue as well as TOS and LOO levels in rabbits' serum. Similarly, TNFα and IL-1α gene expressions were suppressed due to ALA and garlic supplementation. The histopathological analysis confirmed that HFD results in liver disorder leading to steatosis. This adverse effect of HFD was ameliorated by the supplementation of ALA and garlic. The obtained results indicate a beneficial effect of ALA and garlic administration by reducing the oxidative stress intensity and the levels of some proinflammatory cytokines in rabbits fed HFD. PMID:26634212

  8. Gas-saturated solution process to obtain microcomposite particles of alpha lipoic acid/hydrogenated colza oil in supercritical carbon dioxide.


    Mishima, Kenji; Honjo, Masatoshi; Sharmin, Tanjina; Ito, Shota; Kawakami, Ryo; Kato, Takafumi; Misumi, Makoto; Suetsugu, Tadashi; Orii, Hideaki; Kawano, Hiroyuki; Irie, Keiichi; Sano, Kazunori; Mishima, Kenichi; Harada, Takunori; Ouchi, Mikio


    Alpha lipoic acid (ALA), an active substance in anti-aging products and dietary supplements, need to be masked with an edible polymer to obscure its unpleasant taste. However, the high viscosity of the ALA molecules prevents them from forming microcomposites with masking materials even in supercritical carbon dioxide (scCO2). Therefore, the purpose of this study was to investigate and develop a novel production method for microcomposite particles for ALA in hydrogenated colza oil (HCO). Microcomposite particles of ALA/HCO were prepared by using a novel gas-saturated solution (PGSS) process in which the solid-dispersion method is used along with stepwise temperature control (PGSS-STC). Its high viscosity prevents the formation of microcomposites in the conventional PGSS process even under strong agitation. Here, we disperse the solid particles of ALA and HCO in scCO2 at low temperatures and change the temperature stepwise in order to mix the melted ALA and HCO in scCO2. As a result, a homogeneous dispersion of the droplets of ALA in melted HCO saturated with CO2 is obtained at high temperatures. After the rapid expansion of the saturated solution through a nozzle, microcomposite particles of ALA/HCO several micrometers in diameter are obtained.

  9. Short-term supplementation with acetyl-L-carnitine and lipoic acid alters plasma protein carbonyl levels but does not improve cognition in aged beagles

    PubMed Central

    Christie, Lori-Ann; Opii, Wycliffe O.; Head, Elizabeth; Araujo, Joseph A.; De Rivera, Christina; Milgram, Norton W.; Cotman, Carl W.


    Previous work has shown that a diet enriched with antioxidants and mitochondrial co-factors improves cognition in aged dogs, which was accompanied by a reduction oxidative damage in the brain. The objective of the present study was to assess the effects of supplementation with mitochondrial co-factors on cognition and plasma protein carbonyl levels in aged dogs. Specifically, we aimed to test whether the individual or combined action of lipoic acid (LA) and acetyl-L-carnitine (ALCAR) could account for the beneficial effects of the enriched diet that contained both plus antioxidants. Dogs were given LA or ALCAR, alone and then in combination and cognition was assessed using a spatial learning task and two discrimination and reversal paradigms. Dogs receiving the ALCAR supplement showed an increase in protein carbonyl levels that was associated with increased error scores on the spatial task, and which was reduced upon additional supplementation with LA. We did not observe significant positive effects on cognition. The present findings suggest that short-term supplementation with LA and ALCAR is insufficient to improve cognition in aged dogs, and that the beneficial effects of the full spectrum diet arose from either the cellular antioxidants alone or their interaction with LA and ALCAR. PMID:19735717

  10. Effects of Lipoic Acid on Immune Function, the Antioxidant Defense System, and Inflammation-Related Genes Expression of Broiler Chickens Fed Aflatoxin Contaminated Diets

    PubMed Central

    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng


    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens. PMID:24699046

  11. Antioxidative effects of N-acetylcysteine, lipoic acid, taurine, and curcumin in the muscle of Cyprinus carpio L. exposed to cadmium.


    Sevgiler, Yusuf; Karaytug, Sahire; Karayakar, Fahri


    We investigated the muscle tissue of a teleost Cyprinus carpio L. to find out whether N-acetylcysteine (NAC), alpha-lipoic acid (LA), taurine (TAU), and curcumin (CUR) were able to counteract oxidative stress induced by acute exposure to cadmium (Cd). The muscle tissue was dissected 96 h after a single intraperitoneal injection of Cd (5 mg kg(-1)) and of antioxidant substances (50 mg kg(-1)). Using spectrophotometry, we determined the glutathione redox status, lipid peroxidation levels and the activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), and glutathione disulphide reductase (GR). Accumulation of Cd in the muscle was analysed using inductively coupled plasma - optical emission spectrometry (ICP-OES).All substances lowered Cd levels in the following order of efficiency; LA=NAC>TAU=CUR. Cadmium increased SOD activity, but CAT activity declined, regardless of antioxidant treatment. Treatment with CUR induced GPx activity. Treatment with TAU lowered Cd due to higher total glutathione (tGSH). The most effective substances on lipid peroxidation were LA and NAC due to a greater Cd-lowering potential. It seems that the protective role of TAU, LA, and NAC is not necessarily associated with antioxidant enzymes, but rather with their own activity.

  12. Revisiting the ALA/N (alpha-lipoic acid/low-dose naltrexone) protocol for people with metastatic and nonmetastatic pancreatic cancer: a report of 3 new cases.


    Berkson, Burton M; Rubin, Daniel M; Berkson, Arthur J


    The authors, in a previous article, described the long-term survival of a man with pancreatic cancer and metastases to the liver, treated with intravenous alpha-lipoic acid and oral low-dose naltrexone (ALA/N) without any adverse effects. He is alive and well 78 months after initial presentation. Three additional pancreatic cancer case studies are presented in this article. At the time of this writing, the first patient, GB, is alive and well 39 months after presenting with adenocarcinoma of the pancreas with metastases to the liver. The second patient, JK, who presented to the clinic with the same diagnosis was treated with the ALA/N protocol and after 5 months of therapy, PET scan demonstrated no evidence of disease. The third patient, RC, in addition to his pancreatic cancer with liver and retroperitoneal metastases, has a history of B-cell lymphoma and prostate adenocarcinoma. After 4 months of the ALA/N protocol his PET scan demonstrated no signs of cancer. In this article, the authors discuss the poly activity of ALA: as an agent that reduces oxidative stress, its ability to stabilize NF(k)B, its ability to stimulate pro-oxidant apoptosic activity, and its discriminative ability to discourage the proliferation of malignant cells. In addition, the ability of lowdose naltrexone to modulate an endogenous immune response is discussed. This is the second article published on the ALA/N protocol and the authors believe the protocol warrants clinical trial.

  13. Colonic and Hepatic Modulation by Lipoic Acid and/or N-Acetylcysteine Supplementation in Mild Ulcerative Colitis Induced by Dextran Sodium Sulfate in Rats

    PubMed Central

    Moura, Fabiana Andréa; de Andrade, Kívia Queiroz; de Araújo, Orlando Roberto Pimentel; Santos, Juliana Célia de Farias


    Lipoic acid (LA) and N-acetylcysteine (NAC) are antioxidant and anti-inflammatory agents that have not yet been tested on mild ulcerative colitis (UC). This study aims to evaluate the action of LA and/or NAC, on oxidative stress and inflammation markers in colonic and hepatic rat tissues with mild UC, induced by dextran sodium sulfate (DSS) (2% w/v). LA and/or NAC (100 mg·kg·day−1, each) were given, once a day, in the diet, in a pretreatment phase (7 days) and during UC induction (5 days). Colitis induction was confirmed by histological and biochemical analyses (high performance liquid chromatography, spectrophotometry, and Multiplex®). A redox imbalance occurred before an immunological disruption in the colon. NAC led to a decrease in hydrogen peroxide (H2O2), malondialdehyde (MDA) levels, and myeloperoxidase activity. In the liver, DSS did not cause damage but treatments with both antioxidants were potentially harmful, with LA increasing MDA and LA + NAC increasing H2O2, tumor necrosis factor alpha, interferon gamma, and transaminases. In summary, NAC exhibited the highest colonic antioxidant and anti-inflammatory activity, while LA + NAC caused hepatic damage. PMID:27957238

  14. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading

    PubMed Central

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan


    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with Identifier: NCT02439879. PMID:26345602

  15. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading.


    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan


    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with Identifier: NCT02439879.

  16. Combination of N-acetylcysteine, α-lipoic acid and α-tocopherol substantially prevents the brain synaptosomal alterations and memory and learning deficits of aged rats.


    Thakurta, Ishita Guha; Banerjee, Priyanjalee; Bagh, Maria Bindu; Ghosh, Arindam; Sahoo, Arghyadip; Chattopadhyay, Sita; Chakrabarti, Sasanka


    This study has compared several synaptosomal parameters in three groups of rats: young (46 months), aged (22-24 months) and antioxidant supplemented aged rats (antioxidant supplementation given with the diet as a combination of N-acetylcysteine, α-lipoic acid and α-tocopherol from 18 months onwards till 22-24 months). The synaptosomes from aged rat brain, in comparison to those of young animals, exhibit an increased membrane potential with altered contents of Na(+) and K(+) under basal incubation condition and in the presence of depolarizing agents. The intrasynaptosomal Ca(2+) is also higher in aged than in young rat. These age-dependent changes in synaptosomal parameters are prevented markedly in the antioxidant supplemented group. When examined on T-maze, the aged animals are noticeably impaired in learning and memory functions, but the deficit is remarkably prevented in the antioxidant supplemented aged animals. It is suggested that the synaptosomal alterations partly contribute to the cognitive deficits of aged animals, and both are rescued by long-term antioxidant supplementation.

  17. Ameliorative effects of α-lipoic acid on high-fat diet-induced oxidative stress and glucose uptake impairment of T cells.


    Cui, Jue; Huang, Dejian; Zheng, Yi


    The incidence of obesity and metabolic disease continues to rise, mainly associated with consumption of a high-fat diet (HFD). Previous studies have indicated that HFD could disturb the immune system, leading to immunodeficiency and inflammation. Several mechanisms have been postulated to account for immunodeficiency associated with HFD, one being oxidative stress. To further investigate the effects of HFD on glucose metabolism and proliferative capability of T cells and the protective effects of α-lipoic acid (LA), male C57BL/6J mice were fed a normal chow (10% fat), an HFD (60% fat), an LA supplement (HFD +0.1%LA), and a N-acetyl-L-cysteine supplement (HFD +0.1% NAC) for 10 weeks. Results showed that 10-week HFD increased intracellular reactive oxygen species (ROS) production, induced oxidative stress state formation, inhibited glucose uptake, decreased ATP concentration, reduced proliferative rate, and dampened IL-2 production of T cells of mice. Administration of LA significantly alleviated these changes induced by HFD. These findings reveal that oxidative stress of T cells caused by HFD may be a key factor leading to glucose metabolism reduction and proliferative capability and function impairment of T cells. LA, as a potent agonist, could promote Nrf2 nuclear translocation and up-regulate expression of Nrf2 target genes (Ho-1 and Prdx1), which can eliminate excess ROS and restore redox balance of cells.

  18. Alpha-lipoic acid supplementation reduces mTORC1 signaling in skeletal muscle from high fat fed, obese Zucker rats.


    Li, Zhuyun; Dungan, Cory M; Carrier, Bradley; Rideout, Todd C; Williamson, David L


    The mammalian target of rapamycin (mTOR) signaling pathway is hyperactive in liver, adipose and skeletal muscle tissues of obese rodents. Alpha-lipoic acid (αLA) has been well accepted as a weight-loss treatment, though there are limited studies on its effect on mTOR signaling in high-fat fed, obese rodents. Therefore, the goal of this study was to determine mTOR signaling and oxidative protein alterations in skeletal muscle of high-fat fed, obese rats after αLA supplementation. Phosphorylation of the mTOR substrate, eukaryotic initiation factor (eIF) 4E-binding protein 1 (4E-BP1) and eIF4B were significantly reduced (p < 0.05) in muscle from αLA supplemented rats. Activation of AMP-activated protein kinase (AMPK), an mTOR inhibitory kinase, was higher (p < 0.05) in the αLA group. Protein expression of markers of oxidative metabolism, acetyl CoA carboxylase (ACC), cytochrome c oxidase IV (COX IV), peroxisome proliferator-activated receptor (PPAR), and PPAR gamma coactivator 1-alpha (PGC-1α) were significantly higher (p < 0.05) after αLA supplementation compared to non-supplemented group. Our findings show that αLA supplementation limits the negative ramifications of consuming a high fat diet on skeletal muscle markers of oxidative metabolism and mTORC1 signaling.

  19. Prevention and partial reversal of diabetes-induced changes in enteric nerves of the rat ileum by combined treatment with alpha-lipoic acid and evening primrose oil.


    Shotton, Hannah R; Broadbent, Steven; Lincoln, Jill


    Treatment with alpha-lipoic acid (LA) or evening primrose oil (EPO), individually, fails to prevent diabetes-induced changes in enteric nerves. Since synergy between these treatments has been reported, the aim was to investigate the effectiveness of combined LA/EPO treatment. LA and EPO were administered in the diet (approximately 80 and 200 mg/kg/day, respectively) to control and diabetic (induced by streptozotocin, 65 mg/kg, i.p.) rats. For prevention, treatment started after 1 week and lasted 7 weeks. For reversal, treatment lasted 4 weeks and was initiated after 8 weeks. Nerves supplying the ileum containing vasoactive intestinal polypeptide (VIP), calcitonin gene-related peptide (CGRP) and noradrenaline (NA) were examined immunohistochemically or biochemically. Diabetes caused a significant increase in VIP-containing cell bodies (p<0.001), decrease in NA content (p<0.01) and loss of CGRP-immunoreactivity. LA/EPO treatment totally prevented diabetes-induced changes in VIP (p<0.001) and CGRP and partially reversed (p<0.05) these changes once they had been allowed to develop. In contrast, treatment had no effect on diabetes-induced changes in NA-containing nerves. Therefore, LA and EPO are only effective at treating diabetes-induced changes in some enteric nerves when administered in combination. However, diabetes-induced changes in NA-containing nerves are resistant to treatment.

  20. Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets.


    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng


    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens.

  1. Combined R-alpha-lipoic acid and acetyl-L-carnitine exerts efficient preventative effects in a cellular model of Parkinson's disease.


    Zhang, Hongyu; Jia, Haiqun; Liu, Jianghai; Ao, Ni; Yan, Bing; Shen, Weili; Wang, Xuemin; Li, Xin; Luo, Cheng; Liu, Jiankang


    Mitochondrial dysfunction and oxidative damage are highly involved in the pathogenesis of Parkinson's disease (PD). Some mitochondrial antioxidants/nutrients that can improve mitochondrial function and/or attenuate oxidative damage have been implicated in PD therapy. However, few studies have evaluated the preventative effects of a combination of mitochondrial antioxidants/nutrients against PD, and even fewer have sought to optimize the doses of the combined agents. The present study examined the preventative effects of two mitochondrial antioxidant/nutrients, R-alpha-lipoic acid (LA) and acetyl-L-carnitine (ALC), in a chronic rotenone-induced cellular model of PD. We demonstrated that 4-week pretreatment with LA and/or ALC effectively protected SK-N-MC human neuroblastoma cells against rotenone-induced mitochondrial dysfunction, oxidative damage and accumulation of alpha-synuclein and ubiquitin. Most notably, we found that when combined, LA and ALC worked at 100-1000-fold lower concentrations than they did individually. We also found that pretreatment with combined LA and ALC increased mitochondrial biogenesis and decreased production of reactive oxygen species through the up-regulation of the peroxisome proliferator-activated receptor-gamma coactivator 1alpha as a possible underlying mechanism. This study provides important evidence that combining mitochondrial antioxidant/nutrients at optimal doses might be an effective and safe prevention strategy for PD.

  2. Multiple protective mechanisms of alpha-lipoic acid in oxidation, apoptosis and inflammation against hydrogen peroxide induced toxicity in human lymphocytes.


    Rahimifard, Mahban; Navaei-Nigjeh, Mona; Baeeri, Maryam; Maqbool, Faheem; Abdollahi, Mohammad


    The naturally antioxidant and coenzyme, alpha-lipoic acid (α-LA), has gained considerable attention regarding different functions and therapeutically effective in treating oxidative stress-associated diseases in the human body. This study was designed to examine the protective effect of α-LA against H2O2-induced oxidative stress and apoptosis in human lymphoid cells. Human peripheral blood lymphocytes were preincubated with α-LA and then exposed to H2O2. After that, the viability of the cells, rate of apoptosis, oxidative stress biomarkers such as reactive oxygen species (ROS) and level of lipid peroxidation (LPO), and also tumor necrosis factor-α (TNF-α) were studied. Pretreatment of lymphocytes with α-LA, dramatically enhanced viability of the cells and decreased apoptosis. Investigation of caspases gives a clear picture of the mechanism by which α-LA decreases ROS and causes a reduction in apoptosis through caspase-9-dependent mitochondrial pathway. Furthermore, α-LA dose dependently decreased oxidative stress by a reduction in level of LPO, and the dose of 1000 µM indicates a significant decrease (p < 0.01) in TNF-α level. Collectively, the present data show that α-LA is an ideal compound which has profound protective effects on oxidation, inflammation, and apoptosis. As a result, α-LA may indicate a new way toward the development of antioxidant therapy.

  3. Synergistic ameliorative effects of sesame oil and alpha-lipoic acid against subacute diazinon toxicity in rats: hematological, biochemical, and antioxidant studies.


    Abdel-Daim, Mohamed M; Taha, Ramadan; Ghazy, Emad W; El-Sayed, Yasser S


    Diazinon (DZN) is a common organophosphorus insecticide extensively used for agriculture and veterinary purposes. DZN toxicity is not limited to insects; it also induces harmful effects in mammals and birds. Our experiment evaluated the protective and antioxidant potential of sesame oil (SO) and (or) alpha-lipoic acid (ALA) against DZN toxicity in male Wistar albino rats. DZN-treated animals exhibited macrocytic hypochromic anemia and significant increases in serum biochemical parameters related to liver injury, including aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), γ-glutamyl transferase (γGT), cholesterol, and triglycerides. They also had elevated levels of markers related to cardiac injury, such as lactate dehydrogenase (LDH) and creatine phosphokinase (CPK), and increased biomarkers of renal injury, urea and creatinine. DZN also increased hepatic, renal, and cardiac lipid peroxidation and decreased antioxidant biomarker levels. SO and (or) ALA supplementation ameliorated the deleterious effects of DZN intoxication. Treatment improved hematology and serum parameters, enhanced endogenous antioxidant status, and reduced lipid peroxidation. Importantly, they exerted synergistic hepatoprotective, nephroprotective, and cardioprotective effects. Our findings demonstrate that SO and (or) ALA supplementation can alleviate the toxic effects of DZN via their potent antioxidant and free radical-scavenging activities.

  4. The protective role of DL-alpha-lipoic acid in the oxidative vulnerability triggered by Abeta-amyloid vaccination in mice.


    Jesudason, E Philip; Masilamoni, J Gunasingh; Jesudoss, K Samuel; Jayakumar, R


    Recent reports indicate that beta-amyloid peptide (Abeta) vaccine based therapy for Alzheimer's disease (AD) may be on the horizon. There are however, concerns about the safety of this approach. Immunization with Abeta has several disadvantages, because it crosses the blood brain barrier and cause inflammation and neurotoxicity. The present work is aimed to study the protective effective of alpha-lipoic acid (LA) in the oxidative vulnerability of beta-amyloid in plasma, liver, spleen and brain, when Abeta fibrils are given intraperitoneally in inflammation induced mice. Result shows that reactive oxygen species (ROS) in the astrocytes of inflammation induced mice along with Abeta (IA) has shown 2.5-fold increase when compared with LA treated mice. The increased level of lipid peroxidase (LPO) (p < 0.05) and decreased antioxidant status (p < 0.05) were observed in the plasma, liver, spleen and brain of LA induced mice when compared with LA treated mice. Data shows that there were no significant changes observed between the control and LA treated mice. Our biochemical and histological results highlight that significant oxidative vulnerability was observed in IA treated mice, which was prevented by LA therapy. Our findings suggest that the antioxidant effect of LA when induced with Abeta may serve as a potent therapeutic tool for inflammatory AD models.

  5. The Protective Effect of Alpha-Lipoic Acid in Lipopolysaccharide-Induced Acute Lung Injury Is Mediated by Heme Oxygenase-1

    PubMed Central

    Lin, Yu-Chieh; Lai, Yuan-Shu; Chou, Tz-Chong


    Alpha-lipoic acid (ALA), occurring naturally in human food, is known to possess antioxidative and anti-inflammatory activities. Induction of heme oxygenase-1 (HO-1) has been reported to exhibit a therapeutic effect in several inflammatory diseases. The aim of study was to test the hypothesis that the protection of ALA against lipopolysaccharide-(LPS-) induced acute lung injury (ALI) is mediated by HO-1. Pre- or posttreatment with ALA significantly inhibited LPS-induced histological alterations of ALI, lung tissue edema, and production of proinflammatory cytokine, cytokine inducible neutrophil chemoattractant-3, and nitrite/nitrate in bronchoalveolar lavage fluid. In addition, the inflammatory responses including elevation of superoxide formation, myeloperoxidase activity, polymorphonuclear neutrophils infiltration, nitrotyrosine, inducible nitric oxide synthase expression and nuclear factor-kappa B (NF-κB) activation in lung tissues of LPS-instilled rats were also markedly reduced by ALA. Interestingly, treatment with ALA significantly increased nuclear factor-erythroid 2-related factor 2 (Nrf2) activation and HO-1 expression in lungs of ALI. However, blocking HO-1 activity by tin protoporphyrin IX (SnPP), an HO-1 inhibitor, markedly abolished these beneficial effects of ALA in LPS-induced ALI. These results suggest that the protection mechanism of ALA may be through HO-1 induction and in turn suppressing NF-κB-mediated inflammatory responses. PMID:23573137

  6. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  7. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  8. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  9. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  10. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  11. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  12. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  13. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  14. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  15. Isolated menthone reductase and nucleic acid molecules encoding same


    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L


    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  16. Alpha-Lipoic Acid Reduces LDL-Particle Number and PCSK9 Concentrations in High-Fat Fed Obese Zucker Rats

    PubMed Central

    Carrier, Bradley; Wen, Shin; Zigouras, Sophia; Browne, Richard W.; Li, Zhuyun; Patel, Mulchand S.; Williamson, David L.; Rideout, Todd C.


    We characterized the hypolipidemic effects of alpha-lipoic acid (LA, R-form) and examined the associated molecular mechanisms in a high fat fed Zucker rat model. Rats (n = 8) were assigned to a high fat (HF) diet or the HF diet with 0.25% LA (HF-LA) for 30 days and pair fed to remove confounding effects associated with the anorectic properties of LA. Compared with the HF controls, the HF-LA group was protected against diet-induced obesity (102.5±3.1 vs. 121.5±3.6,% change BW) and hypercholesterolemia with a reduction in total-C (−21%), non-HDL-C (−25%), LDL-C (−16%), and total LDL particle number (−46%) and an increase in total HDL particles (∼22%). This cholesterol-lowering response was associated with a reduction in plasma PCSK9 concentration (−70%) and an increase in hepatic LDLr receptor protein abundance (2 fold of HF). Compared with the HF-fed animals, livers of LA-supplemented animals were protected against TG accumulation (−46%), likely through multiple mechanisms including: a suppressed lipogenic response (down-regulation of hepatic acetyl-CoA carboxylase and fatty acid synthase expression); enhanced hepatic fat oxidation (increased carnitine palmitoyltransferase Iα expression); and enhanced VLDL export (increased hepatic diacylglycerol acyltransferase and microsomal triglyceride transfer protein expression and elevated plasma VLDL particle number). Study results also support an enhanced fatty acid uptake (2.8 fold increase in total lipase activity) and oxidation (increased CPT1β protein abundance) in muscle tissue in LA-supplemented animals compared with the HF group. In summary, in the absence of a change in caloric intake, LA was effective in protecting against hypercholesterolemia and hepatic fat accumulation under conditions of strong genetic and dietary predisposition toward obesity and dyslipidemia. PMID:24595397

  17. Chemical derivatization combined with capillary LC or MALDI-TOF MS for trace determination of lipoic acid in cosmetics and integrated protein expression profiling in human keratinocytes.


    Tsai, Chia-Ju; Lin, Ying-Chi; Chen, Yen-Ling; Feng, Chia-Hsien


    Lipoic acid (LA) is an essential cofactor in mitochondrial enzymes and an ideal antioxidant in prokaryotic and eukaryotic cells. Capillary liquid chromatography coupled with ultraviolet detection (CapLC-UV) and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) are two environmentally friendly methods for determining LA. In this study, a pre-column microwave-assisted derivatization with 4-bromomethyl-6,7-dimethoxycoumarin enhanced the UV absorbance of LA and was monitored at 345 nm by CapLC-UV. Gradient separation was performed using a reversed-phase C18 column with a mobile phase consisting of acetonitrile-0.1% formic acid solution. The ionization of LA was increased, and the LA derivative was detected by MALDI-TOF MS at m/z 683 with an α-cyano-4-hydroxycinnamic acid matrix. The linear response ranged from 0.1 to 40 μM with a correlation coefficient of 0.999. The CapLC-UV and MALDI-TOF MS had detection limits of 5 and 4 fmol, respectively. These methods effectively detected LA in dietary supplements and cosmetics. Cellular proteomes of a human keratinocyte cell line (HaCaT) irradiated with UV radiation were also compared with and without LA treatment. The cellular proteomes were identified by nanoultra performance LC with LTQ Orbitrap system after trypsin digestion. Protein identification was performed by simultaneous peptide sequencing and MASCOT search. The analysis revealed changes in several proteins, including CDC42, TPI1, HNRPA2B1, PRDX1, PTGES3 and MYL6.

  18. Genetically encoded fluorescent coumarin amino acids


    Wang, Jiangyun [San Diego, CA; Xie, Jianming [San Diego, CA; Schultz, Peter G [La Jolla, CA


    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  19. Genetically encoded fluorescent coumarin amino acids


    Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.


    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl) ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  20. Lipoic acid inhibits the DNA repair protein O 6-methylguanine-DNA methyltransferase (MGMT) and triggers its depletion in colorectal cancer cells with concomitant autophagy induction.


    Göder, Anja; Nagel, Georg; Kraus, Alexander; Dörsam, Bastian; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg


    Alkylating agents are present in food and tobacco smoke, but are also used in cancer chemotherapy, inducing the DNA lesion O (6)-methylguanine. This critical adduct is repaired by O (6)-methylguanine-DNA methyltransferase (MGMT), resulting in MGMT inactivation and degradation. In the present study, we analyzed the effects of the natural disulfide compound lipoic acid (LA) on MGMT in vitro and in colorectal cancer cells. We show that LA, but not its reduced form dihydrolipoic acid, potently inhibits the activity of recombinant MGMT by interfering with its catalytic Cys-145 residue, which was partially reversible by N-acetyl cysteine. Incubation of HCT116 colorectal cancer cells with LA altered their glutathione pool and caused a decline in MGMT activity. This was mirrored by LA-induced depletion of MGMT protein, which was not attributable to changes in MGMT messenger RNA levels. Loss of MGMT protein coincided with LA-induced autophagy, a process resulting in lysosomal degradation of proteins, including presumably MGMT. LA-stimulated autophagy in a p53-independent manner as revealed by the response of isogenic HCT116 cell lines. Knockdown of the crucial autophagy component beclin-1 and chemical inhibitors blocked LA-induced autophagy, but did not abrogate LA-triggered MGMT degradation. Concomitant with MGMT depletion, LA pretreatment resulted in enhanced O (6)-methylguanine levels in DNA. It also increased the cytotoxicity of the alkylating anticancer drug temozolomide in temozolomide-resistant colorectal cancer cells. Taken together, our study showed that the natural compound LA inhibits MGMT and induces autophagy. Furthermore, LA enhanced the cytotoxic effects of temozolomide, which makes it a candidate for a supplement in cancer therapy.

  1. Antioxidant properties of alpha-lipoic acid: effects on red blood membrane permeability and adaptation of isolated rat heart to reversible ischemia.


    Ghibu, S; Lauzier, B; Delemasure, S; Amoureux, S; Sicard, P; Vergely, C; Muresan, A; Mogosan, C; Rochette, L


    The aim of our work was to study (1) the antioxidant properties of lipoic acid (LA) and its reduced metabolite dihydrolipoic acid (DHLA) formed by reduction of LA and (2) the effects of treatment with LA and DHLA on (a) K(+) efflux from human red blood cells and (b) post-ischemic recovery and oxidative stress in isolated perfused rat hearts challenged with an ischemia-reperfusion (IR) sequence. In vitro, we used xanthine and xanthine oxidase to generate superoxide anion, which is not directly measurable by electron paramagnetic resonance (EPR), but specifically oxidizes the spin probe CPH into an EPR-detectable long lasting CP(*) nitroxide radical. While 5 mM of LA was ineffective in reducing the kinetics of CP(*) nitroxide formation, DHLA was shown to lessen this rate in a dose-dependent manner and at 30 mM was even more efficient than 300 UI/ml SOD. These results are in agreement with the fact that DHLA is able to directly scavenge superoxide anion. Red cells are a good model to investigate oxidative damage in biological membranes; hence, we used a suspension of erythrocytes incubated with 2,2(')-azobis(2-amidinopropane) hydrochloride (AAPH) which generates in vitro free radicals. DHLA provided more effective protection of red cells membranes than LA; DHLA was comparable to Trolox for its antioxidant potency. In vivo, treatment of rats (50 mg/kg/day i.p. for 7 days) with LA induced a slight increase in coronary flow (CF) in isolated perfused hearts, after 30 min of global total ischemia. This effect was not associated with an improvement in contractile function and reduction of myocardial oxidative stress. In conclusion, because of their ability to scavenge free radicals, LA and to an even greater degree DHLA were able to protect the membranes of red blood cells. This finding suggests that LA and DHLA might be useful in the treatment of diseases associated with oxidative stress such as diabetes.

  2. Fluorescence upconversion microbarcodes for multiplexed biological detection: nucleic acid encoding.


    Zhang, Fan; Shi, Qihui; Zhang, Yichi; Shi, Yifeng; Ding, Kunlun; Zhao, Dongyuan; Stucky, Galen D


    Fluoride rare-earth-doped upconversion microbarcodes have been successfully developed for multiplexed signaling and nucleic-acid encoding. This kind of novel barcode material can be used for rapid and sensitive analysis of nucleic acids and antigens, which would have many potential applications in clinical, food, and environment detection.

  3. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    PubMed Central

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves II, H. James


    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or “chemistry space.” Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set. PMID:25802223

  4. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    NASA Astrophysics Data System (ADS)

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves, H. James, II


    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or ``chemistry space.'' Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set.

  5. Nucleic acids encoding metal uptake transporters and their uses


    Schroeder, Julian I.; Antosiewicz, Danuta M.; Schachtman, Daniel P.; Clemens, Stephan


    The invention provides LCT1 nucleic acids which encode metal ion uptake transporters. The invention also provides methods of modulating heavy metal and alkali metal uptake in plants. The methods involve producing transgenic plants comprising a recombinant expression cassette containing an LCT1 nucleic acid linked to a plant promoter.

  6. Alpha-lipoic acid and N-acetylcysteine protects intensive swimming exercise-mediated germ-cell depletion, pro-oxidant generation, and alteration of steroidogenesis in rat testis.


    Jana, Kuladip; Dutta, Ananya; Chakraborty, Pratip; Manna, Indranil; Firdaus, Syed Benazir; Bandyopadhyay, Debasish; Chattopadhyay, Ratna; Chakravarty, Baidyanath


    Prolonged and strenuous exercise has been proposed as a possible source of male-factor infertility. Forced intensive swimming has also been identified as one source of a dysfunctional male reproduction system. The present study evaluated the possible protective role of α-lipoic acid and N-acetylcysteine (NAC) on intensive swimming-induced germ-cell depletion in adult male rats. Forced exhaustive swimming of 1 hr/day, 6 days/week for 8 consecutive weeks resulted in a significant (P < 0.05) reduction in epididymal sperm; testicular androgenic enzyme activities; and plasma and intra-testicular testosterone; and produced different types of germ cells in the seminiferous epithelium cycle. Conversely, plasma corticosterone levels and sperm-head abnormalities increased. Western-blot analysis showed a considerable decrease in testicular StAR protein expression whereas reverse-transcriptase PCR analysis showed no significant change in cytochrome P450scc (Cyp11a1) gene expression. Significant (P < 0.05) elevation in testicular reactive oxygen species (ROS), lipid peroxidation, protein carbonyl content versus reduction in glucose-6-phosphate dehydrogenase, glutathione peroxidase, glutathione S-transferase, and caspase-3 activities along with a depletion in the glutathione pool, mitochondrial membrane potential (▵ψm ), and intracellular ATP generation. A considerable level of DNA damage in testicular spermatogenic cells were also noted following forced extensive swimming. Alpha-lipoic acid and NAC supplementation prevented the swimming-induced testicular spermatogenic and steroidogenic disorders by lowering ROS generation. We therefore conclude that intensive forced swimming causes germ-cell depletion through the generation of ROS and depletion of steroidogenesis in the testis, which can be protected by the co-administration of α-lipoic acid and NAC.

  7. The antioxidant effect of DL-alpha-lipoic acid on copper-induced acute hepatitis in Long-Evans Cinnamon (LEC) rats.


    Yamamoto, H; Watanabe, T; Mizuno, H; Endo, K; Fukushige, J; Hosokawa, T; Kazusaka, A; Fujita, S


    The Long-Evans Cinnamon (LEC) rats, due to a genetic defect, accumulate excess copper (Cu) in the liver in a manner similar to patients with Wilson's disease and spontaneously develop acute hepatitis with severe jaundice. In this study we examined the protective effect of DL-alpha-Lipoic acid (LA) against acute hepatitis in LEC rats. LA was administered to LEC rats by gavage in doses of 10, 30 and 100 mg/kg five times per week, starting at 8-weeks-old and continuing till 12-weeks-old. Although LA had little effect against the increases in serum transaminase activities, it suppressed the loss of body weight and prevented severe jaundice in a dose-dependent manner. Antioxidant system analyses in liver showed that LA treatment significantly suppressed the inactivations of catalase and glutathione peroxidase, and the induction of heme oxygenase-1, an enzyme which is inducible under oxidative stress. Furthermore, LA showed dose-dependent suppressive effect against increase in nonheme iron contents of both cytosolic and crude mitochondrial fractions in a dose-dependent manner. Although at the highest dose, LA slightly suppressed the accumulation of Cu in crude mitochondrial fraction, it had no effect on the accumulation of Cu in cytosolic fraction. While LA completely suppressed the increase in lipid peroxidation (LPO) in the microsomal fraction at the highest dose, the suppressive effect against LPO in crude mitochondrial fractions was slight. From these results, it is concluded that LA has antioxidant effects at the molecular level against the development of Cu-induced hepatitis in LEC rats. Moreover, mitochondrial oxidative damage might be involved in the development of acute hepatitis in LEC rats.

  8. Electroencephalographic study of chlorpromazine alone or combined with alpha-lipoic acid in a model of schizophrenia induced by ketamine in rats.


    Sampaio, Luis Rafael Leite; Borges, Lucas Teixeira Nunes; Barbosa, Talita Matias; Matos, Natalia Castelo Branco; Lima, Ricardo de Freitas; Oliveira, Mariana Nascimento de; Gularte, Viviane Nóbrega; Patrocínio, Manoel Cláudio Azevedo; Macêdo, Danielle; Vale, Otoni Cardoso do; Vasconcelos, Silvânia Maria Mendes de


    Schizophrenia is characterized by behavioral symptoms, brain function impairments and electroencephalographic (EEG) changes. Dysregulation of immune responses and oxidative imbalance underpins this mental disorder. The present study aimed to investigate the effects of the typical antipsychotic chlorpromazine (CP) alone or combined with the natural antioxidant alpha-lipoic acid (ALA) on changes in the hippocampal average spectral power induced by ketamine (KET). Three days after stereotactic implantation of electrodes, male Wistar rats were divided into groups treated for 10 days with saline (control) or KET (10 mg/kg, IP). CP (1 or 5 mg/kg, IP) alone or combined with ALA (100 mg/kg, P.O.) was administered 30 min before KET or saline. Hippocampal EEG recordings were taken on the 1st, 5th and 10th days of treatment immediately after the last drug administration. KET significantly increased average spectral power of delta and gamma-high bands on the 5th and 10th days of treatment when compared to control. Gamma low-band significantly increased on the 1st, 5th and 10th days when compared to control group. This effect of KET was prevented by CP alone or combined with ALA. Indeed, the combination of ALA 100 + CP1 potentiated the inhibitory effects of CP1 on gamma low-band oscillations. In conclusion, our results showed that KET presents excitatory and time-dependent effects on hippocampal EEG bands activity. KET excitatory effects on EEG were prevented by CP alone and in some situations potentiated by its combination with ALA.

  9. Acetyl-L-carnitine and lipoic acid improve mitochondrial abnormalities and serum levels of liver enzymes in a mouse model of nonalcoholic fatty liver disease.


