Sample records for encoding lipoic acid

  1. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail


    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  2. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun


    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  3. Inhibitory effect of lipoic acid on firefly luciferase bioluminescence.


    Niwa, Kazuki; Ohmiya, Yoshihiro


    Lipoic acid was found to inhibit the firefly luciferin-luciferase reaction. The inhibition is competitive and is the strongest known (Ki = 0.026 +/- 0.013 microM) compared with other reported inhibitors. Considering the structure-activity correlations, the mechanism of inhibition may originate from the sulfur atom and carboxyl moiety of lipoic acid giving it structural specificity. Subsequent addition of lipoic acid and nitric oxide accelerated the inhibition in vitro, suggesting that lipoic acid may have a functional role in regulating firefly bioluminescence.

  4. R-lipoic acid inhibits mammalian pyruvate dehydrogenase kinase.


    Korotchkina, Lioubov G; Sidhu, Sukhdeep; Patel, Mulchand S


    The four pyruvate dehydrogenase kinase (PDK) and two pyruvate dehydrogenase phosphatase (PDP) isoenzymes that are present in mammalian tissues regulate activity of the pyruvate dehydrogenase complex (PDC) by phosphorylation/dephosphorylation of its pyruvate dehydrogenase (E1) component. The effect of lipoic acids on the activity of PDKs and PDPs was investigated in purified proteins system. R-lipoic acid, S-lipoic acid and R-dihydrolipoic acid did not significantly affect activities of PDPs and at the same time inhibited PDKs to different extents (PDK1>PDK4 approximately PDK2>PDK3 for R-LA). Since lipoic acids inhibited PDKs activity both when reconstituted in PDC and in the presence of E1 alone, dissociation of PDK from the lipoyl domains of dihydrolipoamide acetyltransferase in the presence of lipoic acids is not a likely explanation for inhibition. The activity of PDK1 towards phosphorylation sites 1, 2 and 3 of E1 was decreased to the same extent in the presence of R-lipoic acid, thus excluding protection of the E1 active site by lipoic acid from phosphorylation. R-lipoic acid inhibited autophosphorylation of PDK2 indicating that it exerted its effect on PDKs directly. Inhibition of PDK1 by R-lipoic acid was not altered by ADP but was decreased in the presence of pyruvate which itself inhibits PDKs. An inhibitory effect of lipoic acid on PDKs would result in less phosphorylation of E1 and hence increased PDC activity. This finding provides a possible mechanism for a glucose (and lactate) lowering effect of R-lipoic acid in diabetic subjects. PMID:15512796

  5. Mitochondrial acyl carrier protein is involved in lipoic acid synthesis in Saccharomyces cerevisiae.


    Brody, S; Oh, C; Hoja, U; Schweizer, E


    The yeast gene, ACP1, encoding the mitochondrial acyl carrier protein, was deleted by gene replacement. The resulting acp1-deficient mutants had only 5-10% of the wild-type lipoic acid content remaining, and exhibited a respiratory-deficient phenotype. Upon meiosis, the lipoate deficiency co-segregated with the acp1 deletion. The role of ACP1 in long-chain fatty acid synthesis was studied in fast and fas2 null mutants completely lacking cytoplasmic fatty acid synthase. When grown on odd-chain (13:0 and 15:0) fatty acids, these cells showed less than 1% of C-16 and C-18 acids in their total lipids. Mitochondrial ACP is therefore suggested to be involved with the biosynthesis of octanoate, a precursor to lipoic acid. PMID:9187370

  6. Lipoic acid functionalized amino acids cationic lipids as gene vectors.


    Su, Rong-Chuan; Liu, Qiang; Yi, Wen-Jing; Zheng, Li-Ting; Zhao, Zhi-Gang


    A series of reducible cationic lipids 4a-4f with different amino acid polar-head groups were prepared. The novel lipid contains a hydrophobic lipoic acid (LA) moiety, which can be reduced under reductive conditions to release of the encapsulated plasmid DNA. The particle size, zeta potential and cellular uptake of lipoplexes formed with DNA, as well as the transfection efficacy (TE) were characterized. The TE of the cationic lipid based on arginine was especially high, and was 2.5times higher than that of a branched polyethylenimine in the presence of 10% serum.

  7. Physicochemical Profiling of α-Lipoic Acid and Related Compounds.


    Mirzahosseini, Arash; Szilvay, András; Noszál, Béla


    Lipoic acid, the biomolecule of vital importance following glycolysis, shows diversity in its thiol/disulfide equilibria and also in its eight different protonation forms of the reduced molecule. In this paper, lipoic acid, lipoamide, and their dihydro derivatives were studied to quantify their solubility, acid-base, and lipophilicity properties at a submolecular level. The acid-base properties are characterized in terms of six macroscopic, 12 microscopic protonation constants, and three interactivity parameters. The species-specific basicities, the pH-dependent distribution of the microspecies, and lipophilicity parameters are interpreted by various intramolecular effects, and contribute to understanding the antioxidant, chelate-forming, and enzyme cofactor behavior of the molecules observed. PMID:27272749

  8. Physicochemical Profiling of α-Lipoic Acid and Related Compounds.


    Mirzahosseini, Arash; Szilvay, András; Noszál, Béla


    Lipoic acid, the biomolecule of vital importance following glycolysis, shows diversity in its thiol/disulfide equilibria and also in its eight different protonation forms of the reduced molecule. In this paper, lipoic acid, lipoamide, and their dihydro derivatives were studied to quantify their solubility, acid-base, and lipophilicity properties at a submolecular level. The acid-base properties are characterized in terms of six macroscopic, 12 microscopic protonation constants, and three interactivity parameters. The species-specific basicities, the pH-dependent distribution of the microspecies, and lipophilicity parameters are interpreted by various intramolecular effects, and contribute to understanding the antioxidant, chelate-forming, and enzyme cofactor behavior of the molecules observed.

  9. Enantioselective Pharmacokinetics of α-Lipoic Acid in Rats.


    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi


    α-Lipoic acid (LA) is widely used for nutritional supplements as a racemic mixture, even though the R enantiomer is biologically active. After oral administration of the racemic mixture (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA) mixed at the ratio of 50:50) to rats, RLA showed higher plasma concentration than SLA, and its area under the plasma concentration-time curve from time zero to the last (AUC) was significantly about 1.26 times higher than that of SLA. However, after intravenous administration of the racemic mixture, the pharmacokinetic profiles, initial concentration (C₀), AUC, and half-life (T1/2) of the enantiomers were not significantly different. After oral and intraduodenal administration of the racemic mixture to pyrolus-ligated rats, the AUCs of RLA were significantly about 1.24 and 1.32 times higher than that of SLA, respectively. In addition, after intraportal administration the AUC of RLA was significantly 1.16 times higher than that of SLA. In conclusion, the enantioselective pharmacokinetics of LA in rats arose from the fraction absorbed multiplied by gastrointestinal availability (FaFg) and hepatic availability (Fh), and not from the total clearance.

  10. Enantioselective Pharmacokinetics of α-Lipoic Acid in Rats

    PubMed Central

    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi


    α-Lipoic acid (LA) is widely used for nutritional supplements as a racemic mixture, even though the R enantiomer is biologically active. After oral administration of the racemic mixture (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA) mixed at the ratio of 50:50) to rats, RLA showed higher plasma concentration than SLA, and its area under the plasma concentration-time curve from time zero to the last (AUC) was significantly about 1.26 times higher than that of SLA. However, after intravenous administration of the racemic mixture, the pharmacokinetic profiles, initial concentration (C0), AUC, and half-life (T1/2) of the enantiomers were not significantly different. After oral and intraduodenal administration of the racemic mixture to pyrolus-ligated rats, the AUCs of RLA were significantly about 1.24 and 1.32 times higher than that of SLA, respectively. In addition, after intraportal administration the AUC of RLA was significantly 1.16 times higher than that of SLA. In conclusion, the enantioselective pharmacokinetics of LA in rats arose from the fraction absorbed multiplied by gastrointestinal availability (FaFg) and hepatic availability (Fh), and not from the total clearance. PMID:26402669

  11. Fatal non-accidental alpha-lipoic acid intoxication in an adolescent girl.


    Hadzik, B; Grass, H; Mayatepek, E; Daldrup, T; Hoehn, T


    The aim of our report is to increase awareness that the antioxidant alpha-lipoic acid, which is marketed primarily as weight loss and energy supplement, has potentially lethal effects. A 14-year-old girl ingested in suicidal intention a large amount of alpha-lipoic acid, which led to multiorgan failure and subsequent death within 24 h. Multiorgan failure consisted of decreased myocardial contractility, seizures, anuria, thrombocytopenia, and coagulopathy. Therapy consisted of ventilation, anticonvulsive treatment and circulatory support with high-dose catecholamines. According to alpha-lipoic acid serum levels following ingestion the girl must have ingested a minimum of 10 alpha-lipoic acid tablets of 600 mg each. This is the first report on a fatal case of alpha-lipoic acid ingestion, which is intended to inform physicians, pharmacists and patients about critical side effects of this allegedly innocuous drug.

  12. Lipoic acid synthetase deficiency causes neonatal-onset epilepsy, defective mitochondrial energy metabolism, and glycine elevation.


    Mayr, Johannes A; Zimmermann, Franz A; Fauth, Christine; Bergheim, Christa; Meierhofer, David; Radmayr, Doris; Zschocke, Johannes; Koch, Johannes; Sperl, Wolfgang


    Lipoic acid is an essential prosthetic group of four mitochondrial enzymes involved in the oxidative decarboxylation of pyruvate, α-ketoglutarate, and branched chain amino acids and in the glycine cleavage. Lipoic acid is synthesized stepwise within mitochondria through a process that includes lipoic acid synthetase. We identified the homozygous mutation c.746G>A (p.Arg249His) in LIAS in an individual with neonatal-onset epilepsy, muscular hypotonia, lactic acidosis, and elevated glycine concentration in plasma and urine. Investigation of the mitochondrial energy metabolism showed reduced oxidation of pyruvate and decreased pyruvate dehydrogenase complex activity. A pronounced reduction of the prosthetic group lipoamide was found in lipoylated proteins.

  13. Effects of two antioxidants; α-lipoic acid and fisetin against diabetic cataract in mice.


    Kan, Emrah; Kiliçkan, Elif; Ayar, Ahmet; Çolak, Ramis


    The purpose of this study was to determine whether α-lipoic acid and fisetin have protective effects against cataract in a streptozotocin-induced experimental cataract model. Twenty-eight male BALB/C mice were made diabetic by the intraperitoneal administration of streptozotocin (200 mg/kg). Three weeks after induction of diabetes, mice were divided randomly into 4 groups in which each group contained 7 mice; fisetin-treated group (group 1), α-lipoic acid-treated group (group 2), fisetin placebo group (group 3), α-lipoic acid placebo group (group 4). Fisetin and α-lipoic acid were administered intraperitoneally weekly for 5 weeks. Cataract development was assessed at the end of 8 weeks by slit lamp examination, and cataract formation was graded using a scale. All groups developed at least grade 1 cataract formation. In the fisetin-treated group, the cataract stages were significantly lower than in the placebo group (p = 0.02). In the α-lipoic acid-treated group, the cataract stages were lower than in the placebo group but it did not reach to a significant value. Both fisetin and α-lipoic acid had a protective effect on cataract development in a streptozotocin-induced experimental cataract model. The protective effect of fisetin appears as though more effective than α-lipoic acid.

  14. HPLC-methods for determination of lipoic acid and its reduced form in human plasma.


    Teichert, J; Preiss, R


    A method has been developed for the HPLC analysis of lipoic acid and its reduced form (dihydrolipoic acid) in biological samples. Both substances are released from the samples by enzymatic hydrolysis and extracted by solid phase column. The extracts, after evaporation, were chromatographed and quantified by electrochemical detection. The basic level was in the range 1-25 ng/ml for lipoic acid and 33-145 ng/ml for dihydrolipoic acid (6 healthy volunteers).

  15. Alpha-lipoic acid treatment of acetaminophen-induced rat liver damage.


    Mahmoud, Y I; Mahmoud, A A; Nassar, G


    Acetaminophen (paracetamol) is a well-tolerated analgesic and antipyretic drug when used at therapeutic doses. Overdoses, however, cause oxidative stress, which leads to acute liver failure. Alpha lipoic acid is an antioxidant that has proven effective for ameliorating many pathological conditions caused by oxidative stress. We evaluated the effect of alpha lipoic acid on the histological and histochemical alterations of liver caused by an acute overdose of acetaminophen in rats. Livers of acetaminophen-intoxicated rats were congested and showed centrilobular necrosis, vacuolar degeneration and inflammatory cell infiltration. Necrotic hepatocytes lost most of their carbohydrates, lipids and structural proteins. Liver sections from rats pre-treated with lipoic acid showed fewer pathological changes; the hepatocytes appeared moderately vacuolated with moderate staining of carbohydrates and proteins. Nevertheless, alpha lipoic acid at the dose we used did not protect the liver fully from acetaminophen-induced acute toxicity. PMID:26179071

  16. Alpha-lipoic acid treatment of acetaminophen-induced rat liver damage.


    Mahmoud, Y I; Mahmoud, A A; Nassar, G


    Acetaminophen (paracetamol) is a well-tolerated analgesic and antipyretic drug when used at therapeutic doses. Overdoses, however, cause oxidative stress, which leads to acute liver failure. Alpha lipoic acid is an antioxidant that has proven effective for ameliorating many pathological conditions caused by oxidative stress. We evaluated the effect of alpha lipoic acid on the histological and histochemical alterations of liver caused by an acute overdose of acetaminophen in rats. Livers of acetaminophen-intoxicated rats were congested and showed centrilobular necrosis, vacuolar degeneration and inflammatory cell infiltration. Necrotic hepatocytes lost most of their carbohydrates, lipids and structural proteins. Liver sections from rats pre-treated with lipoic acid showed fewer pathological changes; the hepatocytes appeared moderately vacuolated with moderate staining of carbohydrates and proteins. Nevertheless, alpha lipoic acid at the dose we used did not protect the liver fully from acetaminophen-induced acute toxicity.

  17. Lipoic acid nanoparticles: effect of polymeric stabilizer on appetite suppression.


    Park, Chul Ho; Lee, Ki-Up; Park, Joong-Yeol; Koh, Eun-Hee; Kim, Hyoun-Sik; Lee, Jonghwi


    Alpha-lipoic acid (ALA), which is common in the human body, is efficacious in appetite suppression. However, its typical formulations of salt or micronized crystals cannot satisfy the desired bioavailability requirements for appetite suppression due to low absorption and a short plasma half-life. Herein, we describe a new ALA nanoparticulate formulation produced by nano-comminution using polymeric stabilizers, such as hydroxypropyl cellulose, Pluronic F127, and polyvinylpyrrolidone. Nanoparticles of similar sizes did not show any remarkable differences in the in vitro release profiles. However, the in vivo results from food intake studies in mice demonstrated that the hydroxypropyl cellulose case had the largest improved efficacy among the three polymeric stabilizer cases. Compared to the nanosuspension formulations, the powder formulations of nanoparticles had improved efficacy in reducing food intake for six hours, possibly because of the delayed release kinetics. Therefore, the ALA powder formulation of nanoparticles is a candidate to replace the current formulations to achieve proper appetite suppression.

  18. Mitochondrial lipoic acid scavenging is essential for Plasmodium berghei liver stage development.


    Deschermeier, Christina; Hecht, Leonie-Sophie; Bach, Frauke; Rützel, Katharina; Stanway, Rebecca R; Nagel, Andreas; Seeber, Frank; Heussler, Volker T


    Lipoic acid is an essential cofactor for enzymes that participate in key metabolic pathways in most organisms. While in mammalian cells lipoylated proteins reside exclusively in the mitochondria, apicomplexan parasites of the genus Plasmodium harbour two independent lipoylation pathways in the mitochondrion and the apicoplast, a second organelle of endosymbiotic origin. Protein lipoylation in the apicoplast relies on de novo lipoic acid synthesis while lipoylation of proteins in the mitochondrion depends on scavenging of lipoic acid from the host cell. Here, we analyse the impact of lipoic acid scavenging on the development of Plasmodium berghei liver stage parasites. Treatment of P. berghei-infected HepG2 cells with the lipoic acid analogue 8-bromo-octanoic acid (8-BOA) abolished lipoylation of mitochondrial enzyme complexes in the parasite while lipoylation of apicoplast proteins was not affected. Parasite growth as well as the ability of the parasites to successfully complete liver stage development by merosome formation were severely impaired but not completely blocked by 8-BOA. Liver stage parasites were most sensitive to 8-BOA treatment during schizogony, the phase of development when the parasite grows and undergoes extensive nuclear division to form a multinucleated syncytium. Live cell imaging as well as immunofluorescence analysis and electronmicroscopy studies revealed a close association of both host cell and parasite mitochondria with the parasitophorous vacuole membrane suggesting that host cell mitochondria might be involved in lipoic acid uptake by the parasite from the host cell.

  19. Antidiabetic effect of the α-lipoic acid γ-cyclodextrin complex.


    Naito, Yuki; Ikuta, Naoko; Nakata, Daisuke; Terao, Keiji; Matsumoto, Kinuyo; Kajiwara, Naemi; Okano, Ayaka; Yasui, Hiroyuki; Yoshikawa, Yutaka


    In recent years, the number of patients suffering from diabetes mellitus has been increasing worldwide. In particular, type 2 diabetes mellitus, a lifestyle-related disease, is recognized as a serious disease with various complications. Many types of pharmaceutics or specific health foods have been used for the management of diabetes mellitus. At the same time, the relationship between diabetes mellitus and α-lipoic acid has been recognized for many years. In this study, we found that the α-lipoic acid γ-cyclodextrin complex exhibited an HbA1c lowering effect for treating type 2 diabetes mellitus in animal models. Moreover, in this study, we investigated the activation of phosphorylation of AMP-activated protein kinase, which plays a role in cellular energy homeostasis, in the liver of KKA(y) mice by using α-lipoic acid and the α-lipoic acid γ-cyclodextrin complex. Our results show that the α-lipoic acid γ-cyclodextrin complex strongly induced the phosphorylation of AMP-activated protein kinase. Thus, we concluded that intake of the α-lipoic acid γ-cyclodextrin complex exerted an antidiabetic effect by suppressing the elevation of postprandial hyperglycemia as well as doing exercise.

  20. Lipoic Acid Glyco-Conjugates, a New Class of Agents for Controlling Nonspecific Adsorption of Blood Serum at Bio-interfaces for Biosensor and Biomedical Applications

    PubMed Central

    Wang, Yanyan; El-Boubbou, Kheireddine; Kouyoumdjian, Hovig; Sun, Bin; Huang, Xuefei; Zeng, Xiangqun


    The carbohydrate-derived lipoic acid derivatives were studied as protein and cell resistant biomaterials. Six types of carbohydrates were examined for their abilities to reduce nonspecific adsorption of human serum and Hela cell using quartz crystal microbalance. Our data suggested that the structures of carbohydrates play an important role in resisting nonspecific binding. Specifically, the resistance was found to increase in the order of: lipoic fucose < lipoic mannose < lipoic N-acetyl glucosamine < lipoic glucose < lipoic sialic acid < lipoic galactose, where lipoic galactose derivative resisted most nonspecific adsorption. Furthermore, the combination of lipoic galactose and BSA was the most effective in reducing the adsorption of even undiluted human serum and the attachment of Hela cells while allowing specific binding. Several control experiments have demonstrated that the resistant-ability of mixed lipoic galactose and BSA was comparable to the best known system for decreasing nonspecific adsorption. PMID:19968241

  1. Lipoic Acid Exerts Antioxidant and Anti-inflammatory Effects in Response to Heat Shock in C2C12 Myotubes.


    Lee, Cheng-Tse; Chang, Li-Ching; Wu, Pei-Fung


    This study explored that lipoic acid treatment for 24 h significantly upregulated and promoted heat shock-induced catalase expression and downregulated GPx1 messenger RNA (mRNA) expression, indicating that lipoic acid exhibits antioxidant activity in the decomposition of hydrogen peroxide by upregulating catalase expression. Moreover, lipoic acid treatment for 3 h increased and promoted heat shock-induced interleukin (IL)-6 mRNA and protein levels and that for 24 h downregulated IL-6 mRNA expression, suggesting a dual effect of lipoic acid on IL-6 regulation. Lipoic acid alone failed to increase or reduce tumor necrosis factor (TNF)-α mRNA and protein levels, whereas heat shock alone downregulated TNF-α mRNA and protein expression. These data suggest that lipoic acid does not have a proinflammatory role and that heat shock acts as an anti-inflammatory agent by downregulating TNF-α expression in C2C12 myotubes. Moreover, lipoic acid or heat shock alone upregulated the IL-6 receptor (IL-6R-α) and glycoprotein 130 (gp130) mRNA expression followed by IL-6 expression; these data indicate that the regulation of lipoic acid or heat shock is mediated by IL-6R signaling, thus suggesting that C2C12 myotubes possesses a mechanism for regulating IL-6R and gp130 expression following lipoic acid treatment or heat shock.

  2. Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

    PubMed Central

    Alonzo, Francis


    To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental



    Morawin, B; Turowski, D; Naczk, M; Siatkowski, I; Zembron-Lacny, A


    The generation of reactive nitrogen/oxygen species (RN/OS) represents an important mechanism in erythropoietin (EPO) expression and skeletal muscle adaptation to physical and metabolic stress. RN/OS generation can be modulated by intense exercise and nutrition supplements such as α-lipoic acid, which demonstrates both anti- and pro-oxidative action. The study was designed to show the changes in the haematological response through the combination of α-lipoic acid intake with running eccentric exercise. Sixteen healthy young males participated in the randomised and placebo-controlled study. The exercise trial involved a 90-min run followed by a 15-min eccentric phase at 65% VO2max (-10% gradient). It significantly increased serum concentrations of nitric oxide (NO), hydrogen peroxide (H2O2) and pro-oxidative products such as 8-isoprostanes (8-iso), lipid peroxides (LPO) and protein carbonyls (PC). α-Lipoic acid intake (Thiogamma: 1200 mg daily for 10 days prior to exercise) resulted in a 2-fold elevation of serum H2O2 concentration before exercise, but it prevented the generation of NO, 8-iso, LPO and PC at 20 min, 24 h, and 48 h after exercise. α-Lipoic acid also elevated serum EPO level, which highly correlated with NO/H2O2 ratio (r = 0.718, P < 0.01). Serum total creatine kinase (CK) activity, as a marker of muscle damage, reached a peak at 24 h after exercise (placebo 732 ± 207 IU · L(-1), α-lipoic acid 481 ± 103 IU · L(-1)), and correlated with EPO (r = 0.478, P < 0.01) in the α-lipoic acid group. In conclusion, the intake of high α-lipoic acid modulates RN/OS generation, enhances EPO release and reduces muscle damage after running eccentric exercise.

  4. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid.


    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna


    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1-10 μmol L(-1). Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5-50 μmol L(-1). Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  5. Analysis of Reaction between α-Lipoic Acid and 2-Chloro-1-methylquinolinium Tetrafluoroborate Used as a Precolumn Derivatization Technique in Chromatographic Determination of α-Lipoic Acid

    PubMed Central

    Godlewska, Magdalena; Odachowska, Angelika; Turkowicz, Monika; Karpinska, Joanna


    The present study offers results of analysis concerning the course of reaction between reduced α-lipoic acid (LA) and 2-chloro-1-methylquinolinium tetrafluoroborate (CMQT). In water environments, the reaction between CMQT and hydrophilic thiols proceeds very rapidly and the resultant products are stable. For the described analysis, optimum reaction conditions, such as concentration of the reducing agent, environment pH, and concentration of the reagent were carefully selected. The spectrophotometric assay was carried out measuring absorbance at λ = 348 nm (i.e., the spectral band of the obtained reaction product). Furthermore, the calibration curve of lipoic acid was registered. It was concluded that the Lambert-Beer law was observed within the range 1–10 μmol L−1. Later, the reaction between LA and CMQT was used as precolumn derivatization in a chromatographic determination of the lipoic acid in the range 2.5–50 μmol L−1. Practical applicability of the designed methods was evaluated by determining lipoic acid in Revitanerv pharmaceutical preparation which contains 300 mg LA in a single capsule. The error of the determination did not exceed 0.5% in relation to the declared value. PMID:26504616

  6. Impact evaluation of α-lipoic acid in gamma-irradiated erythrocytes

    NASA Astrophysics Data System (ADS)

    Desouky, Omar S.; Selim, Nabila S.; Elbakrawy, Eman M.; Rezk, Rezk A.


    This work is intended to study in vitro the ability of lipoic acid to protect erythrocytes against the oxidative damage resulting from exposure to gamma radiation through measurement of their rheological properties and to study the effects of detergent on their membrane solubility and permeability. Different doses of gamma radiation were applied: the most recommended and applied dose (25 Gy), and two higher doses, namely 50 and 100 Gy. The effect of addition of lipoic acid as well as its effect as a radioprotector was tested. The obtained results show changes in structural integrity of the erythrocyte cell membrane components as a result of oxidative damage due to gamma radiation that could be improved by pre-treatment with the antioxidant lipoic acid.

  7. Wheat germ oil and α-lipoic acid predominantly improve the lipid profile of broiler meat.


    Arshad, Muhammad Sajid; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Shahid, Muhammad


    In response to recent assertions that synthetic antioxidants may have the potential to cause toxic effects and to consumers' increased attention to consuming natural products, the poultry industry has been seeking sources of natural antioxidants, alone or in combination with synthetic antioxidants that are currently being used by the industry. The present study was conducted to determine the effect of α-lipoic acid, α-tocopherol, and wheat germ oil on the status of antioxidant enzymes, fatty acid profile, and serum biochemical profile of broiler blood. One-day-old (180) broiler birds were fed six different feeds varying in their antioxidant content: no addition (T1), natural α-tocopherol (wheat germ oil, T2), synthetic α-tocopherol (T3), α-lipoic acid (T4), α-lipoic acid together with natural α-tocopherol (T5), and α-lipoic acid together with synthetic α-tocopherol (T6). The composition of saturated and unsaturated fatty acids in the breast and leg meat was positively influenced by the different dietary supplements. The content of fatty acid was significantly greater in broilers receiving T2 both in breast (23.92%) and in leg (25.82%) meat, whereas lower fatty acid levels was found in broilers receiving diets containing T6 in the breast (19.57%) and leg (21.30%) meat. Serum total cholesterol (113.42 mg/dL) and triglycerides (52.29 mg/dL) were lowest in the group given natural α-tocopherol and α-lipoic acid. Wheat germ oil containing natural α-tocopherol alone or with α-lipoic acid was more effective than synthetic α-tocopherol in raising levels of antioxidant enzymes superoxide dismutase, catalase, and glutathione reductase while lowering plasma total cholesterol, low-density lipoprotein, and triglycerides and raising high-density lipoprotein and plasma protein significantly. It was concluded that the combination of wheat germ oil and α-lipoic acid is helpful in improving the lipid profile of broilers. PMID:24191686

  8. Comparison of the Protective Effects of Radix Astragali, α-Lipoic Acid, and Vitamin E on Acute Acoustic Trauma

    PubMed Central

    Xiong, Min; Lai, Huangwen; Yang, Chuanhong; Huang, Weiyi; Wang, Jian; Fu, Xiaoyan; He, Qinglian


    Objective Oxidative damage is a critical role which involves hearing loss induced by impulse noise. That exogenous antioxidant agents reduce noise induced hearing loss (NIHL) has been well demonstrated in both animal studies and clinical practices. Choosing a stronger and more effective antioxidant is very important for treatment of NIHL. Vitamin E, α-lipoic acid, and radix astragali are the most commonly used anti-oxidants for cochlear oxidative damage from acoustic trauma. In this study, the protective effects of radix astragali, α-lipoic acid, and vitamin E on acute acoustic trauma are investigated. Methods Guinea pigs in the experimental groups were intragastrically administered vitamin E, α-lipoic acid, and radix astragali. Auditory thresholds were assessed by sound-evoked auditory brainstem response (ABR) at click and tone bursts of 8, 16 and 32 kHz, 24 hours before and 72 hours after exposure to impulse noise. Cochlear malondialdehyde (MDA) concentrations were detected. Hair cell damage was analyzed by scanning electron microscopy. Results Vitamin E, α-lipoic acid, and radix astragali significantly reduced ABR deficits, reduced hair cell damage, and decreased the concentrations of MDA. α-lipoic acid and radix astragali were better than vitamin E, and there were no significant differences between α-lipoic acid and radix astragali. Conclusions α-lipoic acid or radix astragali are recommended for treatment of NIHL. PMID:24179406

  9. Neuroprotection of lipoic acid treatment promotes angiogenesis and reduces the glial scar formation after brain injury.


    Rocamonde, B; Paradells, S; Barcia, J M; Barcia, C; García Verdugo, J M; Miranda, M; Romero Gómez, F J; Soria, J M


    After trauma brain injury, a large number of cells die, releasing neurotoxic chemicals into the extracellular medium, decreasing cellular glutathione levels and increasing reactive oxygen species that affect cell survival and provoke an enlargement of the initial lesion. Alpha-lipoic acid is a potent antioxidant commonly used as a treatment of many degenerative diseases such as multiple sclerosis or diabetic neuropathy. Herein, the antioxidant effects of lipoic acid treatment after brain cryo-injury in rat have been studied, as well as cell survival, proliferation in the injured area, gliogenesis and angiogenesis. Thus, it is shown that newborn cells, mostly corresponded with blood vessels and glial cells, colonized the damaged area 15 days after the lesion. However, lipoic acid was able to stimulate the synthesis of glutathione, decrease cell death, promote angiogenesis and decrease the glial scar formation. All those facts allow the formation of new neural tissue. In view of the results herein, lipoic acid might be a plausible pharmacological treatment after brain injury, acting as a neuroprotective agent of the neural tissue, promoting angiogenesis and reducing the glial scar formation. These findings open new possibilities for restorative strategies after brain injury, stroke or related disorders.

  10. Circulating irisin and glucose metabolism in overweight/obese women: effects of α-lipoic acid and eicosapentaenoic acid.


    Huerta, A E; Prieto-Hontoria, P L; Fernández-Galilea, M; Sáinz, N; Cuervo, M; Martínez, J A; Moreno-Aliaga, M J


    Irisin is a myokine/adipokine with potential role in obesity and diabetes. The objectives of the present study were to analyse the relationship between irisin and glucose metabolism at baseline and during an oral glucose tolerance test (OGTT) and to determine the effects of eicosapentaenoic acid (EPA) and/or α-lipoic acid treatment on irisin production in cultured human adipocytes and in vivo in healthy overweight/obese women following a weight loss program. Seventy-three overweight/obese women followed a 30% energy-restricted diet supplemented without (control) or with EPA (1.3 g/day), α-lipoic acid (0.3 g/day) or both EPA + α-lipoic acid (1.3 + 0.3 g/day) during 10 weeks. An OGTT was performed at baseline. Moreover, human adipocytes were treated with EPA (100-200 μM) or α-lipoic acid (100-250 μM) during 24 h. At baseline plasma, irisin circulating levels were positively associated with glucose levels; however, serum irisin concentrations were not affected by the increment in blood glucose or insulin during the OGTT. Treatment with α-lipoic acid (250 μM) upregulated Fndc5 messenger RNA (mRNA) and irisin secretion in cultured adipocytes. In overweight/obese women, irisin circulating levels decreased significantly after weight loss in all groups, while no additional differences were induced by EPA or α-lipoic acid supplementation. Moreover, plasma irisin levels were positively associated with higher glucose concentrations at beginning and at endpoint of the study. The data from the OGTT suggest that glucose is not a direct contributing factor of irisin release. The higher irisin levels observed in overweight/obese conditions could be a protective response of organism to early glucose impairments.

  11. The importance of 1,2-dithiolane structure in α-lipoic acid for the downregulation of cell surface β1-integrin expression of human bladder cancer cells.


    Yamasaki, Masao; Soda, Shozen; Sakakibara, Yoichi; Suiko, Masahito; Nishiyama, Kazuo


    Here, we show that cell surface β1-integrin expression, cell adhesion to fibronectin, migration, and invasion were all significantly inhibited by α-lipoic acid. These effects were not observed when cells were treated with dihydrolipoic acid or caprylic acid. These data reveal that the 1,2-dithiolane structure plays an important role in the action of α-lipoic acid.

  12. Lipoic acid protects against reperfusion injury in the early stages of cerebral ischemia.


    Connell, Barry J; Saleh, Monique; Khan, Bobby V; Saleh, Tarek M


    Lipoic acid (LA) is a known antioxidant currently used as a therapy in patients with vascular and metabolic disorders. We tested the hypothesis that lipoic acid is protective against the cell death observed following stroke. Lipoic acid was administered 30minutes prior to, or immediately following removal of sutures used to occlude the middle cerebral artery (MCA) in male Sprague-Dawley rats. Following removal of the sutures, the MCA territory was allowed to undergo 5.5hrs of reperfusion. This ischemia/reperfusion (I/R) resulted in a focal infarct restricted to the prefrontal cortex (24±3mm(3)). Pretreatment with LA 30minutes prior to occlusion resulted in a dose-dependent reduction in infarct volume. This reduction in infarct volume was not observed when the LA was administered immediately prior to reperfusion (30minutes post-occlusion). To investigate a potential hemodynamic mechanism for this LA-induced neuroprotection, blood pressure, heart rate and baroreceptor reflex sensitivity (BRS) were measured. Intravenous administration of LA did not result in any significant changes in any of these parameters compared to saline-treated rats. Similarly, there was no significant contribution of systemic nitric oxide or alteration in cerebral perfusion measured following pretreatment with lipoic acid or during the course of occlusion and reperfusion compared with saline-treated rats. Western blot analysis of tissue from the ischemic cortex showed an increase in protein expression of superoxide dismutase (SOD2), but not SOD1, in LA pretreated rats. This suggests a potential mechanism of action contributing to the LA-induced neuroprotection observed. Furthermore, the data in the present investigation suggest the potential use of LA pretreatment as a neuroprotectant in stroke patients. PMID:21172313

  13. Modulatory effects of lipoic acid and selenium against cadmium-induced biochemical alterations in testicular steroidogenesis.


    El-Maraghy, Shohda A; Nassar, Noha N


    Exposure to toxic metals including cadmium has become an increasingly recognized source of illness worldwide. Cadmium (Cd(2+) ) is one of the environmental pollutants affecting various tissues and organs including testis. The protective effect of lipoic acid and selenium on Cd(2+) -induced testicular damage was investigated. Accordingly, male Wistar rats were allocated into four groups (n = 8; each). Gp I: (control), whereas the other 3 groups received CdCl(2) (2 mg/kg, i.p. for 28 days) alone or in combination with either (i) lipoic acid (35 mg/kg, p.o) or (ii) selenium (0.35 mg/kg, p.o) throughout the experiment. Serum testosterone, luteinizing hormone and follicle-stimulating hormone levels significantly decreased in the Cd(2+) -exposed rats. The activities of testicular key androgenic enzymes, 3β-hydroxysteroid dehydrogenase and 17 β-HSD significantly decreased in Cd(2) exposed rats compared to the control counterparts. In addition, the activities of testicular marker enzymes were significantly altered in cadmium-treated animals. Significant reductions in body and testicular weight as well as antioxidant status were also observed in Cd(2+) -exposed rats. Moreover, some testicular metal levels were altered. Lipoic acid and selenium significantly increased serum testosterone level and restored testicular activity of 3β-HSD and 17 β-HSD and were effective in modulation of most of the measured biochemical parameters. The biochemical parameters were further confirmed with histopathological findings. In conclusion, the present study demonstrated the beneficial influences of lipoic acid and selenium in reducing harmful effects of Cd(2+) in rats' testes. PMID:20957662

  14. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha-lipoic acid (ALA) is known as a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar sperm and the antioxidant effect of ALA on boar sperm during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0, and 10.0, mg/m...

  15. Investigation of Enantioselective Membrane Permeability of α-Lipoic Acid in Caco-2 and MDCKII Cell.


    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi


    α-Lipoic acid (LA) contains a chiral carbon and exists as two enantiomers (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA)). We previously demonstrated that oral bioavailability of RLA is better than that of SLA. This difference arose from the fraction absorbed multiplied by gastrointestinal availability (F(a) × F(g)) and hepatic availability (F(h)) in the absorption phase. However, it remains unclear whether F(a) and/or F(g) are involved in enantioselectivity. In this study, Caco-2 cells and Madin-Darby canine kidney strain II cells were used to assess the enantioselectivity of membrane permeability. LA was actively transported from the apical side to basal side, regardless of the differences in its steric structure. Permeability rates were proportionally increased in the range of 10-250 µg LA/mL, and the permeability coefficient did not differ significantly between enantiomers. Hence, we conclude that enantioselective pharmacokinetics arose from the metabolism (F(h) or F(g) × F(h)), and definitely not from the membrane permeation (F(a)) in the absorption phase.

  16. Investigation of Enantioselective Membrane Permeability of α-Lipoic Acid in Caco-2 and MDCKII Cell

    PubMed Central

    Uchida, Ryota; Okamoto, Hinako; Ikuta, Naoko; Terao, Keiji; Hirota, Takashi


    α-Lipoic acid (LA) contains a chiral carbon and exists as two enantiomers (R-α-lipoic acid (RLA) and S-α-lipoic acid (SLA)). We previously demonstrated that oral bioavailability of RLA is better than that of SLA. This difference arose from the fraction absorbed multiplied by gastrointestinal availability (Fa × Fg) and hepatic availability (Fh) in the absorption phase. However, it remains unclear whether Fa and/or Fg are involved in enantioselectivity. In this study, Caco-2 cells and Madin–Darby canine kidney strain II cells were used to assess the enantioselectivity of membrane permeability. LA was actively transported from the apical side to basal side, regardless of the differences in its steric structure. Permeability rates were proportionally increased in the range of 10–250 µg LA/mL, and the permeability coefficient did not differ significantly between enantiomers. Hence, we conclude that enantioselective pharmacokinetics arose from the metabolism (Fh or Fg × Fh), and definitely not from the membrane permeation (Fa) in the absorption phase. PMID:26821014

  17. Protective activity of hesperidin and lipoic acid against sodium arsenite acute toxicity in mice.


    das Neves, Ricardo N Pires; Carvalho, Félix; Carvalho, Márcia; Fernandes, Eduarda; Soares, Elisa; de Bastos, Maria Lourdes; de Pereira, Maria Lourdes


    The objective of the present work was to evaluate the toxic effects of sodium arsenite, As(III), in mice and the protective effect of 2 antioxidants, hesperidin and lipoic acid, against the observed As(III)-induced toxicity. In each study, mice were assigned to 1 of 4 groups: control, antioxidant, antioxidant + arsenite, and arsenite. Animals were first injected with the vehicle or 25 mg antioxidant/kg BW. After 30 minutes they received an injection of 10 mg arsenite/kg BW or 0.9% NaCl. Two hours after the first injection, the liver, kidney, and testis were collected for histological evaluation. Liver samples were also taken for quantification of arsenic. In mice exposed only to As(III), various histopathological effects were observed in the liver, kidneys, and testes. In mice pretreated with either hesperidin or lipoic acid, a reduction of histopathologic effects on the liver and kidneys was observed. No protective effects were observed in the testes for either of the 2 studied antioxidants. In conclusion, hesperidin and lipoic acid provided protective effects against As(III)-induced acute toxicity in the liver and kidneys of mice. These compounds may potentially play an important role in the protection of populations chronically exposed to arsenic.

  18. Alpha-lipoic acid as a pleiotropic compound with potential therapeutic use in diabetes and other chronic diseases.


    Gomes, Marilia Brito; Negrato, Carlos Antonio


    Alpha-lipoic acid is a naturally occurring substance, essential for the function of different enzymes that take part in mitochondria's oxidative metabolism. It is believed that alpha-lipoic acid or its reduced form, dihydrolipoic acid have many biochemical functions acting as biological antioxidants, as metal chelators, reducers of the oxidized forms of other antioxidant agents such as vitamin C and E, and modulator of the signaling transduction of several pathways. These above-mentioned actions have been shown in experimental studies emphasizing the use of alpha-lipoic acid as a potential therapeutic agent for many chronic diseases with great epidemiological as well economic and social impact such as brain diseases and cognitive dysfunctions like Alzheimer disease, obesity, nonalcoholic fatty liver disease, burning mouth syndrome, cardiovascular disease, hypertension, some types of cancer, glaucoma and osteoporosis. Many conflicting data have been found concerning the clinical use of alpha-lipoic acid in the treatment of diabetes and of diabetes-related chronic complications such as retinopathy, nephropathy, neuropathy, wound healing and diabetic cardiovascular autonomic neuropathy. The most frequent clinical condition in which alpha-lipoic acid has been studied was in the management of diabetic peripheral neuropathy in patients with type 1 as well type 2 diabetes. Considering that oxidative stress, a imbalance between pro and antioxidants with excessive production of reactive oxygen species, is a factor in the development of many diseases and that alpha-lipoic acid, a natural thiol antioxidant, has been shown to have beneficial effects on oxidative stress parameters in various tissues we wrote this article in order to make an up-to-date review of current thinking regarding alpha-lipoic acid and its use as an antioxidant drug therapy for a myriad of diseases that could have potential benefits from its use.

  19. Alpha-lipoic acid as a pleiotropic compound with potential therapeutic use in diabetes and other chronic diseases.


    Gomes, Marilia Brito; Negrato, Carlos Antonio


    Alpha-lipoic acid is a naturally occurring substance, essential for the function of different enzymes that take part in mitochondria's oxidative metabolism. It is believed that alpha-lipoic acid or its reduced form, dihydrolipoic acid have many biochemical functions acting as biological antioxidants, as metal chelators, reducers of the oxidized forms of other antioxidant agents such as vitamin C and E, and modulator of the signaling transduction of several pathways. These above-mentioned actions have been shown in experimental studies emphasizing the use of alpha-lipoic acid as a potential therapeutic agent for many chronic diseases with great epidemiological as well economic and social impact such as brain diseases and cognitive dysfunctions like Alzheimer disease, obesity, nonalcoholic fatty liver disease, burning mouth syndrome, cardiovascular disease, hypertension, some types of cancer, glaucoma and osteoporosis. Many conflicting data have been found concerning the clinical use of alpha-lipoic acid in the treatment of diabetes and of diabetes-related chronic complications such as retinopathy, nephropathy, neuropathy, wound healing and diabetic cardiovascular autonomic neuropathy. The most frequent clinical condition in which alpha-lipoic acid has been studied was in the management of diabetic peripheral neuropathy in patients with type 1 as well type 2 diabetes. Considering that oxidative stress, a imbalance between pro and antioxidants with excessive production of reactive oxygen species, is a factor in the development of many diseases and that alpha-lipoic acid, a natural thiol antioxidant, has been shown to have beneficial effects on oxidative stress parameters in various tissues we wrote this article in order to make an up-to-date review of current thinking regarding alpha-lipoic acid and its use as an antioxidant drug therapy for a myriad of diseases that could have potential benefits from its use. PMID:25104975

  20. Inhibition of Pseudomonas aeruginosa biofilm formation by 2,2’-bipyridyl, lipoic, kojic and picolinic acids

    PubMed Central

    Çevik, Kübra; Ulusoy, Seyhan


    Objective(s): The inhibitory effects of iron chelators, and FeCl3 chelation on biofilm formation and swarming motility were investigated against an opportunistic human pathogen Pseudomonas aeruginosa. Materials and Methods: The inhibitory activity of 2,2’-bipyridyl, lipoic acid, kojic acid and picolinic acid on biofilm formation of P. aeruginosa strain PAO1 and three clinical isolates (P. aeruginosa PAK01, P. aeruginosa PAK02 and P. aeruginosa PAK03) were investigated, based on crystal violet assay, and swarming motility test. Results: The kojic, lipoic and picolinic acid inhibited biofilm formation by 5-33% in all tested P. aeruginosa isolates. When chelated iron was added, biofilm inhibition rates were determined to be 39-57%. Among the tested chelators against P. aeruginosa, lipoic acid (84%) and kojic acid (68%) presented the highest inhibition of swarming motility. This is the first study to report the inhibitory effect of lipoic acid on biofilm formation and swarming motility of P. aeruginosa. Conclusion: It is considered that lipoic and picolinic acids can serve as alternatives for the treatment of the P. aeruginosa infections by inhibiting biofilm formation. PMID:26557964

  1. Alleviative effects of α-lipoic acid supplementation on acute heat stress-induced thermal panting and the level of plasma nonesterified fatty acids in hypothyroid broiler chickens.


    Hamano, Y


    1. The present study was conducted to examine the effects of α-lipoic acid on hypothyroidism-induced negative growth performance and whether α-lipoic acid alleviates acute heat stress in relation to hypothyroid status. 2. Female broiler chickens (14 d-old) were fed diets supplemented with α-lipoic acid (100 mg/kg) and an antithyroid substance, propylthiouracil (200 mg/kg), for 20 d under thermoneutral conditions (25°C). At 42 d of age, chickens were exposed to a high ambient temperature (36°C, 60% RH) for 4 h. 3. Under the thermoneutral condition, propylthiouracil administration decreased feed efficiency and concomitantly increased adipose tissue and thyroid gland weights. Plasma nonesterified fatty acids and triacylglycerol were also increased by propylthiouracil administration. However, α-lipoic acid supplementation did not affect the hypothyroidism-induced effects. 4. In hypothyroid chickens, the rise in respiratory rate induced by heat exposure was greatly inhibited by α-lipoic acid administration at 1 h, but this effect had disappeared at 4 h. In addition, a similar inhibitory effect on the concentrations of plasma nonesterified fatty acids was subsequently observed at 4 h. 5. Therefore, the present study suggested that α-lipoic acid alleviates acute heat stress if chickens are in a hypothyroid status.

  2. [Alpha-lipoic acid triggers elimination of cells with abnormal nuclei in human carcinoma epidermoid cell line].


    Kisurina-Evgen'eva, O P; Onishchenko, G E


    The skin is usually exposed to adverse environmental conditions that may cause pathological cell proliferation and cellular transformations leading to the formation of malignant cells. Antioxidants may affect these processes and induce the elimination of transformed cell. The purpose of this work was to investigate the effect of alfa-lipoic acid on human carcinoma epidermoid cell line A431. Our results showed that alfa-lipoic acid induced inhibition of cell proliferation or stimulated apoptotic cell death. Cells with abnormal nuclei were eliminated by apoptosis. Electron microscopy showed that survived cells had typical for control cells shape and organization of the nuclei, organization of the cytoplasm and organelles. Thus, alfa-lipoic acid not only triggered apoptosis of carcinoma cells, but it may also activate the mechanism of elimination of cells with abnormal chromosome number.

  3. Lipoic acid reduces inflammation in a mouse focal cortical experimental autoimmune encephalomyelitis model.


    Chaudhary, Priya; Marracci, Gail; Galipeau, Danielle; Pocius, Edvinas; Morris, Brooke; Bourdette, Dennis


    Cortical lesions are a crucial part of MS pathology and it is critical to determine that new MS therapies have the ability to alter cortical inflammatory lesions given the differences between white and gray matter lesions. We tested lipoic acid (LA) in a mouse focal cortical EAE model. Brain sections were stained with antibodies against CD4, CD11b and galectin-3. Compared with vehicle, treatment with LA significantly decreased CD4+ and galectin-3+ immune cells in the brain. LA treated mice had fewer galectin-3+ cells with no projections indicating decrease in the number of infiltrating monocytes. LA significantly reduces inflammation in a focal cortical model of MS. PMID:26616873

  4. Lipoic acid as a potential first agent for protection from mycotoxins and treatment of mycotoxicosis.


    Rogers, Sherry A


    Mycotoxins--toxic substances produced by fungi or molds--are ubiquitous in the environment and are capable of damaging multiple biochemical mechanisms, resulting in a variety of human symptoms referred to collectively as "mycotoxicosis." In fact, mycotoxins mimic multiple xenobiotics, not only with respect to their ultimate damage, but also in their routes of detoxification. This suggests potential therapeutic options for the challenging treatment of mycotoxicosis. In this brief review, the author examines the use of lipoic acid as an example of an inexpensive and available nutrient that has been shown to protect against, or reverse, the adverse health effects of mycotoxins. PMID:15259433

  5. Physiological and Histopathological Investigations on the Effects of α-Lipoic Acid in Rats Exposed to Malathion

    PubMed Central

    Al-Attar, Atef M.


    The present study was designed to evaluate the influence of α-lipoic acid treatment in rats exposed to malathion. Forty adult male rats were used in this study and distributed into four groups. Animals of group 1 were untreated and served as control. Rats of group 2 were orally given malathion at a dose level of 100 mg/kg body weight (BW) for a period of one month. Experimental animals of group 3 were orally given α-lipoic acid at a dose level of 20 mg/kg BW and after 3 hours exposed to malathion at the same dose given to group 2. Rats of group 4 were supplemented with α-lipoic acid at the same dose given to group 3. The activities of serum glutamic oxaloacetic acid transaminase (GOT), glutamic pyruvic acid transaminase (GPT), alkaline phosphatase (ALP), and acid phosphatase (ACP), and the values of creatinine, urea, and uric acid were statistically increased, while the values of total protein and total albumin were significantly decreased in rats exposed to malathion. Moreover, administration of malathion for one month resulted in damage of liver and kidney structures. Administration of α-lipoic acid before malathion exposure to rat can prevent severe alterations of hematobiochemical parameters and disruptions of liver and kidney structures. In conclusion, this study obviously demonstrated that pretreatment with α-lipoic acid significantly attenuated the physiological and histopathological alterations induced by malathion. Also, the present study identifies new areas of research for development of better therapeutic agents for liver, kidney, and other organs' dysfunctions and diseases. PMID:20454535

  6. Alpha lipoic acid efficacy in burning mouth syndrome. A controlled clinical trial

    PubMed Central

    Palacios-Sánchez, Begoña; Cerero-Lapiedra, Rocío; Llamas-Martínez, Silvia; Esparza-Gómez, Germán


    Background A double-blind placebo-controlled trial was conducted in order to evaluate the efficacy of alpha lipoic acid (ALA) and determine the statistical significance of the outcome variables. Burning mouth syndrome (BMS) is defined as an oral burning sensation in the absence of clinical signs which could justify the syndrome. Recent studies suggest the existence of neurological factors as a possible cause of the disease. Material and Methods 60 patients with BMS, in two groups: case group with 600 mg/day and placebo as control group; with follow up of 2 months. Results 64% of ALA patients reported some level of improvement, with a level of maintenance of 68.75% one month after treatment. 27.6% of the placebo group also demonstrated some reduction in BMS symptoms. Conclusions Long-term evolution and the intensity of symptoms are variables that reduce the probability of improvement with ALA treatment. Key words: Burning mouth syndrome, neuropathy, alpha lipoic acid. PMID:26034927

  7. Lipoic Acid: its antioxidant and anti-inflammatory role and clinical applications.


    Moura, Fabiana Andréa; de Andrade, Kívia Queiroz; dos Santos, Juliana Célia Farias; Goulart, Marília Oliveira Fonseca


    Lipoic acid (LA) is an antioxidant able to produce its effects in aqueous or lipophilic environments. Lipoate is the conjugate base of lipoic acid, and the most prevalent form of LA under physiological conditions. It presents a highly negative reduction potential, increases the expression of antioxidant enzymes and participates in the recycling of vitamins C and E. Due to these properties, LA is called the "universal antioxidant". LA is also involved with anti-inflammatory action, independently of its antioxidant activity. This review was carried out, aiming to identify, analyze, and rationalize the various clinical, physiopathological and/or physiological situations in which LA, through oral supplementation, was tested on human and animal (rats and mice) models. LA was mainly tested in cardiovascular diseases (CVD), obesity, pain, inflammatory diseases and aging. LA uses in CVD and obesity, in humans, are controversial. On the other hand, beneficial effects on inflammation and pain were observed. LA supplementation in animal models may prolong life, has neuroprotective effects and presents positive effects against cancer. Differences observed in human and animal models can be due, in part, to different treatments (LA combined with other antioxidants, different doses) and to the variety of biomarkers investigated in animal experiments. These results suggest the need for further clinical trials to guide health professionals regarding the safety of prescription of this supplement.