    Kathirvel, Elango; Morgan, Kengathevy; French, Samuel W; Morgan, Timothy R


    Mitochondrial abnormalities are suggested to be associated with the development of nonalcoholic fatty liver. Liver mitochondrial content and function have been shown to improve in oral feeding of acetyl-L-carnitine (ALC) to rodents. Carnitine is involved in the transport of acyl-coenzyme A across the mitochondrial membrane to be used in mitochondrial β-oxidation. We hypothesized that oral administration ALC with the antioxidant lipoic acid (ALC + LA) would benefit nonalcoholic fatty liver. To test our hypothesis, we fed Balb/C mice a standard diet (SF) or SF with ALC + LA or high-fat diet (HF) or HF with ALC + LA for 6 months. Acetyl-L-carnitine and LA were dissolved at 0.2:0.1% (wt/vol) in drinking water, and mice were allowed free access to food and water. Along with physical parameters, insulin resistance (blood glucose, insulin, glucose tolerance), liver function (alanine transaminase [ALT], aspartate transaminase [AST]), liver histology (hematoxylin and eosin), oxidative stress (malondialdehyde), and mitochondrial abnormalities (carbamoyl phosphate synthase 1 and electron microscopy) were done. Compared with SF, HF had higher body, liver, liver-to-body weight ratio, white adipose tissue, ALT, AST, liver fat, oxidative stress, and insulin resistance. Coadministration of ALC + LA to HF animals significantly improved the mitochondrial marker carbamoyl phosphate synthase 1 and the size of the mitochondria in liver. Alanine transaminase and AST levels were decreased. In a nonalcoholic fatty liver mice model, ALC + LA combination improved liver mitochondrial content, size, serum ALT, and AST without significant changes in oxidative stress, insulin resistance, and liver fat accumulation.

  10. Effect of In Vitro Maturation Technique and Alpha Lipoic Acid Supplementation on Oocyte Maturation Rate: Focus on Oxidative Status of Oocytes

    PubMed Central

    Zavareh, Saeed; Karimi, Isaac; Salehnia, Mojdeh; Rahnama, Ali


    Background Therapeutic potential of in vitro maturation (IVM) in infertility is growing with great promise. Although significant progress is obtained in recent years, existing IVM protocols are far from favorable results. The first aim of this study was to investigate whether two step IVM manner change reactive oxygen species (ROS) and total anti- oxidant capacity (TAC) levels. The second aim was to find the effect of alpha lipoic acid (ALA) supplementation on oocyte maturation rate and on ROS/TAC levels during IVM. Materials and Methods In this experimental study, mouse germinal vesicle (GV) oocytes divided into cumulus denuded oocytes (DOs) and cumulus oocyte complexes (COCs) groups. GVs were matured in vitro in the presence or absence of ALA only for 18 hours (control) or with pre-culture of forskolin plus cilostamide for an additional 18 hours. Matured oocytes obtained following 18 and 36 hours based on experimental design. In parallel, the ROS and TAC levels were measured at different time (0, 18 and 36 hours) by 2',7'-dichlorodihydrofluorescein (DCFH) probe and ferric reducing/antioxidant power (FRAP) assay, respectively. Results Maturation rate of COCs was significantly higher than DOs in control group (P<0.05), while there was no significant difference between COCs and DOs when were pre-cultured with forskolin plus cilostamide. ROS and TAC levels was increased and decreased respectively in DOs after 18 hours while in COCs did not change at 18 hours and showed a significant increase and decrease respectively at 36 hours (P<0.05). ROS and TAC levels in the presence of ALA were significantly decreased and increased respectively after 36 hours (P<0.05) whereas, maturation rates of COCs and DOs were similar to their corresponding control groups. Conclusion ALA decreased ROS and increased TAC but could not affect maturation rate of both COCs and DOs in one or two step IVM manner. PMID:26985332

  11. α-Lipoic Acid Treatment Improves Vision-Related Quality of Life in Patients with Dry Age-Related Macular Degeneration.


    Tao, Yuan; Jiang, Pengfei; Wei, Yuhua; Wang, Ping; Sun, Xiaoling; Wang, Hong


    Dry form of age-related macular degeneration (AMD) constitutes 90% of AMD cases, and it is characterized by the formation of drusen under the retina and the slow breakdown of the light-sensing cells in the macula, which causes a gradual loss of central vision. Since oxidative stress is involved in the pathogenesis of dry AMD, α-lipoic acid (LA) with antioxidant properties was selected, and its effect on anti-oxidative markers and visual quality in patients with dry AMD was assessed. A total of 100 dry AMD patients (60-83 years old) were randomly assigned to LA treatment group (n = 50) and placebo control group (n = 50). We measured the serum superoxide dismutase (SOD) activity, an important marker of antioxidant defense, best-corrected visual acuity (BCVA), contrast sensitivity, and Chinese-Version Low Vision Quality of Life (CLVQOL) before and after LA or placebo intervention. Pearson correlation coefficients were calculated to explore the relationship between contrast sensitivity values and CLVQOL scores. There was a statistically significant increase in serum SOD activity after LA intervention. The CLVQOL score was improved significantly after LA treatment. The contrast sensitivity measured at middle and low spatial frequency was significantly higher after LA treatment. CLVQOL scores were positively correlated with contrast sensitivity at low spatial frequency (3 cyc/degree) in LA-treated group. These results indicate that LA treatment improves vision-related quality of life in patients with dry AMD probably by increasing antioxidant activity. Thus, LA can be regarded as a promising agent for the treatment of AMD.

  12. Inhibitory effect of α-lipoic acid on thioacetamide-induced tumor promotion through suppression of inflammatory cell responses in a two-stage hepatocarcinogenesis model in rats.


    Fujii, Yuta; Segawa, Risa; Kimura, Masayuki; Wang, Liyun; Ishii, Yuji; Yamamoto, Ryuichi; Morita, Reiko; Mitsumori, Kunitoshi; Shibutani, Makoto


    To investigate the protective effect of α-lipoic acid (a-LA) on the hepatocarcinogenic process promoted by thioacetamide (TAA), we used a two-stage liver carcinogenesis model in N-diethylnitrosamine (DEN)-initiated and TAA-promoted rats. We examined the modifying effect of co-administered a-LA on the liver tissue environment surrounding preneoplastic hepatocellular lesions, with particular focus on hepatic macrophages and the mechanism behind the decrease in apoptosis of cells surrounding preneoplastic hepatocellular lesions during the early stages of hepatocellular tumor promotion. TAA increased the number and area of glutathione S-transferase placental form (GST-P)(+) liver cell foci and the numbers of proliferating and apoptotic cells in the liver. Co-administration with a-LA suppressed these effects. TAA also increased the numbers of ED2(+), cyclooxygenase-2(+), and heme oxygenase-1(+) hepatic macrophages as well as the number of CD3(+) lymphocytes. These effects were also suppressed by a-LA. Transcript levels of some inflammation-related genes were upregulated by TAA and downregulated by a-LA in real-time RT-PCR analysis. Outside the GST-P(+) foci, a-LA reduced the numbers of apoptotic cells, active caspase-8(+) cells and death receptor (DR)-5(+) cells. These results suggest that hepatic macrophages producing proinflammatory factors may be activated in TAA-induced tumor promotion. a-LA may suppress tumor-promoting activity by suppressing the activation of these macrophages and the subsequent inflammatory responses. Furthermore, a-LA may suppress tumor-promoting activity by suppressing the DR5-mediated extrinsic pathway of apoptosis and the subsequent regeneration of liver cells outside GST-P(+) foci.

  13. The effect of dietary α-lipoic acid, betaine, l-carnitine, and swimming on the obesity of mice induced by a high-fat diet.


    Jang, Aera; Kim, Dongwook; Sung, Ki-Seung; Jung, Samooel; Kim, Hyun Joo; Jo, Cheorun


    We evaluate the effect of supplementation, at 300 mg kg(-1) body weight (BW), with the antioxidants α-lipoic acid (AL), betaine (BT), l-carnitine (LC), and the combination of these and exercise on obesity induced by a 9 week high-fat diet (HFD) in mice. Healthy 5 week-old male C57BL/6J mice were divided into 9 groups: (1) CON, control group fed with a commercial mice chow containing 10% crude fat; (2) HFD, high fat diet group fed with a commercial mice chow containing 60% crude fat; (3) HFD-AL, HFD group fed with AL; (4) HFD-BT, HFD group fed with BT; (5) HFD-LC, HFD group fed with LC; (6) HFD-SW, HFD with swimming as an exercise; (7) HFD-SWAL, HFD-AL with swimming; (8) HFD-SWBT, HFD-BT with swimming, and (9) HFD-SWLC, HFD-LC with swimming. The BW of mice with LC and swimming reduced the increase of BW after 9 weeks. Relative adipose tissue weights were reduced by the combinations of antioxidant supplementation and swimming. Levels of serum glucose and leptin were reduced in the HFD-SWLC group when compared with the HFD group. Serum triglyceride and total cholesterol and the size of adipose were also decreased in the HFD-LC and HFD-SWLC groups. These results show that LC at a dose of 300 mg kg(-1) BW was the most effective for reducing fat accumulation in mice with HFD for 9 weeks. In addition, exercise should be given in combination to enhance the BW reduction and serum lipid level.

  14. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same


    Croteau, Rodney Bruce; Burke, Charles Cullen


    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  15. Nucleic acids encoding antifungal polypeptides and uses thereof


    Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser


    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  16. Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof


    Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser


    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  17. Human jagged polypeptide, encoding nucleic acids and methods of use


    Li, Linheng; Hood, Leroy


    The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

  18. Effects of a medium chain triglyceride oil mixture and alpha-lipoic acid diet on body composition, antioxidant status, and plasma lipid levels in the Golden Syrian hamster.


    Wollin, Stephanie D; Wang, Yanwen; Kubow, Stan; Jones, Peter J H


    The objective of this study was to examine the effects of the antioxidant alpha-lipoic acid (ALP) versus a medium chain triglyceride oil mixture (MCTo), which was designed to increase energy expenditure and to improve lipid profiles containing medium chain triglycerides, phytosterols, and omega-3 fatty acids in the form of flaxseed oil. A total of 48 hamsters were fed a) hypercholesterolemic (HC) control, b) HC MCTo, c) HC ALP, or d) HC MCTo/ALP diet for 4 weeks. No differences were observed on food intake, body weight, total body water, lean and fat mass, and tissue thiobarbituric acid reactive substances (TBARS). ALP alone had no effect on total cholesterol (TC); however, MCTo feeding increased TC with (P < 0.03) and without (P < 0.003) ALP when compared with control. ALP increased HDL levels compared with control (P < 0.04) and MCTo/ALP (P < 0.007) groups. MCTo, with (P < 0.0001) or without (P < 0.006) ALP, increased non-HDL cholesterol levels versus control. The non-HDL:HDL cholesterol ratio was decreased by ALP compared with MCTo (45%) and MCTo/ALP (68%) (P < 0.0001), a similar trend was seen when compared with the HC control (22%) group (P < 0.14). Triglyceride levels were not altered by any dietary treatment. Liver and heart tissue reduced glutathione (GSH) was increased (P < 0.05) by all three treatments when compared with control. Both tissues showed an increase (P < 0.05) in oxidized glutathione (GSSG) when fed ALP as compared with other treatments. Hamsters fed ALP had a lower (P < 0.05) GSH/GSSG ratio compared with other treatment groups. In conclusion, MCTo feeding does not elicit beneficial effects on circulating plasma lipids and measures of body composition. In addition, our results do not clearly support an improvement in oxidative status through supplementation of ALP. However, our results do support the existence of beneficial effects of ALP on circulating lipoprotein content in the hamster.

  19. Safety and efficacy of an add-on therapy with curcumin phytosome and piperine and/or lipoic acid in subjects with a diagnosis of peripheral neuropathy treated with dexibuprofen

    PubMed Central

    Di Pierro, Francesco; Settembre, Roberto


    We conducted an 8-week, open, randomized controlled clinical trial on 141 subjects affected by neuropathic pain to investigate the role of an adjunctive therapy added to the administration of dexibuprofen (400 mg twice a day) and based on a multi-ingredient formula (Lipicur), consisting of lipoic acid plus curcumin phytosome and piperine, in patients with a diagnosis of lumbar sciatica, lumbar disk herniation, and/or lumbar canal stenosis (96 subjects), or with carpal tunnel syndrome (45 subjects). A total of 135 participants completed the study. Treatment with the multi-ingredient formula (Lipicur) reduced neuropathic pain by more than 66% in both conditions (subjects with lumbar sciatica and with carpal tunnel syndrome), and these reductions were statistically significant. Moreover, the treatment reduced dexibuprofen use by about 40%. An add-on therapy with only lipoic acid has not shown any significant results. On the basis of its safety and efficacy, Lipicur could be considered an effective complementary therapy to be added to conventional treatments to achieve better efficacy in reducing neuropathic pain. PMID:23861596

  20. Antioxidant alpha-lipoic acid inhibits osteoclast differentiation by reducing nuclear factor-kappaB DNA binding and prevents in vivo bone resorption induced by receptor activator of nuclear factor-kappaB ligand and tumor necrosis factor-alpha.


    Kim, Hyon Jong; Chang, Eun-Ju; Kim, Hyun-Man; Lee, Seung Bok; Kim, Hyun-Duck; Su Kim, Ghi; Kim, Hong-Hee


    The relationship between oxidative stress and bone mineral density or osteoporosis has recently been reported. As bone loss occurring in osteoporosis and inflammatory diseases is primarily due to increases in osteoclast number, reactive oxygen species (ROS) may be relevant to osteoclast differentiation, which requires receptor activator of nuclear factor-kappaB ligand (RANKL). Tumor necrosis factor-alpha (TNF-alpha) frequently present in inflammatory conditions has a profound synergy with RANKL in osteoclastogenesis. In this study, we investigated the effects of alpha-lipoic acid (alpha-LA), a strong antioxidant clinically used for some time, on osteoclast differentiation and bone resorption. At concentrations showing no growth inhibition, alpha-LA potently suppressed osteoclastogenesis from bone marrow-derived precursor cells driven either by a high-dose RANKL alone or by a low-dose RANKL plus TNF-alpha (RANKL/TNF-alpha). alpha-LA abolished ROS elevation by RANKL or RANKL/TNF-alpha and inhibited NF-kappaB activation in osteoclast precursor cells. Specifically, alpha-LA reduced DNA binding of NF-kappaB but did not inhibit IKK activation. Furthermore, alpha-LA greatly suppressed in vivo bone loss induced by RANKL or TNF-alpha in a calvarial remodeling model. Therefore, our data provide evidence that ROS plays an important role in osteoclast differentiation through NF-kappaB regulation and the antioxidant alpha-lipoic acid has a therapeutic potential for bone erosive diseases.

  1. Effects of dietary α-lipoic acid, acetyl-l-carnitine, and sex on antioxidative ability, energy, and lipid metabolism in broilers.


    Jia, R; Bao, Y H; Zhang, Y; Ji, C; Zhao, L H; Zhang, J Y; Gao, C Q; Ma, Q G


    An experiment was conducted to evaluate the effects of dietary α-lipoic acid (LA), acetyl-l-carnitine (ALC), and sex on antioxidative ability, energy, and lipid metabolism in broilers. A total of 972 one-day-old broilers with equal sex were randomly assigned in a 3 × 3 × 2 factorial design using 3 LA, 3 ALC levels, and 2 sexes (6 replications, 9 birds/replication). The LA and ALC levels were 0, 50, and 100 mg/kg, respectively. Results showed that increased LA or ALC resulted in increased total antioxidant capacity and superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities and decreased levels of malondialdehyde in serum and liver of birds (P < 0.05). In addition, with increasing addition of LA or ALC, an increased (P < 0.01) level of insulin (Ins), as well as decreased (P < 0.05) levels of glucose and glucagon (Glu), were observed in serum of broilers. Total cholesterol and triglyceride (TG) levels decreased (P < 0.05) and nonesterified fatty acid, lipoprotein lipase, and lipase levels increased (P < 0.05) in serum with increased administration of LA or ALC. Moreover, a significant (P < 0.05) interaction of LA × ALC was observed for serum and liver SOD, serum GSH-Px, glucose, and TG levels. Birds fed diets containing 50 mg/kg of LA and 50 mg/kg of ALC had higher serum and liver SOD activities and lower serum glucose and TG levels than those fed diets containing 100 mg/kg of LA or ALC alone. The main effect of sex and all interactions among main effects (except LA × ALC) were not significant (P > 0.05) for all of the above parameters. Overall, the present data indicate that LA or ALC supplementation, or both, at low levels (50 or 100 mg/kg) improved antioxidative ability, energy metabolism, and lipid metabolism in broilers, and synergistic effects by the combined supplementation of LA and ALC were indicated by serum and liver SOD activities and serum glucose and TG levels.

  2. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  3. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  4. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  5. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same


    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  6. Effects of Dietary Alpha-lipoic Acid and Acetyl-L-carnitine on Growth Performance and Meat Quality in Arbor Acres Broilers.


    Zhang, Yong; Jia, Ru; Ji, Cheng; Ma, Qiugang; Huang, Jin; Yin, Haicheng; Liu, Laiting


    An experiment was conducted to evaluate the effects of dietary alpha-lipoic acid (LA) and acetyl-L-carnitine (ALC) on growth performance, carcass characteristics and meat quality in Arbor Acres broilers. A total of 486 1-d-old male Arbor Acres broilers were randomly allocated to 9 dietary treatments, 9 treatments were group A (0 mg/kg LA and 0 mg/kg ALC), group B (50 mg/kg LA and 0 mg/kg ALC), group C (100 mg/kg LA and 0 mg/kg ALC), group D (0 mg/kg LA and 50 mg/kg ALC), group E (50 mg/kg LA and 50 mg/kg ALC), group F (100 mg/kg LA and 50 mg/kg ALC), group G (0 mg/kg LA and 100 mg/kg ALC), group H (50 mg/kg LA and 100 mg/kg ALC), group I (100 mg/kg LA and 100 mg/kg ALC). Birds were slaughtered at 42 days old. Average daily gain (ADG), average feed intake (AFI), feed conversion rate (FCR), eviscerated rate, breast muscle percentage, thigh muscle percentage, abdominal fat percentage, liver weight, muscle color (L* value, a* value, b* value), pH values at 45 min and 24 h postmortem were measured. Results showed that there existed an interaction between LA and ALC in growth performance of broilers, carcass traits and meat quality. The overall result is that high level of LA and ALC led to lower AFI, ADG (p<0.01), lower abdominal fat percentage, liver weight (p<0.01), lower L* value, a* value, and b* value of breast muscle, L* value of thigh muscle (p<0.05), and higher FCR (p<0.01), eviscerated rate (p<0.01), breast muscle percentage, thigh muscle percentage (p<0.05), a* value, pH 45 min and pH 24 h of thigh muscle (p<0.01). These results suggested that dietary LA and ALC contributed to the improvement of meat quality in broilers.

  7. Enhancement of lipid stability of broiler breast meat and meat products fed on alpha lipoic acid and alpha tocopherol acetate supplemented feed

    PubMed Central


    This study was designed to investigate the effect of alpha lipoic acid (ALA) and alpha tocopherol acetate (ATA) on the antioxidant potential, lipid stability and the quality of the broiler breast meat and meat products. The treatment plan was as (T1 = control feed, T2 = 200 mg ATA + 25 mg ALA/kg feed, T3 = 200 mg ATA + 75 mg ALA/kg feed, T4 = 200 mg ATA + 150 mg ALA/kg feed, T5 = Oxidized oil (4%), T6 = 200 mg ATA + 150 mg ALA + Oxidized oil (4%)/kg feed). After two weeks of acclimatization the birds were fed with ALA and ATA enriched diet. The results revealed that maximum deposition of ALA took place in T4 which contain maximum dose of ALA. The TBARS and DPPH values of the broiler breast meat were in T4 (0.14 ± 0.01 MDA/kg of meat, 76.69 ± 0.14%) and in T5 were (0.24 ± 0.15 MDA/Kg of meat, 44.98 ± 0.04%) accordingly. ATA concentration were also highest in T4 (206.43 ± 0.22 mg/g of meat) and lowest in T5 (79.09 ± 0.06 mg/g of meat). Sensory evaluation results showed that nuggets and patties made of T5 containing oxidized oil were least liked and T4 got highest score. In a nutshell, 150 mg/kg feed dietary supplementation of ALA with constant level of ATA can ameliorate the antioxidant potential, lipid stability and nutritional qualities of broiler breast meat and meat products. PMID:22640892

  8. Augmentation of cholinesterases and ATPase activities in the cerebellum and pons-medulla oblongata, by a combination of antioxidants (resveratrol, ascorbic acid, alpha-lipoic acid and vitamin E), in acutely lindane intoxicated mice.


    Bist, Renu; Bhatt, Devendra Kumar


    In the present investigation neurotoxic effects of lindane and the protective potential of a combination of antioxidants against lindane-induced toxicity were evaluated in Swiss mice. The investigation was carried out on acetylcholinesterase (AChE), butyrylcholinesterase (BChE) and adenosine triphosphatase (ATPase) activities of the cerebellum and pons-medulla oblongata. Healthy mice, 7-8 weeks old were administered acute dose of lindane (40 mg/kg b.w.), antioxidants, both lindane and antioxidants, and vehicle in four separate groups, subcutaneously. Resveratrol (Res), ascorbic acid (C), alpha-lipoic acid (ALA) and vitamin E (E) were used in the combination for neuroprotection at the concentration of 5 mg/kg b.w., 50 mg/kg b.w., 20 mg/kg b.w. and 50 mg/kg b.w. respectively. Enzymatic activities were used as biochemical marker for manifestation of lindane-induced acute toxicity. Protective effects of antioxidants were also evaluated using the same parameters. Treatment of lindane to normal control animals resulted in a significant decrease in AChE, BChE and ATPase levels in crude homogenates of cerebellum and pons-medulla. Antioxidants treatment significantly increased the levels of enzymes. Critical difference (CD) of AChE, BChE and ATPase levels in various groups was found significant at 1% in cerebellum and pons-medulla both (i.e. P<0.01).

  9. An anti-oxidant, α-lipoic acid conjugated oleoyl-sn-phosphatidylcholineas a helper lipid in cationic liposomal formulations.


    Dharmalingam, Priya; Marrapu, Balakrishna; Voshavar, Chandrashekhar; Nadella, Rasagna; Rangasami, Vignesh Kumar; Shaji, R V; Abbas, Salar; Prasad, R B N; Kaki, Shiva Shanker; Marepally, Srujan


    Development of safe non-viral carrier systems for efficient intra-cellular delivery of drugs and genes hold promise in the area of translational research. Liposome based delivery systems have emerged as one of the attractive strategies for efficient delivery of drugs and nucleic acids. To this end, number of investigations was carried on liposomal formulations using lipids for achieving higher efficiency in transfection with lower cytotoxicities. In our efforts to develop safer and efficient liposomal delivery systems, we synthesized a novel anti-oxidant lipid, α-lipoyl, oleyl-sn-phosphatidylcholine (LOPC) and used as a helper lipid in combination with a cationic amphiphile, Di-Stearyl Dihydroxy Ethyl Ammonium Chloride (DSDEAC) and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) at varying concentrations of LOPC. DNA binding properties of the liposomal formulations (DS, DS LA1, DS LA2 and DS LA3) revealed that increasing the percentage of single aliphatic chain lipid LOPC, did not affect the DNA binding properties. But, transfection profiles of these liposomal formulations in 3 different cell lines (HeLa, HEK 293 and MCF7) showed difference in their efficacies. Results showed that optimal percentage of LOPC i.e. 25% in DSDEAC and DOPC at 1:1 molar ratio (DS LA1) enhanced transfection as compared to DSDEAC:DOPC alone. The endosomal escape studies with NBD labelled lysotracker and Rhodamine labelled liposomal formulations revealed that DS LA1 and DS LA2 facilitated the release of genetic cargo with a better efficiency than their counter parts. Reactive Oxygen Species (ROS), a key modulator of necroptosis were lowered with the treatment of DS LA1 than other liposomal formulations. Here in, we present a novel liposomal formulation using DSDEAC and DOPC at 1:1 molar ratio doped with 25-50% (mole ratio) LOPC as an efficient delivery system for enhanced transfection with quenching of ROS levels compared to formulations without LOPC.

  10. Optimization of encoded hydrogel particles for nucleic acid quantification.


    Pregibon, Daniel C; Doyle, Patrick S


    The accurate quantification of nucleic acids is of utmost importance for clinical diagnostics, drug discovery, and basic science research. These applications require the concurrent measurement of multiple targets while demanding high-throughput analysis, high sensitivity, specificity between closely related targets, and a wide dynamic range. In attempt to create a technology that can simultaneously meet these demands, we recently developed a method of multiplexed analysis using encoded hydrogel particles. Here, we demonstrate tuning of hydrogel porosity with semi-interpenetrating networks of poly(ethylene glycol), develop a quantitative model to understand hybridization kinetics, and use the findings from these studies to enhance particle design for nucleic acid detection. With an optimized particle design and efficient fluorescent labeling scheme, we demonstrate subattomole sensitivity and single-nucleotide specificity for small RNA targets.

  11. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by DL-α-Lipoic Acid.


    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester C S; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba


    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3-1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1-3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants DL-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3-MST

  12. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by dl-α-Lipoic Acid

    PubMed Central

    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester CS; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba


    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3–1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1–3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants dl-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3

  13. The combination of N-acetyl cysteine, alpha-lipoic acid, and bromelain shows high anti-inflammatory properties in novel in vivo and in vitro models of endometriosis.


    Agostinis, C; Zorzet, S; De Leo, R; Zauli, G; De Seta, F; Bulla, R


    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory "marker" VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis.

  14. Amelioration of Behavioural, Biochemical, and Neurophysiological Deficits by Combination of Monosodium Glutamate with Resveratrol/Alpha-Lipoic Acid/Coenzyme Q10 in Rat Model of Cisplatin-Induced Peripheral Neuropathy

    PubMed Central

    Sanji, Tejaswi; Madakasira Guggilla, Hariprasad; Razdan, Rema


    Cisplatin or cis-diamminedichloroplatinum (II) (CDDP) is a cytotoxic chemotherapeutic agent with dose-dependent peripheral neuropathy as a foremost side effect characterised by ataxia, pain, and sensory impairment. Cumulative drug therapy of CDDP is known to produce severe oxidative damage. It mainly targets and accumulates in dorsal root ganglia that in turn cause damage resulting in secondary nerve fibre axonopathy. In the present study, we investigated the neuroprotective effect of the combination of monosodium glutamate (MSG) with three individual antioxidants, that is, resveratrol, alpha-lipoic acid (ALA), and coenzyme Q10 (CoQ10), in cisplatin (2 mg/kg i.p. twice weekly) induced peripheral neuropathy in rats. After 8 weeks of treatment the degree of neuroprotection was determined by measuring behavioral and electrophysiological properties and sciatic nerve lipid peroxidation, as well as glutathione and catalase levels. The results suggested that pretreatment with the combination of MSG (500 mg/kg/day po) with resveratrol (10 mg/kg/day i.p.) or ALA (20 mg/kg/day i.p.) or CoQ10 (10 mg/kg weekly thrice i.p.) exhibited neuroprotective effect. The maximum neuroprotection of MSG was observed in the combination with resveratrol. PMID:24489506

  15. The Combination of N-Acetyl Cysteine, Alpha-Lipoic Acid, and Bromelain Shows High Anti-Inflammatory Properties in Novel In Vivo and In Vitro Models of Endometriosis

    PubMed Central

    Agostinis, C.; Zorzet, S.; De Leo, R.; Zauli, G.; De Seta, F.; Bulla, R.


    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory “marker” VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis. PMID:25960622

  16. Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods


    Thompson, David N.; Thompson, Vicki S.; Schaller, Kastli D.; Apel, William A.; Lacey, Jeffrey A.; Reed, David W.


    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  17. Thermal and acid tolerant beta xylosidases, arabinofuranosidases, genes encoding, related organisms, and methods

    SciTech Connect

    Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A


    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  18. The effects of treatment with alpha-lipoic acid or evening primrose oil on vascular hemostatic and lipid risk factors, blood flow, and peripheral nerve conduction in the streptozotocin-diabetic rat.


    Ford, I; Cotter, M A; Cameron, N E; Greaves, M


    Oxidative stress and defective fatty acid metabolism in diabetes may lead to impaired nerve perfusion and contribute to the development of peripheral neuropathy. We studied the effects of 2-week treatments with evening primrose oil (EPO; n = 16) or the antioxidant alpha-lipoic acid (ALA; n = 16) on endoneurial blood flow, nerve conduction parameters, lipids, coagulation, and endothelial factors, in rats with streptozotocin-induced diabetes. Compared with their nondiabetic littermates, untreated diabetic rats had impaired sciatic motor and saphenous sensory nerve-conduction velocity (NCV; P <.001), reduced endoneurial blood flow (P <.001), and increased serum triglycerides (P <.01), cholesterol (P < 0.01), plasma factor VII (P <.0001), and von Willebrand factor (vWF; P <.0001). Plasma fibrinogen and serum high-density lipoprotein concentrations were not significantly different. Treatment with either ALA or EPO effectively corrected the deficits in NCV and endoneurial blood flow. ALA was associated with marked and statistically significant decreases in fibrinogen, factor VII, vWF, and triglycerides (P <.01, paired t tests before v after treatment). In contrast, EPO was associated with significant (P <.05) increases in fibrinogen, factor VII, vWF, triglycerides, and cholesterol and a significant decrease in high-density lipoprotein. Changes in levels of coagulation factors and lipids, qualitatively similar to those found with EPO, were obtained with a diet containing sunflower oil (to control for calorific and lipid content) or with a normal diet alone. Blood glucose and hematocrit levels were not significantly altered by treatments. These data suggest that although both ALA and EPO improve blood flow and nerve function, their actions on vascular factors differ. The marked effects of ALA in lowering lipid and hemostatic risk factors for cardiovascular disease indicate potential antithrombotic and antiatherosclerotic actions that could be of benefit in human diabetes

  19. Effects of Lipoic Acid Supplementation on Activities of Cyclooxygenases and Levels of Prostaglandins E2 and F2α Metabolites, in the Offspring of Rats with Streptozotocin-Induced Diabetes

    PubMed Central

    Oriquat, Ghaleb A.; Abu-Samak, Mahmoud; Al Hanbali, Othman A.; Salim, Maher D.


    Background. Our aim was to evaluate the protective effect of lipoic acid (LA) on fetal outcome of diabetic mothers. Methods. Diabetes was induced in female rats using streptozotocin and rats were made pregnant. Pregnant control (group 1; n = 9; and group 2; n = 7) or pregnant diabetic (group 3; n = 10; and group 4; n = 8) rats were treated daily with either LA (groups 2 and 4) or vehicle (groups 1 and 3) between gestational days 0 and 15. On day 15 of gestation, the fetuses, placentas, and membranes were dissected, examined morphologically, and then homogenized, to measure cyclooxygenase (COX) activities and metabolisms of prostaglandin (PG) E2 (PGEM) and PGF2α (PGFM) levels. The level of total glutathione was measured in the maternal liver and plasma and in all fetuses. Results. Supplementation of diabetic rats with LA was found to significantly (p < 0.05) reduce resorption rates in diabetic rats and led to a significant (p < 0.05) increase in liver, plasma, and fetuses total glutathione from LA-TD rats as compared to those from V-TD. Decreased levels of PGEM and elevated levels of PGFM in the fetuses, placentas, and membranes were characteristic of experimental diabetic gestation associated with malformation. The levels of PGEM in malformed fetuses from LA-TD mothers was significantly (p < 0.05) higher than those in malformed fetuses from V-TD rats. Conclusions. LA treatment did not completely prevent the occurrence of malformations. Thus, other factors may be involved in the pathogenesis of the diabetes-induced congenital malformations. PMID:28042582

  20. Anti-inflammatory effects of the selective phosphodiesterase 3 inhibitor, cilostazol, and antioxidants, enzymatically-modified isoquercitrin and α-lipoic acid, reduce dextran sulphate sodium-induced colorectal mucosal injury in mice.


    Kangawa, Yumi; Yoshida, Toshinori; Abe, Hajime; Seto, Yoshiki; Miyashita, Taishi; Nakamura, Michi; Kihara, Tohru; Hayashi, Shim-Mo; Shibutani, Makoto


    Developing effective treatments and preventing inflammatory bowel disease (IBD) are urgent challenges in improving patients' health. It has been suggested that platelet activation and reactive oxidative species generation are involved in the pathogenesis of IBD. We examined the inhibitory effects of a selective phosphodiesterase-3 inhibitor, cilostazol (CZ), and two antioxidants, enzymatically modified isoquercitrin (EMIQ) and α-lipoic acid (ALA), against dextran sulphate sodium (DSS)-induced colitis. BALB/c mice were treated with 0.3% CZ, 1.5% EMIQ, and 0.2% ALA in their feed. Colitis was induced by administering 5% DSS in drinking water for 8days. The inhibitory effects of these substances were evaluated by measuring relevant clinical symptoms (faecal blood, diarrhoea, and body weight loss), colon length, plasma cytokine and chemokine levels, whole genome gene expression, and histopathology. Diarrhoea was suppressed by each treatment, while CZ prevented shortening of the colon length. All treatment groups exhibited decreased plasma levels of interleukin (IL)-6 and tumour necrosis factor (TNF)-α compared with the DSS group. Microarray analysis showed that cell adhesion, cytoskeleton regulation, cell proliferation, and apoptosis, which might be related to inflammatory cell infiltration and mucosal healing, were affected in all the groups. DSS-induced mucosal injuries such as mucosal loss, submucosal oedema, and inflammatory cell infiltration in the distal colon were prevented by CZ or antioxidant treatment. These results suggest that anti-inflammatory effects of these agents reduced DSS-induced mucosal injuries in mice and, therefore, may provide therapeutic benefits in IBD.

  1. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation.


    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed


    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue.

  2. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation

    PubMed Central

    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed


    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue. PMID:25891652

  3. Age-associated mitochondrial oxidative decay: Improvement of carnitine acetyltransferase substrate-binding affinity and activity in brain by feeding old rats acetyl-l- carnitine and/or R-α-lipoic acid

    PubMed Central

    Liu, Jiankang; Killilea, David W.; Ames, Bruce N.


    We test whether the dysfunction with age of carnitine acetyltransferase (CAT), a key mitochondrial enzyme for fuel utilization, is due to decreased binding affinity for substrate and whether this substrate, fed to old rats, restores CAT activity. The kinetics of CAT were analyzed by using the brains of young and old rats and of old rats supplemented for 7 weeks with the CAT substrate acetyl-l-carnitine (ALCAR) and/or the mitochondrial antioxidant precursor R-α-lipoic acid (LA). Old rats, compared with young rats, showed a decrease in CAT activity and in CAT-binding affinity for both substrates, ALCAR and CoA. Feeding ALCAR or ALCAR plus LA to old rats significantly restored CAT-binding affinity for ALCAR and CoA, and CAT activity. To explore the underlying mechanism, lipid peroxidation and total iron and copper levels were assayed; all increased in old rats. Feeding old rats LA or LA plus ALCAR inhibited lipid peroxidation but did not decrease iron and copper levels. Ex vivo oxidation of young-rat brain with Fe(II) caused loss of CAT activity and binding affinity. In vitro oxidation of purified CAT with Fe(II) inactivated the enzyme but did not alter binding affinity. However, in vitro treatment of CAT with the lipid peroxidation products malondialdehyde or 4-hydroxy-nonenal caused a decrease in CAT-binding affinity and activity, thus mimicking age-related change. Preincubation of CAT with ALCAR or CoA prevented malondialdehyde-induced dysfunction. Thus, feeding old rats high levels of key mitochondrial metabolites can ameliorate oxidative damage, enzyme activity, substrate-binding affinity, and mitochondrial dysfunction. PMID:11854488

  4. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  5. BGL3 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  6. BGL6 .beta.-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  7. BGL7 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  8. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  9. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  10. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  11. BGL5 .beta.-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  12. BGL3 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  13. BGL4 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  14. BGL3 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  15. BGL7 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  16. BGL3 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  17. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  18. BGL4 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  19. Nucleic acids encoding mosaic clade M human immunodeficiency virus type 1 (HIV-1) envelope immunogens


    Korber, Bette T; Fischer, William; Liao, Hua-Xin; Haynes, Barton F; Letvin, Norman; Hahn, Beatrice H


    The present invention relates to nucleic acids encoding mosaic clade M HIV-1 Env polypeptides and to compositions and vectors comprising same. The nucleic acids of the invention are suitable for use in inducing an immune response to HIV-1 in a human.

  20. Minimal genome encoding proteins with constrained amino acid repertoire

    PubMed Central

    Tsoy, Olga; Yurieva, Marina; Kucharavy, Andrey; O'Reilly, Mary; Mushegian, Arcady


    Minimal bacterial gene set comprises the genetic elements needed for survival of engineered bacterium on a rich medium. This set is estimated to include 300–350 protein-coding genes. One way of simplifying an organism with such a minimal genome even further is to constrain the amino acid content of its proteins. In this study, comparative genomics approaches and the results of gene knockout experiments were used to extrapolate the minimal gene set of mollicutes, and bioinformatics combined with the knowledge-based analysis of the structure-function relationships in these proteins and their orthologs, paralogs and analogs was applied to examine the challenges of completely replacing the rarest residue, cysteine. Among several known functions of cysteine residues, their roles in the active centers of the enzymes responsible for deoxyribonucleoside synthesis and transfer RNA modification appear to be crucial, as no alternative chemistry is known for these reactions. Thus, drastic reduction of the content of the rarest amino acid in a minimal proteome appears to be possible, but its complete elimination is challenging. PMID:23873957

  1. Symmetrical and Thermodynamic Properties of Phenotypic Graphs of Amino Acids Encoded by the Primeval RNY Code

    NASA Astrophysics Data System (ADS)

    José, Marco V.; Zamudio, Gabriel S.; Palacios-Pérez, Miryam; Bobadilla, Juan R.; de Farías, Sávio Torres


    The 12 different types of graphs of the 8 amino acids encoded by the presumably primeval RNY code are derived. The symmetry groups of these graphs are analyzed and coincide with the corresponding values of polar requirement for each amino acid. The symmetry groups at the codon level are partially carried over as a group or subgroup at the amino acid level. Measures of centrality of the 12 graphs indicate that all amino acids were equally relevant irrespective of its chronological order of its appearance. The elimination of any amino acid would be strongly selected against and therefore the genetic code at this stage was already frozen.

  2. Rv0132c of Mycobacterium tuberculosis Encodes a Coenzyme F420-Dependent Hydroxymycolic Acid Dehydrogenase

    PubMed Central

    Purwantini, Endang; Mukhopadhyay, Biswarup


    The ability of Mycobacterium tuberculosis to manipulate and evade human immune system is in part due to its extraordinarily complex cell wall. One of the key components of this cell wall is a family of lipids called mycolic acids. Oxygenation of mycolic acids generating methoxy- and ketomycolic acids enhances the pathogenic attributes of M. tuberculosis. Thus, the respective enzymes are of interest in the research on mycobacteria. The generation of methoxy- and ketomycolic acids proceeds through intermediary formation of hydroxymycolic acids. While the methyl transferase that generates methoxymycolic acids from hydroxymycolic acids is known, hydroxymycolic acids dehydrogenase that oxidizes hydroxymycolic acids to ketomycolic acids has been elusive. We found that hydroxymycolic acid dehydrogenase is encoded by the rv0132c gene and the enzyme utilizes F420, a deazaflavin coenzyme, as electron carrier, and accordingly we called it F420-dependent hydroxymycolic acid dehydrogenase. This is the first report on the involvement of F420 in the synthesis of a mycobacterial cell envelope. Also, F420-dependent hydroxymycolic acid dehydrogenase was inhibited by PA-824, and therefore, it is a previously unknown target for this new tuberculosis drug. PMID:24349169

  3. Nucleic Acid Encoding A Lectin-Derived Progenitor Cell Preservation Factor


    Colucci, M. Gabriella; Chrispeels, Maarten J.; Moore, Jeffrey G.


    The invention relates to an isolated nucleic acid molecule that encodes a protein that is effective to preserve progenitor cells, such as hematopoietic progenitor cells. The nucleic acid comprises a sequence defined by SEQ ID NO:1, a homolog thereof, or a fragment thereof. The encoded protein has an amino acid sequence that comprises a sequence defined by SEQ ID NO:2, a homolog thereof, or a fragment thereof that contains an amino acid sequence TNNVLQVT. Methods of using the encoded protein for preserving progenitor cells in vitro, ex vivo, and in vivo are also described. The invention, therefore, include methods such as myeloablation therapies for cancer treatment wherein myeloid reconstitution is facilitated by means of the specified protein. Other therapeutic utilities are also enabled through the invention, for example, expanding progenitor cell populations ex vivo to increase chances of engraftation, improving conditions for transporting and storing progenitor cells, and facilitating gene therapy to treat and cure a broad range of life-threatening hematologic diseases.

  4. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 Gene Encodes an Aldehyde Dehydrogenase Involved in Ferulic Acid and Sinapic Acid Biosynthesis

    PubMed Central

    Nair, Ramesh B.; Bastress, Kristen L.; Ruegger, Max O.; Denault, Jeff W.; Chapple, Clint


    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP+-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall–esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes. PMID:14729911

  5. Nucleic acids encoding modified human immunodeficiency virus type 1 (HIV-1) group M consensus envelope glycoproteins


    Haynes, Barton F [Durham, NC; Gao, Feng [Durham, NC; Korber, Bette T [Los Alamos, NM; Hahn, Beatrice H [Birmingham, AL; Shaw, George M [Birmingham, AL; Kothe, Denise [Birmingham, AL; Li, Ying Ying [Hoover, AL; Decker, Julie [Alabaster, AL; Liao, Hua-Xin [Chapel Hill, NC


    The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens.

  6. Nucleotide sequence and the encoded amino acids of human apolipoprotein A-I mRNA.

    PubMed Central

    Law, S W; Brewer, H B


    The cDNA clones encoding the precursor form of human liver apolipoprotein A-I (apoA-I), preproapoA-I, have been isolated from a cDNA library. A 17-base synthetic oligonucleotide based on residues 108-113 of apoA-I and a 26-base primer-extended, dideoxynucleotide-terminated cDNA were used as hybridization probes to select for recombinant plasmids bearing the apoA-I sequence. The complete nucleic acid sequence of human liver preproapoA-I has been determined by analysis of the cloned cDNA. The sequence is composed of 801 nucleotides encoding 267 amino acid residues. PreproapoA-I contains an 18-amino-acid prepeptide and a 6-amino-acid propeptide connected to the amino terminus of the 243-amino acid mature apoA-I. Southern blotting analysis of chromosomal DNA obtained from peripheral blood indicated the apoA-I gene is contained in a 2.1-kilobase-pair Pst I fragment and there is no gross difference in structural organization between the normal apoA-I gene and the Tangier disease apoA-I gene. Images PMID:6198645

  7. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei


    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  8. The oxalic acid biosynthetic activity of Burkholderia mallei is encoded by a single locus.


    Nakata, Paul A


    Although it is known that oxalic acid provides a selective advantage to the secreting microbe our understanding of how this acid is biosynthesized remains incomplete. This study reports the identification, cloning, and partial characterization of the oxalic acid biosynthetic enzyme from the animal bacterial pathogen, Burkholderia mallei. The discovered gene was named oxalate biosynthetic component (obc)1. Complementation of Burkholderia oxalate defective (Bod)1, a Burkholderia glumae mutant that lacks expression of a functional oxalic acid biosynthetic operon, revealed that the obc1 was able to rescue the no oxalate mutant phenotype. This single gene rescue is in contrast to the situation found in B. glumae which required the expression of two genes, obcA and obcB, to achieve complementation. Enzyme assays showed that even though the two Burkholderia species differed in the number of genes required to encode a functional enzyme, both catalyzed the same acyl-CoA dependent biosynthetic reaction. In addition, mutagenesis studies suggested a similar domain structure of the assembled oxalate biosynthetic enzymes whether encoded by one or two genes.

  9. Characterization of the lys2 gene of Penicillium chrysogenum encoding alpha-aminoadipic acid reductase.


    Casqueiro, J; Gutiérrez, S; Bañuelos, O; Fierro, F; Velasco, J; Martín, J F


    A DNA fragment containing a gene homologous to LYS2 gene of Saccharomyces cerevisiae was cloned from a genomic DNA library of Penicillium chrysogenum AS-P-78. It encodes a protein of 1409 amino acids (Mr 154859) with strong similarity to the S. cerevisiae (49.9% identity) Schizosaccharomyces pombe (51.3% identity) and Candida albicans (48.12% identity) alpha-aminoadipate reductases and a lesser degree of identity to the amino acid-activating domains of the non-ribosomal peptide synthetases, including the alpha-aminoadipate-activating domain of the alpha-aminoadipyl-cysteinyl-valine synthetase of P. chrysogenum (12.4% identical amino acids). The lys2 gene contained one intron in the 5'-region and other in the 3'-region, as shown by comparing the nucleotide sequences of the cDNA and genomic DNA, and was transcribed as a 4.7-kb monocistronic mRNA. The lys2 gene was localized on chromosome III (7.5 Mb) in P. chrysogenum AS-P-78 and on chromosome IV (5.6 Mb) in strain P2, whereas the penicillin gene cluster is known to be located in chromosome I in both strains. The lys2-encoded protein is a member of the aminoacyladenylate-forming enzyme family with a reductase domain in its C-terminal region.

  10. Mutations of the Corynebacterium glutamicum NCgl1221 gene, encoding a mechanosensitive channel homolog, induce L-glutamic acid production.


    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki


    Corynebacterium glutamicum is a biotin auxotroph that secretes L-glutamic acid in response to biotin limitation; this process is employed in industrial L-glutamic acid production. Fatty acid ester surfactants and penicillin also induce L-glutamic acid secretion, even in the presence of biotin. However, the mechanism of L-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in L-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive L-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive L-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an L-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes L-glutamic acid secretion, causing an increase in the intracellular L-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased L-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an L-glutamic acid exporter. We propose that treatments that induce L-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export L-glutamic acid.

  11. Oxalic acid biosynthesis is encoded by an operon in Burkholderia glumae.


    Nakata, Paul A; He, Cixin


    Although the biosynthesis of oxalic acid is known to occur in a number of bacteria, the mechanism(s) regulating its production remains largely unknown. To date, there is no report on the identification of an oxalic acid biosynthetic pathway gene from bacteria. In an attempt to identify such a gene(s), a mutant screen was conducted using the simple oxalic acid-producing phytopathogenic bacterium, Burkholderia glumae. Four mutants that failed to produce oxalic acid were isolated from a transposon-mutagenized B. glumae library and named Burkholderia oxalate defective (Bod)1. DNA sequence analysis revealed that each mutant contained an insertion event at different sites in the same ORF, which we referred to as the oxalate biosynthetic component (obc)A locus. Complementation of the Bod1 mutant with the obcA gene, however, resulted only in a partial restoration of the oxalic acid-producing phenotype. Further complementation studies utilizing a larger DNA fragment encompassing the obcA locus coupled with deletion mutagenesis led to the identification of another ORF that we named the obcB locus, which was essential for higher levels of oxalic acid production. Transcript analysis indicated that both obcA and obcB are coexpressed and encoded on a single polycistron message.

  12. Nucleic acids encoding plant glutamine phenylpyruvate transaminase (GPT) and uses thereof


    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.


    Glutamine phenylpyruvate transaminase (GPT) proteins, nucleic acid molecules encoding GPT proteins, and uses thereof are disclosed. Provided herein are various GPT proteins and GPT gene coding sequences isolated from a number of plant species. As disclosed herein, GPT proteins share remarkable structural similarity within plant species, and are active in catalyzing the synthesis of 2-hydroxy-5-oxoproline (2-oxoglutaramate), a powerful signal metabolite which regulates the function of a large number of genes involved in the photosynthesis apparatus, carbon fixation and nitrogen metabolism.

  13. Nucleic acid encoding DS-CAM proteins and products related thereto

    SciTech Connect

    Korenberg, Julie R.


    In accordance with the present invention, there are provided Down Syndrome-Cell Adhesion Molecule (DS-CAM) proteins. Nucleic acid sequences encoding such proteins and assays employing same are also disclosed. The invention DS-CAM proteins can be employed in a variety of ways, for example, for the production of anti-DS-CAM antibodies thereto, in therapeutic compositions and methods employing such proteins and/or antibodies. DS-CAM proteins are also useful in bioassays to identify agonists and antagonists thereto.

  14. Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase


    Srienc, Friedrich; Jackson, John K.; Somers, David A.


    A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

  15. Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.


    Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin


    We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

  16. Nucleotide sequence of the luxC gene encoding fatty acid reductase of the lux operon from Photobacterium leiognathi.


    Lin, J W; Chao, Y F; Weng, S F


    The nucleotide sequence of the luxC gene (EMBL Accession No. 65156) encoding fatty acid reductase (FAR) of the lux operon from Photobacterium leiognathi PL741 was determined and the encoded amino acid sequence deduced. The fatty acid reductase is a component of the fatty acid reductase complex. The complex is responsible for converting fatty acid to aldehyde which serves as the substrate in the luciferase-catalyzed bioluminescent reaction. The protein comprises 478 amino acid residues and has a calculated M(r) of 53,858. Alignment and comparison of the fatty acid reductase of P. leiognathi with that of Vibrio harveyi B392 and Vibrio fischeri ATCC 7744 shows that there is 70% and 59% amino acid residues identity, respectively.

  17. The Saccharomyces Cerevisiae Spt7 Gene Encodes a Very Acidic Protein Important for Transcription in Vivo

    PubMed Central

    Gansheroff, L. J.; Dollard, C.; Tan, P.; Winston, F.


    Mutations in the SPT7 gene of Saccharomyces cerevisiae originally were identified as suppressors of Ty and {delta small} insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Other genes that have been identified in mutant hunts of this type have been shown to play a role in transcription. In this work we show that SPT7 is also important for proper transcription in vivo. We have cloned and sequenced the SPT7 gene and have shown that it encodes a large, acidic protein that is localized to the nucleus. The SPT7 protein contains a bromodomain sequence; a deletion that removes the bromodomain from the SPT7 protein causes no detectable mutant phenotype. Strains that contain an spt7 null mutation are viable but grow very slowly and have transcriptional defects at many loci including insertion mutations, Ty elements, the INO1 gene and the MFA1 gene. These transcriptional defects and other mutant phenotypes are similar to those caused by certain mutations in SPT15, which encodes the TATA binding protein (TBP). The similarity of the phenotypes of spt7 and spt15 mutants, including effects of spt7 mutations on the transcription start site of certain genes, suggests that SPT7 plays an important role in transcription initiation in vivo. PMID:7713415

  18. Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use


    Croteau, Rodney B.; Lange, Bernd M.


    A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

  19. High affinity of acid phosphatase encoded by PHO3 gene in Saccharomyces cerevisiae for thiamin phosphates.


    Nosaka, K


    The enzymatic properties of acid phosphatase (orthophosphoric-monoester phosphohydrolase, EC encoded by PHO3 gene in Saccharomyces cerevisiae, which is repressed by thiamin and has thiamin-binding activity at pH 5.0, were investigated to study physiological functions. The following results led to the conclusion that thiamin-repressible acid phosphatase physiologically catalyzes the hydrolysis of thiamin phosphates in the periplasmic space of S. cerevisiae, thus participating in utilization of the thiamin moiety of the phosphates by yeast cells: (a) thiamin-repressible acid phosphatase showed Km values of 1.6 and 1.7 microM at pH 5.0 for thiamin monophosphate and thiamin pyrophosphate, respectively. These Km values were 2-3 orders of magnitude lower than those (0.61 and 1.7 mM) for p-nitrophenyl phosphate; (b) thiamin exerted remarkable competitive inhibition in the hydrolysis of thiamin monophosphate (Ki 2.2 microM at pH 5.0), whereas the activity for p-nitrophenyl phosphate was slightly affected by thiamin; (c) the inhibitory effect of inorganic phosphate, which does not repress the thiamin-repressible enzyme, on the hydrolysis of thiamin monophosphate was much smaller than that of p-nitrophenyl phosphate. Moreover, the modification of thiamin-repressible acid phosphatase of S. cerevisiae with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide resulted in the complete loss of thiamin-binding activity and the Km value of the modified enzyme for thiamin monophosphate increased nearly to the value of the native enzyme for p-nitrophenyl phosphate. These results also indicate that the high affinity of the thiamin-repressible acid phosphatase for thiamin phosphates is due to the thiamin-binding properties of this enzyme.

  20. Protein Crosslinking by Genetically Encoded Noncanonical Amino Acids with Reactive Aryl Carbamate Side Chains.


    Xuan, Weimin; Shao, Sida; Schultz, Peter G


    The use of genetically encoded noncanonical amino acids (ncAAs) to construct crosslinks within or between proteins has emerged as a useful method to enhance protein stability, investigate protein-protein interactions, and improve the pharmacological properties of proteins. We report ncAAs with aryl carbamate side chains (PheK and FPheK) that can react with proximal nucleophilic residues to form intra- or intermolecular protein crosslinks. We evolved a pyrrolysyl-tRNA synthetase that incorporates site-specifically PheK and FPheK into proteins in both E. coli and mammalian cells. PheK and FPheK when incorporated into proteins showed good stability during protein expression and purification. FPheK reacted with adjacent Lys, Cys, and Tyr residues in thioredoxin in high yields. In addition, crosslinks could be formed between FPheK and Lys residue of two interacting proteins, including the heavy chain and light chain of an antibody Fab.

  1. A gene encoding a protein modified by the phytohormone indoleacetic acid

    PubMed Central

    Walz, Alexander; Park, Seijin; Slovin, Janet P.; Ludwig-Müller, Jutta; Momonoki, Yoshie S.; Cohen, Jerry D.


    We show that the expression of an indole-3-acetic acid (IAA)-modified protein from bean seed, IAP1, is correlated to the developmental period of rapid growth during seed development. Moreover, this protein undergoes rapid degradation during germination. The gene for IAP1, the most abundant protein covalently modified by IAA (iap1, GenBank accession no. AF293023) was isolated and cloned from bush bean (Phaseolus vulgaris) seeds. The 957-bp sequence encodes a 35-kDa polypeptide. IAA-modified proteins represent a distinct class of conjugated phytohormones and appear in bean to be the major form of auxin in seeds. IAA proteins also are found at other stages of development in bean plants. Our immunological and analytical data suggest that auxin modification of a small class of proteins may be a feature common to many plants. PMID:11830675

  2. Garlic and alpha lipoic supplementation enhance the immune system of albino rats and alleviate implications of pesticides mixtures

    PubMed Central

    Elhalwagy, Manal EA; Darwish, Nevine S; Shokry, Dina A; El-Aal, Aly GE Abd; Abd-Alrahman, Sherif H; Nahas, Abd-Alhamed; Ziada, Reem M


    This study aimed to investigate age dependent immune-system response versus exposure to different doses of mixture of (chlorpyrifos, profenofose, and fenitrothion) and/or combined with 60 and 250 mg kg-1 alpha lipoic acid and garlic, respectively. 120 males of albino rats were divided to two groups according to age; weaning group (2 months age and 60-80 gm.), adult (6 months and 180-200 gm). Each age was divided into 6 subgroups treated orally for 3 months , G1 (control), G2 high dose (HDPM) CPF10 mg kg-1, PRO 3 mg kg-1, FEN 6 mg kg-1, G3 low dose (LDPM) CPF 1 mg kg-1, PFN 0.3 mg kg-1 and FEN 0.6 mg kg-1, G4 AOX (alpha lipoic + Garlic), G5 HDPM + AOX and G6 LDPM + AOX. Results showed significant inhibition in serum acetylcholinesterase (AChE), elevation in malondialdehyde (MDA) concurrent with reduction in total reduced glutathione (GSH) in both ages was recorded as well as, decrease in IGG, IGM, Lymphocyte transformation and Phagocytosis humeral and cellular immunity confirmed by alteration in lymph nodes architecture. This study was concluded that the supplementation with alpha lipoic acid and garlic improved previous alternations slightly to be more or less near the control level in both adult and weaning rats. It seems that, immune-responses of both adult and weaning rats were slightly similar. PMID:26221319

  3. Inositol phosphatase activity of the Escherichia coli agp-encoded acid glucose-1-phosphatase.


    Cottrill, Michael A; Golovan, Serguei P; Phillips, John P; Forsberg, Cecil W


    When screening an Escherichia coli gene library for myo-inositol hexakisphosphate (InsP6) phosphatases (phytases), we discovered that the agp-encoded acid glucose-1-phosphatase also possesses this activity. Purified Agp hydrolyzes glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6 with pH optima, 6.5, 3.5, and 4.5, respectively, and was stable when incubated at pH values ranging from 3 to 10. Glucose-1-phosphate was hydrolyzed most efficiently at 55 degrees C. while InsP6 and p-nitrophenyl phosphate were hydrolyzed maximally at 60 degrees C. The Agp exhibited Km values of (0.39 mM, 13 mM, and 0.54 mM for the hydrolysis of glucose-1-phosphate, p-nitrophenyl phosphate, and InsP6, respectively. High-pressure liquid chromatography (HPLC) analysis of inositol phosphate hydrolysis products of Agp demonstrated that the enzyme catalyzes the hydrolysis of phosphate from each of InsP6, D-Ins(1,2,3,4,5)P5, Ins(1,3,4,5,6)P5, and Ins(1,2,3,4,6)P5, producing D/L-Ins(1,2,4,5,6)P5. D-Ins(1,2,4,5)P4, D/L-Ins(1,4,5,6)P4 and D/L-Ins(1,2,4,6)P4, respectively. These data support the contention that Agp is a 3-phosphatase.

  4. The mae1 gene of Schizosaccharomyces pombe encodes a permease for malate and other C4 dicarboxylic acids.


    Grobler, J; Bauer, F; Subden, R E; Van Vuuren, H J


    The mae1 gene of the yeast Schizosaccharomyces pombe was identified on the basis of its ability to complement a mutant defective in the transport of malic acid. Analysis of the DNA sequence revealed an open reading frame of 1314 base pairs, encoding a polypeptide of 438 amino acids with a predicted molecular weight of 49 kDa. A hydropathy profile of the predicted amino acid sequence revealed a protein with ten membrane-spanning or associated domains and hydrophilic N- and C- termini. The predicted secondary structure of the protein in similar to models proposed for other integral membrane proteins from both prokaryotes and eukaryotes. The S. pombe mae1 gene encodes a single mRNA of 1.5 kb. The mea1 gene is expressed constitutively and is not subject to catabolite repression as was previously reported for the malate permease systems of Candida utilis and Hansenula anomala. The mae1 gene was mapped 2842 bp 5' to the MFml gene on chromosome I. Transport assays revealed that the mae1 gene encodes a permease involved in the uptake of L-malate, succinate and malonic acid.

  5. Relative catalytic efficiency of ldhL- and ldhD-encoded products is crucial for optical purity of lactic acid produced by lactobacillus strains.


    Zheng, Zhaojuan; Sheng, Binbin; Ma, Cuiqing; Zhang, Haiwei; Gao, Chao; Su, Fei; Xu, Ping


    NAD-dependent l- and d-lactate dehydrogenases coexist in Lactobacillus genomes and may convert pyruvic acid into l-lactic acid and d-lactic acid, respectively. Our findings suggest that the relative catalytic efficiencies of ldhL- and ldhD-encoded products are crucial for the optical purity of lactic acid produced by Lactobacillus strains.

  6. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose.


    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc


    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products.

  7. Cellulases, nucleic acids encoding them and methods for making and using them


    Blum, David; Gemsch Cuenca, Joslin; Dycaico, Mark


    This invention relates to molecular and cellular biology and biochemistry. In one aspect, the invention provides polypeptides having cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts.

  8. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes


    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  9. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    SciTech Connect

    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  10. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    SciTech Connect

    Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  11. Cloning and characterization of the NapA acid phosphatase/phosphotransferase of Morganella morganii: identification of a new family of bacterial acid-phosphatase-encoding genes.


    Thaller, M C; Lombardi, G; Berlutti, F; Schippa, S; Rossolini, G M


    The gene encoding a minor phosphate-irrepressible acid phosphatase (named NapA) of Morganella morganii was cloned and sequenced, and its product characterized. NapA is a secreted acid phosphatase composed of four 27 kDa polypeptide subunits. The enzyme is active on several organic phosphate monoesters but not on diesters, and is also endowed with transphosphorylating activity from organic phosphoric acid esters to nucleosides and other compounds with free hydroxyl groups. Its activity is inhibited by EDTA, inorganic phosphate, nucleosides and Ca2+, but not by fluoride or tartrate, and is enhanced by Mg2+, Co2+ and Zn2+. At the sequence level, the NapA enzyme did not show similarities to any other sequenced bacterial phosphatases. However, a search for homologous genes in sequence databases allowed identification of two open reading frames located within sequenced regions of the Escherichia coli and Proteus mirabilis genomes respectively, encoding proteins of unknown function which are highly homologous to the Morganella enzyme. Moreover, the properties of the NapA enzyme are very similar to those reported for the periplasmic nonspecific acid phosphatase II of Salmonella typhimurium (for which no sequence data are available). These data point to the existence of a new family of bacterial acid phosphatases, which we propose designating class B bacterial acid phosphatases.

  12. The oxalic acid biosynthetic activity of Burkholderia mallei is encoded by a single locus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although it is known that oxalic acid provides a selective advantage to the secreting microbe, our understanding of how this acid is biosynthesized remains incomplete. This study reports the identification, cloning, and partial characterization of the oxalic acid biosynthetic enzyme from the animal ...

  13. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them


    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika


    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  14. Oxalic acid biosynthesis is encoded by an operon in Burkholderia glumae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although the biosynthesis of oxalic acid is known to occur in a number of bacteria, the mechanism(s) regulating its production remains largely unknown. To date, there is no report on the identification of an oxalic acid biosynthetic pathway gene from bacteria. In an attempt to identify such a gene...

  15. The ABC transporter ABC40 encodes a phenylacetic acid export system in Penicillium chrysogenum.


    Weber, Stefan S; Kovalchuk, Andriy; Bovenberg, Roel A L; Driessen, Arnold J M


    The filamentous fungus Penicillium chrysogenum is used for the industrial production of β-lactam antibiotics. The pathway for β-lactam biosynthesis has been resolved and involves the enzyme phenylacetic acid CoA ligase that is responsible for the CoA activation of the side chain precursor phenylacetic acid (PAA) that is used for the biosynthesis of penicillin G. To identify ABC transporters related to β-lactam biosynthesis, we analyzed the expression of all 48 ABC transporters present in the genome of P. chryso-genum when grown in the presence and absence of PAA. ABC40 is significantly upregulated when cells are grown or exposed to high levels of PAA. Although deletion of this transporter did not affect β-lactam biosynthesis, it resulted in a significant increase in sensitivity to PAA and other weak acids. It is concluded that ABC40 is involved in weak acid detoxification in P. chrysogenum including resistance to phenylacetic acid.

  16. Lysosomal and cytosolic sialic acid 9-O-acetylesterase activities can Be encoded by one gene via differential usage of a signal peptide-encoding exon at the N terminus.


    Takematsu, H; Diaz, S; Stoddart, A; Zhang, Y; Varki, A


    9-O-Acetylation is one of the most common modifications of sialic acids, and it can affect several sialic acid-mediated recognition phenomena. We previously reported a cDNA encoding a lysosomal sialic acid-specific 9-O-acetylesterase, which traverses the endoplasmic reticulum-Golgi pathway and localizes primarily to lysosomes and endosomes. In this study, we report a variant cDNA derived from the same gene that contains a different 5' region. This cDNA has a putative open reading frame lacking a signal peptide-encoding sequence and is thus a candidate for the previously described cytosolic sialic acid 9-O-acetylesterase activity. Epitope-tagged constructs confirm that the new sequence causes the protein product to be targeted to the cytosol and has esterase activity. Using reverse transcription-polymerase chain reaction to distinguish the two forms of message, we show that although the lysosomal sialic acid-specific 9-O-acetylesterase message has a widespread pattern of expression in adult mouse tissues, this cytosolic sialic acid 9-O-acetylesterase form has a rather restricted distribution, with the strongest expression in the liver, ovary, and brain. Using a polyclonal antibody directed against the 69-amino acid region common to both proteins, we confirmed that the expression of glycosylated and nonglycosylated polypeptides occurred in appropriate subcellular fractions of normal mouse tissues. Rodent liver polypeptides reacting to the antibody also co-purify with previously described lysosomal sialic acid esterase activity and at least a portion of the cytosolic activity. Thus, two sialic acid 9-O-acetylesterases found in very different subcellular compartments can be encoded by a single gene by differential usage of a signal peptide-encoding exon at the N terminus. The 5'-rapid amplification of cDNA ends results and the differences in tissue-specific expression suggest that expression of these two products may be differentially regulated by independent promoters.

  17. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them


    Gray, Kevin A; Zhao, Lishan; Cayouette, Michelle H


    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  18. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them


    Gray, Kevin A.; Zhao, Lishan; Cayouette, Michelle H.


    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  19. Molecular cloning and analysis of functional cDNA and genomic clones encoding bovine cellular retinoic acid-binding protein.

    PubMed Central

    Shubeita, H E; Sambrook, J F; McCormick, A M


    A recombinant cDNA clone, pCRABP-HS1, encoding cellular retinoic acid-binding protein was isolated from a bovine adrenal cDNA library. COS-7 cells transfected with pCRABP-HS1 produced a biologically active retinoic acid-binding protein molecule of the expected molecular mass (15.5 kDa). RNA blot hybridization analysis using pCRABP-HS1 as a probe revealed a single 1050-nucleotide mRNA species in bovine adrenal, uterus, and testis, tissues that contain the highest levels of retinoic acid-binding activity. No hybridization was detected in RNA extracted from ovary, spleen, kidney, or liver, which contain relatively low levels of cellular retinoic acid-binding protein activity. Analysis of genomic clones isolated from an EcoRI bovine genomic library demonstrated that the bovine cellular retinoic acid-binding protein gene is composed of four exons and three introns. Two putative promoter sequences were identified in the cloned 5' sequence of the gene. Images PMID:3039499

  20. Molecular cloning and analysis of functional cDNA and genomic clones encoding bovine cellular retinoic acid-binding protein.


    Shubeita, H E; Sambrook, J F; McCormick, A M


    A recombinant cDNA clone, pCRABP-HS1, encoding cellular retinoic acid-binding protein was isolated from a bovine adrenal cDNA library. COS-7 cells transfected with pCRABP-HS1 produced a biologically active retinoic acid-binding protein molecule of the expected molecular mass (15.5 kDa). RNA blot hybridization analysis using pCRABP-HS1 as a probe revealed a single 1050-nucleotide mRNA species in bovine adrenal, uterus, and testis, tissues that contain the highest levels of retinoic acid-binding activity. No hybridization was detected in RNA extracted from ovary, spleen, kidney, or liver, which contain relatively low levels of cellular retinoic acid-binding protein activity. Analysis of genomic clones isolated from an EcoRI bovine genomic library demonstrated that the bovine cellular retinoic acid-binding protein gene is composed of four exons and three introns. Two putative promoter sequences were identified in the cloned 5' sequence of the gene.

  1. Arabidopsis Deficient in Cutin Ferulate encodes a transferase required for feruloylation of ω-hydroxy fatty acids in cutin polyester.


    Rautengarten, Carsten; Ebert, Berit; Ouellet, Mario; Nafisi, Majse; Baidoo, Edward E K; Benke, Peter; Stranne, Maria; Mukhopadhyay, Aindrila; Keasling, Jay D; Sakuragi, Yumiko; Scheller, Henrik Vibe


    The cuticle is a complex aliphatic polymeric layer connected to the cell wall and covers surfaces of all aerial plant organs. The cuticle prevents nonstomatal water loss, regulates gas exchange, and acts as a barrier against pathogen infection. The cuticle is synthesized by epidermal cells and predominantly consists of an aliphatic polymer matrix (cutin) and intracuticular and epicuticular waxes. Cutin monomers are primarily C(16) and C(18) unsubstituted, ω-hydroxy, and α,ω-dicarboxylic fatty acids. Phenolics such as ferulate and p-coumarate esters also contribute to a minor extent to the cutin polymer. Here, we present the characterization of a novel acyl-coenzyme A (CoA)-dependent acyl-transferase that is encoded by a gene designated Deficient in Cutin Ferulate (DCF). The DCF protein is responsible for the feruloylation of ω-hydroxy fatty acids incorporated into the cutin polymer of aerial Arabidopsis (Arabidopsis thaliana) organs. The enzyme specifically transfers hydroxycinnamic acids using ω-hydroxy fatty acids as acyl acceptors and hydroxycinnamoyl-CoAs, preferentially feruloyl-CoA and sinapoyl-CoA, as acyl donors in vitro. Arabidopsis mutant lines carrying DCF loss-of-function alleles are devoid of rosette leaf cutin ferulate and exhibit a 50% reduction in ferulic acid content in stem insoluble residues. DCF is specifically expressed in the epidermis throughout all green Arabidopsis organs. The DCF protein localizes to the cytosol, suggesting that the feruloylation of cutin monomers takes place in the cytoplasm.

  2. Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them


    Gray, Kevin A [San Diego, CA; Zhao, Lishan [Emeryville, CA; Cayouette, Michelle H [San Diego, CA


    The invention provides polypeptides having any cellulolytic activity, e.g., a cellulase activity, a endoglucanase, a cellobiohydrolase, a beta-glucosidase, a xylanase, a mannanse, a .beta.-xylosidase, an arabinofuranosidase, and/or an oligomerase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. In one aspect, the invention provides polypeptides having an oligomerase activity, e.g., enzymes that convert recalcitrant soluble oligomers to fermentable sugars in the saccharification of biomass. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  3. A computational method to predict genetically encoded rare amino acids in proteins

    PubMed Central

    Chaudhuri, Barnali N; Yeates, Todd O


    In several natural settings, the standard genetic code is expanded to incorporate two additional amino acids with distinct functionality, selenocysteine and pyrrolysine. These rare amino acids can be overlooked inadvertently, however, as they arise by recoding at certain stop codons. We report a method for such recoding prediction from genomic data, using read-through similarity evaluation. A survey across a set of microbial genomes identifies almost all the known cases as well as a number of novel candidate proteins. PMID:16168086

  4. The maize (Zea mays ssp. mays var. B73) genome encodes 33 members of the purple acid phosphatase family

    PubMed Central

    González-Muñoz, Eliécer; Avendaño-Vázquez, Aida-Odette; Montes, Ricardo A. Chávez; de Folter, Stefan; Andrés-Hernández, Liliana; Abreu-Goodger, Cei; Sawers, Ruairidh J. H.


    Purple acid phosphatases (PAPs) play an important role in plant phosphorus nutrition, both by liberating phosphorus from organic sources in the soil and by modulating distribution within the plant throughout growth and development. Furthermore, members of the PAP protein family have been implicated in a broader role in plant mineral homeostasis, stress responses and development. We have identified 33 candidate PAP encoding gene models in the maize (Zea mays ssp. mays var. B73) reference genome. The maize Pap family includes a clear single-copy ortholog of the Arabidopsis gene AtPAP26, shown previously to encode both major intracellular and secreted acid phosphatase activities. Certain groups of PAPs present in Arabidopsis, however, are absent in maize, while the maize family contains a number of expansions, including a distinct radiation not present in Arabidopsis. Analysis of RNA-sequencing based transcriptome data revealed accumulation of maize Pap transcripts in multiple plant tissues at multiple stages of development, and increased accumulation of specific transcripts under low phosphorus availability. These data suggest the maize PAP family as a whole to have broad significance throughout the plant life cycle, while highlighting potential functional specialization of individual family members. PMID:26042133

  5. The maize (Zea mays ssp. mays var. B73) genome encodes 33 members of the purple acid phosphatase family.


    González-Muñoz, Eliécer; Avendaño-Vázquez, Aida-Odette; Montes, Ricardo A Chávez; de Folter, Stefan; Andrés-Hernández, Liliana; Abreu-Goodger, Cei; Sawers, Ruairidh J H


    Purple acid phosphatases (PAPs) play an important role in plant phosphorus nutrition, both by liberating phosphorus from organic sources in the soil and by modulating distribution within the plant throughout growth and development. Furthermore, members of the PAP protein family have been implicated in a broader role in plant mineral homeostasis, stress responses and development. We have identified 33 candidate PAP encoding gene models in the maize (Zea mays ssp. mays var. B73) reference genome. The maize Pap family includes a clear single-copy ortholog of the Arabidopsis gene AtPAP26, shown previously to encode both major intracellular and secreted acid phosphatase activities. Certain groups of PAPs present in Arabidopsis, however, are absent in maize, while the maize family contains a number of expansions, including a distinct radiation not present in Arabidopsis. Analysis of RNA-sequencing based transcriptome data revealed accumulation of maize Pap transcripts in multiple plant tissues at multiple stages of development, and increased accumulation of specific transcripts under low phosphorus availability. These data suggest the maize PAP family as a whole to have broad significance throughout the plant life cycle, while highlighting potential functional specialization of individual family members.

  6. Characterization of the Genes Encoding d-Amino Acid Transaminase and Glutamate Racemase, Two d-Glutamate Biosynthetic Enzymes of Bacillus sphaericus ATCC 10208

    PubMed Central

    Fotheringham, Ian G.; Bledig, Stefan A.; Taylor, Paul P.


    In Bacillus sphaericus and other Bacillus spp., d-amino acid transaminase has been considered solely responsible for biosynthesis of d-glutamate, an essential component of cell wall peptidoglycan, in contrast to the glutamate racemase employed by many other bacteria. We report here the cloning of the dat gene encoding d-amino acid transaminase and the glr gene encoding a glutamate racemase from B. sphaericus ATCC 10208. The glr gene encodes a 28.8-kDa protein with 40 to 50% sequence identity to the glutamate racemases of Lactobacillus, Pediococcus, and Staphylococcus species. The dat gene encodes a 31.4-kDa peptide with 67% primary sequence homology to the d-amino acid transaminase of the thermophilic Bacillus sp. strain YM1. PMID:9696787

  7. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E


    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  8. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    SciTech Connect

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.


    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  9. Bioconjugation of therapeutic proteins and enzymes using the expanded set of genetically encoded amino acids.


    Lim, Sung In; Kwon, Inchan


    The last decade has witnessed striking progress in the development of bioorthogonal reactions that are strictly directed towards intended sites in biomolecules while avoiding interference by a number of physical and chemical factors in biological environment. Efforts to exploit bioorthogonal reactions in protein conjugation have led to the evolution of protein translational machineries and the expansion of genetic codes that systematically incorporate a range of non-natural amino acids containing bioorthogonal groups into recombinant proteins in a site-specific manner. Chemoselective conjugation of proteins has begun to find valuable applications to previously inaccessible problems. In this review, we describe bioorthogonal reactions useful for protein conjugation, and biosynthetic methods that produce proteins amenable to those reactions through an expanded genetic code. We then provide key examples in which novel protein conjugates, generated by the genetic incorporation of a non-natural amino acid and the chemoselective reactions, address unmet needs in protein therapeutics and enzyme engineering.