  8. Preparation of aqueous alpha-lipoic acid dispersions with octenylsuccinylated high amylose starch.


    Li, Yi-Xuan; Lim, Seung-Taik


    Aqueous dispersions prepared with OSA-modified high amylose starch were investigated in comparison with native high amylose starch and beta-cyclodextrin using alpha-lipoic acid as a model substance. Alpha-lipoic acid (ALA), a lipophilic antioxidant essential for energy metabolism in human, was dispersed in gelatinized starch solutions (1.0% w/v) at different temperatures (50-90°C) and times (3-12h). High amylose starch modified with 3% OSA (dry starch base) was most favored in maximizing the dispersibility of ALA (84% recovery) under mild heating (70°C for 3h). The optimally prepared dispersion was milky white and contained particles with a narrow size distribution (200-300nm). The precipitate isolated from the dispersion contained crystalline V-complexes of ALA and amylose while the supernatant contained free ALA accounting for 1/3 of total ALA, indicating OSA-modified high amylose starch stabilized ALA either by complexing with amylose or by retarding aggregation of ALA.

  9. Preparation of aqueous alpha-lipoic acid dispersions with octenylsuccinylated high amylose starch.


    Li, Yi-Xuan; Lim, Seung-Taik


    Aqueous dispersions prepared with OSA-modified high amylose starch were investigated in comparison with native high amylose starch and beta-cyclodextrin using alpha-lipoic acid as a model substance. Alpha-lipoic acid (ALA), a lipophilic antioxidant essential for energy metabolism in human, was dispersed in gelatinized starch solutions (1.0% w/v) at different temperatures (50-90°C) and times (3-12h). High amylose starch modified with 3% OSA (dry starch base) was most favored in maximizing the dispersibility of ALA (84% recovery) under mild heating (70°C for 3h). The optimally prepared dispersion was milky white and contained particles with a narrow size distribution (200-300nm). The precipitate isolated from the dispersion contained crystalline V-complexes of ALA and amylose while the supernatant contained free ALA accounting for 1/3 of total ALA, indicating OSA-modified high amylose starch stabilized ALA either by complexing with amylose or by retarding aggregation of ALA. PMID:26876852

  10. Alpha-lipoic acid prevents endotoxic shock and multiple organ dysfunction syndrome induced by endotoxemia in rats.


    Shen, Hsin-Hsueh; Lam, Kwok-Keung; Cheng, Pao-Yun; Kung, Ching-Wen; Chen, Shu-Ying; Lin, Pei-Chiang; Chung, Ming-Ting; Lee, Yen-Mei


    Alpha-lipoic acid (ALA), a naturally occurring disulfide derivative of octanoic acid, serves as a strong antioxidant and has been reported to possess anti-inflammatory effects. The aim of the present study is to investigate the preventive and therapeutic effects of ALA on multiple organ dysfunction syndrome (MODS) caused by endotoxemia in rats. Male Wistar rats were intravenously infused with lipopolysaccharide (LPS) (10 mg/kg) to induce endotoxemia. Alpha-lipoic acid 10, 20, or 40 mg/kg was administered intravenously 60 min before (pretreatment) LPS challenge, and ALA 40 mg/kg was administered intravenously 30 min after (posttreatment) LPS challenge. Pretreatment and posttreatment with ALA significantly improved the deleterious hemodynamic changes 8 h after LPS challenge, including hypotension and bradycardia. Alpha-lipoic acid reduced the plasma levels of glutamic pyruvic transaminase, blood urea nitrogen, lactate dehydrogenase, tumor necrosis factor-α, nitric oxide metabolites, and thrombin-antithrombin complex, which increased markedly after LPS challenge. The induction of inducible nitric oxide synthase both in the liver and the lung and vascular superoxide anion production were also significantly suppressed by ALA. Moreover, ALA significantly attenuated LPS-induced caspase-3 activation in cardiomyocytes and improved survival rate. In conclusion, ALA effectively attenuated LPS-induced acute inflammatory response and improved MODS. The antioxidant and anti-inflammatory effects of ALA may contribute to these beneficial effects. Alpha-lipoic acid might be considered as a novel therapeutic strategy in the prevention of sepsis-induced MODS and inflammatory vascular diseases.

  11. Alteration of fatty acid profile and nucleotide-related substances in post-mortem breast meat of α-lipoic acid-fed broiler chickens.


    Hamano, Y


    The present study was conducted to determine the effects of α-lipoic acid supplementation on post-mortem changes in the fatty acid profile and concentrations of nucleotide-related substances, especially those of a taste-active compound, inosine 5'-monophosphate, in chicken meat. Mixed-sex broiler chicks aged 14 d were divided into three groups of 16 birds each and were fed on diets supplemented with α-lipoic acid at levels of 0, 100 or 200 mg/kg for 4 weeks. Blood and breast muscle samples were taken at 42 d of age under the fed condition and then after fasting for 18 h. The breast muscle obtained from fasted chickens was subsequently refrigerated at 2°C for one and 3 d. α-Lipoic acid supplementation did not affect any plasma metabolite concentration independently of feeding condition, while a slight increase in plasma glucose concentration was shown with both administration levels of α-lipoic acid. In early post-mortem breast muscle under the fed condition, α-lipoic acid had no effect on concentrations of fatty acids or nucleotides of ATP, ADP, and AMP. In post-mortem breast tissues obtained from fasted chickens, total fatty acid concentrations were markedly increased by α-lipoic acid feeding at 200 mg/kg irrespective of length of refrigeration. This effect was dependent on stearic acid, oleic acid, linoleic acid and linolenic acid. However, among fatty acids, the only predominantly increased unsaturated fatty acid was oleic acid. Dietary supplementation with α-lipoic acid at 200 mg/kg increased the inosine 5'-monophosphate concentration in breast meat and, in contrast, reduced the subsequent catabolites, inosine and xanthine, regardless of the length of refrigeration. Therefore, the present study suggests that α-lipoic acid administration altered the fatty acid profile and improved meat quality by increasing taste-active substances in the post-mortem meat obtained from fasted chickens.

  12. Vitamin A palmitate and α-lipoic acid stability in o/w emulsions for cosmetic application.


    Moyano, M A; Segall, A


    Skin becomes thin, dry, pale, and finely wrinkled with age. Retinoids are a large class of compounds that are important in modern therapy for dermatological treatment of wrinkled skin. Of the retinoids, retinol and vitamin A palmitate are thought to induce thickening of the epidermis and to be effective for treatment of skin diseases. Accordingly, α-lipoic acid or the reduced form, dihydrolipoate, are potent scavengers of hydroxyl radicals, superoxide radicals, peroxyl radicals, singlet oxygen, and nitric oxide with anti-inflammatory properties (1). Cosmetic ingredient stability prediction relies on kinetic quantitative chemical analysis of active components at different temperatures. Vitamin A palmitate and α-lipoic acid, are known to be unstable to light or heat (2). The aims of this study were to evaluate the stability of α-lipoic acid and vitamin A palmitate in the presence of vitamin E (acetate) and other antioxidants in lipophilic/hydrophilic medium (O/W emulsions) at pH 3.0, 5.0, and 7.0. The formulations that were investigated contained 0.12% (w/w) vitamin A palmitate, 0.4% (w/w) vitamin E acetate, and 0.5 % α-lipoic acid (formulation A), supplemented with ascorbyl palmitate, magnesium ascorbyl phosphate, and vitamin C (formulation B) or with butylhydroxytoluene (BHT, formulation C) or ascorbyl palmitate (formulation D). The chemical analyses of α-lipoic acid and vitamin A palmitate were carried out by HPLC. Formulations C and D at pH 7.0 were selected as the most stable for these components. The purpose of this paper is the selection of the most stable formulations for their application in in vivo studies.

  13. A combination of alpha lipoic acid and calcium hydroxycitrate is efficient against mouse cancer models: preliminary results.


    Schwartz, Laurent; Abolhassani, Mohammad; Guais, Adeline; Sanders, Edward; Steyaert, Jean-Marc; Campion, Frederic; Israël, Maurice


    The impact of metabolic dysregulation on tumor development has long been established. We have targeted two enzymes that are altered during carcinogenesis: pyruvate dehydrogenase (PDH), which is down-regulated, and ATP citrate lyase, which is overexpressed in cancer cells. Alpha lipoic acid is a cofactor of PDH, while hydroxycitrate is a known inhibitor of ATP citrate lyase. Our hypothesis is that a combination of these drugs may have antitumoral potential. The efficacy of these molecules was screened in vitro by treatment of different human cancer and murine cell lines. Lipoic acid reduced the cell number by 10-50% depending on concentrations (0.1-10 microM) and cell types. Calcium hydroxycitrate reduced the cell number by 5-60% at different concentrations (10-500 microM). When hydroxycitrate and lipoic acid were used together, there was a major cytotoxic effect: complete cell death was seen following 8 microM lipoic acid and 300 microM hydroxycitrate treatment for 72 h. The combination of alpha lipoic acid and hydroxycitrate was administered to healthy mice, at doses currently utilized for other indications than cancer; no demonstrable toxicity was observed. The combination was used to treat mouse syngenic cancer models: MBT-2 bladder transitional cell carcinoma, B16-F10 melanoma and LL/2 Lewis lung carcinoma. The efficacy of this combination appears similar to conventional chemotherapy (cisplatin or 5-fluorouracil) as it resulted in significant tumor growth retardation and enhanced survival. This preliminary study suggests that this combination of drugs is efficient against cancer cell proliferation both in vitro and in vivo. A clinical trial is warranted. PMID:20372858

  14. Alpha-lipoic acid prevents 3,4-methylenedioxy-methamphetamine (MDMA)-induced neurotoxicity.


    Aguirre, N; Barrionuevo, M; Ramírez, M J; Del Río, J; Lasheras, B


    A single administration of 3,4-methylenedioxymethamphetamine (MDMA, 20 mg/kg, i.p.), induced significant hyperthermia in rats and reduced 5-hydroxytryptamine (5-HT) content and [3H]paroxetine-labeled 5-HT transporter density in the frontal cortex, striatum and hippocampus by 40-60% 1 week later. MDMA treatment also increased glial fibrillary acidic protein (GFAP) immunoreactivity in the hippocampus. Repeated administration of the metabolic antioxidant alpha-lipoic acid (100 mg/kg, i.p., b.i.d. for 2 consecutive days) 30 min prior to MDMA did not prevent the acute hyperthermia induced by the drug; however, it fully prevented the serotonergic deficits and the changes in the glial response induced by MDMA. These results further support the hypothesis that free radical formation is responsible for MDMA-induced neurotoxicity.

  15. {alpha}-Lipoic acid exhibits anti-amyloidogenicity for {beta}-amyloid fibrils in vitro

    SciTech Connect

    Ono, Kenjiro; Hirohata, Mie; Yamada, Masahito . E-mail:


    Inhibition of the formation of {beta}-amyloid fibrils (fA{beta}), as well as the destabilization of preformed fA{beta} in the CNS would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of {alpha}-lipoic acid (LA) and the metabolic product of LA, dihydrolipoic acid (DHLA), on the formation, extension, and destabilization of fA{beta} at pH 7.5 at 37 {sup o}C in vitro. LA and DHLA dose-dependently inhibited fA{beta} formation from amyloid {beta}-protein, as well as their extension. Moreover, they destabilized preformed fA{beta}s. LA and DHLA could be key molecules for the development of therapeutics for AD.

  16. Effects of α-lipoic acid supplementation on sexual difference of growth performance, heat exposure-induced metabolic response and lipid peroxidation of raw meat in broiler chickens.


    Hamano, Y


    1. The effects of α-lipoic acid administration on sexual differences in growth performance, heat exposure-induced metabolic response and lipid peroxidation of raw meat in broiler chickens were studied. 2. Two-week-old male and female broiler chicks were divided into two groups each, as a 2 × 2 factorial arrangement. Half the birds were fed on a diet supplemented with α-lipoic acid (100 mg/kg) and half on a control diet. All groups were reared to 6 weeks of age at 25°C and, thereafter, exposed to 33°C for 8 h per day for 3 d. 3. Under thermo-neutral conditions, α-lipoic acid decreased feed consumption and body weight gain of male chickens. However, the feed conversion rate and tissue mass of breast muscle and abdominal fat were unchanged. 4. In plasma metabolites, α-lipoic acid increased the molar ratio of non-esterified fatty acids to free glycerol, regardless of sex and heat exposure. A decrease in β-hydroxybutyrate was observed in the α-lipoic acid-fed male chickens. In the heat-exposed chickens, α-lipoic acid lowered the molar ratio of plasma lactate to pyruvate in relation to the enhanced concentrations of plasma pyruvate. However, no sexual difference was observed. 5. The value of thiobarbituric acid reactive substances in breast meat of heat-stressed chickens that was refrigerated for 3 or 7 d was higher in males than in females. An antioxidative effect of α-lipoic acid was observed in the meat of male chickens. 6. The present study suggests that the α-lipoic acid-inducing fatty acid metabolism and antioxidative effect persisted during the heat stress, even though a sexual difference in the responsiveness was seen in broiler chickens.

  17. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.


    Cronan, John E


    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  18. Protective effect of α-lipoic acid against radiation-induced fibrosis in mice

    PubMed Central

    Ryu, Seung-Hee; Park, Eun-Young; Kwak, Sungmin; Heo, Seung-Ho; Ryu, Je-Won; Park, Jin-hong


    Radiation-induced fibrosis (RIF) is one of the most common late complications of radiation therapy. We found that α-lipoic acid (α-LA) effectively prevents RIF. In RIF a mouse model, leg contracture assay was used to test the in vivo efficacy of α-LA. α-LA suppressed the expression of pro-fibrotic genes after irradiation, both in vivo and in vitro, and inhibited the up-regulation of TGF-β1-mediated p300/CBP activity. Thus, α-LA prevents radiation-induced fibrosis (RIF) by inhibiting the transcriptional activity of NF-κB through inhibition of histone acetyltransferase activity. α-LA is a new therapeutic methods that can be used in the prevention-treatment of RIF. PMID:26799284

  19. Protective effect of α-lipoic acid against radiation-induced fibrosis in mice.


    Ryu, Seung-Hee; Park, Eun-Young; Kwak, Sungmin; Heo, Seung-Ho; Ryu, Je-Won; Park, Jin-Hong; Choi, Kyung-Chul; Lee, Sang-Wook


    Radiation-induced fibrosis (RIF) is one of the most common late complications of radiation therapy. We found that α-lipoic acid (α-LA) effectively prevents RIF. In RIF a mouse model, leg contracture assay was used to test the in vivo efficacy of α-LA. α-LA suppressed the expression of pro-fibrotic genes after irradiation, both in vivo and in vitro, and inhibited the up-regulation of TGF-β1-mediated p300/CBP activity. Thus, α-LA prevents radiation-induced fibrosis (RIF) by inhibiting the transcriptional activity of NF-κB through inhibition of histone acetyltransferase activity. α-LA is a new therapeutic methods that can be used in the prevention-treatment of RIF.

  20. Effect of dietary α-lipoic acid on the mRNA expression of genes involved in drug metabolism and antioxidation system in rat liver.


    Ide, Takashi


    In the present study, the mRNA levels of hepatic proteins involved in the drug metabolism of rats fed α-lipoic acid were evaluated by DNA microarray and real-time PCR analyses. Experimental diets containing 0, 0·1, 0·25 and 0·5 % (w/w) α-lipoic acid were fed to four groups of rats consisting of seven animals each for 21 d. DNA microarray analysis revealed that the diet containing 0·5 % α-lipoic acid significantly (P< 0·05) increased the mRNA levels of various phase I drug-metabolising enzymes up to 15-fold and phase II enzymes up to 52-fold in an isoenzyme-specific manner. α-Lipoic acid also up-regulated the mRNA levels of some members of the ATP-binding cassette transporter superfamily, presumed to be involved in the exportation of xenobiotics, up to 6·6-fold. In addition, we observed that α-lipoic acid increased the mRNA levels of many proteins involved in antioxidation, such as members of the thiol redox system (up to 5·5-fold), metallothioneins (up to 12-fold) and haeme oxygenase 1 (1·5-fold). These results were confirmed using real-time PCR analysis, and α-lipoic acid dose dependently increased the mRNA levels of various proteins involved in drug metabolism and antioxidation. Consistent with these observations, α-lipoic acid dose dependently increased the hepatic concentration of glutathione and the activities of glutathione reductase and glutathione transferase measured using 1-chloro-2,4-dinitrobenzene and 1,2-dichloro-4-nitrobenzene as substrates, but decreased the hepatic and serum concentrations of malondialdehyde. In conclusion, the present study unequivocally demonstrated that α-lipoic acid increases the mRNA expression of proteins involved in drug metabolism and antioxidation in the liver.

  1. Evaluation of the protective effect of α-lipoic acid on cisplatin ototoxicity using distortion-product otoacoustic emission measurements: an experimental animal study.


    Ozkul, Yilmaz; Songu, Murat; Basoglu, Mehmet Sinan; Ozturkcan, Sedat; Katilmis, Huseyin


    The aim of our study was to determine the effectiveness of intratympanic α-lipoic acid injection as an otoprotective agent against cisplatin-induced ototoxicity in guinea pigs. Twenty-four adult male albino guinea pigs with normal hearing were divided into 4 groups. The guinea pigs received intraperitoneal cisplatin in group 1, intraperitoneal cisplatin and intratympanic α-lipoic acid in group 2, intratympanic α-lipoic acid in group 3, as well as intraperitoneal cisplatin and intratympanic saline in group 4. Distortion-product otoacoustic emission measurements were obtained for both ears at the following time points: before administration (baseline recording) and on day 3 (72 h later). In group 1 (cisplatin), significant deterioration was observed at all frequencies on day 3 (P < 0.05). In group 2 (cisplatin + α-lipoic acid), deterioration was observed at all frequencies on day 3; however, this deterioration did not reach a statistical significance (P > 0.05). In group 3 (α-lipoic acid), no significant difference was observed between baseline and day 3 (P > 0.05). In group 4 (cisplatin + saline), deterioration was observed at all frequencies on day 3; however, this deterioration did not reach a statistical significance (P > 0.05). Cisplatin-induced hearing loss in the guinea pigs may be limited to some extent by the concomitant use of α-lipoic acid. Dose-dependent changes in the possible effects of α-lipoic acid need further investigation. Future morphologic studies may contribute to expose clearly the protective effect of α-lipoic acid.

  2. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study

    PubMed Central

    Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem


    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion.

  3. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.


    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem


    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  4. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study

    PubMed Central

    Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem


    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion. PMID:27597986

  5. The Protective Effects of Alpha-Lipoic Acid and Coenzyme Q10 Combination on Ovarian Ischemia-Reperfusion Injury: An Experimental Study.


    Tuncer, Ahmet Ali; Bozkurt, Mehmet Fatih; Koken, Tulay; Dogan, Nurhan; Pektaş, Mine Kanat; Baskin Embleton, Didem


    Objective. This study aims to evaluate whether alpha-lipoic acid and/or coenzyme Q10 can protect the prepubertal ovarian tissue from ischemia-reperfusion injury in an experimental rat model of ovarian torsion. Materials and Methods. Forty-two female preadolescent Wistar-Albino rats were divided into 6 equal groups randomly. The sham group had laparotomy without torsion; the other groups had torsion/detorsion procedure. After undergoing torsion, group 2 received saline, group 3 received olive oil, group 4 received alpha-lipoic acid, group 5 received coenzyme Q10, and group 6 received both alpha-lipoic acid and coenzyme Q10 orally. The oxidant-antioxidant statuses of these groups were compared using biochemical measurement of oxidized/reduced glutathione, glutathione peroxidase and malondialdehyde, pathological evaluation of damage and apoptosis within the ovarian tissue, and immunohistochemical assessment of nitric oxide synthase. Results. The left ovaries of the alpha-lipoic acid + coenzyme Q10 group had significantly lower apoptosis scores and significantly higher nitric oxide synthase content than the left ovaries of the control groups. The alpha-lipoic acid + coenzyme Q10 group had significantly higher glutathione peroxidase levels and serum malondialdehyde concentrations than the sham group. Conclusions. The combination of alpha-lipoic acid and coenzyme Q10 has beneficial effects on oxidative stress induced by ischemia-reperfusion injury related to ovarian torsion.

  6. Effect of treatment with the antioxidant alpha-lipoic (thioctic) acid on heart and kidney microvasculature in spontaneously hypertensive rats.


    Tayebati, Seyed Khosrow; Tomassoni, Daniele; Di Cesare Mannelli, Lorenzo; Amenta, Francesco


    Endothelial cells represent an important vascular site of signaling and development of damage during ischemia, inflammation and other pathological conditions. Excessive reactive oxygen species production causes pathological activation of endothelium including exposure of cell to adhesion molecules. Intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and platelet-endothelial cell adhesion molecule-1 (PECAM-1) are members of the immunoglobulin super-family which are present on the surface of endothelial cells. These molecules represent important markers of endothelial inflammation. The present study was designed to investigate, with immunochemical and immunohistochemical techniques, the effect of treatment with (+/-)-alpha lipoic (thioctic) acid and its enantiomers on heart and kidney endothelium in spontaneously hypertensive rats (SHR). Arterial hypertension is accompanied by an increased oxidative stress status in the heart characterized by thiobarbituric acid reactive substances (TBARS) and nucleic acid oxidation increase. The higher oxidative stress also modifies adhesion molecules expression. In the heart VCAM-1, which was higher than ICAM-1 and PECAM-1, was increased in SHR. ICAM-1, VCAM-1 and PECAM-1 expression was significantly greater in the renal endothelium of SHR. (+/-)-Alpha lipoic acid and (+)-alpha lipoic acid treatment significantly decreased TBARS levels, the nucleic acid oxidation and prevented adhesion molecules expression in cardiac and renal vascular endothelium. These data suggest that endothelial molecules may be used for studying the mechanisms of vascular injury on target organs of hypertension. The effects observed after treatment with (+)-alpha lipoic acid could open new perspectives for countering heart and kidney microvascular injury which represent a common feature in hypertensive end-organs damage.

  7. Effect of treatment with the antioxidant alpha-lipoic (thioctic) acid on heart and kidney microvasculature in spontaneously hypertensive rats.


    Tayebati, Seyed Khosrow; Tomassoni, Daniele; Di Cesare Mannelli, Lorenzo; Amenta, Francesco


    Endothelial cells represent an important vascular site of signaling and development of damage during ischemia, inflammation and other pathological conditions. Excessive reactive oxygen species production causes pathological activation of endothelium including exposure of cell to adhesion molecules. Intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and platelet-endothelial cell adhesion molecule-1 (PECAM-1) are members of the immunoglobulin super-family which are present on the surface of endothelial cells. These molecules represent important markers of endothelial inflammation. The present study was designed to investigate, with immunochemical and immunohistochemical techniques, the effect of treatment with (+/-)-alpha lipoic (thioctic) acid and its enantiomers on heart and kidney endothelium in spontaneously hypertensive rats (SHR). Arterial hypertension is accompanied by an increased oxidative stress status in the heart characterized by thiobarbituric acid reactive substances (TBARS) and nucleic acid oxidation increase. The higher oxidative stress also modifies adhesion molecules expression. In the heart VCAM-1, which was higher than ICAM-1 and PECAM-1, was increased in SHR. ICAM-1, VCAM-1 and PECAM-1 expression was significantly greater in the renal endothelium of SHR. (+/-)-Alpha lipoic acid and (+)-alpha lipoic acid treatment significantly decreased TBARS levels, the nucleic acid oxidation and prevented adhesion molecules expression in cardiac and renal vascular endothelium. These data suggest that endothelial molecules may be used for studying the mechanisms of vascular injury on target organs of hypertension. The effects observed after treatment with (+)-alpha lipoic acid could open new perspectives for countering heart and kidney microvascular injury which represent a common feature in hypertensive end-organs damage. PMID:26207883

  8. Oral co-administration of α-lipoic acid, quercetin and captopril prevents gallium arsenide toxicity in rats.


    Bhatt, Kapil; Flora, S J S


    Gallium arsenide (GaAs), an inter-metallic semiconductor, known to exhibit superior optical and electronic properties compared to silicon, promotes its use in semiconductor industries. Extensive use of GaAs will inevitably lead to an increase in the exposure of workers manufacturing these products. Antioxidants are exogenous or endogenous compounds acting in several ways, including scavenging reactive oxygen species (ROS) or their precursors, inhibiting ROS formation, and binding metal ions needed for the catalysis of ROS generation. In the present study we investigated the protective efficacy of α-lipoic acid, quercetin and captopril individually against gallium arsenide exposure. Co-administration of α-lipoic acid with GaAs was most effective in reducing GaAs induced inhibition of blood δ-aminolevulinic acid dehydratase (ALAD) activity, liver, kidney and brain reduced glutathione (GSH) level and elevation of oxidized glutathione (GSSG). Captopril, on the other hand was effective in reducing thiobarbituric acid reactive substance (TBARS) levels, while quercetin reduced ROS in liver and kidney. The results suggest comparatively better preventive efficacy of concomitant α-lipoic acid administration during Gallium arsenide exposure compared to quercetin and captopril in preventing GaAs induced oxidative stress.

  9. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age

    SciTech Connect

    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory


    Highlights: • 24 month old rats were supplemented with 0.2% lipoic acid in the diet for 2 weeks. • Lipoic acid shifts phase of core circadian clock proteins. • Lipoic acid corrects age-induced desynchronized lipid metabolism rhythms. - Abstract: It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks.

  10. Preventive effect of α-lipoic acid on prepulse inhibition deficits in a juvenile two-hit model of schizophrenia.


    Deslauriers, J; Racine, W; Sarret, P; Grignon, S


    Some pathophysiological models of schizophrenia posit that prenatal inflammation sensitizes the developing brain to second insults in early life and enhances brain vulnerability, thereby increasing the risk of developing the disorder during adulthood. We previously developed a two-hit animal model, based on the well-established prenatal immune challenge with poly-inosinic/cytidylic acid (polyI:C), followed by juvenile restraint stress (RS). We observed an additive disruption of prepulse inhibition (PPI) of acoustic startle in juvenile mice submitted to both insults. Previous studies have also reported that oxidative stress is associated with pathophysiological mechanisms of psychiatric disorders, including schizophrenia. We report here that PPI disruption in our two-hit animal model of schizophrenia is associated with an increase in oxidative stress. These findings led us to assess whether α-lipoic acid, an antioxidant, can prevent both increase in oxidative status and PPI deficits in our juvenile in vivo model of schizophrenia. In the offspring submitted to prenatal injection of polyI:C and to RS, treatment with α-lipoic acid prevented the development of PPI deficits 24h after the last period of RS. α-Lipoic acid also improved PPI performance in control mice. The reversal effect of α-lipoic acid pretreatment on these behavioral alterations was further accompanied by a normalization of the associated oxidative status and dopaminergic and GABAergic abnormalities in the prefrontal cortex. Based on our double insult paradigm, these results support the hypothesis that oxidative stress plays an important role in the development of PPI deficits, a well-known behavior associated with schizophrenia. These findings form the basis of future studies aiming to unravel mechanistic insights of the putative role of antioxidants in the treatment of schizophrenia, especially during the prodromal stage.

  11. Effects of an inhibitor of poly(ADP-ribose) polymerase, desmethylselegiline, trientine, and lipoic acid in transgenic ALS mice.


    Andreassen, O A; Dedeoglu, A; Friedlich, A; Ferrante, K L; Hughes, D; Szabo, C; Beal, M F


    The development of transgenic mouse models of amyotrophic lateral sclerosis (ALS) allows the testing of neuroprotective agents. We evaluated the effects of five agents in transgenic mice with the G93A Cu,Zn superoxide dismutase mutation. A novel inhibitor of poly(ADP-ribose) polymerase showed no effects on survival. Desmethylselegiline and CGP3466 are agents that exert antiapoptotic effects in vitro by preventing nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase. They had no significant effects on survival in the G93A mice. Trientine, a copper chelator, produced a modest significant increase in survival. Similarly administration of lipoic acid in the diet produced a significant improvement in survival. These results therefore provide evidence for potential therapeutic effects of copper chelators and lipoic acid in the treatment of ALS.

  12. Self-Assembly of Pyridine-Modified Lipoic Acid Derivatives on Gold and Their Interaction with Thyroxine (T4)

    PubMed Central

    Albers, Willem M.; Milani, Roberto; Tappura, Kirsi; Munter, Tony; Resnati, Giuseppe; Metrangolo, Pierangelo


    Pyridyl derivatives of lipoic acid were prepared as ligands for the study of the interaction with thyroxine (T4). Thin self-assembled films of the ligands were prepared in 70% ethanol on gold and their interaction with T4 was studied by titration experiments in an aqueous buffer solution using Surface Plasmon Resonance (SPR). The thickness and refractive index of the ligand layers were calculated from SPR spectra recorded in two media, also allowing for surface coverage and the density of the layers to be estimated. Two ligands, a 4-pyridyl and a bis(2-hydroxyethyl) derivative of lipoic acid, were selected to investigate the feasibility for producing molecularly imprinted self-assembled layers on gold for T4. The methodology was to co-assemble T4 and the ligand onto the gold surface, elute the T4 from the layer under alkaline conditions, and study the rebinding of T4 to the layer. Multiple elution/rebinding cycles were conducted in different buffer solutions, and rebinding of T4 could be observed, with a moderate binding affinity that depended greatly on the solvent used. More optimal binding was observed in HBS buffer, and the affinity of the interaction could be slightly increased when the 4-pyridyl and bis(2-hydroxy-ethyl) derivatives of lipoic acid were combined in the imprinted layer. PMID:23389045

  13. α-Lipoic acid inhibits sevoflurane-induced neuronal apoptosis through PI3K/Akt signalling pathway.


    Ma, Rong; Wang, Xiang; Peng, Peipei; Xiong, Jingwei; Dong, Hongquan; Wang, Lixia; Ding, Zhengnian


    Sevoflurane is a widely used anaesthetic agent, including in anaesthesia of children and infants. Recent studies indicated that the general anaesthesia might cause the cell apoptosis in the brain. This issue raises the concerns about the neuronal toxicity induced by the application of anaesthetic agents, especially in the infants and young children. In this study, we used Morris water maze, western blotting and immunohistochemistry to elucidate the role of α-lipoic acid in the inhibition of neuronal apoptosis. We found that sevoflurane led to the long-term cognitive impairment in the young rats. This adverse effect may be caused by the neuronal death in the hippocampal region, mediated through PI3K/Akt signalling pathway. We also showed that α-lipoic acid offset the effect of sevoflurane on the neuronal apoptosis and cognitive dysfunction. This study elucidated the potential clinical role of α-lipoic acid, providing a promising way in the prevention and treatment of long-term cognitive impairment induced by sevoflurane general anesthesia.

  14. Effects of combined lipoic acid and pyridoxine on albuminuria, advanced glycation end-products, and blood pressure in diabetic nephropathy.


    Noori, Nazanin; Tabibi, Hadi; Hosseinpanah, Farhad; Hedayati, Mehdi; Nafar, Mohsen


    This study was designed to investigate the effects of combined administration of lipoic acid and pyridoxine on albuminuria, oxidative stress, blood pressure, serum advanced glycation end-products, nitric oxide (NO), and endothelin-1 in patients with diabetic nephropathy. Thirty-four patients were randomly assigned to either a supplement group or a placebo group. The patients in the supplement group received 800 mg lipoic acid and 80 mg pyridoxine daily for 12 weeks, whereas the placebo group received corresponding placebos. Urinary albumin, serum malondialdehyde (MDA), and systolic blood pressure decreased significantly in the supplement group compared to the placebo group (p < 0.05). Serum NO increased in the supplement group compared to the placebo group (p < 0.05). Serum pentosidine and carboxymethyl lysine decreased significantly in the supplement group at the end of week 12 compared to baseline (p < 0.05). No statistically significant differences were observed between the two groups in mean changes of serum endothelin-1, glucose, and diastolic blood pressure. The present study indicates that combined administration of lipoic acid and pyridoxine improves albuminuria in patients with diabetic nephropathy by reducing oxidative stress, advanced glycation end-products, and systolic blood pressure. The reduction in microalbuminuria may be of benefit in retarding the progression of diabetic nephropathy.

  15. alpha-Lipoic acid inhibits inflammatory bone resorption by suppressing prostaglandin E2 synthesis.


    Ha, Hyunil; Lee, Jong-Ho; Kim, Ha-Neui; Kim, Hyun-Man; Kwak, Han Bok; Lee, Seungbok; Kim, Hong-Hee; Lee, Zang Hee


    alpha-Lipoic acid (LA) has been intensely investigated as a therapeutic agent for several pathological conditions, including diabetic polyneuropathy. In the present study, we examined the effects of LA on osteoclastic bone loss associated with inflammation. LA significantly inhibited IL-1-induced osteoclast formation in cocultures of mouse osteoblasts and bone marrow cells, but LA had only a marginal effect on osteoclastogenesis from bone marrow macrophages induced by receptor activator of NF-kappaB ligand (RANKL). LA inhibited both the sustained up-regulation of RANKL expression and the production of PGE2 induced by IL-1 in osteoblasts. In addition, treatment with either prostaglandin E2 (PGE2) or RANKL rescued IL-1-induced osteoclast formation inhibited by LA or NS398, a specific cyclooxygenase-2 (COX-2) inhibitor, in cocultures. LA blocked IL-1-induced PGE2 production even in the presence of arachidonic acid, without affecting the expression of COX-2 and membrane-bound PGE2 synthase. Dihydrolipoic acid (the reduced form of LA), but not LA, attenuated recombinant COX-2 activity in vitro. LA also inhibited osteoclast formation and bone loss induced by IL-1 and LPS in mice. Our results suggest that the reduced form of LA inhibits COX-2 activity, PGE2 production, and sustained RANKL expression, thereby inhibiting osteoclast formation and bone loss in inflammatory conditions.

  16. BACE1 activity impairs neuronal glucose oxidation: rescue by beta-hydroxybutyrate and lipoic acid

    PubMed Central

    Findlay, John A.; Hamilton, David L.; Ashford, Michael L. J.


    Glucose hypometabolism and impaired mitochondrial function in neurons have been suggested to play early and perhaps causative roles in Alzheimer's disease (AD) pathogenesis. Activity of the aspartic acid protease, beta-site amyloid precursor protein (APP) cleaving enzyme 1 (BACE1), responsible for beta amyloid peptide generation, has recently been demonstrated to modify glucose metabolism. We therefore examined, using a human neuroblastoma (SH-SY5Y) cell line, whether increased BACE1 activity is responsible for a reduction in cellular glucose metabolism. Overexpression of active BACE1, but not a protease-dead mutant BACE1, protein in SH-SY5Y cells reduced glucose oxidation and the basal oxygen consumption rate, which was associated with a compensatory increase in glycolysis. Increased BACE1 activity had no effect on the mitochondrial electron transfer process but was found to diminish substrate delivery to the mitochondria by inhibition of key mitochondrial decarboxylation reaction enzymes. This BACE1 activity-dependent deficit in glucose oxidation was alleviated by the presence of beta hydroxybutyrate or α-lipoic acid. Consequently our data indicate that raised cellular BACE1 activity drives reduced glucose oxidation in a human neuronal cell line through impairments in the activity of specific tricarboxylic acid cycle enzymes. Because this bioenergetic deficit is recoverable by neutraceutical compounds we suggest that such agents, perhaps in conjunction with BACE1 inhibitors, may be an effective therapeutic strategy in the early-stage management or treatment of AD. PMID:26483636

  17. Alpha lipoic acid protects the heart against myocardial post ischemia-reperfusion arrhythmias via KATP channel activation in isolated rat hearts.


    Dudek, Magdalena; Knutelska, Joanna; Bednarski, Marek; Nowiński, Leszek; Zygmunt, Małgorzata; Bilska-Wilkosz, Anna; Iciek, Małgorzata; Otto, Monika; Żytka, Iwona; Sapa, Jacek; Włodek, Lidia; Filipek, Barbara


    The cardiovascular effects of alpha lipoic acid were evaluated in isolated rat hearts exposed to ischemia-reperfusion injury in vitro. Alpha-lipoic acid raised the level of sulfane sulfur playing an important role in the release of hydrogen sulfide. H2S was shown to prevent the post-reperfusion arrhythmias and to protect the cardiomyocytes from death caused by hypoxia. The activation of potassium ATP-sensitive channels (K(ATP) channels) is one of the most important mechanisms of action of hydrogen sulfide in the cardiovascular system. The aim of this study was to investigate whether alpha lipoic acid can prevent the occurrence of post-reperfusion arrhythmias in vitro using a Langendorff model of ischemia-reperfusion in rats affecting the K(ATP) channels. Alpha lipoic acid significantly improved post-reperfusion cardiac function (reducing incidence of arrhythmias), especially in a dose of 10(-7)M. These cardiovascular effects of this compound on the measured parameters were reversed by glibenclamide, a selective K(ATP) blocker. Alpha lipoic acid increased the level of sulfane sulfur in the hearts. This may suggest that the positive effects caused by alpha lipoic acid in the cardiovascular system are not only related to its strong antioxidant activity, and the influence on the activity of such enzymes as aldehyde dehydrogenase 2, as previously suggested, but this compound can affect K(ATP) channels. It is possible that this indirect effect of alpha lipoic acid is connected with changes in the release of sulfane sulfur and hydrogen sulfide.

  18. The effects of the antioxidant lipoic acid on beef longissimus bloom time.


    Rentfrow, G; Linville, M L; Stahl, C A; Olson, K C; Berg, E P


    The objective of this study was to evaluate the influence of lipoic acid (LA) on beef LM steak bloom time, as well-as to characterize bloom time in the CIE L*, a*, and b* color space over a 93-min period. Thirty-two Simmental steers were supplemented with LA for 21 d immediately before slaughter at levels of 0, 8, 16, or 24 mg of LA/kg BW (eight steers per treatment). Lipoic acid was mixed with liquid paraffin, allowed to solidify, prilled, and top-dressed over a standard finishing diet. Steers were slaughtered at the University of Missouri abattoir in four groups of eight (two steers per treatment) over a 2-wk period. After a 24-h chill at 4 degrees C, the right LM was removed from each carcass. One 2.54cm steak was removed from the anterior portion of the LM, and its color characteristics (CIE L*, a*, and b*) were measured immediately with a standardized spectrocolorimeter. Color measurements were taken every 3 min thereafter for a total of 93-min. Hue angle (true red) and chroma (color saturation) were calculated from the color measurements. Addition of LA to the diet had no effect on bloom time (P = 0.67). When treatment means were analyzed, the addition of 24 mg of LA/kg BW to the diet resulted in higher (lighter) L* values (P < 0.05) compared with other treatments, whereas the addition of 16 mg of LA/kg BW to the diet caused lower hue angles (more true red; P < 0.05) when compared with other treatments. Addition of LA to the diet did not affect a* (P = 0.13) and b* (P = 0.18) values or chroma (P = 0.62). In the absence of treatment effects, bloom times for all treatments were pooled, and L* values did not change (P > 0.05) during the 93-min bloom time; however, a* and chroma values increased for 9 min and plateaued after 12 min (P < 0.01). Similarly, b* values increased (P < 0.01) for the first 6 min, and after 9 min, no further increase in yellowness was detected. Bloom time had little effect on hue angle, which stabilized after 3 min. Supplementing steers

  19. Is it time to reassess alpha lipoic acid and niacinamide therapy in schizophrenia?


    Seybolt, Sheila E J


    As sulfur containing thiols, alpha lipoic acid (ALA) and its reduced form dihydrolipoic acid (DHLA) are powerful antioxidants and free radical scavengers capable of performing many of the same functions as glutathione (GSH). ALA supplementation may help protect mitochondria from oxidative stress, a possible mechanism contributing to certain forms of brain diseases called schizophrenia. Shortly before the advent of antipsychotic medications, two small studies found ALA relieved psychiatric symptoms in schizophrenia. More recently, animal studies have shown ALA augmentation improves mitochondrial function. At pharmaceutical levels, niacinamide helps preserve mitochondrial membrane integrity and acts as an antioxidant. ALA is a precursor for lipoamide, an essential mitochondrial coenzyme and niacinamide is a component of niacinamide adenine dinucleotide (NAD). NADH, the reduced form of NAD, is involved in the reduction of ALA to DHLA within the mitochondria. This is relevant to contemporary research because DHLA increases GSH and low GSH levels contribute to mitochondrial dysfunction and oxidative stress which have been implicated in the pathophysiology of schizophrenia.

  20. Bioavailability of an R-α-Lipoic Acid/γ-Cyclodextrin Complex in Healthy Volunteers

    PubMed Central

    Ikuta, Naoko; Okamoto, Hinako; Furune, Takahiro; Uekaji, Yukiko; Terao, Keiji; Uchida, Ryota; Iwamoto, Kosuke; Miyajima, Atsushi; Hirota, Takashi; Sakamoto, Norihiro


    R-α-lipoic acid (R-LA) is a cofactor of mitochondrial enzymes and a very strong antioxidant. R-LA is available as a functional food ingredient but is unstable against heat or acid. Stabilized R-LA was prepared through complexation with γ-cyclodextrin (CD), yielding R-LA/CD. R-LA/CD was orally administered to six healthy volunteers and showed higher plasma levels with an area under the plasma concentration-time curve that was 2.5 times higher than that after oral administration of non-complexed R-LA, although the time to reach the maximum plasma concentration and half-life did not differ. Furthermore, the plasma glucose level after a single oral administration of R-LA/CD or R-LA was not affected and no side effects were observed. These results indicate that R-LA/CD could be easily absorbed in the intestine. In conclusion, γ-CD complexation is a promising technology for delivering functional but unstable ingredients like R-LA. PMID:27314343

  1. Lipoic acid mitigates bisphenol A-induced testicular mitochondrial toxicity in rats.


    El-Beshbishy, Hesham A; Aly, Hamdy A A; El-Shafey, Mostafa


    Bisphenol A (BPA) is one of the highest volume chemicals produced worldwide. BPA is used in the production of polycarbonate plastics and epoxy resins used in manufacturing plastic baby bottles and lining of food cans. In this study, we investigated the BPA-induced testicular oxidative stress and perturbation of mitochondrial marker enzymes in male albino rats and its amelioration by α-lipoic acid (LA). Rats were administered a dose of BPA (10 mg/kg body weight) orally for 14 days. This resulted in decreased testes weight, total testicular protein content, testicular enzymes such as acid phosphatase, alkaline phosphatase and lactate dehydrogenase and decline in activities of marker mitochondrial enzymes such as succinate dehydrogenase, malate dehydrogenase, isocitrate dehydrogenase, monoamine oxidase and NADH dehydrogenase. The serum testosterone and total antioxidant status were reduced. Besides, it also affected the activities of testicular antioxidant enzymes such as glutathione reductase, glutathione peroxidase, superoxide dismutase and catalase. BPA also caused lipid peroxidation and decrease in reduced glutathione content of mitochondria. The co-administration of LA (20 mg/kg body weight; orally for 14 days) together with BPA resulted in restoration of the mitochondrial marker enzyme activities and increasing enzymatic and non-enzymatic antioxidants of mitochondria. The obtained results demonstrated that LA has a potential role in mitigating BPA-induced mitochondrial toxicity through antioxidant mechanism or by direct free radical scavenging activity. PMID:22623521

  2. Alpha-lipoic acid: molecular mechanisms and therapeutic potential in diabetes.


    Rochette, Luc; Ghibu, Steliana; Muresan, Adriana; Vergely, Catherine


    Diabetes is a chronic metabolic disease with a high prevalence worldwide. Diabetes and insulin resistance are associated with the development of cardiovascular and nervous diseases. The development of these disorders reflects complex pathological processes in which the oxidative stress caused by reactive oxygen species (ROS) and reactive nitrogen species (RNS) plays a pivotal role. It is widely accepted that diabetes impairs endothelial nitric oxide synthase (eNOS) activity and increases the production of ROS, thus resulting in diminished NO bioavailability and increased oxidative stress. Alpha-lipoic acid (LA) possesses beneficial effects both in the prevention and in the treatment of diabetes. LA is a potent antioxidant with insulin-mimetic and anti-inflammatory activity. LA in the diet is quickly absorbed, transported to the intracellular compartments, and reduced to dihydrolipoic acid (DHLA) under the action of enzymes. LA, which plays an essential role in mitochondrial bioenergetic reactions, has drawn considerable attention as an antioxidant for use in managing diabetic complications such as retinopathy, neuropathy and other vascular diseases.

  3. Bioavailability of an R-α-Lipoic Acid/γ-Cyclodextrin Complex in Healthy Volunteers.


    Ikuta, Naoko; Okamoto, Hinako; Furune, Takahiro; Uekaji, Yukiko; Terao, Keiji; Uchida, Ryota; Iwamoto, Kosuke; Miyajima, Atsushi; Hirota, Takashi; Sakamoto, Norihiro


    R-α-lipoic acid (R-LA) is a cofactor of mitochondrial enzymes and a very strong antioxidant. R-LA is available as a functional food ingredient but is unstable against heat or acid. Stabilized R-LA was prepared through complexation with γ-cyclodextrin (CD), yielding R-LA/CD. R-LA/CD was orally administered to six healthy volunteers and showed higher plasma levels with an area under the plasma concentration-time curve that was 2.5 times higher than that after oral administration of non-complexed R-LA, although the time to reach the maximum plasma concentration and half-life did not differ. Furthermore, the plasma glucose level after a single oral administration of R-LA/CD or R-LA was not affected and no side effects were observed. These results indicate that R-LA/CD could be easily absorbed in the intestine. In conclusion, γ-CD complexation is a promising technology for delivering functional but unstable ingredients like R-LA.

  4. A randomized placebo-controlled pilot trial of omega-3 fatty acids and alpha lipoic acid in Alzheimer's disease.


    Shinto, Lynne; Quinn, Joseph; Montine, Thomas; Dodge, Hiroko H; Woodward, William; Baldauf-Wagner, Sara; Waichunas, Dana; Bumgarner, Lauren; Bourdette, Dennis; Silbert, Lisa; Kaye, Jeffrey


    Oxidative stress, inflammation, and increased cholesterol levels are all mechanisms that have been associated with Alzheimer's disease (AD) pathology. Several epidemiologic studies have reported a decreased risk of AD with fish consumption. This pilot study was designed to evaluate the effects of supplementation with omega-3 fatty acids alone (ω-3) or omega-3 plus alpha lipoic acid (ω-3 + LA) compared to placebo on oxidative stress biomarkers in AD. The primary outcome measure was peripheral F2-isoprostane levels (oxidative stress measure). Secondary outcome measures included performance on: Mini-Mental State Examination (MMSE), Activities of Daily Living/Instrumental Activities of Daily Living (ADL/IADL), and Alzheimer Disease Assessment Scale-cognitive subscale (ADAS-cog). Thirty-nine AD subjects were randomized to one of three groups: 1) placebo, 2) ω-3, or 3) ω-3 + LA for a treatment duration of 12 months. Eighty seven percent (34/39) of the subjects completed the 12-month intervention. There was no difference between groups at 12 months in peripheral F2-isoprostane levels (p = 0.83). The ω-3 + LA and ω-3 were not significantly different than the placebo group in ADAS-cog (p = 0.98, p = 0.86) and in ADL (p = 0.15, p = 0.82). Compared to placebo, the ω-3 + LA showed less decline in MMSE (p < 0.01) and IADL (p = 0.01) and the ω-3 group showed less decline in IADL (p < 0.01). The combination of ω-3 + LA slowed cognitive and functional decline in AD over 12 months. Because the results were generated from a small sample size, further evaluation of the combination of omega-3 fatty acids plus alpha-lipoic acid as a potential treatment in AD is warranted.

  5. A randomized placebo-controlled pilot trial of omega-3 fatty acids and alpha lipoic acid in Alzheimer's disease.


    Shinto, Lynne; Quinn, Joseph; Montine, Thomas; Dodge, Hiroko H; Woodward, William; Baldauf-Wagner, Sara; Waichunas, Dana; Bumgarner, Lauren; Bourdette, Dennis; Silbert, Lisa; Kaye, Jeffrey


    Oxidative stress, inflammation, and increased cholesterol levels are all mechanisms that have been associated with Alzheimer's disease (AD) pathology. Several epidemiologic studies have reported a decreased risk of AD with fish consumption. This pilot study was designed to evaluate the effects of supplementation with omega-3 fatty acids alone (ω-3) or omega-3 plus alpha lipoic acid (ω-3 + LA) compared to placebo on oxidative stress biomarkers in AD. The primary outcome measure was peripheral F2-isoprostane levels (oxidative stress measure). Secondary outcome measures included performance on: Mini-Mental State Examination (MMSE), Activities of Daily Living/Instrumental Activities of Daily Living (ADL/IADL), and Alzheimer Disease Assessment Scale-cognitive subscale (ADAS-cog). Thirty-nine AD subjects were randomized to one of three groups: 1) placebo, 2) ω-3, or 3) ω-3 + LA for a treatment duration of 12 months. Eighty seven percent (34/39) of the subjects completed the 12-month intervention. There was no difference between groups at 12 months in peripheral F2-isoprostane levels (p = 0.83). The ω-3 + LA and ω-3 were not significantly different than the placebo group in ADAS-cog (p = 0.98, p = 0.86) and in ADL (p = 0.15, p = 0.82). Compared to placebo, the ω-3 + LA showed less decline in MMSE (p < 0.01) and IADL (p = 0.01) and the ω-3 group showed less decline in IADL (p < 0.01). The combination of ω-3 + LA slowed cognitive and functional decline in AD over 12 months. Because the results were generated from a small sample size, further evaluation of the combination of omega-3 fatty acids plus alpha-lipoic acid as a potential treatment in AD is warranted. PMID:24077434

  6. Protective role of alpha lipoic acid against polychlorobiphenyl (Aroclor 1254)-induced testicular toxicity in rats.


    Güleş, Özay; Eren, Ülker


    The present study was aimed to investigate the antioxidant, biochemical, and histological effects of alpha lipoic acid (ALA) on polychlorinated biphenyl (PCB)-induced testicular toxicity in male rats. The rats were divided into five groups: In the control group, the rats were not administered any chemicals for 30 days. In the sham group, the rats were administered corn oil for 30 days. In the PCB group, the rats were administered with Aroclor 1254 for 30 days. In the ALA group, the rats were treated with ALA for 30 days. In the ALA+PCB group, the rats were treated with ALA 24 hours before Aroclor 1254 was administered for 30 days. The total oxidant status (TOS) level in the serum and testis, number of apoptotic cells, vacuolization at the basal membrane, immature spermatids in the tubular lumen, heme oxygenase-1 (HO-1) staining density, and abnormal spermatozoa were significantly increased in the PCB group. Moreover, in the PCB group, the seminiferous tubule diameter (STD) was decreased in stage VII-VIII and XII-XIV tubules. The TOS level in the serum and testis, vacuolization at the basal membrane, immature spermatids in the tubular lumen, and apoptosis were significantly decreased in the ALA+PCB groups. These findings suggested that ALA has a protective role against PCB-induced testicular toxicity. PMID:27516018

  7. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail:


    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  8. The impact of alpha-lipoic acid on amikacin-induced nephrotoxicity.