  10. In vivo modification of retroviral gag gene-encoded polyproteins by myristic acid.

    PubMed Central

    Schultz, A M; Oroszlan, S


    It has recently been shown by mass spectral analysis (Henderson et al., Proc. Natl. Acad. Sci. U.S.A. 80:339-343, 1983) that the p15gag protein of murine leukemia viruses contains a novel post-translational modification, an amino-terminal myristyl (tetradecanoyl) amide. In this report we show that p15gag is the only structural protein to contain this fatty acid. In addition, the gag precursor polyproteins of type B, C, and D retroviruses have been examined for the presence of myristic acid by metabolic labeling and immunoprecipitation studies. In a panel of mammalian type C retroviruses we found that the precursor polyprotein Pr65gag homologs, but not the glycosylated forms (gPr80gag homologs), were specifically labeled after a 5-min incubation of infected cells with [3H]myristic acid. The gag precursor polyprotein was also labeled in mouse mammary tumor virus and in Mason-Pfizer monkey virus, but Pr76gag of Rous sarcoma virus failed to incorporate [3H]myristate. Under similar conditions, [3H]palmitate was not found to be incorporated into any viral gag proteins. Thus, myristylation appears to be a common feature of mammalian type B, C, and D retroviruses but not of avian retroviruses. Images PMID:6302307

  11. Enhanced efficacy of an AAV vector encoding chimeric, highly secreted acid alpha-glucosidase in glycogen storage disease type II.


    Sun, Baodong; Zhang, Haoyue; Benjamin, Daniel K; Brown, Talmage; Bird, Andrew; Young, Sarah P; McVie-Wylie, Alison; Chen, Y-T; Koeberl, Dwight D


    Glycogen storage disease type II (GSD-II; Pompe disease; MIM 232300) is an inherited muscular dystrophy caused by deficiency in the activity of the lysosomal enzyme acid alpha-glucosidase (GAA). We hypothesized that chimeric GAA containing an alternative signal peptide could increase the secretion of GAA from transduced cells and enhance the receptor-mediated uptake of GAA in striated muscle. The relative secretion of chimeric GAA from transfected 293 cells increased up to 26-fold. Receptor-mediated uptake of secreted, chimeric GAA corrected cultured GSD-II patient cells. High-level hGAA was sustained in the plasma of GSD-II mice for 24 weeks following administration of an AAV2/8 vector encoding chimeric GAA; furthermore, GAA activity was increased and glycogen content was significantly reduced in striated muscle and in the brain. Administration of only 1 x 10(10) vector particles increased GAA activity in the heart and diaphragm for >18 weeks, whereas 3 x 10(10) vector particles increased GAA activity and reduced glycogen content in the heart, diaphragm, and quadriceps. Furthermore, an AAV2/2 vector encoding chimeric GAA produced secreted hGAA for >12 weeks in the majority of treated GSD-II mice. Thus, chimeric, highly secreted GAA enhanced the efficacy of AAV vector-mediated gene therapy in GSD-II mice.

  12. Evaluation of DNA encoding acidic ribosomal protein P2 of Cryptosporidium parvum as a potential vaccine candidate for cryptosporidiosis.


    Benitez, Alvaro; Priest, Jeffrey W; Ehigiator, Humphrey N; McNair, Nina; Mead, Jan R


    The Cryptosporidium parvum acidic ribosomal protein P2 (CpP2) is an important immunodominant marker in C. parvum infection. In this study, the CpP2 antigen was evaluated as a vaccine candidate using a DNA vaccine model in adult C57BL/6 IL-12 knockout (KO) mice, which are susceptible to C. parvum infection. Our data show that subcutaneous immunization in the ear with DNA encoding CpP2 (CpP2-DNA) cloned into the pUMVC4b vector induced a significant anti-CpP2 IgG antibody response that was predominantly of the IgG1 isotype. Compared to control KO mice immunized with plasmid alone, CpP2-immunized mice demonstrated specific in vitro spleen cell proliferation as well as enhanced IFN-γ production to recombinant CpP2. Further, parasite loads in CpP2 DNA-immunized mice were compared to control mice challenged with C. parvum oocysts. Although a trend in reduction of infection was observed in the CpP2 DNA-immunized mice, differences between groups were not statistically significant. These results suggest that a DNA vaccine encoding the C. parvum P2 antigen is able to provide an effective means of eliciting humoral and cellular responses and has the potential to generate protective immunity against C. parvum infection but may require using alternative vectors or adjuvant to generate a more potent and balanced response.

  13. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    PubMed Central

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando


    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  14. Investigation of the fatty acid transporter-encoding genes SLC27A3 and SLC27A4 in autism.


    Maekawa, Motoko; Iwayama, Yoshimi; Ohnishi, Tetsuo; Toyoshima, Manabu; Shimamoto, Chie; Hisano, Yasuko; Toyota, Tomoko; Balan, Shabeesh; Matsuzaki, Hideo; Iwata, Yasuhide; Takagai, Shu; Yamada, Kohei; Ota, Motonori; Fukuchi, Satoshi; Okada, Yohei; Akamatsu, Wado; Tsujii, Masatsugu; Kojima, Nobuhiko; Owada, Yuji; Okano, Hideyuki; Mori, Norio; Yoshikawa, Takeo


    The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. During fetal and postnatal periods of development, the growing brain requires a reliable supply of fatty acids. Because autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. Here, we confirmed the expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system. Additionally, we resequenced the SLC27A3 and SLC27A4 genes using 267 ASD patient and 1140 control samples and detected 47 (44 novel and 29 nonsynonymous) and 30 (17 novel and 14 nonsynonymous) variants for the SLC27A3 and SLC27A4, respectively, revealing that they are highly polymorphic with multiple rare variants. The SLC27A4 Ser209 allele was more frequently represented in ASD samples. Furthermore, we showed that a SLC27A4 Ser209 mutant resulted in significantly higher fluorescently-labeled fatty acid uptake into bEnd3 cells, a mouse brain capillary-derived endothelial cell line, compared with SLC27A4 Gly209, suggesting that the functional change may contribute to ASD pathophysiology.

  15. Investigation of the fatty acid transporter-encoding genes SLC27A3 and SLC27A4 in autism

    PubMed Central

    Maekawa, Motoko; Iwayama, Yoshimi; Ohnishi, Tetsuo; Toyoshima, Manabu; Shimamoto, Chie; Hisano, Yasuko; Toyota, Tomoko; Balan, Shabeesh; Matsuzaki, Hideo; Iwata, Yasuhide; Takagai, Shu; Yamada, Kohei; Ota, Motonori; Fukuchi, Satoshi; Okada, Yohei; Akamatsu, Wado; Tsujii, Masatsugu; Kojima, Nobuhiko; Owada, Yuji; Okano, Hideyuki; Mori, Norio; Yoshikawa, Takeo


    The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. During fetal and postnatal periods of development, the growing brain requires a reliable supply of fatty acids. Because autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. Here, we confirmed the expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system. Additionally, we resequenced the SLC27A3 and SLC27A4 genes using 267 ASD patient and 1140 control samples and detected 47 (44 novel and 29 nonsynonymous) and 30 (17 novel and 14 nonsynonymous) variants for the SLC27A3 and SLC27A4, respectively, revealing that they are highly polymorphic with multiple rare variants. The SLC27A4 Ser209 allele was more frequently represented in ASD samples. Furthermore, we showed that a SLC27A4 Ser209 mutant resulted in significantly higher fluorescently-labeled fatty acid uptake into bEnd3 cells, a mouse brain capillary-derived endothelial cell line, compared with SLC27A4 Gly209, suggesting that the functional change may contribute to ASD pathophysiology. PMID:26548558

  16. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.


    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando


    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  17. Ribosomal Synthesis of Macrocyclic Peptides in Vitro and in Vivo Mediated by Genetically Encoded Amino-Thiol Unnatural Amino Acids

    PubMed Central

    Frost, John R.; Jacob, Nicholas T.; Papa, Louis J.; Owens, Andrew E.


    A versatile method for orchestrating the formation of side-chain-to-tail cyclic peptides from ribosomally derived polypeptide precursors is reported. Upon ribosomal incorporation into intein-containing precursor proteins, designer unnatural amino acids bearing side-chain 1,3- or 1,2-aminothiol functionalities are able to promote the cyclization of a downstream target peptide sequence via a C-terminal ligation/ring contraction mechanism. Using this approach, peptide macrocycles of variable size and composition could be generated in a pH-triggered manner in vitro, or directly in living bacterial cells. This methodology furnishes a new platform for the creation and screening of genetically encoded libraries of conformationally constrained peptides. This strategy was applied to identify and isolate a low micromolar streptavidin binder (KD = 1.1 µM) from a library of cyclic peptides produced in E. coli, thereby illustrating its potential toward aiding the discovery of functional peptide macrocycles. PMID:25933125

  18. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)


    Freimuth, Paul I.


    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  19. Interactions Between Fatty Acid Transport Proteins, Genes That Encode for Them, and Exercise: A Systematic Review.


    Jayewardene, Avindra F; Mavros, Yorgi; Reeves, Anneliese; Hancock, Dale P; Gwinn, Tom; Rooney, Kieron B


    Long-chain fatty acid (LCFA) movement into skeletal muscle involves a highly mediated process in which lipid rafts are utilized in the cellular membrane, involving numerous putative plasma membrane-associated LCFA transport proteins. The process of LCFA uptake and oxidation is of particular metabolic significance both at rest and during light to moderate exercise. A comprehensive systematic search of electronic databases was conducted to investigate whether exercise alters protein and/or gene expression of putative LCFA transport proteins. There were 31 studies meeting all eligibility criteria, of these 13 utilized an acute exercise protocol and 18 examined chronic exercise adaptations. Seventeen involved a study design incorporating an exercise stimulus, while the remaining 14 incorporated a combined exercise and diet stimulus. Divergent data relating to acute exercise, as well as prolonged exercise training (≥3 weeks), on protein content (PC) response was identified for proteins CD36, FABPpm and CAV1. Messenger ribonucleic acid (mRNA) data did not always correspond to functional PC, supporting previous suggestions of a disconnect due to potentially limiting factors post gene expression. The large array of study designs, cohorts, and primary dependent variables within the studies included in the present review elucidate the complexity of the interaction between exercise and LCFA transport proteins. Summary of the results in the present review validate the need for further targeted investigation within this topic, and provide an important information base for such research. J. Cell. Physiol. 231: 1671-1687, 2016. © 2015 Wiley Periodicals, Inc.

  20. Molecular cloning, encoding sequence, and expression of vaccinia virus nucleic acid-dependent nucleoside triphosphatase gene.

    PubMed Central

    Rodriguez, J F; Kahn, J S; Esteban, M


    A rabbit poxvirus genomic library contained within the expression vector lambda gt11 was screened with polyclonal antiserum prepared against vaccinia virus nucleic acid-dependent nucleoside triphosphatase (NTPase)-I enzyme. Five positive phage clones containing from 0.72- to 2.5-kilobase-pair (kbp) inserts expressed a beta-galactosidase fusion protein that was reactive by immunoblotting with the NTPase-I antibody. Hybridization analysis allowed the location of this gene within the vaccinia HindIIID restriction fragment. From the known nucleotide sequence of the 16-kbp vaccinia HindIIID fragment, we identified a region that contains a 1896-base open reading frame coding for a 631-amino acid protein. Analysis of the complete sequence revealed a highly basic protein, with hydrophilic COOH and NH2 termini, various hydrophobic domains, and no significant homology to other known proteins. Translational studies demonstrate that NTPase-I belongs to a late class of viral genes. This protein is highly conserved among Orthopoxviruses. Images PMID:3025846

  1. Recessive Mutations in ACPT, Encoding Testicular Acid Phosphatase, Cause Hypoplastic Amelogenesis Imperfecta.


    Seymen, Figen; Kim, Youn Jung; Lee, Ye Ji; Kang, Jenny; Kim, Tak-Heun; Choi, Hwajung; Koruyucu, Mine; Kasimoglu, Yelda; Tuna, Elif Bahar; Gencay, Koray; Shin, Teo Jeon; Hyun, Hong-Keun; Kim, Young-Jae; Lee, Sang-Hoon; Lee, Zang Hee; Zhang, Hong; Hu, Jan C-C; Simmer, James P; Cho, Eui-Sic; Kim, Jung-Wook


    Amelogenesis imperfecta (AI) is a heterogeneous group of genetic disorders affecting tooth enamel. The affected enamel can be hypoplastic and/or hypomineralized. In this study, we identified ACPT (testicular acid phosphatase) biallelic mutations causing non-syndromic, generalized hypoplastic autosomal-recessive amelogenesis imperfecta (AI) in individuals from six apparently unrelated Turkish families. Families 1, 4, and 5 were affected by the homozygous ACPT mutation c.713C>T (p.Ser238Leu), family 2 by the homozygous ACPT mutation c.331C>T (p.Arg111Cys), family 3 by the homozygous ACPT mutation c.226C>T (p.Arg76Cys), and family 6 by the compound heterozygous ACPT mutations c.382G>C (p.Ala128Pro) and 397G>A (p.Glu133Lys). Analysis of the ACPT crystal structure suggests that these mutations damaged the activity of ACPT by altering the sizes and charges of key amino acid side chains, limiting accessibility of the catalytic core, and interfering with homodimerization. Immunohistochemical analysis confirmed localization of ACPT in secretory-stage ameloblasts. The study results provide evidence for the crucial function of ACPT during amelogenesis.

  2. Cloning of a human cDNA encoding a novel enzyme involved in the elongation of long-chain polyunsaturated fatty acids.

    PubMed Central

    Leonard, A E; Bobik, E G; Dorado, J; Kroeger, P E; Chuang, L T; Thurmond, J M; Parker-Barnes, J M; Das, T; Huang, Y S; Mukerji, P


    The Saccharomyces cerevisiae protein ELO2p is involved in the elongation of saturated and monounsaturated fatty acids. Among several sequences with limited identity with the S. cerevisiae ELO2 gene, a consensus cDNA sequence was identified from the LifeSeq(R) database of Incyte Pharmaceuticals, Inc. Human liver cDNA was amplified by PCR using oligonucleotides complementary to the 5' and 3' ends of the putative human cDNA sequence. The resulting full-length sequence, termed HELO1, consisted of 897 bp, which encoded 299 amino acids. However, in contrast with the ELO2 gene, expression of this open reading frame in S. cerevisiae demonstrated that the encoded protein was involved in the elongation of long-chain polyunsaturated fatty acids, as determined by the conversion of gamma-linolenic acid (C(18:3, n-6)) into dihomo-gamma-linolenic acid (C(20:3, n-6)), arachidonic acid (C(20:4, n-6)) into adrenic acid (C(22:4, n-6)), stearidonic acid (C(18:4, n-3)) into eicosatetraenoic acid (C(20:4, n-3)), eicosapentaenoic acid (C(20:5, n-3)) into omega3-docosapentaenoic acid (C(22:5, n-3)) and alpha-linolenic acid (C(18:3, n-3)) into omega3-eicosatrienoic acid (C(20:3, n-3)). The predicted amino acid sequence of the open reading frame had only 29% identity with the yeast ELO2 sequence, contained a single histidine-rich domain and had six transmembrane-spanning regions, as suggested by hydropathy analysis. The tissue expression profile revealed that the HELO1 gene is highly expressed in the adrenal gland and testis. Furthermore, the HELO1 gene is located on chromosome 6, best known for encoding the major histocompatibility complex, which is essential to the human immune response. PMID:10970790

  3. The Saccharomyces cerevisiae PHM8 gene encodes a soluble magnesium-dependent lysophosphatidic acid phosphatase.


    Reddy, Venky Sreedhar; Singh, Arjun Kumar; Rajasekharan, Ram


    Phosphate is the essential macronutrient required for the growth of all organisms. In Saccharomyces cerevisiae, phosphatases are up-regulated, and the level of lysophosphatidic acid (LPA) is drastically decreased under phosphate-starved conditions. The reduction in the LPA level is attributed to PHM8, a gene of unknown function. phm8Delta yeast showed a decreased LPA-hydrolyzing activity under phosphate-limiting conditions. Overexpression of PHM8 in yeast resulted in an increase in the LPA phosphatase activity in vivo. In vitro assays of the purified recombinant Phm8p revealed magnesium-dependent LPA phosphatase activity, with maximal activity at pH 6.5. The purified Phm8p did not hydrolyze any lipid phosphates other than LPA. In silico analysis suggest that Phm8p is a soluble protein with no transmembrane domain. Site-directed mutational studies revealed that aspartate residues in a DXDXT motif are important for the catalysis. These findings indicated that LPA plays a direct role in phosphate starvation. This is the first report of the identification and characterization of magnesium-dependent soluble LPA phosphatase.

  4. Expression of the Rhodobacter sphaeroides hemA and hemT genes, encoding two 5-aminolevulinic acid synthase isozymes.

    PubMed Central

    Neidle, E L; Kaplan, S


    The nucleotide sequences of the Rhodobacter sphaeroides hemA and hemT genes, encoding 5-aminolevulinic acid (ALA) synthase isozymes, were determined. ALA synthase catalyzes the condensation of glycine and succinyl coenzyme A, the first and rate-limiting step in tetrapyrrole biosynthesis. The hemA and hemT structural gene sequences were 65% identical to each other, and the deduced HemA and HemT polypeptide sequences were 53% identical, with an additional 16% of aligned amino acids being similar. HemA and HemT were homologous to all characterized ALA synthases, including two human ALA synthase isozymes. In addition, they were evolutionarily related to 7-keto-8-aminopelargonic acid synthetase (BioF) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), enzymes which catalyze similar reactions. Two hemA transcripts were identified, both expressed under photosynthetic conditions at levels approximately three times higher than those found under aerobic conditions. A single transcriptional start point was identified for both transcripts, and a consensus sequence at this location indicated that an Fnr-like protein may be involved in the transcriptional regulation of hemA. Transcription of hemT was not detected in wild-type cells under the physiological growth conditions tested. In a mutant strain in which the hemA gene had been inactivated, however, hemT was expressed. In this mutant, hemT transcripts were characterized by Northern (RNA) hybridization, primer extension, and ribonuclease protection techniques. A small open reading frame of unknown function was identified upstream of, and transcribed in the same direction as, hemA. Images PMID:8468290

  5. Early region 1B of adenovirus 2 encodes two coterminal proteins of 495 and 155 amino acid residues.

    PubMed Central

    Anderson, C W; Schmitt, R C; Smart, J E; Lewis, J B


    Partial sequence analysis of tryptic peptides has identified the E1B-495R (E1b-57K) (early transcription region 1B of 495 amino acid residues, with an approximate molecular weight of 57,000) protein of adenovirus 2 as encoded by the 495 amino acid open reading frame located in the adenovirus 2 DNA sequence between nucleotides 2016 and 3500. Additional proteins of 16,000 Mr and 18,000 Mr that are related to the E1B-495R protein were identified by cell-free translation of hybridization-selected mRNA. Analysis of [35S]methionine-containing amino terminal tryptic peptides by thin-layer chromatography showed that the E1B-495R, E1B-18K, and E1B-16K proteins all begin at the same initiation codon. The E1B-495R protein from 293 cells also has the same initial tryptic peptide, acetyl-methionyl-glutamyl-arginine. Sequence analysis of E1B-18K tryptic peptides indicated that this protein also has the same carboxy terminus as the E1B-495R protein and that it is derived from an mRNA that is spliced to remove sequences between nucleotides 2250 and 3269, resulting in a protein product of 155 amino acid residues. Analysis of E1B-16K tryptic peptides has not yet revealed the carboxy terminal structure of this protein. Both the E1B-495R and the E1B-155R (E1B-18K) proteins, as well as the E1B-16K protein, were precipitated from cell-free translations and from extracts of infected cells by antiserum against an amino terminal nonapeptide common to these proteins. Images PMID:6323739

  6. Molecular cloning and characterization of a human cDNA and gene encoding a novel acid ceramidase-like protein.


    Hong, S B; Li, C M; Rhee, H J; Park, J H; He, X; Levy, B; Yoo, O J; Schuchman, E H


    Computer-assisted database analysis of sequences homologous to human acid ceramidase (ASAH) revealed a 1233-bp cDNA (previously designated cPj-LTR) whose 266-amino-acid open reading frame had approximately 36% identity with the ASAH polypeptide. Based on this high degree of homology, we undertook further molecular characterization of cPj-LTR and now report the full-length cDNA sequence, complete gene structure (renamed human ASAHL since it is a human acid ceramidase-like sequence), chromosomal location, primer extension and promoter analysis, and transient expression results. The full-length human ASAHL cDNA was 1825 bp and contained an open-reading frame encoding a 359-amino-acid polypeptide that was 33% identical and 69% similar to the ASAH polypeptide over its entire length. Numerous short regions of complete identity were observed between these two sequences and two sequences obtained from the Caenorhabditis elegans genome database. The 30-kb human ASAHL genomic sequence contained 11 exons, which ranged in size from 26 to 671 bp, and 10 introns, which ranged from 150 bp to 6.4 kb. The gene was localized to the chromosomal region 4q21.1 by fluorescence in situ hybridization analysis. Northern blotting experiments revealed a major 2.0-kb ASAHL transcript that was expressed at high levels in the liver and kidney, but at relatively low levels in other tissues such as the lung, heart, and brain. Sequence analysis of the 5'-flanking region of the human ASAHL gene revealed a putative promoter region that lacked a TATA box and was GC rich, typical features of a housekeeping gene promoter, as well as several tissue-specific and/or hormone-induced transcription regulatory sites. 5'-Deletion analysis localized the promoter activity to a 1. 1-kb fragment within this region. A major transcription start site also was located 72 bp upstream from the ATG translation initiation site by primer extension analysis. Expression analysis of a green fluorescence protein/ASAHL fusion

  7. Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N-acyl-D-amino acid amidohydrolase responsible for D-amino acid production.


    Lin, Pei-Hsun; Su, Shiun-Cheng; Tsai, Ying-Chieh; Lee, Chia-Yin


    An N-acyl-d-amino acid amidohydrolase (N-D-AAase) was identified in cell extracts of a strain, Iso1, isolated from an environment containing N-acetyl-d-methionine. The bacterium was classified as Variovorax paradoxus by phylogenetic analysis. The gene was cloned and sequenced. The gene consisted of a 1467-bp ORF encoding a polypeptide of 488 amino acids. The V. paradoxusN-D-AAase showed significant amino acid similarity to the N-acyl-d-amino acid amidohydrolases of the two eubacteria Alcaligenes xylosoxydans A-6 (44-56% identity), Alcaligenes facelis DA1 (54% identity) and the hyperthermophilic archaeon Pyrococcus abyssi (42% identity). After over-expression of the N-D-AAase protein in Escherichia coli, the enzyme was purified by multistep chromatography. The native molecular mass was 52.8 kDa, which agreed with the predicted molecular mass of 52 798 Da and the enzyme appeared to be a monomer protein by gel-filtration chromatography. A homogenous protein with a specific activity of 516 was finally obtained. After peptide sequencing by LC/MS/MS, the results were in agreement with the deduced amino acid sequence of the N-D-AAase. The pI of the enzyme was 5.12 and it had an optimal pH and temperature of 7.5 and 50 degrees C, respectively. After 30 min heat treatment at 45 degrees C, between pH 6 and pH 8, 80% activity remained. The N-D-AAase had higher hydrolysing activity against N-acetyl-d-amino acid derivates containing d-methionine, d-leucine and d-alanine and against N-chloroacetyl-d-phenylalanine. Importantly, the enzyme does not act on the N-acetyl-l-amino acid derivatives. The enzyme was inhibited by chelating agents and certain metal ions, but was activated by 1 mm of Co2+ and Mg2+. Thus, the N-D-AAase from V. paradoxus can be considered a chiral specific and metal-dependent enzyme.

  8. Distribution of messenger RNAs encoding the enzymes glutaminase, aspartate aminotransferase and glutamic acid decarboxylase in rat brain.


    Najlerahim, A; Harrison, P J; Barton, A J; Heffernan, J; Pearson, R C


    In situ hybridization histochemistry (ISHH) using synthetic oligonucleotide probes has been used to identify cells containing the mRNAs coding for glutaminase (GluT), aspartate aminotransferase (AspT) and glutamic acid decarboxylase (GAD). The distribution of GAD mRNA confirms previous descriptions and matches the distribution of GAD detected using specific antibodies. AspT mRNA is widely distributed in the brain, but is present at high levels in GABAergic neuronal populations, some that may be glutamatergic, and in a subset of neurons which do not contain significant levels of either GAD or GluT mRNA. Particularly prominent are the neurons of the magnocellular division of the red nucleus, the large cells in the deep cerebellar nuclei and the vestibular nuclei and neurons of the lateral superior olivary nucleus. GluT mRNA does not appear to be present at high levels in all GAD-containing neurons, but is seen prominently in many neuronal populations that may use glutamate as a neurotransmitter, such as neocortical and hippocampal pyramidal cells, the granule cells of the cerebellum and neurons of the dentate gyrus of the hippocampus. The heaviest labelling of GluT mRNA is seen in the lateral reticular nucleus of the medulla. ISHH using probes directed against the mRNAs encoding these enzymes may be an important technique for identifying glutamate and aspartate using neuronal populations and for examining their regulation in a variety of experimental and pathological circumstances.

  9. Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.


    Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V


    Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

  10. Hydrophobicity, expressivity and aromaticity are the major trends of amino-acid usage in 999 Escherichia coli chromosome-encoded genes.

    PubMed Central

    Lobry, J R; Gautier, C


    Multivariate analysis of the amino-acid compositions of 999 chromosome-encoded proteins from Escherichia coli showed that three main factors influence the variability of amino-acid composition. The first factor was correlated with the global hydrophobicity of proteins, and it discriminated integral membrane proteins from the others. The second factor was correlated with gene expressivity, showing a bias in highly expressed genes towards amino-acids having abundant major tRNAs. Just as highly expressed genes have reduced codon diversity in protein coding sequences, so do they have a reduced diversity of amino-acid choice. This showed that translational constraints are important enough to affect the global amino-acid composition of proteins. The third factor was correlated with the aromaticity of proteins, showing that aromatic amino-acid content is highly variable. PMID:8065933

  11. Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

    PubMed Central

    Ridley, R G; Patel, H V; Gerber, G E; Morton, R C; Freeman, K B


    A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a targeting region must reside within the amino acid sequence of the mature protein. Images PMID:3012461

  12. Inactivation of the lys7 gene, encoding saccharopine reductase in Penicillium chrysogenum, leads to accumulation of the secondary metabolite precursors piperideine-6-carboxylic acid and pipecolic acid from alpha-aminoadipic acid.


    Naranjo, Leopoldo; Martín de Valmaseda, Eva; Casqueiro, Javier; Ullán, Ricardo V; Lamas-Maceiras, Mónica; Bañuelos, Oscar; Martín, Juan F


    Pipecolic acid serves as a precursor of the biosynthesis of the alkaloids slaframine and swainsonine (an antitumor agent) in some fungi. It is not known whether other fungi are able to synthesize pipecolic acid. Penicillium chrysogenum has a very active alpha-aminoadipic acid pathway that is used for the synthesis of this precursor of penicillin. The lys7 gene, encoding saccharopine reductase in P. chrysogenum, was target inactivated by the double-recombination method. Analysis of a disrupted strain (named P. chrysogenum SR1-) showed the presence of a mutant lys7 gene lacking about 1,000 bp in the 3'-end region. P. chrysogenum SR1- lacked saccharopine reductase activity, which was recovered after transformation of this mutant with the intact lys7 gene in an autonomously replicating plasmid. P. chrysogenum SR1- was a lysine auxotroph and accumulated piperideine-6-carboxylic acid. When mutant P. chrysogenum SR1- was grown with L-lysine as the sole nitrogen source and supplemented with DL-alpha-aminoadipic acid, a high level of pipecolic acid accumulated intracellularly. A comparison of strain SR1- with a lys2-defective mutant provided evidence showing that P. chrysogenum synthesizes pipecolic acid from alpha-aminoadipic acid and not from L-lysine catabolism.

  13. Molecular characterization and expression analysis of GlHMGS, a gene encoding hydroxymethylglutaryl-CoA synthase from Ganoderma lucidum (Ling-zhi) in ganoderic acid biosynthesis pathway.


    Ren, Ang; Ouyang, Xiang; Shi, Liang; Jiang, Ai-Liang; Mu, Da-Shuai; Li, Meng-Jiao; Han, Qin; Zhao, Ming-Wen


    A hydroxymethylglutaryl-CoA synthase gene, designated as GlHMGS (GenBank accession No. JN391469) involved in ganoderic acid (GA) biosynthesis pathway was cloned from Ganoderma lucidum. The full-length cDNA of GlHMGS (GenBank accession No. JN391468) was found to contain an open reading frame of 1,413 bp encoding a polypeptide of 471 amino acid residues. The deduced amino acid sequence of GlHMGS shared high homology with other known hydroxymethylglutaryl-CoA synthase (HMGS) enzymes. In addition, functional complementation of GlHMGS in a mutant yeast strain YSC1021 lacking HMGS activity demonstrated that the cloned cDNA encodes a functional HMGS. A 1,561 bp promoter sequence was isolated and its putative regulatory elements and potential specific transcription factor binding sites were analyzed. GlHMGS expression profile analysis revealed that salicylic acid, abscisic acid and methyl jasmonate up-regulated GlHMGS transcript levels over the control. Further expression analysis revealed that the developmental stage and carbon source had significant effects on GlHMGS transcript levels. GlHMGS expression peaked on day 16 before decreasing with prolonged culture time. The highest mRNA level was observed when the carbon source was maltose. Overexpression of GlHMGS enhanced GA content in G. lucidum. This study provides useful information for further studying this gene and on its function in the ganoderic acid biosynthetic pathway in G. lucidum.

  14. Selective heterogeneous acid catalyzed esterification of N-terminal sulfyhdryl fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our interest in thiol fatty acids lies in their antioxidative, free radical scavenging, and metal ion scavenging capabilities as applied to cosmeceutical and skin care formulations. The retail market is filled with products containing the disulfide-containing free fatty acid, lipoic acid. These pr...

  15. Quantification of toxin-encoding mRNA from Clostridium botulinum type E in media containing sorbic acid or sodium nitrite by competitive RT-PCR.


    Sharkey, Freddie H; Markos, Spiros I; Haylock, Richard W


    Competitive reverse transcription polymerase chain reaction (cRT-PCR) was used to quantify the toxin-encoding mRNA production of a Clostridium botulinum type E strain in media containing either sorbic acid or sodium nitrite. A 10-fold reduction in toxin mRNA production and a 25-fold reduction in the proportion of toxin mRNA to total RNA, was estimated when either 1 mg ml(-1) sorbic acid or 100 microg ml(-1) sodium nitrite were added to the medium at pH 7.0.

  16. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.


    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario


    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  17. Comparative analysis of amino acid composition in the active site of nirk gene encoding copper-containing nitrite reductase (CuNiR) in bacterial spp.


    Adhikari, Utpal Kumar; Rahman, M Mizanur


    The nirk gene encoding the copper-containing nitrite reductase (CuNiR), a key catalytic enzyme in the environmental denitrification process that helps to produce nitric oxide from nitrite. The molecular mechanism of denitrification process is definitely complex and in this case a theoretical investigation has been conducted to know the sequence information and amino acid composition of the active site of CuNiR enzyme using various Bioinformatics tools. 10 Fasta formatted sequences were retrieved from the NCBI database and the domain and disordered regions identification and phylogenetic analyses were done on these sequences. The comparative modeling of protein was performed through Modeller 9v14 program and visualized by PyMOL tools. Validated protein models were deposited in the Protein Model Database (PMDB) (PMDB id: PM0080150 to PM0080159). Active sites of nirk encoding CuNiR enzyme were identified by Castp server. The PROCHECK showed significant scores for four protein models in the most favored regions of the Ramachandran plot. Active sites and cavities prediction exhibited that the amino acid, namely Glycine, Alanine, Histidine, Aspartic acid, Glutamic acid, Threonine, and Glutamine were common in four predicted protein models. The present in silico study anticipates that active site analyses result will pave the way for further research on the complex denitrification mechanism of the selected species in the experimental laboratory.

  18. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    NASA Technical Reports Server (NTRS)

    Lu, C.; Fedoroff, N.


    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  19. Human and mouse ZFY genes produce a conserved testis-specific transcript encoding a zinc finger protein with a short acidic domain and modified transactivation potential.


    Decarpentrie, Fanny; Vernet, Nadège; Mahadevaiah, Shantha K; Longepied, Guy; Streichemberger, Eric; Aknin-Seifer, Isabelle; Ojarikre, Obah A; Burgoyne, Paul S; Metzler-Guillemain, Catherine; Mitchell, Michael J


    Mammalian ZFY genes are located on the Y chromosome, and code putative transcription factors with 12-13 zinc fingers preceded by a large acidic (activating) domain. In mice, there are two genes, Zfy1 and Zfy2, which are expressed mainly in the testis. Their transcription increases in germ cells as they enter meiosis, both are silenced by meiotic sex chromosome inactivation (MSCI) during pachytene, and Zfy2 is strongly reactivated later in spermatids. Recently, we have shown that mouse Zfy2, but not Zfy1, is involved in triggering the apoptotic elimination of specific types of sex chromosomally aberrant spermatocytes. In humans, there is a single widely transcribed ZFY gene, and there is no evidence for a specific role in the testis. Here, we characterize ZFY transcription during spermatogenesis in mice and humans. In mice, we define a variety of Zfy transcripts, among which is a Zfy2 transcript that predominates in spermatids, and a Zfy1 transcript, lacking an exon encoding approximately half of the acidic domain, which predominates prior to MSCI. In humans, we have identified a major testis-specific ZFY transcript that encodes a protein with the same short acidic domain. This represents the first evidence that ZFY has a conserved function during human spermatogenesis. We further show that, in contrast to the full acidic domain, the short domain does not activate transcription in yeast, and we hypothesize that this explains the functional difference observed between Zfy1 and Zfy2 during mouse meiosis.

  20. Cloning, sequence analysis, and expression in Escherichia coli of the gene encoding an alpha-amino acid ester hydrolase from Acetobacter turbidans.


    Polderman-Tijmes, Jolanda J; Jekel, Peter A; de Vries, Erik J; van Merode, Annet E J; Floris, René; van der Laan, Jan-Metske; Sonke, Theo; Janssen, Dick B


    The alpha-amino acid ester hydrolase from Acetobacter turbidans ATCC 9325 is capable of hydrolyzing and synthesizing beta-lactam antibiotics, such as cephalexin and ampicillin. N-terminal amino acid sequencing of the purified alpha-amino acid ester hydrolase allowed cloning and genetic characterization of the corresponding gene from an A. turbidans genomic library. The gene, designated aehA, encodes a polypeptide with a molecular weight of 72,000. Comparison of the determined N-terminal sequence and the deduced amino acid sequence indicated the presence of an N-terminal leader sequence of 40 amino acids. The aehA gene was subcloned in the pET9 expression plasmid and expressed in Escherichia coli. The recombinant protein was purified and found to be dimeric with subunits of 70 kDa. A sequence similarity search revealed 26% identity with a glutaryl 7-ACA acylase precursor from Bacillus laterosporus, but no homology was found with other known penicillin or cephalosporin acylases. There was some similarity to serine proteases, including the conservation of the active site motif, GXSYXG. Together with database searches, this suggested that the alpha-amino acid ester hydrolase is a beta-lactam antibiotic acylase that belongs to a class of hydrolases that is different from the Ntn hydrolase superfamily to which the well-characterized penicillin acylase from E. coli belongs. The alpha-amino acid ester hydrolase of A. turbidans represents a subclass of this new class of beta-lactam antibiotic acylases.

  1. Cloning and Sequence Analysis of cDNAs Encoding Two Acidic PLA(2) from venom of Ophiophagus hannah(King Cobra), Guangxi Species.


    Wang, Qiu-Yan; Shu, Yu-Yan; Zhuang, Mao-Xing; Lin, Zheng-Jiong


    Total RNA was extracted from venom glands of Ophiophagus hannah, Guangxi species. The cDNAs encoding PLA(2) were amplified by RT-PCR and cloned into the PUCm-T vector. The positive clones encoding two acidic PLA(2) (APLA(2)-1 and APLA(2)-2) were selected and bidirectionally sequenced. Their complete amino acid sequences were deduced and found to be identical to the known amino acid sequences. Their isoelectric points calculated by computer agreed with the values determined with their protein. Homology analysis indicated that the mature peptide of APLA(2)-1 had high homology with PLA(2) from venoms of Ophiophagus hannah, Fujian and Taiwan species, but APLA(2)-2 had lower homology. The most striking difference between APLA(2)-2 and other PLA(2) from Ophiophagus hannah venoms is the missing of a extra "pancreatic loop" at residues 62--66 in APLA(2)-2, and it may be related to their species evolution and biological activity.

  2. Plasmonic Encoding

    DTIC Science & Technology


    AFRL-OSR-VA-TR-2014-0291 PLASMONIC ENCODING Chad Mirkin NORTHWESTERN UNIVERSITY Final Report 10/06/2014 DISTRIBUTION A: Distribution approved for...2014 4.  TITLE AND SUBTITLE PLASMONIC ENCODING 5a.  CONTRACT NUMBER 5b.  GRANT NUMBER FA9550-09-1-0294 5c.  PROGRAM ELEMENT NUMBER 6.  AUTHOR(S) Chad...called Nanoflares. 15.  SUBJECT TERMS plasmonic , encoding 16.  SECURITY CLASSIFICATION OF: 17.  LIMITATION OF       ABSTRACT UU 18.  NUMBER        OF

  3. Aromatic Amino Acid Auxotrophs Constructed by Recombinant Marker Exchange in Methylophilus methylotrophus AS1 Cells Expressing the aroP-Encoded Transporter of Escherichia coli▿ † ‡

    PubMed Central

    Yomantas, Yurgis A. V.; Tokmakova, Irina L.; Gorshkova, Natalya V.; Abalakina, Elena G.; Kazakova, Svetlana M.; Gak, Evgueni R.; Mashko, Sergey V.


    The isolation of auxotrophic mutants, which is a prerequisite for a substantial genetic analysis and metabolic engineering of obligate methylotrophs, remains a rather complicated task. We describe a novel method of constructing mutants of the bacterium Methylophilus methylotrophus AS1 that are auxotrophic for aromatic amino acids. The procedure begins with the Mu-driven integration of the Escherichia coli gene aroP, which encodes the common aromatic amino acid transporter, into the genome of M. methylotrophus. The resulting recombinant strain, with improved permeability to certain amino acids and their analogues, was used for mutagenesis. Mutagenesis was carried out by recombinant substitution of the target genes in the chromosome by linear DNA using the FLP-excisable marker flanked with cloned homologous arms longer than 1,000 bp. M. methylotrophus AS1 genes trpE, tyrA, pheA, and aroG were cloned in E. coli, sequenced, disrupted in vitro using a Kmr marker, and electroporated into an aroP carrier recipient strain. This approach led to the construction of a set of marker-less M. methylotrophus AS1 mutants auxotrophic for aromatic amino acids. Thus, introduction of foreign amino acid transporter genes appeared promising for the following isolation of desired auxotrophs on the basis of different methylotrophic bacteria. PMID:19880640

  4. Arabidopsis Deficient in Cutin Ferulate Encodes a Transferase Required for Feruloylation of ω-Hydroxy Fatty Acids in Cutin Polyester1[W][OA

    PubMed Central

    Rautengarten, Carsten; Ebert, Berit; Ouellet, Mario; Nafisi, Majse; Baidoo, Edward E.K.; Benke, Peter; Stranne, Maria; Mukhopadhyay, Aindrila; Keasling, Jay D.; Sakuragi, Yumiko; Scheller, Henrik Vibe


    The cuticle is a complex aliphatic polymeric layer connected to the cell wall and covers surfaces of all aerial plant organs. The cuticle prevents nonstomatal water loss, regulates gas exchange, and acts as a barrier against pathogen infection. The cuticle is synthesized by epidermal cells and predominantly consists of an aliphatic polymer matrix (cutin) and intracuticular and epicuticular waxes. Cutin monomers are primarily C16 and C18 unsubstituted, ω-hydroxy, and α,ω-dicarboxylic fatty acids. Phenolics such as ferulate and p-coumarate esters also contribute to a minor extent to the cutin polymer. Here, we present the characterization of a novel acyl-coenzyme A (CoA)-dependent acyl-transferase that is encoded by a gene designated Deficient in Cutin Ferulate (DCF). The DCF protein is responsible for the feruloylation of ω-hydroxy fatty acids incorporated into the cutin polymer of aerial Arabidopsis (Arabidopsis thaliana) organs. The enzyme specifically transfers hydroxycinnamic acids using ω-hydroxy fatty acids as acyl acceptors and hydroxycinnamoyl-CoAs, preferentially feruloyl-CoA and sinapoyl-CoA, as acyl donors in vitro. Arabidopsis mutant lines carrying DCF loss-of-function alleles are devoid of rosette leaf cutin ferulate and exhibit a 50% reduction in ferulic acid content in stem insoluble residues. DCF is specifically expressed in the epidermis throughout all green Arabidopsis organs. The DCF protein localizes to the cytosol, suggesting that the feruloylation of cutin monomers takes place in the cytoplasm. PMID:22158675

  5. Mutations in the Arabidopsis Lst8 and Raptor genes encoding partners of the TOR complex, or inhibition of TOR activity decrease abscisic acid (ABA) synthesis.


    Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie


    The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis.

  6. aguA, the gene encoding an extracellular alpha-glucuronidase from Aspergillus tubingensis, is specifically induced on xylose and not on glucuronic acid.


    de Vries, R P; Poulsen, C H; Madrid, S; Visser, J


    An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.

  7. Packaging of an AAV vector encoding human acid alpha-glucosidase for gene therapy in glycogen storage disease type II with a modified hybrid adenovirus-AAV vector.


    Sun, Baodong; Chen, Y-T; Bird, Andrew; Xu, Fang; Hou, Yang-Xun; Amalfitano, Andrea; Koeberl, Dwight D


    We have developed an improved method for packaging adeno-associated virus (AAV) vectors with a replication-defective adenovirus-AAV (Ad-AAV) hybrid virus. The AAV vector encoding human acid alpha-glucosidase (hGAA) was cloned into an E1, polymerase/preterminal protein-deleted adenovirus, such that it is packaged as an Ad vector. Importantly, the Ad-AAV hybrid cannot replicate during AAV vector packaging in 293 cells, because of deletion of polymerase/preterminal protein. The residual Ad-AAV in the AAV vector stock was reduced to <1 infectious particle per 10(10) AAV vector particles. These modifications resulted in approximately 30-fold increased packaging of the AAV vector for the hybrid Ad-AAV vector method as compared with standard transfection-only methods. Similarly improved packaging was demonstrated for pseudotyping the AAV vector as AAV6, and for AAV vector packaging with a second Ad-AAV vector encoding canine glucose-6-phosphatase. Liver-targeted delivery of either the Ad-AAV hybrid or AAV vector particles in acid alpha-glucosidase-knockout (GAA-KO) mice revealed secretion of hGAA with the Ad-AAV vector, and sustained secretion of hGAA with an AAV vector in hGAA-tolerant GAA-KO mice. Further development of hybrid Ad-AAV vectors could offer distinct advantages for gene therapy in glycogen storage diseases.

  8. Cross-species conservation of complementary amino acid-ribonucleobase interactions and their potential for ribosome-free encoding

    PubMed Central

    Cannon, John G. D.; Sherman, Rachel M.; Wang, Victoria M. Y.; Newman, Grace A.


    The role of amino acid-RNA nucleobase interactions in the evolution of RNA translation and protein-mRNA autoregulation remains an open area of research. We describe the inference of pairwise amino acid-RNA nucleobase interaction preferences using structural data from known RNA-protein complexes. We observed significant matching between an amino acid’s nucleobase affinity and corresponding codon content in both the standard genetic code and mitochondrial variants. Furthermore, we showed that knowledge of nucleobase preferences allows statistically significant prediction of protein primary sequence from mRNA using purely physiochemical information. Interestingly, ribosomal primary sequences were more accurately predicted than non-ribosomal sequences, suggesting a potential role for direct amino acid-nucleobase interactions in the genesis of amino acid-based ribosomal components. Finally, we observed matching between amino acid-nucleobase affinities and corresponding mRNA sequences in 35 evolutionarily diverse proteomes. We believe these results have important implications for the study of the evolutionary origins of the genetic code and protein-mRNA cross-regulation. PMID:26656258

  9. Pear ACO genes encoding putative 1-aminocyclopropane-1-carboxylate oxidase homologs are functionally expressed during fruit ripening and involved in response to salicylic acid.


    Shi, Hai-Yan; Zhang, Yu-Xing


    1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final reaction of the ethylene biosynthetic pathway, converting ACC into ethylene. Past studies have shown a possible link between ACC oxidase and salicylic acid during fruit ripening in pear, but the relationship has received no more than modest study at the gene expression level. In this study, two cDNA clones encoding putative ACC oxidase, PpACO1 and PpACO2, were isolated from a cDNA library constructed by our own laboratory and produced using mRNA from mesocarp of pear (Pyrus pyrifolia Nakai. cv.Whangkeumbae). One cDNA clone, designated PpACO1 (GenBank accession No. JN807390), comprised an open reading frame of 945 bp encoding a protein of 314 amino acids. The other cDNA, designated PpACO2 (GenBank accession No. JN807392), encodes a protein with 322 amino acids that shares high similarity with the known plant ACOs. Using PCR amplification techniques, two genomic clones corresponding to PpACO1 and PpACO2 were isolated and shown to contain independently three introns with typical GT/AG boundaries defining the splice junctions. The PpACO1 gene product shared 99 % identity with an ACC oxidase from pear (Pyrus × bretschneideri, and phylogenetic analyses clearly placed the gene product in the ACC oxidase cluster of the pear 2-oxoglutarate-dependent dioxygenase superfamily tree. Quantitative RT-PCR analysis indicated that the two PpACO genes are differentially expressed in pear tissues. PpACO1 and PpACO2 were predominantly expressed in fruit. The transcripts of PpACO1 were accumulated at relatively low levels in early fruit, but strongly high levels in fruit ripening and senescence stages, while the transcripts of PpACO2 were accumulated at higher levels in early fruit and much lower levels with further fruit cell development than the transcripts of PpACO1. In addition, PpACO1 gene was down-regulated in fruit by salicylic acid (SA). Nevertheless, PpACO2 gene was dramatically up-regulated in

  10. Stabilization of secondary structure elements by specific combinations of hydrophilic and hydrophobic amino acid residues is more important for proteins encoded by GC-poor genes.


    Khrustalev, Vladislav Victorovich; Barkovsky, Eugene Victorovich


    Stabilization of secondary structure elements by specific combinations of hydrophobic and hydrophilic amino acids has been studied by the way of analysis of pentapeptide fragments from twelve partial bacterial proteomes. PDB files describing structures of proteins from species with extremely high and low genomic GC-content, as well as with average G + C were included in the study. Amino acid residues in 78,009 pentapeptides from alpha helices, beta strands and coil regions were classified into hydrophobic and hydrophilic ones. The common propensity scale for 32 possible combinations of hydrophobic and hydrophilic amino acid residues in pentapeptide has been created: specific pentapeptides for helix, sheet and coil were described. The usage of pentapeptides preferably forming alpha helices is decreasing in alpha helices of partial bacterial proteomes with the increase of the average genomic GC-content in first and second codon positions. The usage of pentapeptides preferably forming beta strands is increasing in coil regions and in helices of partial bacterial proteomes with the growth of the average genomic GC-content in first and second codon positions. Due to these circumstances the probability of coil-sheet and helix-sheet transitions should be increased in proteins encoded by GC-rich genes making them prone to form amyloid in certain conditions. Possible causes of the described fact that importance of alpha helix and coil stabilization by specific combinations of hydrophobic and hydrophilic amino acids is growing with the decrease of genomic GC-content have been discussed.

  11. A single amino acid change in AngR, a protein encoded by pJM1-like virulence plasmids, results in hyperproduction of anguibactin.

    PubMed Central

    Tolmasky, M E; Actis, L A; Crosa, J H


    The siderophore anguibactin is produced in vivo in a diffusible form and is an important factor in the virulence of Vibrio anguillarum. The natural isolate V. anguillarum 531A is a hyperproducer of anguibactin when compared with the prototype strain V. anguillarum 775. The angR gene was found to be responsible for this difference in levels of anguibactin produced. Nucleotide sequence analysis showed that the angR531A differed in a single nucleotide from the angR775 present in the prototype plasmid pJM1. This nucleotide substitution resulted in a change in amino acid 267 from His in strain 775 to Asn in strain 531A. This amino acid is located in a region between one of the two helix-turn-helix domains and the neighboring leucine zipper. Mutations to replace His with either Leu or Gln, generated by site-directed mutagenesis, in amino acid 267 resulted in strains for which the MIC of the iron chelator ethylenediamine di(o-hydroxyphenyl) acetic acid were lower than for the proptotype 775 but higher than for iron uptake-deficient strains. In addition to its transcriptional activating function, AngR also complemented a mutation in the Escherichia coli entE gene, which encodes the enterobactin biosynthetic enzyme 2,3-dihydroxybenzoate-AMP ligase. Therefore, AngR may also function in V. anguillarum as an EntE-like enzyme for the biosynthesis of anguibactin. Images PMID:8335354

  12. Comparative studies of genes encoding thermostable L-2-halo acid dehalogenase from Pseudomonas sp. strain YL, other dehalogenases, and two related hypothetical proteins from Escherichia coli.

    PubMed Central

    Nardi-Dei, V; Kurihara, T; Okamura, T; Liu, J Q; Koshikawa, H; Ozaki, H; Terashima, Y; Esaki, N; Soda, K


    We have determined the nucleotide sequence of the gene encoding thermostable L-2-halo acid dehalogenase (L-DEX) from the 2-chloroacrylate-utilizable bacterium Pseudomonas sp. strain YL. The open reading frame consists of 696 nucleotides corresponding to 232 amino acid residues. The protein molecular weight was estimated to be 26,179, which was in good agreement with the subunit molecular weight of the enzyme. The gene was efficiently expressed in the recombinant Escherichia coli cells: the amount of L-DEX corresponds to about 49% of the total soluble proteins. The predicted amino acid sequence showed a high level of similarity to those of L-DEXs from other bacterial strains and haloacetate dehalogenase H-2 from Moraxella sp. strain B (38 to 57% identity) but a very low level of similarity to those of haloacetate dehalogenase H-1 from Moraxella sp. strain B (10%) and haloalkane dehalogenase from Xanthobacter autotrophicus GJ10 (12%). By searching the protein amino acid sequence database, we found two E. coli hypothetical proteins similar to the Pseudomonas sp. strain YL L-DEX (21 to 22%). PMID:7944368

  13. A genetically encoded probe for the identification of proteins that form sulfenic acid in response to H2O2 in Saccharomyces cerevisiae.


    Takanishi, Christina L; Wood, Matthew J


    It is widely known that reactive oxygen species (ROS), such as hydrogen peroxide, play important roles in cellular signaling and initiation of oxidative stress responses via thiol modifications. Identification of the targets of these modifications will provide a better understanding of the relationship between ROS and human diseases, such as cancer and atherosclerosis. Sulfenic acid is the principle product of a reaction between hydrogen peroxide and a reactive protein cysteine. This reversible post-translational modification plays an important role in enzyme active sites, signaling transduction via disulfide bond formation, as well as an intermediate to overoxidation products during oxidative stress. By re-engineering the C-terminal cysteine rich domain (cCRD) of the Yap1 transcription factor, we were able to create a genetically encoded probe for the general detection and identification of proteins that form sulfenic acid in vivo. The Yap1-cCRD probe has been used previously in the identification of proteins that form sulfenic acid in Escherichia coli. Here we demonstrate the successful use of the Yap1-cCRD probe in the identification of proteins that form sulfenic acid in response to hydrogen peroxide in Saccharomyces cerevisiae.

  14. Molecular cloning and sequencing of a cDNA encoding the thioesterase domain of the rat fatty acid synthetase.


    Naggert, J; Witkowski, A; Mikkelsen, J; Smith, S


    A cloned cDNA containing the entire coding sequence for the long-chain S-acyl fatty acid synthetase thioester hydrolase (thioesterase I) component as well as the 3'-noncoding region of the fatty acid synthetase has been isolated using an expression vector and domain-specific antibodies. The coding region was assigned to the thioesterase I domain by identification of sequences coding for characterized peptide fragments, amino-terminal analysis of the isolated thioesterase I domain and the presence of the serine esterase active-site sequence motif. The thioesterase I domain is 306 amino acids long with a calculated molecular mass of 33,476 daltons; its DNA is flanked at the 5'-end by a region coding for the acyl carrier protein domain and at the 3'-end by a 1,537-base pairs-long noncoding sequence with a poly(A) tail. The thioesterase I domain exhibits a low, albeit discernible, homology with the discrete medium-chain S-acyl fatty acid synthetase thioester hydrolases (thioesterase II) from rat mammary gland and duck uropygial gland, suggesting a distant but common evolutionary ancestry for these proteins.

  15. Ectopic expression of Arabidopsis genes encoding salicylic acid- and jasmonic acid-related proteins confers partial resistance to soybean cyst nematode (Heterodera glycines) in transgenic soybean roots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background. Extensive studies using the model system Arabidopsis thaliana to elucidate plant defense signaling and pathway networks indicate that salicylic acid (SA) is the key hormone triggering the plant defense response against biotrophic and hemi-biotrophic pathogens, while jasmonic acid (JA) an...

  16. Nucleotide sequence and functional analysis of the genes encoding 2,4,5-trichlorophenoxyacetic acid oxygenase in Pseudomonas cepacia AC1100.

    PubMed Central

    Danganan, C E; Ye, R W; Daubaras, D L; Xun, L; Chakrabarty, A M


    Pseudomonas cepacia AC1100 is able to use the chlorinated aromatic compound 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) as the sole source of carbon and energy. One of the early steps in this pathway is the conversion of 2,4,5-T to 2,4,5-trichlorophenol (2,4,5-TCP). 2,4,5-TCP accumulates in the culture medium when AC1100 is grown in the presence of 2,4,5-T. A DNA region from the AC1100 genome has been subcloned as a 2.7-kb SstI-XbaI DNA fragment, which on transfer to Pseudomonas aeruginosa PAO1 allows the conversion of 2,4,5-T to 2,4,5-TCP. We have determined the directions of transcription of these genes as well as the complete nucleotide sequences of the genes and the number and sizes of the polypeptides synthesized by pulse-labeling experiments. This 2.7-kb DNA fragment encodes two polypeptides with calculated molecular masses of 51 and 18 kDa. Proteins of similar sizes were seen in the T7 pulse-labeling experiment in Escherichia coli. We have designated the genes for these proteins tftA1 (which encodes the 51-kDa protein) and tftA2 (which encodes the 18-kDa protein). TftA1 and TftA2 have strong amino acid sequence homology to BenA and BenB from the benzoate 1,2-dioxygenase system of Acinetobacter calcoaceticus, as well as to XylX and XylY from the toluate 1,2-dioxygenase system of Pseudomonas putida. The Pseudomonas aeruginosa PAO1 strain containing the 2.7-kb SstI-XbaI fragment was able to convert not only 2,4,5-T to 2,4,5-TCP but also 2,4-dichlorophenoxyacetic acid to 2,4-dichlorophenol and phenoxyacetate to phenol. Images PMID:7527626

  17. Secretion of the acid trehalase encoded by the CgATH1 gene allows trehalose fermentation by Candida glabrata.


    Zilli, D M W; Lopes, R G; Alves, S L; Barros, L M; Miletti, L C; Stambuk, B U


    The emergent pathogen Candida glabrata differs from other yeasts because it assimilates only two sugars, glucose and the disaccharide trehalose. Since rapid identification tests are based on the ability of this yeast to rapidly hydrolyze trehalose, in this work a biochemical and molecular characterization of trehalose catabolism by this yeast was performed. Our results show that C. glabrata consumes and ferments trehalose, with parameters similar to those observed during glucose fermentation. The presence of glucose in the medium during exponential growth on trehalose revealed extracellular hydrolysis of the sugar by a cell surface acid trehalase with a pH optimum of 4.4. Approximately ∼30% of the total enzymatic activity is secreted into the medium during growth on trehalose or glycerol. The secreted enzyme shows an apparent molecular mass of 275 kDa in its native form, but denaturant gel electrophoresis revealed a protein with ∼130 kDa, which due to its migration pattern and strong binding to concanavalin A, indicates that it is probably a dimeric glycoprotein. The secreted acid trehalase shows high affinity and activity for trehalose, with Km and Vmax values of 3.4 mM and 80 U (mg protein)(-1), respectively. Cloning of the CgATH1 gene (CAGLOK05137g) from de C. glabrata genome, a gene showing high homology to fungal acid trehalases, allowed trehalose fermentation after heterologous expression in Saccharomyces cerevisiae.

  18. Enhanced Efficacy of an AAV Vector Encoding Chimeric, Highly-Secreted Acid α-glucosidase in Glycogen Storage Disease Type II

    PubMed Central

    Sun, Baodong; Zhang, Haoyue; Benjamin, Daniel K.; Brown, Talmage; Bird, Andrew; Young, Sarah P.; McVie-Wylie, Alison; Chen, Y-T; Koeberl, Dwight D.


    Glycogen storage disease type II (GSD-II; Pompe disease; MIM 232300) is an inherited muscular dystrophy caused by deficiency in the activity of the lysosomal enzyme acid α-glucosidase (GAA). We hypothesized that chimeric GAA containing an alternative signal peptide could increase the secretion of GAA from transduced cells and enhance the receptor-mediated uptake of GAA in striated muscle. The relative secretion of chimeric GAA from transfected 293 cells increased up to 26-fold. Receptor-mediated uptake of secreted, chimeric GAA corrected cultured GSD-II patient cells. High-level hGAA was sustained in the plasma of GSD-II mice for 24 weeks following administration of an AAV2/8 vector encoding chimeric GAA; furthermore, GAA activity was increased and glycogen content was significantly reduced in striated muscle and in the brain. Administration of only 1×1010 vector particles increased GAA activity in the heart and diaphragm for >18 weeks, whereas 3×1010 vector particles increased GAA activity and reduced glycogen content in the heart, diaphragm, and quadriceps. Furthermore, an AAV2/2 vector encoding chimeric GAA produced secreted hGAA for >12 weeks in the majority of treated GSD-II mice. Thus, chimeric, highly secreted GAA enhanced the efficacy of AAV vector-mediated gene therapy in GSD-II mice. PMID:16987711

  19. Sequence of a cDNA clone encoding the polysialic acid-rich and cytoplasmic domains of the neural cell adhesion molecule N-CAM.

    PubMed Central

    Hemperly, J J; Murray, B A; Edelman, G M; Cunningham, B A


    Purified fractions of the neural cell-adhesion molecule N-CAM from embryonic chicken brain contain two similar polypeptides (Mr, 160,000 and 130,000), each containing an amino-terminal external binding region, a carbohydrate-rich central region, and a carboxyl-terminal region that is associated with the cell. Previous studies indicate that the two polypeptides arise by alternative splicing of mRNAs transcribed from a single gene. We report here the 3556-nucleotide sequence of a cDNA clone (pEC208) that encodes 964 amino acids from the carbohydrate and cell-associated domains of the larger N-CAM polypeptide followed by 664 nucleotides of 3' untranslated sequence. The predicted protein sequence contains attachment sites for polysialic acid-containing oligosaccharides, four tandem homologous regions of polypeptide resembling those seen in the immunoglobulin superfamily, and a single hydrophobic sequence that appears to be the membrane-spanning segment. The cytoplasmic domain carboxyl terminal to this segment includes a block of approximately equal to 250 amino acids present in the larger but not in the smaller N-CAM polypeptide. We designate these the ld (large domain) polypeptide and the sd (small domain) polypeptide. The intracellular domains of the ld and sd polypeptides are likely to be critical for cell-surface modulation of N-CAM by interacting in a differential fashion with other intrinsic proteins or with the cytoskeleton. PMID:3458261

  20. Biosynthesis of UDP-xylose. Cloning and characterization of a novel Arabidopsis gene family, UXS, encoding soluble and putative membrane-bound UDP-glucuronic acid decarboxylase isoforms.


    Harper, April D; Bar-Peled, Maor


    UDP-xylose (Xyl) is an important sugar donor for the synthesis of glycoproteins, polysaccharides, various metabolites, and oligosaccharides in animals, plants, fungi, and bacteria. UDP-Xyl also feedback inhibits upstream enzymes (UDP-glucose [Glc] dehydrogenase, UDP-Glc pyrophosphorylase, and UDP-GlcA decarboxylase) and is involved in its own synthesis and the synthesis of UDP-arabinose. In plants, biosynthesis of UDP-Xyl is catalyzed by different membrane-bound and soluble UDP-GlcA decarboxylase (UDP-GlcA-DC) isozymes, all of which convert UDP-GlcA to UDP-Xyl. Because synthesis of UDP-Xyl occurs both in the cytosol and in membranes, it is not known which source of UDP-Xyl the different Golgi-localized xylosyltransferases are utilizing. Here, we describe the identification of several distinct Arabidopsis genes (named AtUXS for UDP-Xyl synthase) that encode functional UDP-GlcA-DC isoforms. The Arabidopsis genome contains five UXS genes and their protein products can be subdivided into three isozyme classes (A-C), one soluble and two distinct putative membrane bound. AtUxs from each class, when expressed in Escherichia coli, generate active UDP-GlcA-DC that converts UDP-GlcA to UDP-Xyl. Members of this gene family have a large conserved C-terminal catalytic domain (approximately 300 amino acids long) and an N-terminal variable domain differing in sequence and size (30-120 amino acids long). Isoforms of class A and B appear to encode putative type II membrane proteins with their catalytic domains facing the lumen (like Golgi-glycosyltransferases) and their N-terminal variable domain facing the cytosol. Uxs class C is likely a cytosolic isoform. The characteristics of the plant Uxs support the hypothesis that unique UDP-GlcA-DCs with distinct subcellular localizations are required for specific xylosylation events.

  1. Impact of improving dietary amino acid balance for lactating sows on efficiency of dietary amino acid utilization and transcript abundance of genes encoding lysine transporters in mammary tissue.


    Huber, L; de Lange, C F M; Ernst, C W; Krogh, U; Trottier, N L


    Lactating multiparous Yorkshire sows ( = 64) were used in 2 experiments to test the hypothesis that reducing dietary CP intake and improving AA balance through crystalline AA (CAA) supplementation improves apparent dietary AA utilization efficiency for milk production and increases transcript abundance of genes encoding Lys transporter proteins in mammary tissue. In Exp. 1, 40 sows were assigned to 1 of 4 diets: 1) high CP (HCP; 16.0% CP, as-fed basis; analyzed concentration), 2) medium-high CP (MHCP; 15.7% CP), 3) medium-low CP (MLCP; 14.3% CP), and 4) low CP (LCP; 13.2% CP). The HCP diet was formulated using soybean meal and corn as the only Lys sources. The reduced-CP diets contained CAA to meet estimated requirements for essential AA that became progressively limiting with reduction in CP concentration, that is, Lys, Ile, Met + Cys, Thr, Trp, and Val. Dietary standardized ileal digestible (SID) Lys concentration was 80% of the estimated requirement. In Exp. 2, 24 sows were assigned to the HCP or LCP diets. In Exp. 1, blood samples were postprandially collected 15 h on d 3, 7, 14, and 18 of lactation and utilization efficiency of dietary AA for milk production was calculated during early (d 3 to 7) and peak (d 14 to 18) lactation. Efficiency values were estimated from daily SID AA intakes and milk AA yield, with corrections for maternal AA requirement for maintenance and AA contribution from body protein losses. In Exp. 2, mammary tissue was biopsied on d 4 and 14 of lactation to determine the mRNA abundance of genes encoding Lys transporter proteins. In peak lactation, Lys, Thr, Trp, and Val utilization efficiency increased with decreasing dietary CP (linear for Trp and Val, < 0.05; in sows fed the MHCP diet vs. sows fed the HCP diet for Lys and Thr, < 0.05). Total essential and nonessential 15-h postprandial serum AA concentrations increased with decreasing dietary CP (linear, = 0.09 and < 0.05, respectively), suggesting increased maternal body protein

  2. Expression of genes encoding enzymes involved in the one carbon cycle in rat placenta is determined by maternal micronutrients (folic acid, vitamin B12) and omega-3 fatty acids.


    Khot, Vinita; Kale, Anvita; Joshi, Asmita; Chavan-Gautam, Preeti; Joshi, Sadhana


    We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency) leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR) and methionine synthase , but higher cystathionine b-synthase (CBS) and Phosphatidylethanolamine-N-methyltransferase (PEMT) as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE), phosphatidylcholine (PC), in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.

  3. Asparagusic acid.


    Mitchell, Stephen C; Waring, Rosemary H


    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications.

  4. In Candida parapsilosis the ATC1 Gene Encodes for an Acid Trehalase Involved in Trehalose Hydrolysis, Stress Resistance and Virulence

    PubMed Central

    Sánchez-Fresneda, Ruth; Martínez-Esparza, María; Maicas, Sergi; Argüelles, Juan-Carlos; Valentín, Eulogio


    An ORF named CPAR2-208980 on contig 005809 was identified by screening a Candida parapsilosis genome data base. Its 67% identity with the acid trehalase sequence from C. albicans (ATC1) led us to designate it CpATC1. Homozygous mutants that lack acid trehalase activity were constructed by gene disruption at the two CpATC1 chromosomal alleles. Phenotypic characterization showed that atc1Δ null cells were unable to grow on exogenous trehalose as carbon source, and also displayed higher resistance to environmental challenges, such as saline exposure (1.2 M NaCl), heat shock (42°C) and both mild and severe oxidative stress (5 and 50 mM H2O2). Significant amounts of intracellular trehalose were specifically stored in response to the thermal upshift in both wild type and mutant strains. Analysis of their antioxidant activities revealed that catalase was only triggered in response to heat shock in atc1Δ cells, whereas glutathione reductase was activated upon mild oxidative stress in wild type and reintegrant strains, and in response to the whole set of stress treatments in the homozygous mutant. Furthermore, yeast cells with double CpATC1 deletion were significantly attenuated in non-mammalian infection models, suggesting that CpATC1 is required for the pathobiology of the fungus. Our results demonstrate the involvement of CpAtc1 protein in the physiological hydrolysis of external trehalose in C. parapsilosis, where it also plays a major role in stress resistance and virulence. PMID:24922533

  5. Environmental DNA-encoded antibiotics fasamycins A and B inhibit FabF in type II fatty acid biosynthesis.


    Feng, Zhiyang; Chakraborty, Debjani; Dewell, Scott B; Reddy, Boojala Vijay B; Brady, Sean F


    In a recent study of polyketide biosynthetic gene clusters cloned directly from soil, we isolated two antibiotics, fasamycins A and B, which showed activity against methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis. To identify the target of the fasamycins, mutants with elevated fasamycin A minimum inhibitory concentrations were selected from a wild-type culture of E. faecalis OG1RF. Next-generation sequencing of these mutants, in conjunction with in vitro biochemical assays, showed that the fasamycins inhibit FabF of type II fatty acid biosynthesis (FASII). Candidate gene overexpression studies also showed that fasamycin resistance is conferred by fabF overexpression. On the basis of comparisons with known FASII inhibitors and in silico docking studies, the chloro-gem-dimethyl-anthracenone substructure seen in the fasamycins is predicted to represent a naturally occurring FabF-specific antibiotic pharmacophore. Optimization of this pharmacophore should yield FabF-specific antibiotics with increased potencies and differing spectra of activity. This study demonstrates that culture-independent antibiotic discovery methods have the potential to provide access to novel metabolites with modes of action that differ from those of antibiotics currently in clinical use.

  6. Amplification of an MFS transporter encoding gene penT significantly stimulates penicillin production and enhances the sensitivity of Penicillium chrysogenum to phenylacetic acid.


    Yang, Jing; Xu, Xinxin; Liu, Gang


    Penicillin is historically important as the first discovered drug against bacterial infections in human. Although the penicillin biosynthetic pathway and regulatory mechanism have been well studied in Penicillium chrysogenum, the compartmentation and molecular transport of penicillin or its precursors are still poorly understood. In search of the genomic database, more than 830 open reading frames (ORFs) were found to encode transmembrane proteins of P. chrysogenum. In order to investigate their roles on penicillin production, one of them (penT) was selected and cloned. The deduced protein of penT belongs to the major facilitator superfamily (MFS) and contains 12 transmembrane spanning domains (TMS). During fermentation, the transcription of penT was greatly induced by penicillin precursors phenylacetic acid (PAA) and phenoxyacetic acid (POA). Knock-down of penT resulted in significant decrease of penicillin production, while over-expression of penT under the promoter of trpC enhanced the penicillin production. Introduction of an additional penT in the wild-type strain of P. chrysogenum doubled the penicillin production and enhanced the sensitivity of P. chrysogenum to the penicillin precursors PAA or POA. These results indicate that penT stimulates penicillin production probably through enhancing the translocation of penicillin precursors across fungal cellular membrane.

  7. RepA Protein Encoded by Oat dwarf virus Elicits a Temperature-Sensitive Hypersensitive Response-Type Cell Death That Involves Jasmonic Acid-Dependent Signaling.


    Qian, Yajuan; Hou, Huwei; Shen, Qingtang; Cai, Xinzhong; Sunter, Garry; Zhou, Xueping


    The hypersensitive response (HR) is a component of disease resistance that is often induced by pathogen infection, but essentially no information is available for members of the destructive mastreviruses. We have investigated an HR-type response elicited in Nicotiana species by Oat dwarf virus (ODV) and have found that expression of the ODV RepA protein but not other ODV-encoded proteins elicits the HR-type cell death associated with a burst of H2O2. Deletion mutagenesis indicates that the first nine amino acids (aa) at the N terminus of RepA and the two regions located between aa residues 173 and 195 and between aa residues 241 and 260 near the C terminus are essential for HR-type cell-death elicitation. Confocal and electron microscopy showed that the RepA protein is localized in the nuclei of plant cells and might contain bipartite nuclear localization signals. The HR-like lesions mediated by RepA were inhibited by temperatures above 30°C and involvement of jasmonic acid (JA) in HR was identified by gain- and loss-of-function experiments. To our knowledge, this is the first report of an elicitor of HR-type cell death from mastreviruses.

  8. Isolation of a gene encoding a chaperonin-like protein by complementation of yeast amino acid transport mutants with human cDNA.

    PubMed Central

    Segel, G B; Boal, T R; Cardillo, T S; Murant, F G; Lichtman, M A; Sherman, F


    A human cDNA library in lambda-yes plasmid was used to transform a strain of Saccharomyces cerevisiae with defects in histidine biosynthesis (his4-401) and histidine permease (hip1-614) and with the general amino acid permease (GAP) repressed by excess ammonium. We investigated three plasmids complementing the transport defect on a medium with a low concentration of histidine. Inserts in these plasmids hybridized with human genomic but not yeast genomic DNA, indicating their human origin. mRNA corresponding to the human DNA insert was produced by each yeast transformant. Complementation of the histidine transport defect was confirmed by direct measurement of histidine uptake, which was increased 15- to 65-fold in the transformants as compared with the parental strain. Competitive inhibition studies, measurement of citrulline uptake, and lack of complementation in gap1- strains indicated that the human cDNA genes code for proteins that prevent GAP repression by ammonium. The amino acid sequence encoded by one of the cDNA clones is related to T-complex proteins, which suggests a "chaperonin"-like function. We suggest that the human chaperonin-like protein stabilizes the NPR1 gene product and prevents inactivation of GAP. Images PMID:1352881

  9. Calmodulin-binding proteins in bryophytes: identification of abscisic acid-, cold-, and osmotic stress-induced genes encoding novel membrane-bound transporter-like proteins.


    Takezawa, Daisuke; Minami, Anzu


    Plant responses to environmental stresses are mediated in part by signaling processes involving cytosolic Ca2+ and a Ca(2+)-binding protein, calmodulin. Screening with radiolabeled calmodulin of a cDNA library of the moss Physcomitrella patens resulted in identification of genes encoding novel membrane transporter-like proteins, MCamb1 and MCamb2. These proteins each had a central hydrophobic domain with two putative membrane spans and N- and C-terminal hydrophilic domains, and showed sequence similarity to mammalian inward rectifier potassium channels. Calmodulin binds to MCamb1 and MCamb2 via interaction with basic amphiphilic amino acids in the C-terminal domain. Levels of MCamb1 and MCamb2 transcripts increased dramatically following treatment with low temperature, hyperosmotic solutes, and the stress hormone abscisic acid, all of which were previously shown to increase cellular tolerance to freezing stress. These results suggest that calmodulin participates in cellular signaling events leading to enhancement of stress resistance through regulation of novel transporter-like proteins.

  10. PgLOX6 encoding a lipoxygenase contributes to jasmonic acid biosynthesis and ginsenoside production in Panax ginseng

    PubMed Central

    Rahimi, Shadi; Kim, Yu-Jin; Sukweenadhi, Johan; Zhang, Dabing; Yang, Deok-Chun


    Ginsenosides, the valuable pharmaceutical compounds in Panax ginseng, are triterpene saponins that occur mainly in ginseng plants. It was shown that in vitro treatment with the phytohormone jasmonic acid (JA) is able to increase ginsenoside production in ginseng plants. To understand the molecular link between JA biosynthesis and ginsenoside biosynthesis, we identified a JA biosynthetic 13-lipoxygenase gene (PgLOX6) in P. ginseng that promotes ginsenoside production. The expression of PgLOX6 was high in vascular bundles, which corresponds with expression of ginsenoside biosynthetic genes. Consistent with the role of PgLOX6 in synthesizing JA and promoting ginsenoside synthesis, transgenic plants overexpressing PgLOX6 in Arabidopsis had increased amounts of JA and methyl jasmonate (MJ), increased expression of triterpene biosynthetic genes such as squalene synthase (AtSS1) and squalene epoxidase (AtSE1), and increased squalene content. Moreover, transgenic ginseng roots overexpressing PgLOX6 had around 1.4-fold increased ginsenoside content and upregulation of ginsenoside biosynthesis-related genes including PgSS1, PgSE1, and dammarenediol synthase (PgDDS), which is similar to that of treatment with MJ. However, MJ treatment of transgenic ginseng significantly enhanced JA and MJ, associated with a 2.8-fold increase of ginsenoside content compared with the non-treated, non-transgenic control plant, which was 1.4 times higher than the MJ treatment effect on non-transgenic plants. These results demonstrate that PgLOX6 is responsible for the biosynthesis of JA and promotion of the production of triterpenoid saponin through up-regulating the expression of ginsenoside biosynthetic genes. This work provides insight into the role of JA in biosynthesizing secondary metabolites and provides a molecular tool for increasing ginsenoside production. PMID:27811076

  11. Characterization of the Salmonella enterica Serovar Typhimurium ydcI Gene, Which Encodes a Conserved DNA Binding Protein Required for Full Acid Stress Resistance▿†

    PubMed Central

    Jennings, Matthew E.; Quick, Laura N.; Soni, Anjali; Davis, Richard R.; Crosby, Kathleen; Ott, C. Mark; Nickerson, Cheryl A.; Wilson, James W.