    Asci, Halil; Saygin, Mustafa; Cankara, Fatma Nihan; Bayram, Dilek; Yesilot, Sukriye; Candan, Ibrahim Aydin; Ilhan, Ilter


    Amikacin (AK) is an antibacterial drug, but it has remarkable nephrotoxic and ototoxic side effects due to increase in reactive oxygen radicals. This study was established to determine the possible protective effects of alpha-lipoic acid (ALA), a powerful antioxidant, on AK-induced nephrotoxicity. Three different groups of rats (n = 6) were administered saline (control), AK (1.2 g/kg, intraperitoneally), ALA (100 mg/kg, p.o.) and AK combination (ALA one day before the AK for five days). Renal function, oxidative stress markers and histological changes were evaluated at the end of the experiment. Malondialdehyde was increased as an indicator of free radical formation in AK-induced group and decreased with ALA treatment. While catalase activity was increased significantly, superoxide dismutase and glutathione peroxidase activities were not statistically significant increased with ALA treatment. The result showed that AK enhanced levels of urea, creatinine and blood urea nitrogen in serum significantly. Administration of ALA reduced these levels of biochemical markers. Histopathological observations were confirmed by biochemical findings. In conclusion, ALA is suggested to be a potential candidate to ameliorate AK-induced nephrotoxicity. PMID:25296102

  9. Alpha-lipoic acid protects cardiomyocytes against hypoxia/reoxygenation injury by inhibiting autophagy

    SciTech Connect

    Cao, Xueming; Chen, Aihua Yang, Pingzhen; Song, Xudong; Liu, Yingfeng; Li, Zhiliang; Wang, Xianbao; Wang, Lizi; Li, Yunpeng


    Highlights: •We observed the cell viability and death subjected to H/R in H9c2 cardiomyocytes. •We observed the degree of autophagy subjected to H/R in H9c2 cardiomyocytes. •LA inhibited the degree of autophagy in parallel to the enhanced cell survival. •LA inhibited the autophagy in parallel to the decreased total cell death. •We concluded that LA protected cardiomyocytes against H/R by inhibiting autophagy. -- Abstract: Hypoxia/reoxygenation (H/R) is an important in vitro model for exploring the molecular mechanisms and functions of autophagy during myocardial ischemia/reperfusion (I/R). Alpha-lipoic acid (LA) plays an important role in the etiology of cardiovascular disease. Autophagy is widely implicated in myocardial I/R injury. We assessed the degree of autophagy by pretreatment with LA exposed to H/R in H9c2 cell based on the expression levels of Beclin-1, LC3II/LC3I, and green fluorescent protein-labeled LC3 fusion proteins. Autophagic vacuoles were confirmed in H9c2 cells exposed to H/R using transmission electron microscopy. Our findings indicated that pretreatment with LA inhibited the degree of autophagy in parallel to the enhanced cell survival and decreased total cell death in H9c2 cells exposed to H/R. We conclude that LA protects cardiomyocytes against H/R injury by inhibiting autophagy.

  10. Effect of alpha-lipoic acid on radiation-induced small intestine injury in mice

    PubMed Central

    Jeong, Bae Kwon; Song, Jin Ho; Jeong, Hojin; Choi, Hoon Sik; Jung, Jung Hwa; Hahm, Jong Ryeal; Woo, Seung Hoon; Jung, Myeong Hee; Choi, Bong-Hoi; Kim, Jin Hyun; Kang, Ki Mun


    Purpose Radiation therapy is a highly effective treatment for patients with solid tumors. However, it can cause damage and inflammation in normal tissues. Here, we investigated the effects of alpha-lipoic acid (ALA) as radioprotection agent for the small intestine in a mouse model. Materials and Methods Whole abdomen was evenly irradiated with total a dose of 15 Gy. Mice were treated with either ALA (100 mg/kg, intraperitoneal injection [i.p.]) or saline (equal volume, i.p.) the prior to radiation as 100 mg/kg/day for 3 days. Body weight, food intake, histopathology, and biochemical parameters were evaluated. Results Significant differences in body weight and food intake were observed between the radiation (RT) and ALA + RT groups. Moreover, the number of crypt cells was higher in the ALA + RT group. Inflammation was decreased and recovery time was shortened in the ALA + RT group compared with the RT group. The levels of inflammation-related factors (i.e., phosphorylated nuclear factor kappa B and matrix metalloproteinase-9) and mitogen-activated protein kinases were significantly decreased in the ALA + RT group compared with those in the RT group. Conclusions ALA treatment prior to radiation decreases the severity and duration of radiation-induced enteritis by reducing inflammation, oxidative stress, and cell death. PMID:26943777

  11. Effect of alpha-lipoic acid on boar spermatozoa quality during freezing-thawing.


    Shen, Tao; Jiang, Zhong-Liang; Li, Cong-Jun; Hu, Xiao-Chen; Li, Qing-Wang


    Alpha-lipoic acid (ALA) is known to be a natural antioxidant. The aim of the present study was to evaluate the cryoprotective effect of ALA on the motility of boar spermatozoa and its antioxidant effect on boar spermatozoa during freezing-thawing. Different concentrations (2.0, 4.0, 6.0, 8.0 or 10.0 mg/ml) of ALA were added to the extender used to freeze boar semen, and the effects on the quality and endogenous antioxidant enzyme activities of frozen-thawed spermatozoa were assessed. The results indicated that the addition of ALA to the extender resulted in a higher percentage of motile spermatozoa post-thaw (P < 0.05). The activities of superoxide dismutase, lactate dehydrogenase, glutamic-oxaloacetic transaminase and catalase improved after adding ALA to the extender (P < 0.05). Artificial insemination results showed that pregnancy rate and litter size were significantly higher at 6.0 mg/ml in the ALA group than in the control group (P < 0.05). In conclusion, ALA conferred a cryoprotective capacity to the extender used for boar semen during the process of freezing-thawing, and the optimal concentration of ALA for the frozen extender was 6.0 mg/ml.

  12. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    PubMed Central

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen


    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  13. Protective effect of alpha-lipoic acid on cypermethrin-induced oxidative stress in Wistar rats.


    Mignini, F; Nasuti, C; Fedeli, D; Mattioli, L; Cosenza, M; Artico, M; Gabbianelli, R


    Cypermethrin (CY), a class II pyrethroid pesticide, is globally used to control insects in the household and in agriculture. Despite beneficial roles, its uncontrolled and repetitive application leads to unintended effects in non-target organisms. In light of the relevant anti-oxidant properties of alpha-lipoic acid (ALA), in the work described herein we tested the effect of a commercially available ALA formulation on cypermethrin CY)-induced oxidative stress in Wistar rats. The rats were orally administered with 53.14 mg/kg of ALA and 35.71 mg/kg of CY for 60 days. The treatment with CY did not induce changes in either locomotor activities or in body weight. Differences were observed on superoxide dismutase (SOD), catalase (CAT) and lipid peroxidation that were re-established by ALA treatment at similar levels of the placebo group. Furthermore, ALA formulation increased glutathione (GSH) level and glutathione peroxidase (GPx) activity. Because of the widespread use of CY, higher amounts of pesticide residues are present in food, and a diet supplementation with ALA could be an active free radical scavenger protecting against diseases associated with oxidative stress.

  14. The Effect of Lipoic Acid Therapy on Cognitive Functioning in Patients with Alzheimer's Disease

    PubMed Central

    Fava, Antonietta; Pirritano, Domenico; Plastino, Massimiliano; Cristiano, Dario; Puccio, Giovanna; Colica, Carmen; Ermio, Caterina; De Bartolo, Matteo; Mauro, Gaetano


    Diabetes mellitus (DM) is an important risk factor for Alzheimer's disease (AD). Most diabetic patients have insulin resistance (IR) that is associated with compensatory hyperinsulinemia, one of the mechanisms suggested for increased AD risk in patients with DM. Alpha-lipoic acid (ALA) is a disulfide molecule with antioxidant properties that has positive effects on glucose metabolism and IR. This study evaluated the effect of ALA treatment (600 mg/day) on cognitive performances in AD patients with and without DM. One hundred and twenty-six patients with AD were divided into two groups, according to DM presence (group A) or absence (group B). Cognitive functions were assessed by MMSE, Alzheimer's Disease Assessment Scale-cognitive (ADAS-Cog), Clinician's Interview-Based Impression of Severity (CIBIC), Clinical Dementia Rating (CDR), and Alzheimer's Disease Functional and Change Scale (ADFACS). IR was assessed by HOMA index. At the end of the study, MMSE scores showed a significant improvement in 43% patients of group A (26 subjects) and 23% of group B (15 subjects), compared to baseline (P = .001). Also ADAS-Cog, CIBIC, and ADFACS scores showed a significant improvement in group A versus group B. IR was higher in group A. Our study suggests that ALA therapy could be effective in slowing cognitive decline in patients with AD and IR. PMID:26316990

  15. Protective effects of alpha lipoic acid on radiation-induced salivary gland injury in rats

    PubMed Central

    Kim, Jin Hyun; Kim, Kyung Mi; Jung, Myeong Hee; Jung, Jung Hwa; Kang, Ki Mun; Jeong, Bae Kwon; Kim, Jin Pyeong; Park, Jung Je; Woo, Seung Hoon


    Purpose Radiation therapy is a treatment for patients with head and neck (HN) cancer. However, radiation exposure to the HN often induces salivary gland (SG) dysfunction. We investigated the effect of α-lipoic acid (ALA) on radiation-induced SG injury in rats. Results ALA preserved acinoductal integrity and acinar cell secretary function following irradiation. These results are related to the mechanisms by which ALA inhibits oxidative stress by inhibiting gp91 mRNA and 8-OHdG expression and apoptosis of acinar cells and ductal cells by inactivating MAPKs in the early period and expression of inflammation-related factors including NF-κB, IκB-α, and TGF-β1 and fibrosis in late irradiated SG. ALA effects began in the acute phase and persisted for at least 56 days after irradiation. Materials and Methods Rats were assigned to followings: control, ALA only (100 mg/kg, i.p.), irradiated, and ALA administered 24 h and 30 min prior to irradiation. The neck area including the SG was evenly irradiated with 2 Gy per minute (total dose, 18 Gy) using a photon 6-MV linear accelerator. Rats were killed at 4, 7, 28, and 56 days after radiation. Conclusions Our results show that ALA could be used to ameliorate radiation-induced SG injury in patients with HN cancer. PMID:27072584

  16. Adding a combination of hydroxycitrate and lipoic acid (METABLOC™) to chemotherapy improves effectiveness against tumor development: experimental results and case report.


    Guais, Adeline; Baronzio, GianFranco; Sanders, Edward; Campion, Frédéric; Mainini, Carlo; Fiorentini, Giammaria; Montagnani, Francesco; Behzadi, Mahsa; Schwartz, Laurent; Abolhassani, Mohammad


    Altered metabolism of cancer first highlighted by Otto Warburg has a long history. Although ignored for a considerable amount of time, it is now receiving substantial attention. We recently published results obtained with a combination of two drugs, lipoic acid and hydroxycitrate, targeting metabolic enzymes particularly affected in cancer: ATP citrate lyase and pyruvate dehydrogenase kinase. This treatment was as efficient as chemotherapy in the three mouse cancer models that were tested. In this work, we asked if our drug combination could be used in conjunction with standard cytotoxic chemotherapy, in particular cisplatin, to improve basic protocol efficacy. A combination of lipoic acid and hydroxycitrate was administered to mice implanted with syngeneic cancer cells, LL/2 lung carcinoma and MBT-2 bladder carcinoma, concommitantly with classical chemotherapy (cisplatin or methotrexate). We demonstrate that the triple combination lipoic acid + hydroxycitrate + cisplatin or methotrexate is more efficient than cisplatin or methotrexate used individually or the combination of lipoic acid and hydroxycitrate administered alone. Of particular note are the results obtained in the treatment of an 80 year-old female who presented with ductal adenocarcinoma of the pancreas accompanied by liver metastases. A treatment course using gemcitabine plus α-lipoic acid and hydroxycitrate gave highly promising results. The in vivo data, coupled with the case study results, suggest a possible advantage in using a treatment targeted at cancer metabolism in association with classical chemotherapy. PMID:20931262

  17. Effects of alpha-lipoic acid on spatial learning and memory, oxidative stress, and central cholinergic system in a rat model of vascular dementia.


    Zhao, Ran-Ran; Xu, Fei; Xu, Xiao-Chen; Tan, Guo-Jun; Liu, Liang-Min; Wu, Ning; Zhang, Wen-Zhong; Liu, Ji-Xiang


    Brain oxidative stress due to chronic cerebral hypoperfusion was considered to be the major risk factor in the pathogenesis of vascular dementia. In this study, we investigated the protective efficacy of alpha-lipoic acid, an antioxidant, against vascular dementia in rats, as well as the potential mechanism. Bilateral common carotid arteries occlusion (BCCAO) induced severe cognitive deficits tested by Morris water maze (MWM), along with oxidative stress and disturbance of central cholinergic system. However, administration of alpha-lipoic acid (50mg/kg, i.p.) for 28 days significantly restored cognitive deficits induced by BCCAO. Biochemical determination revealed that alpha-lipoic acid markedly decreased the production of malondialdehyde (MDA) and the generation of reactive oxidative species (ROS), and increased the level of reduced glutathione (GSH) in the hippocampal tissue. Additionally, alpha-lipoic acid raised the level of acetylcholine (ACh) and choline acetyltransferase (ChAT) and decreased the activity of acetycholinesterase (AChE) in the hippocampus. These results indicated that treatment with alpha-lipoic acid significantly improved behavioral alterations, protected against oxidative stress, and restored central cholinergic system in the rat model of vascular dementia induced by BCCAO.

  18. Inhibitory effects of indole α-lipoic acid derivatives on nitric oxide production in LPS/IFNγ activated RAW 264.7 macrophages.


    Karabay, Arzu Zeynep; Koc, Aslı; Gurkan-Alp, A Selen; Buyukbingol, Zeliha; Buyukbingol, Erdem


    Alpha-lipoic acid (α-lipoic acid) is a potent antioxidant compound that has been shown to possess anti-inflammatory effects. RAW 264.7 macrophages produce various inflammatory mediators such as nitric oxide, IL-1β, IL-6 and TNF-alpha upon activation with LPS (Lipopolysaccharide) and IFNγ (interferon gamma). In this study, the effect of 12 synthetic indole α-lipoic acid derivatives on nitric oxide production and iNOS (inducible nitric oxide synthase) protein expression in LPS/IFNγ activated RAW 264.7 macrophages was determined. Cell proliferation, nitric oxide levels and iNOS protein expression were examined with thiazolyl blue tetrazolium blue test, griess assay and western blot, respectively. Our results showed that all of the indole α-lipoic acid derivatives showed significant inhibitory effects on nitric oxide production and iNOS protein levels (p < 0.05). The most active compounds were identified as compound I-4b, I-4e and II-3b. In conclusion, these indole α-lipoic acid derivatives may have the potential for treatment of inflammatory conditions related with high nitric oxide production.

  19. Alpha-lipoic acid improves high-fat diet-induced hepatic steatosis by modulating the transcription factors SREBP-1, FoxO1 and Nrf2 via the SIRT1/LKB1/AMPK pathway.


    Yang, Yi; Li, Wang; Liu, Yang; Sun, Yuning; Li, Yan; Yao, Qing; Li, Jianning; Zhang, Qian; Gao, Yujing; Gao, Ling; Zhao, Jiajun


    Understanding the mechanism by which alpha-lipoic acid supplementation has a protective effect upon nonalcoholic fatty liver disease in vivo and in vitro may lead to targets for preventing hepatic steatosis. Male C57BL/6J mice were fed a normal diet, high-fat diet or high-fat diet supplemented with alpha-lipoic acid for 24 weeks. HepG2 cells were incubated with normal medium, palmitate or alpha-lipoic acid. The lipid-lowering effects were measured. The protein expression and distribution were analyzed by Western blot, immunoprecipitation and immunofluorescence, respectively. We found that alpha-lipoic acid enhanced sirtuin 1 deacetylase activity through liver kinase B1 and stimulated AMP-activated protein kinase. By activating the sirtuin 1/liver kinase B1/AMP-activated protein kinase pathway, the translocation of sterol regulatory element-binding protein-1 into the nucleus and forkhead box O1 into the cytoplasm was prevented. Alpha-lipoic acid increased adipose triacylglycerol lipase expression and decreased fatty acid synthase abundance. In in vivo and in vitro studies, alpha-lipoic acid also increased nuclear NF-E2-related factor 2 levels and downstream target amounts via the sirtuin 1 pathway. Alpha-lipoic acid eventually reduced intrahepatic and serum triglyceride content. The protective effects of alpha-lipoic acid on hepatic steatosis appear to be associated with the transcription factors sterol regulatory element-binding protein-1, forkhead box O1 and NF-E2-related factor 2.

  20. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade.


    El-Gowelli, Hanan M; Saad, Evan I; Abdel-Galil, Abdel-Galil A; Ibrahim, Einas R


    In this work, α-lipoic acid and cyclosporine demonstrated significant protection against acetic acid-induced ulcerative colitis in rats. We proposed that α-lipoic acid and cyclosporine co-administration might modulate their individual effects. Induction of ulcerative colitis in rats was performed by intra-rectal acetic acid (5% v/v) administration for 3 consecutive days. Effects of individual or combined used of α-lipoic acid (35 mg/kg ip) or cyclosporine (5mg/kg sc) for 6 days starting 2 days prior to acetic acid were assessed. Acetic acid caused colon ulceration, bloody diarrhea and weight loss. Histologically, there was mucosal atrophy and inflammatory cells infiltration in submucosa, associated with depletion of colon reduced glutathione, superoxide dismutase and catalase activities and elevated colon malondialdehyde, serum C-reactive protein (C-RP) and tumor necrosis factor-α (TNF-α). Colon gene expression of cyclooxygenase-2 and miR-210 was also elevated. These devastating effects of acetic acid were abolished upon concurrent administration of α-lipoic acid. Alternatively, cyclosporine caused partial protection against acetic acid-induced ulcerative colitis. Cyclosporine did not restore colon reduced glutathione, catalase activity, serum C-RP or TNF-α. Unexpectedly, co-administration of α-lipoic acid and cyclosporine aggravated colon ulceration. Concomitant use of α-lipoic acid and cyclosporine significantly increased nitric oxide production, cyclooxygenase-2 and miR-210 gene expression compared to all other studied groups. The current findings suggest that facilitation of nitric oxide/cyclooxygenase-2/miR-210 cascade constitutes, at least partially, the cellular mechanism by which concurrent use of α-lipoic acid and cyclosporine aggravates colon damage. Collectively, the present work highlights the probable risk of using α-lipoic acid/cyclosporine combination in ulcerative colitis patients.

  1. Behavioral and Neurochemical Effects of Alpha-Lipoic Acid in the Model of Parkinson's Disease Induced by Unilateral Stereotaxic Injection of 6-Ohda in Rat

    PubMed Central

    de Araújo, Dayane Pessoa; De Sousa, Caren Nádia Soares; Araújo, Paulo Victor Pontes; Menezes, Carlos Eduardo de Souza; Sousa Rodrigues, Francisca Taciana; Escudeiro, Sarah Souza; Lima, Nicole Brito Cortez; Patrocínio, Manoel Claúdio Azevedo; Aguiar, Lissiana Magna Vasconcelos; Viana, Glauce Socorro de Barros; Vasconcelos, Silvânia Maria Mendes


    This study aimed to investigate behavioral and neurochemical effects of α-lipoic acid (100 mg/kg or 200 mg/kg) alone or associated with L-DOPA using an animal model of Parkinson's disease induced by stereotaxic injection of 6-hydroxydopamine (6-OHDA) in rat striatum. Motor behavior was assessed by monitoring body rotations induced by apomorphine, open field test and cylinder test. Oxidative stress was accessed by determination of lipid peroxidation using the TBARS method, concentration of nitrite and evaluation of catalase activity. α-Lipoic acid decreased body rotations induced by apomorphine, as well as caused an improvement in motor performance by increasing locomotor activity in the open field test and use of contralateral paw (in the opposite side of the lesion produced by 6-OHDA) at cylinder test. α-lipoic acid showed antioxidant effects, decreasing lipid peroxidation and nitrite levels and interacting with antioxidant system by decreasing of endogenous catalase activity. Therefore, α-lipoic acid prevented the damage induced by 6-OHDA or by chronic use of L-DOPA in dopaminergic neurons, suggesting that α-lipoic could be a new therapeutic target for Parkinson's disease prevention and treatment. PMID:24023579

  2. The impact of high fructose on cardiovascular system: Role of α-lipoic acid.


    Saygin, M; Asci, H; Cankara, F N; Bayram, D; Yesilot, S; Candan, I A; Alp, H H


    The aim of this study was to evaluate the role of α-lipoic acid (α-LA) on oxidative damage and inflammation that occur in endothelium of aorta and heart while constant consumption of high-fructose corn syrup (HFCS). The rats were randomly divided into three groups with each group containing eight rats. The groups include HFCS, HFCS + α-LA treatment, and control. HFCS was given to the rats at a ratio of 30% of F30 corn syrup in drinking water for 10 weeks. α-LA treatment was given to the rats at a dose of 100 mg/kg/day orally for the last 6 weeks. At the end of the experiment, the rats were killed by cervical dislocation. The blood samples were collected for biochemical studies, and the aortic and cardiac tissues were collected for evaluation of oxidant-antioxidant system, tissue bath, and pathological examination. HFCS had increased the levels of malondialdehyde, creatine kinase MB, lactate dehydrogenase, and uric acid and showed significant structural changes in the heart of the rats by histopathology. Those changes were improved by α-LA treatment as it was found in this treatment group. Immunohistochemical expressions of tumor necrosis factor α and inducible nitric oxide synthase were increased in HFCS group, and these receptor levels were decreased by α-LA treatment. All the tissue bath studies supported these findings. Chronic consumption of HFCS caused several problems like cardiac and endothelial injury of aorta by hyperuricemia and induced oxidative stress and inflammation. α-LA treatment reduced uric acid levels, oxidative stress, and corrected vascular responses. α-LA can be added to cardiac drugs due to its cardiovascular protective effects against the cardiovascular diseases.

  3. The impact of high fructose on cardiovascular system: Role of α-lipoic acid.


    Saygin, M; Asci, H; Cankara, F N; Bayram, D; Yesilot, S; Candan, I A; Alp, H H


    The aim of this study was to evaluate the role of α-lipoic acid (α-LA) on oxidative damage and inflammation that occur in endothelium of aorta and heart while constant consumption of high-fructose corn syrup (HFCS). The rats were randomly divided into three groups with each group containing eight rats. The groups include HFCS, HFCS + α-LA treatment, and control. HFCS was given to the rats at a ratio of 30% of F30 corn syrup in drinking water for 10 weeks. α-LA treatment was given to the rats at a dose of 100 mg/kg/day orally for the last 6 weeks. At the end of the experiment, the rats were killed by cervical dislocation. The blood samples were collected for biochemical studies, and the aortic and cardiac tissues were collected for evaluation of oxidant-antioxidant system, tissue bath, and pathological examination. HFCS had increased the levels of malondialdehyde, creatine kinase MB, lactate dehydrogenase, and uric acid and showed significant structural changes in the heart of the rats by histopathology. Those changes were improved by α-LA treatment as it was found in this treatment group. Immunohistochemical expressions of tumor necrosis factor α and inducible nitric oxide synthase were increased in HFCS group, and these receptor levels were decreased by α-LA treatment. All the tissue bath studies supported these findings. Chronic consumption of HFCS caused several problems like cardiac and endothelial injury of aorta by hyperuricemia and induced oxidative stress and inflammation. α-LA treatment reduced uric acid levels, oxidative stress, and corrected vascular responses. α-LA can be added to cardiac drugs due to its cardiovascular protective effects against the cardiovascular diseases. PMID:25825413

  4. Development and characterisation of a novel chitosan-coated antioxidant liposome containing both coenzyme Q10 and alpha-lipoic acid.


    Zhao, Guo Dong; Sun, Rui; Ni, Shi Lei; Xia, Qiang


    This article describes the physicochemical properties of chitosan-coated liposomes containing skin-protecting agents, coenzyme Q10 and alpha-lipoic acid (CCAL). CCAL had a spherical shell-core structure and liposomes inverted the surface charge from negative to positive after coating with chitosan. Compared with the uncoated liposome, CCAL had higher zeta potential, larger droplet size and long-term stability. Fourier transform infrared spectroscopy (FTIR) study showed that the driving force for chitosan coating the liposomes was enhanced via hydrogen bonding and ionic bond force between the chitosan and the alpha-lipoic acid. While the encapsulation efficiency (EE) of alpha-lipoic acid also increased by interacting with the chitosan shell. In vitro antioxidant activity study showed an excellent hydroxyl radical scavenging activity of CCAL. In vitro release study displayed a sustained drug release, and in vitro penetration studies promoted the accumulation of drugs in rabbit skin.

  5. Dihydrolipoic but not alpha-lipoic acid affects susceptibility of eukaryotic cells to bacterial invasion.


    Bozhokina, Ekaterina; Khaitlina, Sofia; Gamaley, Irina


    Sensitivity of eukaryotic cells to facultative pathogens can depend on physiological state of host cells. Previously we have shown that pretreatment of HeLa cells with N-acetylcysteine (NAC) makes the cells 2-3-fold more sensitive to invasion by the wild-type Serratia grimesii and recombinant Escherichia coli expressing gene of actin-specific metalloprotease grimelysin [1]. To evaluate the impact of chemically different antioxidants, in the present work we studied the effects of α-Lipoic acid (LA) and dihydrolipoic acid (DHLA) on efficiency of S. grimesii and recombinant E. coli expressing grimelysin gene to penetrate into HeLa and CaCo cells. Similarly to the effect of NAC, pretreatment of HeLa and CaCo cells with 0.6 or 1.25 mM DHLA increased the entry of grimelysin producing bacteria by a factor of 2.5 and 3 for the wild-type S. grimesii and recombinant E. coli, respectively. In contrast, pretreatment of the cells with 0.6 or 1.25 mM LA did not affect the bacteria uptake. The increased invasion of HeLa and CaCo cells correlated with the enhanced expression of E-cadherin and β-catenin genes, whereas expression of these genes in the LA-treated cells was not changed. Comparison of these results suggests that it is sulfhydryl group of DHLA that promotes efficient modification of cell properties assisting bacterial uptake. We assume that the NAC- and DHLA-induced stimulation of the E-cadherin-catenin pathway contributes to the increased internalization of the grimelysin producing bacteria within transformed cells.

  6. Alpha lipoic acid inhibits proliferation and epithelial mesenchymal transition of thyroid cancer cells.


    Jeon, Min Ji; Kim, Won Gu; Lim, Seonhee; Choi, Hyun-Jeung; Sim, Soyoung; Kim, Tae Yong; Shong, Young Kee; Kim, Won Bae


    The naturally occurring short-chain fatty acid, α-lipoic acid (ALA) is a powerful antioxidant which is clinically used for treatment of diabetic neuropathy. Recent studies suggested the possibility of ALA as a potential anti-cancer agent, because it could activate adenosine monophosphate activated protein kinase (AMPK) and inhibit transforming growth factor-β (TGFβ) pathway. In this study, we evaluate the effects of ALA on thyroid cancer cell proliferation, migration and invasion. We performed in vitro cell proliferation analysis using BCPAP, HTH-83, CAL-62 and FTC-133 cells. ALA suppressed thyroid cancer cell proliferation through activation of AMPK and subsequent down-regulation of mammalian target of rapamycin (mTOR)-S6 signaling pathway. Low-dose ALA, which had minimal effects on cell proliferation, also decreased cell migration and invasion of BCPAP, CAL-62 and HTH-83 cells. ALA inhibited epithelial mesenchymal transition (EMT) evidently by increase of E-cadherin and decreases of activated β-catenin, vimentin, snail, and twist in these cells. ALA suppressed TGFβ production and inhibited induction of p-Smad2 and twist by TGFβ1 or TGFβ2. These findings indicate that ALA reduces cancer cell migration and invasion through suppression of TGFβ production and inhibition of TGFβ signaling pathways in thyroid cancer cells. ALA also significantly suppressed tumor growth in mouse xenograft model using BCPAP and FTC-133 cells. This is the first study to show anti-cancer effect of ALA on thyroid cancer cells. ALA could be a potential therapeutic agent for treatment of advanced thyroid cancer, possibly as an adjuvant therapy with other systemic therapeutic agents.

  7. Effect of myo-inositol and alpha-lipoic acid on oocyte quality in polycystic ovary syndrome non-obese women undergoing in vitro fertilization: a pilot study.


    Rago, R; Marcucci, I; Leto, G; Caponecchia, L; Salacone, P; Bonanni, P; Fiori, C; Sorrenti, G; Sebastianelli, A


    The aim of the present study was to evaluate the effectiveness of the combined administration of myo-inositol and α-lipoic acid in polycystic ovary syndrome (PCOS) patients with normal body mass index (BMI), who had previously undergone intracytoplasmic sperm injection (ICSI) and received myo-inositol alone. Thirty-six of 65 normal-weight patients affected by PCOS who did not achieve pregnancy and one patient who had a spontaneous abortion were re-enrolled and given a cycle of treatment with myo-inositol and α-lipoic acid. For all female partners of the treated couples, the endocrine-metabolic and ultrasound parameters, ovarian volume, oocyte and embryo quality, and pregnancy rates were assessed before and after three months of treatment and compared with those of previous in vitro fertilization (IVF) cycle(s). After supplementation of myo-inositol with α-lipoic acid, insulin levels, BMI and ovarian volume were significantly reduced compared with myo-inositol alone. No differences were found in the fertilization and cleavage rate or in the mean number of transferred embryos between the two different treatments, whereas the number of grade 1 embryos was significantly increased, with a significant reduction in the number of grade 2 embryos treated with myo-inositol plus α-lipoic acid. Clinical pregnancy was not significantly different with a trend for a higher percentage for of myo-inositol and α-lipoic acid compared to the myo-inositol alone group. Our preliminary data suggest that the supplementation of myo-inositol and α-lipoic acid in PCOS patients undergoing an IVF cycle can help to improve their reproductive outcome and also their metabolic profiles, opening potential for their use in long-term prevention of PCOS.

  8. Effect of myo-inositol and alpha-lipoic acid on oocyte quality in polycystic ovary syndrome non-obese women undergoing in vitro fertilization: a pilot study.


    Rago, R; Marcucci, I; Leto, G; Caponecchia, L; Salacone, P; Bonanni, P; Fiori, C; Sorrenti, G; Sebastianelli, A


    The aim of the present study was to evaluate the effectiveness of the combined administration of myo-inositol and α-lipoic acid in polycystic ovary syndrome (PCOS) patients with normal body mass index (BMI), who had previously undergone intracytoplasmic sperm injection (ICSI) and received myo-inositol alone. Thirty-six of 65 normal-weight patients affected by PCOS who did not achieve pregnancy and one patient who had a spontaneous abortion were re-enrolled and given a cycle of treatment with myo-inositol and α-lipoic acid. For all female partners of the treated couples, the endocrine-metabolic and ultrasound parameters, ovarian volume, oocyte and embryo quality, and pregnancy rates were assessed before and after three months of treatment and compared with those of previous in vitro fertilization (IVF) cycle(s). After supplementation of myo-inositol with α-lipoic acid, insulin levels, BMI and ovarian volume were significantly reduced compared with myo-inositol alone. No differences were found in the fertilization and cleavage rate or in the mean number of transferred embryos between the two different treatments, whereas the number of grade 1 embryos was significantly increased, with a significant reduction in the number of grade 2 embryos treated with myo-inositol plus α-lipoic acid. Clinical pregnancy was not significantly different with a trend for a higher percentage for of myo-inositol and α-lipoic acid compared to the myo-inositol alone group. Our preliminary data suggest that the supplementation of myo-inositol and α-lipoic acid in PCOS patients undergoing an IVF cycle can help to improve their reproductive outcome and also their metabolic profiles, opening potential for their use in long-term prevention of PCOS. PMID:26753656

  9. Beneficial effects of natural antioxidants EGCG and alpha-lipoic acid on life span and age-dependent behavioral declines in Caenorhabditis elegans.


    Brown, Marishka K; Evans, Joseph L; Luo, Yuan


    Oxidative stress has been associated with both the aging process and the development of age-dependent tissue degenerative pathologies. Beneficial effects of antioxidant therapies to abrogate the deleterious consequences of elevated free radicals are implicated in disease prevention and cost-effective strategy. Previous data have shown protective effects of the polyphenol green tea constituent epigallocatechin gallate (EGCG) and a classic natural antioxidant alpha-lipoic acid (LA) against oxidative stress and aging. In this study, EGCG and alpha-lipoic acid were applied to model Caenorhabditis elegans, and their ability to modulate the life span and several age-associated behavioral declines were examined, including: pharyngeal pumping, chemotaxic behavior and amyloid beta-associated pathological behavior. It was demonstrated that both antioxidants attenuated the levels of hydrogen peroxide in C. elegans, but their effects on age-dependent decline in behaviors were different. EGCG, but not alpha-lipoic acid, attenuated the rate of decline in pharyngeal pumping behavior in C. elegans. In contrast, alpha-lipoic acid, but not EGCG, extended mean and maximal life span in C. elegans. Both EGCG and alpha-lipoic acid were able to facilitate the chemotaxis index and this effect was additive. Furthermore, EGCG, but not alpha-lipoic acid, moderately alleviated an Abeta-induced pathological behavior in a transgenic C. elegans strain. These results indicate that natural antioxidants can protect against age-dependent behavioral declines. Other protective mechanisms, in addition to their antioxidant properties, may underlie their differential beneficial effects on aging and physiological behaviors. PMID:17156833

  10. Stability, cutaneous delivery, and antioxidant potential of a lipoic acid and α-tocopherol codrug incorporated in microemulsions.


    Thomas, Siji; Vieira, Camila S; Hass, Martha A; Lopes, Luciana B


    The aim of this study was to assess the skin penetration, stability, and antioxidant effects of a α-tocopherol-lipoic acid codrug. To enhance penetration, we evaluated three microemulsions varying in water content and composition of the oil phase (isopropyl myristate with either monocaprylin or oleic acid). The codrug was incorporated at 1% (w/w). Codrug hydrolysis in the microemulsion increased with increases in time (up to 48 h) and formulation water content (10%-30%, w/w). Microemulsions increased the codrug delivery into viable layers of porcine ear skin by 2.9-7.8-fold compared with a control formulation (20% monocaprylin in isopropyl myristate) after 24 h. Penetration enhancement was influenced by the oil phase, with the formulation containing monocaprylin displaying the most pronounced effect. Antioxidant activity, assessed in skin bioequivalents using the thiobarbituric acid-reactive substances (TBARS) assay, demonstrated that TBARS levels decreased by 39% after treatment with the codrug-containing microemulsion compared with the unloaded formulation. In addition to the codrug, tocopherol (8.2 ± 0.6 μg/cm(2)) was detected in the viable bioequivalent tissues, suggesting that the codrug was partly hydrolyzed after 12 h. Taken together, these results support the potential of nanodispersed formulations containing a tocopherol-lipoic acid codrug to improve skin antioxidant activity.

  11. Lipoic Acid Use and Functional Outcomes after Thrombolysis in Patients with Acute Ischemic Stroke and Diabetes

    PubMed Central

    Choi, Kang-Ho; Kim, Joon-Tae; Kim, Hyung-Seok; Kim, Ja-Hae; Nam, Tai-Seung; Choi, Seong-Min; Lee, Seung-Han; Kim, Byeong-Chae; Kim, Myeong-Kyu; Cho, Ki-Hyun


    Background Alpha-lipoic acid (aLA) is a strong antioxidant commonly used for treating diabetic polyneuropathy. Previously, we demonstrated the neurorestorative effects of aLA after cerebral ischemia in rats. However, its effects on patients with stroke remain unknown. We investigated whether patients treated with aLA have better functional outcomes after acute ischemic stroke (AIS) and reperfusion therapy than patients not receiving aLA. Methods In this retrospective study of 172 prospectively registered patients with diabetes and AIS treated with tissue plasminogen activator (tPA), we investigated the relationship between aLA use and functional outcome both after 3 months and after 1 year. The functional outcomes included occurrence of hemorrhagic transformation (HT), early neurological deterioration (END), and early clinical improvement (ECI). Favorable outcomes were defined as modified Rankin Scale (mRS) scores of 0–2. Results Of the 172 patients with AIS and diabetes, 47 (27.3%) used aLA. In the entire cohort, favorable outcomes occurred at significantly higher rates both at 3 months and at 1 year in those treated with aLA. The risks for END and HT were lower and the occurrence of ECI was higher in patients treated with aLA. In multivariable analysis, aLA use was associated with favorable outcomes both at 3 months and at 1 year. Age, HT, and increased National Institutes of Health Stroke Scale scores were negative predictors of a favorable outcome. Conclusions The use of aLA in patients with AIS and diabetes who are treated with tPA is associated with favorable outcomes. These results indicate that aLA could be a useful intervention for the treatment of AIS after reperfusion therapy. PMID:27677185

  12. The oxidative damage and inflammation caused by pesticides are reverted by lipoic acid in rat brain.


    Astiz, Mariana; de Alaniz, María J T; Marra, Carlos Alberto


    We have previously demonstrated that the administration of low doses of dimethoate, glyphosate and zineb to rats (i.p. 1/250 LD50, three times a week for 5weeks) provokes severe oxidative stress (OS) in specific brain regions: substantia nigra, cortex and hippocampus. These effects were also observed in plasma. Lipoic acid (LA) is considered an "ideal antioxidant" due to its ability to scavenge reactive species, reset antioxidant levels and cross the blood-brain barrier. To investigate its protective effect we administered LA (i.p. 25, 50 and 100mg/kg) simultaneously with the pesticide mixture (PM) for 5weeks. After suppression of PM administration, we evaluated the restorative effect of LA for a further 5weeks. LA prevented OS and the production of nitrites+nitrates [NOx] caused by PM in a dose-dependent manner. The PM-induced decrease in reduced glutathione and α-tocopherol levels in all brain regions was completely restored by LA at both high doses. PM administration also caused an increase in prostaglandins E(2) and F(2α) in brain that was reduced by LA in a dose-dependent fashion. Taking into account the relationship between OS, inflammation and apoptosis, we measured caspase and calpain activity. Only milli- and micro-calpain isoforms were increased in the PM-treated group and LA reduced the activities to basal levels. We also demonstrated that interrupting PM administration is not enough to restore the levels of all the parameters measured and that LA is necessary to achieve basal status. In our experimental model LA displayed a protective role against pesticide-induced damage, suggesting that LA administration is a promising therapeutic strategy to cope with disorders suspected to be caused by OS generators, especially in brain.

  13. Selective detection and enumeration of fecal coliforms in water by potentiometric measurement of lipoic acid reduction.


    Jouenne, T; Junter, G A; Charriere, G


    Water samples of various origins were inoculated into a specific coliform-selective lactose broth provided with lipoic (thioctic) acid, and the time evolution of the redox potential of the cultures was monitored during incubation at 41 degrees C by use of gold versus reference electrodes. Positive potential-time responses, i.e., 100-mV potential shifts recorded within 20 h of inoculation, were related to the initial number of fecal coliforms in the broth determined by control enumeration techniques, and the organisms responsible were isolated and identified by conventional procedures. A total of 30 samples of wastewater, 38 of surface water, 553 of groundwater, and 110 of drinking water were tested successively. A total of 240 natural water samples, including 172 groundwater samples, and 1 drinking water sample were found to be positive in the potentiometric test. The majority (i.e., 92.5%) of the relevant potentiometric detection times were shorter than 15 h, and 96% of these could be attributed to Escherichia coli. Fifteen hours corresponded to the limit for detecting 1 E. coli cell per 100 ml of water. About 78% of the potentiometric responses occurring after 15 h were induced by fecal coliforms other than E. coli (Enterobacter cloacae, Klebsiella pneumoniae, and Citrobacter freundii). Calibration curves relating detection times shorter than 15 h to fecal coliform (i.e., E. coli) concentrations were constructed for the natural water samples tested. There were minor variations in the average growth rate of the organisms in the relation to the contamination level of the water tested. The number of false-positive samples in the potentiometric test was equivalent to that of false-negative samples (groundwater or drinking water).

  14. Bio-active nanoemulsions enriched with gold nanoparticle, marigold extracts and lipoic acid: In vitro investigations.


    Guler, Emine; Barlas, F Baris; Yavuz, Murat; Demir, Bilal; Gumus, Z Pinar; Baspinar, Yucel; Coskunol, Hakan; Timur, Suna


    A novel and efficient approach for the preparation of enriched herbal formulations was described and their potential applications including wound healing and antioxidant activity (cell based and cell free) were investigated via in vitro cell culture studies. Nigella sativa oil was enriched with Calendula officinalis extract and lipoic acid capped gold nanoparticles (AuNP-LA) using nanoemulsion systems. The combination of these bio-active compounds was used to design oil in water (O/W) and water in oil (W/O) emulsions. The resulted emulsions were characterized by particle size measurements. The phenolic content of each nanoemulsion was examined by using both colorimetric assay and chromatographic analyses. Two different methods containing cell free chemical assay (1-diphenyl-2-picrylhydrazyl method) and cell based antioxidant activity test were used to evaluate the antioxidant capacities. In order to investigate the bio-activities of the herbal formulations, in vitro cell culture experiments, including cytotoxicity, scratch assay, antioxidant activity and cell proliferation were carried out using Vero cell line as a model cell line. Furthermore, to monitor localization of the nanoemulsions after application of the cell culture, the cell images were monitored via fluorescence microscope after FITC labeling. All data confirmed that the enriched N. sativa formulations exhibited better antioxidant and wound healing activity than N. sativa emulsion without any enrichment. In conclusion, the incorporation of AuNP-LA and C. officinalis extract into the N. sativa emulsions significantly increased the bio-activities. The present work may support further studies about using the other bio-active agents for the enrichment of herbal preparations to strengthen their activities.

  15. Interaction of α-Lipoic Acid with the Human Na+/Multivitamin Transporter (hSMVT)*

    PubMed Central

    Zehnpfennig, Britta; Wiriyasermkul, Pattama; Carlson, David A.; Quick, Matthias


    The human Na+/multivitamin transporter (hSMVT) has been suggested to transport α-lipoic acid (LA), a potent antioxidant and anti-inflammatory agent used in therapeutic applications, e.g. in the treatment of diabetic neuropathy and Alzheimer disease. However, the molecular basis of the cellular delivery of LA and in particular the stereospecificity of the transport process are not well understood. Here, we expressed recombinant hSMVT in Pichia pastoris and used affinity chromatography to purify the detergent-solubilized protein followed by reconstitution of hSMVT in lipid bilayers. Using a combined approach encompassing radiolabeled LA transport and equilibrium binding studies in conjunction with the stabilized R-(+)- and S-(−)-enantiomers and the R,S-(+/−) racemic mixture of LA or lipoamide, we identified the biologically active form of LA, R-LA, to be the physiological substrate of hSMVT. Interaction of R-LA with hSMVT is strictly dependent on Na+. Under equilibrium conditions, hSMVT can simultaneously bind ∼2 molecules of R-LA in a biphasic binding isotherm with dissociation constants (Kd) of 0.9 and 7.4 μm. Transport of R-LA in the oocyte and reconstituted system is exclusively dependent on Na+ and exhibits an affinity of ∼3 μm. Measuring transport with known amounts of protein in proteoliposomes containing hSMVT in outside-out orientation yielded a catalytic turnover number (kcat) of about 1 s−1, a value that is well in agreement with other Na+-coupled transporters. Our data suggest that hSMVT-mediated transport is highly specific for R-LA at our tested concentration range, a finding with wide ramifications for the use of LA in therapeutic applications. PMID:25971966

  16. Bio-active nanoemulsions enriched with gold nanoparticle, marigold extracts and lipoic acid: In vitro investigations.


    Guler, Emine; Barlas, F Baris; Yavuz, Murat; Demir, Bilal; Gumus, Z Pinar; Baspinar, Yucel; Coskunol, Hakan; Timur, Suna


    A novel and efficient approach for the preparation of enriched herbal formulations was described and their potential applications including wound healing and antioxidant activity (cell based and cell free) were investigated via in vitro cell culture studies. Nigella sativa oil was enriched with Calendula officinalis extract and lipoic acid capped gold nanoparticles (AuNP-LA) using nanoemulsion systems. The combination of these bio-active compounds was used to design oil in water (O/W) and water in oil (W/O) emulsions. The resulted emulsions were characterized by particle size measurements. The phenolic content of each nanoemulsion was examined by using both colorimetric assay and chromatographic analyses. Two different methods containing cell free chemical assay (1-diphenyl-2-picrylhydrazyl method) and cell based antioxidant activity test were used to evaluate the antioxidant capacities. In order to investigate the bio-activities of the herbal formulations, in vitro cell culture experiments, including cytotoxicity, scratch assay, antioxidant activity and cell proliferation were carried out using Vero cell line as a model cell line. Furthermore, to monitor localization of the nanoemulsions after application of the cell culture, the cell images were monitored via fluorescence microscope after FITC labeling. All data confirmed that the enriched N. sativa formulations exhibited better antioxidant and wound healing activity than N. sativa emulsion without any enrichment. In conclusion, the incorporation of AuNP-LA and C. officinalis extract into the N. sativa emulsions significantly increased the bio-activities. The present work may support further studies about using the other bio-active agents for the enrichment of herbal preparations to strengthen their activities. PMID:25009101

  17. Lipoic acid as an anti-inflammatory and neuroprotective treatment for Alzheimer's disease.


    Maczurek, Annette; Hager, Klaus; Kenklies, Marlene; Sharman, Matt; Martins, Ralph; Engel, Jürgen; Carlson, David A; Münch, Gerald


    Alzheimer's disease (AD) is a progressive neurodegenerative disorder that destroys patient memory and cognition, communication ability with the social environment and the ability to carry out daily activities. Despite extensive research into the pathogenesis of AD, a neuroprotective treatment - particularly for the early stages of disease - remains unavailable for clinical use. In this review, we advance the suggestion that lipoic acid (LA) may fulfil this therapeutic need. A naturally occurring cofactor for the mitochondrial enzymes pyruvate dehydrogenase and alpha-ketoglutarate dehydrogenase, LA has been shown to have a variety of properties which can interfere with the pathogenesis or progression of AD. For example, LA increases acetylcholine (ACh) production by activation of choline acetyltransferase and increases glucose uptake, thus supplying more acetyl-CoA for the production of ACh. LA chelates redox-active transition metals, thus inhibiting the formation of hydroxyl radicals and also scavenges reactive oxygen species (ROS), thereby increasing the levels of reduced glutathione. In addition, LA down-regulates the expression of redox-sensitive pro-inflammatory proteins including TNF and inducible nitric oxide synthase. Furthermore, LA can scavenge lipid peroxidation products such as hydroxynonenal and acrolein. In human plasma, LA exists in an equilibrium of free and plasma protein bound form. Up to 150 muM, it is bound completely, most likely binding to high affinity fatty acid sites on human serum albumin, suggesting that one large dose rather than continuous low doses (as provided by "slow release" LA) will be beneficial for delivery of LA to the brain. Evidence for a clinical benefit for LA in dementia is yet limited. There are only two published studies, in which 600 mg LA was given daily to 43 patients with AD (receiving a standard treatment with choline-esterase inhibitors) in an open-label study over an observation period of up to 48 months. Whereas

  18. Increasing bioavailability of (R)-alpha-lipoic acid to boost antioxidant activity in the treatment of neuropathic pain.


    Maglione, Emilia; Marrese, Cinzia; Migliaro, Elisa; Marcuccio, Fortuna; Panico, Claudia; Salvati, Carmine; Citro, Giuseppe; Quercio, Marco; Roncagliolo, Federico; Torello, Carlo; Brufani, Mario


    a-lipoic acid (a-LA) is a potent natural antioxidant because it has a broad spectrum of action towards a great many free radical species and boosts the endogenous antioxidant systems.Although it is a multi-functional molecule, its pharmacokinetic characteristics pose restrictions to its use in the treatment of oxidative stress-dependent illnesses. Formulations that increase the bioavailability of a-LA have a better potential efficacy as adjuvants for the treatment of these conditions.This objective was achieved with a liquid formulation for oral use containing only R-aLA, the natural enantiomeric and most active form of a-lipoic acid.For the first time, the effects of this formulation were evaluated on neuropathic pain, a symptom caused by an increase in oxidative stress, regardless of the underlying cause. Neuropathic patients who have used this dietary supplement noticed an improvement in their quality of life and a significant reduction was observed in a number of certain descriptive pain parameters (intensity, burning, unpleasantness, superficial pain).Undoubtedly further, more in-depth, studies need to be conducted; however, this first investigation confirms the role of R-aLA as an anti-oxidant for the aetiological treatment of peripheral neuropathy. Increasing its plasma bioavailability even after a non-invasive administration through the oral route is a good starting point for proposing a valid adjuvant for the treatment of pain symptoms. PMID:26694149

  19. Novel Conjugates of 1,3-Diacylglycerol and Lipoic Acid: Synthesis, DPPH Assay, and RP-LC-MS-APCI Analysis

    PubMed Central

    Madawala, Samanthi R. P.; Andersson, Rolf E.; Jastrebova, Jelena A.; Almeida, Maria; Dutta, Paresh C.


    1,3-Diacylglycerol is known to reduce body weight and fat deposits in humans. α-Lipoic acid is a potent antioxidant and effective against many pathological conditions, including obesity and related metabolic syndromes. The present work is based on the hypothesis that the hybrid molecules of 1,3-diacylglycerol and lipoic acid possess synergistic and/or additive effects compared with the parent compounds against obesity, overweight, and related metabolic syndromes. Laboratory scale synthesis of 1,3-dioleoyl-2-lipoyl-sn-glycerol (yield 80%) and 1,3-dioleoyl-2-dihydrolipoyl-sn-glycerol (yield 70%) was performed for the first time and supported by NMR and MS data. Free radical scavenging capacity of the conjugates was assayed using DPPH test. A remarkably high in vitro free radical scavenging capacity was demonstrated for the 1,3-dioleoyl-2-dihydrolipoyl-sn-glycerol (EC50 value 0.21). RP-HPLC-MS-APCI analysis showed satisfactory separation between the conjugates (R~1). Protonated molecular ion of the conjugates at m/z 809 and m/z at 811, respectively, and their characteristic fragment ions were abundant. PMID:21966595

  20. The disulfide compound α-lipoic acid and its derivatives: A novel class of anticancer agents targeting mitochondria.


    Dörsam, Bastian; Fahrer, Jörg


    The endogenous disulfide α-lipoic acid (LA) is an essential mitochondrial co-factor. In addition, LA and its reduced counterpart dihydro lipoic acid form a potent redox couple with antioxidative functions, for which it is used as dietary supplement and therapeutic. Recently, it has gained attention due to its cytotoxic effects in cancer cells, which is the key aspect of this review. We initially recapitulate the dietary occurrence, gastrointestinal absorption and pharmacokinetics of LA, illustrating its diverse antioxidative mechanisms. We then focus on its mode of action in cancer cells, in which it triggers primarily the mitochondrial pathway of apoptosis, whereas non-transformed primary cells are hardly affected. Furthermore, LA impairs oncogenic signaling and displays anti-metastatic potential. Novel LA derivatives such as CPI-613, which target mitochondrial energy metabolism, are described and recent pre-clinical studies are presented, which demonstrate that LA and its derivatives exert antitumor activity in vivo. Finally, we highlight clinical studies currently performed with the LA analog CPI-613. In summary, LA and its derivatives are promising candidates to complement the arsenal of established anticancer drugs due to their mitochondria-targeted mode of action and non-genotoxic properties.

  1. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury.


    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue


    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries.

  2. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury.


    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue


    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries. PMID:27314327

  3. The Protective Effects of 5-Methoxytryptamine-α-lipoic Acid on Ionizing Radiation-Induced Hematopoietic Injury

    PubMed Central

    Li, Deguan; Tian, Zhenyuan; Tang, Weisheng; Zhang, Junling; Lu, Lu; Sun, Zhaojin; Zhou, Zewei; Fan, Feiyue


    Antioxidants are prospective radioprotectors because of their ability to scavenge radiation-induced reactive oxygen species (ROS). The hematopoietic system is widely studied in radiation research because of its high radiosensitivity. In the present study, we describe the beneficial effects of 5-methoxytryptamine-α-lipoic acid (MLA), which was synthesized from melatonin and α-lipoic acid, against radiation-induced hematopoietic injury. MLA administration significantly enhanced the survival rate of mice after 7.2 Gy total body irradiation. The results showed that MLA not only markedly increased the numbers and clonogenic potential of hematopoietic cells but also decreased DNA damage, as determined by flow cytometric analysis of histone H2AX phosphorylation. In addition, MLA decreased the levels of ROS in hematopoietic cells by inhibiting NOX4 expression. These data demonstrate that MLA prevents radiation-induced hematopoietic syndrome by increasing the number and function of and by inhibiting DNA damage and ROS production in hematopoietic cells. These data suggest MLA is beneficial for the protection of radiation injuries. PMID:27314327

  4. Alpha-Lipoic Acid and Antioxidant Diet Help to Improve Endothelial Dysfunction in Adolescents with Type 1 Diabetes: A Pilot Trial.