    Salmonella enterica serovar Typhimurium possesses a stimulon of genes that are differentially regulated in response to conditions of low fluid shear force that increase bacterial virulence and alter other phenotypes. In this study, we show that a previously uncharacterized member of this stimulon, ydcI or STM1625, encodes a highly conserved DNA binding protein with related homologs present in a range of Gram-negative bacterial genera. Gene expression analysis shows that ydcI is expressed in different bacterial genera and is involved in its autoregulation in S. Typhimurium. We demonstrate that purified YdcI protein specifically binds a DNA probe consisting of its own promoter sequence. We constructed an S. Typhimurium ΔydcI mutant strain and show that this strain is more sensitive to both organic and inorganic acid stress than is an isogenic WT strain, and this defect is complemented in trans. Moreover, our data indicate that ydcI is part of the rpoS regulon related to stress resistance. The S. Typhimurium ΔydcI mutant was able to invade cultured cells to the same degree as the WT strain, but a strain in which ydcI expression is induced invaded cells at a level 2.8 times higher than that of the WT. In addition, induction of ydcI expression in S. Typhimurium resulted in the formation of a biofilm in stationary-phase cultures. These data indicate the ydcI gene encodes a conserved DNA binding protein involved with aspects of prokaryotic biology related to stress resistance and possibly virulence. PMID:21398541

  12. Suppression of 9-cis-Epoxycarotenoid Dioxygenase, Which Encodes a Key Enzyme in Abscisic Acid Biosynthesis, Alters Fruit Texture in Transgenic Tomato1[W][OA

    PubMed Central

    Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping


    Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp). PMID:22108525

  13. Arabidopsis thaliana VTC4 encodes L-galactose-1-P phosphatase, a plant ascorbic acid biosynthetic enzyme.


    Conklin, Patricia L; Gatzek, Stephan; Wheeler, Glen L; Dowdle, John; Raymond, Marjorie J; Rolinski, Susanne; Isupov, Mikhail; Littlechild, Jennifer A; Smirnoff, Nicholas


    In plants, a proposed ascorbate (vitamin C) biosynthesis pathway occurs via GDP-D-mannose (GDP-D-Man), GDP-L-galactose (GDP-L-Gal), and L-galactose. However, the steps involved in the synthesis of L-Gal from GDP-L-Gal in planta are not fully characterized. Here we present evidence for an in vivo role for L-Gal-1-P phosphatase in plant ascorbate biosynthesis. We have characterized a low ascorbate mutant (vtc4-1) of Arabidopsis thaliana, which exhibits decreased ascorbate biosynthesis. Genetic mapping and sequencing of the VTC4 locus identified a mutation (P92L) in a gene with predicted L-Gal-1-P phosphatase activity (At3g02870). Pro-92 is within a beta-bulge that is conserved in related myo-inositol monophosphatases. The mutation is predicted to disrupt the positioning of catalytic amino acid residues within the active site. Accordingly, L-Gal-1-P phosphatase activity in vtc4-1 was approximately 50% of wild-type plants. In addition, vtc4-1 plants incorporate significantly more radiolabel from [2-(3)H]Man into L-galactosyl residues suggesting that the mutation increases the availability of GDP-L-Gal for polysaccharide synthesis. Finally, a homozygous T-DNA insertion line, which lacks a functional At3g02870 gene product, is also ascorbate-deficient (50% of wild type) and deficient in L-Gal-1-P phosphatase activity. Genetic complementation tests revealed that the insertion mutant and VTC4-1 are alleles of the same genetic locus. The significantly lower ascorbate and perturbed L-Gal metabolism in vtc4-1 and the T-DNA insertion mutant indicate that L-Gal-1-P phosphatase plays a role in plant ascorbate biosynthesis. The presence of ascorbate in the T-DNA insertion mutant suggests there is a bypass to this enzyme or that other pathways also contribute to ascorbate biosynthesis.

  14. Application of the shsp Gene, Encoding a Small Heat Shock Protein, as a Food-Grade Selection Marker for Lactic Acid Bacteria

    PubMed Central

    El Demerdash, Hassan A. M.; Heller, Knut J.; Geis, Arnold


    Plasmid pSt04 of Streptococcus thermophilus contains a gene encoding a protein with homology to small heat shock proteins (A. Geis, H. A. M. El Demerdash, and K. J. Heller, Plasmid 50:53-69, 2003). Strains cured from the shsp plasmids showed significantly reduced heat and acid resistance and a lower maximal growth temperature. Transformation of the cloned shsp gene into S. thermophilus St11 lacking a plasmid encoding shsp resulted in increased resistance to incubation at 60°C or pH 3.5 and in the ability to grow at 52°C. A food-grade cloning system for S. thermophilus, based on the plasmid-encoded shsp gene as a selection marker, was developed. This approach allowed selection after transfer of native and recombinant shsp plasmids into different S. thermophilus and Lactococcus lactis strains. Using a recombinant plasmid carrying an erythromycin resistance (Emr) gene in addition to shsp, we demonstrated that both markers are equally efficient in selecting for plasmid-bearing cells. The average transformation rates in S. thermophilus (when we were selecting for heat resistance) were determined to be 2.4 × 104 and 1.0 × 104 CFU/0.5 μg of DNA, with standard deviations of 0.54 × 104 and 0.32 × 104, for shsp and Emr selection, respectively. When we selected for pH resistance, the average transformation rates were determined to be 2.25 × 104 and 3.8 × 103 CFU/0.5 μg of DNA, with standard deviations of 0.63 × 104 and 3.48 × 103, for shsp and Emr selection, respectively. The applicability of shsp as a selection marker was further demonstrated by constructing S. thermophilus plasmid pHRM1 carrying the shsp gene as a selection marker and the restriction-modification genes of another S. thermophilus plasmid as a functional trait. PMID:12902223

  15. ScChi, Encoding an Acidic Class III Chitinase of Sugarcane, Confers Positive Responses to Biotic and Abiotic Stresses in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Fu, Zhiwei; Yang, Yuting; Guo, Jinlong; Wang, Shanshan; Que, Youxiong


    Chitinases (EC, expressed during the plant-pathogen interaction, are associated with plant defense against pathogens. In the present study, a positive correlation between chitinase activity and sugarcane smut resistance was found. ScChi (GenBank accession no. KF664180), a Class III chitinase gene, encoded a 31.37 kDa polypeptide, was cloned and identified. Subcellular localization revealed ScChi targeting to the nucleus, cytoplasm and the plasma membrane. Real-time quantitative PCR (RT-qPCR) results showed that ScChi was highly expressed in leaf and stem epidermal tissues. The ScChi transcript was both higher and maintained longer in the resistance cultivar during challenge with Sporisorium scitamineum. The ScChi also showed an obvious induction of transcription after treatment with SA (salicylic acid), H2O2, MeJA (methyl jasmonate), ABA (abscisic acid), NaCl, CuCl2, PEG (polyethylene glycol) and low temperature (4 °C). The expression levels of ScChi and six immunity associated marker genes were upregulated by the transient overexpression of ScChi. Besides, histochemical assay of Nicotiana benthamiana leaves overexpressing pCAMBIA 1301-ScChi exhibited deep DAB (3,3′-diaminobenzidinesolution) staining color and high conductivity, indicating the high level of H2O2 accumulation. These results suggest a close relationship between the expression of ScChi and plant immunity. In conclusion, the positive responses of ScChi to the biotic and abiotic stimuli reveal that this gene is a stress-related gene of sugarcane. PMID:24552874

  16. Cloning and functional analysis of 9-cis-epoxycarotenoid dioxygenase (NCED) genes encoding a key enzyme during abscisic acid biosynthesis from peach and grape fruits.


    Zhang, Mei; Leng, Ping; Zhang, Guanglian; Li, Xiangxin


    Ripening and senescence are generally controlled by ethylene in climacteric fruits like peaches, and the ripening process of grape, a non-climacteric fruit, may have some relationship to abscisic acid (ABA) function. In order to better understand the role of ABA in ripening and senescence of these two types of fruits, we cloned the 9-cis-epoxycarotenoid dioxygenase (NCED) gene that encodes a key enzyme in ABA biosynthesis from peaches and grapes using an RT-PCR approach. The NCED gene fragments were cloned from peaches (PpNCED1and PpNCED2, each 740bp) and grapes (VVNCED1, 741bp) using degenerate primers designed based on the conserved amino acids sequence of NCEDs in other plants. PpNCED1 showed 78.54% homology with PpNCED2, 74.90% homology with VVNCED1, and both showed high homology to NCEDs from other plants. The expression patterns of PpNCED1 and VVNCED1 were very similar. Both were highly expressed at the beginning of ripening when ABA content becomes high. The maximum ABA preceded ethylene production in peach fruit. ABA in the grape gradually increased from the beginning of ripening and reached the highest level at 20d before the harvest stage. However, ethylene remained at low levels during the entire process of fruit development, including ripening and senescence. ABA content, and ripening and softening of both types of fruits, were promoted or delayed by exogenous ABA or Fluridone (or NDGA) treatment. The roles of ABA and ethylene in the later ripening of fruit are complex. Based on results obtained in this study, we concluded that PpNCED1 and VVNCED1 initiate ABA biosynthesis at the beginning of fruit ripening, and that ABA accumulation might play a key role in the regulation of ripeness and senescence of both peach and grape fruits.

  17. FcLDP1, a Gene Encoding a Late Embryogenesis Abundant (LEA) Domain Protein, Responds to Brassinosteroids and Abscisic Acid during the Development of Fruits in Fragaria chiloensis

    PubMed Central

    Espinoza, Analía; Contreras, Rodrigo; Zúñiga, Gustavo E.; Herrera, Raúl; Moya-León, María Alejandra; Norambuena, Lorena; Handford, Michael


    White Chilean strawberries (Fragaria chiloensis) are non-climacteric fruits, with an exotic color and aroma. In order to discover genes involved in the development of these fruits, we identified a fragment of a gene encoding a late embryogenesis abundant domain protein, FcLDP1, that was expressed in early stages of fruit development, particularly in receptacles. Hormones play key roles in regulating the development of non-climacteric fruits. We show that the brassinosteroid content of the white strawberry varies during development. Additionally, FcLDP1 as well as the closest ortholog in the woodland strawberry, F. vesca (FvLDP1) possess multiple brassinosteroid, as well as abscisic acid (ABA) response motifs in the promoter region, consistent with the response of transiently expressed FcLDP1 promoter-GFP fusions to these hormones, and the rise in FcLDP1 transcript levels in white strawberry fruits treated with brassinosteroids or ABA. These findings suggest that both hormones regulate FcLDP1 expression during the development of white strawberries. PMID:27379111

  18. Deletion of a gene encoding an amino acid transporter in the midgut membrane causes resistance to a Bombyx parvo-like virus.


    Ito, Katsuhiko; Kidokoro, Kurako; Sezutsu, Hideki; Nohata, Junko; Yamamoto, Kimiko; Kobayashi, Isao; Uchino, Keiro; Kalyebi, Andrew; Eguchi, Ryokitsu; Hara, Wajiro; Tamura, Toshiki; Katsuma, Susumu; Shimada, Toru; Mita, Kazuei; Kadono-Okuda, Keiko


    Bombyx mori densovirus type 2 (BmDNV-2), a parvo-like virus, replicates only in midgut columnar cells and causes fatal disease. The resistance expressed in some silkworm strains against the virus is determined by a single gene, nsd-2, which is characterized as nonsusceptibility irrespective of the viral dose. However, the responsible gene has been unknown. We isolated the nsd-2 gene by positional cloning. The virus resistance is caused by a 6-kb deletion in the ORF of a gene encoding a 12-pass transmembrane protein, a member of an amino acid transporter family, and expressed only in midgut. Germ-line transformation with a wild-type transgene expressed in the midgut restores susceptibility, showing that the defective membrane protein is responsible for resistance. Cumulatively, our data show that the membrane protein is a functional receptor for BmDNV-2. This is a previously undescribed report of positional cloning of a mutant gene in Bombyx and isolation of an absolute virus resistance gene in insects.

  19. FcLDP1, a Gene Encoding a Late Embryogenesis Abundant (LEA) Domain Protein, Responds to Brassinosteroids and Abscisic Acid during the Development of Fruits in Fragaria chiloensis.


    Espinoza, Analía; Contreras, Rodrigo; Zúñiga, Gustavo E; Herrera, Raúl; Moya-León, María Alejandra; Norambuena, Lorena; Handford, Michael


    White Chilean strawberries (Fragaria chiloensis) are non-climacteric fruits, with an exotic color and aroma. In order to discover genes involved in the development of these fruits, we identified a fragment of a gene encoding a late embryogenesis abundant domain protein, FcLDP1, that was expressed in early stages of fruit development, particularly in receptacles. Hormones play key roles in regulating the development of non-climacteric fruits. We show that the brassinosteroid content of the white strawberry varies during development. Additionally, FcLDP1 as well as the closest ortholog in the woodland strawberry, F. vesca (FvLDP1) possess multiple brassinosteroid, as well as abscisic acid (ABA) response motifs in the promoter region, consistent with the response of transiently expressed FcLDP1 promoter-GFP fusions to these hormones, and the rise in FcLDP1 transcript levels in white strawberry fruits treated with brassinosteroids or ABA. These findings suggest that both hormones regulate FcLDP1 expression during the development of white strawberries.

  20. PNA-encoded chemical libraries.


    Zambaldo, Claudio; Barluenga, Sofia; Winssinger, Nicolas


    Peptide nucleic acid (PNA)-encoded chemical libraries along with DNA-encoded libraries have provided a powerful new paradigm for library synthesis and ligand discovery. PNA-encoding stands out for its compatibility with standard solid phase synthesis and the technology has been used to prepare libraries of peptides, heterocycles and glycoconjugates. Different screening formats have now been reported including selection-based and microarray-based methods that have yielded specific ligands against diverse target classes including membrane receptors, lectins and challenging targets such as Hsp70.

  1. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.


    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov


    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum.

  2. Inhibition of the dapE-Encoded N-Succinyl-L,L-diaminopimelic Acid Desuccinylase from Neisseria meningitidis by L-Captopril.


    Starus, Anna; Nocek, Boguslaw; Bennett, Brian; Larrabee, James A; Shaw, Daniel L; Sae-Lee, Wisath; Russo, Marie T; Gillner, Danuta M; Makowska-Grzyska, Magdalena; Joachimiak, Andrzej; Holz, Richard C


    Binding of the competitive inhibitor L-captopril to the dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase from Neisseria meningitidis (NmDapE) was examined by kinetic, spectroscopic, and crystallographic methods. L-Captopril, an angiotensin-converting enzyme (ACE) inhibitor, was previously shown to be a potent inhibitor of the DapE from Haemophilus influenzae (HiDapE) with an IC50 of 3.3 μM and a measured Ki of 1.8 μM and displayed a dose-responsive antibiotic activity toward Escherichia coli. L-Captopril is also a competitive inhibitor of NmDapE with a Ki of 2.8 μM. To examine the nature of the interaction of L-captopril with the dinuclear active site of DapE, we have obtained electron paramagnetic resonance (EPR) and magnetic circular dichroism (MCD) data for the enzymatically hyperactive Co(II)-substituted forms of both HiDapE and NmDapE. EPR and MCD data indicate that the two Co(II) ions in DapE are antiferromagnetically coupled, yielding an S = 0 ground state, and suggest a thiolate bridge between the two metal ions. Verification of a thiolate-bridged dinuclear complex was obtained by determining the three-dimensional X-ray crystal structure of NmDapE in complex with L-captopril at 1.8 Å resolution. Combination of these data provides new insights into binding of L-captopril to the active site of DapE enzymes as well as important inhibitor-active site residue interaction's. Such information is critical for the design of new, potent inhibitors of DapE enzymes.

  3. A novel allelic variant of the human TSG-6 gene encoding an amino acid difference in the CUB module. Chromosomal localization, frequency analysis, modeling, and expression.


    Nentwich, Hilke A; Mustafa, Zehra; Rugg, Marilyn S; Marsden, Brian D; Cordell, Martin R; Mahoney, David J; Jenkins, Suzanne C; Dowling, Barbara; Fries, Erik; Milner, Caroline M; Loughlin, John; Day, Anthony J


    Tumor necrosis factor-stimulated gene-6 (TSG-6) encodes a 35-kDa protein, which is comprised of contiguous Link and CUB modules. TSG-6 protein has been detected in the articular joints of osteoarthritis (OA) patients, with little or no constitutive expression in normal adult tissues. It interacts with components of cartilage matrix (e.g. hyaluronan and aggrecan) and thus may be involved in extracellular remodeling during joint disease. In addition, TSG-6 has been found to have anti-inflammatory properties in models of acute and chronic inflammation. Here we have mapped the human TSG-6 gene to 2q23.3, a region of chromosome 2 linked with OA. A single nucleotide polymorphism was identified that involves a non-synonymous G --> A transition at nucleotide 431 of the TSG-6 coding sequence, resulting in an Arg to Gln alteration in the CUB module (at residue 144 in the preprotein). Molecular modeling of the CUB domain indicated that this amino acid change might lead to functional differences. Typing of 400 OA cases and 400 controls revealed that the A(431) variant identified here is the major TSG-6 allele in Caucasians (with over 75% being A(431) homozygotes) but that this polymorphism is not a marker for OA susceptibility in the patients we have studied. Expression of the Arg(144) and Gln(144) allotypes in Drosophila Schneider 2 cells, and functional characterization, showed that there were no significant differences in the ability of these full-length proteins to bind hyaluronan or form a stable complex with inter-alpha-inhibitor.

  4. Pectobacterium atrosepticum and Pectobacterium carotovorum Harbor Distinct, Independently Acquired Integrative and Conjugative Elements Encoding Coronafacic Acid that Enhance Virulence on Potato Stems.


    Panda, Preetinanda; Vanga, Bhanupratap R; Lu, Ashley; Fiers, Mark; Fineran, Peter C; Butler, Ruth; Armstrong, Karen; Ronson, Clive W; Pitman, Andrew R


    Integrative and conjugative elements (ICEs) play a central role in the evolution of bacterial virulence, their transmission between bacteria often leading to the acquisition of virulence factors that alter host range or aggressiveness. Much is known about the functions of the virulence determinants that ICEs harbor, but little is understood about the cryptic effects of ICEs on their host cell. In this study, the importance of horizontally acquired island 2 (HAI2), an ICE in the genome of Pectobacterium atrosepticum SCRI1043, was studied using a strain in which the entire ICE had been removed by CRISPR-Cas-mediated genome editing. HAI2 encodes coronafacic acid, a virulence factor that enhances blackleg disease of potato stems caused by P. atrosepticum SCRI1043. As expected, deletion of HAI2 resulted in reduced blackleg symptoms in potato stems. A subsequent screen for HAI2-related ICEs in other strains of the Pectobacterium genus revealed their ubiquitous nature in P. atrosepticum. Yet, HAI2-related ICEs were only detected in the genomes of a few P. carotovorum strains. These strains were notable as blackleg causing strains belonging to two different subspecies of P. carotovorum. Sequence analysis of the ICEs in different strains of both P. atrosepticum and P. carotovorum confirmed that they were diverse and were present in different locations on the genomes of their bacterial host, suggesting that the cfa cluster was probably acquired independently on a number of occasions via chromosomal insertion of related ICEs. Excision assays also demonstrated that the ICEs in both P. atrosepticum and P. carotovorum are mobilized from the host chromosome. Thus, the future spread of these ICEs via lateral gene transfer might contribute to an increase in the prevalence of blackleg-causing strains of P. carotovorum.

  5. Effects of estradiol-17beta administration on steady-state messenger ribonucleic acid (MRNA) encoding equine alpha and LH/CGbeta subunits in pituitaries of ovariectomized pony mares.


    Sharp, D C; Wolfe, M W; Cleaver, B D; Nilson, J


    The process of sexual recrudescence in the springtime in mares is characterized by renewal of follicular growth and acquisition of steroidogenic competence. Concomitant with renewal of follicular steroidogenesis is re-establishment of LH biosynthesis and secretion. Research results from our laboratory indicate that increased estradiol and LH secretion occur in close temporal association before the first ovulation of the year. Therefore, the hypothesis tested in this experiment was that estrogen administration to ovariectomized pony mares during the equivalent time of early vernal transition would enhance LH biosynthesis as monitored by messenger ribonucleic acid (mRNA) encoding for the pituitary subunits of LH (alpha and LH/CGbeta). Mares were administered either sesame oil vehicle control, or estradiol (5 mg i.m. twice daily in sesame oil) for 3, 6 or 9 days, beginning on February 2. The pituitary glands were harvested, and examined for LH subunit mRNA by Northern Blot and slot blot analysis. There was a significant increase in LH secretion after 6 days of estradiol secretion compared with control vehicle administration. Similarly, there was a significant increase in both alpha and LH/CGbeta subunit mRNA when estradiol was administered for 9 days. These data indicate that estrogen stimulates LH subunit formation in mares during early equivalent vernal transition. These data do not, however, discriminate between a direct pituitary effect of estrogen, and a hypothalamic effect. Whether the surge of estradiol just prior to the first ovulation of the year is essential for the renewed biosynthesis of LH subunits cannot be determined from these data. However an important role of estrogen in the final stages of sexual recrudescence is indicated.

  6. Pectobacterium atrosepticum and Pectobacterium carotovorum Harbor Distinct, Independently Acquired Integrative and Conjugative Elements Encoding Coronafacic Acid that Enhance Virulence on Potato Stems

    PubMed Central

    Panda, Preetinanda; Vanga, Bhanupratap R.; Lu, Ashley; Fiers, Mark; Fineran, Peter C.; Butler, Ruth; Armstrong, Karen; Ronson, Clive W.; Pitman, Andrew R.


    Integrative and conjugative elements (ICEs) play a central role in the evolution of bacterial virulence, their transmission between bacteria often leading to the acquisition of virulence factors that alter host range or aggressiveness. Much is known about the functions of the virulence determinants that ICEs harbor, but little is understood about the cryptic effects of ICEs on their host cell. In this study, the importance of horizontally acquired island 2 (HAI2), an ICE in the genome of Pectobacterium atrosepticum SCRI1043, was studied using a strain in which the entire ICE had been removed by CRISPR-Cas-mediated genome editing. HAI2 encodes coronafacic acid, a virulence factor that enhances blackleg disease of potato stems caused by P. atrosepticum SCRI1043. As expected, deletion of HAI2 resulted in reduced blackleg symptoms in potato stems. A subsequent screen for HAI2-related ICEs in other strains of the Pectobacterium genus revealed their ubiquitous nature in P. atrosepticum. Yet, HAI2-related ICEs were only detected in the genomes of a few P. carotovorum strains. These strains were notable as blackleg causing strains belonging to two different subspecies of P. carotovorum. Sequence analysis of the ICEs in different strains of both P. atrosepticum and P. carotovorum confirmed that they were diverse and were present in different locations on the genomes of their bacterial host, suggesting that the cfa cluster was probably acquired independently on a number of occasions via chromosomal insertion of related ICEs. Excision assays also demonstrated that the ICEs in both P. atrosepticum and P. carotovorum are mobilized from the host chromosome. Thus, the future spread of these ICEs via lateral gene transfer might contribute to an increase in the prevalence of blackleg-causing strains of P. carotovorum. PMID:27065965

  7. The Maize Viviparous8 Locus, Encoding a Putative ALTERED MERISTEM PROGRAM1-Like Peptidase, Regulates Abscisic Acid Accumulation and Coordinates Embryo and Endosperm Development1[W

    PubMed Central

    Suzuki, Masaharu; Latshaw, Susan; Sato, Yutaka; Settles, A. Mark; Koch, Karen E.; Hannah, L. Curtis; Kojima, Mikiko; Sakakibara, Hitoshi; McCarty, Donald R.


    We describe a mutant of Zea mays isolated from a W22 inbred transposon population, widow's peak mutant1 (wpk1), with an altered pattern of anthocyanin synthesis and aleurone cell differentiation in endosperm. In addition, a failure of the developing mutant embryo to form leaf initials is associated with decreased expression of a subset of meristem regulatory genes that includes Abphyl1 and Td1. We show that the viviparous8 (vp8) mutant has a similar pleiotropic phenotype in the W22 inbred background in contrast to the viviparous embryo phenotype exhibited in the standard genetic background, and we confirmed that wpk1 is allelic to vp8. Further genetic analysis revealed that the standard vp8 stock contains an unlinked, partially dominant suppressor of the vp8 mutation that is not present in W22. Consistent with the early-onset viviparous phenotype of vp8, expression of several embryonic regulators, including LEC1/B3 domain transcription factors, was reduced in the mutant embryo. Moreover, reduced abscisic acid (ABA) content of vp8/wpk1 embryos was correlated with altered regulation of ABA biosynthesis, as well as ABA catabolic pathways. The ABA biosynthetic gene Vp14 was down-regulated in the nonsuppressed background, whereas the ZmABA8′oxA1a ABA 8′-hydroxylase gene was strongly up-regulated in both genetic backgrounds. Molecular analysis revealed that Vp8 encodes a putative peptidase closely related to Arabidopsis thaliana ALTERED MERISTEM PROGRAM1. Because the Vp8 regulates meristem development as well as seed maturation processes, including ABA accumulation, we propose that VP8 is required for synthesis of an unidentified signal that integrates meristem and embryo formation in seeds. PMID:18203869

  8. The Maize Viviparous8 locus, encoding a putative ALTERED MERISTEM PROGRAM1-like peptidase, regulates abscisic acid accumulation and coordinates embryo and endosperm development.


    Suzuki, Masaharu; Latshaw, Susan; Sato, Yutaka; Settles, A Mark; Koch, Karen E; Hannah, L Curtis; Kojima, Mikiko; Sakakibara, Hitoshi; McCarty, Donald R


    We describe a mutant of Zea mays isolated from a W22 inbred transposon population, widow's peak mutant1 (wpk1), with an altered pattern of anthocyanin synthesis and aleurone cell differentiation in endosperm. In addition, a failure of the developing mutant embryo to form leaf initials is associated with decreased expression of a subset of meristem regulatory genes that includes Abphyl1 and Td1. We show that the viviparous8 (vp8) mutant has a similar pleiotropic phenotype in the W22 inbred background in contrast to the viviparous embryo phenotype exhibited in the standard genetic background, and we confirmed that wpk1 is allelic to vp8. Further genetic analysis revealed that the standard vp8 stock contains an unlinked, partially dominant suppressor of the vp8 mutation that is not present in W22. Consistent with the early-onset viviparous phenotype of vp8, expression of several embryonic regulators, including LEC1/B3 domain transcription factors, was reduced in the mutant embryo. Moreover, reduced abscisic acid (ABA) content of vp8/wpk1 embryos was correlated with altered regulation of ABA biosynthesis, as well as ABA catabolic pathways. The ABA biosynthetic gene Vp14 was down-regulated in the nonsuppressed background, whereas the ZmABA8'oxA1a ABA 8'-hydroxylase gene was strongly up-regulated in both genetic backgrounds. Molecular analysis revealed that Vp8 encodes a putative peptidase closely related to Arabidopsis thaliana ALTERED MERISTEM PROGRAM1. Because the Vp8 regulates meristem development as well as seed maturation processes, including ABA accumulation, we propose that VP8 is required for synthesis of an unidentified signal that integrates meristem and embryo formation in seeds.

  9. Disruption of the Candida albicans ATC1 gene encoding a cell-linked acid trehalase decreases hypha formation and infectivity without affecting resistance to oxidative stress.


    Pedreño, Yolanda; González-Párraga, Pilar; Martínez-Esparza, María; Sentandreu, Rafael; Valentín, Eulogio; Argüelles, Juan-Carlos


    In Candida albicans, the ATC1 gene, encoding a cell wall-associated acid trehalase, has been considered as a potentially interesting target in the search for new antifungal compounds. A phenotypic characterization of the double disruptant atc1Delta/atc1Delta mutant showed that it was unable to grow on exogenous trehalose as sole carbon source. Unlike actively growing cells from the parental strain (CAI4), the atc1Delta null mutant displayed higher resistance to environmental insults, such as heat shock (42 degrees C) or saline exposure (0.5 M NaCl), and to both mild and severe oxidative stress (5 and 50 mM H(2)O(2)), which are relevant during in vivo infections. Parallel measurements of intracellular trehalose and trehalose-metabolizing enzymes revealed that significant amounts of the disaccharide were stored in response to thermal and oxidative challenge in the two cell types. The antioxidant activities of catalase and glutathione reductase were triggered by moderate oxidative exposure (5 mM H(2)O(2)), whereas superoxide dismutase was inhibited dramatically by H(2)O(2), where a more marked decrease was observed in atc1Delta cells. In turn, the atc1Delta mutant exhibited a decreased capacity of hypha and pseudohypha formation tested in different media. Finally, the homozygous null mutant in a mouse model of systemic candidiasis displayed strongly reduced pathogenicity compared with parental or heterozygous strains. These results suggest not only a novel role for the ATC1 gene in dimorphism and infectivity, but also that an interconnection between stress resistance, dimorphic conversion and virulence in C. albicans may be reconsidered. They also support the hypothesis that Atc1p is not involved in the physiological hydrolysis of endogenous trehalose.

  10. Amplification and disruption of the phenylacetyl-CoA ligase gene of Penicillium chrysogenum encoding an aryl-capping enzyme that supplies phenylacetic acid to the isopenicillin N-acyltransferase.


    Lamas-Maceiras, Mónica; Vaca, Inmaculada; Rodríguez, Esther; Casqueiro, Javier; Martín, Juan F


    A gene, phl, encoding a phenylacetyl-CoA ligase was cloned from a phage library of Penicillium chrysogenum AS-P-78. The presence of five introns in the phl gene was confirmed by reverse transcriptase-PCR. The phl gene encoded an aryl-CoA ligase closely related to Arabidopsis thaliana 4-coumaroyl-CoA ligase. The Phl protein contained most of the amino acids defining the aryl-CoA (4-coumaroyl-CoA) ligase substrate-specificity code and differed from acetyl-CoA ligase and other acyl-CoA ligases. The phl gene was not linked to the penicillin gene cluster. Amplification of phl in an autonomous replicating plasmid led to an 8-fold increase in phenylacetyl-CoA ligase activity and a 35% increase in penicillin production. Transformants containing the amplified phl gene were resistant to high concentrations of phenylacetic acid (more than 2.5 g/l). Disruption of the phl gene resulted in a 40% decrease in penicillin production and a similar reduction of phenylacetyl-CoA ligase activity. The disrupted mutants were highly susceptible to phenylacetic acid. Complementation of the disrupted mutants with the phl gene restored normal levels of penicillin production and resistance to phenylacetic acid. The phenylacetyl-CoA ligase encoded by the phl gene is therefore involved in penicillin production, although a second aryl-CoA ligase appears to contribute partially to phenylacetic acid activation. The Phl protein lacks a peptide-carrier-protein domain and behaves as an aryl-capping enzyme that activates phenylacetic acid and transfers it to the isopenicillin N acyltransferase. The Phl protein contains the peroxisome-targeting sequence that is also present in the isopenicillin N acyltransferase. The peroxisomal co-localization of these two proteins indicates that the last two enzymes of the penicillin pathway form a peroxisomal functional complex.

  11. [Antihypoxic effect of 3-hydroxypyridine and succinic acid derivatives and their nootropic action in alloxan diabetes].


    Volchegorskiĭ, I A; Rassokhina, L M; Miroshnichenko, I Iu


    Relationship between the antihypoxic effect of 3-hydroxypyridine and succinic acid derivatives (emoxipine, reamberin and mexidol) and their effect on conditional learning, glycemia, and lipidemia was studied in rats with alloxan-induced diabetes. In parallel, the analogous relationship was investigated for alpha-lipoic acid that is regarded as a "gold standard" in treatment of diabetic neuropathy. It was established that single administration of emoxipine and mexidol in mice in doses equivalent to therapeutic-range doses in humans produces antihypoxic effect manifested by increased resistance to acute hypoxic hypoxia in test animals. Alpha-lipoic acid is inferior to emoxipin and mexidol in the degree of antihypoxic action. Reamberin does not exhibit this effect. The introduction of emoxipin, reamberin, mexidol, and alpha-lipoic acid in rats with alloxan diabetes during 7 or 14 days in doses equivalent to therapeutic-range doses in humans corrects conditional learning disorders in direct relationship with the antihypoxic activity of these drugs. The development of the nootropic effect of emoxipin, mexidol, and alpha-lipoic acid is related to a decrease in hyperglycemia and hyperlipidemia in rats with alloxan diabetes. The nootropic action of reamberin is accompanied by a transient hypoglycemizing effect and aggravation of dyslipidemic disorders. The antihypoxic activity of investigated drugs determines the direction and expression of their lipidemic effect, but is not correlated with the hypoglycemizing action these drugs on test animals with alloxan diabetes.

  12. Conjugated linoleic acid-enriched butter improved memory and up-regulated phospholipase A2 encoding-genes in rat brain tissue.


    Gama, Marco A S; Raposo, Nádia R B; Mury, Fábio B; Lopes, Fernando C F; Dias-Neto, Emmanuel; Talib, Leda L; Gattaz, Wagner F


    Reduced phospholipase A2 (PLA2) activity has been reported in blood cells and in postmortem brains of patients with Alzheimer disease (AD), and there is evidence that conjugated linoleic acid (CLA) modulates the activity of PLA2 groups in non-brain tissues. As CLA isomers were shown to be actively incorporated and metabolized in the brains of rats, we hypothesized that feeding a diet naturally enriched in CLA would affect the activity and expression of Pla 2 -encoding genes in rat brain tissue, with possible implications for memory. To test this hypothesis, Wistar rats were trained for the inhibitory avoidance task and fed a commercial diet (control) or experimental diets containing either low CLA- or CLA-enriched butter for 4 weeks. After this period, the rats were tested for memory retrieval and killed for tissue collection. Hippocampal expression of 19 Pla 2 genes was evaluated by qPCR, and activities of PLA2 groups (cPLA2, iPLA2, and sPLA2) were determined by radioenzymatic assay. Rats fed the high CLA diet had increased hippocampal mRNA levels for specific PLA2 isoforms (iPla 2 g6γ; cPla 2 g4a, sPla 2 g3, sPla 2 g1b, and sPla 2 g12a) and higher enzymatic activity of all PLA2 groups as compared to those fed the control and the low CLA diet. The increment in PLA2 activities correlated significantly with memory enhancement, as assessed by increased latency in the step-down inhibitory avoidance task after 4 weeks of treatment (rs = 0.69 for iPLA2, P < 0.001; rs = 0.81 for cPLA2, P < 0.001; and rs = 0.69 for sPLA2, P < 0.001). In face of the previous reports showing reduced PLA2 activity in AD brains, the present findings suggest that dairy products enriched in cis-9, trans-11 CLA may be useful in the treatment of this disease.

  13. A gene encoding an abscisic acid biosynthetic enzyme (LsNCED4) collocates with the high temperature germination locus Htg6.1 in lettuce (Lactuca sp.)

    PubMed Central

    Argyris, Jason; Truco, María José; Ochoa, Oswaldo; McHale, Leah; Dahal, Peetambar; Van Deynze, Allen; Michelmore, Richard W.