    Scaramuzza, Andrea; Giani, Elisa; Redaelli, Francesca; Ungheri, Saverio; Macedoni, Maddalena; Giudici, Valentina; Bosetti, Alessandra; Ferrari, Matteo; Zuccotti, Gian Vincenzo


    After evaluating the prevalence of early endothelial dysfunction, as measured by means of reactive hyperemia in adolescents with type 1 diabetes, we started a 6-month, double-blind, randomized trial to test the efficacy of an antioxidant diet (± alpha-lipoic acid supplementation) to improve endothelial dysfunction. Seventy-one children and adolescents, ages 17 ± 3.9 yrs, with type 1 diabetes since 9.5 ± 5.3 yrs, using intensified insulin therapy, were randomized into 3 arms: (a) antioxidant diet 10.000 ORAC + alpha-lipoic acid; (b) antioxidant diet 10.000 ORAC + placebo; (c) controls. BMI, blood pressure, fasting lipid profile, HbA1c, insulin requirement, dietary habits, and body composition were determined in each patient. An antioxidant diet significantly improved endothelial dysfunction when supplemented with alpha-lipoic acid, unlike diet with placebo or controls. A significant reduction in bolus insulin was also observed. We speculate that alpha-lipoic acid might have an antioxidant effect in pediatric diabetes patients by reducing insulin.

  5. Alpha-Lipoic Acid and Antioxidant Diet Help to Improve Endothelial Dysfunction in Adolescents with Type 1 Diabetes: A Pilot Trial

    PubMed Central

    Scaramuzza, Andrea; Giani, Elisa; Redaelli, Francesca; Ungheri, Saverio; Macedoni, Maddalena; Giudici, Valentina; Bosetti, Alessandra; Ferrari, Matteo; Zuccotti, Gian Vincenzo


    After evaluating the prevalence of early endothelial dysfunction, as measured by means of reactive hyperemia in adolescents with type 1 diabetes, we started a 6-month, double-blind, randomized trial to test the efficacy of an antioxidant diet (± alpha-lipoic acid supplementation) to improve endothelial dysfunction. Seventy-one children and adolescents, ages 17 ± 3.9 yrs, with type 1 diabetes since 9.5 ± 5.3 yrs, using intensified insulin therapy, were randomized into 3 arms: (a) antioxidant diet 10.000 ORAC + alpha-lipoic acid; (b) antioxidant diet 10.000 ORAC + placebo; (c) controls. BMI, blood pressure, fasting lipid profile, HbA1c, insulin requirement, dietary habits, and body composition were determined in each patient. An antioxidant diet significantly improved endothelial dysfunction when supplemented with alpha-lipoic acid, unlike diet with placebo or controls. A significant reduction in bolus insulin was also observed. We speculate that alpha-lipoic acid might have an antioxidant effect in pediatric diabetes patients by reducing insulin. PMID:26171398

  6. Alpha Lipoic Acid Attenuates Radiation-Induced Thyroid Injury in Rats

    PubMed Central

    Jung, Jung Hwa; Jung, Jaehoon; Kim, Soo Kyoung; Woo, Seung Hoon; Kang, Ki Mun; Jeong, Bae-Kwon; Jung, Myeong Hee; Kim, Jin Hyun; Hahm, Jong Ryeal


    Exposure of the thyroid to radiation during radiotherapy of the head and neck is often unavoidable. The present study aimed to investigate the protective effect of α-lipoic acid (ALA) on radiation-induced thyroid injury in rats. Rats were randomly assigned to four groups: healthy controls (CTL), irradiated (RT), received ALA before irradiation (ALA + RT), and received ALA only (ALA, 100 mg/kg, i.p.). ALA was treated at 24 h and 30 minutes prior to irradiation. The neck area including the thyroid gland was evenly irradiated with 2 Gy per minute (total dose of 18 Gy) using a photon 6-MV linear accelerator. Greater numbers of abnormal and unusually small follicles in the irradiated thyroid tissues were observed compared to the controls and the ALA group on days 4 and 7 after irradiation. However, all pathologies were decreased by ALA pretreatment. The quantity of small follicles in the irradiated rats was greater on day 7 than day 4 after irradiation. However, in the ALA-treated irradiated rats, the numbers of small and medium follicles were significantly decreased to a similar degree as in the control and ALA-only groups. The PAS-positive density of the colloid in RT group was decreased significantly compared with all other groups and reversed by ALA pretreatment. The high activity index in the irradiated rats was lowered by ALA treatment. TGF-ß1 immunoreactivity was enhanced in irradiated rats and was more severe on the day 7 after radiation exposure than on day 4. Expression of TGF-ß1 was reduced in the thyroid that had undergone ALA pretreatment. Levels of serum pro-inflammatory cytokines (TNF-α, IL-1ß and IL-6) did not differ significantly between the all groups. This study provides that pretreatment with ALA decreased the severity of radiation-induced thyroid injury by reducing inflammation and fibrotic infiltration and lowering the activity index. Thus, ALA could be used to ameliorate radiation-induced thyroid injury. PMID:25401725

  7. Effect of alpha lipoic acid on retinal ganglion cell survival in an optic nerve crush model

    PubMed Central

    Liu, Ruixing; Wang, Yanling; Pu, Mingliang


    Purpose This study was conducted to determine whether alpha lipoic acid (ALA) promotes the survival of retinal ganglion cells (RGCs) in a rat model of optic nerve crush (ONC) injury and to investigate the neuroprotective mechanisms of ALA in the retina in this ONC injury model. Methods Adult male Sprague-Dawley rats (180–220 g) were subjected to ONC injury surgery. ALA (63 mg/kg) was injected intravenously 1 day before or after the ONC injury. Animals were euthanized after 10 days, and the number of ganglion cells positive for RNA-binding protein with multiple splicing (Rbpms), which is an RGC marker, were counted on the whole mount retinas. In addition, immunofluorescence and immunoblotting were performed to examine the localization and levels of erythropoietin receptor (EPOR) and neurotrophin-4/5 (NT4/5) in the retinas in all experimental groups. To determine whether the EPO/EPOR signaling pathway was involved in the ALA antioxidant pathway, the rats were subjected to ruxolitinib (INCB018424, 0.25 mg/kg, bid, intraperitoneal, i.p.) treatment after the animals were injected intravenously with ALA 1 day before ONC injury. Results The average number of Rbpms-positive cells/mm2 in the control group (sham-operated group), the ONC group, the ALA-ONC group, and the ONC-ALA group retinas was 2219±28, 418±8, 848±22, and 613±18/mm2, respectively. The ALA-ONC and ONC-ALA groups showed a statistically significantly increased RGC survival rate compared to the ONC group. There were statistical differences in the RGC survival rates between the ALA-ONC (39%) and ONC-ALA groups (28%; p<0.05). Immunofluorescent labeling showed that EPOR and NT4/5 expression was significant in the retinal ganglion cell layer (GCL). At the same time, western blot analysis revealed that ALA induced upregulation of EPOR protein and NT4/5 protein expression in the retina after ONC injury. However, INCB018424 reversed the protective effects of ALA on the ONC retinas. Conclusions ALA has

  8. Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant potential and lipid stability of meat

    PubMed Central


    Background Lipid peroxidation is the cause of declining the meat quality. Natural antioxidants plays a vital role in enhancing the stability and quality of meat. The supplementation of natural antioxidants in feed decreases lipid peroxidation and improves the stability of meat. Methods The present research was conducted to determine the effect of α-lipoic acid, α-tocopherol and wheat germ oil on the status of antioxidants, quality and lipid stability of broiler meat. One day old male broilers were fed with different feeds containing antioxidants i.e. natural (wheat germ oil) and synthetic α-tocopherol and α-lipoic acid during the two experimental years. Results The feed treatments have significant variation on the body weight and feed conversion ratio (FCR) while having no influence on the feed intake. The broilers fed on wheat germ oil (natural α-tocopherol) gained maximum body weight (2451.97 g & 2466.07 g) in the experimental years 2010–11 & 2011–12, respectively. The higher total phenolic contents were found in the broilers fed on wheat germ oil plus α-lipoic acid in breast (162.73±4.8 mg Gallic acid equivalent/100 g & 162.18±4.5 mg Gallic acid equivalent/100 g) and leg (149.67±3.3 mg Gallic acid equivalent/100 g & 146.07±3.2 mg Gallic acid equivalent/100 g) meat during both experimental years. Similar trend was observed for the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power assay (FRAP). The production of malondialdehydes in the breast and leg meat increased with progressive increase in the time period. The deposition of α-tocopherol (AT) and α-lipoic acid (ALA) contents were found to be higher in the broilers fed on wheat germ oil plus α-lipoic acid in breast and leg meat during the both experimental years. Conclusion In conclusion, the combination of wheat germ oil and α-lipoic acid has more beneficial for stability and the quality of the broiler meat and more work should be needed in future for the bio

  9. α-Lipoic acid attenuates LPS-induced liver injury by improving mitochondrial function in association with GR mitochondrial DNA occupancy.


    Liu, Zhiqing; Guo, Jun; Sun, Hailin; Huang, Yanping; Zhao, Ruqian; Yang, Xiaojing


    α-Lipoic acid (LA) has been demonstrated to be a key regulator of energy metabolism. However, whether LA can protect the liver from inflammation, as well as the underlying mechanism involved, are still largely unclear. In the present study, mice treated with lipopolysaccharide (LPS) and injected with LA were used as a model. Liver injury, energy metabolism and mitochondrial regulation were investigated to assess the protective effect of LA on the liver and explore the possible mechanisms involved. Our results showed that LA attenuated liver injury, as evidenced by the decreased plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels after LA treatment compared with the LPS-treated group. The hepatic ATP and NADH levels, expression levels of most mitochondrial DNA (mtDNA)-encoded genes as well as mitochondrial complex I, IV and V activities were all significantly increased in the LA-treated group compared with the LPS-treated group. Levels of Sirt3 protein, which is essential for the regulation of mitochondrial metabolism, were also increased in the LA-treated group. Regarding the regulation of mtDNA-encoded genes expression, we observed no obvious change in the methylation status of the mtDNA D-loop region. However, compared to the LPS-treated group, LA treatment increased glucocorticoid receptor (GR) protein expression in the liver, as well as the level of GR occupancy on the mtDNA D-loop region. Our study demonstrates that LA exerts a liver-protective effect in an inflammation state by improving mitochondrial function. Furthermore, to the best of our knowledge, we demonstrate for the first time that GR may be involved in this effect via an enhanced binding to the mtDNA transcriptional control region, thereby regulating the expression of mtDNA-encoded genes. PMID:26133658

  10. Design, synthesis and evaluation of PEGylated lipoic acid derivatives with functionality as potent anti-melanogenic agents.


    Lu, Chichong; Kim, Bo-Mi; Chai, Kyu Yun


    The novel PEGylated lipoic acid (LA) derivatives with functionality were synthesized in satisfactory yield by simple procedures and evaluated about its anti-melanogenic activity on the B16F10 melanoma cells. Grafting a PEG moiety onto the carboxyl group of LA has reduced the cell cytotoxicity and provided the water solubility and functionality to incorporate the other bioactive moieties. We have found that derivatives showed inhibition of melanin formation by up to 36.5% at 0.1 mM, whereas LA decreased the melanin formation by 8.6%. In addition, it also inhibits at least 86.4% UV-induced MMP-1 expression at 0.1 mM which is higher than LA. These data suggest that the novel PEGylated LA derivatives with functionality may thus serve as a potentially effective anti-melanogenic and anti-aging agent. PMID:21890247

  11. Ataxia-telangiectasia: chronic activation of damage-responsive functions is reduced by alpha-lipoic acid.


    Gatei, M; Shkedy, D; Khanna, K K; Uziel, T; Shiloh, Y; Pandita, T K; Lavin, M F; Rotman, G


    Cells from patients with the genetic disorder ataxia-telangiectasia (A-T) are hypersensitive to ionizing radiation and radiomimetic agents, both of which generate reactive oxygen species capable of causing oxidative damage to DNA and other macromolecules. We describe in A-T cells constitutive activation of pathways that normally respond to genotoxic stress. Basal levels of p53 and p21(WAF1/CIP1), phosphorylation on serine 15 of p53, and the Tyr15-phosphorylated form of cdc2 are chronically elevated in these cells. Treatment of A-T cells with the antioxidant alpha-lipoic acid significantly reduced the levels of these proteins, pointing to the involvement of reactive oxygen species in their chronic activation. These findings suggest that the absence of functional ATM results in a mild but continuous state of oxidative stress, which could account for several features of the pleiotropic phenotype of A-T.

  12. The protective effect of lipoic acid on selected cardiovascular diseases caused by age-related oxidative stress.


    Skibska, Beata; Goraca, Anna


    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system.

  13. Mitochondrial decay in the brains of old rats: ameliorating effect of alpha-lipoic acid and acetyl-L-carnitine.


    Long, Jiangang; Gao, Feng; Tong, Liqi; Cotman, Carl W; Ames, Bruce N; Liu, Jiankang


    To investigate the mitochondrial decay and oxidative damage resulting from aging, the activities/kinetics of the mitochondrial complexes were examined in the brains of young and old rats as well as in old rats fed R-alpha-lipoic acid plus acetyl-L-carnitine (LA/ALC). The brain mitochondria of old rats, compared with young rats, had significantly decreased endogenous antioxidants and superoxide dismutase activity; more oxidative damage to lipids and proteins; and decreased activities of complex I, IV and V. Complex I showed a decrease in binding affinity (increase in K(m)) for substrates. Feeding LA/ALC to old rats partially restored age-associated mitochondrial dysfunction to the levels of the young rats. These results indicate that oxidative mitochondrial decay plays an important role in brain aging and that a combination of nutrients targeting mitochondria, such as LA/ALC, could ameliorate mitochondrial decay through preventing mitochondrial oxidative damage.

  14. The Protective Effect of Lipoic Acid on Selected Cardiovascular Diseases Caused by Age-Related Oxidative Stress

    PubMed Central

    Goraca, Anna


    Oxidative stress is considered to be the primary cause of many cardiovascular diseases, including endothelial dysfunction in atherosclerosis and ischemic heart disease, hypertension, and heart failure. Oxidative stress increases during the aging process, resulting in either increased reactive oxygen species (ROS) production or decreased antioxidant defense. The increase in the incidence of cardiovascular disease is directly related to age. Aging is also associated with oxidative stress, which in turn leads to accelerated cellular senescence and organ dysfunction. Antioxidants may help lower the incidence of some pathologies of cardiovascular diseases and have antiaging properties. Lipoic acid (LA) is a natural antioxidant which is believed to have a beneficial effect on oxidative stress parameters in relation to diseases of the cardiovascular system. PMID:25949771

  15. Thermoregulatory and cardiovascular responses to creatine, glycerol and alpha lipoic acid in trained cyclists

    PubMed Central


    Background It has been shown that supplementation with creatine (Cr) and glycerol (Gly), when combined with glucose (Glu) necessary for the enhancement of Cr uptake by skeletal muscle, induces significant improvements in thermoregulatory and cardiovascular responses during exercise in the heat. Purpose To determine whether Cr/Gly-induced thermoregulatory and cardiovascular responses are maintained when the majority (~75%) of the Glu in the Cr/Gly supplement is replaced with the insulintropic agent alpha lipoic acid (Ala). Methods 22 healthy endurance trained cyclists were randomly assigned to receive either 20 g/day (4 × 5 g/day) of Cr, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly and 150 g/day (4 × 37.5 g/day) of Glu or 20 g/day (4 × 5 g/day) of Cr monohydrate, 2 g .kg-1 BM per day (4 × 0.5 g .kg-1 BM per day) of Gly (100 g/day (4 × 25 g/day) of Glu and 1000 mg/day (4 × 250 mg/day) of Ala for 7 days for 7 days. Exercise trials were conducted pre- and post-supplementation and involved 40 min of constant-load cycling exercise at 70% O2 max by a self-paced 16.1 km time trial at 30°C and 70% relative humidity. Results Median and range values of TBW increased significantly by 2.1 (1.3-3.3) L and 1.8 (0.2-4.6) L in Cr/Gly/Glu and Cr/Gly/Glu/Ala groups respectively (P = 0.03) and of BM not significantly by 1.8 (0.2-3.0) kg and 1.2 (0.5-2.1) kg in Cr/Gly/Glu and in Cr/Gly/Glu/Ala, respectively (P = 0.75). During constant load exercise, heart rate (HR) and core temperature (Tcore) were significantly lower post-supplementation: HR was reduced on average by 3.3 ± 2.1 beats/min and by 4.8 ± 3.3 beats/min (mean ± SD) and Tcore by 0.2 ± 0.1 (mean ± SD) in the Cr/Gly/Glu and Cr/Gly/Glu/Ala, respectively The reduction in HR and Tcore was not significantly different between the supplementation groups. Conclusions In comparison to the established hyper hydrating Cr

  16. Lipoic acid modified low molecular weight polyethylenimine mediates nontoxic and highly potent in vitro gene transfection.


    Zheng, Meng; Zhong, Yinan; Meng, Fenghua; Peng, Rui; Zhong, Zhiyuan


    The clinical success of gene therapy intimately relies on the development of safe and efficient gene carrier systems. We found here that 1.8 kDa polyethylenimine (PEI) following hydrophobic modification with lipoic acid (LA) mediated nontoxic and highly potent in vitro gene transfection in both HeLa and 293T cells. 1.8 kDa PEI-LA conjugates were prepared with controlled degree of substitution (DS) by coupling LA to PEI using carbodiimide chemistry. Gel electrophoresis measurements showed that the DNA binding ability of 1.8 kDa PEI was impaired by lipoylation, in which an N/P ratio of 2/1 and 4-6/1 was required for 1.8 kDa PEI and 1.8 kDa PEI-LA conjugates, respectively, to completely inhibit DNA migration. Interestingly, dynamic light scattering measurements (DLS) revealed that PEI-LA conjugates condensed DNA into much smaller sizes (183-84 nm) than unmodified 1.8 kDa PEI (444-139 nm) at N/P ratios ranging from 20/1 to 60/1. These polyplexes revealed similar surface charges of ca. +22 to +30 mV. 1.8 kDa PEI-LA(2) polyplexes formed at an N/P ratio of 10/1 were stable against exchange with 12-fold excess of negatively charged dextran sodium sulfate (DSS) relative to DNA phosphate groups while 1.8 kDa PEI controls dissociated at 6-fold excess of DSS, indicating that lipoylation of 1.8 kDa PEI resulted in stronger binding with DNA. Importantly, DNA was released from 1.8 kDa PEI-LA(2) polyplexes upon addition of 10 mM dithiothreitol (DTT). Reduction-triggered unpacking of 1.8 kDa PEI-LA(2) polyplexes was also confirmed by DLS. MTT assays demonstrated that all PEI-LA conjugates and polyplexes were essentially nontoxic to HeLa and 293T cells up to a tested concentration of 50 μg/mL and an N/P ratio of 80/1, respectively. The in vitro gene transfection studies in HeLa and 293T cells showed that lipoylation of 1.8 kDa PEI markedly boosted its transfection activity. For example, 1.8 kDa PEI-LA(2) polyplexes displayed 400-fold and 500-fold higher levels of gene expression

  17. Lipoic acid increases the expression of genes involved in bone formation in mice fed a high-fat diet.


    Xiao, Ying; Cui, Jue; Shi, Yonghui; Le, Guowei


    Antioxidant lipoic acid (LA) has been reported to have a potential prophylactic effect on bone loss induced by high-fat diet (HFD). The aim of this work was to examine the hypothesis that LA decreases bone resorption-related gene expression and increases bone formation-related gene expression in HFD-fed mice, preventing a shift in the bone metabolism balance toward resorption. Male C57BL/6 mice were fed a normal diet, HFD, or HFD plus 0.1% LA for 12 weeks. The bone metabolism-related genes differentially expressed between mice fed HFD and those fed HFD supplemented with LA were identified through complementary DNA microarray. The supplemental LA significantly increased bone mineral density and bone antioxidant capacity in mice fed HFD (P < .05). Compared with the HFD-fed mice, LA induced the decreased expression of genes associated with bone resorption, such as Mmp9 (1.9-fold) and Ctsk (2.3-fold), and increased those genes associated with bone formation, such as Col1a1 (1.3-fold) and Alp1 (1.5-fold). Furthermore, LA upregulated many genes involved in the Igf signaling pathway, such as Igf-1 (increased 1.7-fold), and downregulated genes involved in the p53 apoptotic pathway, such as p53 (decreased 2.3-fold), thus attenuating the HFD-induced inhibition of bone formation. Lipoic acid induced upregulation of Il12a (2.1-fold) and downregulation of Tgfbr1 (4.3-fold) and Il17a (11.3-fold), which may reduce bone resorption. In summary, LA supplementation during HFD could affect bone density, altering gene expression.

  18. Alpha-Lipoic Acid Alleviates Acute Inflammation and Promotes Lipid Mobilization During the Inflammatory Response in White Adipose Tissue of Mice.


    Guo, Jun; Gao, Shixing; Liu, Zhiqing; Zhao, Ruqian; Yang, Xiaojing


    Recently, white adipose tissue has been shown to exhibit immunological activity, and may play an important role in host defense and protection against bacterial infection. Αlpha-lipoic acid (α-LA) has been demonstrated to function as an anti-inflammatory and anti-oxidant agent. However, its influence on the inflammatory response and metabolic changes in white adipose tissue remains unknown. We used male C57BL/6 mice as models to study the effect of α-LA on the inflammatory response and metabolic changes in white adipose tissue after stimulation with lipopolysaccharide (LPS). The non-esterified fatty acid content was measured by an automatic biochemical analyzer. The expression of inflammation-, lipid- and energy metabolism-related genes and proteins was determined by quantitative real-time polymerase chain reaction and western blotting. The results indicated that α-LA significantly decreased the epididymis fat weight index and the non-esterified fatty acid content in plasma compared with the control group. LPS significantly increased the expression of inflammation genes and α-LA reduced their expression. The LPS-induced expression of nuclear factor-κB protein was decreased by α-LA. Regarding lipid metabolism, α-LA significantly counteracted the inhibitory effects of LPS on the expression of hormone-sensitive lipase gene and protein. α-LA evidently increased the gene expression of fatty acid transport protein 1 and cluster of differentiation 36. Regarding energy metabolism, α-LA significantly increased the expression of most of mitochondrial DNA-encoded genes compared with the control and LPS group. Accordingly, α-LA can alleviate acute inflammatory response and this action may be related with the promotion of lipid mobilization in white adipose tissue.

  19. [Oxidative stress and antioxidant therapy with alpha-lipoic acid inclusion in acute poisoning by herbicide based on 2,4-dichlorphenoxyacetic acid].


    Kharchenko, O A; Balan, H M; Bubalo, N N; Mymrenko, T V


    In patients with acute poisoning amine salt herbicide 2,4-D develops oxidative stress with simultaneous inhibition of intracellular and extracellular antioxidant factors. These changes are more pronounced with neurological disorders that occur in conjunction with a toxic damage of liver or heart. The inclusion of a comprehensive detoxification therapy alpha-lipoic acid not only promotes a more pronounced therapeutic effect but also an earlier recourse cytolytic syndrome, a marked recovery of levels of malondialdehyde and indices of antioxidant system (superoxide dismutase and ceruloplasmin) than for patients in the comparison group. PMID:24908976

  20. A comparison of melatonin and α-lipoic acid in the induction of antioxidant defences in L6 rat skeletal muscle cells.


    Favero, Gaia; Rodella, Luigi Fabrizio; Nardo, Lorenzo; Giugno, Lorena; Cocchi, Marco Angelo; Borsani, Elisa; Reiter, Russel J; Rezzani, Rita


    Aging is characterized by a progressive deterioration in physiological functions and metabolic processes. The loss of cells during aging in vital tissues and organs is related to several factors including oxidative stress and inflammation. Skeletal muscle degeneration is common in elderly people; in fact, this tissue is particularly vulnerable to oxidative stress since it requires large amounts of oxygen, and thus, oxidative damage is abundant and accumulates with increasing age. Melatonin (N-acetyl-5-methoxytryptamine) is a highly efficient scavenger of reactive oxygen species and it also exhibits beneficial anti-inflammatory and anti-aging effects. This study investigated the susceptibility of rat L6 skeletal muscle cells to an induced oxidative stress following their exposure to hydrogen peroxide (50 μM) and evaluating the potential protective effects of pre-treatment with melatonin (10 nM) compared to the known beneficial effect of alpha-lipoic acid (300 μM). Hydrogen peroxide-induced obvious oxidative stress; it increased the expression of tumour necrosis factor-alpha and in turn promoted nuclear factor kappa-B and overrode the endogenous defence mechanisms. Conversely, pre-treatment of the hydrogen peroxide-exposed cells to melatonin or alpha-lipoic acid increased endogenous antioxidant enzymes, including superoxide dismutase-2 and heme oxygenase-1; moreover, they ameliorated significantly oxidative stress damage and partially reduced alterations in the muscle cells, which are typical of aging. In conclusion, melatonin was equally effective as alpha-lipoic acid; it exhibited marked antioxidant and anti-aging effects at the level of skeletal muscle in vitro even when it was given in a much lower dose than alpha-lipoic acid.

  1. Inhibition of Peripheral TNF-α and Downregulation of Microglial Activation by Alpha-Lipoic Acid and Etanercept Protect Rat Brain Against Ischemic Stroke.


    Wu, Ming-Hsiu; Huang, Chao-Ching; Chio, Chung-Ching; Tsai, Kuen-Jer; Chang, Ching-Ping; Lin, Nan-Kai; Lin, Mao-Tsun


    Ischemic stroke, caused by obstruction of blood flow to the brain, would initiate microglia activation which contributes to neuronal damage. Therefore, inhibition of microglia-mediated neuroinflammation could be a therapeutic strategy for ischemic stroke. This study was aimed to elucidate the anti-inflammatory effects of alpha-lipoic acid and etanercept given either singly or in combination in rats subjected to middle cerebral artery occlusion. Both α-lipoic acid and etanercept markedly reduced cerebral infarct, blood-brain barrier disruption, and neurological motor deficits with the former drug being more effective with the dosage used. Furthermore, when used in combination, the reduction was more substantial. Remarkably, a greater diminution in the serum levels of tumor necrosis factor-alpha as well as the brain levels of microglial activation (e.g., microgliosis, amoeboid microglia, and microglial overexpression of tumor necrosis factor-α) was observed with the combined drug treatment as compared to the drugs given separately. We conclude that inhibition of peripheral tumor necrosis factor-alpha as well as downregulation of brain microglial activation by alpha-lipoic acid or etanercept protect rat brain against ischemic stroke. Moreover, when both drugs were used in combination, the stroke recovery was promoted more extensively.

  2. Palladium alpha-lipoic acid complex formulation enhances activities of Krebs cycle dehydrogenases and respiratory complexes I-IV in the heart of aged rats.


    Sudheesh, N P; Ajith, T A; Janardhanan, K K; Krishnan, C V


    Age-related decline in the capacity to withstand stress, such as ischemia and reperfusion, results in congestive heart failure. Though the mechanisms underlying cardiac decay are not clear, age dependent somatic damages to mitochondrial DNA (mtDNA), loss of mitochondrial function, and a resultant increase in oxidative stress in heart muscle cells may be responsible for the increased risk for cardiovascular diseases. The effect of a safe nutritional supplement, POLY-MVA, containing the active ingredient palladium alpha-lipoic acid complex, was evaluated on the activities of the Krebs cycle enzymes such as isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, and malate dehydrogenase as well as mitochondrial complexes I, II, III, and IV in heart mitochondria of aged male albino rats of Wistar strain. Administration of 0.05 ml/kg of POLY-MVA (which is equivalent to 0.38 mg complexed alpha-lipoic acid/kg, p.o), once daily for 30 days, was significantly (p<0.05) effective to enhance the Krebs cycle dehydrogenases, and mitochondrial electron transport chain complexes. The unique electronic and redox properties of palladium alpha-lipoic acid complex appear to be a key to this physiological effectiveness. The results strongly suggest that this formulation might be effective to protect the aging associated risk of cardiovascular and neurodegenerative diseases.

  3. Coenzyme Q10 and α-lipoic acid: antioxidant and pro-oxidant effects in plasma and peripheral blood lymphocytes of supplemented subjects.


    Silvestri, Sonia; Orlando, Patrick; Armeni, Tatiana; Padella, Lucia; Brugè, Francesca; Seddaiu, Giovanna; Littarru, Gian Paolo; Tiano, Luca


    Reactive oxygen species not only cause damage but also have a physiological role in the protection against pathogens and in cell signalling. Mitochondrial nutrients, such as coenzyme Q10 and α-lipoic acid, beside their acknowledged antioxidant activities, show interesting features in relation to their redox state and consequent biological activity. In this study, we tested whether oral supplementation with 200 mg/day of coenzyme Q10 alone or in association with 200 mg/die of α-lipoic acid for 15 days on 16 healthy subjects was able to modulate the oxidative status into different compartments (plasma and cells), in basal condition and following an oxidative insult in peripheral blood lymphocytes exposed in vitro to H2O2. Data have shown that tested compounds produced antioxidant and bioenergetic effects improving oxidative status of the lipid compartment and mitochondrial functionality in peripheral blood lymphocytes. Simultaneously, an increased intracellular reactive oxygen species level was observed, although they did not lead to enhanced DNA oxidative damage. Coenzyme Q10 and α-lipoic acid produced beneficial effects also steering intracellular redox poise toward a pro-oxidant environment. In contrast with other antioxidant molecules, pro-oxidant activities of tested mitochondrial nutrients and consequent oxidant mediated signalling, could have important implications in promoting adaptive response to oxidative stress.

  4. Reversal of Lead-Induced Acute Toxicity by Lipoic Acid with Nutritional Supplements in Male Wistar Rats.


    Shukla, Sangeeta; Sharma, Yamini; Shrivastava, Sadhana


    Lead (Pb) is a pleiotropic toxicant. The potential role of oxidative stress injury that is associated with Pb poisoning suggests that antioxidants may enhance the efficacy of treatment designed to mitigate Pb-induced toxicity. The aim of this study is to investigate the comparative ameliorative potential of lipoic acid (LA) alone or in combination with calcium (Ca) and zinc (Zn). Pb acetate (50 mg/kg, intraperitoneally) was administered for 3 d. After 24 h of the last toxicant dose, LA (100 mg/kg, orally [po]) alone or in conjuction with Ca (50 mg/kg, po) and Zn (10 mg/kg, po) was administered for 3 d. Significant alterations in the concentration of urea, uric acid, triglycerides, cholesterol, aspartate amino transferase, alanine amino transferase, lipid peroxidation, and reduced glutathione as well as alterations in enzyme activity of δ-aminolevulinic acid (ALA) dehydratase were observed following acute Pb exposure. These findings were also supported by elevated mean DNA damage and Pb body burden in blood and soft tissues compared to controls (p ≤ 0.05). Three d posttreatment with LA along with Zn and Ca could significantly restore the biochemical parameters and Pb body burden to near-normal status through antioxidant activity or by preventing bioaccumulation of Pb within the blood and tissues of experimental rats. PMID:27481494

  5. The use of alpha-lipoic acid (ALA), gamma linolenic acid (GLA) and rehabilitation in the treatment of back pain: effect on health-related quality of life.


    Ranieri, M; Sciuscio, M; Cortese, A M; Santamato, A; Di Teo, L; Ianieri, G; Bellomo, R G; Stasi, M; Megna, M


    The aim of this trial was to evaluate the effects of alpha-lipoic acid (ALA) and gamma-linolenic acid (GLA) and the beneficial effect of physical exercise on positive sensory symptoms and neuropathic pain in patients with compressive radiculopathy syndrome from disc-nerve root conflict. Often these painful syndromes after the acute event, tend to recurr becoming subacute or chronic syndromes that become for the period of interest disabiling is an event very important in these cases proper prevention, based on a maintenance drug therapy and the strengthening exercises of paravertebral muscles, flexibility exercises on the spine and when needed on the reduction of body weight. In this Observational Cohort, two-arm trial, 203 patients were enrolled and divided into two groups, the first, ALA and GLA group, (n = 101) received oral dose of 600 mg of alpha-lipoic acid (ALA) and 360 mg of gamma-linolenic acid (GLA) and a rehabilitation program for six weeks, the second (n = 102) treated with only rehabilitation program. Patients were recruited at the centre of Physical Medicine and Rehabilitation, they underwent a physiatric examination at the primary outcome (t0) and secondary outcomes were recorded at monitoring visits scheduled at two weeks = t1, four weeks = t2, six weeks = t3, and at the same has been administered the following scale: VAS scale, SF-36, Oswestry Low Back Pain Disability Questionnaire, Aberdeen Back Pain Scale (ABPS), Revised Leeds Disability Questionnaire (LDQ), Roland and Morris Disability Questionnaire. Significant improvements was noted in the ALA and GLA group for paresthesia, stabbing and burning pain, as showed by VAS (Visual Analogue Scale), Oswestry Low Back Pain Disability Questionnaire, Aberdeen Low Back Pain Scale; also, improvements of quality of life has been noted, in the same group, as showed by SF-36, LDQ (Revised Leeds Disability Questionnaire), Roland and Morris disability questionnaire. All these outcome measure showed statistically

  6. Lipoic acid entrains the hepatic circadian clock and lipid metabolic proteins that have been desynchronized with advanced age.


    Keith, Dove; Finlay, Liam; Butler, Judy; Gómez, Luis; Smith, Eric; Moreau, Régis; Hagen, Tory


    It is well established that lipid metabolism is controlled, in part, by circadian clocks. However, circadian clocks lose temporal precision with age and correlates with elevated incidence in dyslipidemia and metabolic syndrome in older adults. Because our lab has shown that lipoic acid (LA) improves lipid homeostasis in aged animals, we hypothesized that LA affects the circadian clock to achieve these results. We fed 24 month old male F344 rats a diet supplemented with 0.2% (w/w) LA for 2 weeks prior to sacrifice and quantified hepatic circadian clock protein levels and clock-controlled lipid metabolic enzymes. LA treatment caused a significant phase-shift in the expression patterns of the circadian clock proteins Period (Per) 2, Brain and Muscle Arnt-Like1 (BMAL1), and Reverse Erythroblastosis virus (Rev-erb) β without altering the amplitude of protein levels during the light phase of the day. LA also significantly altered the oscillatory patterns of clock-controlled proteins associated with lipid metabolism. The level of peroxisome proliferator-activated receptor (PPAR) α was significantly increased and acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS) were both significantly reduced, suggesting that the LA-supplemented aged animals are in a catabolic state. We conclude that LA remediates some of the dyslipidemic processes associated with advanced age, and this mechanism may be at least partially through entrainment of circadian clocks. PMID:24944020

  7. Effect of γ-Cyclodextrin Inclusion Complex on the Absorption of R-α-Lipoic Acid in Rats

    PubMed Central

    Uchida, Ryota; Iwamoto, Kosuke; Nagayama, Suetada; Miyajima, Atsushi; Okamoto, Hinako; Ikuta, Naoko; Fukumi, Hiroshi; Terao, Keiji; Hirota, Takashi


    R-α-lipoic acid (RLA) is an endogenous organic acid, and works as a cofactor for mitochondrial enzymes and as a kind of antioxidant. Inclusion complexes of RLA with α-, β- or γ-cyclodextrins (CD) were prepared and orally administered as a suspension to rats. Among them, RLA/γ-CD showed the highest plasma exposure, and its area under the plasma concentration-time curve (AUC) of RLA was 2.2 times higher than that after oral administration of non-inclusion RLA. On the other hand, the AUC after oral administration of non-inclusion RLA and RLA/γ-CD to pylorus-ligated rats did not differ. However, the AUC after intraduodenal administration of RLA/γ-CD was 5.1 times higher than that of non-inclusion RLA, and was almost comparable to the AUC after intraduodenal administration of RLA-Na solution. Furthermore, the AUC after intraduodenal administration of RLA/γ-CD was not affected by biliary ligation or co-administration of an amylase inhibitor. These findings demonstrated that RLA was absorbed from the small intestine effectively when orally administered as a γ-CD inclusion complex, which could be easily dissolved in the lumen of the intestine. In conclusion, γ-CD inclusion complex is an appropriate formulation for supplying RLA as a drug or nutritional supplement with respect to absorption. PMID:25946345

  8. Analysis of the enhanced stability of r(+)-alpha lipoic Acid by the complex formation with cyclodextrins.


    Ikuta, Naoko; Sugiyama, Hironori; Shimosegawa, Hiroshi; Nakane, Rie; Ishida, Yoshiyuki; Uekaji, Yukiko; Nakata, Daisuke; Pallauf, Kathrin; Rimbach, Gerald; Terao, Keiji; Matsugo, Seiichi


    R(+)-alpha lipoic acid (RALA) is one of the cofactors for mitochondrial enzymes and, therefore, plays a central role in energy metabolism. RALA is unstable when exposed to low pH or heat, and therefore, it is difficult to use enantiopure RALA as a pharma- and nutra-ceutical. In this study, we have aimed to stabilize RALA through complex formation with cyclodextrins (CDs). α-CD, β-CD and γ-CD were used for the formation of these RALA-CD complexes. We confirmed the complex formation using differential scanning calorimetry and showed by using HPLC analysis that complexed RALA is more stable than free RALA when subjected to humidity and high temperature or acidic pH conditions. Scanning electron microscopy studies showed that the particle size and shape differed depending on the cyclodextrin used for complexation. Further, the complexes of CD and RALA showed a different particle size distribution pattern compared with that of CD itself or that of the physical mixture of RALA and CD.

  9. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.


    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J


    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  10. A Randomized Placebo-Controlled Pilot Trial of Omega-3 Fatty Acids and Alpha Lipoic Acid in Alzheimer’s Disease

    PubMed Central

    Shinto, Lynne; Quinn, Joseph; Montine, Thomas; Dodge, Hiroko H.; Woodward, William; Baldauf-Wagner, Sara; Waichunas, Dana; Bumgarner, Lauren; Bourdette, Dennis; Silbert, Lisa; Kaye, Jeffrey


    Oxidative stress, inflammation, and increased cholesterol levels are all mechanisms that have been associated with Alzheimer’s disease (AD) pathology. Several epidemiologic studies have reported a decreased risk of AD with fish consumption. This pilot study was designed to evaluate the effects of supplementation with omega-3 fatty acids alone (ω-3) or omega-3 plus alpha lipoic acid (ω-3 +LA) compared to placebo on oxidative stress biomarkers in AD. The primary outcome measure was peripheral F2-isoprostane levels (oxidative stress measure). Secondary outcome measures included performance on: Mini-Mental State Examination (MMSE), Activities of Daily Living/Instrumental Activities of Daily Living (ADL/IADL), and Alzheimer Disease Assessment Scale-cognitive subscale (ADAS-cog). Thirty-nine AD subjects were randomized to one of three groups: 1) placebo, 2) ω-3, or 3) ω-3 + LA for a treatment duration of 12 months. Eighty seven percent (34/39) of the subjects completed the 12-month intervention. There was no difference between groups at 12 months in peripheral F2-isoprostane levels (p = 0.83). The ω-3 +LA and ω-3 were not significantly different than the placebo group in ADAS-cog (p = 0.98, p = 0.86) and in ADL (p = 0.15, p = 0.82). Compared to placebo, the ω-3+LA showed less decline in MMSE (p< 0.01) and IADL (p= 0.01) and the ω-3 group showed less decline in IADL (p < 0.01). The combination of ω-3+LA slowed cognitive and functional decline in AD over 12 months. Because the results were generated from a small sample size, further evaluation of the combination of omega-3 fatty acids plus alpha-lipoic acid as a potential treatment in AD is warranted. PMID:24077434

  11. Molecular Mechanisms of Lipoic Acid Protection against Aflatoxin B1-Induced Liver Oxidative Damage and Inflammatory Responses in Broilers

    PubMed Central

    Ma, Qiugang; Li, Yan; Fan, Yu; Zhao, Lihong; Wei, Hua; Ji, Cheng; Zhang, Jianyun


    Alpha-lipoic acid (α-LA) was evaluated in this study for its molecular mechanisms against liver oxidative damage and inflammatory responses induced by aflatoxin B1 (AFB1). Birds were randomly allocated into four groups with different diets for three weeks: a basal diet, a 300 mg/kg α-LA supplementation in a basal diet, a diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in a diet containing 74 μg/kg AFB1. In the AFB1 group, the expression of GSH-PX mRNA was down-regulated (p < 0.05), and the levels of lipid peroxide and nitric oxide were increased (p < 0.05) in the chicken livers compared to those of the control group. Additionally, the mRNA level of the pro-inflammatory factor interleukin-6 was up-regulated significantly (p < 0.05), the protein expressions of both the nuclear factor kappa B (NF-κB) p65 and the inducible nitric oxide synthase were enhanced significantly (p < 0.05) in the AFB1 group. All of these negative effects were inhibited by α-LA. These results indicate that α-LA may be effective in preventing hepatic oxidative stress, down-regulating the expression of hepatic pro-inflammatory cytokines, as well as inhibiting NF-κB expression. PMID:26694462

  12. α-Lipoic Acid in Soluplus(®) Polymeric Nanomicelles for Ocular Treatment of Diabetes-Associated Corneal Diseases.


    Alvarez-Rivera, Fernando; Fernández-Villanueva, David; Concheiro, Angel; Alvarez-Lorenzo, Carmen


    α-Lipoic acid (ALA) is a powerful antioxidant valuable for prevention and treatment of ophthalmic complications such as diabetic keratopathy and retinopathy. The aim of this work was to develop micelle-based formulations that can enhance the solubility, stability, and corneal permeability of ALA. Compared to a conventional surfactant (sodium dioctylsulfosuccinate), Soluplus(®) (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol copolymer) led to smaller micelles (70-80 vs. 240-528 nm) with improved ability to solubilize ALA, maintaining ocular compatibility (Hens Egg Test on the Chorio-Allantoic Membrane). Soluplus nanomicelles enhanced more than 10-fold ALA solubility compared to common eye drops and withstood strong dilution in lachrymal fluid, filtration through sterilizing membranes, and freeze-drying. Interestingly, Soluplus nanomicelle formulation prepared with 1 or 2 mM block copolymer concentration exhibited in situ gelling capability and transformed into weak gels at 35°C, which is expected to increase corneal residence time. Bovine corneal permeability revealed that Soluplus nanomicelles notably enhanced ALA accumulation into the cornea as well as flux of drug toward the receptor chamber. Overall, these findings point out Soluplus nanomicelles as suitable carriers of ALA that may exhibit improved performance compared to currently available eye drop solutions.

  13. Tumor regression with a combination of drugs interfering with the tumor metabolism: efficacy of hydroxycitrate, lipoic acid and capsaicin.


    Schwartz, Laurent; Guais, Adeline; Israël, Maurice; Junod, Bernard; Steyaert, Jean-Marc; Crespi, Elisabetta; Baronzio, Gianfranco; Abolhassani, Mohammad


    Cellular metabolic alterations are now well described as implicated in cancer and some strategies are currently developed to target these different pathways. In previous papers, we demonstrated that a combination of molecules (namely alpha-lipoic acid and hydroxycitrate, i.e. Metabloc™) targeting the cancer metabolism markedly decreased tumor cell growth in mice. In this work, we demonstrate that the addition of capsaicin further delays tumor growth in mice in a dose dependant manner. This is true for the three animal model tested: lung (LLC) cancer, bladder cancer (MBT-2) and melanoma B16F10. There was no apparent side effect of this ternary combination. The addition of a fourth drug (octreotide) is even more effective resulting in tumor regression in mice bearing LLC cancer. These four compounds are all known to target the cellular metabolism not its DNA. The efficacy, the apparent lack of toxicity, the long clinical track records of these medications in human medicine, all points toward the need for a clinical trial. The dramatic efficacy of treatment suggests that cancer may simply be a disease of dysregulated cellular metabolism. PMID:22797854

  14. Cytoprotection against Cr(6+)-induced DNA damage by alpha-lipoic acid: implications in reducing occupational cancer risk.


    Kumar, Sushil; Budhwar, Roli; Nigam, Akanksha; Priya, Shivam


    Alpha-lipoic acid (LA), the metabolic antioxidant, was evaluated for its potential to protect against Cr(6+)-induced DNA damage. Potassium dichromate was administered to Swiss albino mice orally ad libitum at the doses of 5, 10 or 25 mg/kg body weight in drinking water to set DNA damage in cells, which was characterized in mouse peripheral blood mononuclear cells and bone marrow cells using single-cell gel electrophoresis and analyses of generated comets for Tail moment, Tail DNA and Tail length. DNA damage was dose dependent. Cytoprotection by LA was remarkable. LA (5, 10 and 25 mg/kg body weight intraperitoneally) in pre-, co- and post-toxicant administration schedule abrogated DNA damage substantially in both cell types. Protection by LA was also dose dependent. LA annulled DNA damage by Cr(6+) in plasmid relaxation assay. A negligible DNA damage resulted during interaction of Cr(6+) and LA. Compared to ascorbate, LA emerged as a better antioxidant and least DNA damaging. In conclusion, our study advocated an experimental therapeutic research potential in LA against Cr(6+)-induced DNA damage for reduction of occupational cancer risk in humans. PMID:19710206

  15. Kinetic modeling and scale up of lipoic acid (LA) production from Saccharomyces cerevisiae in a stirred tank bioreactor.


    Jayakar, Shilpa S; Singhal, Rekha S


    Scale up studies for production of lipoic acid (LA) from Saccharomyces cerevisiae have been reported in this paper for the first time. LA production in batch mode was carried out in a stirred tank bioreactor at varying agitation and aeration with maximum LA production of 512 mg/L obtained at 350 rpm and 25 % dissolved oxygen in batch culture conditions. Thus, LA production increased from 352 mg/L in shake flask to 512 mg/L in batch mode in a 5 L stirred tank bioreactor. Biomass production under these conditions was mathematically explained using logistic equation and data obtained for LA production and substrate utilization were successfully fitted using Luedeking-Piret and Mercier's models. The kinetic studies showed LA production to be growth associated. Further enhancement of LA production was carried out using fed-batch (variable volume) and semi-continuous modes of fermentation. Semi-continuous fermentation with three feeding cycles of sucrose effectively increased the production of LA from 512 to 725 mg/L.

  16. Dietary Alpha Lipoic Acid Improves Body Composition, Meat Quality and Decreases Collagen Content in Muscle of Broiler Chickens

    PubMed Central

    El-Senousey, H. K.; Fouad, A. M.; Yao, J. H.; Zhang, Z. G.; Shen, Q. W.


    A total of 192 broiler chicks were used to evaluate the influence of dietary α-lipoic acid (ALA) on growth performance, carcass characteristics and meat quality of broiler chickens with the purpose of developing a strategy to prevent the occurrence of pale, soft, and exudative (PSE) meat and to improve the meat quality of broilers. At 22 d of age, birds were allocated to 4 ALA treatments (0, 400, 800, and 1200 ppm). The results showed that dietary ALA significantly decreased average feed intake (AFI), average daily gain (ADG), final live body weight (BW) and carcass weight (p<0.05), while no difference in feed conversion ratio (FCR) was detected among chickens fed with and without ALA. Abdominal fat weight significantly decreased (p<0.05) for broilers fed 800 and 1200 ppm ALA. However when calculated as the percentage of carcass weight there was no significant difference between control and ALA treatments. Meat quality measurements showed that dietary ALA regulated postmortem glycolysis and improved meat quality as evidenced by increased muscle pH and decreased drip loss of meat (p<0.05). Although ALA did not change the tenderness of meat as indicated by meat shear force, dietary ALA decreased collagen content and mRNA expression of COL3A1 gene (p<0.05). In conclusion, the results indicate that dietary ALA may contribute to the improvement of meat quality in broilers. PMID:25049802

  17. α-Lipoic acid promotes α-tubulin hyperacetylation and blocks the turnover of mitochondria through mitophagy.


    Stoner, Michael W; Thapa, Dharendra; Zhang, Manling; Gibson, Gregory A; Calderon, Michael J; St Croix, Claudette M; Scott, Iain


    Lysine acetylation is tightly coupled to the nutritional status of the cell, as the availability of its cofactor, acetyl-CoA, fluctuates with changing metabolic conditions. Recent studies have demonstrated that acetyl-CoA levels act as an indicator of cellular nourishment, and increased abundance of this metabolite can block the induction of cellular recycling programmes. In the present study we investigated the cross-talk between mitochondrial metabolic pathways, acetylation and autophagy, using chemical inducers of mitochondrial acetyl-CoA production. Treatment of cells with α-lipoic acid (αLA), a cofactor of the pyruvate dehydrogenase complex, led to the unexpected hyperacetylation of α-tubulin in the cytosol. This acetylation was blocked by pharmacological inhibition of mitochondrial citrate export (a source for mitochondria-derived acetyl-CoA in the cytosol), was dependent on the α-tubulin acetyltransferase (αTAT) and was coupled to a loss in function of the cytosolic histone deacetylase, HDAC6. We further demonstrate that αLA slows the flux of substrates through autophagy-related pathways, and severely limits the ability of cells to remove depolarized mitochondria through PTEN-associated kinase 1 (PINK1)-mediated mitophagy.

  18. Fast quantification of α-lipoic acid in biological samples and dietary supplements using batch injection analysis with amperometric detection.


    Santos Pereira, Laise Nayra Dos; da Silva, Iranaldo Santos; Araújo, Thaylan Pinheiro; Tanaka, Auro Atsushi; Angnes, Lúcio


    Batch injection analysis (BIA) with amperometric detection, using a pyrolytic graphite electrode modified with cobalt phthalocyanine (PG/CoPc), was employed for determination of α-lipoic acid (ALA) in pharmaceutical product and in synthetic urine samples. The proposed BIA method is based on the application of a potential of +0.9V vs. Ag/AgCl, KCl sat, enabling quantification of ALA over a concentration range from 1.3×10(-6) to 1.0×10(-4)molL(-1), with a detection limit of 1.5×10(-8)molL(-1). A sampling rate of 180 injections per hour was attained and measurements of the reproducibility of successive injections (100µmolL(-1) ALA on the same electrode) showed a RSD of 2.11% for 40 successive injections. The new sensor was utilised for ALA quantification in a dietary pharmaceutical supplement and in synthetic urine and the results obtained for both samples were compared with parallel analysis using high performance liquid chromatography (HPLC), the method recommended by the United States Pharmacopeia. The results obtained were similar (at a 95% confidence level) and in the case of the synthetic urine sample (prepared with a known amount of ALA) the recovery was situated between 98.0% and 102.6%.

  19. Ammonia-induced oxidative damage in neurons is prevented by resveratrol and lipoic acid with participation of heme oxygenase 1.


    Bobermin, Larissa Daniele; Wartchow, Krista Minéia; Flores, Marianne Pires; Leite, Marina Concli; Quincozes-Santos, André; Gonçalves, Carlos-Alberto


    Ammonia is a metabolite that, at high concentrations, is implicated in neurological disorders, such as hepatic encephalopathy (HE), which is associated with acute or chronic liver failure. Astrocytes are considered the primary target of ammonia toxicity in the central nervous system (CNS) because glutamine synthetase (GS), responsible for ammonia metabolism in CNS, is an astrocytic enzyme. Thus, neuronal dysfunction has been associated as secondary to astrocytic impairment. However, we demonstrated that ammonia can induce direct effects on neuronal cells. The cell viability was decreased by ammonia in SH-SY5Y cells and cerebellar granule neurons. In addition, ammonia induced increased reactive oxygen species (ROS) production and decreased GSH intracellular content, the main antioxidant in CNS. As ammonia neurotoxicity is strongly associated with oxidative stress, we also investigated the potential neuroprotective roles of the antioxidants, resveratrol (RSV) and lipoic acid (LA), against ammonia toxicity in cerebellar granule neurons. RSV and LA were able to prevent the oxidative damage induced by ammonia, maintaining the levels of ROS production and GSH close to basal values. Both antioxidants also decreased ROS production and increased GSH content under basal conditions (in the absence of ammonia). Moreover, we showed that heme oxygenase 1 (HO1), a protein associated with protection against stress conditions, is involved in the beneficial effects of RSV and LA in cerebellar granule neurons. Thus, this study reinforces the neuroprotective effects of RSV and LA. Although more studies in vivo are required, RSV and LA could represent interesting therapeutic strategies for the management of HE.

  20. α-Lipoic Acid in Soluplus(®) Polymeric Nanomicelles for Ocular Treatment of Diabetes-Associated Corneal Diseases.


    Alvarez-Rivera, Fernando; Fernández-Villanueva, David; Concheiro, Angel; Alvarez-Lorenzo, Carmen


    α-Lipoic acid (ALA) is a powerful antioxidant valuable for prevention and treatment of ophthalmic complications such as diabetic keratopathy and retinopathy. The aim of this work was to develop micelle-based formulations that can enhance the solubility, stability, and corneal permeability of ALA. Compared to a conventional surfactant (sodium dioctylsulfosuccinate), Soluplus(®) (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol copolymer) led to smaller micelles (70-80 vs. 240-528 nm) with improved ability to solubilize ALA, maintaining ocular compatibility (Hens Egg Test on the Chorio-Allantoic Membrane). Soluplus nanomicelles enhanced more than 10-fold ALA solubility compared to common eye drops and withstood strong dilution in lachrymal fluid, filtration through sterilizing membranes, and freeze-drying. Interestingly, Soluplus nanomicelle formulation prepared with 1 or 2 mM block copolymer concentration exhibited in situ gelling capability and transformed into weak gels at 35°C, which is expected to increase corneal residence time. Bovine corneal permeability revealed that Soluplus nanomicelles notably enhanced ALA accumulation into the cornea as well as flux of drug toward the receptor chamber. Overall, these findings point out Soluplus nanomicelles as suitable carriers of ALA that may exhibit improved performance compared to currently available eye drop solutions. PMID:27103010

  1. Fast quantification of α-lipoic acid in biological samples and dietary supplements using batch injection analysis with amperometric detection.


    Santos Pereira, Laise Nayra Dos; da Silva, Iranaldo Santos; Araújo, Thaylan Pinheiro; Tanaka, Auro Atsushi; Angnes, Lúcio


    Batch injection analysis (BIA) with amperometric detection, using a pyrolytic graphite electrode modified with cobalt phthalocyanine (PG/CoPc), was employed for determination of α-lipoic acid (ALA) in pharmaceutical product and in synthetic urine samples. The proposed BIA method is based on the application of a potential of +0.9V vs. Ag/AgCl, KCl sat, enabling quantification of ALA over a concentration range from 1.3×10(-6) to 1.0×10(-4)molL(-1), with a detection limit of 1.5×10(-8)molL(-1). A sampling rate of 180 injections per hour was attained and measurements of the reproducibility of successive injections (100µmolL(-1) ALA on the same electrode) showed a RSD of 2.11% for 40 successive injections. The new sensor was utilised for ALA quantification in a dietary pharmaceutical supplement and in synthetic urine and the results obtained for both samples were compared with parallel analysis using high performance liquid chromatography (HPLC), the method recommended by the United States Pharmacopeia. The results obtained were similar (at a 95% confidence level) and in the case of the synthetic urine sample (prepared with a known amount of ALA) the recovery was situated between 98.0% and 102.6%. PMID:27154671

  2. Proteomic and biochemical responses of canola (Brassica napus L.) exposed to salinity stress and exogenous lipoic acid.


    Yıldız, Mustafa; Akçalı, Nermin; Terzi, Hakan


    To evaluate the mitigating effects of exogenous lipoic acid (LA) on NaCl toxicity, proteomic, biochemical and physiological changes were investigated in the leaves of canola (Brassica napus L.) seedlings. Salinity stress decreased the growth parameters and contents of ascorbate (AsA) and glutathione (GSH), and increased the contents of malondialdehyde (MDA), proline, cysteine and the activities of antioxidant enzymes such as superoxide dismutase (SOD), guaiacol peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX). The foliar application of LA alleviated the toxic effects of salinity stress on canola seedlings and notably decreased MDA content and increased growth parameters, cysteine content, and activities of CAT and POD. In the proteomic analyses, total proteins from the leaves of control, LA, NaCl and NaCl+LA treated-seedlings were separated using two-dimensional gel electrophoresis (2-DE). A total of 28 proteins were differentially expressed. Of these, 21 proteins were successfully identified by MALDI-TOF/TOF MS. These proteins had functions related to photosynthesis, stress defense, energy metabolism, signal transduction, protein folding and stabilization indicating that LA might play important roles in salinity through the regulation of photosynthesis, stress defense and signal transduction related proteins. The proteomic findings have provided new insight to reveal the effect of LA on salinity stress for the first time. PMID:25841209

  3. Proteomic and biochemical responses of canola (Brassica napus L.) exposed to salinity stress and exogenous lipoic acid.


    Yıldız, Mustafa; Akçalı, Nermin; Terzi, Hakan


    To evaluate the mitigating effects of exogenous lipoic acid (LA) on NaCl toxicity, proteomic, biochemical and physiological changes were investigated in the leaves of canola (Brassica napus L.) seedlings. Salinity stress decreased the growth parameters and contents of ascorbate (AsA) and glutathione (GSH), and increased the contents of malondialdehyde (MDA), proline, cysteine and the activities of antioxidant enzymes such as superoxide dismutase (SOD), guaiacol peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX). The foliar application of LA alleviated the toxic effects of salinity stress on canola seedlings and notably decreased MDA content and increased growth parameters, cysteine content, and activities of CAT and POD. In the proteomic analyses, total proteins from the leaves of control, LA, NaCl and NaCl+LA treated-seedlings were separated using two-dimensional gel electrophoresis (2-DE). A total of 28 proteins were differentially expressed. Of these, 21 proteins were successfully identified by MALDI-TOF/TOF MS. These proteins had functions related to photosynthesis, stress defense, energy metabolism, signal transduction, protein folding and stabilization indicating that LA might play important roles in salinity through the regulation of photosynthesis, stress defense and signal transduction related proteins. The proteomic findings have provided new insight to reveal the effect of LA on salinity stress for the first time.

  4. Tolerability in the elderly population of high-dose alpha lipoic acid: a potential antioxidant therapy for the eye

    PubMed Central

    Sarezky, Daniel; Raquib, Aaishah R; Dunaief, Joshua L; Kim, Benjamin J


    Purpose Alpha lipoic acid (ALA) is an antioxidant and iron-chelating supplement that has potential benefits for geographic atrophy in dry age-related macular degeneration as well as other eye diseases. The purpose of this study was to determine the tolerability of ALA in the elderly population. Patients and methods Fifteen subjects, age ≥65 years, took sequential ALA doses of 600, 800, and 1,200 mg. Each dose was taken once daily with a meal for 5 days. After each dose was taken by the subjects for 5 days, the subjects were contacted by phone, a review of systems was performed, and they were asked if they thought they could tolerate taking that dose of ALA for an extended period of time. Results The 600 mg dose was well tolerated. At the 800 mg dose, one subject had an intolerable flushing sensation. At the 1,200 mg dose, two subjects had intolerable upper gastrointestinal side effects and one subject had an intolerable flushing sensation. Subjects taking gastrointestinal prophylaxis medications had no upper gastrointestinal side effects. Conclusion High-dose ALA is not completely tolerated by the elderly. These preliminary data suggest that gastrointestinal prophylaxis may improve tolerability. (, NCT02613572). PMID:27729766

  5. Lipoic acid does not improve renal function markers in 5/6 nephrectomy model: possible role of Nrf2 inactivation.


    Lo, Sze M; Dal Lin, Fernando T; Soares, Maria F; Hauser, Aline B; Pecoits-Filho, Roberto; Nakao, Lia S


    Chronic kidney disease (CKD) progression and complications are associated with increased oxidative stress, as well as with Nrf2 inactivation. Lipoic acid (LA) has been considered an inducer of Nrf2 antioxidant response. We tested whether oral administration of LA provides beneficial effects in experimental CKD in rats. Wistar rats underwent 5/6 nephrectomy (CKD group) or sham laparotomy. Seven days later, CKD group was divided into three subgroups that received: (i) LA continuously in the drinking water (100 mg/kg/day), (ii) LA by gavage every other day (100 mg/kg), or (iii) no LA treatment. LA treatment lasted until day 60. Plasma urea and creatinine, 24 h-proteinuria, glomerulosclerosis, interstitial fibrosis/tubular atrophy, and Nrf2 activation were analyzed. All parameters measured were significantly altered in the untreated CKD group, compared with the sham group, as expected. Oral LA administration, either in the drinking water or by gavage, did not improve significantly any parameter, comparing the treated-groups with the untreated CKD group. These results indicate that oral LA administration for 53 days was ineffective to reactivate Nrf2 in the remnant kidney of uremic rats, likely preventing improvements in biochemical and histopathological markers of renal function.

  6. Protection against arsenic trioxide-induced autophagic cell death in U118 human glioma cells by use of lipoic acid.


    Cheng, Tain-Junn; Wang, Ying-Jan; Kao, Wei-Wan; Chen, Rong-Jane; Ho, Yuan-Soon


    Arsenic is an environmental toxicant found naturally in ground water. Epidemiological studies have suggested a correlation between chronic arsenic exposure and potential brain tissue damage in clinical case and animal experiments. Lipoic acid (LA) is a thiol-compound naturally occurring in plants and animals, which is thought to be a strong antioxidant and possess neuroprotective effects. The objective of this study was to determine if the AS(2)O(3)-induced glial cell toxicity could be prevented by LA. The human malignant glioma cell (U118) was selected as a research model. By using acridine orange staining and flow cytometry analysis, we found that autophagic, but not apoptotic, cell death was significantly induced by AS(2)O(3) in U118 cells, and that AS(2)O(3)-mediated autophagic cell death was nearly completely attenuated by LA. Down-regulation of p53 and Bax proteins and the up-regulation of Bcl-2 and HSP-70 proteins were observed by western blot in AS(2)O(3)-mediated autophagic cell death. Our results implied that LA completely inhibited U118 cells autophagic cell death induced by AS(2)O(3). We suggested that LA may emerge as a useful protective agent against arsenic-induced glial cell toxicity and reversing arsenic-induced damage in human brain.

  7. Quantification of lipoic acid from skin samples by HPLC using ultraviolet, electrochemical and evaporative light scattering detectors.


    Campos, Patrícia Mazureki; Praça, Fabíola Silva Garcia; Bentley, Maria Vitória Lopes Badra


    Lipoic acid (LA) is an endogenous organosulfur compound with potent antioxidant property. LA is often used as a drug for the treatment of skin disorders. For the accomplishment of topical applications of LA appropriate drug quantification methods are essential. Thus far, no HPLC methods have been reported for the measurement of LA extracted from skin. In this article we report on the development and validation of three sensitive and specific HPLC methods for LA and dihydrolipoic acid (DHLA) using ultraviolet (UV), electrochemical (EC) or evaporative light scattering (ELS) detection. These methods demonstrate different linearity ranges. The chromatographic separations were performed by RP-HPLC (250 × 4 mm, 5 μm) with isocratic elution using an acidic mobile phase for the three detection techniques. The lower limits of detection and quantification were 0.04 and 0.08 ng LA, respectively, for HPLC coupled to ELS, an innovative detector for LA with high sensitivity. The extraction of LA from skin samples showed recoveries greater than 71%. The recovered LA concentrations from stratum corneum and epidermis+dermis layers were: 5.41 ± 0.56 and 4.92 ± 0.33 μg/mL, respectively for HPLC/UV and 6.52 ± 0.49 and 5.01 ± 0.41 μg/mL, respectively, for HPLC/EC for the added LA concentration (6.67 μg/mL), and 8.88 ± 0.46 and 8.95 ± 0.08 μg/mL, respectively, for HPLC/ELS for the added LA concentration (10 μg/mL). These three optimized HPLC methods allowed for a simple, rapid and reliable determination of LA in human skin. They should be useful for the development of drug delivery systems for topical applications of LA.

  8. HFA1 encoding an organelle-specific acetyl-CoA carboxylase controls mitochondrial fatty acid synthesis in Saccharomyces cerevisiae.


    Hoja, Ursula; Marthol, Sandra; Hofmann, Jörg; Stegner, Sabine; Schulz, Rainer; Meier, Sandra; Greiner, Eva; Schweizer, Eckhart


    The Saccharomyces cerevisiae gene, HFA1, encodes a >250-kDa protein, which is required for mitochondrial function. Hfa1p exhibits 72% overall sequence similarity (54% identity) to ACC1-encoded yeast cytoplasmic acetyl-CoA carboxylase. Nevertheless, HFA1 and ACC1 functions are not overlapping because mutants of the two genes have different phenotypes and do not complement each other. Whereas ACC1 is involved in cytoplasmic fatty acid synthesis, the phenotype of hfa1Delta disruptants resembles that of mitochondrial fatty-acid synthase mutants. They fail to grow on lactate or glycerol, and the mitochondrial cofactor, lipoic acid, is reduced to <10% of its normal cellular concentration. Other than Acc1p, the N-terminal sequence of Hfa1p comprises a canonical mitochondrial targeting signal together with a matrix protease cleavage site. Accordingly, the HFA1-encoded protein was specifically assigned by Western blotting of appropriate cell fractions to the mitochondrial compartment. Removal of the mitochondrial targeting sequence abolished the competence of HFA1 DNA to complement hfal null mutants. Conversely and in contrast to the intact HFA1 sequence, the signal sequence-free HFA1 gene complemented the mutational loss of cytoplasmic acetyl-CoA carboxylase. Expression of HFA1 under the control of the ACC1 promoter restored cellular ACC activity in ACC1-defective yeast mutants to wild type levels. From this finding, it is concluded that HFA1 encodes a specific mitochondrial acetyl-CoA carboxylase providing malonyl-CoA for intraorganellar fatty acid and, in particular, lipoic acid synthesis. PMID:14761959

  9. Effect of combination therapy consisting of enalapril, α-lipoic acid, and menhaden oil on diabetic neuropathy in a high fat/low dose streptozotocin treated rat.


    Davidson, Eric P; Holmes, Amey; Coppey, Lawrence J; Yorek, Mark A


    We have previously demonstrated that treating diabetic rats with enalapril, an angiotensin converting enzyme (ACE) inhibitor, α-lipoic acid, an antioxidant, or menhaden oil, a natural source of omega-3 fatty acids can partially improve diabetic peripheral neuropathy. In this study we sought to determine the efficacy of combining these three treatments on vascular and neural complications in a high fat fed low dose streptozotocin treated rat, a model of type 2 diabetes. Rats were fed a high fat diet for 8 weeks followed by a 30 mg/kg dose of streptozotocin. Eight weeks after the onset of hyperglycemia diabetic rats were treated with a combination of enalapril, α-lipoic acid and menhaden oil. Diabetic rats not receiving treatment were continued on the high fat diet. Glucose clearance was impaired in diabetic rats and significantly improved with treatment. Diabetes caused steatosis, elevated serum lipid levels, slowing of motor and sensory nerve conduction, thermal hypoalgesia, reduction in intraepidermal nerve fiber profiles, decrease in cornea sub-basal nerve fiber length and corneal sensitivity and impairment in vascular relaxation to acetylcholine and calcitonin gene-related peptide in epineurial arterioles of the sciatic nerve. Treating diabetic rats with the combination of enalapril, α-lipoic acid and menhaden oil reversed all these deficits to near control levels except for motor nerve conduction velocity which was also significantly improved compared to diabetic rats but remained significantly decreased compared to control rats. These studies suggest that a combination therapeutic approach may be most effective for treating vascular and neural complications of type 2 diabetes.

  10. Complementary Cholesterol-Lowering Response of a Phytosterol/α-Lipoic Acid Combination in Obese Zucker Rats.


    Rideout, Todd C; Carrier, Bradley; Wen, Shin; Raslawsky, Amy; Browne, Richard W; Harding, Scott V


    To investigate the cholesterol-lowering effectiveness of a phytosterol/α-lipoic acid (PS/αLA) therapy, thirty-two male Zucker rats were randomly assigned to 1 of 4 diets for 30 days: (i) high fat diet (HF, 40% energy from fat); (ii) HF diet supplemented with 3% phytosterols; (iii) HF diet supplemented with 0.25% αLA; or (iv) HF diet supplemented with PS (3%) and αLA (0.25%, PS/αLA). Compared with the HF diet, combination PS/αLA proved more effective in reducing non-HDL cholesterol (-55%) than either the PS (-24%) or the αLA (-25%) therapies alone. PS supplementation did not affect LDL particle number, however, αLA supplementation reduced LDL particle number when supplemented alone (-47%) or in combination with PS (-54%). Compared with the HF-fed animals, evidence of increased HDL-particle number was evident in all treatment groups to a similar extent (21-22%). PS-mediated interruption of intestinal cholesterol absorption was evident by increased fecal cholesterol loss (+52%) and compensatory increase in HMG-CoA reductase mRNA (1.6 fold of HF), however, αLA supplementation did not affect fecal cholesterol loss. Hepatic mRNA and protein expression patterns suggested that αLA modulated multiple aspects of cholesterol homeostasis including reduced synthesis (HMG-CoA reductase mRNA, 0.7 fold of HF), reduced bile acid synthesis (CYP7a1 expression, 0.17 of HF), and increased cholesterol clearance (reduced PCSK9 mRNA, 0.5 fold of HF; increased LDLr protein, 2 fold of HF). Taken together, this data suggests that PS and αLA work through unique and complementary mechanisms to provide a superior and more comprehensive cholesterol lowering response than either therapy alone.

  11. α-Lipoic acid interaction with dopamine D2 receptor-dependent activation of the Akt/GSK-3β signaling pathway induced by antipsychotics: potential relevance for the treatment of schizophrenia.


    Deslauriers, Jessica; Desmarais, Christian; Sarret, Philippe; Grignon, Sylvain


    Chronic administration of antipsychotics has been associated with dopamine D2 receptor (D2R) upregulation and tardive dyskinesia. We have previously shown that haloperidol, a first-generation antipsychotic (FGA), exerted an increase in D2R expression and oxidative stress and that (±)-α-lipoic acid reversed its effect. Previous studies have implicated the Akt/glycogen synthase kinase-3β (GSK-3β) signaling pathway in antipsychotic action. These findings led us to examine whether the Akt/GSK-3β pathway was involved in D2R upregulation and oxidative stress elicited by antipsychotics and, in (±)-α-lipoic acid-induced reversal of these phenomena, in SH-SY5Y cells. Antipsychotics increased phosphorylation of Akt and GSK-3β, and additive effects were observed with (±)-α-lipoic acid. GSK-3β inhibitors reversed haloperidol-induced overexpression of D2R mRNA levels but did not affect haloperidol-induced oxidative stress. Sustained antipsychotic treatment increased β-arrestin-2 and D2R receptor interaction. Regarding Akt/GSK-3β downstream targets, antipsychotics increased β-catenin levels, whereas (±)-α-lipoic acid induced an elevation of mTOR activation. These results suggest (1) that the effect of antipsychotics on the Akt/GSK-3β pathway in SH-SY5Y cells is reminiscent of their in vivo action, (2) that (±)-α-lipoic acid partially synergizes with antipsychotic drugs (APDs) on the same pathway, and (3) that the Akt/GSK-3β signaling cascade is not involved in the preventive effect of (±)-α-lipoic acid on antipsychotics-induced D2R upregulation.

  12. Lipoic acid and pentoxifylline mitigate nandrolone decanoate-induced neurobehavioral perturbations in rats via re-balance of brain neurotransmitters, up-regulation of Nrf2/HO-1 pathway, and down-regulation of TNFR1 expression.


    Ahmed, Maha A E; El-Awdan, Sally A


    Behavioral perturbations associated with nandrolone decanoate abuse by athletes and adolescents may be attributed to oxidative stress and inflammation. However, the underlying mechanisms are not yet fully explored. On the other hand, the natural antioxidant lipoic acid can pass the blood brain barrier and enhance Nrf2/HO-1 (nuclear factor erythroid-2 related factor 2/heme oxygenase-1) pathway. In addition, the phosphodiesterase-IV inhibitor xanthine derivative pentoxifylline has a remarkable inhibitory effect on tumor necrosis factor-alpha (TNF-α). Therefore, this study aimed at investigation of the possible protective effects of lipoic acid and/or pentoxifylline against nandrolone-induced neurobehavioral alterations in rats. Accordingly, male albino rats were randomly distributed into seven groups and treated with either vehicle, nandrolone (15mg/kg, every third day, s.c.), lipoic acid (100mg/kg/day, p.o.), pentoxifylline (200mg/kg/day, i.p.), or nandrolone with lipoic acid and/or pentoxifylline. Rats were challenged in the open field, rewarded T-maze, Morris water maze, and resident-intruder aggression behavioral tests. The present findings showed that nandrolone induced hyperlocomotion, anxiety, memory impairment, and aggression in rats. These behavioral abnormalities were accompanied by several biochemical changes, including altered levels of brain monoamines, GABA, and acetylcholine, enhanced levels of malondialdehyde and TNF-α, elevated activity of acetylcholinesterase, and up-regulated expression of TNF-α receptor-1 (TNFR1). In addition, inhibited catalase activity, down-regulated Nrf2/HO-1 pathway, and suppressed acetylcholine receptor expression were observed. Lipoic acid and pentoxifylline combination significantly mitigated all the previously mentioned deleterious effects mainly via up-regulation of Nrf2/HO-1 pathway, inhibition of TNF-α and down-regulation of TNFR1 expression. In conclusion, the biochemical and histopathological findings of this

  13. Curcumin, Silybin Phytosome(®) and α-R-Lipoic Acid Mitigate Chronic Hepatitis in Rat by Inhibiting Oxidative Stress and Inflammatory Cytokines Production.


    Ali, Shimaa O; Darwish, Hebatallah A; Ismail, Nabila A


    Chronic hepatitis is recognized as a worldwide health problem that gradually progresses towards cirrhosis and hepatocellular carcinoma. Despite the large number of experiments using animal models for allergic hepatitis, it is still difficult to produce a picture of chronic hepatitis. Therefore, this study was conducted to introduce an animal model approximating to the mechanism of chronicity in human hepatitis. The study also aimed to examine the hepatoprotective effects of curcumin, silybin phytosome(®) and α-R-lipoic acid against thioacetamide (TAA)-induced chronic hepatitis in rat model. TAA was administered intraperitoneally at a dose of 200 mg/kg three times weekly for 4 weeks. At the end of this period, a group of rats was killed to assess the development of chronic hepatitis in comparison with their respective control group. TAA administration was then discontinued, and the remaining animals were subsequently allocated into four groups. Group 1 was left untreated, whereas groups 2-4 were allowed to receive daily oral doses of curcumin, silybin phytosome(®) or α-R-lipoic acid, respectively, for 7 weeks. Increases in hepatic levels of malondialdehyde associated with TAA administration were inhibited in groups receiving supplements. Furthermore, glutathione depletion, collagen deposition, macrophage activation and nuclear factor κappa-B expression as well as tumour necrosis factor-α and interleukin-6 levels were significantly decreased in response to supplements administration. Serological analysis of liver function and liver histopathological examination reinforced the results. The above evidence collectively indicates that the antioxidant and anti-inflammatory activities of curcumin, silybin phytosome(®) and α-R-lipoic acid may confer therapeutic efficacy against chronic hepatitis.

  14. Mapping the response of human fibroblast growth factor 21 (FGF21) promoter to serum availability and lipoic acid in HepG2 hepatoma cells.


    Xia, Mengna; Erickson, Anjeza; Yi, Xiaohua; Moreau, Régis


    The hormone-like polypeptide, fibroblast growth factor 21 (FGF21), is a major modulator of lipid and glucose metabolism and an exploratory treatment strategy for obesity related metabolic disorders. The costs of recombinant FGF21 and mode of delivery by injection are important constraints to its wide therapeutic use. The stimulation of endogenous FGF21 production through diet is being explored as an alternative approach. To that end, we examined the mechanism(s) by which serum manipulation and lipoic acid (a dietary activator of FGF21) induce FGF21 in human hepatocellular carcinoma HepG2 cells. Serum withdrawal markedly induced FGF21 mRNA levels (88 fold) and FGF21 secreted in the media (19 fold). Lipoic acid induced FGF21 mRNA 7 fold above DMSO-treated control cells and FGF21 secretion 3 fold. These effects were several-fold greater than those of PPARα agonist, Wy14643, which failed to induce FGF21 above and beyond the induction seen with serum withdrawal. The use of transcription inhibitor, actinomycin D, revealed that de novo mRNA synthesis drives FGF21 secretion in response to serum starvation. Four previously unrecognized loci in FGF21 promoter were nucleosome depleted and enriched in acetylated histone H3 revealing their role as transcriptional enhancers and putative transcription factor binding sites. FGF21 did not accumulate to a significant degree in induced HepG2 cells, which secreted FGF21 time dependently in media. We conclude that lipoic acid cell signaling connects with the transcriptional upregulation of FGF21 and it may prove to be a safe and affordable means to stimulate FGF21 production. PMID:26691139

  15. Protective Efficacy of Alpha-lipoic Acid against AflatoxinB1-induced Oxidative Damage in the Liver

    PubMed Central

    Li, Y.; Ma, Q. G.; Zhao, L. H.; Guo, Y. Q.; Duan, G. X.; Zhang, J. Y.; Ji, C.


    Alpha-lipoic acid (α-LA) is not only involved in energy metabolism, but is also a powerful antioxidant that can protect against hepatic oxidative stress induced by some drugs, toxins, or under various physiological and pathophysiological conditions. Here, we investigated the effect of α-LA against liver oxidative damage in broilers exposed to aflatoxin B1 (AFB1). Birds were randomly divided into four groups and assigned different diets: basal diet, 300 mg/kg α-LA supplementation in basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1, for 3 weeks. The results revealed that the addition of 300 mg/kg α-LA protected against the liver function damage of broilers induced by chronic low dose of AFB1 as estimated by a significant (p<0.05) change in levels of plasma total protein, albumin, alkaline phosphatase and the activities of liver glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase. The histopathological analysis also showed that liver tissues were injured in the AFB1 diet, but this effect was alleviated by the addition of 300 mg/kg α-LA. Additionally, AFB1 induced a profound elevation of oxidative stress in birds, as indicated by an increase in malondialdehyde level, a decrease in glutathione peroxidase activity and a depletion of the glutathione content in the liver. All of these negative effects were inhibited by treatment with α-LA. Our results suggest that the inhibition of AFB1-induced excess production of lipid peroxides and the maintenance of intracellular antioxidant status may play important roles in the protective effects of α-LA against AFB1-induced oxidative damage in the liver. PMID:25050030

  16. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: a pilot study.


    Keith, Dove J; Butler, Judy A; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L; Christensen, J Mark; Pereira, Cliff; Hagen, Tory M


    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age=32 years) and older adults (average age=79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen.

  17. Alpha-lipoic acid-mediated activation of muscarinic receptors improves hippocampus- and amygdala-dependent memory.


    Mahboob, Aamra; Farhat, Syeda Mehpara; Iqbal, Ghazala; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf; Nabavi, Seyed Mohammad; Ahmed, Touqeer


    Aluminum (Al) is a neurotoxic agent which readily crosses the blood-brain-barrier (BBB) and accumulates in the brain leading to neurodegenerative disorders, characterised by cognitive impairment. Alpha-lipoic acid (ALA) is an antioxidant and has a potential to improve cognitive functions. This study aimed to evaluate the neuroprotective effect of ALA in AlCl3-induced neurotoxicity mouse model. Effect of ALA (25mg/kg/day) was evaluated in the AlCl3-induced neurotoxicity (AlCl3 150 mg/kg/day) mouse model on learning and memory using behaviour tests and on the expression of muscarinic receptor genes (using RT-PCR), in hippocampus and amygdala. Following ALA treatment, the expression of muscarinic receptor genes M1, M2 and choline acetyltransferase (ChaT) were significantly improved (p<0.05) relative to AlCl3-treated group. ALA enhanced fear memory (p<0.01) and social novelty preference (p<0.001) comparative to the AlCl3-treated group. Fear extinction memory was remarkably restored (p<0.001) in ALA-treated group demonstrated by reduced freezing response as compared to the AlCl3-treated group which showed higher freezing. In-silico analysis showed that racemic mixture of ALA has higher binding affinity for M1 and M2 compared to acetylcholine. These novel findings highlight the potential role of ALA in cognitive functions and cholinergic system enhancement thus presenting it an enviable therapeutic candidate for the treatment of neurodegenerative disorders.

  18. Structural Analysis of Crystalline R(+)-α-Lipoic Acid-α-cyclodextrin Complex Based on Microscopic and Spectroscopic Studies.


    Ikuta, Naoko; Endo, Takatsugu; Hosomi, Shota; Setou, Keita; Tanaka, Shiori; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Takahashi, Kenji; Terao, Keiji; Matsugo, Seiichi


    R(+)-α-lipoic acid (RALA) is a naturally-occurring substance, and its protein-bound form plays significant role in the energy metabolism in the mitochondria. RALA is vulnerable to a variety of physical stimuli, including heat and UV light, which prompted us to study the stability of its complexes with cyclodextrins (CDs). In this study, we have prepared and purified a crystalline RALA-αCD complex and evaluated its properties in the solid state. The results of ¹H NMR and PXRD analyses indicated that the crystalline RALA-αCD complex is a channel type complex with a molar ratio of 2:3 (RALA:α-CD). Attenuated total reflection/Fourier transform infrared analysis of the complex showed the shift of the C=O stretching vibration of RALA due to the formation of the RALA-αCD complex. Raman spectroscopic analysis revealed the significant weakness of the S-S and C-S stretching vibrations of RALA in the RALA-αCD complex implying that the dithiolane ring of RALA is almost enclosed in glucose ring of α-CD. Extent of this effect was dependent on the direction of the excitation laser to the hexagonal morphology of the crystal. Solid-state NMR analysis allowed for the chemical shift of the C=O peak to be precisely determined. These results suggested that RALA was positioned in the α-CD cavity with its 1,2-dithiolane ring orientated perpendicular to the plane of the α-CD ring.

  19. Effects of alpha-lipoic acid on chemerin secretion in 3T3-L1 and human adipocytes.


    Prieto-Hontoria, Pedro L; Pérez-Matute, Patricia; Fernández-Galilea, Marta; López-Yoldi, Miguel; Sinal, Christopher J; Martínez, J Alfredo; Moreno-Aliaga, María J


    Chemerin is a novel adipokine associated with obesity and insulin resistance. α-Lipoic acid (α-LA) has shown beneficial properties on diabetes and obesity. The aim of this study was to examine the effects of α-LA on chemerin production in adipocytes in absence or presence of TNF-α, insulin and AICAR. The potential signaling pathways involved in α-LA effects on chemerin were also analyzed. α-LA actions on chemerin were tested in differentiated 3T3-L1 adipocytes and in some cases in human subcutaneous and omental adipocytes. Chemerin mRNA levels were measured by RT-PCR and the amount of chemerin secreted to culture media was determined by ELISA. α-LA induced a concentration-dependent inhibition on both chemerin secretion and mRNA levels in 3T3-L1 adipocytes. The AMPK activator AICAR and the PI3K inhibitor LY294002 dramatically abrogated both chemerin secretion and gene expression, and further potentiated the inhibitory effect of α-LA on chemerin secretion. Insulin was able to partially reverse the inhibitory action of α-LA on chemerin secretion. α-LA also reduced basal chemerin secretion in both subcutaneous and omental adipocytes from overweight/obese subjects. Moreover, α-LA was able to abolish the stimulatory effects of the pro-inflammatory cytokine TNF-α on chemerin secretion. Our data demonstrated the ability of α-LA to inhibit chemerin production, an adipokine associated to obesity and metabolic syndrome, suggesting that the reduction of chemerin could contribute to the antiobesity/antidiabetic properties described for α-LA.

  20. Evidence for protective effect of lipoic acid and desvenlafaxine on oxidative stress in a model depression in mice.


    Silva, Márcia Calheiros Chaves; de Sousa, Caren Nádia Soares; Gomes, Patrícia Xavier Lima; de Oliveira, Gersilene Valente; Araújo, Fernanda Yvelize Ramos; Ximenes, Naiara Coelho; da Silva, Jéssica Calheiros; Vasconcelos, Germana Silva; Leal, Luzia Kalyne Almeida Moreira; Macêdo, Danielle; Vasconcelos, Silvânia Maria Mendes


    Oxidative stress is implicated in the neurobiology of depression. Here we investigated oxidative alterations in brain areas of animals submitted to the model of depression induced by corticosterone (CORT) and the effects of the antioxidant compound alpha-lipoic acid (ALA) alone or associated with the antidepressant desvenlafaxine (DVS) in these alterations. Female mice received vehicle or CORT (20 mg/kg) during 14 days. From the 15th to 21st days different animals received further administrations of: vehicle, DVS (10 or 20 mg/kg), ALA (100 or 200 mg/kg), or the combinations of DVS10+ALA100, DVS20+ALA100, DVS10+ALA200, or DVS20+ALA200. Twenty-four hours after the last drug administration prefrontal cortex (PFC), hippocampus (HC) and striatum (ST) were dissected for the determination of the activity of superoxide dismutase (SOD), reduced glutathione (GSH) and lipid peroxidation (LP) levels. CORT significantly increased SOD activity in the PFC and HC, decreased GSH levels in the HC and increased LP in all brain areas studied when compared to saline-treated animals. Decrements of SOD activity were observed in all groups and brain areas studied when compared to controls and CORT. The hippocampal decrease in GSH was reversed by ALA100, DVS10+ALA100, DVS20+ALA100 and DVS20+ALA200. The same DVS+ALA combination groups presented increased levels of GSH in the PFC and ST. The greater GSH levels were observed in the PFC, HC and ST of DVS20+ALA200 mice. LP was reversed in the groups ALA200 (PFC), DVS10+ALA100, DVS20+ALA100 (PFC, HC and ST), and DVS20+ALA200 (PFC, HC). Our findings contribute to the previous preclinical evidences implicating ALA as a promising agent for augmentation therapy in depression.

  1. Effects of alpha-lipoic acid on chemerin secretion in 3T3-L1 and human adipocytes.


    Prieto-Hontoria, Pedro L; Pérez-Matute, Patricia; Fernández-Galilea, Marta; López-Yoldi, Miguel; Sinal, Christopher J; Martínez, J Alfredo; Moreno-Aliaga, María J


    Chemerin is a novel adipokine associated with obesity and insulin resistance. α-Lipoic acid (α-LA) has shown beneficial properties on diabetes and obesity. The aim of this study was to examine the effects of α-LA on chemerin production in adipocytes in absence or presence of TNF-α, insulin and AICAR. The potential signaling pathways involved in α-LA effects on chemerin were also analyzed. α-LA actions on chemerin were tested in differentiated 3T3-L1 adipocytes and in some cases in human subcutaneous and omental adipocytes. Chemerin mRNA levels were measured by RT-PCR and the amount of chemerin secreted to culture media was determined by ELISA. α-LA induced a concentration-dependent inhibition on both chemerin secretion and mRNA levels in 3T3-L1 adipocytes. The AMPK activator AICAR and the PI3K inhibitor LY294002 dramatically abrogated both chemerin secretion and gene expression, and further potentiated the inhibitory effect of α-LA on chemerin secretion. Insulin was able to partially reverse the inhibitory action of α-LA on chemerin secretion. α-LA also reduced basal chemerin secretion in both subcutaneous and omental adipocytes from overweight/obese subjects. Moreover, α-LA was able to abolish the stimulatory effects of the pro-inflammatory cytokine TNF-α on chemerin secretion. Our data demonstrated the ability of α-LA to inhibit chemerin production, an adipokine associated to obesity and metabolic syndrome, suggesting that the reduction of chemerin could contribute to the antiobesity/antidiabetic properties described for α-LA. PMID:26721419

  2. Alpha-lipoic acid affects the oxidative stress in various brain structures in mice with methionine and choline deficiency.


    Veskovic, Milena; Mladenovic, Dusan; Jorgacevic, Bojan; Stevanovic, Ivana; de Luka, Silvio; Radosavljevic, Tatjana


    Deficiency in methionine or choline can induce oxidative stress in various organs such as liver, kidney, heart, and brain. This study was to examine the effects of alpha-lipoic acid (LA) on oxidative stress induced by methionine and choline deficiency (MCD) in several brain structures. Male mice C57BL/6 (n = 28) were divided into four groups: (1) control - continuously fed with standard chow; (2) LA - fed with standard chow and receiving LA; (3) MCD2 - fed with MCD diet for two weeks, and (4) MCD2+LA - fed with MCD diet for two weeks and receiving LA (100 mg/kg/day intraperitonealy [i.p.]). Brain tissue (cortex, hypothalamus, striatum and hippocampus) was taken for determination of oxidative stress parameters. MCD diet induced a significant increase in malondialdehyde and NOx concentration in all brain regions, while LA restored their content to normal values. Similar to this, in MCD2 group, activity of total SOD, MnSOD, and Cu/ZnSOD was reduced by MCD diet, while LA treatment improved their activities in all brain structures. Besides, in MCD2 group a decrease in catalase activity in cortex and GSH content in hypothalamus was evident, while LA treatment induced an increase in catalase activity in cortex and striatum and GSH content in hypothalamus. LA treatment can significantly reduce lipid peroxidation and nitrosative stress, caused by MCD diet, in all brain regions by restoring antioxidant enzymes activities, predominantly total SOD, MnSOD, and Cu/ZnSOD, and to a lesser extent by modulating catalase activity and GSH content. LA supplementation may be used in order to prevent brain oxidative injury induced by methionine and choline deficiency.

  3. Flaxseed oil and alpha-lipoic acid combination ameliorates hepatic oxidative stress and lipid accumulation in comparison to lard

    PubMed Central


    Background Intake of high-fat diet is associated with increased non-alcoholic fatty liver disease (NAFLD). Hepatic lipid accumulation and oxidative stress are key pathophysiological mechanisms in NAFLD. Both flaxseed oil (FO) and α-lipoic acid (LA) exert potential benefit to NAFLD. The aim of this study was to determine the effect of the combination of FO and LA on hepatic lipid accumulation and oxidative stress in rats induced by high-fat diet. Methods LA was dissolved in flaxseed oil to a final concentration of 8 g/kg (FO + LA). The rodent diet contained 20% fat. One-fifth of the fat was soybean oil and the others were lard (control group), or 75% lard and 25% FO + LA (L-FO + LA group), or 50% lard and 50% FO + LA (M-FO + LA group), or FO + LA (H-FO + LA group). Male Sprague–Dawley rats were fed for 10 weeks and then killed for liver collection. Results Intake of high-fat lard caused a significant hepatic steatosis. Replacement with FO + LA was effective in reducing steatosis as well as total triglyceride and total cholesterol contents in liver. The combination of FO and LA also significantly elevated hepatic antioxidant defense capacities, as evaluated by the remarkable increase in the activities of SOD, CAT and GPx as well as the level of GSH, and the significant decline in lipid peroxidation. Conclusion The combination of FO and LA may contribute to prevent fatty livers such as NAFLD by ameliorating hepatic lipid accumulation and oxidative stress. PMID:23634883

  4. Alpha-lipoic acid affects the oxidative stress in various brain structures in mice with methionine and choline deficiency

    PubMed Central

    Veskovic, Milena; Mladenovic, Dusan; Jorgacevic, Bojan; Stevanovic, Ivana; de Luka, Silvio


    Deficiency in methionine or choline can induce oxidative stress in various organs such as liver, kidney, heart, and brain. This study was to examine the effects of alpha-lipoic acid (LA) on oxidative stress induced by methionine and choline deficiency (MCD) in several brain structures. Male mice C57BL/6 (n = 28) were divided into four groups: (1) control – continuously fed with standard chow; (2) LA – fed with standard chow and receiving LA; (3) MCD2 – fed with MCD diet for two weeks, and (4) MCD2+LA – fed with MCD diet for two weeks and receiving LA (100 mg/kg/day intraperitonealy [i.p.]). Brain tissue (cortex, hypothalamus, striatum and hippocampus) was taken for determination of oxidative stress parameters. MCD diet induced a significant increase in malondialdehyde and NOx concentration in all brain regions, while LA restored their content to normal values. Similar to this, in MCD2 group, activity of total SOD, MnSOD, and Cu/ZnSOD was reduced by MCD diet, while LA treatment improved their activities in all brain structures. Besides, in MCD2 group a decrease in catalase activity in cortex and GSH content in hypothalamus was evident, while LA treatment induced an increase in catalase activity in cortex and striatum and GSH content in hypothalamus. LA treatment can significantly reduce lipid peroxidation and nitrosative stress, caused by MCD diet, in all brain regions by restoring antioxidant enzymes activities, predominantly total SOD, MnSOD, and Cu/ZnSOD, and to a lesser extent by modulating catalase activity and GSH content. LA supplementation may be used in order to prevent brain oxidative injury induced by methionine and choline deficiency. PMID:25193852

  5. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: a pilot study.


    Keith, Dove J; Butler, Judy A; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L; Christensen, J Mark; Pereira, Cliff; Hagen, Tory M


    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age=32 years) and older adults (average age=79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen. PMID:22609537

  6. Age and gender dependent bioavailability of R- and R,S-α-lipoic acid: A pilot study

    PubMed Central

    Keith, Dove J.; Butler, Judy A.; Bemer, Brett; Dixon, Brian; Johnson, Shawn; Garrard, Mary; Sudakin, Daniel L.; Christensen, J. Mark; Pereira, Cliff; Hagen, Tory M.


    Lipoic acid (LA) shows promise as a beneficial micronutrient toward improving elder health. Studies using old rats show that (R)-α-LA (R-LA) significantly increases low molecular weight antioxidants that otherwise decline with age. Despite this rationale for benefiting human health, little is known about age-associated alterations in absorption characteristics of LA, or whether the commercially available racemic mixture of LA (R,S-LA) is equally as bioavailable as the naturally occurring R-enantiomer. To address these discrepancies, a pilot study was performed to establish which form of LA is most effectively absorbed in older subjects relative to young volunteers. Young adults (average age = 32 years) and older adults (average age = 79 years) each received 500 mg of either R- or R,S-LA. Blood samples were collected for 3 h after supplementation. After a washout period they were given the other chiral form of LA not originally ingested. Results showed that 2 out of 6 elder males exhibited greater maximal plasma LA and area under the curve for the R-form of LA versus the racemic mixture. The elder subjects also demonstrated a reduced time to reach maximal plasma LA concentration following R-LA supplementation than for the racemic mixture. In contrast, young males had a tendency for increased bioavailability of R,S-LA. Overall, bioavailability for either LA isoform was much more variable between older subjects compared to young adults. Plasma glutathione levels were not altered during the sampling period. Thus subject age, and potential for varied response, should be considered when determining an LA supplementation regimen. PMID:22609537

  7. Structural Analysis of Crystalline R(+)-α-Lipoic Acid-α-cyclodextrin Complex Based on Microscopic and Spectroscopic Studies

    PubMed Central

    Ikuta, Naoko; Endo, Takatsugu; Hosomi, Shota; Setou, Keita; Tanaka, Shiori; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Takahashi, Kenji; Terao, Keiji; Matsugo, Seiichi


    R(+)-α-lipoic acid (RALA) is a naturally-occurring substance, and its protein-bound form plays significant role in the energy metabolism in the mitochondria. RALA is vulnerable to a variety of physical stimuli, including heat and UV light, which prompted us to study the stability of its complexes with cyclodextrins (CDs). In this study, we have prepared and purified a crystalline RALA-αCD complex and evaluated its properties in the solid state. The results of 1H NMR and PXRD analyses indicated that the crystalline RALA-αCD complex is a channel type complex with a molar ratio of 2:3 (RALA:α-CD). Attenuated total reflection/Fourier transform infrared analysis of the complex showed the shift of the C=O stretching vibration of RALA due to the formation of the RALA-αCD complex. Raman spectroscopic analysis revealed the significant weakness of the S–S and C–S stretching vibrations of RALA in the RALA-αCD complex implying that the dithiolane ring of RALA is almost enclosed in glucose ring of α-CD. Extent of this effect was dependent on the direction of the excitation laser to the hexagonal morphology of the crystal. Solid-state NMR analysis allowed for the chemical shift of the C=O peak to be precisely determined. These results suggested that RALA was positioned in the α-CD cavity with its 1,2-dithiolane ring orientated perpendicular to the plane of the α-CD ring. PMID:26501268

  8. Nucleic acid compositions and the encoding proteins

    SciTech Connect

    Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.


    The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

  9. Effect of vitamin C and lipoic acid on streptozotocin-induced diabetes gene expression: mRNA and protein expressions of Cu-Zn SOD and catalase.


    Sadi, Gökhan; Yilmaz, Okkes; Güray, Tülin


    The involvement of oxidative stress in the pathogenesis of diabetes mellitus has been confirmed by numerous studies. In this study, the expression of two antioxidant enzymes, superoxide dismutase (SOD), and catalase which are involved in the detoxification of reactive oxygen species was studied in the streptozotocin-induced diabetic rat liver tissues. The enzyme assays showed a significant decrease in both enzymes activities compared to control animals. The RT-PCR and Western-blot analysis results demonstrated that this decrease in activity is regulated at the level of gene expression, as both catalase and Cu-Zn SOD mRNA and protein expressions were also suppressed. Supplementing the animals with vitamin C, a powerful antioxidant increased both SOD and catalase activities with no change in both mRNA and protein expressions suggesting a role of post-translational modification. However, even though mRNA expressions of both catalase and Cu-Zn SOD were not changed, the protein levels increased in parallel to activities in the case of another antioxidant, alpha-lipoic acid. An increase in the rate of translation, without changing the rate of transcription indicates a translational effect of lipoic acid in changing the activities of antioxidant enzymes to prevent the oxidative damage in diabetes.

  10. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging

    PubMed Central

    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida


    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA. PMID:26788510

  11. Rheology as a Tool to Predict the Release of Alpha-Lipoic Acid from Emulsions Used for the Prevention of Skin Aging.


    Isaac, Vera Lucia Borges; Chiari-Andréo, Bruna Galdorfini; Marto, Joana Marques; Moraes, Jemima Daniela Dias; Leone, Beatriz Alves; Corrêa, Marcos Antonio; Ribeiro, Helena Margarida


    The availability of an active substance through the skin depends basically on two consecutive steps: the release of this substance from the vehicle and its subsequent permeation through the skin. Hence, studies on the specific properties of vehicles, such as their rheological behavior, are of great interest in the field of dermatological products. Recent studies have shown the influence of the rheological features of a vehicle on the release of drugs and active compounds from the formulation. In this context, the aim of this study was to evaluate the influence of the rheological features of two different emulsion formulations on the release of alpha-lipoic acid. Alpha-lipoic acid (ALA) was chosen for this study because of its antioxidant characteristics, which could be useful for the prevention of skin diseases and aging. The rheological and mechanical behavior and the in vitro release profile were assayed. The results showed that rheological features, such as viscosity, thixotropy, and compliance, strongly influenced the release of ALA from the emulsion and that the presence of a hydrophilic polymer in one of the emulsions was an important factor affecting the rheology and, therefore, the release of ALA.

  12. Clinical Usefulness of Oral Supplementation with Alpha-Lipoic Acid, Curcumin Phytosome, and B-Group Vitamins in Patients with Carpal Tunnel Syndrome Undergoing Surgical Treatment

    PubMed Central

    Pajardi, Giorgio; Bortot, Paola; Ponti, Veronica; Novelli, Chiara


    We investigated the clinical usefulness of oral supplementation with a combination product containing alpha-lipoic acid, curcumin phytosome, and B-group vitamins in 180 patients with carpal tunnel syndrome (CTS), scheduled to undergo surgical decompression of the median nerve. Patients in Group A (n = 60) served as controls and did not receive any treatment either before or after surgery. Patients in Group B (n = 60) received oral supplementation twice a day for 3 months both before and after surgery (totaling 6 months of supplementation). Patients in Group C (n = 60) received oral supplementation twice a day for 3 months before surgery only. Patients in Group B showed significantly lower nocturnal symptoms scores compared with Group A subjects at both 40 days and 3 months after surgery (both P values <0.05). Moreover, patients in Group B had a significantly lower number of positive Phalen's tests at 3 months compared with the other study groups (P < 0.05). We conclude that oral supplementation with alpha-lipoic acid, curcumin phytosome, and B-group vitamins twice a day both before and after surgery is safe and effective in CTS patients scheduled to undergo surgical decompression of the median nerve. PMID:24563654

  13. A Regenerative Antioxidant Protocol of Vitamin E and α-Lipoic Acid Ameliorates Cardiovascular and Metabolic Changes in Fructose-Fed Rats

    PubMed Central

    Patel, Jatin; Matnor, Nur Azim; Iyer, Abishek; Brown, Lindsay


    Type 2 diabetes is a major cause of cardiovascular disease. We have determined whether the metabolic and cardiovascular changes induced by a diet high in fructose in young adult male Wistar rats could be prevented or reversed by chronic intervention with natural antioxidants. We administered a regenerative antioxidant protocol using two natural compounds: α-lipoic acid together with vitamin E (α-tocopherol alone or a tocotrienol-rich fraction), given as either a prevention or reversal protocol in the food. These rats developed glucose intolerance, hypertension, and increased collagen deposition in the heart together with an increased ventricular stiffness. Treatment with a fixed combination of vitamin E (either α-tocopherol or tocotrienol-rich fraction, 0.84 g/kg food) and α-lipoic acid (1.6 g/kg food) normalized glucose tolerance, blood pressure, cardiac collagen deposition, and ventricular stiffness in both prevention and reversal protocols in these fructose-fed rats. These results suggest that adequate antioxidant therapy can both prevent and reverse the metabolic and cardiovascular damage in type 2 diabetes. PMID:21437191

  14. Alpha-lipoic acid effects on brain glial functions accompanying double-stranded RNA antiviral and inflammatory signaling.


    Scumpia, Philip O; Kelly-Scumpia, Kindra; Stevens, Bruce R


    Double-stranded RNAs (dsRNA) serve as viral ligands that trigger innate immunity in astrocytes and microglial, as mediated through Toll-like receptor 3 (TLR3) and dsRNA-dependent protein kinase (PKR). Beneficial transient TLR3 and PKR anti-viral signaling can become deleterious when events devolve into inflammation and cytotoxicity. Viral products in the brain cause glial cell dysfunction, and are a putative etiologic factor in neuropsychiatric disorders, notably schizophrenia, bipolar disorder, Parkinson's, and autism spectrum. Alpha-lipoic acid (LA) has been proposed as a possible therapeutic neuroprotectant. The objective of this study was to test our hypothesis that LA can control untoward antiviral mechanisms associated with neural dysfunction. Utilizing rat brain glial cultures (91% astrocytes:9% microglia) treated with PKR- and TLR3-ligand/viral mimetic dsRNA, polyinosinic-polycytidylic acid (polyI:C), we report in vitro glial antiviral signaling and LA reduction of the effects of this signaling. LA blunted the dsRNA-stimulated expression of IFNα/β-inducible genes Mx1, PKR, and TLR3. And in polyI:C treated cells, LA promoted gene expression of rate-limiting steps that benefit healthy neural redox status in glutamateric systems. To this end, LA decreased dsRNA-induced inflammatory signaling by downregulating IL-1β, IL-6, TNFα, iNOS, and CAT2 transcripts. In the presence of polyI:C, LA prevented cultured glial cytotoxicity which was correlated with increased expression of factors known to cooperatively control glutamate/cystine/glutathione redox cycling, namely glutamate uptake transporter GLAST/EAAT1, γ-glutamyl cysteine ligase catalytic and regulatory subunits, and IL-10. Glutamate exporting transporter subunits 4F2hc and xCT were downregulated by LA in dsRNA-stimulated glia. l-Glutamate net uptake was inhibited by dsRNA, and this was relieved by LA. Glutathione synthetase mRNA levels were unchanged by dsRNA or LA. This study demonstrates the protective

  15. [The effect of long-chain polyunsaturated higher ω-3 fatty acids, benfotiamine and α-lipoic acid on the lipid metabolism in patients with diabetes mellitus type 2 and cardiovascular autonomic neuropathy].


    Sergienko, V A; Segin, V B; Samir, A; Sergienko, A A


    Eighty-one patients with diabetes mellitus type 2 (DM) and cardiovascular autonomic neuropathy were studied. The combined treatment with ω-3 PUFA, benfotiamine, and α-lipoic acid resulted in significant positive changes in total cholesterol, triacylglycerol, LDL and HDL cholesterol levels. The efficacy of this treatment was not associated with the improved compensation of DM but was a result of the direct influence of pharmacological agents on the metabolic rate studied.