    Thermoinhibition, or failure of seeds to germinate when imbibed at warm temperatures, can be a significant problem in lettuce (Lactuca sativa L.) production. The reliability of stand establishment would be improved by increasing the ability of lettuce seeds to germinate at high temperatures. Genes encoding germination- or dormancy-related proteins were mapped in a recombinant inbred line population derived from a cross between L. sativa cv. Salinas and L. serriola accession UC96US23. This revealed several candidate genes that are located in the genomic regions containing quantitative trait loci (QTLs) associated with temperature and light requirements for germination. In particular, LsNCED4, a temperature-regulated gene in the biosynthetic pathway for abscisic acid (ABA), a germination inhibitor, mapped to the center of a previously detected QTL for high temperature germination (Htg6.1) from UC96US23. Three sets of sister BC3S2 near-isogenic lines (NILs) that were homozygous for the UC96US23 allele of LsNCED4 at Htg6.1 were developed by backcrossing to cv. Salinas and marker-assisted selection followed by selfing. The maximum temperature for germination of NIL seed lots with the UC96US23 allele at LsNCED4 was increased by 2–3°C when compared with sister NIL seed lots lacking the introgression. In addition, the expression of LsNCED4 was two- to threefold lower in the former NIL lines as compared to expression in the latter. Together, these data strongly implicate LsNCED4 as the candidate gene responsible for the Htg6.1 phenotype and indicate that decreased ABA biosynthesis at high imbibition temperatures is a major factor responsible for the increased germination thermotolerance of UC96US23 seeds. Electronic supplementary material The online version of this article (doi:10.1007/s00122-010-1425-3) contains supplementary material, which is available to authorized users. PMID:20703871

  14. Lipoic-based TRPA1/TRPV1 antagonist to treat orofacial pain.


    Gualdani, Roberta; Ceruti, Stefania; Magni, Giulia; Merli, Davide; Di Cesare Mannelli, Lorenzo; Francesconi, Oscar; Richichi, Barbara; la Marca, Giancarlo; Ghelardini, Carla; Moncelli, Maria Rosa; Nativi, Cristina


    Inflammation of the trigeminal nerve is considered one of the most painful conditions known to humankind. The diagnosis is often difficult; moreover, safe and effective pharmacological treatments are lacking. A new molecule, ADM_12, formed by a lipoic and omotaurine residues covalently linked, is here reported. In vitro and in vivo tests showed that ADM_12 is a very attractive original compound presenting (i) a remarkable safety profile; (ii) a high binding constant versus TRPA1; (iii) an intriguing behavior versus TRPV1; and (iv) the ability to significantly and persistently reduce mechanical facial allodynia in rats. Noteworthy, by testing ADM_12, we shed light on the unprecedented involvement of TRPA1 and TRPV1 channels in orofacial pain.

  15. A gene encoding lysine 6-aminotransferase, which forms the beta-lactam precursor alpha-aminoadipic acid, is located in the cluster of cephamycin biosynthetic genes in Nocardia lactamdurans.

    PubMed Central

    Coque, J J; Liras, P; Laiz, L; Martín, J F


    A gene (lat) encoding lysine 6-aminotransferase was found upstream of the pcbAB (encoding alpha-aminoadipylcysteinyl-valine synthetase) and pcbC (encoding isopenicillin N synthase) genes in the cluster of early cephamycin biosynthetic genes in Nocardia lactamdurans. The lat gene was separated by a small intergenic region of 64 bp from the 5' end of the pcbAB gene. The lat gene contained an open reading frame of 1,353 nucleotides (71.4% G + C) encoding a protein of 450 amino acids with a deduced molecular mass of 48,811 Da. Expression of DNA fragments carrying the lat gene in Streptomyces lividans led to a high lysine 6-aminotransferase activity which was absent from untransformed S. lividans. The enzyme was partially purified from S. lividans(pULBS8) and showed a molecular mass of 52,800 Da as calculated by Sephadex gel filtration and polyacrylamide gel electrophoresis. DNA sequences which hybridized strongly with the lat gene of N. lactamdurans were found in four cephamycin-producing Streptomyces species but not in four other actinomycetes which are not known to produce beta-lactams, suggesting that the gene is specific for beta-lactam biosynthesis and is not involved in general lysine catabolism. The protein encoded by the lat gene showed similarity to ornithine-5-aminotransferases and N-acetylornithine-5-aminotransferases and contained a pyridoxal phosphate-binding consensus amino acid sequence around Lys-300 of the protein. The evolutionary implications of the lat gene as a true beta-lactam biosynthetic gene are discussed. Images PMID:1917857

  16. WRINKLED1 specifies the regulatory action of LEAFY COTYLEDON2 towards fatty acid metabolism during seed maturation in Arabidopsis.


    Baud, Sébastien; Mendoza, Monica Santos; To, Alexandra; Harscoët, Erwana; Lepiniec, Loïc; Dubreucq, Bertrand


    The WRINKLED1 (WRI1) transcription factor has been shown to play a role of the utmost importance during oil accumulation in maturing seeds of Arabidopsis thaliana. However, little is known about the regulatory processes involved. In this paper, comprehensive functional analyses of three new mutants corresponding to null alleles of wri1 confirm that the induction of WRI1 is a prerequisite for fatty acid synthesis and is important for normal embryo development. The strong expression of WRI1 specifically detected at the onset of the maturation phase in oil-accumulating tissues of A. thaliana seeds is fully consistent with this function. Complementation experiments carried out with various seed-specific promoters emphasized the importance of a tight regulation of WRI1 expression for proper oil accumulation, raising the question of the factors controlling WRI1 transcription. Interestingly, molecular and genetic analyses using an inducible system demonstrated that WRI1 is a target of LEAFY COTYLEDON2 and is necessary for the regulatory action of LEC2 towards fatty acid metabolism. In addition to this, quantitative RT-PCR experiments suggested that several genes encoding enzymes of late glycolysis, the fatty acid synthesis pathway, and the biotin and lipoic acid biosynthetic pathways are targets of WRI1. Taken together, these results indicate new relationships in the regulatory model for the control of oil synthesis in maturing A. thaliana seeds. In addition, they exemplify how metabolic and developmental processes affecting the developing embryo can be coordinated at the molecular level.

  17. Replacement of two non-adjacent amino acids in the S.cerevisiae bi2 intron-encoded RNA maturase is sufficient to gain a homing-endonuclease activity.

    PubMed Central

    Szczepanek, T; Lazowska, J


    Two homologous group I introns, the second intron of the cyt b gene, from related Saccharomyces species differ in their mobility. The S.capensis intron is mobile and encodes the I-ScaI endonuclease promoting intron homing, whilst the homologous S.cerevisiae intron is not mobile, but functions as an RNA maturase promoting splicing. These two intron-encoded proteins differ by only four amino acid substitutions. Taking advantage of the remarkable similarity of the two intron open reading frames and using biolistic transformation of mitochondria, we show that the replacement of only two non-adjacent residues in the S.cerevisiae maturase carboxy-terminal sequence is sufficient to induce a homing-endonuclease activity without losing the splicing function. Also, we demonstrate that these two activities reside in the S.capensis bi2-encoded protein which functions in both splicing and intron mobility in the wild-type cells. These results provide new insight into our understanding of the activity and the evolution of group I intron-encoded proteins. Images PMID:8670880

  18. Molecular mechanisms for protein-encoded inheritance

    SciTech Connect

    Wiltzius, Jed J.W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David


    In prion inheritance and transmission, strains are phenotypic variants encoded by protein 'conformations'. However, it is unclear how a protein conformation can be stable enough to endure transmission between cells or organisms. Here we describe new polymorphic crystal structures of segments of prion and other amyloid proteins, which offer two structural mechanisms for the encoding of prion strains. In packing polymorphism, prion strains are encoded by alternative packing arrangements (polymorphs) of {beta}-sheets formed by the same segment of a protein; in segmental polymorphism, prion strains are encoded by distinct {beta}-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring conformations capable of encoding strains. These molecular mechanisms for transfer of protein-encoded information into prion strains share features with the familiar mechanism for transfer of nucleic acid-encoded information into microbial strains, including sequence specificity and recognition by noncovalent bonds.

  19. Effect of alpha lipoic acid on the blood cell count and iron kinetics in hypertensive patients.


    Mendes, Paula Renata Florêncio; Félix, Danielle dos Santos; Silva, Paulo César Dantas da; Pereira, Guêdijany Henrique; Simões, Mônica Oliveira da Silva


    Introducción: El Ácido -Lipóico (ALA) ha sido utilizado como recurso terapéutico para reducir daño oxidativo en la Hipertensión Arterial Sistémica (HAS), pero aún no existen estudios in vivo que reporten sobre su mecanismo de acción en el metabolismo del hierro. Objetivo: Evaluar el efecto antioxidante del ácido Alfa- Lipóico sobre el hemograma y metabolismo del hierro en individuos hipertensos con o sin anemia. Métodos: Estudio clínico doble-ciego, randomizado y controlado con placebo. La muestra fue constituida por 60 individuos hipertensos, distribuidos aleatoriamente en grupo tratamiento (n = 32), que recibió 600 mg/día del ALA por doce semanas y grupo control (n = 28), que recibió el placebo por el mismo período. Fueron analizados antes y después de la intervención, los parámetros del hemograma, Hierro Sérico, Ferritina, Capacidad Latente de Enlace del hierro, Capacidad Total de Enlace del Hierro, Índice de Saturación de la Transferrina (ISI) y Transferrina. Para evaluar las alteraciones entre los grupos, se utilizó el teste t de Student y el análisis de varianza ANOVA, adoptándose el nivel de significación de 5%. Resultados: Después de la intervención, el suplemento con el ALA demostró una asociación estadísticamente significativa (p < 0,05) con la reducción de los leucocitos totales, aumento del número de neutrófilos y reducciones en los niveles de Hierro Sérico e ISI. Conclusión: La administración oral del ALA como un adyuvante terapéutico, altera la respuesta hematológica del leucograma y reduce la absorción del hierro. Cabe senãlar que el mecanismo de quelación de metales por el ácido lipoico puede ser responsable de estos cambios y, en consecuencia, podría desencadenar una condicion de anemia ferropénica en individuos hipertensos.

  20. Alpha-lipoic acid protects mitochondrial enzymes and attenuates lipopolysaccharide-induced hypothermia in mice

    EPA Science Inventory

    Abstract: Hypothermia is a key symptom of sepsis and the mechanism(s) leading to hypothermia during sepsis is largely unknown. To investigate a potential mechanism and find an effective treatment for hypothermia in sepsis, we induced hypothermia in mice by lipopolysaccharide (LP...

  1. [Alpha lipoic acid and its antioxidant against cancer and diseases of central sensitization].


    Durand, Marisa; Mach, Núria


    Introducción: El ácido alfa lipoico (ALA) puede controlar y limitar la cantidad de radicales libres, influyendo el desarrollo de patologías como el cáncer o las enfermedades de sensibilización central, aunque los mecanismos moleculares implicados en este proceso aún están dilucidándose. Objetivo: Reunir y contrastar información sobre las propiedades antioxidantes del ALA en la prevención y desarrollo de las patologías relacionadas con el estrés oxidativo. Material y métodos: En este trabajo, se analizan más de 100 artículos publicados en los últimos 20 años que relacionan el consumo de ALA y la prevalencia y desarrollo de patologías relacionadas con el estrés oxidativo. Los artículos han sido obtenidos en diferentes bases de datos (PubMed central, Web of Science, Elsevier Journal, Science Direct), e incluyen experimentos en células, animales y humanos. Las palabras clave utilizadas fueron: cáncer, enfermedades de sensibilización central, radicales libres, y ALA. Resultados y discusión: Se han reunido resultados de trabajos realizados in vitro y en animales de laboratorio en los que se pone de manifiesto el efecto del ALA en el control de la apoptosis celular de diferentes tipos de cánceres mediante un aumento de las especies reactivas de oxígeno, así como también el retardo en el crecimiento de las mismas. Aparte, se ha demostrado que la capacidad antioxidante del ALA y su potencial para regenerar otros antioxidantes es de gran importancia para tratar las patologías de sensibilización central. Conclusiones: El ALA ha demostrado un papel significativo como antioxidante y prooxidante en el cáncer y las patologías de sensibilización central, aunque son necesarias más investigaciones en humanos.

  2. Lutein ester profile in wheat and tritordeum can be modulated by temperature: Evidences for regioselectivity and fatty acid preferential of enzymes encoded by genes on chromosomes 7D and 7H(ch).


    Mattera, M G; Hornero-Méndez, D; Atienza, S G


    The increase of lutein retention through the food chain is desirable for wheat breeding. Lutein esters are more stable than free lutein during post-harvest storage and two loci on chromosomes 7D and 7H(ch) are important for esterification. We investigated the effect of temperature during grain filling on carotenoid accumulation and lutein ester profile including fatty acid selectivity (palmitic vs. linoleic) and regioselectivity (esterification at positions 3 vs. 3'). Three different temperature regimes were assayed (controlled, semi-controlled and non-controlled). Lutein esters were more stable than free carotenoids in vivo and the enzymes encoded by chromosomes 7H(ch) and 7D are complementary. Indeed, they show differential preferences for the fatty acid (palmitic and linoleic, respectively) and regioselectivity (3 and 3', respectively). Besides, H. chilense has additional genes for esterification. Finally, the increase of temperature favoured the accumulation of lutein esters with linoleic acid and the synthesis of regioisomers at position 3'.

  3. Genetic enhancement of palmitic acid accumulation in cotton seed oil through RNAi down-regulation of ghKAS2 encoding β-ketoacyl-ACP synthase II (KASII).


    Liu, Qing; Wu, Man; Zhang, Baolong; Shrestha, Pushkar; Petrie, James; Green, Allan G; Singh, Surinder P


    Palmitic acid (C16:0) already makes up approximately 25% of the total fatty acids in the conventional cotton seed oil. However, further enhancements in palmitic acid content at the expense of the predominant unsaturated fatty acids would provide increased oxidative stability of cotton seed oil and also impart the high melting point required for making margarine, shortening and confectionary products free of trans fatty acids. Seed-specific RNAi-mediated down-regulation of β-ketoacyl-ACP synthase II (KASII) catalysing the elongation of palmitoyl-ACP to stearoyl-ACP has succeeded in dramatically increasing the C16 fatty acid content of cotton seed oil to well beyond its natural limits, reaching up to 65% of total fatty acids. The elevated C16 levels were comprised of predominantly palmitic acid (C16:0, 51%) and to a lesser extent palmitoleic acid (C16:1, 11%) and hexadecadienoic acid (C16:2, 3%), and were stably inherited. Despite of the dramatic alteration of fatty acid composition and a slight yet significant reduction in oil content in these high-palmitic (HP) lines, seed germination remained unaffected. Regiochemical analysis of triacylglycerols (TAG) showed that the increased levels of palmitic acid mainly occurred at the outer positions, while C16:1 and C16:2 were predominantly found in the sn-2 position in both TAG and phosphatidylcholine. Crossing the HP line with previously created high-oleic (HO) and high-stearic (HS) genotypes demonstrated that HP and HO traits could be achieved simultaneously; however, elevation of stearic acid was hindered in the presence of high level of palmitic acid.

  4. Cellobiohydrolase variants and polynucleotides encoding same


    Wogulis, Mark


    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  5. Cellobiohydrolase variants and polynucleotides encoding same


    Wogulis, Mark


    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  6. Cellobiohydrolase variants and polynucleotides encoding the same


    Wogulis, Mark


    The present invention relates to variants of a parent cellobiohydrolase. The present invention also relates to polynucleotides encoding the cellobiohydrolase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the cellobiohydrolase variants.

  7. Nucleotide sequence of a Pseudomonas denitrificans 5.4-kilobase DNA fragment containing five cob genes and identification of structural genes encoding S-adenosyl-L-methionine: uroporphyrinogen III methyltransferase and cobyrinic acid a,c-diamide synthase.

    PubMed Central

    Crouzet, J; Cauchois, L; Blanche, F; Debussche, L; Thibaut, D; Rouyez, M C; Rigault, S; Mayaux, J F; Cameron, B


    A 5.4-kilobase DNA fragment carrying Pseudomonas denitrificans cob genes has been sequenced. The nucleotide sequence and genetic analysis revealed that this fragment carries five different cob genes (cobA to cobE). Four of these genes present the characteristics of translationally coupled genes. cobA has been identified as the structural gene of S-adenosyl-L-methionine:uroporphyrinogen III methyltransferase (SUMT) because the encoded protein has the same NH2 terminus and molecular weight as those determined for the purified SUMT. For the same reasons the cobB gene was shown to be the structural gene for cobyrinic acid a,c-diamide synthase. Genetic and biochemical data concerning cobC and cobD mutants suggest that the products of these genes are involved in the conversion of cobyric acid to cobinamide. PMID:2211520

  8. [The effect of 3-oxypyridine and succinic acid derivatives on obsessive-compulsive activity of mice in marble-burying test].


    Volchegorskiĭ, I A; Miroshnichenko, I Iu; Rassokhina, L M; Faĭzullin, R M; Priakhina, K E


    The effect of domestic derivatives of 3-oxypyridine and succinic acid (emoxipine, reamberin, and mexidol) on obsessive-compulsive behavior of mice was studied in the marble-burying test. Additionally the effect of these drugs on the behavior of animals was assessed in the open field test. Amitriptylin and alpha-lipoic acid were used as reference drugs. It was established that single administration of the investigated drugs in optimal doses, corresponding to therapeutic range in humans, inhibits obsessive-compulsive behavior of mice in the marble-burying test. Amitriptylin and alpha-lipoic acid produced similar effects. It is established that emoxipine stimulates the behavior of mice in the open field after single administration. An increase in the emoxipine dose led to decrease of stimulation and gradual development of sedative effect. Reamberin and mexidol, as well as alpha-lipoic acid and amitriptyline, caused sedation in mice tested in the open field. Inhibiting effect of emoxipine, reamberin, mexidol and alpha-lipoic acid on the obsessive-compulsive behavior in mice directly depended on sedative action of these drugs.

  9. Protective Effects of Membrane-Anchored and Secreted DNA Vaccines Encoding Fatty Acid-Binding Protein and Glutathione S-Transferase against Schistosoma japonicum

    PubMed Central

    Tu, Yaqin; Hu, Yang; Fan, Guorun; Chen, Zhihao; Liu, Lin; Man, Dandan; Liu, Shuojie; Tang, Chengwu; Zhang, Yin; Dai, Wuxing


    In order to explore the high performance bivalent DNA-based vaccine against schistosomes, SjFABP and Sj26GST were selected and used to construct a vaccine. Two strategies were used to construct the bivalent DNA vaccine. In the first strategy, a plasmid encoding antigen in the secreted form was used, while in the other, a plasmid encoding a truncated form of SjFABP and Sj26GST targeted to the cell surface was used. Various parameters, including antibody and cytokine response, proliferation, histopathological examination, and characterization of T cell subsets were used to evaluate the type of immune response and the level of protection against challenge infection. Injection with secreted pIRES-sjFABP-sj26GST significantly increased the levels of antibody, splenocyte proliferation, and production of IFN-γ, compared with membrane-anchored groups. Analysis of splenic T cell subsets showed that the secreted vaccine significantly increased the percentage of CD3+CD4+ and CD3+CD8+ T cells. Liver immunopathology (size of liver granulomas) was significantly reduced in the secreted group compared with the membrane-anchored groups. Moreover, challenge experiments showed that the worm and egg burdens were significantly reduced in animals immunized with recombinant vaccines. Most importantly, secreted Sj26GST-SjFABP markedly enhanced protection, by reducing worm and egg burdens by 31.8% and 24.78%, respectively, while the membrane-anchored group decreased worm and egg burdens by 24.80% and 18.80%, respectively. Taken together, these findings suggest that the secretory vaccine is more promising than the membrane-anchored vaccine, and provides support for the development and application of this vaccine. PMID:24466157

  10. ENCODE data at the ENCODE portal

    PubMed Central

    Sloan, Cricket A.; Chan, Esther T.; Davidson, Jean M.; Malladi, Venkat S.; Strattan, J. Seth; Hitz, Benjamin C.; Gabdank, Idan; Narayanan, Aditi K.; Ho, Marcus; Lee, Brian T.; Rowe, Laurence D.; Dreszer, Timothy R.; Roe, Greg; Podduturi, Nikhil R.; Tanaka, Forrest; Hong, Eurie L.; Cherry, J. Michael


    The Encyclopedia of DNA Elements (ENCODE) Project is in its third phase of creating a comprehensive catalog of functional elements in the human genome. This phase of the project includes an expansion of assays that measure diverse RNA populations, identify proteins that interact with RNA and DNA, probe regions of DNA hypersensitivity, and measure levels of DNA methylation in a wide range of cell and tissue types to identify putative regulatory elements. To date, results for almost 5000 experiments have been released for use by the scientific community. These data are available for searching, visualization and download at the new ENCODE Portal ( The revamped ENCODE Portal provides new ways to browse and search the ENCODE data based on the metadata that describe the assays as well as summaries of the assays that focus on data provenance. In addition, it is a flexible platform that allows integration of genomic data from multiple projects. The portal experience was designed to improve access to ENCODE data by relying on metadata that allow reusability and reproducibility of the experiments. PMID:26527727

  11. Use of an alpha lipoic, methylsulfonylmethane and bromelain dietary supplement (Opera(®)) for chemotherapy-induced peripheral neuropathy management, a prospective study.


    Desideri, Isacco; Francolini, Giulio; Becherini, Carlotta; Terziani, Francesca; Delli Paoli, Camilla; Olmetto, Emanuela; Loi, Mauro; Perna, Marco; Meattini, Icro; Scotti, Vieri; Greto, Daniela; Bonomo, Pierluigi; Sulprizio, Susanna; Livi, Lorenzo


    Chemotherapy-induced peripheral neuropathy (CIPN) is a major clinical problem associated with a number of cytotoxic agents. OPERA(®) (GAMFARMA srl, Milan, Italy) is a new dietary supplement where α-lipoic acid, Boswellia Serrata, methylsulfonylmethane and bromelain are combined in a single capsule. The aim of this prospective study was to determine the efficacy and safety of OPERA(®) supplementation in a series of patients affected by CIPN. We selected 25 subjects with CIPN evolving during or after chemotherapy with potentially neurotoxic agents. Patients were enrolled at the first clinical manifestation of neuropathy. CIPN was assessed at the enrollment visit and subsequently repeated every 3 weeks until 12 weeks. Primary endpoint was the evaluation of changes of measured scores after 12 weeks of therapy compared to baseline evaluation. Secondary endpoints were the evaluation of neuropathy reduction at 12 weeks after beginning of therapy with OPERA(®). Analysis of VAS data showed reduction in pain perceived by patients. According to NCI-CTC sensor and motor score, mISS scale and TNSc scale, both pain and both sensor and motor neuropathic impairment decreased after 12 weeks of treatments. Treatment with OPERA supplement was well tolerated; no increase in the toxicity profile of any of the therapeutic regimen that the patients were undergoing was reported. OPERA(®) was able to improve CIPN symptoms in a prospective series of patients treated with neurotoxic chemotherapy, with no significant toxicity or interaction. Prospective RCT in a selected patients' population is warranted to confirm its promising activity.

  12. Clustered Genes Encoding 2-Keto-l-Gulonate Reductase and l-Idonate 5-Dehydrogenase in the Novel Fungal d-Glucuronic Acid Pathway.


    Kuivanen, Joosu; Arvas, Mikko; Richard, Peter


    D-Glucuronic acid is a biomass component that occurs in plant cell wall polysaccharides and is catabolized by saprotrophic microorganisms including fungi. A pathway for D-glucuronic acid catabolism in fungal microorganisms is only partly known. In the filamentous fungus Aspergillus niger, the enzymes that are known to be part of the pathway are the NADPH requiring D-glucuronic acid reductase forming L-gulonate and the NADH requiring 2-keto-L-gulonate reductase that forms L-idonate. With the aid of RNA sequencing we identified two more enzymes of the pathway. The first is a NADPH requiring 2-keto-L-gulonate reductase that forms L-idonate, GluD. The second is a NAD(+) requiring L-idonate 5-dehydrogenase forming 5-keto-gluconate, GluE. The genes coding for these two enzymes are clustered and share the same bidirectional promoter. The GluD is an enzyme with a strict requirement for NADP(+)/NADPH as cofactors. The kcat for 2-keto-L-gulonate and L-idonate is 21.4 and 1.1 s(-1), and the Km 25.3 and 12.6 mM, respectively, when using the purified protein. In contrast, the GluE has a strict requirement for NAD(+)/NADH. The kcat for L-idonate and 5-keto-D-gluconate is 5.5 and 7.2 s(-1), and the Km 30.9 and 8.4 mM, respectively. These values also refer to the purified protein. The gluD deletion resulted in accumulation of 2-keto-L-gulonate in the liquid cultivation while the gluE deletion resulted in reduced growth and cessation of the D-glucuronic acid catabolism.

  13. Clustered Genes Encoding 2-Keto-l-Gulonate Reductase and l-Idonate 5-Dehydrogenase in the Novel Fungal d-Glucuronic Acid Pathway

    PubMed Central

    Kuivanen, Joosu; Arvas, Mikko; Richard, Peter


    D-Glucuronic acid is a biomass component that occurs in plant cell wall polysaccharides and is catabolized by saprotrophic microorganisms including fungi. A pathway for D-glucuronic acid catabolism in fungal microorganisms is only partly known. In the filamentous fungus Aspergillus niger, the enzymes that are known to be part of the pathway are the NADPH requiring D-glucuronic acid reductase forming L-gulonate and the NADH requiring 2-keto-L-gulonate reductase that forms L-idonate. With the aid of RNA sequencing we identified two more enzymes of the pathway. The first is a NADPH requiring 2-keto-L-gulonate reductase that forms L-idonate, GluD. The second is a NAD+ requiring L-idonate 5-dehydrogenase forming 5-keto-gluconate, GluE. The genes coding for these two enzymes are clustered and share the same bidirectional promoter. The GluD is an enzyme with a strict requirement for NADP+/NADPH as cofactors. The kcat for 2-keto-L-gulonate and L-idonate is 21.4 and 1.1 s-1, and the Km 25.3 and 12.6 mM, respectively, when using the purified protein. In contrast, the GluE has a strict requirement for NAD+/NADH. The kcat for L-idonate and 5-keto-D-gluconate is 5.5 and 7.2 s-1, and the Km 30.9 and 8.4 mM, respectively. These values also refer to the purified protein. The gluD deletion resulted in accumulation of 2-keto-L-gulonate in the liquid cultivation while the gluE deletion resulted in reduced growth and cessation of the D-glucuronic acid catabolism. PMID:28261181

  14. Characterization of 19 Genes Encoding Membrane-Bound Fatty Acid Desaturases and their Expression Profiles in Gossypium raimondii Under Low Temperature.


    Liu, Wei; Li, Wei; He, Qiuling; Daud, Muhammad Khan; Chen, Jinhong; Zhu, Shuijin


    To produce unsaturated fatty acids, membrane-bound fatty acid desaturases (FADs) can be exploited to introduce double bonds into the acyl chains of fatty acids. In this study, 19 membrane-bound FAD genes were identified in Gossypium raimondii through database searches and were classified into four different subfamilies based on phylogenetic analysis. All 19 membrane-bound FAD proteins shared three highly conserved histidine boxes, except for GrFAD2.1, which lost the third histidine box in the C-terminal region. In the G. raimondii genome, tandem duplication might have led to the increasing size of the FAD2 cluster in the Omega Desaturase subfamily, whereas segmental duplication appeared to be the dominant mechanism for the expansion of the Sphingolipid and Front-end Desaturase subfamilies. Gene expression analysis showed that seven membrane-bound FAD genes were significantly up-regulated and that five genes were greatly suppressed in G. raimondii leaves exposed to low temperature conditions.

  15. The neutrophil alloantigen HNA-3a (5b) is located on choline transporter-like protein 2 and appears to be encoded by an R>Q154 amino acid substitution

    PubMed Central

    Cox, Nancy J.; Sullivan, Mia J.; Konkashbaev, Anuar; Bowens, Krista; Hansen, Kirk; Aster, Richard H.


    The molecular basis of the HNA-3a/b (5b/a) leukocyte antigen system has not yet been defined despite evidence that HNA-3a–specific antibodies are particularly prone to cause severe, often fatal, transfusion-related lung injury. We used genome-wide single nucleotide polymorphism scanning and sequencing of DNA from persons of different HNA-3a/b phenotypes to identify a single single nucleotide polymorphism in exon 7 of the CLT2 gene (SLC44A2) that predicts an amino acid substitution in the first extracellular loop of choline transporter-like protein 2, a member of the choline transporter-like protein family of membrane glycoproteins, and correlates perfectly with HNA-3a/b phenotypes (R154 encodes HNA-3a; Q154 encodes HNA-3b). Mass spectrometric analysis of proteins immunoprecipitated from leukocytes by anti–HNA-3a provided direct evidence that anti–HNA-3a recognizes choline transporter-like protein 2. These findings will enable large-scale genotyping for HNA-3a/b to identify blood donors at risk to have HNA-3a–specific antibodies and should facilitate development of practical methods to detect such antibodies and prevent transfusion-related lung injury. PMID:20040764

  16. Molecular characterization of an autoantigen of PM-Scl in the polymyositis/scleroderma overlap syndrome: a unique and complete human cDNA encoding an apparent 75-kD acidic protein of the nucleolar complex

    PubMed Central


    About 50% of patients with the polymyositis/scleroderma (PM-Scl) overlap syndrome are reported to have autoantibodies to a nuclear/nucleolar particle termed PM-Scl. The particle is composed of several polypeptides of which two have been identified as autoantigens. In this report, human cDNA clone coding for the entire 75-kD autoantigen of the PM-Scl particle (PM-Scl 75) was isolated from a MOLT- 4 lambda gt-11 library. The deduced amino acid sequence of the cDNA clone represented a protein of 355 amino acids and 39.2 kD; the in vitro translation product of this cDNA migrated in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) at approximately 70 kD. The aberrant migration of the polypeptide in SDS-PAGE was shown to be related to the COOH half that was rich in acidic residues. Authenticity of the cDNA coding for PM-Scl 75 was shown by immunoreactivity of PM-Scl sera with in vitro translation products and recombinant fusion proteins encoded by the cDNA. In addition, rabbit antibodies raised to recombinant fusion protein reacted in immunofluorescence, immunoblotting, and immunoprecipitation with the characteristic features displayed by human anti-PM-Scl sera. PMID:2007859

  17. Concordance between isolated cleft palate in mice and alterations within a region including the gene encoding the beta 3 subunit of the type A gamma-aminobutyric acid receptor.


    Culiat, C T; Stubbs, L; Nicholls, R D; Montgomery, C S; Russell, L B; Johnson, D K; Rinchik, E M


    Genetic and molecular analyses of a number of radiation-induced deletion mutations of the pink-eyed dilution (p) locus in mouse chromosome 7 have identified a specific interval on the genetic map associated with a neonatally lethal mutation that results in cleft palate. This interval, closely linked and distal to p, and bracketed by the genes encoding the alpha 5 and beta 3 subunits of the type A gamma-aminobutyric acid receptor (Gabra5 and Gabrb3, respectively), contains a gene(s) (cp1; cleft palate 1) necessary for normal palate development. The cp1 interval extends from the distal breakpoint of the prenatally lethal p83FBFo deletion to the Gabrb3 locus. Among 20 p deletions tested, there was complete concordance between alterations at the Gabrb3 transcription unit and inability to complement the cleft-palate defect. These mapping data, along with previously described in vivo and in vitro teratological effects of gamma-aminobutyric acid or its agonists on palate development, suggest the possibility that a particular type A gamma-aminobutyric acid receptor that includes the beta 3 subunit may be necessary for normal palate development. The placement of the cp1 gene within a defined segment of the larger D15S12h (p)-D15S9h-1 interval in the mouse suggests that the highly homologous region of the human genome, 15q11-q13, be evaluated for a role(s) in human fetal facial development.

  18. SPT5, an essential gene important for normal transcription in Saccharomyces cerevisiae, encodes an acidic nuclear protein with a carboxy-terminal repeat.

    PubMed Central

    Swanson, M S; Malone, E A; Winston, F


    Mutations in the SPT5 gene of Saccharomyces cerevisiae were isolated previously as suppressors of delta insertion mutations at HIS4 and LYS2. In this study we have shown that spt5 mutations suppress the his4-912 delta and lys2-128 delta alleles by altering transcription. We cloned the SPT5 gene and found that either an increase or a decrease in the copy number of the wild-type SPT5 gene caused an Spt- phenotype. Construction and analysis of an spt5 null mutation demonstrated that SPT5 is essential for growth, suggesting that SPT5 may be required for normal transcription of a large number of genes. The SPT5 DNA sequence was determined; it predicted a 116-kDa protein with an extremely acidic amino terminus and a novel six-amino-acid repeat at the carboxy terminus (consensus = S-T/A-W-G-G-A/Q). By indirect immunofluorescence microscopy we showed that a bifunctional SPT5-beta-galactosidase protein was located in the yeast nucleus. This molecular analysis of the SPT5 gene revealed a number of interesting similarities to the previously characterized SPT6 gene of S. cerevisiae. These results suggest that SPT5 and SPT6 act in a related fashion to influence essential transcriptional processes in S. cerevisiae. Images PMID:1840633

  19. [Anxiolytic and antidepressant effects of 3-oxypiridine and succinic acid derivatives in alloxan diabetes].


    Volchegorskii, L A; Miroshnichenko, I Yu; Rassokhina, L M; Faizullin, R M; Pryakhina, K E; Kalugina, A V


    The effects of 3-oxypyridine and succinic acid derivatives (emoxipine, reamberin and mexidol) on affective disorders in rats with alloxan diabetes were studied. The efficiency of emoxipine, reamberin and mexidol was compared to alpha-lipoic acid, which is considered a "golden standard" in treatment of diabetic neuropathies. Emoxipine, reamberin and mexidol after seven administrations in single doses, that are equivalent to therapeutic range in humans, corrected the anxiety-depressive disorders in rats with alloxan diabetes. Unlike reamberin and alpha-lipoic acid, emoxipine and mexidol corrected the affective status concurrently with the decrease in hyperglycemia. At the same time, emoxipine outperformed mexidol in tranquilizing action (in maximal doses) but yielded mexidol in the antidepressant effect (in minimal doses).

  20. The Drosophila don juan (dj) gene encodes a novel sperm specific protein component characterized by an unusual domain of a repetitive amino acid motif.


    Santel, A; Winhauer, T; Blümer, N; Renkawitz-Pohl, R


    We identified and characterized the don juan gene (dj) of Drosophila melanogaster. The don juan gene codes for a sperm specific protein component with an unusual repetitive six amino acid motif (DPCKKK) in the carboxy-terminal part of the protein. The expression of Don Juan is limited to male germ cells where transcription of the dj gene is initiated during meiotic prophase. But Western blot experiments indicate that DJ protein occurs just postmeiotically. Examination of transgenic flies bearing a dj-promoter-lacZ reporter construct revealed lacZ mRNA distribution resembling the expression pattern of the endogenous dj mRNA in the adult testes, whereas beta-galactosidase expression is exclusively present in postmeiotic germ cells. Thus, these observations strongly suggest that dj transcripts are under translational repression until in spermiogenesis. To study the function and subcellular distribution of DJ in spermiogenesis we expressed a chimaeric dj-GFP fusion gene in the male germline exhibiting strong GFP fluorescence in the liver testes, where only elongated spermatids are decorated. With regard to the characteristic expression pattern of DJ protein and its conspicuous repeat units possible functional roles are discussed.

  1. Suppression of Cell Wall Degrading Enzymes and their Encoding Genes in Button Mushrooms (Agaricus bisporus) by CaCl2 and Citric Acid.


    Khan, Zia Ullah; Jiayin, Li; Khan, Nasir Mehmood; Mou, Wangshu; Li, Dongdong; Wang, Yansheng; Feng, Simin; Luo, Zisheng; Mao, Linchun; Ying, Tiejin


    Fresh button mushrooms (Agaricus bisporus) were harvested and treated with a solution of 1.5% CaCl2 + 0.5% citric acid and stored for 16 days at 12 °C. The effects of this treatment on firmness, weight, color, cell wall compositions (cellulose and chitin) and cell wall degrading enzymes (cel1ulase, beta-1, 3 glucanase, chitinase and phenylalanine ammonialyase) were investigated during post-harvest storage. The expressions of major genes (Cel1, Glu1, Chi1 and PAL1) involved in cell wall degradation during post-harvest storage were also monitored. The results revealed that the post-harvest chemical treatment maintained better firmness, weight, color and inhibited cellulase, beta-1, 3 glucanase, chitinase and phenylalanine ammonialyase activities. These findings showed that the down-regulation of cell wall degrading enzymes is a possible mechanism that delays the softening of button mushrooms by the application of combined chemical treatment.

  2. The Arabidopsis cytochrome P450 CYP86A1 encodes a fatty acid ω-hydroxylase involved in suberin monomer biosynthesis

    PubMed Central

    Höfer, Rene; Briesen, Isabel; Beck, Martina; Pinot, Franck; Schreiber, Lukas; Franke, Rochus


    The lipophilic biopolyester suberin forms important boundaries to protect the plant from its surrounding environment or to separate different tissues within the plant. In roots, suberin can be found in the cell walls of the endodermis and the hypodermis or periderm. Apoplastic barriers composed of suberin accomplish the challenge to restrict water and nutrient loss and prevent the invasion of pathogens. Despite the physiological importance of suberin and the knowledge of the suberin composition of many plants, very little is known about its biosynthesis and the genes involved. Here, a detailed analysis of the Arabidopsis aliphatic suberin in roots at different developmental stages is presented. This study demonstrates some variability in suberin amount and composition along the root axis and indicates the importance of ω-hydroxylation for suberin biosynthesis. Using reverse genetics, the cytochrome P450 fatty acid ω-hydroxylase CYP86A1 (At5g58860) has been identified as a key enzyme for aliphatic root suberin biosynthesis in Arabidopsis. The corresponding horst mutants show a substantial reduction in ω-hydroxyacids with a chain length

  3. Fatty acid biosynthesis in Pseudomonas aeruginosa: cloning and characterization of the fabAB operon encoding beta-hydroxyacyl-acyl carrier protein dehydratase (FabA) and beta-ketoacyl-acyl carrier protein synthase I (FabB).