  16. The clinical efficacy of cosmeceutical application of liquid crystalline nanostructured dispersions of alpha lipoic acid as anti-wrinkle.


    Sherif, Saly; Bendas, Ehab R; Badawy, Sabry


    Topical 5% alpha lipoic acid (ALA) has shown efficacy in treatment of photo-damaged skin. The aim of this work was to evaluate the potential of poloxamer (P407) gel as a vehicle for the novel lipid base particulate system (cubosome dispersions) of ALA. Cubosome dispersions were formulated by two different approaches, emulsification of glyceryl monoolein (GMO) and poloxamer (P407) in water followed by ultrasonication, and the dilution method using a hydrotrope. Three different concentrations of GMO were used to formulate the cubosome dispersions using the first method, 5% (D1), 10% (D2) and 15% w/w (D3). In the second technique an isotropic liquid was produced by combining GMO with ethanol, and this isotropic liquid was then diluted with a P407 solution (D4). The dispersions were characterized by zeta potential, light scattering techniques, optical and transmission electron microscopy, encapsulation efficiency and in vitro drug release. Results showed that D4 was not a uniform dispersion and that D1, D2 and D3 were uniform dispersions, in which by increasing the GMO content in the dispersion, the size of the cubosomes decreased, zeta potential became more negative, encapsulation efficiency increased up to 86.48% and the drug release rate was slower. P407 gels were prepared using the cold method. Two concentrations of P407 gel were fabricated, 20 and 30% w/w. P407 gels were loaded with either ALA or dispersions containing ALA cubosomes. P407 gels were characterized by critical gelation temperature, rheological measurements and in vitro drug release studies. Results suggested that by increasing P407 concentration, the gelation temperature decreases and viscosity increases. Drug release in both cases was found to follow the Higuchi square root model. Gel loaded with ALA cubosomes provided a significantly lower release rate than the gel loaded with the un-encapsulated ALA. A double blinded placebo controlled clinical study was conducted, aiming to evaluate the efficacy

  17. Stability of vitamin C derivatives in topical formulations containing lipoic acid, vitamins A and E.


    Segall, A I; Moyano, M A


    The stability of ascorbyl palmitate, sodium ascorbyl phosphate and magnesium ascorbyl phosphate in topical formulations was investigated by direct reverse phase high performance liquid chromatography after sample dilution with a suitable buffer - organic solvent mixture. Ascorbyl palmitate, sodium ascorbyl phosphate and magnesium ascorbyl phosphate are derivatives of ascorbic acid which differ in hydrolipophilic properties. They are widely used in cosmetic and pharmaceutical preparations. According to the results, ascorbyl esters showed significant differences: sodium ascorbyl phosphate and magnesium ascorbyl phosphate are more stable derivatives of vitamin C than ascorbyl palmitate and may be easily used in cosmetic products.

  18. Selective deposition of dietary α-Lipoic acid in mitochondrial fraction and its synergistic effect with α-Tocoperhol acetate on broiler meat oxidative stability

    PubMed Central


    The use of bioactive antioxidants in feed of broiler to mitigate reactive oxygen species (ROS) in biological systems is one of promising nutritional strategies. The aim of present study was to alleviate ROS production in mitochondrial fraction (MF) of meat by supplemented dietary antioxidant in feed of broiler. For this purpose, mitochondria specific antioxidant: α-lipoic acid (25 mg, 75 mg and 150 mg) with or without combination of α-tocopherol acetate (200 mg) used in normal and palm olein oxidized oil (4%) supplemented feed. One hundred and eighty one day old broiler birds were randomly divided into six treatments and provided the mentioned feed from third week. Feed intake, feed conversion ratio (FCR) remained statistically same in all groups while body weight decreased in supplemented groups accordingly at the end of study. The broiler meat MF antioxidant potential was significantly improved by feeding supplemented feed estimated as 1,1-di phenyl-2-picrylhydrazyl (DPPH) free radical scavenging activity, 2,2-azinobis-(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS+) and thiobarbituric acid reactive substances (TBARS). The maximum antioxidant activity was depicted in group fed on 150 mg/kg α-lipoic acid (ALA) and 200 mg/kg α-tocopherol acetate (ATA) (T4) in both breast and leg MF. Moreover, TBARS were higher in leg as compared to breast MF. Although, oxidized oil containing feed reduced the growth, lipid stability and antioxidant potential of MF whilst these traits were improved by receiving feed containing ALA and ATA. ALA and ATA showed higher deposition in T4 group while least in group received oxidized oil containing feed (T5). Positive correlation exists between DPPH free radical scavenging activity and the ABTS + reducing activity. In conclusion, ALA and ATA supplementation in feed had positive effect on antioxidant status of MF that consequently diminished the oxidative stress in polyunsaturated fatty acid enriched meat. PMID:23617815

  19. Nucleic acids encoding human trithorax protein


    Evans, Glen A.; Djabali, Malek; Selleri, Licia; Parry, Pauline


    In accordance with the present invention, there is provided an isolated peptide having the characteristics of human trithorax protein (as well as DNA encoding same, antisense DNA derived therefrom and antagonists therefor). The invention peptide is characterized by having a DNA binding domain comprising multiple zinc fingers and at least 40% amino acid identity with respect to the DNA binding domain of Drosophila trithorax protein and at least 70% conserved sequence with respect to the DNA binding domain of Drosophila trithorax protein, and wherein said peptide is encoded by a gene located at chromosome 11 of the human genome at q23. Also provided are methods for the treatment of subject(s) suffering from immunodeficiency, developmental abnormality, inherited disease, or cancer by administering to said subject a therapeutically effective amount of one of the above-described agents (i.e., peptide, antagonist therefor, DNA encoding said peptide or antisense DNA derived therefrom). Also provided is a method for the diagnosis, in a subject, of immunodeficiency, developmental abnormality, inherited disease, or cancer associated with disruption of chromosome 11 at q23.

  20. Hypermetabolic state in the 7-month-old triple transgenic mouse model of Alzheimer's disease and the effect of lipoic acid: a 13C-NMR study.


    Sancheti, Harsh; Patil, Ishan; Kanamori, Keiko; Díaz Brinton, Roberta; Zhang, Wei; Lin, Ai-Ling; Cadenas, Enrique


    Alzheimer's disease (AD) is characterized by age-dependent biochemical, metabolic, and physiologic changes. These age-dependent changes ultimately converge to impair cognitive functions. This study was carried out to examine the metabolic changes by probing glucose and tricarboxylic acid cycle metabolism in a 7-month-old triple transgenic mouse model of AD (3xTg-AD). The effect of lipoic acid, an insulin-mimetic agent, was also investigated to examine its ability in modulating age-dependent metabolic changes. Seven-month-old 3xTg-AD mice were given intravenous infusion of [1-(13)C]glucose followed by an ex vivo (13)C nuclear magnetic resonance to determine the concentrations of (13)C-labeled isotopomers of glutamate, glutamine, aspartate, gamma aminobutyric acid, and N-acetylaspartate. An intravenous infusion of [1-(13)C]glucose+[1,2-(13)C]acetate was given for different periods of time to distinguish neuronal and astrocytic metabolism. Enrichments of glutamate, glutamine, and aspartate were calculated after quantifying the total ((12)C+(13)C) concentrations by high-performance liquid chromatography. A hypermetabolic state was clearly evident in 7-month-old 3xTg-AD mice in contrast to the hypometabolic state reported earlier in 13-month-old mice. Hypermetabolism was evidenced by prominent increase of (13)C labeling and enrichment in the 3xTg-AD mice. Lipoic acid feeding to the hypermetabolic 3xTg-AD mice brought the metabolic parameters to the levels of nonTg mice.

  1. Hypermetabolic state in the 7-month-old triple transgenic mouse model of Alzheimer's disease and the effect of lipoic acid: a 13C-NMR study

    PubMed Central

    Sancheti, Harsh; Patil, Ishan; Kanamori, Keiko; Díaz Brinton, Roberta; Zhang, Wei; Lin, Ai-Ling; Cadenas, Enrique


    Alzheimer's disease (AD) is characterized by age-dependent biochemical, metabolic, and physiologic changes. These age-dependent changes ultimately converge to impair cognitive functions. This study was carried out to examine the metabolic changes by probing glucose and tricarboxylic acid cycle metabolism in a 7-month-old triple transgenic mouse model of AD (3xTg-AD). The effect of lipoic acid, an insulin-mimetic agent, was also investigated to examine its ability in modulating age-dependent metabolic changes. Seven-month-old 3xTg-AD mice were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C nuclear magnetic resonance to determine the concentrations of 13C-labeled isotopomers of glutamate, glutamine, aspartate, gamma aminobutyric acid, and N-acetylaspartate. An intravenous infusion of [1-13C]glucose+[1,2-13C]acetate was given for different periods of time to distinguish neuronal and astrocytic metabolism. Enrichments of glutamate, glutamine, and aspartate were calculated after quantifying the total (12C+13C) concentrations by high-performance liquid chromatography. A hypermetabolic state was clearly evident in 7-month-old 3xTg-AD mice in contrast to the hypometabolic state reported earlier in 13-month-old mice. Hypermetabolism was evidenced by prominent increase of 13C labeling and enrichment in the 3xTg-AD mice. Lipoic acid feeding to the hypermetabolic 3xTg-AD mice brought the metabolic parameters to the levels of nonTg mice. PMID:25099753

  2. Hypermetabolic state in the 7-month-old triple transgenic mouse model of Alzheimer's disease and the effect of lipoic acid: a 13C-NMR study.


    Sancheti, Harsh; Patil, Ishan; Kanamori, Keiko; Díaz Brinton, Roberta; Zhang, Wei; Lin, Ai-Ling; Cadenas, Enrique


    Alzheimer's disease (AD) is characterized by age-dependent biochemical, metabolic, and physiologic changes. These age-dependent changes ultimately converge to impair cognitive functions. This study was carried out to examine the metabolic changes by probing glucose and tricarboxylic acid cycle metabolism in a 7-month-old triple transgenic mouse model of AD (3xTg-AD). The effect of lipoic acid, an insulin-mimetic agent, was also investigated to examine its ability in modulating age-dependent metabolic changes. Seven-month-old 3xTg-AD mice were given intravenous infusion of [1-(13)C]glucose followed by an ex vivo (13)C nuclear magnetic resonance to determine the concentrations of (13)C-labeled isotopomers of glutamate, glutamine, aspartate, gamma aminobutyric acid, and N-acetylaspartate. An intravenous infusion of [1-(13)C]glucose+[1,2-(13)C]acetate was given for different periods of time to distinguish neuronal and astrocytic metabolism. Enrichments of glutamate, glutamine, and aspartate were calculated after quantifying the total ((12)C+(13)C) concentrations by high-performance liquid chromatography. A hypermetabolic state was clearly evident in 7-month-old 3xTg-AD mice in contrast to the hypometabolic state reported earlier in 13-month-old mice. Hypermetabolism was evidenced by prominent increase of (13)C labeling and enrichment in the 3xTg-AD mice. Lipoic acid feeding to the hypermetabolic 3xTg-AD mice brought the metabolic parameters to the levels of nonTg mice. PMID:25099753

  3. The Effects of α-Lipoic Acid on Liver Oxidative Stress and Free Fatty Acid Composition in Methionine–Choline Deficient Diet-Induced NAFLD

    PubMed Central

    Stanković, Milena N.; Mladenović, Dušan; Ninković, Milica; Ðuričić, Ivana; Šobajić, Slađana; Jorgačević, Bojan; de Luka, Silvio; Vukicevic, Rada Jesic


    Abstract Development of nonalcoholic fatty liver disease (NAFLD) occurs through initial steatosis and subsequent oxidative stress. The aim of this study was to examine the effects of α-lipoic acid (LA) on methionine–choline deficient (MCD) diet-induced NAFLD in mice. Male C57BL/6 mice (n=21) were divided into three groups (n=7 per group): (1) control fed with standard chow, (2) MCD2 group—fed with MCD diet for 2 weeks, and (3) MCD2+LA group—2 weeks on MCD receiving LA i.p. 100 mg/kg/day. After the treatment, liver samples were taken for pathohistology, oxidative stress parameters, antioxidative enzymes, and liver free fatty acid (FFA) composition. Mild microvesicular hepatic steatosis was found in MCD2 group, while it was reduced to single fat droplets evident in MCD2+LA group. Lipid peroxidation and nitrosative stress were increased by MCD diet, while LA administration induced a decrease in liver malondialdehyde and nitrates+nitrites level. Similary, LA improved liver antioxidative capacity by increasing total superoxide dismutase (tSOD), manganese SOD (MnSOD), and copper/zinc-SOD (Cu/ZnSOD) activity as well as glutathione (GSH) content. Liver FFA profile has shown a significant decrease in saturated acids, arachidonic, and docosahexaenoic acid (DHA), while LA treatment increased their proportions. It can be concluded that LA ameliorates lipid peroxidation and nitrosative stress in MCD diet-induced hepatic steatosis through an increase in SOD activity and GSH level. In addition, LA increases the proportion of palmitic, stearic, arachidonic, and DHA in the fatty liver. An increase in DHA may be a potential mechanism of anti-inflammatory and antioxidant effects of LA in MCD diet-induced NAFLD. PMID:24325457

  4. The combination of exercise training and alpha-lipoic acid treatment has therapeutic effects on the pathogenic phenotypes of Alzheimer's disease in NSE/APPsw-transgenic mice.


    Cho, Joon Y; Um, Hyun S; Kang, Eun B; Cho, In H; Kim, Chul H; Cho, Jung S; Hwang, Dae Y


    Exercise training was suggested as a practical therapeutic strategy for human subjects suffering from Alzheimer's disease (AD) in our previous study. Therefore, the purpose of this study was to investigate the effects of combining exercise training with the administration of antioxidants on the pathological phenotype of AD. To accomplish this, non-transgenic mice (Non-Tg) and NSE/APPsw Tg mice were treated with alpha-lipoic acid and treadmill exercised for 16 weeks, after which their brains were evaluated to determine whether any changes in the pathological phenotype-related factors occurred. The results indicated that (i) the combination-applied (COMA) Tg group with exercise training (ET) and alpha-lipoic acid administration (LA) showed ameliorated spatial learning and memory compared to the sedentary (SED)-Tg and single-treatment groups; (ii) there were no differences in the level of Abeta-42 peptides across groups; (iii) the level of glucose transporter-1 and brain-derived neurotrophic factor proteins were highly increased in the COMA group, (iv) ET and LA did not induce a synergistic effect on the expression of heat shock protein-70 and apoptotic proteins including Bax and caspase-3; (v) the levels of SOD-1 and CAT suppressing oxidative stress were extensively higher in the COMA than in the single-treated groups and (vi) there were no significant differences across groups regarding these serum characteristics, although these levels were lower than the SED-Tg group. Taken together, these results suggest that the combination with ET and LA may contribute to protect the neuron injury induced by Abeta peptides and may be considered an effective therapeutic strategy for human subjects suffering from AD.

  5. Chronic systemic D-galactose exposure induces memory loss, neurodegeneration, and oxidative damage in mice: protective effects of R-alpha-lipoic acid.


    Cui, Xu; Zuo, Pingping; Zhang, Qing; Li, Xuekun; Hu, Yazhuo; Long, Jiangang; Packer, Lester; Liu, Jiankang


    Chronic systemic exposure of D-galactose to mice, rats, and Drosophila causes the acceleration of senescence and has been used as an aging model. However, the underlying mechanism is as yet unclear. To investigate the mechanisms of neurodegeneration in this model, we studied cognitive function, hippocampal neuronal apoptosis and neurogenesis, and peripheral oxidative stress biomarkers and also the protective effects of the antioxidant R-alpha-lipoic acid. Chronic systemic exposure of mice to D-galactose (100 mg/kg, s.c., 7 weeks) induced a spatial memory deficit, an increase in cell karyopyknosis, apoptosis, and caspase-3 protein levels in hippocampal neurons, a decrease in the number of new neurons in the subgranular zone in the dentate gyrus, a reduction of migration of neural progenitor cells, and an increase in death of newly formed neurons in the granular cell layer. The D-galactose exposure also induced an increase in peripheral oxidative stress, including an increase in malondialdehyde and decreases in total antioxidative capabilities (T-AOC), total superoxide dismutase (T-SOD), and glutathione peroxidase (GSH-Px) activities. A concomitant treatment with lipoic acid ameliorated cognitive dysfunction and neurodegeneration in the hippocampus and also reduced peripheral oxidative damage by decreasing malondialdehyde and increasing T-AOC and T-SOD, without an effect on GSH-Px. These findings suggest that chronic D-galactose exposure induces neurodegeneration by enhancing caspase-mediated apoptosis and inhibiting neurogenesis and neuron migration, as well as increasing oxidative damage. In addition, D-galactose-induced toxicity in mice is a useful model for studying the mechanisms of neurodegeneration and neuroprotective drugs and agents.

  6. Chronic systemic D-galactose exposure induces memory loss, neurodegeneration, and oxidative damage in mice: protective effects of R-alpha-lipoic acid.


    Cui, Xu; Zuo, Pingping; Zhang, Qing; Li, Xuekun; Hu, Yazhuo; Long, Jiangang; Packer, Lester; Liu, Jiankang


    Chronic systemic exposure of mice, rats, and Drosophila to D-galactose causes the acceleration of senescence and has been used as an aging model. The underlying mechanism is yet unclear. To investigate the mechanisms of neurodegeneration in this model, we studied cognitive function, hippocampal neuronal apoptosis and neurogenesis, and peripheral oxidative stress biomarkers, and also the protective effects of the antioxidant R-alpha-lipoic acid. Chronic systemic exposure of D-galactose (100 mg/kg, s.c., 7 weeks) to mice induced a spatial memory deficit, an increase in cell karyopyknosis, apoptosis and caspase-3 protein levels in hippocampal neurons, a decrease in the number of new neurons in the subgranular zone in the dentate gyrus, a reduction of migration of neural progenitor cells, and an increase in death of newly formed neurons in granular cell layer. The D-galactose exposure also induced an increase in peripheral oxidative stress, including an increase in malondialdehyde, a decrease in total anti-oxidative capabilities (T-AOC), total superoxide dismutase (T-SOD), and glutathione peroxidase (GSH-Px) activities. A concomitant treatment with lipoic acid ameliorated cognitive dysfunction and neurodegeneration in the hippocampus, and also reduced peripheral oxidative damage by decreasing malondialdehyde and increasing T-AOC and T-SOD, without an effect on GSH-Px. These findings suggest that chronic D-galactose exposure induces neurodegeneration by enhancing caspase-mediated apoptosis and inhibiting neurogenesis and neuron migration, as well as increasing oxidative damage. In addition, D-galactose-induced toxicity in mice is a useful model for studying the mechanisms of neurodegeneration and neuroprotective drugs and agents.

  7. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells.


    Choi, Ji Hyun; Cho, Soon Ok; Kim, Hyeyoung


    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation.

  8. α-Lipoic Acid Inhibits Expression of IL-8 by Suppressing Activation of MAPK, Jak/Stat, and NF-κB in H. pylori-Infected Gastric Epithelial AGS Cells

    PubMed Central

    Choi, Ji Hyun; Cho, Soon Ok


    The epithelial cytokine response, associated with reactive oxygen species (ROS), is important in Helicobacter pylori (H. pylori)-induced inflammation. H. pylori induces the production of ROS, which may be involved in the activation of mitogen-activated protein kinases (MAPK), janus kinase/signal transducers and activators of transcription (Jak/Stat), and oxidant-sensitive transcription factor, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and thus, expression of interleukin-8 (IL-8) in gastric epithelial cells. α-lipoic acid, a naturally occurring thiol compound, is a potential antioxidant. It shows beneficial effects in treatment of oxidant-associated diseases including diabetes. The present study is purposed to investigate whether α-lipoic acid inhibits expression of inflammatory cytokine IL-8 by suppressing activation of MAPK, Jak/Stat, and NF-κB in H. pylori-infected gastric epithelial cells. Gastric epithelial AGS cells were pretreated with or without α-lipoic acid for 2 h and infected with H. pylori in a Korean isolate (HP99) at a ratio of 300:1. IL-8 mRNA expression was analyzed by RT-PCR analysis. IL-8 levels in the medium were determined by enzyme-linked immunosorbent assay. NF-κB-DNA binding activity was determined by electrophoretic mobility shift assay. Phospho-specific and total forms of MAPK and Jak/Stat were assessed by Western blot analysis. ROS levels were determined using dichlorofluorescein fluorescence. As a result, H. pylori induced increases in ROS levels, mRNA, and protein levels of IL-8, as well as the activation of MAPK [extracellular signal-regulated kinase 1/2 (ERK1/2), c-Jun NH2-terminal kinase 1/2 (JNK1/2), p38], Jak/Stat (Jak1/2, Stat3), and NF-κB in AGS cells, which was inhibited by α-lipoic acid. In conclusion, α-lipoic acid may be beneficial for prevention and/or treatment of H. pylori infection-associated gastric inflammation. PMID:26632410

  9. Gas-saturated solution process to obtain microcomposite particles of alpha lipoic acid/hydrogenated colza oil in supercritical carbon dioxide.


    Mishima, Kenji; Honjo, Masatoshi; Sharmin, Tanjina; Ito, Shota; Kawakami, Ryo; Kato, Takafumi; Misumi, Makoto; Suetsugu, Tadashi; Orii, Hideaki; Kawano, Hiroyuki; Irie, Keiichi; Sano, Kazunori; Mishima, Kenichi; Harada, Takunori; Ouchi, Mikio


    Alpha lipoic acid (ALA), an active substance in anti-aging products and dietary supplements, need to be masked with an edible polymer to obscure its unpleasant taste. However, the high viscosity of the ALA molecules prevents them from forming microcomposites with masking materials even in supercritical carbon dioxide (scCO2). Therefore, the purpose of this study was to investigate and develop a novel production method for microcomposite particles for ALA in hydrogenated colza oil (HCO). Microcomposite particles of ALA/HCO were prepared by using a novel gas-saturated solution (PGSS) process in which the solid-dispersion method is used along with stepwise temperature control (PGSS-STC). Its high viscosity prevents the formation of microcomposites in the conventional PGSS process even under strong agitation. Here, we disperse the solid particles of ALA and HCO in scCO2 at low temperatures and change the temperature stepwise in order to mix the melted ALA and HCO in scCO2. As a result, a homogeneous dispersion of the droplets of ALA in melted HCO saturated with CO2 is obtained at high temperatures. After the rapid expansion of the saturated solution through a nozzle, microcomposite particles of ALA/HCO several micrometers in diameter are obtained.

  10. The Influence of α-Lipoic Acid and Garlic Administration on Biomarkers of Oxidative Stress and Inflammation in Rabbits Exposed to Oxidized Nutrition Oils.


    Zalejska-Fiolka, Jolanta; Wielkoszyński, Tomasz; Rokicki, Wojciech; Dąbrowska, Natalia; Strzelczyk, Joanna Katarzyna; Kasperczyk, Aleksandra; Owczarek, Aleksander; Błaszczyk, Urszula; Kasperczyk, Sławomir; Stawiarska-Pięta, Barbara; Birkner, Ewa; Gamian, Andrzej


    We hypothesized that addition of substances with antioxidant activity could decrease the concentrations of biomarkers of oxidative stress and inflammatory process, thus inhibiting nonalcoholic steatohepatitis development. We investigated the influence of α-lipoic acid (ALA) and garlic administration on the development of adverse changes in rabbit liver and serum under oxidative stress conditions induced with HFD from oxidized oils. We determined 8-hydroxy-2'-deoxyguanosine (8 OHdG) and malondialdehyde (MDA) in liver homogenates, total oxidant status (TOS), lipid peroxides (LOO) and tumor necrosis factor alpha (TNFα) in blood serum, and TNFα and IL-1α genes expression in liver. The results indicate that the intake of dietary ALA and garlic was significantly associated with decreases of 8 OHdG and MDA levels in rabbits' liver tissue as well as TOS and LOO levels in rabbits' serum. Similarly, TNFα and IL-1α gene expressions were suppressed due to ALA and garlic supplementation. The histopathological analysis confirmed that HFD results in liver disorder leading to steatosis. This adverse effect of HFD was ameliorated by the supplementation of ALA and garlic. The obtained results indicate a beneficial effect of ALA and garlic administration by reducing the oxidative stress intensity and the levels of some proinflammatory cytokines in rabbits fed HFD. PMID:26634212

  11. Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets.


    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng


    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens. PMID:24699046

  12. Glutaredoxin S15 Is Involved in Fe-S Cluster Transfer in Mitochondria Influencing Lipoic Acid-Dependent Enzymes, Plant Growth, and Arsenic Tolerance in Arabidopsis1[OPEN

    PubMed Central


    Glutaredoxins (Grxs) are small proteins that function as oxidoreductases with roles in deglutathionylation of proteins, reduction of antioxidants, and assembly of iron-sulfur (Fe-S) cluster-containing enzymes. Which of the 33 Grxs in Arabidopsis (Arabidopsis thaliana) perform roles in Fe-S assembly in mitochondria is unknown. We have examined in detail the function of the monothiol GrxS15 in plants. Our results show its exclusive mitochondrial localization, and we are concluding it is the major or only Grx in this subcellular location. Recombinant GrxS15 has a very low deglutathionylation and dehydroascorbate reductase activity, but it binds a Fe-S cluster. Partially removing GrxS15 from mitochondria slowed whole plant growth and respiration. Native GrxS15 is shown to be especially important for lipoic acid-dependent enzymes in mitochondria, highlighting a putative role in the transfer of Fe-S clusters in this process. The enhanced effect of the toxin arsenic on the growth of GrxS15 knockdown plants compared to wild type highlights the role of mitochondrial glutaredoxin Fe-S-binding in whole plant growth and toxin tolerance. PMID:26672074

  13. The Influence of α-Lipoic Acid and Garlic Administration on Biomarkers of Oxidative Stress and Inflammation in Rabbits Exposed to Oxidized Nutrition Oils

    PubMed Central

    Zalejska-Fiolka, Jolanta; Wielkoszyński, Tomasz; Rokicki, Wojciech; Dąbrowska, Natalia; Strzelczyk, Joanna Katarzyna; Kasperczyk, Aleksandra; Owczarek, Aleksander; Błaszczyk, Urszula; Kasperczyk, Sławomir; Stawiarska-Pięta, Barbara; Birkner, Ewa; Gamian, Andrzej


    We hypothesized that addition of substances with antioxidant activity could decrease the concentrations of biomarkers of oxidative stress and inflammatory process, thus inhibiting nonalcoholic steatohepatitis development. We investigated the influence of α-lipoic acid (ALA) and garlic administration on the development of adverse changes in rabbit liver and serum under oxidative stress conditions induced with HFD from oxidized oils. We determined 8-hydroxy-2′-deoxyguanosine (8OHdG) and malondialdehyde (MDA) in liver homogenates, total oxidant status (TOS), lipid peroxides (LOO) and tumor necrosis factor alpha (TNFα) in blood serum, and TNFα and IL-1α genes expression in liver. The results indicate that the intake of dietary ALA and garlic was significantly associated with decreases of 8OHdG and MDA levels in rabbits' liver tissue as well as TOS and LOO levels in rabbits' serum. Similarly, TNFα and IL-1α gene expressions were suppressed due to ALA and garlic supplementation. The histopathological analysis confirmed that HFD results in liver disorder leading to steatosis. This adverse effect of HFD was ameliorated by the supplementation of ALA and garlic. The obtained results indicate a beneficial effect of ALA and garlic administration by reducing the oxidative stress intensity and the levels of some proinflammatory cytokines in rabbits fed HFD. PMID:26634212

  14. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy

    PubMed Central

    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin


    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  15. Type 1 5'-deiodinase activity is inhibited by oxidative stress and restored by alpha-lipoic acid in HepG2 cells.


    Chen, Kanjun; Yan, Biao; Wang, Fei; Wen, Feiting; Xing, Xingan; Tang, Xue; Shi, Yonghui; Le, Guowei


    3,3',5-triiodothyronine (T3) is largely generated from thyroxine (T4) by the catalysis of deiodinases in peripheral tissues. Emerging evidences have indicated its broad participation in regulating various metabolic process via protecting tissues from oxidative stress and improving cellular antioxidant capacity. However, the potential correlation between the oxidative stress and conversion of T4 to T3 is still unclear. In the present study, the effects of T3 and T4 on redox homeostasis in HepG2 cells pre-treated with H2O2 was investigated. It revealed that T3 significantly rescued the apoptotic cell death, consistent with an upregulation of cell antioxidant ability and reduction of ROS accumulation while T4 did not. Afterwards, we examined the enzyme activity and mRNA expression of type 1 5'-deiodianse (DIO1), T3 and rT3 level and found that H2O2 reduced both DIO1 activity and expression in a dose-dependent manner, which consequently declined T3 and rT3 generation. Alpha-lipoic acid (LA) treatment notably restored DIO1 activity, T3 and rT3 level, as well as transcriptional abnormalities of inflammation-associated genes. It suggests that oxidative stress may reduce DIO1 activity by an indirect way like activating cellular inflammatory responses. All these results indicate that the oxidative stress downregulates the conversion of T4 to T3 through DIO1 function in HepG2 cells.

  16. Synergistic ameliorative effects of sesame oil and alpha-lipoic acid against subacute diazinon toxicity in rats: hematological, biochemical, and antioxidant studies.


    Abdel-Daim, Mohamed M; Taha, Ramadan; Ghazy, Emad W; El-Sayed, Yasser S


    Diazinon (DZN) is a common organophosphorus insecticide extensively used for agriculture and veterinary purposes. DZN toxicity is not limited to insects; it also induces harmful effects in mammals and birds. Our experiment evaluated the protective and antioxidant potential of sesame oil (SO) and (or) alpha-lipoic acid (ALA) against DZN toxicity in male Wistar albino rats. DZN-treated animals exhibited macrocytic hypochromic anemia and significant increases in serum biochemical parameters related to liver injury, including aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), γ-glutamyl transferase (γGT), cholesterol, and triglycerides. They also had elevated levels of markers related to cardiac injury, such as lactate dehydrogenase (LDH) and creatine phosphokinase (CPK), and increased biomarkers of renal injury, urea and creatinine. DZN also increased hepatic, renal, and cardiac lipid peroxidation and decreased antioxidant biomarker levels. SO and (or) ALA supplementation ameliorated the deleterious effects of DZN intoxication. Treatment improved hematology and serum parameters, enhanced endogenous antioxidant status, and reduced lipid peroxidation. Importantly, they exerted synergistic hepatoprotective, nephroprotective, and cardioprotective effects. Our findings demonstrate that SO and (or) ALA supplementation can alleviate the toxic effects of DZN via their potent antioxidant and free radical-scavenging activities.

  17. Alpha-lipoic acid attenuates endoplasmic reticulum stress-induced insulin resistance by improving mitochondrial function in HepG2 cells.


    Lei, Lin; Zhu, Yiwei; Gao, Wenwen; Du, Xiliang; Zhang, Min; Peng, Zhicheng; Fu, Shoupeng; Li, Xiaobing; Zhe, Wang; Li, Xinwei; Liu, Guowen


    Alpha-lipoic acid (ALA) has been reported to have beneficial effects for improving insulin sensitivity. However, the underlying molecular mechanism of the beneficial effects remains poorly understood. Endoplasmic reticulum (ER) stress and mitochondrial dysfunction are considered causal factors that induce insulin resistance. In this study, we investigated the effect of ALA on the modulation of insulin resistance in ER-stressed HepG2 cells, and we explored the potential mechanism of this effect. HepG2 cells were incubated with tunicamycin (Tun) for 6h to establish an ER stress cell model. Tun treatment induced ER stress, mitochondrial dysfunction and insulin resistance. Interestingly, ALA had no significant effect on ER stress signals. Pretreatment of the ER stress cell model with ALA for 24h improved insulin sensitivity, restored the expression levels of mitochondrial oxidative phosphorylation (OXPHOS) complexes and increased intracellular ATP production. Moreover, ALA augmented the β-oxidation capacity of the mitochondria. Importantly, ALA treatment could decrease oligomycin-induced mitochondrial dysfunction and then improved insulin resistance. Taken together, our data suggest that ALA prevents ER stress-induced insulin resistance by enhancing mitochondrial function.

  18. An alpha-lipoic acid-vitamin E mixture reduces post-embolism lipid peroxidation, cerebral infarction, and neurological deficit in rats.


    Garcia-Estrada, Joaquin; Gonzalez-Perez, Oscar; Gonzalez-Castaneda, Rocio Elizabeth; Martinez-Contreras, Alicia; Luquin, Sonia; de la Mora, Pedro Garzon; Navarro-Ruiz, Alicia


    Oxidative stress increases delayed neuronal death in the brain following ischemia. As a consequence, many attempts to reduce the damage resulting from cerebral ischemia under more highly oxidized conditions have focused on treatments aimed at maintaining the redox equilibrium of the local environment. This study demonstrates the synergistic effects of combining treatments with alpha-lipoic acid (LA) and vitamin E (VE) as an efficient measure to reduce the damage caused by cerebral ischemia. Two oral therapeutic protocols were examined: intensive treatment (100 mg/kg LA and 140 mg/kg VE for 7 days after ischemia) and prophylactic treatment (20 mg/kg LA and 50 mg/kg VE from 30 days before infarction up to the day of sacrifice). The prophylactic treatment reduced serum lipid peroxidation, and diminished brain infarct volume by approximately 50%. Furthermore, prophylactically treated rats showed a reduction in post-ischemia neurological scores. No significant differences were found in the intensively treated group. Our data indicate that pre-ischemia administration of the LA-VE antioxidant mixture reduced the volume of brain damaged and the functional consequences of embolic infarction. These findings suggest that prophylaxis with an LA-VE mixture may be valuable in reducing cerebral damage levels in patients with a high risk of stroke.

  19. Reversal of corticosterone-induced BDNF alterations by the natural antioxidant alpha-lipoic acid alone and combined with desvenlafaxine: Emphasis on the neurotrophic hypothesis of depression.


    de Sousa, Caren Nádia Soares; Meneses, Lucas Nascimento; Vasconcelos, Germana Silva; Silva, Márcia Calheiros Chaves; da Silva, Jéssica Calheiros; Macêdo, Danielle; de Lucena, David Freitas; Vasconcelos, Silvânia Maria Mendes


    Brain derived neurotrophic factor (BDNF) is linked to the pathophysiology of depression. We hypothesized that BDNF is one of the neurobiological pathways related to the augmentation effect of alpha-lipoic acid (ALA) when associated with antidepressants. Female mice were administered vehicle or CORT 20mg/kg during 14 days. From the 15th to 21st days the animals were divided in groups that were further administered: vehicle, desvenlafaxine (DVS) 10 or 20mg/kg, ALA 100 or 200mg/kg or the combinations of DVS10+ALA100, DVS20+ALA100, DVS10+ALA200 or DVS20+ALA200. ALA or DVS alone or in combination reversed CORT-induced increase in immobility time in the forced swimming test and decrease in sucrose preference, presenting, thus, an antidepressant-like effect. DVS10 alone reversed CORT-induced decrease in BDNF in the prefrontal cortex (PFC), hippocampus (HC) and striatum (ST). The same was observed in the HC and ST of ALA200 treated animals. The combination of DVS and ALA200 reversed CORT-induced alterations in BDNF and even, in some cases, increased the levels of this neurotrophin when compared to vehicle-treated animals in HC and ST. Taken together, these results suggest that the combination of the DVS+ALA may be valuable for treating conditions in which BDNF levels are decreased, such as depression.

  20. Comparative analysis of the effects combined physical procedures and alpha-lipoic acid on the electroneurographic parameters of patients with distal sensorimotor diabetic polyneuropathy.


    Grbovic, Vesna; Jurisic-Skevin, Aleksandra; Djukic, Svetlana; Stefanović, Srdjan; Nurkovic, Jasmin


    [Purpose] Painful diabetic polyneuropathy occurs as a complication in 16% of all patients with diabetes mellitus. [Subjects and Methods] A clinical, prospective open-label randomized intervention study was conducted of 60 adult patients, with distal sensorimotor diabetic neuropathy two groups of 30 patients, with diabetes mellitus type 2 with distal sensorimotor diabetic neuropathy. Patients in group A were treated with combined physical procedures, and patients in group B were treated with alpha lipoic acid. [Results] There where a statistically significant improvements in terminal latency and the amplitude of the action potential in group A patients, while group B patients showed a statistically significant improvements in conduction velocity and terminal latency of n. peroneus. Group A patients showed a statistically significant improvements in conduction velocity and terminal latency, while group B patients also showed a statistically significant improvements in conduction velocity and terminal latency. This was reflected in a significant improvements in electrophysiological parameters (conduction velocity, amplitude and latency) of the motor and sensory nerves (n. peroneus, n. suralis). [Conclusion] These results present further evidence justifying of the use of physical agents in the treatment of diabetic sensorimotor polyneuropathy. PMID:27065527

  1. AMPK/p53 Axis Is Essential for α-Lipoic Acid-Regulated Metastasis in Human and Mouse Colon Cancer Cells.


    Park, Sunmi; Choi, Seung Kug; Choi, Yura; Moon, Hyun-Seuk


    α-Lipoic acid (ALA) has an anticancer property of lung, cervix, and prostate cancer cells. However, direct evidence that ALA contributes to the development of colon cancer has not been fully elucidated. In addition, no previous studies have evaluated whether ALA may regulate malignant potential, such as adhesion, invasion, and colony formation of colon cancer cells. To address the aforementioned questions, we conducted in vitro ALA signaling studies using human (HT29) and mouse (MCA38) colon cancer cell lines. We observed that cell proliferation is reduced by ALA administration in a dose-dependent manner in human and mouse colon cancer cell lines. Specifically, 0.5 to 1 mM concentration of ALA significantly decreased cell proliferation when compared with control. Similarly, we found that ALA downregulates adhesion, invasion, and colony formation. Finally, we observed that ALA activates p53 and AMPK signaling pathways in human and mouse colon cancer cells. We found for the first time that ALA suppresses cell proliferation and malignant potential via p53 and AMPK signaling pathways in human and mouse colon cancer cells. These new and early mechanistic studies provide a causal role of ALA in colon cancer, suggesting that ALA might be a useful agent in the management or chemoprevention of colon cancer.

  2. Treatment with α-Lipoic Acid over 16 Weeks in Type 2 Diabetic Patients with Symptomatic Polyneuropathy Who Responded to Initial 4-Week High-Dose Loading

    PubMed Central

    Garcia-Alcala, Hector; Santos Vichido, Celia Isabel; Islas Macedo, Silverio; Genestier-Tamborero, Christelle Nathalie; Minutti-Palacios, Marissa; Hirales Tamez, Omara; García, Carlos; Ziegler, Dan


    Effective treatment of diabetic sensorimotor polyneuropathy remains a challenge. To assess the efficacy and safety of α-lipoic acid (ALA) over 20 weeks, we conducted a multicenter randomized withdrawal open-label study, in which 45 patients with type 2 diabetes and symptomatic polyneuropathy were initially treated with ALA (600 mg tid) for 4 weeks (phase 1). Subsequently, responders were randomized to receive ALA (600 mg qd; n = 16) or to ALA withdrawal (n = 17) for 16 weeks (phase 2). During phase 1, the Total Symptom Score (TSS) decreased from 8.9 ± 1.8 points to 3.46 ± 2.0 points. During phase 2, TSS improved from 3.7 ± 1.9 points to 2.5 ± 2.5 points in the ALA treated group (p < 0.05) and remained unchanged in the ALA withdrawal group. The use of analgesic rescue medication was higher in the ALA withdrawal group than ALA treated group (p < 0.05). In conclusion, in type 2 diabetic patients with symptomatic polyneuropathy who responded to initial 4-week high-dose (600 mg tid) administration of ALA, subsequent treatment with ALA (600 mg qd) over 16 weeks improved neuropathic symptoms, whereas ALA withdrawal was associated with a higher use of rescue analgesic drugs. This trial is registered with Identifier: NCT02439879. PMID:26345602

  3. Effects of Lipoic Acid on Immune Function, the Antioxidant Defense System, and Inflammation-Related Genes Expression of Broiler Chickens Fed Aflatoxin Contaminated Diets

    PubMed Central

    Li, Yan; Ma, Qiu-Gang; Zhao, Li-Hong; Wei, Hua; Duan, Guo-Xiang; Zhang, Jian-Yun; Ji, Cheng


    This study was designed to evaluate the effect of low level of Aflatoxin B1 (AFB1) on oxidative stress, immune reaction and inflammation response and the possible ameliorating effects of dietary alpha-lipoic acid (α-LA) in broilers. Birds were randomly allocated into three groups and assigned to receive different diets: basal diet, diet containing 74 μg/kg AFB1, and 300 mg/kg α-LA supplementation in diet containing 74 μg/kg AFB1 for three weeks. The results showed that the serum levels of malondialdehyde, tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) in the AFB1-treated group were significantly increased than the control group. In addition, the increased expressions of interleukin 6 (IL6), TNFα and IFNγ were observed in birds exposed to the AFB1-contaminated diet. These degenerative changes were inhibited by α-LA-supplement. The activities of total superoxide dismutase and glutathione peroxidase, the levels of humoral immunity, and the expressions of nuclear factor-κB p65 and heme oxygenase-1, however, were not affected by AFB1. The results suggest that α-LA alleviates AFB1 induced oxidative stress and immune changes and modulates the inflammatory response at least partly through changes in the expression of proinflammatory cytokines of spleen such as IL6 and TNFα in broiler chickens. PMID:24699046

  4. α-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway.


    Jing, Yuanyuan; Cai, Xingcai; Xu, Yaqiong; Zhu, Canjun; Wang, Lina; Wang, Songbo; Zhu, Xiaotong; Gao, Ping; Zhang, Yongliang; Jiang, Qingyan; Shu, Gang


    Skeletal muscle protein turnover is regulated by endocrine hormones, nutrients, and inflammation. α-Lipoic acid (ALA) plays an important role in energy homeostasis. Therefore, the aim of this study was to investigate the effects of ALA on protein synthesis in skeletal muscles and reveal the underlying mechanism. ALA (25 μM) significantly increased the protein synthesis and phosphorylation of Akt, mTOR, and S6 in C2C12 myotubes with attenuated phosphorylation of AMPK, Ikkα/β, and eIF2α. Intraperitoneal injection of 50 mg/kg ALA also produced the same results in mouse gastrocnemius. Both the PI3K (LY294002) and mTOR (rapamycin) inhibitors abolished the effects of ALA on protein synthesis in the C2C12 myotubes. However, AICAR (AMPK agonist) failed to block the activation of mTOR and S6 by ALA. ALA increased TLR2 and MyD88 mRNA expression in the C2C12 myotubes. TLR2 knockdown by siRNA almost eliminated the effects of ALA on protein synthesis and the Akt/mTOR pathway in the C2C12 myotubes. Immunoprecipitation data showed that ALA enhanced the p85 subunit of PI3K binding to MyD88. These findings indicate that ALA induces protein synthesis and the PI3K/Akt signaling pathway by TLR2.

  5. The Influence of α-Lipoic Acid and Garlic Administration on Biomarkers of Oxidative Stress and Inflammation in Rabbits Exposed to Oxidized Nutrition Oils.


    Zalejska-Fiolka, Jolanta; Wielkoszyński, Tomasz; Rokicki, Wojciech; Dąbrowska, Natalia; Strzelczyk, Joanna Katarzyna; Kasperczyk, Aleksandra; Owczarek, Aleksander; Błaszczyk, Urszula; Kasperczyk, Sławomir; Stawiarska-Pięta, Barbara; Birkner, Ewa; Gamian, Andrzej


    We hypothesized that addition of substances with antioxidant activity could decrease the concentrations of biomarkers of oxidative stress and inflammatory process, thus inhibiting nonalcoholic steatohepatitis development. We investigated the influence of α-lipoic acid (ALA) and garlic administration on the development of adverse changes in rabbit liver and serum under oxidative stress conditions induced with HFD from oxidized oils. We determined 8-hydroxy-2'-deoxyguanosine (8 OHdG) and malondialdehyde (MDA) in liver homogenates, total oxidant status (TOS), lipid peroxides (LOO) and tumor necrosis factor alpha (TNFα) in blood serum, and TNFα and IL-1α genes expression in liver. The results indicate that the intake of dietary ALA and garlic was significantly associated with decreases of 8 OHdG and MDA levels in rabbits' liver tissue as well as TOS and LOO levels in rabbits' serum. Similarly, TNFα and IL-1α gene expressions were suppressed due to ALA and garlic supplementation. The histopathological analysis confirmed that HFD results in liver disorder leading to steatosis. This adverse effect of HFD was ameliorated by the supplementation of ALA and garlic. The obtained results indicate a beneficial effect of ALA and garlic administration by reducing the oxidative stress intensity and the levels of some proinflammatory cytokines in rabbits fed HFD.

  6. Dietary supplementation with (R)-alpha-lipoic acid reverses the age-related accumulation of iron and depletion of antioxidants in the rat cerebral cortex.


    Suh, Jung H; Moreau, Régis; Heath, Shi-Hua D; Hagen, Tory M


    Accumulation of divalent metal ions (e.g. iron and copper) has been proposed to contribute to heightened oxidative stress evident in aging and neurodegenerative disorders. To understand the extent of iron accumulation and its effect on antioxidant status, we monitored iron content in the cerebral cortex of F344 rats by inductively coupled plasma atomic emission spectrometry (ICP-AES) and found that the cerebral iron levels in 24-28-month-old rats were increased by 80% (p<0.01) relative to 3-month-old rats. Iron accumulation correlated with a decline in glutathione (GSH) and the GSH/GSSG ratio, indicating that iron accumulation altered antioxidant capacity and thiol redox state in aged animals. Because (R)-alpha-Lipoic acid (LA) is a potent chelator of divalent metal ions in vitro and also regenerates other antioxidants, we monitored whether feeding LA (0.2% [w/w]; 2 weeks) could lower cortical iron and improve antioxidant status. Results show that cerebral iron levels in old LA-fed animals were lower when compared to controls and were similar to levels seen in young rats. Antioxidant status and thiol redox state also improved markedly in old LA-fed rats versus controls. These results thus show that LA supplementation may be a means to modulate the age-related accumulation of cortical iron content, thereby lowering oxidative stress associated with aging.

  7. Supplementation with α-Lipoic Acid, CoQ10, and Vitamin E Augments Running Performance and Mitochondrial Function in Female Mice

    PubMed Central

    Abadi, Arkan; Crane, Justin D.; Ogborn, Daniel; Hettinga, Bart; Akhtar, Mahmood; Stokl, Andrew; MacNeil, Lauren; Safdar, Adeel; Tarnopolsky, Mark


    Antioxidant supplements are widely consumed by the general public; however, their effects of on exercise performance are controversial. The aim of this study was to examine the effects of an antioxidant cocktail (α-lipoic acid, vitamin E and coenzyme Q10) on exercise performance, muscle function and training adaptations in mice. C57Bl/J6 mice were placed on antioxidant supplement or placebo-control diets (n = 36/group) and divided into trained (8 wks treadmill running) (n = 12/group) and untrained groups (n = 24/group). Antioxidant supplementation had no effect on the running performance of trained mice nor did it affect training adaptations; however, untrained female mice that received antioxidants performed significantly better than placebo-control mice (p ≤ 0.05). Furthermore, antioxidant-supplemented females (untrained) showed elevated respiratory capacity in freshly excised muscle fibers (quadriceps femoris) (p ≤ 0.05), reduced oxidative damage to muscle proteins (p ≤ 0.05), and increased expression of mitochondrial proteins (p ≤ 0.05) compared to placebo-controls. These changes were attributed to increased expression of proliferator-activated receptor gamma coactivator 1α (PGC-1α) (p ≤ 0.05) via activation of AMP-activated protein kinase (AMPK) (p ≤ 0.05) by antioxidant supplementation. Overall, these results indicate that this antioxidant supplement exerts gender specific effects; augmenting performance and mitochondrial function in untrained females, but does not attenuate training adaptations. PMID:23565271

  8. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  9. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  10. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  11. EGVII endoglucanase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  12. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  13. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  14. EGVIII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl8, and the corresponding EGVIII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVIII, recombinant EGVIII proteins and methods for producing the same.

  15. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  16. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  17. EGVI endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6, and the corresponding EGVI amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  18. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  19. EGVII endoglucanase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

  20. Isolated menthone reductase and nucleic acid molecules encoding same


    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L


    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  1. Chemical derivatization combined with capillary LC or MALDI-TOF MS for trace determination of lipoic acid in cosmetics and integrated protein expression profiling in human keratinocytes.


    Tsai, Chia-Ju; Lin, Ying-Chi; Chen, Yen-Ling; Feng, Chia-Hsien


    Lipoic acid (LA) is an essential cofactor in mitochondrial enzymes and an ideal antioxidant in prokaryotic and eukaryotic cells. Capillary liquid chromatography coupled with ultraviolet detection (CapLC-UV) and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) are two environmentally friendly methods for determining LA. In this study, a pre-column microwave-assisted derivatization with 4-bromomethyl-6,7-dimethoxycoumarin enhanced the UV absorbance of LA and was monitored at 345 nm by CapLC-UV. Gradient separation was performed using a reversed-phase C18 column with a mobile phase consisting of acetonitrile-0.1% formic acid solution. The ionization of LA was increased, and the LA derivative was detected by MALDI-TOF MS at m/z 683 with an α-cyano-4-hydroxycinnamic acid matrix. The linear response ranged from 0.1 to 40 μM with a correlation coefficient of 0.999. The CapLC-UV and MALDI-TOF MS had detection limits of 5 and 4 fmol, respectively. These methods effectively detected LA in dietary supplements and cosmetics. Cellular proteomes of a human keratinocyte cell line (HaCaT) irradiated with UV radiation were also compared with and without LA treatment. The cellular proteomes were identified by nanoultra performance LC with LTQ Orbitrap system after trypsin digestion. Protein identification was performed by simultaneous peptide sequencing and MASCOT search. The analysis revealed changes in several proteins, including CDC42, TPI1, HNRPA2B1, PRDX1, PTGES3 and MYL6.

  2. Alpha-Lipoic Acid Reduces LDL-Particle Number and PCSK9 Concentrations in High-Fat Fed Obese Zucker Rats

    PubMed Central

    Carrier, Bradley; Wen, Shin; Zigouras, Sophia; Browne, Richard W.; Li, Zhuyun; Patel, Mulchand S.; Williamson, David L.; Rideout, Todd C.