    PubMed Central

    Hoang, T T; Schweizer, H P


    The Pseudomonas aeruginosa fabA and fabB genes, encoding beta-hydroxyacyl-acyl carrier protein dehydratase and beta-ketoacyl-acyl carrier protein synthase I, respectively, were cloned, sequenced, and expressed in Escherichia coli. Northern analysis demonstrated that fabA and fabB are cotranscribed and most probably form a fabAB operon. The FabA and FabB proteins were similar in size and amino acid composition to their counterparts from Escherichia coli and to the putative homologs from Haemophilus influenzae. Chromosomal fabA and fabB mutants were isolated; the mutants were auxotrophic for unsaturated fatty acids. A temperature-sensitive fabA mutant was obtained by site-directed mutagenesis of a single base that induced a G101D change; this mutant grew normally at 30 degrees C but not at 42 degrees C, unless the growth medium was supplemented with oleate. By physical and genetic mapping, the fabAB genes were localized between 3.45 and 3.6 Mbp on the 5.9-Mbp chromosome, which corresponds to the 58- to 59.5-min region of the genetic map. PMID:9286984

  4. Induction of anti-melanoma CTL response using DC transfected with mutated mRNA encoding full-length Melan-A/MART-1 antigen with an A27L amino acid substitution.


    Abdel-Wahab, Zeinab; Kalady, Matthew F; Emani, Sirisha; Onaitis, Mark W; Abdel-Wahab, Omar I; Cisco, Robin; Wheless, Lee; Cheng, Tsung-Yen; Tyler, Douglas S; Pruitt, Scott K


    Modification of the parental immunodominant Melan-A/MART-1 peptide (MART-1(26-35)) by replacing the alanine with leucine (A27L) enhances its immunogenicity. Because of the reported advantages of RNA over peptides in DC vaccines, we sought to mutate the MART-1 gene to encode a full-length MART-1 antigen with an A27L amino acid substitution. Human DC were transfected with A27L-mutated MART-1 RNA (A27L RNA) or native MART-1 RNA, and then used to stimulate autologous T cells from a series of 8 HLA-A2+ volunteers. After three stimulations, all CTL induced with DC/A27L RNA exhibited more tetramer+ cells, and demonstrated stronger antigen-specific IFNgamma-secreting activity compared to CTL induced with DC/native RNA. A potent MART-1-specific, and predominantly class-I-restricted lysis was detected in most CTL induced with DC/A27L RNA, while native RNA-induced CTL showed minimal and non-specific lysis. HLA-A2+ DC and MART-1 negative/A2+ melanoma cells transfected with the A27L RNA were recognized and killed by MART-1-specific CTL, suggesting that these APC efficiently processed the A27L RNA and presented correct MART-1-specific epitope(s). In summary, introducing an A27L mutation into the MART-1 full-length mRNA sequence enhanced the immunogenicity of the encoded MART-1 Ag. The ease with which such a mutation can be made in RNA presents another potential advantage of using RNA for immunotherapy. Our results support considering this strategy for enhancing the immunogenicity of DC-based RNA vaccines.

  5. Functional analysis and transcriptional regulation of two orthologs of ARO10, encoding broad-substrate-specificity 2-oxo-acid decarboxylases, in the brewing yeast Saccharomyces pastorianus CBS1483.


    Bolat, Irina; Romagnoli, Gabriele; Zhu, Feibai; Pronk, Jack T; Daran, Jean-Marc


    The hybrid genomes of Saccharomyces pastorianus consist of subgenomes similar to those of S. cerevisiae and S. eubayanus, and impact of the genome structure on flavour production and its regulation is poorly understood. This study focuses on ARO10, a 2-oxo-acid decarboxylase involved in production of higher alcohols. In S. pastorianus CBS1483, four ARO10 copies were identified, three resembled S. cerevisiae ARO10 and one S. eubayanus ARO10. Substrate specificities of lager strain (Lg)ScAro10 and LgSeubAro10 were compared by individually expressing them in a pdc1Δ-pdc5Δ-pdc6Δ-aro10Δ-thi3Δ S. cerevisiae strain. Both isoenzymes catalysed decarboxylation of the 2-oxo-acids derived from branched-chain, sulphur-containing amino acids and preferably phenylpyruvate. Expression of both alleles was induced by phenylalanine, however in contrast to the S. cerevisiae strain, the two genes were not induced by leucine. Additionally, LgSeubARO10 showed higher basal expression levels during growth with ammonia. ARO80, which encodes ARO10 transcriptional activator, is located on CHRIV and counts three Sc-like and one Seub-like copies. Deletion of LgSeubARO80 did not affect LgSeubARO10 phenylalanine induction, revealing 'trans' regulation across the subgenomes. ARO10 transcript levels showed a poor correlation with decarboxylase activities. These results provide insights into flavour formation in S. pastorianus and illustrate the complexity of functional characterization in aneuploid strains.

  6. Miniaturised optical encoder

    NASA Astrophysics Data System (ADS)

    Carr, John; Desmulliez, Marc P. Y.; Weston, Nick; McKendrick, David; Cunningham, Graeme; McFarland, Geoff; Meredith, Wyn; McKee, Andrew; Langton, Conrad; Eddie, Iain


    Optical encoders are pervasive in many sectors of industry including metrology, motion systems, electronics, medical, scanning/ printing, scientific instruments, space research and specialist machine tools. The precision of automated manufacture and assembly has been revolutionised by the adoption of optical diffractive measurement methods. Today's optical encoders comprise discrete components: light source(s), reference and analyser gratings, and a photodiode array that utilise diffractive optic methods to achieve high resolution. However the critical alignment requirements between the optical gratings and to the photodiode array, the bulky nature of the encoder devices and subsequent packaging mean that optical encoders can be prohibitively expensive for many applications and unsuitable for others. We report here on the design, manufacture and test of a miniaturised optical encoder to be used in precision measurement systems. Microsystems manufacturing techniques facilitate the monolithic integration of the traditional encoder components onto a single compound semiconductor chip, radically reducing the size, cost and set-up time. Fabrication of the gratings at the wafer level, by standard photo-lithography, allows for the simultaneous alignment of many devices in a single process step. This development coupled with a unique photodiode configuration not only provides increased performance but also significantly improves the alignment tolerances in both manufacture and set-up. A National Research and Development Corporation type optical encoder chip has been successfully demonstrated under test conditions on both amplitude and phase scales with pitches of 20 micron, 8 micron and 4 micron, showing significantly relaxed alignment tolerances with signal-to-noise ratios greater than 60:1. Various reference mark schemes have also been investigated. Results are presented here.

  7. Identification of functional BrFAD2-1 gene encoding microsomal delta-12 fatty acid desaturase from Brassica rapa and development of Brassica napus containing high oleic acid contents.


    Jung, Jin Hee; Kim, Hyojin; Go, Young Sam; Lee, Saet Buyl; Hur, Cheol-Goo; Kim, Hyun Uk; Suh, Mi Chung


    Microsomal delta-12 fatty acid desaturase (FAD2) functions in the first committed step of the biosynthesis of polyunsaturated fatty acids via the desaturation of oleic acid to linoleic acid. In this study, two FAD2 genes were identified through genome-wide analysis of Brassica rapa. One BrFAD2-1 gene harbors functional sequence information, but another BrFAD2-2 gene has mutations that generated a premature stop codon, rendering it nonfunctional. From a database of 120,000 B. rapa expressed sequence tags, we determined that all sequences coding for FAD2 corresponded to the BrFAD2-1 gene. The BrFAD2-1 protein was shown to share high sequence homology (71-99%) with FAD2 proteins from other plant species. An intron in the 5'-untranslated region and three histidine boxes in the protein, which are characteristic of plant FAD2 genes, have been well-conserved. BrFAD2-1 transcripts were detected in various organs of B. rapa. When a pBrFAD2-1:mRFP construct was introduced into tobacco epidermal cells, the fluorescent signal was noted in the endoplasmic reticulum. Ectopic expression of BrFAD2-1:mRFP complemented the Arabidopsis fad2-2 mutant. Finally, transgenic Korean rapeseed Tammi containing high oleic acid contents (78 mol%) was developed via the expression of the BrFAD2-1 gene in an antisense orientation. The data demonstrate that B. rapa harbors only one functional FAD2 that can be utilized for the development of the high-oleic acid Korean rapeseed cultivar Tammi, which might be useful for both human consumption and industrial applications.

  8. Gene encoding acetyl-coenzyme A carboxylase


    Roessler, P.G.; Ohlrogge, J.B.


    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives are disclosed which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides. 5 figs.

  9. Gene encoding acetyl-coenzyme A carboxylase


    Roessler, Paul G.; Ohlrogge, John B.


    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives thereof which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides.

  10. The Penicillium chrysogenum aclA gene encodes a broad-substrate-specificity acyl-coenzyme A ligase involved in activation of adipic acid, a side-chain precursor for cephem antibiotics.


    Koetsier, Martijn J; Gombert, Andreas K; Fekken, Susan; Bovenberg, Roel A L; van den Berg, Marco A; Kiel, Jan A K W; Jekel, Peter A; Janssen, Dick B; Pronk, Jack T; van der Klei, Ida J; Daran, Jean-Marc


    Activation of the cephalosporin side-chain precursor to the corresponding CoA-thioester is an essential step for its incorporation into the beta-lactam backbone. To identify an acyl-CoA ligase involved in activation of adipate, we searched in the genome database of Penicillium chrysogenum for putative structural genes encoding acyl-CoA ligases. Chemostat-based transcriptome analysis was used to identify the one presenting the highest expression level when cells were grown in the presence of adipate. Deletion of the gene renamed aclA, led to a 32% decreased specific rate of adipate consumption and a threefold reduction of adipoyl-6-aminopenicillanic acid levels, but did not affect penicillin V production. After overexpression in Escherichia coli, the purified protein was shown to have a broad substrate range including adipate. Finally, protein-fusion with cyan-fluorescent protein showed co-localization with microbody-borne acyl-transferase. Identification and functional characterization of aclA may aid in developing future metabolic engineering strategies for improving the production of different cephalosporins.

  11. Inhibition by polyphenolic phytochemicals and sulfurous compounds of the formation of 8-chloroguanosine mediated by hypochlorous acid, human myeloperoxidase, and activated human neutrophils.


    Nakano, Toshiki; Masuda, Mitsuharu; Suzuki, Toshinori; Ohshima, Hiroshi


    Hypochlorous acid (HOCl) produced by myeloperoxidase (MPO) of activated neutrophils can react with nucleic acid bases to form chlorinated nucleosides such as 8-chloroguanosine (Cl-Guo). Chlorination is enhanced by nicotine. We investigated the effects of various natural antioxidants including polyphenolic phytochemicals on the formation of Cl-Guo by HOCl in the presence and the absence of nicotine. Polyphenols, including catechins, curcumin, resveratrol, silibinin, and sulfurous compound α-lipoic acid, were found to inhibit both HOCl- and human MPO-induced Cl-Guo formation dose-dependently. Among the test compounds, (-)-epigallocatechin gallate (EGCG) showed the strongest inhibitory effect. Cl-Guo formation, mediated by activated human neutrophils in the presence of nicotine, was inhibited by EGCG, silibinin, and α-lipoic acid. These results suggest that polyphenols and sulfurous compounds have the potential to inhibit the induction of nucleobase damage mediated by chlorination, with possible application to reducing DNA damage associated with inflammation and cigarette-smoke inhalation.

  12. Time-Encoded Imagers.

    SciTech Connect

    Marleau, Peter; Brubaker, Erik


    This report provides a short overview of the DNN R&D funded project, Time-Encoded Imagers. The project began in FY11 and concluded in FY14. The Project Description below provides the overall motivation and objectives for the project as well as a summary of programmatic direction. It is followed by a short description of each task and the resulting deliverables.

  13. Video time encoding machines.


    Lazar, Aurel A; Pnevmatikakis, Eftychios A


    We investigate architectures for time encoding and time decoding of visual stimuli such as natural and synthetic video streams (movies, animation). The architecture for time encoding is akin to models of the early visual system. It consists of a bank of filters in cascade with single-input multi-output neural circuits. Neuron firing is based on either a threshold-and-fire or an integrate-and-fire spiking mechanism with feedback. We show that analog information is represented by the neural circuits as projections on a set of band-limited functions determined by the spike sequence. Under Nyquist-type and frame conditions, the encoded signal can be recovered from these projections with arbitrary precision. For the video time encoding machine architecture, we demonstrate that band-limited video streams of finite energy can be faithfully recovered from the spike trains and provide a stable algorithm for perfect recovery. The key condition for recovery calls for the number of neurons in the population to be above a threshold value.

  14. Plasmids encoding therapeutic agents


    Keener, William K.


    Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

  15. Genetically-encoded Reporters

    NASA Astrophysics Data System (ADS)

    Isacoff, Ehud


    One of the principle goals of neuroscience has been to understand the cellular basis of information processing and the plasticity that underlies learning and memory. Efforts in this area have mainly relied on electrical recording and optical imaging with chemical dyes. Over the last few years we and others have begun to develop genetically-encoded optical reporter "dyes" which should provide several important advantages over the classical methods for monitoring signal transmission in the nervous system. The advantages are that genetically-encoded reporters can be molecularly targeted a) to specific cell types via cell-specific promoters, and b) to specific subcellular compartments by peptides that are recognized by the protein sorting machinery of the cell. This makes it possible, in principle, to exclude signals from non-neuronal cells and to visualize selectively, in a brain region that contains many cell types with numerous kinds of synaptic connections, the activity of specific types of neurons (e.g. GABAergic interneurons) and specific synaptic elements (e.g. nerve terminals or dendrites), something that has hitherto not been possible. An additional advantage is that protein reporters may be rationally and irrationally "tuned" with mutations in functional domains known to control their dynamic range of operation. The general idea behind genetically-encoded reporters of cell signaling is to encode a protein that is either intrinsically fluorescent, or that can be labeled orthogonally with a fluorescent probe, and where the physiological signal changes fluorescence emission. I will describe recent progress employing both kinds of approaches.

  16. Nucleic acids encoding a cellulose binding domain


    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc A.; Doi, Roy H.


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  17. Nucleic acids encoding a cellulose binding domain


    Shoseyov, O.; Shpiegl, I.; Goldstein, M.A.; Doi, R.H.


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 15 figs.

  18. Regulation of resin acid synthesis in Pinus densiflora by differential transcription of genes encoding multiple 1-deoxy-D-xylulose 5-phosphate synthase and 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase genes.


    Kim, Yeon-Bok; Kim, Sang-Min; Kang, Min-Kyoung; Kuzuyama, Tomohisa; Lee, Jong Kyu; Park, Seung-Chan; Shin, Sang-Chul; Kim, Soo-Un


    Pinus densiflora Siebold et Zucc. is the major green canopy species in the mountainous area of Korea. To assess the response of resin acid biosynthetic genes to mechanical and chemical stimuli, we cloned cDNAs of genes encoding enzymes involved in the 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway (1-deoxy-d-xylulose 5-phosphate synthase (PdDXS), 1-deoxy-d-xylulose 5-phosphate reductoisomerase (PdDXR) and 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase (PdHDR)) by the rapid amplification of cDNA ends (RACE) technique. In addition, we cloned the gene encoding abietadiene synthase (PdABS) as a marker for the site of pine resin biosynthesis. PdHDR and PdDXS occurred as two gene families. In the phylogenetic trees, PdDXSs, PdDXR and PdHDRs each formed a separate clade from their respective angiosperm homologs. PdDXS2, PdHDR2 and PdDXR were most actively transcribed in stem wood, whereas PdABS was specifically transcribed. The abundance of PdDXS2 transcripts in wood in the resting state was generally 50-fold higher than the abundance of PdDXS1 transcripts, and PdHDR2 transcripts were more abundant by an order of magnitude in wood than in other tissues, with the ratio of PdHDR2 to PdHDR1 transcripts in wood being about 1. Application of 1 mM methyl jasmonate (MeJA) selectively enhanced the transcript levels of PdDXS2 and PdHDR2 in wood. The ratios of PdDXS2 to PdDXS1 and PdHDR2 to PdHDR1 reached 900 and 20, respectively, on the second day after MeJA treatment, whereas the transcript level of PdABS increased twofold by 3 days after MeJA treatment. Wounding of the stem differentially enhanced the transcript ratios of PdDXS2 to PdDXS1 and PdHDR2 to PdHDR1 to 300 and 70, respectively. The increase in the transcript levels of the MEP pathway genes in response to wounding was accompanied by two orders of magnitude increase in PdABS transcripts. These observations indicated that resin acid biosynthesis activity, represented by PdABS transcription, was correlated

  19. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


    Dotson, William D.; Greenier, Jennifer; Ding, Hanshu


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated nucleic acids encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acids as well as methods for producing and using the polypeptides.

  20. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


    Dotson, William D.; Greenier, Jennifer; Ding, Hanshu


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated nucleic acids encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acids as well as methods for producing and using the polypeptides.

  1. Hybrid polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Shaghasi, Tarana


    The present invention provides hybrid polypeptides having cellobiohydrolase activity. The present invention also provides polynucleotides encoding the hybrid polypeptides; nucleic acid constructs, vectors and host cells comprising the polynucleotides; and processes of using the hybrid polypeptides.

  2. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    SciTech Connect

    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping


    Provided are isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having endoglucanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having endoglucanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Polypeptides having xylanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan; Duan, Junxin


    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having endoglucanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polypeptides having endoglucanse activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having xylanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having xylanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having xylanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  17. Polypeptides having endoglucanase activity and polynucleotides encoding same


    Liu, Ye; Duan, Junxin; Tang, Lan


    The present invention provides isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cell comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  19. [Effect of the B-group vitamin complex on the blood content of saturated and unsaturated fatty acids in patients with ischemic heart disease and hypertension].


    Vodoevich, V P; Buko, V U


    Gas-liquid chromatography was used to study the blood content of saturated and unsaturated fatty acids, under the influence of the functionally-associated vitamin-B complex, in 45 patients with coronary heart disease and essential hypertension. The vitamins were given daily in the following doses: thiamine diphosphate 50 mg, riboflavine 40 mg, calcium pantothenate 200 mg, nicotinic acid 200 mg and lipoic acid 50 mg. Favourable shifts leading to positive clinical effects were recorded in the fatty acid metabolism after 10-day taking the vitamin-B complex: the content of unsaturated (linoleic and arachidonic) fatty acids increased while that of saturated (stearic and palmitic) fatty acids decreased.

  20. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, J.D.; Scott-Craig, J.S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is presented. The deduced amino acid sequence is provided. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with vectors and seeds from the plants.

  1. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    PubMed Central

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong


    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1–2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1–2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  2. Time encoded radiation imaging


    Marleau, Peter; Brubaker, Erik; Kiff, Scott


    The various technologies presented herein relate to detecting nuclear material at a large stand-off distance. An imaging system is presented which can detect nuclear material by utilizing time encoded imaging relating to maximum and minimum radiation particle counts rates. The imaging system is integrated with a data acquisition system that can utilize variations in photon pulse shape to discriminate between neutron and gamma-ray interactions. Modulation in the detected neutron count rates as a function of the angular orientation of the detector due to attenuation of neighboring detectors is utilized to reconstruct the neutron source distribution over 360 degrees around the imaging system. Neutrons (e.g., fast neutrons) and/or gamma-rays are incident upon scintillation material in the imager, the photons generated by the scintillation material are converted to electrical energy from which the respective neutrons/gamma rays can be determined and, accordingly, a direction to, and the location of, a radiation source identified.

  3. Rotary encoding device

    NASA Technical Reports Server (NTRS)

    Leviton, Douglas B. (Inventor)


    A device for position encoding of a rotating shaft in which a polygonal mirror having a number of facets is mounted to the shaft and a light beam is directed towards the facets is presented. The facets of the polygonal mirror reflect the light beam such that a light spot is created on a linear array detector. An analog-to-digital converter is connected to the linear array detector for reading the position of the spot on the linear array detector. A microprocessor with memory is connected to the analog-to-digital converter to hold and manipulate the data provided by the analog-to-digital converter on the position of the spot and to compute the position of the shaft based upon the data from the analog-to-digital converter.

  4. Linear encoding device

    NASA Technical Reports Server (NTRS)

    Leviton, Douglas B. (Inventor)


    A Linear Motion Encoding device for measuring the linear motion of a moving object is disclosed in which a light source is mounted on the moving object and a position sensitive detector such as an array photodetector is mounted on a nearby stationary object. The light source emits a light beam directed towards the array photodetector such that a light spot is created on the array. An analog-to-digital converter, connected to the array photodetector is used for reading the position of the spot on the array photodetector. A microprocessor and memory is connected to the analog-to-digital converter to hold and manipulate data provided by the analog-to-digital converter on the position of the spot and to compute the linear displacement of the moving object based upon the data from the analog-to-digital converter.

  5. Space vehicle onboard command encoder

    NASA Technical Reports Server (NTRS)


    A flexible onboard encoder system was designed for the space shuttle. The following areas were covered: (1) implementation of the encoder design into hardware to demonstrate the various encoding algorithms/code formats, (2) modulation techniques in a single hardware package to maintain comparable reliability and link integrity of the existing link systems and to integrate the various techniques into a single design using current technology. The primary function of the command encoder is to accept input commands, generated either locally onboard the space shuttle or remotely from the ground, format and encode the commands in accordance with the payload input requirements and appropriately modulate a subcarrier for transmission by the baseband RF modulator. The following information was provided: command encoder system design, brassboard hardware design, test set hardware and system packaging, and software.

  6. N-Consecutive-Phase Encoder

    NASA Technical Reports Server (NTRS)

    Divsalar, Dariush; Lee, Ho-Kyoung; Weber, Charles


    N-consecutive-phase encoder (NCPE) is conceptual encoder for generating alphabet of N consecutive full-response continuous-phase-modulation (CPM) signals. Enables use of binary preencoder of higher rate than used with simple continuous-phase encoder (CPE). NCPE makes possible to achieve power efficiencies and bandwidth efficiencies greater than conventional trellis coders with continuous-phase frequency-shift keying (CPFSK).

  7. Asymmetric synthesis using chiral-encoded metal

    PubMed Central

    Yutthalekha, Thittaya; Wattanakit, Chularat; Lapeyre, Veronique; Nokbin, Somkiat; Warakulwit, Chompunuch; Limtrakul, Jumras; Kuhn, Alexander


    The synthesis of chiral compounds is of crucial importance in many areas of society and science, including medicine, biology, chemistry, biotechnology and agriculture. Thus, there is a fundamental interest in developing new approaches for the selective production of enantiomers. Here we report the use of mesoporous metal structures with encoded geometric chiral information for inducing asymmetry in the electrochemical synthesis of mandelic acid as a model molecule. The chiral-encoded mesoporous metal, obtained by the electrochemical reduction of platinum salts in the presence of a liquid crystal phase and the chiral template molecule, perfectly retains the chiral information after removal of the template. Starting from a prochiral compound we demonstrate enantiomeric excess of the (R)-enantiomer when using (R)-imprinted electrodes and vice versa for the (S)-imprinted ones. Moreover, changing the amount of chiral cavities in the material allows tuning the enantioselectivity. PMID:27562028

  8. Asymmetric synthesis using chiral-encoded metal

    NASA Astrophysics Data System (ADS)

    Yutthalekha, Thittaya; Wattanakit, Chularat; Lapeyre, Veronique; Nokbin, Somkiat; Warakulwit, Chompunuch; Limtrakul, Jumras; Kuhn, Alexander


    The synthesis of chiral compounds is of crucial importance in many areas of society and science, including medicine, biology, chemistry, biotechnology and agriculture. Thus, there is a fundamental interest in developing new approaches for the selective production of enantiomers. Here we report the use of mesoporous metal structures with encoded geometric chiral information for inducing asymmetry in the electrochemical synthesis of mandelic acid as a model molecule. The chiral-encoded mesoporous metal, obtained by the electrochemical reduction of platinum salts in the presence of a liquid crystal phase and the chiral template molecule, perfectly retains the chiral information after removal of the template. Starting from a prochiral compound we demonstrate enantiomeric excess of the (R)-enantiomer when using (R)-imprinted electrodes and vice versa for the (S)-imprinted ones. Moreover, changing the amount of chiral cavities in the material allows tuning the enantioselectivity.

  9. Prosodic Encoding in Silent Reading.

    ERIC Educational Resources Information Center

    Wilkenfeld, Deborah

    In silent reading, short-memory tasks, such as semantic and syntactic processing, require a stage of phonetic encoding between visual representation and the actual extraction of meaning, and this encoding includes prosodic as well as segmental features. To test for this suprasegmental coding, an experiment was conducted in which subjects were…

  10. Atoms-in-molecules study of the genetically encoded amino acids. III. Bond and atomic properties and their correlations with experiment including mutation-induced changes in protein stability and genetic coding.


    Matta, Chérif F; Bader, Richard F W


    This article presents a study of the molecular charge distributions of the genetically encoded amino acids (AA), one that builds on the previous determination of their equilibrium geometries and the demonstrated transferability of their common geometrical parameters. The properties of the charge distributions are characterized and given quantitative expression in terms of the bond and atomic properties determined within the quantum theory of atoms-in-molecules (QTAIM) that defines atoms and bonds in terms of the observable charge density. The properties so defined are demonstrated to be remarkably transferable, a reflection of the underlying transferability of the charge distributions of the main chain and other groups common to the AA. The use of the atomic properties in obtaining an understanding of the biological functions of the AA, whether free or bound in a polypeptide, is demonstrated by the excellent statistical correlations they yield with experimental physicochemical properties. A property of the AA side chains of particular importance is the charge separation index (CSI), a quantity previously defined as the sum of the magnitudes of the atomic charges and which measures the degree of separation of positive and negative charges in the side chain of interest. The CSI values provide a correlation with the measured free energies of transfer of capped side chain analogues, from the vapor phase to aqueous solution, yielding a linear regression equation with r2 = 0.94. The atomic volume is defined by the van der Waals isodensity surface and it, together with the CSI, which accounts for the electrostriction of the solvent, yield a linear regression (r2 = 0.98) with the measured partial molar volumes of the AAs. The changes in free energies of transfer from octanol to water upon interchanging 153 pairs of AAs and from cyclohexane to water upon interchanging 190 pairs of AAs, were modeled using only three calculated parameters (representing electrostatic and

  11. Plant fatty acid hydroxylases


    Somerville, Chris; Broun, Pierre; van de Loo, Frank


    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  12. Information encoder/decoder using chaotic systems


    Miller, S.L.; Miller, W.M.; McWhorter, P.J.


    The present invention discloses a chaotic system-based information encoder and decoder that operates according to a relationship defining a chaotic system. Encoder input signals modify the dynamics of the chaotic system comprising the encoder. The modifications result in chaotic, encoder output signals that contain the encoder input signals encoded within them. The encoder output signals are then capable of secure transmissions using conventional transmission techniques. A decoder receives the encoder output signals (i.e., decoder input signals) and inverts the dynamics of the encoding system to directly reconstruct the original encoder input signals. 32 figs.

  13. Information encoder/decoder using chaotic systems


    Miller, Samuel Lee; Miller, William Michael; McWhorter, Paul Jackson


    The present invention discloses a chaotic system-based information encoder and decoder that operates according to a relationship defining a chaotic system. Encoder input signals modify the dynamics of the chaotic system comprising the encoder. The modifications result in chaotic, encoder output signals that contain the encoder input signals encoded within them. The encoder output signals are then capable of secure transmissions using conventional transmission techniques. A decoder receives the encoder output signals (i.e., decoder input signals) and inverts the dynamics of the encoding system to directly reconstruct the original encoder input signals.

  14. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, Jonathan D.; Scott-Craig, John S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

  15. Polynucleotides encoding TRF1 binding proteins


    Campisi, Judith; Kim, Sahn-Ho


    The present invention provides a novel telomere associated protein (Trf1-interacting nuclear protein 2 "Tin2") that hinders the binding of Trf1 to its specific telomere repeat sequence and mediates the formation of a Tin2-Trf1-telomeric DNA complex that limits telomerase access to the telomere. Also included are the corresponding nucleic acids that encode the Tin2 of the present invention, as well as mutants of Tin2. Methods of making, purifying and using Tin2 of the present invention are described. In addition, drug screening assays to identify drugs that mimic and/or complement the effect of Tin2 are presented.

  16. Encoded libraries of chemically modified peptides.


    Heinis, Christian; Winter, Greg


    The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries.

  17. DNA sequences encoding osteoinductive products

    SciTech Connect

    Wang, E.A.; Wozney, J.M.; Rosen, V.


    This patent describes an isolated DNA sequence encoding an osteoinductive protein the DNA sequence comprising a coding sequence. It comprises: nucleotide No.1 through nucleotide No.387, nucleotide No.356 through nucleotide No.1543, nucleotide $402 through nucleotide No.1626, naturally occurring allelic sequences and equivalent degenerative codon sequences and sequences which hybridize to any of sequences under stringent hybridization conditions; and encode a protein characterized by the ability to induce the formation of bone and/or cartilage.

  18. Sequence of the bphD gene encoding 2-hydroxy-6-oxo-(phenyl/chlorophenyl)hexa-2,4-dienoic acid (HOP/cPDA) hydrolase involved in the biphenyl/polychlorinated biphenyl degradation pathway in Comamonas testosteroni: evidence suggesting involvement of Ser112 in catalytic activity.


    Ahmad, D; Fraser, J; Sylvestre, M; Larose, A; Khan, A; Bergeron, J; Juteau, J M; Sondossi, M


    The nucleotide sequence of bphD, encoding 2-hydroxy-6-oxo-(phenyl/chlorophenyl)hexa-2,4-dienoic acid hydrolase involved in the biphenyl/polychlorinated biphenyl degradation pathway of Comamonas testosteroni strain B-356, was determined. Comparison of the deduced amino-acid sequence with published sequences led to the identification of a 'lipase box', containing a consensus pentapeptide sequence GlyXaaSerXaaGly. This suggested that the mechanism of action of this enzyme may involve an Asp-Ser-His catalytic triad similar to that of classical lipases and serine hydrolases. Further biochemical and genetic evidence for the active-site involvement of Ser112 was obtained by showing that a semipurified enzyme was inhibited by PMSF, a classic inhibitor of serine hydrolases, and by site-directed Ser112-->Ala mutagenesis.

  19. Neutron encoded labeling for peptide identification.


    Rose, Christopher M; Merrill, Anna E; Bailey, Derek J; Hebert, Alexander S; Westphall, Michael S; Coon, Joshua J


    Metabolic labeling of cells using heavy amino acids is most commonly used for relative quantitation; however, partner mass shifts also detail the number of heavy amino acids contained within the precursor species. Here, we use a recently developed metabolic labeling technique, NeuCode (neutron encoding) stable isotope labeling with amino acids in cell culture (SILAC), which produces precursor partners spaced ~40 mDa apart to enable amino acid counting. We implement large scale counting of amino acids through a program, "Amino Acid Counter", which determines the most likely combination of amino acids within a precursor based on NeuCode SILAC partner spacing and filters candidate peptide sequences during a database search using this information. Counting the number of lysine residues for precursors selected for MS/MS decreases the median number of candidate sequences from 44 to 14 as compared to an accurate mass search alone (20 ppm). Furthermore, the ability to co-isolate and fragment NeuCode SILAC partners enables counting of lysines in product ions, and when the information is used, the median number of candidates is reduced to 7. We then demonstrate counting leucine in addition to lysine results in a 6-fold decrease in search space, 43 to 7, when compared to an accurate mass search. We use this scheme to analyze a nanoLC-MS/MS experiment and demonstrate that accurate mass plus lysine and leucine counting reduces the number of candidate sequences to one for ~20% of all precursors selected, demonstrating an ability to identify precursors without MS/MS analysis.

  20. Neutron Encoded Labeling for Peptide Identification

    PubMed Central

    Rose, Christopher M.; Merrill, Anna E.; Bailey, Derek J.; Hebert, Alexander S.; Westphall, Michael S.; Coon, Joshua J.


    Metabolic labeling of cells using heavy amino acids is most commonly used for relative quantitation; however, partner mass shifts also detail the number of heavy amino acids contained within the precursor species. Here, we use a recently developed metabolic labeling technique, NeuCode (neutron encoding) stable isotope labeling with amino acids in cell culture (SILAC), which produces precursor partners spaced ~40 mDa apart to enable amino acid counting. We implement large scale counting of amino acids through a program, “Amino Acid Counter”, which determines the most likely combination of amino acids within a precursor based on NeuCode SILAC partner spacing and filters candidate peptide sequences during a database search using this information. Counting the number of lysine residues for precursors selected for MS/MS decreases the median number of candidate sequences from 44 to 14 as compared to an accurate mass search alone (20 ppm). Furthermore, the ability to co-isolate and fragment NeuCode SILAC partners enables counting of lysines in product ions, and when the information is used, the median number of candidates is reduced to 7. We then demonstrate counting leucine in addition to lysine results in a 6-fold decrease in search space, 43 to 7, when compared to an accurate mass search. We use this scheme to analyze a nanoLC-MS/MS experiment and demonstrate that accurate mass plus lysine and leucine counting reduces the number of candidate sequences to one for ~20% of all precursors selected, demonstrating an ability to identify precursors without MS/MS analysis. PMID:23638792

  1. Omega-3 fatty acids and cardiovascular disease.


    Jain, A P; Aggarwal, K K; Zhang, P-Y


    Cardioceuticals are nutritional supplements that contain all the essential nutrients including vitamins, minerals, omega-3-fatty acids and other antioxidants like a-lipoic acid and coenzyme Q10 in the right proportion that provide all round protection to the heart by reducing the most common risks associated with the cardiovascular disease including high low-density lipoprotein cholesterol and triglyceride levels and factors that contribute to coagulation of blood. Omega-3 fatty acids have been shown to significantly reduce the risk for sudden death caused by cardiac arrhythmias and all-cause mortality in patients with known coronary heart disease. Omega-3 fatty acids are also used to treat hyperlipidemia and hypertension. There are no significant drug interactions with omega-3 fatty acids. The American Heart Association recommends consumption of two servings of fish per week for persons with no history of coronary heart disease and at least one serving of fish daily for those with known coronary heart disease. Approximately 1 g/day of eicosapentaenoic acid plus docosahexaenoic acid is recommended for cardio protection. Higher dosages of omega-3 fatty acids are required to reduce elevated triglyceride levels (2-4 g/day). Modest decreases in blood pressure occur with significantly higher dosages of omega-3 fatty acids.

  2. Multidimensionally encoded magnetic resonance imaging.


    Lin, Fa-Hsuan


    Magnetic resonance imaging (MRI) typically achieves spatial encoding by measuring the projection of a q-dimensional object over q-dimensional spatial bases created by linear spatial encoding magnetic fields (SEMs). Recently, imaging strategies using nonlinear SEMs have demonstrated potential advantages for reconstructing images with higher spatiotemporal resolution and reducing peripheral nerve stimulation. In practice, nonlinear SEMs and linear SEMs can be used jointly to further improve the image reconstruction performance. Here, we propose the multidimensionally encoded (MDE) MRI to map a q-dimensional object onto a p-dimensional encoding space where p > q. MDE MRI is a theoretical framework linking imaging strategies using linear and nonlinear SEMs. Using a system of eight surface SEM coils with an eight-channel radiofrequency coil array, we demonstrate the five-dimensional MDE MRI for a two-dimensional object as a further generalization of PatLoc imaging and O-space imaging. We also present a method of optimizing spatial bases in MDE MRI. Results show that MDE MRI with a higher dimensional encoding space can reconstruct images more efficiently and with a smaller reconstruction error when the k-space sampling distribution and the number of samples are controlled.

  3. In situ localization of the genetic locus encoding the lysosomal acid lipase/cholesteryl esterase (LIPA) deficient in wolman disease to chromosome 10q23. 2-q23. 3

    SciTech Connect

    Anderson, R.A.; Rao, N.; Byrum, R.S.; Rothschild, C.B.; Bowden, D.W.; Hayworth, R.; Pettenati, M. )


    Human acid lipase/cholesteryl esterase (EC is a 46-kDa glycoprotein required for the lysosomal hydrolysis of cholesteryl esters and triglycerides that cells acquire through the receptor-mediated endocytosis of low-density lipoproteins. This activity is essential in the provision of free cholesterol for cell metabolism as well as for the feedback signal that modulates endogenous cellular cholesterol production. The extremely low level of lysosomal acid lipase in patients afflicted with the hereditary, allelic lysosomal storage disorders Woman disease (WD) and cholesteryl ester storage disease (CESD) (MIM Number 278000 (6)) is associated with the massive intralysosomal lipid storage and derangements in the regulation of cellular cholesterol production (10). Both WD and CESD cells lack a specific acid lipase isoenzyme and it is thought that the different mutations associated with WD and CESD are in the structural gene for this isoenzyme, LIPA. Analysis of the activity of the acid lipase isoenzyme in cell extracts from human-Chinese hamster somatic cell hybrids (4, 11) demonstrated the concordant segregation of the gene locus for lysosomal acid lipase with the glutamate oxaloacetate transaminase-1 (GOT1) enzyme marker for human chromosome 10 which was subsequently localized to 10q24.1 q25.1 (8). 11 refs., 1 figs.

  4. Polypeptides having xylanase activity and polynucleotides encoding same

    SciTech Connect

    Tang, Lan; Liu, Ye; Duan, Junxin; Hanshu, Ding


    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Polypeptides having beta-glucosidase activity and polynucleotides encoding same

    SciTech Connect

    Morant, Marc


    The present invention relates to isolated polypeptides having beta-glucosidase activity, beta-xylosidase, or beta-glucosidase activity and isolated polynucleotides encoding polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same

    SciTech Connect

    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having xylanase activity and polynucleotides encoding same

    SciTech Connect

    Lopez de Leon, Alfredo; Rey, Michael


    The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping


    The present invention relates to isolated p