    We characterized the hypolipidemic effects of alpha-lipoic acid (LA, R-form) and examined the associated molecular mechanisms in a high fat fed Zucker rat model. Rats (n = 8) were assigned to a high fat (HF) diet or the HF diet with 0.25% LA (HF-LA) for 30 days and pair fed to remove confounding effects associated with the anorectic properties of LA. Compared with the HF controls, the HF-LA group was protected against diet-induced obesity (102.5±3.1 vs. 121.5±3.6,% change BW) and hypercholesterolemia with a reduction in total-C (−21%), non-HDL-C (−25%), LDL-C (−16%), and total LDL particle number (−46%) and an increase in total HDL particles (∼22%). This cholesterol-lowering response was associated with a reduction in plasma PCSK9 concentration (−70%) and an increase in hepatic LDLr receptor protein abundance (2 fold of HF). Compared with the HF-fed animals, livers of LA-supplemented animals were protected against TG accumulation (−46%), likely through multiple mechanisms including: a suppressed lipogenic response (down-regulation of hepatic acetyl-CoA carboxylase and fatty acid synthase expression); enhanced hepatic fat oxidation (increased carnitine palmitoyltransferase Iα expression); and enhanced VLDL export (increased hepatic diacylglycerol acyltransferase and microsomal triglyceride transfer protein expression and elevated plasma VLDL particle number). Study results also support an enhanced fatty acid uptake (2.8 fold increase in total lipase activity) and oxidation (increased CPT1β protein abundance) in muscle tissue in LA-supplemented animals compared with the HF group. In summary, in the absence of a change in caloric intake, LA was effective in protecting against hypercholesterolemia and hepatic fat accumulation under conditions of strong genetic and dietary predisposition toward obesity and dyslipidemia. PMID:24595397

  3. Restoration of Dioxin-Induced Damage to Fetal Steroidogenesis and Gonadotropin Formation by Maternal Co-Treatment with α-Lipoic Acid

    PubMed Central

    Koga, Takayuki; Ishida, Takumi; Takeda, Tomoki; Ishii, Yuji; Uchi, Hiroshi; Tsukimori, Kiyomi; Yamamoto, Midori; Himeno, Masaru; Furue, Masutaka; Yamada, Hideyuki


    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), an endocrine disruptor, causes reproductive and developmental toxic effects in pups following maternal exposure in a number of animal models. Our previous studies have demonstrated that TCDD imprints sexual immaturity by suppressing the expression of fetal pituitary gonadotropins, the regulators of gonadal steroidogenesis. In the present study, we discovered that all TCDD-produced damage to fetal production of pituitary gonadotropins as well as testicular steroidogenesis can be repaired by co-treating pregnant rats with α-lipoic acid (LA), an obligate co-factor for intermediary metabolism including energy production. While LA also acts as an anti-oxidant, other anti-oxidants; i.e., ascorbic acid, butylated hydroxyanisole and edaravone, failed to exhibit any beneficial effects. Neither wasting syndrome nor CYP1A1 induction in the fetal brain caused through the activation of aryl hydrocarbon receptor (AhR) could be attenuated by LA. These lines of evidence suggest that oxidative stress makes only a minor contribution to the TCDD-induced disorder of fetal steroidogenesis, and LA has a restorative effect by targeting on mechanism(s) other than AhR activation. Following a metabolomic analysis, it was found that TCDD caused a more marked change in the hypothalamus, a pituitary regulator, than in the pituitary itself. Although the components of the tricarboxylic acid cycle and the ATP content of the fetal hypothalamus were significantly changed by TCDD, all these changes were again rectified by exogenous LA. We also provided evidence that the fetal hypothalamic content of endogenous LA is significantly reduced following maternal exposure to TCDD. Thus, the data obtained strongly suggest that TCDD reduces the expression of fetal pituitary gonadotropins to imprint sexual immaturity or disturb development by suppressing the level of LA, one of the key players serving energy production. PMID:22911699

  4. Genetically encoded fluorescent coumarin amino acids


    Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.


    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  5. Genetically encoded fluorescent coumarin amino acids


    Wang, Jiangyun; Xie, Jianming; Schultz, Peter G.


    The invention relates to orthogonal pairs of tRNAs and aminoacyl-tRNA synthetases that can incorporate the coumarin unnatural amino acid L-(7-hydroxycoumarin-4-yl) ethylglycine into proteins produced in eubacterial host cells such as E. coli. The invention provides, for example but not limited to, novel orthogonal synthetases, methods for identifying and making the novel synthetases, methods for producing proteins containing the unnatural amino acid L-(7-hydroxycoumarin-4-yl)ethylglycine and related translation systems.

  6. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    PubMed Central

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves II, H. James


    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or “chemistry space.” Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set. PMID:25802223

  7. Extraordinarily Adaptive Properties of the Genetically Encoded Amino Acids

    NASA Astrophysics Data System (ADS)

    Ilardo, Melissa; Meringer, Markus; Freeland, Stephen; Rasulev, Bakhtiyor; Cleaves, H. James, II


    Using novel advances in computational chemistry, we demonstrate that the set of 20 genetically encoded amino acids, used nearly universally to construct all coded terrestrial proteins, has been highly influenced by natural selection. We defined an adaptive set of amino acids as one whose members thoroughly cover relevant physico-chemical properties, or ``chemistry space.'' Using this metric, we compared the encoded amino acid alphabet to random sets of amino acids. These random sets were drawn from a computationally generated compound library containing 1913 alternative amino acids that lie within the molecular weight range of the encoded amino acids. Sets that cover chemistry space better than the genetically encoded alphabet are extremely rare and energetically costly. Further analysis of more adaptive sets reveals common features and anomalies, and we explore their implications for synthetic biology. We present these computations as evidence that the set of 20 amino acids found within the standard genetic code is the result of considerable natural selection. The amino acids used for constructing coded proteins may represent a largely global optimum, such that any aqueous biochemistry would use a very similar set.

  8. Nucleic acids encoding metal uptake transporters and their uses


    Schroeder, Julian I.; Antosiewicz, Danuta M.; Schachtman, Daniel P.; Clemens, Stephan


    The invention provides LCT1 nucleic acids which encode metal ion uptake transporters. The invention also provides methods of modulating heavy metal and alkali metal uptake in plants. The methods involve producing transgenic plants comprising a recombinant expression cassette containing an LCT1 nucleic acid linked to a plant promoter.

  9. Alpha-lipoic acid and N-acetylcysteine protects intensive swimming exercise-mediated germ-cell depletion, pro-oxidant generation, and alteration of steroidogenesis in rat testis.


    Jana, Kuladip; Dutta, Ananya; Chakraborty, Pratip; Manna, Indranil; Firdaus, Syed Benazir; Bandyopadhyay, Debasish; Chattopadhyay, Ratna; Chakravarty, Baidyanath


    Prolonged and strenuous exercise has been proposed as a possible source of male-factor infertility. Forced intensive swimming has also been identified as one source of a dysfunctional male reproduction system. The present study evaluated the possible protective role of α-lipoic acid and N-acetylcysteine (NAC) on intensive swimming-induced germ-cell depletion in adult male rats. Forced exhaustive swimming of 1 hr/day, 6 days/week for 8 consecutive weeks resulted in a significant (P < 0.05) reduction in epididymal sperm; testicular androgenic enzyme activities; and plasma and intra-testicular testosterone; and produced different types of germ cells in the seminiferous epithelium cycle. Conversely, plasma corticosterone levels and sperm-head abnormalities increased. Western-blot analysis showed a considerable decrease in testicular StAR protein expression whereas reverse-transcriptase PCR analysis showed no significant change in cytochrome P450scc (Cyp11a1) gene expression. Significant (P < 0.05) elevation in testicular reactive oxygen species (ROS), lipid peroxidation, protein carbonyl content versus reduction in glucose-6-phosphate dehydrogenase, glutathione peroxidase, glutathione S-transferase, and caspase-3 activities along with a depletion in the glutathione pool, mitochondrial membrane potential (▵ψm ), and intracellular ATP generation. A considerable level of DNA damage in testicular spermatogenic cells were also noted following forced extensive swimming. Alpha-lipoic acid and NAC supplementation prevented the swimming-induced testicular spermatogenic and steroidogenic disorders by lowering ROS generation. We therefore conclude that intensive forced swimming causes germ-cell depletion through the generation of ROS and depletion of steroidogenesis in the testis, which can be protected by the co-administration of α-lipoic acid and NAC. PMID:25104294

  10. Type 1 5'-deiodinase activity is inhibited by oxidative stress and restored by alpha-lipoic acid in HepG2 cells.


    Chen, Kanjun; Yan, Biao; Wang, Fei; Wen, Feiting; Xing, Xingan; Tang, Xue; Shi, Yonghui; Le, Guowei


    3,3',5-triiodothyronine (T3) is largely generated from thyroxine (T4) by the catalysis of deiodinases in peripheral tissues. Emerging evidences have indicated its broad participation in regulating various metabolic process via protecting tissues from oxidative stress and improving cellular antioxidant capacity. However, the potential correlation between the oxidative stress and conversion of T4 to T3 is still unclear. In the present study, the effects of T3 and T4 on redox homeostasis in HepG2 cells pre-treated with H2O2 was investigated. It revealed that T3 significantly rescued the apoptotic cell death, consistent with an upregulation of cell antioxidant ability and reduction of ROS accumulation while T4 did not. Afterwards, we examined the enzyme activity and mRNA expression of type 1 5'-deiodianse (DIO1), T3 and rT3 level and found that H2O2 reduced both DIO1 activity and expression in a dose-dependent manner, which consequently declined T3 and rT3 generation. Alpha-lipoic acid (LA) treatment notably restored DIO1 activity, T3 and rT3 level, as well as transcriptional abnormalities of inflammation-associated genes. It suggests that oxidative stress may reduce DIO1 activity by an indirect way like activating cellular inflammatory responses. All these results indicate that the oxidative stress downregulates the conversion of T4 to T3 through DIO1 function in HepG2 cells. PMID:26947333

  11. Inhibitory Effects of α-Lipoic Acid on Oxidative Stress-Induced Adipogenesis in Orbital Fibroblasts From Patients With Graves Ophthalmopathy.


    Hwang, Sena; Byun, Jung Woo; Yoon, Jin Sook; Lee, Eun Jig


    A choice of the optimal treatment for Graves ophthalmopathy (GO) is a challenge due to the complexity of the pathogenesis. Alpha-lipoic acid (ALA) is well known as a multifunctional antioxidant, helping to protect cells against oxidative stress and inflammatory damage.The aim of this study was to investigate the effects of ALA on intracellular production of reactive oxygen species (ROS), inflammation, and adipogenesis using primary cultured orbital fibroblasts from patients with GO.Intracellular ROS levels and mRNA expressions of proinflammatory cytokines and chemokines including intercellular adhesion molecule-1 (ICAM-1), interleukin (IL)-6, monocyte chemoattractant protein (MCP)-1, and regulated upon activation normal T cell expressed and presumably secreted (RANTES) were measured. After adipogenesis, the expressions of peroxisome proliferator-activated receptor (PPAR)γ, CCAAT-enhancer-binding proteins (C/EBP)α and β, and heme oxygenase-1 (HO-1) were investigated.H2O2 dose-dependently stimulated ROS production and HO-1 expression. Addition of ALA strongly attenuated ROS production and further increased HO-1 expression. However, by pretreatment of zinc protoporphyrin (ZnPP), HO-1 inhibitor, ALA inhibition of ROS generation by H2O2 was abolished. Tumor necrosis factor (TNF)α-induced mRNA expressions of ICAM-1, IL-6, MCP-1, and RANTES were inhibited by ALA treatment. In this context, TNFα-induced phosphorylation of P65 was also inhibited. In addition, ALA dose-dependently inhibited H2O2-induced intracellular accumulation of lipid droplets. The expression of adipogenic transcription factors, including PPARγ, C/EBPα, and β, was also inhibited.ALA is a potential therapeutic agent for GO because of the inhibitory effects on ROS production and gene expression of proinflammatory cytokines and chemokines, resulting in prevention of adipose-tissue expansion. PMID:26765462

  12. α-lipoic acid protects against hypoxia/reoxygenation-induced injury in human umbilical vein endothelial cells through suppression of apoptosis and autophagy

    PubMed Central



    α-lipoic acid (ALA) is known as a powerful antioxidant, which has been reported to have protective effects against various cardiovascular diseases. The present study aimed to determine whether ALA pre- or post-treatment induced protective effects against hypoxia/reoxygenation-induced injury via inhibition of apoptosis and autophagy in human umbilical vein endothelial cells (HUVECs). In order to simulate the conditions of hypoxia/reoxygenation, HUVECs were subjected to 4 h of oxygen-glucose deprivation (OGD) followed by 12 h of reoxygenation. For the pre-treatment, ALA was added to the buffer 12 h prior to OGD, whereas for the post-treatment, ALA was added at the initiation of reoxygenation. The results demonstrated that ALA pre- or post-treatment significantly reduced lactate dehydrogenase (LDH) release induced through hypoxia/reoxygenation in HUVECs in a dose-dependent manner; of note, 1 mM ALA pre- or post-treatment exhibited the most potent protective effects. In addition, ALA significantly reduced hypoxia/reoxygenation-induced loss of mitochondrial membrane potential, apoptosis and the expression of cleaved caspase-3 in HUVECs. In the presence of the specific autophagy inhibitor 3-methyladenine, hypoxia/reoxygenation-induced apoptosis was significantly reduced. Furthermore, the formation of autophagosomes, cytosolic microtubule-associated protein 1A/1B-light chain 3 ratio and beclin1 levels significantly increased following hypoxia/reoxygenation injury; however, all of these effects were ameliorated following pre- or post-treatment with ALA. The results of the present study suggested that ALA may provide beneficial protection against hypoxia/reoxygenation-induced injury via attenuation of apoptosis and autophagy in HUVECs. PMID:25684163

  13. A Placebo-Controlled Trial of Acetyl-L-Carnitine and α-Lipoic Acid in the Treatment of Bipolar Depression

    PubMed Central

    Brennan, Brian P.; Jensen, John Eric; Hudson, James I.; Coit, Caitlin E.; Beaulieu, Ashley; Pope, Harrison G.; Renshaw, Perry F.; Cohen, Bruce M.


    Background Bipolar disorder may be associated with mitochondrial dysfunction. Therefore, agents that enhance mitochondrial functioning may be efficacious in bipolar disorder. We performed a randomized placebo-controlled trial of the mitochondrial enhancers acetyl-L-carnitine (ALCAR) and α-lipoic acid (ALA) in patients with bipolar depression, and assessed markers of cerebral energy metabolism using phosphorus magnetic resonance spectroscopy. Methods We administered ALCAR (1000–3000 mg daily) plus ALA (600–1800 mg daily) or placebo for 12 weeks to 40 patients with bipolar depression and obtained imaging data at baseline, week 1, and week 12 of treatment in 20 patients using phosphorus 3-dimensional chemical-shift imaging at 4 T. Statistical analysis used random effects mixed models. Results We found no significant difference between ALCAR/ALA and placebo on change from baseline in the Montgomery-Asberg Depression Rating Scale in both the longitudinal (mean difference [95% confidence interval], −1.4 [−6.2 to 3.4], P = 0.58) and last-observation-carried-forward (−3.2 [−7.2 to 0.9], P = 0.12) analyses. ALCAR/ALA treatment significantly reduced phosphocreatine levels in the parieto-occipital cortex at week 12 (P = 0.002). Reduction in whole brain total nucleoside triphosphate levels from baseline to week 1 was associated with reduction in Montgomery-Asberg Depression Rating Scale scores (P = 0.02) in patients treated with ALCAR/ALA. However, this was likely a chance finding attributable to multiple statistical comparisons. Conclusions Treatment with ALCAR and ALA at the dose and duration used in this study does not have antidepressant effects in depressed bipolar patients and does not significantly enhance mitochondrial functioning in this patient group. PMID:23948785

  14. Acetyl-L-carnitine and lipoic acid improve mitochondrial abnormalities and serum levels of liver enzymes in a mouse model of nonalcoholic fatty liver disease.


    Kathirvel, Elango; Morgan, Kengathevy; French, Samuel W; Morgan, Timothy R


    Mitochondrial abnormalities are suggested to be associated with the development of nonalcoholic fatty liver. Liver mitochondrial content and function have been shown to improve in oral feeding of acetyl-L-carnitine (ALC) to rodents. Carnitine is involved in the transport of acyl-coenzyme A across the mitochondrial membrane to be used in mitochondrial β-oxidation. We hypothesized that oral administration ALC with the antioxidant lipoic acid (ALC + LA) would benefit nonalcoholic fatty liver. To test our hypothesis, we fed Balb/C mice a standard diet (SF) or SF with ALC + LA or high-fat diet (HF) or HF with ALC + LA for 6 months. Acetyl-L-carnitine and LA were dissolved at 0.2:0.1% (wt/vol) in drinking water, and mice were allowed free access to food and water. Along with physical parameters, insulin resistance (blood glucose, insulin, glucose tolerance), liver function (alanine transaminase [ALT], aspartate transaminase [AST]), liver histology (hematoxylin and eosin), oxidative stress (malondialdehyde), and mitochondrial abnormalities (carbamoyl phosphate synthase 1 and electron microscopy) were done. Compared with SF, HF had higher body, liver, liver-to-body weight ratio, white adipose tissue, ALT, AST, liver fat, oxidative stress, and insulin resistance. Coadministration of ALC + LA to HF animals significantly improved the mitochondrial marker carbamoyl phosphate synthase 1 and the size of the mitochondria in liver. Alanine transaminase and AST levels were decreased. In a nonalcoholic fatty liver mice model, ALC + LA combination improved liver mitochondrial content, size, serum ALT, and AST without significant changes in oxidative stress, insulin resistance, and liver fat accumulation. PMID:24176233

  15. The antioxidant effect of DL-alpha-lipoic acid on copper-induced acute hepatitis in Long-Evans Cinnamon (LEC) rats.


    Yamamoto, H; Watanabe, T; Mizuno, H; Endo, K; Fukushige, J; Hosokawa, T; Kazusaka, A; Fujita, S


    The Long-Evans Cinnamon (LEC) rats, due to a genetic defect, accumulate excess copper (Cu) in the liver in a manner similar to patients with Wilson's disease and spontaneously develop acute hepatitis with severe jaundice. In this study we examined the protective effect of DL-alpha-Lipoic acid (LA) against acute hepatitis in LEC rats. LA was administered to LEC rats by gavage in doses of 10, 30 and 100 mg/kg five times per week, starting at 8-weeks-old and continuing till 12-weeks-old. Although LA had little effect against the increases in serum transaminase activities, it suppressed the loss of body weight and prevented severe jaundice in a dose-dependent manner. Antioxidant system analyses in liver showed that LA treatment significantly suppressed the inactivations of catalase and glutathione peroxidase, and the induction of heme oxygenase-1, an enzyme which is inducible under oxidative stress. Furthermore, LA showed dose-dependent suppressive effect against increase in nonheme iron contents of both cytosolic and crude mitochondrial fractions in a dose-dependent manner. Although at the highest dose, LA slightly suppressed the accumulation of Cu in crude mitochondrial fraction, it had no effect on the accumulation of Cu in cytosolic fraction. While LA completely suppressed the increase in lipid peroxidation (LPO) in the microsomal fraction at the highest dose, the suppressive effect against LPO in crude mitochondrial fractions was slight. From these results, it is concluded that LA has antioxidant effects at the molecular level against the development of Cu-induced hepatitis in LEC rats. Moreover, mitochondrial oxidative damage might be involved in the development of acute hepatitis in LEC rats.

  16. Effects of alpha-lipoic acid supplementation in different stages on growth performance, antioxidant capacity and meat quality in broiler chickens.


    Guo, Z Y; Li, J L; Zhang, L; Jiang, Y; Gao, F; Zhou, G H


    This experiment was conducted to investigate the effect of basal dietary supplementation with 500 mg/kg alpha-lipoic acid (LA) on growth performance, antioxidant capacity and meat quality in different stages in broiler chickens. A total of 240 Arbor Acre chickens were randomly assigned into 4 treatment groups, each treatment containing 6 replicates of 10 chickens each. Group 1 was the control group without LA supplementation; Group 2 was supplied with LA in the starter period; Group 3 was supplied with LA in the grower period; and Group 4 was supplied with LA in the whole period. The results showed that LA supplementation improved average feed intake and body weight gain in all three experimental groups, especially in Group 2. LA supplementation significantly decreased abdominal fat yield in Groups 3 and 4. LA supplementation all improved hepatic total antioxidant capacity, the level of glutathione, the activities of total superoxide dismutase, catalase (CAT) and glutathione peroxidase, in particular in Group 4. LA supplementation decreased the activity of liver xanthine oxidase (XO) in all experimental groups, and that of liver monoamine oxidase in Group 3. The activities of liver CAT and XO in Group 2 were higher than that in Group 3. LA supplementation elevated the pH24 h and decreased drip loss in breast meat in Groups 3 and 4. In conclusion, LA supplementation can improve growth performance, antioxidant properties and meat quality in broiler chicken. LA supplementation in the starter period can improve growth performance and supplementation in the grower - and in the whole period can improve carcass characteristics. There was no significant difference in meat quality of broiler chickens fed on LA-supplemented diet in different stages. PMID:25162760

  17. Enhancement of lipid stability of broiler breast meat and meat products fed on alpha lipoic acid and alpha tocopherol acetate supplemented feed.


    Sohaib, Muhammad; Anjum, Faqir Muhammad; Khan, Muhammad Issa; Arshad, Muhammad Sajid; Shahid, Muhammad


    This study was designed to investigate the effect of alpha lipoic acid (ALA) and alpha tocopherol acetate (ATA) on the antioxidant potential, lipid stability and the quality of the broiler breast meat and meat products. The treatment plan was as (T1=control feed, T2=200 mg ATA + 25 mg ALA/kg feed, T3=200 mg ATA + 75 mg ALA/kg feed, T4=200 mg ATA +150 mg ALA/kg feed, T5=Oxidized oil (4%), T6=200 mg ATA + 150 mg ALA + Oxidized oil (4%)/kg feed). After two weeks of acclimatization the birds were fed with ALA and ATA enriched diet. The results revealed that maximum deposition of ALA took place in T4 which contain maximum dose of ALA. The TBARS and DPPH values of the broiler breast meat were in T4 (0.14 ± 0.01 MDA/kg of meat, 76.69 ± 0.14%) and in T5 were (0.24 ± 0.15 MDA/Kg of meat, 44.98 ± 0.04%) accordingly. ATA concentration were also highest in T4 (206.43 ± 0.22 mg/g of meat) and lowest in T5 (79.09 ± 0.06 mg/g of meat). Sensory evaluation results showed that nuggets and patties made of T5 containing oxidized oil were least liked and T4 got highest score. In a nutshell, 150 mg/kg feed dietary supplementation of ALA with constant level of ATA can ameliorate the antioxidant potential, lipid stability and nutritional qualities of broiler breast meat and meat products.

  18. Role of α-lipoic acid in LPS/d-GalN induced fulminant hepatic failure in mice: studies on oxidative stress, inflammation and apoptosis.


    Xia, Xiaomin; Su, Chuanyang; Fu, Juanli; Zhang, Pu; Jiang, Xiaoji; Xu, Demei; Hu, Lihua; Song, Erqun; Song, Yang


    This study investigated the protective effect of α-lipoic acid (LA) on lipopolysaccharide (LPS)/d-galactosamine (d-GalN)-induced fulminant hepatic failure in mice. First, we found that LA markedly reduced LPS/d-GalN-induced increases in serum ALT and AST activities, which were supplemented with histopathological examination, suggested that LA has a protective effect on this model of hepatic damage. Livers challenged with LPS/d-GalN exhibited extensive areas of vacuolization with the disappearance of nuclei and the loss of hepatic architecture. On the contrary, these pathological alterations were ameliorated by LA treatment. Next, we found that ROS and TBARS levels were increased in LPS/d-GalN treated liver homogenates, which were attenuated by LA administration. Consistently, decreases in hepatic CAT and GPx activities were observed in LPS/d-GalN group and were significantly restored by LA administration. Moreover, pretreatment with LA markedly reduced LPS/d-GalN-induced iNOS, COX-2, TNF-α, NF-κB, IL-1β and IL-6 expressions. Furthermore, our data showed that TUNEL-positive cells increased in LPS/d-GalN-treated mice liver which was counteracted by LA administration. LPS/d-GalN induced apoptosis of hepatocytes, as estimated by caspase 3, caspase 8 and caspase 9 activations. Also, the increasing of Bax and the decreasing of Bcl-2 expressions also supported LPS/d-GalN induced apoptosis. Interestingly, LA marked relieved these apoptotic features. Taking together, our results indicated that LA plays an important role on LPS/d-GalN-induced fulminant hepatic failure through its antioxidant, anti-inflammatory and anti-apoptotic activities.

  19. α-Lipoic acid up-regulates expression of peroxisome proliferator-activated receptor β in skeletal muscle: involvement of the JNK signaling pathway.


    Rousseau, Anne-Sophie; Sibille, Brigitte; Murdaca, Joseph; Mothe-Satney, Isabelle; Grimaldi, Paul A; Neels, Jaap G


    We hypothesized that α-lipoic acid (α-LA) might interact with the transcriptional control of peroxisome proliferator-activated receptor (PPAR)β in skeletal muscle. Molecular mechanisms were investigated using differentiated C2C12 myotubes treated with α-LA and/or PPARβ agonist GW0742. In vivo studies with 3-mo-old C57Bl6 mice were realized: voluntary wheel running (VWR) training (7 wk), and a 6 wk diet containing (or not) α-LA (0.25% wt/wt). This last condition was combined with (or not) 1 bout of treadmill exercise (18 m/min for 1 h). Using a reporter assay, we demonstrate that α-LA is not an agonist of PPARβ but regulates PPARβ target gene expression through an active PPARβ pathway. GW0742-induced pyruvate dehydrogenase kinase 4 mRNA is potentiated by α-LA. In C2C12, α-LA lowers the activation of the JNK signaling pathway and increases PPARβ mRNA and protein levels (2-fold) to the same extent as with the JNK inhibitor SP600125. Similarly to VWR training effect, PPARβ expression increases (2-fold) in vastus lateralis of animals fed an α-LA-enriched diet. However, α-LA treatment does not further stimulate the adaptive up-regulation of PPARβ observed in response to 1 bout of exercise. We have identified a novel mechanism of regulation of PPARβ expression/action in skeletal muscle with potential physiologic application through the action of α-LA, involving the JNK pathway.

  20. Inhibitory effect of α-lipoic acid on thioacetamide-induced tumor promotion through suppression of inflammatory cell responses in a two-stage hepatocarcinogenesis model in rats.


    Fujii, Yuta; Segawa, Risa; Kimura, Masayuki; Wang, Liyun; Ishii, Yuji; Yamamoto, Ryuichi; Morita, Reiko; Mitsumori, Kunitoshi; Shibutani, Makoto


    To investigate the protective effect of α-lipoic acid (a-LA) on the hepatocarcinogenic process promoted by thioacetamide (TAA), we used a two-stage liver carcinogenesis model in N-diethylnitrosamine (DEN)-initiated and TAA-promoted rats. We examined the modifying effect of co-administered a-LA on the liver tissue environment surrounding preneoplastic hepatocellular lesions, with particular focus on hepatic macrophages and the mechanism behind the decrease in apoptosis of cells surrounding preneoplastic hepatocellular lesions during the early stages of hepatocellular tumor promotion. TAA increased the number and area of glutathione S-transferase placental form (GST-P)(+) liver cell foci and the numbers of proliferating and apoptotic cells in the liver. Co-administration with a-LA suppressed these effects. TAA also increased the numbers of ED2(+), cyclooxygenase-2(+), and heme oxygenase-1(+) hepatic macrophages as well as the number of CD3(+) lymphocytes. These effects were also suppressed by a-LA. Transcript levels of some inflammation-related genes were upregulated by TAA and downregulated by a-LA in real-time RT-PCR analysis. Outside the GST-P(+) foci, a-LA reduced the numbers of apoptotic cells, active caspase-8(+) cells and death receptor (DR)-5(+) cells. These results suggest that hepatic macrophages producing proinflammatory factors may be activated in TAA-induced tumor promotion. a-LA may suppress tumor-promoting activity by suppressing the activation of these macrophages and the subsequent inflammatory responses. Furthermore, a-LA may suppress tumor-promoting activity by suppressing the DR5-mediated extrinsic pathway of apoptosis and the subsequent regeneration of liver cells outside GST-P(+) foci.

  1. Lipoic acid improves neuronal insulin signalling and rescues cognitive function regulating VGlut1 expression in high-fat-fed rats: Implications for Alzheimer's disease.


    Rodriguez-Perdigon, Manuel; Solas, Maite; Moreno-Aliaga, Maria Jesús; Ramirez, Maria Javier


    The concept of central insulin resistance and dysfunctional insulin signalling in sporadic Alzheimer's disease (AD) is now widely accepted and diabetes is recognized as one of the main risk factors for developing AD. Moreover, some lines of evidence indicated that VGlut1 is impaired in frontal regions of AD patients and this impairment is correlated with the progression of cognitive decline in AD. The present work hypothesizes that ketosis associated to insulin resistance could interfere with the normal activity of VGlut1 and its role in the release of glutamate in the hippocampus, which might ultimately lead to cognitive deficits. High fat diet (HFD) rats showed memory impairments and both peripheral (as shown by increased fasting plasma insulin levels and HOMA index) and hippocampal (as shown by decreased activation of insulin receptor, IRS-1 and pAkt) insulin pathway alterations, accompanied by increased ketone bodies production. All these effects were counteracted by α-lipoic acid (LA) administration. VGlut1 levels were significantly decreased in the hippocampus of HFD rats, and this decrease was reversed by LA. Altogether, the present results suggest that HFD induced alterations in central insulin signalling could switch metabolism to produce ketone bodies, which in turn, in the hippocampus, might lead to a decreased expression of VGlut1, and therefore to a decreased release of glutamate and hence, to the glutamatergic deficit described in AD. The ability of LA treatment to prevent the alterations in insulin signalling in this model of HFD might represent a possible new therapeutic target for the treatment of AD.

  2. Alpha-lipoic acid alone and combined with clozapine reverses schizophrenia-like symptoms induced by ketamine in mice: Participation of antioxidant, nitrergic and neurotrophic mechanisms.


    Vasconcelos, Germana Silva; Ximenes, Naiara Coelho; de Sousa, Caren Nádia Soares; Oliveira, Tatiana de Queiroz; Lima, Laio Ladislau Lopes; de Lucena, David Freitas; Gama, Clarissa Severino; Macêdo, Danielle; Vasconcelos, Silvânia Maria Mendes


    Oxidative stress has important implications in schizophrenia. Alpha-lipoic acid (ALA) is a natural antioxidant synthesized in human tissues with clinical uses. We studied the effect of ALA or clozapine (CLZ) alone or in combination in the reversal of schizophrenia-like alterations induced by ketamine (KET). Adult male mice received saline or KET for 14 days. From 8th to 14th days mice were additionally administered saline, ALA (100 mg/kg), CLZ 2.5 or 5 mg/kg or the combinations ALA+CLZ2.5 or ALA+CLZ5. Schizophrenia-like symptoms were evaluated by prepulse inhibition of the startle (PPI) and locomotor activity (positive-like), social preference (negative-like) and Y maze (cognitive-like). Oxidative alterations (reduced glutathione - GSH and lipid peroxidation - LP) and nitrite in the prefrontal cortex (PFC), hippocampus (HC) and striatum (ST) and BDNF in the PFC were also determined. KET caused deficits in PPI, working memory, social interaction and hyperlocomotion. Decreased levels of GSH, nitrite (HC) and BDNF and increased LP were also observed in KET-treated mice. ALA and CLZ alone reversed KET-induced behavioral alterations. These drugs also reversed the decreases in GSH (HC) and BDNF and increase in LP (PFC, HC and ST). The combination ALA+CLZ2.5 reversed behavioral and some neurochemical parameters. However, ALA+CLZ5 caused motor impairment. Therefore, ALA presented an antipsychotic-like profile reversing KET-induced positive- and negative-like symptoms. The mechanism partially involves antioxidant, neurotrophic and nitrergic pathways. The combination of ALA+CLZ2.5 improved most of the parameters evaluated in this study without causing motor impairment demonstrating, thus, that possibly when combined with ALA a lower dose of CLZ is required. PMID:25937462

  3. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same


    Croteau, Rodney Bruce; Burke, Charles Cullen


    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  4. Nucleic acids encoding antifungal polypeptides and uses thereof


    Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser


    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  5. Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof


    Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser


    Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

  6. Human jagged polypeptide, encoding nucleic acids and methods of use


    Li, Linheng; Hood, Leroy


    The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

  7. Improvement of mTORC1-driven overproduction of apoB-containing triacylglyceride-rich lipoproteins by short-chain fatty acids, 4-phenylbutyric acid and (R)-α-lipoic acid, in human hepatocellular carcinoma cells.


    Roberts, Joseph L; He, Bo; Erickson, Anjeza; Moreau, Régis


    The activation of hepatic kinase mechanistic target of rapamycin complex 1 (mTORC1) is implicated in the development of obesity-related metabolic disorders. This study investigated the metabolic sequelae of mTORC1 hyperactivation in human hepatoma cells and the lipid-regulating mechanisms of two short-chain fatty acids: 4-phenylbutyric acid (PBA) and (R)-α-lipoic acid (LA). We created three stable cell lines that exhibit low, normal, or high mTORC1 activity. mTORC1 hyperactivation induced the expression of lipogenic (DGAT1 and DGAT2) and lipoprotein assembly (MTP and APOB) genes, thereby raising cellular triacylglyceride (TG) and exacerbating secretion of apoB-containing TG-rich lipoproteins. LYS6K2, a specific inhibitor of the p70 S6 kinase branch of mTORC1 signaling, reversed these effects. PBA and LA decreased secreted TG through distinct mechanisms. PBA repressed apoB expression (both mRNA and protein) and lowered secreted TG without mitigation of mTORC1 hyperactivity or activation of AMPK. LA decreased cellular and secreted TG by attenuating mTORC1 signaling in an AMPK-independent manner. LA did not regulate apoB expression but led to the secretion of apoB-containing TG-poor lipoproteins by repressing the expression of lipogenic genes, FASN, DGAT1, and DGAT2. Our studies provide new mechanistic insight into the hypolipidemic activity of PBA and LA in the context of mTORC1 hyperactivation and suggest that the short-chain fatty acids may aid in the prevention and treatment of hypertriglyceridemia.

  8. Safety and efficacy of an add-on therapy with curcumin phytosome and piperine and/or lipoic acid in subjects with a diagnosis of peripheral neuropathy treated with dexibuprofen

    PubMed Central

    Di Pierro, Francesco; Settembre, Roberto


    We conducted an 8-week, open, randomized controlled clinical trial on 141 subjects affected by neuropathic pain to investigate the role of an adjunctive therapy added to the administration of dexibuprofen (400 mg twice a day) and based on a multi-ingredient formula (Lipicur), consisting of lipoic acid plus curcumin phytosome and piperine, in patients with a diagnosis of lumbar sciatica, lumbar disk herniation, and/or lumbar canal stenosis (96 subjects), or with carpal tunnel syndrome (45 subjects). A total of 135 participants completed the study. Treatment with the multi-ingredient formula (Lipicur) reduced neuropathic pain by more than 66% in both conditions (subjects with lumbar sciatica and with carpal tunnel syndrome), and these reductions were statistically significant. Moreover, the treatment reduced dexibuprofen use by about 40%. An add-on therapy with only lipoic acid has not shown any significant results. On the basis of its safety and efficacy, Lipicur could be considered an effective complementary therapy to be added to conventional treatments to achieve better efficacy in reducing neuropathic pain. PMID:23861596

  9. Effects of dietary α-lipoic acid, acetyl-l-carnitine, and sex on antioxidative ability, energy, and lipid metabolism in broilers.


    Jia, R; Bao, Y H; Zhang, Y; Ji, C; Zhao, L H; Zhang, J Y; Gao, C Q; Ma, Q G


    An experiment was conducted to evaluate the effects of dietary α-lipoic acid (LA), acetyl-l-carnitine (ALC), and sex on antioxidative ability, energy, and lipid metabolism in broilers. A total of 972 one-day-old broilers with equal sex were randomly assigned in a 3 × 3 × 2 factorial design using 3 LA, 3 ALC levels, and 2 sexes (6 replications, 9 birds/replication). The LA and ALC levels were 0, 50, and 100 mg/kg, respectively. Results showed that increased LA or ALC resulted in increased total antioxidant capacity and superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities and decreased levels of malondialdehyde in serum and liver of birds (P < 0.05). In addition, with increasing addition of LA or ALC, an increased (P < 0.01) level of insulin (Ins), as well as decreased (P < 0.05) levels of glucose and glucagon (Glu), were observed in serum of broilers. Total cholesterol and triglyceride (TG) levels decreased (P < 0.05) and nonesterified fatty acid, lipoprotein lipase, and lipase levels increased (P < 0.05) in serum with increased administration of LA or ALC. Moreover, a significant (P < 0.05) interaction of LA × ALC was observed for serum and liver SOD, serum GSH-Px, glucose, and TG levels. Birds fed diets containing 50 mg/kg of LA and 50 mg/kg of ALC had higher serum and liver SOD activities and lower serum glucose and TG levels than those fed diets containing 100 mg/kg of LA or ALC alone. The main effect of sex and all interactions among main effects (except LA × ALC) were not significant (P > 0.05) for all of the above parameters. Overall, the present data indicate that LA or ALC supplementation, or both, at low levels (50 or 100 mg/kg) improved antioxidative ability, energy metabolism, and lipid metabolism in broilers, and synergistic effects by the combined supplementation of LA and ALC were indicated by serum and liver SOD activities and serum glucose and TG levels. PMID:25239530

  10. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  11. Polypeptides having cellulolytic enhancing activity and nucleic acids encoding same

    SciTech Connect

    Brown, Kimberly; Harris, Paul; Zaretsky, Elizabeth; Re, Edward; Vlasenko, Elena; McFarland, Keith; Lopez de Leon, Alfredo


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods for producing and using the polypeptides.

  12. Method for Enzyme Design with Genetically Encoded Unnatural Amino Acids.


    Hu, C; Wang, J


    We describe the methodologies for the design of artificial enzymes with genetically encoded unnatural amino acids. Genetically encoded unnatural amino acids offer great promise for constructing artificial enzymes with novel activities. In our studies, the designs of artificial enzyme were divided into two steps. First, we considered the unnatural amino acids and the protein scaffold separately. The scaffold is designed by traditional protein design methods. The unnatural amino acids are inspired by natural structure and organic chemistry methods, and synthesized by either organic chemistry methods or enzymatic conversion. With the increasing number of published unnatural amino acids with various functions, we described an unnatural amino acids toolkit containing metal chelators, redox mediators, and click chemistry reagents. These efforts enable a researcher to search the toolkit for appropriate unnatural amino acids for the study, rather than design and synthesize the unnatural amino acids from the beginning. After the first step, the model enzyme was optimized by computational methods and directed evolution. Lastly, we describe a general method for evolving aminoacyl-tRNA synthetase and expressing unnatural amino acids incorporated into a protein. PMID:27586330

  13. Method for Enzyme Design with Genetically Encoded Unnatural Amino Acids.


    Hu, C; Wang, J


    We describe the methodologies for the design of artificial enzymes with genetically encoded unnatural amino acids. Genetically encoded unnatural amino acids offer great promise for constructing artificial enzymes with novel activities. In our studies, the designs of artificial enzyme were divided into two steps. First, we considered the unnatural amino acids and the protein scaffold separately. The scaffold is designed by traditional protein design methods. The unnatural amino acids are inspired by natural structure and organic chemistry methods, and synthesized by either organic chemistry methods or enzymatic conversion. With the increasing number of published unnatural amino acids with various functions, we described an unnatural amino acids toolkit containing metal chelators, redox mediators, and click chemistry reagents. These efforts enable a researcher to search the toolkit for appropriate unnatural amino acids for the study, rather than design and synthesize the unnatural amino acids from the beginning. After the first step, the model enzyme was optimized by computational methods and directed evolution. Lastly, we describe a general method for evolving aminoacyl-tRNA synthetase and expressing unnatural amino acids incorporated into a protein.

  14. Enhancement of lipid stability of broiler breast meat and meat products fed on alpha lipoic acid and alpha tocopherol acetate supplemented feed

    PubMed Central


    This study was designed to investigate the effect of alpha lipoic acid (ALA) and alpha tocopherol acetate (ATA) on the antioxidant potential, lipid stability and the quality of the broiler breast meat and meat products. The treatment plan was as (T1 = control feed, T2 = 200 mg ATA + 25 mg ALA/kg feed, T3 = 200 mg ATA + 75 mg ALA/kg feed, T4 = 200 mg ATA + 150 mg ALA/kg feed, T5 = Oxidized oil (4%), T6 = 200 mg ATA + 150 mg ALA + Oxidized oil (4%)/kg feed). After two weeks of acclimatization the birds were fed with ALA and ATA enriched diet. The results revealed that maximum deposition of ALA took place in T4 which contain maximum dose of ALA. The TBARS and DPPH values of the broiler breast meat were in T4 (0.14 ± 0.01 MDA/kg of meat, 76.69 ± 0.14%) and in T5 were (0.24 ± 0.15 MDA/Kg of meat, 44.98 ± 0.04%) accordingly. ATA concentration were also highest in T4 (206.43 ± 0.22 mg/g of meat) and lowest in T5 (79.09 ± 0.06 mg/g of meat). Sensory evaluation results showed that nuggets and patties made of T5 containing oxidized oil were least liked and T4 got highest score. In a nutshell, 150 mg/kg feed dietary supplementation of ALA with constant level of ATA can ameliorate the antioxidant potential, lipid stability and nutritional qualities of broiler breast meat and meat products. PMID:22640892

  15. Proteomic analysis of specific brain proteins in aged SAMP8 mice treated with alpha-lipoic acid: implications for aging and age-related neurodegenerative disorders.


    Poon, H Fai; Farr, Susan A; Thongboonkerd, Visith; Lynn, Bert C; Banks, William A; Morley, John E; Klein, Jon B; Butterfield, D Allan


    Free radical-mediated damage to neuronal membrane components has been implicated in the etiology of Alzheimer's disease (AD) and aging. The senescence accelerated prone mouse strain 8 (SAMP8) exhibits age-related deterioration in memory and learning along with increased oxidative markers. Therefore, SAMP8 is a suitable model to study brain aging and, since aging is the major risk factor for AD and SAMP8 exhibits many of the biochemical findings of AD, perhaps as a model for and the early phase of AD. Our previous studies reported higher oxidative stress markers in brains of 12-month-old SAMP8 mice when compared to that of 4-month-old SAMP8 mice. Further, we have previously shown that injecting the mice with alpha-lipoic acid (LA) reversed brain lipid peroxidation, protein oxidation, as well as the learning and memory impairments in SAMP8 mice. Recently, we reported the use of proteomics to identify proteins that are expressed differently and/or modified oxidatively in aged SAMP8 brains. In order to understand how LA reverses the learning and memory deficits of aged SAMP8 mice, in the current study, we used proteomics to compare the expression levels and specific carbonyl levels of proteins in brains from 12-month-old SAMP8 mice treated or not treated with LA. We found that the expressions of the three brain proteins (neurofilament triplet L protein, alpha-enolase, and ubiquitous mitochondrial creatine kinase) were increased significantly and that the specific carbonyl levels of the three brain proteins (lactate dehydrogenase B, dihydropyrimidinase-like protein 2, and alpha-enolase) were significantly decreased in the aged SAMP8 mice treated with LA. These findings suggest that the improved learning and memory observed in LA-injected SAMP8 mice may be related to the restoration of the normal condition of specific proteins in aged SAMP8 mouse brain. Moreover, our current study implicates neurofilament triplet L protein, alpha-enolase, ubiquitous mitochondrial

  16. Multiple mechanisms of age-dependent accumulation of amyloid beta protein in rat brain: Prevention by dietary supplementation with N-acetylcysteine, α-lipoic acid and α-tocopherol.


    Sinha, Maitrayee; Bir, Aritri; Banerjee, Anindita; Bhowmick, Pritha; Chakrabarti, Sasanka


    The aged brain may be used as a tool to investigate altered metabolism of amyloid beta protein (Aβ42) that may have implications in the pathogenesis of Alzheimer's disease (AD). In the present study, we have observed a striking increase in the amyloid precursor protein (APP) level in the brain cortex of aged rats (22-24 months) along with a mild but statistically significant increase in the level of APP mRNA. Moreover, the activity of β secretase is elevated (nearly 55%) and that of neprilysin diminished (48%) in brain cortex of aged rats compared to that in young rats (4-6 months). All these changes lead to a markedly increased accumulation of Aβ42 in brain cortical tissue of aged rats. Long-term dietary supplementation of rats with a combination of N-acetylcysteine, α-lipoic and α-tocopherol from 18 months onwards daily till the sacrifice of the animals by 22-24 months, attenuates the age-related alterations in amyloid beta metabolism. In separate experiments, a significant impairment of spatial learning and memory has been observed in aged rats, and the phenomenon is remarkably prevented by the dietary supplementation of the aged animals by the same combination of N-acetylcysteine, α-lipoic acid and α-tocopherol. The results call for further explorations of this combination in suitable animal models in ameliorating AD related brain deficits.

  17. The pea gene NA encodes ent-kaurenoic acid oxidase.


    Davidson, Sandra E; Elliott, Robert C; Helliwell, Chris A; Poole, Andrew T; Reid, James B


    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA(12) when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7alpha-hydroxykaurenoic acid and GA(12)-aldehyde, some additional products of the pea KAO activity were detected, including ent-6alpha,7alpha-dihydroxykaurenoic acid and 7beta-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants.

  18. Chlamydia pneumoniae encodes a functional aromatic amino acid hydroxylase.


    Abromaitis, Stephanie; Hefty, P Scott; Stephens, Richard S


    Chlamydia pneumoniae is a community-acquired respiratory pathogen that has been associated with the development of atherosclerosis. Analysis of the C. pneumoniae genome identified a gene (Cpn1046) homologous to eukaryotic aromatic amino acid hydroxylases (AroAA-Hs). AroAA-Hs hydroxylate phenylalanine, tyrosine, and tryptophan into tyrosine, dihydroxyphenylalanine, and 5-hydroxytryptophan, respectively. Sequence analysis of Cpn1046 demonstrated that residues essential for AroAA-H enzymatic function are conserved and that a subset of Chlamydia species contain an AroAA-H homolog. The chlamydial AroAA-Hs are transcriptionally linked to a putative bacterial membrane transport protein. We determined that recombinant Cpn1046 is able to hydroxylate phenylalanine, tyrosine, and tryptophan with roughly equivalent activity for all three substrates. Cpn1046 is expressed within 24 h of infection, allowing C. pneumoniae to hydroxylate host stores of aromatic amino acids during the period of logarithmic bacterial growth. From these results we can conclude that C. pneumoniae, as well as a subset of other Chlamydia species, encode an AroAA-H that is able to use all three aromatic amino acids as substrates. The maintenance of this gene within a number of Chlamydia suggests that the enzyme may have an important role in shaping the metabolism or overall pathogenesis of these bacteria. PMID:19141112

  19. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by DL-α-Lipoic Acid.


    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester C S; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba


    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3-1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1-3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants DL-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3-MST

  20. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by dl-α-Lipoic Acid

    PubMed Central

    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester CS; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba


    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3–1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1–3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants dl-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3

  1. Regulation of Vascular Tone, Angiogenesis and Cellular Bioenergetics by the 3-Mercaptopyruvate Sulfurtransferase/H2S Pathway: Functional Impairment by Hyperglycemia and Restoration by DL-α-Lipoic Acid.


    Coletta, Ciro; Módis, Katalin; Szczesny, Bartosz; Brunyánszki, Attila; Oláh, Gábor; Rios, Ester C S; Yanagi, Kazunori; Ahmad, Akbar; Papapetropoulos, Andreas; Szabo, Csaba


    Hydrogen sulfide (H2S), as a reducing agent and an antioxidant molecule, exerts protective effects against hyperglycemic stress in the vascular endothelium. The mitochondrial enzyme 3-mercaptopyruvate sulfurtransferase (3-MST) is an important biological source of H2S. We have recently demonstrated that 3-MST activity is inhibited by oxidative stress in vitro and speculated that this may have an adverse effect on cellular homeostasis. In the current study, given the importance of H2S as a vasorelaxant, angiogenesis stimulator and cellular bioenergetic mediator, we first determined whether the 3-MST/H2S system plays a physiological regulatory role in endothelial cells. Next, we tested whether a dysfunction of this pathway develops during the development of hyperglycemia and μmol/L to diabetes-associated vascular complications. Intraperitoneal (IP) 3-MP (1 mg/kg) raised plasma H2S levels in rats. 3-MP (10 1 mmol/L) promoted angiogenesis in vitro in bEnd3 microvascular endothelial cells and in vivo in a Matrigel assay in mice (0.3-1 mg/kg). In vitro studies with bEnd3 cell homogenates demonstrated that the 3-MP-induced increases in H2S production depended on enzymatic activity, although at higher concentrations (1-3 mmol/L) there was also evidence for an additional nonenzymatic H2S production by 3-MP. In vivo, 3-MP facilitated wound healing in rats, induced the relaxation of dermal microvessels and increased mitochondrial bioenergetic function. In vitro hyperglycemia or in vivo streptozotocin diabetes impaired angiogenesis, attenuated mitochondrial function and delayed wound healing; all of these responses were associated with an impairment of the proangiogenic and bioenergetic effects of 3-MP. The antioxidants DL-α-lipoic acid (LA) in vivo, or dihydrolipoic acid (DHLA) in vitro restored the ability of 3-MP to stimulate angiogenesis, cellular bioenergetics and wound healing in hyperglycemia and diabetes. We conclude that diabetes leads to an impairment of the 3-MST

  2. Reduction-responsive disassemblable core-cross-linked micelles based on poly(ethylene glycol)-b-poly(N-2-hydroxypropyl methacrylamide)-lipoic acid conjugates for triggered intracellular anticancer drug release.


    Wei, Rongran; Cheng, Liang; Zheng, Meng; Cheng, Ru; Meng, Fenghua; Deng, Chao; Zhong, Zhiyuan


    Reduction-sensitive reversibly core-cross-linked micelles were developed based on poly(ethylene glycol)-b-poly(N-2-hydroxypropyl methacrylamide)-lipoic acid (PEG-b-PHPMA-LA) conjugates and investigated for triggered doxorubicin (DOX) release. Water-soluble PEG-b-PHPMA block copolymers were obtained with M(n,PEG) of 5.0 kg/mol and M(n,HPMA) varying from 1.7 and 4.1 to 7.0 kg/mol by reversible addition-fragmentation chain transfer (RAFT) polymerization. The esterification of the hydroxyl groups in the PEG-b-PHPMA copolymers with lipoic acid (LA) gave amphiphilic PEG-b-PHPMA-LA conjugates with degrees of substitution (DS) of 71-86%, which formed monodispersed micelles with average sizes ranging from 85.3 to 142.5 nm, depending on PHPMA molecular weights, in phosphate buffer (PB, 10 mM, pH 7.4). These micelles were readily cross-linked with a catalytic amount of dithiothreitol (DTT). Notably, PEG-b-PHPMA(7.0k)-LA micelles displayed superior DOX loading content (21.3 wt %) and loading efficiency (90%). The in vitro release studies showed that only about 23.0% of DOX was released in 12 h from cross-linked micelles at 37 °C at a low micelle concentration of 40 μg/mL, whereas about 87.0% of DOX was released in the presence of 10 mM DTT under otherwise the same conditions. MTT assays showed that DOX-loaded core-cross-linked PEG-b-PHPMA-LA micelles exhibited high antitumor activity in HeLa and HepG2 cells with low IC(50) (half inhibitory concentration) of 6.7 and 12.8 μg DOX equiv/mL, respectively, following 48 h incubation, while blank micelles were practically nontoxic up to a tested concentration of 1.0 mg/mL. Confocal laser scanning microscope (CLSM) studies showed that DOX-loaded core-cross-linked micelles released DOX into the cell nuclei of HeLa cells in 12 h. These reduction-sensitive disassemblable core-cross-linked micelles with excellent biocompatibility, superior drug loading, high extracellular stability, and triggered intracellular drug release are promising

  3. Determination of newly synthesized lipoic acid-niacin dimer in rat plasma by UPLC/electrospray ionization tandem mass spectrometry: assay development, validation and application to a pharmacokinetic study.


    Chen, Xiao; Gao, Jingwen; Jiang, Yiming; Huang, Ping; Xie, Yuhui; Pi, Rongbiao; Zhu, Shuzhen; Yao, Meicun


    A simple, sensitive and specific ultra-performance liquid chromatography/tandem mass spectrometry (UPLC-MS/MS) method was developed to determine the newly synthesized compound lipoic acid-niacin dimer (N2L) in plasma. Plasma samples were precipitated by methanol using tetrahydropalmatine as internal standard. Chromatographic separation was achieved on an Acquity BEH C18 (2.1 × 50 mm i.d., 1.7 µm) column; the mobile phase contains methanol and buffer solution (water with 0.5% formic acid and 10 mmol/L ammonium acetate). Multiple reaction monitoring (m/z 353.9 → 148.6 for N2L and m/z 356.0 → 192.0 for internal standard) was performed for detection and quantification. The method was validated to be rapid, specific, accurate and precise over the concentration range of 1-750 ng/mL; N2L was not stable on the bench-top or during freeze-freeze-thaw cycles in plasma, but was stable in the stock solution and after preparation in the autosampler for 24 h. The utility of the assay was confirmed by pharmacokinetic study of N2L in rats.

  4. The Combination of N-Acetyl Cysteine, Alpha-Lipoic Acid, and Bromelain Shows High Anti-Inflammatory Properties in Novel In Vivo and In Vitro Models of Endometriosis

    PubMed Central

    Agostinis, C.; Zorzet, S.; De Leo, R.; Zauli, G.; De Seta, F.; Bulla, R.


    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory “marker” VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis. PMID:25960622

  5. Role of Cyt-C/caspases-9,3, Bax/Bcl-2 and the FAS death receptor pathway in apoptosis induced by zinc oxide nanoparticles in human aortic endothelial cells and the protective effect by alpha-lipoic acid.


    Liang, Shuhang; Sun, Kuo; Wang, Yue; Dong, Shuying; Wang, Cheng; Liu, LianXin; Wu, YongHui


    Zinc oxide nanoparticles (ZnO NPs) are widely used in a variety of products used in daily life. However, their impact on human health has not been completely elucidated. This study was designed to investigate the cytotoxicity associated with ZnO NPs, the role of dissolution in the toxicity of ZnO NPs, the molecular mechanisms and mode of cell death induced by ZnO NPs in human aortic endothelial cells (HAECs), and the protective effects of the antioxidant alpha-lipoic acid (LA). ZnO NPs significantly reduced cell viability in a dose- and time-dependent manner, resulted in intracellular oxidative stress and cell membrane leakage when treated with doses of 8-50 μg/mL for 12 and 24 h in HAECs. The toxicity was produced by undissolved ZnO NPs but not dissolved Zn(2+) and metal impurities. Exposure to ZnO NPs was found to induce apoptosis at 12 h and necrosis after 24 h. Apoptosis was confirmed using reactive oxygen species that triggered a decrease in mitochondria membrane potential, increase in Cyt-C release, activation of caspases 3 and caspases9 and increase in the ratio of Bax/Bcl-2. Futhermore, ZnO NPs could activate the Fas death receptor pathway. In addition, the antioxidant LA was able to protect HAECs from apoptosis induced by ZnO NPs. PMID:27544635

  6. α-Lipoic acid protects against the cytotoxicity and oxidative stress induced by cadmium in HepG2 cells through regeneration of glutathione by glutathione reductase via Nrf2/ARE signaling pathway.


    Shi, Chunli; Zhou, Xue; Zhang, Jiayu; Wang, Jiachun; Xie, Hong; Wu, Zhigang


    α-Lipoic acid (α-LA) is a potent natural antioxidant, which is capable of regenerating glutathione (GSH). However, the mechanisms by which α-LA regenerates reduced glutathione (rGSH) via the reduction of oxidized glutathione (GSSG) by glutathione reductase (GR) are still not well understood. In the present study, we investigated if α-LA replenished rGSH by GR via Nrf2/ARE signaling pathway in cadmium-treated HepG2 cells. We found that α-LA antagonized the oxidative damage and alleviated the cytotoxicity in cadmium-induced HepG2 cells by regeneration of rGSH. α-LA regenerated rGSH by activating Nrf2 signaling pathway via promoting the nuclear translocation of Nrf2, which upregulates the transcription of GR, and thus increased the activity of GR. Our results indicated that α-LA was an effective agent to antagonize the oxidative stress and alleviate the cytotoxicity in cadmium-treated HepG2 cells by regenerating rGSH through activating Nrf2 signaling pathway.

  7. Role of Cyt-C/caspases-9,3, Bax/Bcl-2 and the FAS death receptor pathway in apoptosis induced by zinc oxide nanoparticles in human aortic endothelial cells and the protective effect by alpha-lipoic acid.


    Liang, Shuhang; Sun, Kuo; Wang, Yue; Dong, Shuying; Wang, Cheng; Liu, LianXin; Wu, YongHui


    Zinc oxide nanoparticles (ZnO NPs) are widely used in a variety of products used in daily life. However, their impact on human health has not been completely elucidated. This study was designed to investigate the cytotoxicity associated with ZnO NPs, the role of dissolution in the toxicity of ZnO NPs, the molecular mechanisms and mode of cell death induced by ZnO NPs in human aortic endothelial cells (HAECs), and the protective effects of the antioxidant alpha-lipoic acid (LA). ZnO NPs significantly reduced cell viability in a dose- and time-dependent manner, resulted in intracellular oxidative stress and cell membrane leakage when treated with doses of 8-50 μg/mL for 12 and 24 h in HAECs. The toxicity was produced by undissolved ZnO NPs but not dissolved Zn(2+) and metal impurities. Exposure to ZnO NPs was found to induce apoptosis at 12 h and necrosis after 24 h. Apoptosis was confirmed using reactive oxygen species that triggered a decrease in mitochondria membrane potential, increase in Cyt-C release, activation of caspases 3 and caspases9 and increase in the ratio of Bax/Bcl-2. Futhermore, ZnO NPs could activate the Fas death receptor pathway. In addition, the antioxidant LA was able to protect HAECs from apoptosis induced by ZnO NPs.

  8. α-Lipoic acid protects against the cytotoxicity and oxidative stress induced by cadmium in HepG2 cells through regeneration of glutathione by glutathione reductase via Nrf2/ARE signaling pathway.


    Shi, Chunli; Zhou, Xue; Zhang, Jiayu; Wang, Jiachun; Xie, Hong; Wu, Zhigang


    α-Lipoic acid (α-LA) is a potent natural antioxidant, which is capable of regenerating glutathione (GSH). However, the mechanisms by which α-LA regenerates reduced glutathione (rGSH) via the reduction of oxidized glutathione (GSSG) by glutathione reductase (GR) are still not well understood. In the present study, we investigated if α-LA replenished rGSH by GR via Nrf2/ARE signaling pathway in cadmium-treated HepG2 cells. We found that α-LA antagonized the oxidative damage and alleviated the cytotoxicity in cadmium-induced HepG2 cells by regeneration of rGSH. α-LA regenerated rGSH by activating Nrf2 signaling pathway via promoting the nuclear translocation of Nrf2, which upregulates the transcription of GR, and thus increased the activity of GR. Our results indicated that α-LA was an effective agent to antagonize the oxidative stress and alleviate the cytotoxicity in cadmium-treated HepG2 cells by regenerating rGSH through activating Nrf2 signaling pathway. PMID:27343752

  9. α-Lipoic acid protects against the oxidative stress and cytotoxicity induced by cadmium in HepG2 cells through regenerating glutathione regulated by glutamate-cysteine ligase.


    Xu, Yuan; Zhou, Xue; Shi, Chunli; Wang, Jiachun; Wu, Zhigang


    Alpha-lipoic acid (α-LA) is an important antioxidant that is capable of regenerating other antioxidants, such as glutathione (GSH). In the present study, we examined the protective effects of α-LA against the oxidative stress and cytotoxicity induced by cadmium in human hepatoma cell lines (HepG2) and investigated if the process was mediated through regenerating GSH. Our results showed that after exposure to 25 μM cadmium for 16 h, there was a significant decrease in the cell viability and glutathione levels and a significant increase in lipid peroxidation (p<0.01) compared with untreated cells. The presence of α-LA significantly attenuated cadmium-induced cytotoxicity and lipid peroxidation, and reversed cellular GSH levels compared with cadmium-treated cells (p<0.05). Compared with the cells treated with cadmium, co-treatment with α-LA and cadmium significantly increased the activities of γ-glutamylcysteine ligase (γ-GCL), the rate limiting enzyme in GSH biosynthesis and the mRNA and the protein levels of γ-GCL catalytic subunit (GCLC) and a modifier subunit (GCLM). In conclusion, our results indicated that α-LA is an effective agent to reduce the oxidative stress and cytotoxicity induced by cadmium by regenerating GSH levels through increasing the activities and the expressions of γ-GCL.

  10. The combination of N-acetyl cysteine, alpha-lipoic acid, and bromelain shows high anti-inflammatory properties in novel in vivo and in vitro models of endometriosis.


    Agostinis, C; Zorzet, S; De Leo, R; Zauli, G; De Seta, F; Bulla, R


    To evaluate the efficacy of an association of N-acetyl cystein, alpha-lipoic acid, and bromelain (NAC/LA/Br) in the treatment of endometriosis we set up a new in vivo murine model. We explored the anti-inflammatory and proapoptotic effect of this combination on human endometriotic endothelial cells (EECs) and on endothelial cells isolated from normal uterus (UtMECs). We implanted fragments of human endometriotic cysts intraperitoneally into SCID mice to evaluate the efficacy of NAC/LA/Br treatment. UtMECs and EECs, untreated or treated with NAC/LA/Br, were activated with the proinflammatory stimulus TNF-α and their response in terms of VCAM1 expression was evaluated. The proapoptotic effect of higher doses of NAC/LA/Br on UtMECs and EECs was measured with a fluorogenic substrate for activated caspases 3 and 7. The preincubation of EECs with NAC/LA/Br prior to cell stimulation with TNF-α prevents the upregulation of the expression of the inflammatory "marker" VCAM1. Furthermore NAC/LA/Br were able to induce EEC, but not UtMEC, apoptosis. Finally, the novel mouse model allowed us to demonstrate that mice treated with NAC/LA/Br presented a lower number of cysts, smaller in size, compared to untreated mice. Our findings suggest that these dietary supplements may have potential therapeutic uses in the treatment of chronic inflammatory diseases like endometriosis.

  11. Thermal and acid tolerant beta xylosidases, arabinofuranosidases, genes encoding, related organisms, and methods


    Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A


    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  12. Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods


    Thompson, David N.; Thompson, Vicki S.; Schaller, Kastli D.; Apel, William A.; Lacey, Jeffrey A.; Reed, David W.


    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  13. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation

    PubMed Central

    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed


    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue. PMID:25891652

  14. Effect of alpha lipoic acid co-administration on structural and immunohistochemical changes in subcutaneous tissue of anterior abdominal wall of adult male albino rat in response to polypropylene mesh implantation.


    Mazroa, Shireen A; Asker, Samar A; Asker, Waleed; Abd Ellatif, Mohamed


    Polypropylene mesh is commonly used in the treatment of abdominal hernia. Different approaches were addressed to improve their tissue integration and consequently reduce long-term complications. This study aimed to investigate the effect of alpha-lipoic acid (ALA) co-administration on structural and immunohistochemical (IHC) changes in the subcutaneous tissues of the anterior abdominal wall of the adult rat in response to polypropylene mesh implantation. Forty adult male albino rats were divided into: group I (control), group II (receiving ALA), group III (polypropylene mesh implantation) and group IV (mesh implantation + ALA co-administration). After 4 weeks, subcutaneous tissue samples were prepared for light microscopy and IHC study of CD34 as a marker for angiogenesis. In groups I and II rats, positive CD34 expression was demonstrated by IHC reaction, localized to endothelial cells lining small blood vessels. Group III showed an excess inflammatory reaction, deposition of both regular and irregularly arranged collagen fibres around mesh pores and few elastic fibres. CD34-positive was detected not only in cells lining small blood vessels but also in other cells scattered in the connective tissue indicating angiogenesis. In group IV, ALA co-administration resulted in less inflammatory reaction, regular collagen deposition, enhanced elastic fibres synthesis and a significant increase in CD34-positive cells and small blood vessels reflecting improved angiogenesis. ALA co-administration with polypropylene mesh implantation controlled the inflammatory reaction, helped regular collagen deposition, enhanced elastic fibres synthesis and improved angiogenesis in the subcutaneous tissue of anterior abdominal wall of adult albino rats, suggesting a possible role of ALA in optimizing mesh integration in subcutaneous tissue.

  15. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  16. BGL3 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  17. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  18. BGL3 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  19. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  20. BGL6 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  1. BGL7 beta-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  2. BGL6 .beta.-glucosidase and nucleic acids encoding the same

    SciTech Connect

    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  3. BGL3 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  4. BGL4 .beta.-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  5. BGL4 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  6. BGL5 .beta.-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  7. BGL4 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl4, and the corresponding BGL4 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL4, recombinant BGL4 proteins and methods for producing the same.

  8. BGL5 .beta.-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  9. BGL3 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl3, and the corresponding BGL3 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL3, recombinant BGL3 proteins and methods for producing the same.

  10. BGL6 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

  11. BGL7 beta-glucosidase and nucleic acids encoding the same


    Dunn-Coleman, Nigel; Ward, Michael


    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl7, and the corresponding BGL7 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL7, recombinant BGL7 proteins and methods for producing the same.

  12. α-Lipoic acid has anti-inflammatory and anti-oxidative properties: an experimental study in rats with carrageenan-induced acute and cotton pellet-induced chronic inflammations.


    Odabasoglu, Fehmi; Halici, Zekai; Aygun, Hayati; Halici, Mesut; Atalay, Fadime; Cakir, Ahmet; Cadirci, Elif; Bayir, Yasin; Suleyman, Halis


    α-Lipoic acid (ALA) has been termed the 'ideal' antioxidant, a readily absorbed and bioavailable compound capable of scavenging a number of free radicals, and it has been used for treating diseases in which oxidative stress plays a major role. The present study was designed to gain a better understanding for the positive effects of ALA on the models of acute and chronic inflammation in rats, and also determine its anti-oxidative potency. In an acute model, three doses of ALA (50, 100 and 200 mg/kg) and one dose of indomethacin (25 mg/kg) or diclofenac (25 mg/kg) were administered to rats by oral administration. The paw volumes of the animals were calculated plethysmometrically, and 0·1 ml of 1 % carrageenan (CAR) was injected into the hind paw of each animal 1 h after oral drug administration. The change in paw volume was detected as five replicates every 60 min by plethysmometry. In particular, we investigated the activities of catalase, superoxide dismutase (SOD), glutathione S-transferase (GST), glutathione peroxidase (GPx), glutathione reductase (GR), inducible NO synthase (iNOS) and myeloperoxidase (MPx), and the amounts of lipid peroxidation (LPO) or total GSH in the paw tissues of CAR-injected rats. We showed that ALA exhibited anti-inflammatory effects on both acute and chronic inflammations, and a strongly anti-oxidative potency on linoleic acid oxidation. Moreover, the administration of CAR induced oedema in the paws. ALA significantly inhibited the ability of CAR to induce: (1) the degree of acute inflammation, (2) the rise in MPx activity, (3) the increases of GST and iNOS activities and the amount of LPO and (4) the decreases of GPx, GR and SOD activities and the amount of GSH. In conclusion, these results suggest that the anti-inflammatory properties of ALA, which has a strong anti-oxidative potency, could be related to its positive effects on the antioxidant system in a variety of tissues in rats.

  13. Nucleic acids encoding mosaic clade M human immunodeficiency virus type 1 (HIV-1) envelope immunogens


    Korber, Bette T; Fischer, William; Liao, Hua-Xin; Haynes, Barton F; Letvin, Norman; Hahn, Beatrice H


    The present invention relates to nucleic acids encoding mosaic clade M HIV-1 Env polypeptides and to compositions and vectors comprising same. The nucleic acids of the invention are suitable for use in inducing an immune response to HIV-1 in a human.

  14. Antiallodynic effects of alpha lipoic acid in an optimized RR-EAE mouse model of MS-neuropathic pain are accompanied by attenuation of upregulated BDNF-TrkB-ERK signaling in the dorsal horn of the spinal cord.


    Khan, Nemat; Gordon, Richard; Woodruff, Trent M; Smith, Maree T


    Neuropathic pain may affect patients with multiple sclerosis (MS) even in early disease. In an experimental autoimmune encephalomyelitis (EAE)-mouse model of MS, chronic alpha lipoic acid (ALA) treatment reduced clinical disease severity, but MS-neuropathic pain was not assessed. Hence, we investigated the pain-relieving efficacy and mode of action of ALA using our optimized relapsing-remitting (RR)-EAE mouse model of MS-associated neuropathic pain. C57BL/6 mice were immunized with MOG35-55 and adjuvants (Quil A and pertussis toxin) to induce RR-EAE; sham-mice received adjuvants only. RR-EAE mice received subcutaneous ALA (3 or 10 mg kg(-1) day(-1)) or vehicle for 21 days (15-35 d.p.i.; [days postimmunization]); sham-mice received vehicle. Hindpaw hypersensitivity was assessed blinded using von Frey filaments. Following euthanasia (day 35 d.p.i.), lumbar spinal cords were removed for immunohistochemical and molecular biological assessments. Fully developed mechanical allodynia in the bilateral hindpaws of vehicle-treated RR-EAE mice was accompanied by marked CD3(+) T-cell infiltration, microglia activation, and increased brain-derived neurotrophic factor (BDNF)-tyrosine kinase B (TrkB) signaling in the dorsal horn of the lumbar spinal cord. Consequently, phospho-ERK, a marker of central sensitization in neuropathic pain, was upregulated in the spinal dorsal horn. Importantly, hindpaw hypersensitivity was completely attenuated in RR-EAE mice administered ALA at 10 mg kg(-1) day(-1) but not 3 mg kg(-1) day(-1). The antiallodynic effect of ALA (10 mg kg(-1) day(-1)) was associated with a marked reduction in the aforementioned spinal dorsal horn markers to match their respective levels in the vehicle-treated sham-mice. Our findings suggest that ALA at 10 mg kg(-1) day(-1) produced its antiallodynic effects in RR-EAE mice by reducing augmented CD3(+) T-cell infiltration and BDNF-TrkB-ERK signaling in the spinal dorsal horn. PMID:26171221

  15. Rv0132c of Mycobacterium tuberculosis Encodes a Coenzyme F420-Dependent Hydroxymycolic Acid Dehydrogenase

    PubMed Central

    Purwantini, Endang; Mukhopadhyay, Biswarup


    The ability of Mycobacterium tuberculosis to manipulate and evade human immune system is in part due to its extraordinarily complex cell wall. One of the key components of this cell wall is a family of lipids called mycolic acids. Oxygenation of mycolic acids generating methoxy- and ketomycolic acids enhances the pathogenic attributes of M. tuberculosis. Thus, the respective enzymes are of interest in the research on mycobacteria. The generation of methoxy- and ketomycolic acids proceeds through intermediary formation of hydroxymycolic acids. While the methyl transferase that generates methoxymycolic acids from hydroxymycolic acids is known, hydroxymycolic acids dehydrogenase that oxidizes hydroxymycolic acids to ketomycolic acids has been elusive. We found that hydroxymycolic acid dehydrogenase is encoded by the rv0132c gene and the enzyme utilizes F420, a deazaflavin coenzyme, as electron carrier, and accordingly we called it F420-dependent hydroxymycolic acid dehydrogenase. This is the first report on the involvement of F420 in the synthesis of a mycobacterial cell envelope. Also, F420-dependent hydroxymycolic acid dehydrogenase was inhibited by PA-824, and therefore, it is a previously unknown target for this new tuberculosis drug. PMID:24349169

  16. Nucleic Acid Encoding A Lectin-Derived Progenitor Cell Preservation Factor

    SciTech Connect

    Colucci, M. Gabriella; Chrispeels, Maarten J.; Moore, Jeffrey G.


    The invention relates to an isolated nucleic acid molecule that encodes a protein that is effective to preserve progenitor cells, such as hematopoietic progenitor cells. The nucleic acid comprises a sequence defined by SEQ ID NO:1, a homolog thereof, or a fragment thereof. The encoded protein has an amino acid sequence that comprises a sequence defined by SEQ ID NO:2, a homolog thereof, or a fragment thereof that contains an amino acid sequence TNNVLQVT. Methods of using the encoded protein for preserving progenitor cells in vitro, ex vivo, and in vivo are also described. The invention, therefore, include methods such as myeloablation therapies for cancer treatment wherein myeloid reconstitution is facilitated by means of the specified protein. Other therapeutic utilities are also enabled through the invention, for example, expanding progenitor cell populations ex vivo to increase chances of engraftation, improving conditions for transporting and storing progenitor cells, and facilitating gene therapy to treat and cure a broad range of life-threatening hematologic diseases.

  17. Nucleic acids encoding modified human immunodeficiency virus type 1 (HIV-1) group M consensus envelope glycoproteins


    Haynes, Barton F.; Gao, Feng; Korber, Bette T.; Hahn, Beatrice H.; Shaw, George M.; Kothe, Denise; Li, Ying Ying; Decker, Julie; Liao, Hua-Xin


    The present invention relates, in general, to an immunogen and, in particular, to an immunogen for inducing antibodies that neutralizes a wide spectrum of HIV primary isolates and/or to an immunogen that induces a T cell immune response. The invention also relates to a method of inducing anti-HIV antibodies, and/or to a method of inducing a T cell immune response, using such an immunogen. The invention further relates to nucleic acid sequences encoding the present immunogens.

  18. Phosphoenolpyruvate carboxykinase is an acid-induced, chromosomally encoded virulence factor in Agrobacterium tumefaciens.


    Liu, Pu; Wood, Derek; Nester, Eugene W


    The pckA gene, encoding phosphoenolpyruvate carboxykinase, catalyzes the reversible decarboxylation and phosphorylation of oxaloacetate to form phosphoenolpyruvate. Located on the circular chromosome of Agrobacterium, this locus is adjacent to the loci chvG and chvI, encoding a two-component regulatory system that has been shown to be important in virulence. Using a reporter gene fusion, studies showed that the pckA gene is induced by acidic pH but not by acetosyringone. This acid induction is regulated by the chvG-chvI regulatory system, which controls acid-inducible genes. A pckA mutant had no demonstrable PckA enzyme activity and grew on AB minimal medium with glucose but did not grow on the same medium with succinate as the sole carbon source and was more inhibited in its growth than the wild-type strain by an acidic environment. A pckA mutant was highly attenuated in tumor-inducing ability on tobacco leaf disks and was severely attenuated in vir gene expression. Although vir gene induction was completely restored when a constitutive virG gene was introduced into the mutant strain, virulence was only partially restored. These results suggest that avirulence may be due to a combination of the inhibition of this mutant in the acidic plant wound environment and the poor induction of the vir genes. PMID:16109945

  19. Fatty acid composition of beef is associated with exonic nucleotide variants of the gene encoding FASN.


    Oh, Dongyep; Lee, Yoonseok; La, Boomi; Yeo, Jungsou; Chung, Euiryong; Kim, Younyoung; Lee, Chaeyoung


    Genetic associations of fatty acid composition with exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase (FASN) were examined using 513 Korean cattle. All five individual SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A were associated with a variety of fatty acid compositions and further with marbling score (P < 0.05). Their genotypes of CC, TT, AA, TT, and GG were associated with increased monounsaturated fatty acids and with decreased saturated fatty acids (P < 0.05). The genotypes at all the SNPs also increased marbling score (P < 0.05). Further genetic associations with fatty acid composition suggested that homozygous genotype with the haplotype of ATG at g.15532, g.16907, and g.17924 in a linkage disequilibrium block increased monounsaturated fatty acids and marbling score (P < 0.05). We concluded that the five exonic SNPs of g.12870, g.13126, g.15532, g.16907, and g.17924 in the FASN gene could change fatty acid contents. Their genotypes of CC, TT, AA, TT, and GG and haplotype of ATG at g.15532, g.16907, and g.17924 were recommended for genetic improvement of beef quality.

  20. Isolation of an osmotic stress- and abscisic acid-induced gene encoding an acidic endochitinase from Lycopersicon chilense.


    Chen, R D; Yu, L X; Greer, A F; Cheriti, H; Tabaeizadeh, Z


    We have identified one osmotic stress- and abscisic acid-responsive member of the endochitinase (EC gene family from leaves of drought-stressed Lycopersicon chilense plants, a natural inhabitant of extremely arid regions in South America. The 966-bp full-length cDNA (designated pcht28) encodes an acidic chitinase precursor with an amino-terminal signal peptide. The mature protein is predicted to have 229 amino acid residues with a relative molecular mass of 24,943 and pI value of 6.2. Sequence analysis revealed that pcht28 has a high degree of homology with class II chitinases (EC from tomato and tobacco. Expression of the pcht28 protein in Escherichia coli verified that it is indeed a chitinase. Northern blot analysis indicated that this gene has evolved a different pattern of expression from that of other family members reported thus far. It is highly induced by both osmotic stress and the plant hormone abscisic acid. Southern blot analysis of genomic DNA suggested that the pcht28-related genes may form a small multigene family in this species. The efficiency of induction of the gene by drought stress, in leaves and stems, is significantly higher in L. chilense than in the cultivated tomato. It is speculated that, besides its general defensive function, the pcht28-encoded chitinase may play a particular role in plant development or in protecting plants from pathogen attack during water stress. PMID:7816027

  1. Nucleic acid encoding DS-CAM proteins and products related thereto

    SciTech Connect

    Korenberg, Julie R.


    In accordance with the present invention, there are provided Down Syndrome-Cell Adhesion Molecule (DS-CAM) proteins. Nucleic acid sequences encoding such proteins and assays employing same are also disclosed. The invention DS-CAM proteins can be employed in a variety of ways, for example, for the production of anti-DS-CAM antibodies thereto, in therapeutic compositions and methods employing such proteins and/or antibodies. DS-CAM proteins are also useful in bioassays to identify agonists and antagonists thereto.

  2. Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase


    Srienc, Friedrich; Jackson, John K.; Somers, David A.


    A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

  3. Nucleic acids encoding plant glutamine phenylpyruvate transaminase (GPT) and uses thereof


    Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.


    Glutamine phenylpyruvate transaminase (GPT) proteins, nucleic acid molecules encoding GPT proteins, and uses thereof are disclosed. Provided herein are various GPT proteins and GPT gene coding sequences isolated from a number of plant species. As disclosed herein, GPT proteins share remarkable structural similarity within plant species, and are active in catalyzing the synthesis of 2-hydroxy-5-oxoproline (2-oxoglutaramate), a powerful signal metabolite which regulates the function of a large number of genes involved in the photosynthesis apparatus, carbon fixation and nitrogen metabolism.

  4. Enzymes Catalyzing the Early Steps of Clavulanic Acid Biosynthesis Are Encoded by Two Sets of Paralogous Genes in Streptomyces clavuligerus

    PubMed Central

    Jensen, Susan E.; Elder, Kenneth J.; Aidoo, Kwamena A.; Paradkar, Ashish S.


    Genes encoding the proteins required for clavulanic acid biosynthesis and for cephamycin biosynthesis are grouped into a “supercluster” in Streptomyces clavuligerus. Nine open reading frames (ORFs) associated with clavulanic acid biosynthesis were located in a 15-kb segment of the supercluster, including six ORFs encoding known biosynthetic enzymes or regulatory proteins, two ORFs that have been reported previously but whose involvement in clavulanic acid biosynthesis is unclear, and one ORF not previously reported. Evidence for the involvement of these ORFs in clavulanic acid production was obtained by generating mutants and showing that all were defective for clavulanic acid production when grown on starch asparagine medium. However, when five of the nine mutants, including mutants defective in known clavulanic acid biosynthetic enzymes, were grown in a soy-based medium, clavulanic acid-producing ability was restored. This ability to produce clavulanic acid when seemingly essential biosynthetic enzymes have been mutated suggests that paralogous genes encoding functionally equivalent proteins exist for each of the five genes but that these paralogues are expressed only in the soy-based medium. The five genes that have paralogues encode proteins involved in the early steps of the pathway common to the biosynthesis of both clavulanic acid and the other clavam metabolites produced by this organism. No evidence was seen for paralogues of the four remaining genes involved in late, clavulanic acid-specific steps in the pathway. PMID:10681345

  5. Molecular dynamics simulations data of the twenty encoded amino acids in different force fields.


    Vitalini, F; Noé, F; Keller, B G


    We present extensive all-atom Molecular Dynamics (MD) simulation data of the twenty encoded amino acids in explicit water, simulated with different force fields. The termini of the amino acids have been capped to ensure that the dynamics of the Φ and ψ torsion angles are analogues to the dynamics within a peptide chain. We use representatives of each of the four major force field families: AMBER ff-99SBILDN [1], AMBER ff-03 [2], OPLS-AA/L [3], CHARMM27 [4] and GROMOS43a1 [5], [6]. Our data represents a library and test bed for method development for MD simulations and for force fields development. Part of the data set has been previously used for comparison of the dynamic properties of force fields (Vitalini et al., 2015) [7] and for the construction of peptide basis functions for the variational approach to molecular kinetics [8].

  6. Molecular dynamics simulations data of the twenty encoded amino acids in different force fields.


    Vitalini, F; Noé, F; Keller, B G


    We present extensive all-atom Molecular Dynamics (MD) simulation data of the twenty encoded amino acids in explicit water, simulated with different force fields. The termini of the amino acids have been capped to ensure that the dynamics of the Φ and ψ torsion angles are analogues to the dynamics within a peptide chain. We use representatives of each of the four major force field families: AMBER ff-99SBILDN [1], AMBER ff-03 [2], OPLS-AA/L [3], CHARMM27 [4] and GROMOS43a1 [5], [6]. Our data represents a library and test bed for method development for MD simulations and for force fields development. Part of the data set has been previously used for comparison of the dynamic properties of force fields (Vitalini et al., 2015) [7] and for the construction of peptide basis functions for the variational approach to molecular kinetics [8]. PMID:27054161

  7. Molecular dynamics simulations data of the twenty encoded amino acids in different force fields

    PubMed Central

    Vitalini, F.; Noé, F.; Keller, B.G.


    We present extensive all-atom Molecular Dynamics (MD) simulation data of the twenty encoded amino acids in explicit water, simulated with different force fields. The termini of the amino acids have been capped to ensure that the dynamics of the Φ and ψ torsion angles are analogues to the dynamics within a peptide chain. We use representatives of each of the four major force field families: AMBER ff-99SBILDN [1], AMBER ff-03 [2], OPLS-AA/L [3], CHARMM27 [4] and GROMOS43a1 [5], [6]. Our data represents a library and test bed for method development for MD simulations and for force fields development. Part of the data set has been previously used for comparison of the dynamic properties of force fields (Vitalini et al., 2015) [7] and for the construction of peptide basis functions for the variational approach to molecular kinetics [8]. PMID:27054161

  8. Controlling enzyme inhibition using an expanded set of genetically encoded amino acids.


    Zheng, Shun; Kwon, Inchan


    Enzyme inhibition plays an important role in drug development, metabolic pathway regulation, and biocatalysis with product inhibition. When an inhibitor has high structural similarities to the substrate of an enzyme, controlling inhibitor binding without affecting enzyme substrate binding is often challenging and requires fine-tuning of the active site. We hypothesize that an extended set of genetically encoded amino acids can be used to design an enzyme active site that reduces enzyme inhibitor binding without compromising substrate binding. As a model case, we chose murine dihydrofolate reductase (mDHFR), substrate dihydrofolate, and inhibitor methotrexate. Structural models of mDHFR variants containing non-natural amino acids complexed with each ligand were constructed to identify a key residue for inhibitor binding and non-natural amino acids to replace the key residue. Then, we discovered that replacing the key phenylalanine residue with two phenylalanine analogs (p-bromophenylalanine (pBrF) and L-2-naphthylalanine (2Nal)) enhances binding affinity toward the substrate dihydrofolate over the inhibitor by 4.0 and 5.8-fold, respectively. Such an enhanced selectivity is mainly due to a reduced inhibitor binding affinity by 2.1 and 4.3-fold, respectively. The catalytic efficiency of the mDHFR variant containing pBrF is comparable to that of wild-type mDHFR, whereas the mDHFR variant containing 2Nal exhibits a moderate decrease in the catalytic efficiency. The work described here clearly demonstrates the feasibility of selectively controlling enzyme inhibition using an expanded set of genetically encoded amino acids.

  9. Identification and Analysis of a Gene from Calendula officinalis Encoding a Fatty Acid Conjugase

    PubMed Central

    Qiu, Xiao; Reed, Darwin W.; Hong, Haiping; MacKenzie, Samuel L.; Covello, Patrick S.


    Two homologous cDNAs, CoFad2 and CoFac2, were isolated from a Calendula officinalis developing seed by a polymerase chain reaction-based cloning strategy. Both sequences share similarity to FAD2 desaturases and FAD2-related enzymes. In C. officinalis plants CoFad2 was expressed in all tissues tested, whereas CoFac2 expression was specific to developing seeds. Expression of CoFad2 cDNA in yeast (Saccharomyces cerevisiae) indicated it encodes a Δ12 desaturase that introduces a double bond at the 12 position of 16:1(9Z) and 18:1(9Z). Expression of CoFac2 in yeast revealed that the encoded enzyme acts as a fatty acid conjugase converting 18:2(9Z, 12Z) to calendic acid 18:3(8E, 10E, 12Z). The enzyme also has weak activity on the mono-unsaturates 16:1(9Z) and 18:1(9Z) producing compounds with the properties of 8,10 conjugated dienes. PMID:11161042

  10. Amino acid sequence heterogeneity of the chromosomal encoded Borrelia burgdorferi sensu lato major antigen P100.


    Fellinger, W; Farencena, A; Redl, B; Sambri, V; Cevenini, R; Stöffler, G


    The entire nucleotide sequence of the chromosomal encoded major antigen p100 of the European Borrelia garinii isolate B29 was determined and the deduced amino acid sequence was compared to the homologous antigen p83 of the North American Borrelia burgdorferi sensu stricto strain B31 and the p100 of the European Borrelia afzelii (group VS461) strain PKo. p100 of strain B29 shows 87% amino acid sequence identity to strain B31 and 79.2% to strain PKo, p100 of strain B31 and PKo shows 62.5% identity to each other. In addition, partial nucleotide sequences of the most heterogeneous region of the p100 gene of two other Borrelia garinii isolates (PBi and VS286) have been determined and the deduced amino acid sequences were compared with all p100 of Borrelia garinii published so far. We found an amino acid sequence identity between 88.6 and 100% within the same genospecies. The N-terminal part of the p100 proteins is highly conserved whereas a striking heterogeneous region within the C-terminal part of the proteins was observed.

  11. The Saccharomyces Cerevisiae Spt7 Gene Encodes a Very Acidic Protein Important for Transcription in Vivo

    PubMed Central

    Gansheroff, L. J.; Dollard, C.; Tan, P.; Winston, F.


    Mutations in the SPT7 gene of Saccharomyces cerevisiae originally were identified as suppressors of Ty and {delta small} insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Other genes that have been identified in mutant hunts of this type have been shown to play a role in transcription. In this work we show that SPT7 is also important for proper transcription in vivo. We have cloned and sequenced the SPT7 gene and have shown that it encodes a large, acidic protein that is localized to the nucleus. The SPT7 protein contains a bromodomain sequence; a deletion that removes the bromodomain from the SPT7 protein causes no detectable mutant phenotype. Strains that contain an spt7 null mutation are viable but grow very slowly and have transcriptional defects at many loci including insertion mutations, Ty elements, the INO1 gene and the MFA1 gene. These transcriptional defects and other mutant phenotypes are similar to those caused by certain mutations in SPT15, which encodes the TATA binding protein (TBP). The similarity of the phenotypes of spt7 and spt15 mutants, including effects of spt7 mutations on the transcription start site of certain genes, suggests that SPT7 plays an important role in transcription initiation in vivo. PMID:7713415

  12. Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use


    Croteau, Rodney B.; Lange, Bernd M.


    A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

  13. High affinity of acid phosphatase encoded by PHO3 gene in Saccharomyces cerevisiae for thiamin phosphates.


    Nosaka, K


    The enzymatic properties of acid phosphatase (orthophosphoric-monoester phosphohydrolase, EC encoded by PHO3 gene in Saccharomyces cerevisiae, which is repressed by thiamin and has thiamin-binding activity at pH 5.0, were investigated to study physiological functions. The following results led to the conclusion that thiamin-repressible acid phosphatase physiologically catalyzes the hydrolysis of thiamin phosphates in the periplasmic space of S. cerevisiae, thus participating in utilization of the thiamin moiety of the phosphates by yeast cells: (a) thiamin-repressible acid phosphatase showed Km values of 1.6 and 1.7 microM at pH 5.0 for thiamin monophosphate and thiamin pyrophosphate, respectively. These Km values were 2-3 orders of magnitude lower than those (0.61 and 1.7 mM) for p-nitrophenyl phosphate; (b) thiamin exerted remarkable competitive inhibition in the hydrolysis of thiamin monophosphate (Ki 2.2 microM at pH 5.0), whereas the activity for p-nitrophenyl phosphate was slightly affected by thiamin; (c) the inhibitory effect of inorganic phosphate, which does not repress the thiamin-repressible enzyme, on the hydrolysis of thiamin monophosphate was much smaller than that of p-nitrophenyl phosphate. Moreover, the modification of thiamin-repressible acid phosphatase of S. cerevisiae with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide resulted in the complete loss of thiamin-binding activity and the Km value of the modified enzyme for thiamin monophosphate increased nearly to the value of the native enzyme for p-nitrophenyl phosphate. These results also indicate that the high affinity of the thiamin-repressible acid phosphatase for thiamin phosphates is due to the thiamin-binding properties of this enzyme.

  14. A WRKY gene from creosote bush encodes an activator of the abscisic acid signaling pathway.


    Zou, Xiaolu; Seemann, Jeffrey R; Neuman, Dawn; Shen, Qingxi J


    The creosote bush (Larrea tridentata) is a xerophytic evergreen C3 shrub thriving in vast arid areas of North America. As the first step toward understanding the molecular mechanisms controlling the drought tolerance of this desert plant, we have isolated a dozen genes encoding transcription factors, including LtWRKY21 that encodes a protein of 314 amino acid residues. Transient expression studies with the GFP-LtWRKY21 fusion construct indicate that the LtWRKY21 protein is localized in the nucleus and is able to activate the promoter of an abscisic acid (ABA)-inducible gene, HVA22, in a dosage-dependent manner. The transactivating activity of LtWRKY21 relies on the C-terminal sequence containing the WRKY domain and a N-terminal motif that is essential for the repression activity of some regulators in ethylene signaling. LtWRKY21 interacts synergistically with ABA and transcriptional activators VP1 and ABI5 to control the expression of the HVA22 promoter. Co-expression of VP1, ABI5, and LtWRKY21 leads to a much higher expression of the HVA22 promoter than does the ABA treatment alone. In contrast, the Lt-WRKY21-mediated transactivation is inhibited by two known negative regulators of ABA signaling: 1-butanol, an inhibitor of phospholipase D, and abi1-1, a dominant negative mutant protein phosphatase. Interestingly, abi1-1 does not block the synergistic effect of LtWRKY21, VP1, and ABI5 co-expression, indicating that LtWRKY21, VP1, and ABI5 may form a complex that functions downstream of ABI1 to control ABA-regulated expression of genes.

  15. A C. elegans Model for Mitochondrial Fatty Acid Synthase II: The Longevity-Associated Gene W09H1.5/mecr-1 Encodes a 2-trans-Enoyl-Thioester Reductase

    PubMed Central

    Gurvitz, Aner


    Our recognition of the mitochondria as being important sites of fatty acid biosynthesis is continuously unfolding, especially in light of new data becoming available on compromised fatty acid synthase type 2 (FASII) in mammals. For example, perturbed regulation of murine 17β-HSD8 encoding a component of the mitochondrial FASII enzyme 3-oxoacyl-thioester reductase is implicated in polycystic kidney disease. In addition, over-expression in mice of the Mecr gene coding for 2-trans-enoyl-thioester reductase, also of mitochondrial FASII, leads to impaired heart function. However, mouse knockouts for mitochondrial FASII have hitherto not been reported and, hence, there is a need to develop alternate metazoan models such as nematodes or fruit flies. Here, the identification of Caenorhabditis elegans W09H1.5/MECR-1 as a 2-trans-enoyl-thioester reductase of mitochondrial FASII is reported. To identify MECR-1, Saccharomyces cerevisiae etr1Δ mutant cells were employed that are devoid of mitochondrial 2-trans-enoyl-thioester reductase Etr1p. These yeast mutants fail to synthesize sufficient levels of lipoic acid or form cytochrome complexes, and cannot respire or grow on non-fermentable carbon sources. A mutant yeast strain ectopically expressing nematode mecr-1 was shown to contain reductase activity and resemble the self-complemented mutant strain for these phenotype characteristics. Since MECR-1 was not intentionally targeted for compartmentalization using a yeast mitochondrial leader sequence, this inferred that the protein represented a physiologically functional mitochondrial 2-trans-enoyl-thioester reductase. In accordance with published findings, RNAi-mediated knockdown of mecr-1 in C. elegans resulted in life span extension, presumably due to mitochondrial dysfunction. Moreover, old mecr-1(RNAi) worms had better internal organ appearance and were more mobile than control worms, indicating a reduced physiological age. This is the first report on RNAi work dedicated

  16. Adenovirus carrying gene encoding Haliotis discus discus sialic acid binding lectin induces cancer cell apoptosis.


    Yang, Xinyan; Wu, Liqin; Duan, Xuemei; Cui, Lianzhen; Luo, Jingjing; Li, Gongchu


    Lectins exist widely in marine bioresources such as bacteria, algae, invertebrate animals and fishes. Some purified marine lectins have been found to elicit cytotoxicity to cancer cells. However, there are few reports describing the cytotoxic effect of marine lectins on cancer cells through virus-mediated gene delivery. We show here that a replication-deficient adenovirus-carrying gene encoding Haliotis discus discus sialic acid binding lectin (Ad.FLAG-HddSBL) suppressed cancer cell proliferation by inducing apoptosis, as compared to the control virus Ad.FLAG. A down-regulated level of anti-apoptosis factor Bcl-2 was suggested to be responsible for the apoptosis induced by Ad.FLAG-HddSBL infection. Further subcellular localization studies revealed that HddSBL distributed in cell membrane, ER, and the nucleus, but not in mitochondria and Golgi apparatus. In contrast, a previously reported mannose-binding lectin Pinellia pedatisecta agglutinin entered the nucleus as well, but did not distribute in inner membrane systems, suggesting differed intracellular sialylation and mannosylation, which may provide different targets for lectin binding. Further cancer-specific controlling of HddSBL expression and animal studies may help to provide insights into a novel way of anti-cancer marine lectin gene therapy. Lectins may provide a reservoir of anti-cancer genes.

  17. Electrophile-Modified Lipoic Derivatives of PDC-E2 Elicits Anti-mitochondrial Antibody Reactivity

    PubMed Central

    Naiyanetr, Phornnop; Butler, Jeffrey D.; Meng, Liping; Pfeiff, Janice; Kenny, Thomas P.; Guggenheim, Kathryn G.; Reiger, Roman; Lam, Kit; Kurth, Mark J.; Ansari, Aftab. A.; Coppel, Ross L.; López-Hoyos, Marcos; Gershwin, M. Eric; Leung, Patrick S.C.


    Our laboratory has hypothesized that xenobiotic modification of the native lipoyl moiety of the major mitochondrial autoantigen, the E2 subunit of the pyruvate dehydrogenase complex (PDC-E2), may lead to loss of self-tolerance in primary biliary cirrhosis (PBC). This thesis is based on the finding of readily detectable levels of immunoreactivity of PBC sera against extensive panels of protein microarrays containing mimics of the inner lipoyl domain of PDC-E2 and subsequent quantitative structure-activity relationships (QSARs). Importantly, we have demonstrated that murine immunization with one such mimic, 2-octynoic acid coupled to bovine serum albumin (BSA), induces antimitochondrial antibodies (AMAs) and cholangitis. Based upon these data, we have focused on covalent modifications of the lipoic acid disulfide ring and subsequent analysis of such xenobiotics coupled to a 15mer of PDC-E2 for immunoreactivity against a broad panel of sera from patients with PBC and controls. Our results demonstrate that AMA-positive PBC sera demonstrate marked reactivity against 6,8-bis(acetylthio)octanoic acid, implying that chemical modification of the lipoyl ring, i.e. disruption of the S-S disulfide, renders lipoic acid to its reduced form that will promote xenobiotic modification. This observation is particularly significant in light of the function of the lipoyl1oiety in electron transport of which the catalytic disulfide constantly opens and closes and, thus, raises the intriguing thesis that common electrophilic agents, i.e. acetaminophen or non-steroidal anti-inflammatory drugs (NSAIDs), may lead to xenobiotic modification in genetically susceptible individuals that results in the generation of AMAs and ultimately clinical PBC. PMID:21763105

  18. Electrophile-modified lipoic derivatives of PDC-E2 elicits anti-mitochondrial antibody reactivity.


    Naiyanetr, Phornnop; Butler, Jeffrey D; Meng, Liping; Pfeiff, Janice; Kenny, Thomas P; Guggenheim, Kathryn G; Reiger, Roman; Lam, Kit; Kurth, Mark J; Ansari, Aftab A; Coppel, Ross L; López-Hoyos, Marcos; Gershwin, M Eric; Leung, Patrick S C


    Our laboratory has hypothesized that xenobiotic modification of the native lipoyl moiety of the major mitochondrial autoantigen, the E2 subunit of the pyruvate dehydrogenase complex (PDC-E2), may lead to loss of self-tolerance in primary biliary cirrhosis (PBC). This thesis is based on the finding of readily detectable levels of immunoreactivity of PBC sera against extensive panels of protein microarrays containing mimics of the inner lipoyl domain of PDC-E2 and subsequent quantitative structure-activity relationships (QSARs). Importantly, we have demonstrated that murine immunization with one such mimic, 2-octynoic acid coupled to bovine serum albumin (BSA), induces anti-mitochondrial antibodies (AMAs) and cholangitis. Based upon these data, we have focused on covalent modifications of the lipoic acid disulfide ring and subsequent analysis of such xenobiotics coupled to a 15mer of PDC-E2 for immunoreactivity against a broad panel of sera from patients with PBC and controls. Our results demonstrate that AMA-positive PBC sera demonstrate marked reactivity against 6,8-bis(acetylthio)octanoic acid, implying that chemical modification of the lipoyl ring, i.e. disruption of the S-S disulfide, renders lipoic acid to its reduced form that will promote xenobiotic modification. This observation is particularly significant in light of the function of the lipoyl moiety in electron transport of which the catalytic disulfide constantly opens and closes and, thus, raises the intriguing thesis that common electrophilic agents, i.e. acetaminophen or non-steroidal anti-inflammatory drugs (NSAIDs), may lead to xenobiotic modification in genetically susceptible individuals that results in the generation of AMAs and ultimately clinical PBC.

  19. Codon usage bias in prokaryotic pyrimidine-ending codons is associated with the degeneracy of the encoded amino acids

    PubMed Central

    Wald, Naama; Alroy, Maya; Botzman, Maya; Margalit, Hanah


    Synonymous codons are unevenly distributed among genes, a phenomenon termed codon usage bias. Understanding the patterns of codon bias and the forces shaping them is a major step towards elucidating the adaptive advantage codon choice can confer at the level of individual genes and organisms. Here, we perform a large-scale analysis to assess codon usage bias pattern of pyrimidine-ending codons in highly expressed genes in prokaryotes. We find a bias pattern linked to the degeneracy of the encoded amino acid. Specifically, we show that codon-pairs that encode two- and three-fold degenerate amino acids are biased towards the C-ending codon while codons encoding four-fold degenerate amino acids are biased towards the U-ending codon. This codon usage pattern is widespread in prokaryotes, and its strength is correlated with translational selection both within and between organisms. We show that this bias is associated with an improved correspondence with the tRNA pool, avoidance of mis-incorporation errors during translation and moderate stability of codon–anticodon interaction, all consistent with more efficient translation. PMID:22581775

  20. A possible role for acid phosphatase with thiamin-binding activity encoded by PHO3 in yeast.


    Nosaka, K; Kaneko, Y; Nishimura, H; Iwashima, A


    Periplasmic soluble thiamin-binding protein in Saccharomyces cerevisiae (Iwashima, A. et al. (1979) Biochim. Biophys. Acta 577, 217-220) was demonstrated to be encoded by PHO3 gene that codes for thiamin repressible acid phosphatase (Schweingruber, M.E. et al. (1986) J. Biol. Chem. 261, 15877-15882) by genetic analysis. The pho3 mutant cells of S. cerevisiae in contrast to the parent cells have markedly reduced activity of the uptake of [14C]thiamin phosphates, suggesting that thiamin repressible acid phosphatase plays a role in the hydrolysis of thiamin phosphates in the periplasmic space prior to the uptake of their thiamin moieties by S. cerevisiae.

  1. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose.


    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc


    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products.

  2. Cellulases, nucleic acids encoding them and methods for making and using them


    Blum, David; Gemsch Cuenca, Joslin; Dycaico, Mark


    This invention relates to molecular and cellular biology and biochemistry. In one aspect, the invention provides polypeptides having cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides cellulase activity, e.g., endoglucanase, cellobiohydrolase, mannanase and/or .beta.-glucosidase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts.

  3. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    SciTech Connect

    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  4. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes


    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  5. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes


    Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.


    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

  6. Functional analysis of the gene encoding the clavaminate synthase 2 isoenzyme involved in clavulanic acid biosynthesis in Streptomyces clavuligerus.

    PubMed Central

    Paradkar, A S; Jensen, S E


    A Streptomyces clavuligerus mutant disrupted in cas2, encoding the clavaminate synthase (CAS2) isoenzyme, was constructed by a gene replacement procedure. The resulting cas2 mutant showed no clavulanic acid production when grown in starch-asparagine medium. However, in soy medium, the cas2 mutant did produce clavulanic acid, although in amounts less than those produced by wild-type cultures. This medium-dependent leaky phenotype correlated well with the presence of the cas1 transcript, encoding the CAS1 isoenzyme, in cultures grown in soy medium and with its absence from those grown in starch-asparagine medium. This suggested that CAS1 and CAS2 both contribute to clavulanic acid production but that their production is regulated differently. Under nutritional conditions in which cas1 expression is blocked, cas2 becomes essential for clavulanic acid production. Northern (RNA) analysis revealed that while cas1 is transcribed as a 1.4-kb monocistronic transcript only, cas2 is transcribed both as a 1.2-kb monocistronic transcript and as part of a 5.3-kb polycistronic transcript. High-resolution S1 nuclease analysis located the transcription start point of the monocistronic cas2 transcript at a C residue 103 nucleotides upstream from the cas2 start codon. PMID:7868606

  7. The oxalic acid biosynthetic activity of Burkholderia mallei is encoded by a single locus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although it is known that oxalic acid provides a selective advantage to the secreting microbe, our understanding of how this acid is biosynthesized remains incomplete. This study reports the identification, cloning, and partial characterization of the oxalic acid biosynthetic enzyme from the animal ...

  8. Identification of an Amino Acid Domain Encoded by the Capsid Protein Gene of Porcine Circovirus Type 2 that Modulates Viral Protein Distribution During Replication

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous work showed that distinct amino acid motifs are encoded by the Rep, Cap and ORF3 genes of two subgroups of porcine circoviruses (PCV), PCV2a and PCV2b. At a specific location of the gene, a certain amino acid residue or sequence is preferred. Specifically, two amino acid domains located in ...

  9. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them


    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika


    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  10. Oxalic acid biosynthesis is encoded by an operon in Burkholderia glumae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although the biosynthesis of oxalic acid is known to occur in a number of bacteria, the mechanism(s) regulating its production remains largely unknown. To date, there is no report on the identification of an oxalic acid biosynthetic pathway gene from bacteria. In an attempt to identify such a gene...

  11. TaOPR2 encodes a 12-oxo-phytodienoic acid reductase involved in the biosynthesis of jasmonic acid in wheat (Triticum aestivum L.).


    Wang, Yukun; Yuan, Guoliang; Yuan, Shaohua; Duan, Wenjing; Wang, Peng; Bai, Jianfang; Zhang, Fengting; Gao, Shiqing; Zhang, Liping; Zhao, Changping


    The 12-oxo-phytodienoic acid reductases (OPRs) are involved in the various processes of growth and development in plants, and classified into the OPRⅠ and OPRⅡ subgroups. In higher plants, only OPRⅡ subgroup genes take part in the biosynthesis of endogenous jasmonic acid. In this study, we isolated a novel OPRⅡ subgroup gene named TaOPR2 (GeneBank accession: KM216389) from the thermo-sensitive genic male sterile (TGMS) wheat cultivar BS366. TaOPR2 was predicted to encode a protein with 390 amino acids. The encoded protein contained the typical oxidored_FMN domain, the C-terminus peroxisomal-targeting signal peptide, and conserved FMN-binding sites. TaOPR2 was mapped to wheat chromosome 7B and located on peroxisome. Protein evolution analysis revealed that TaOPR2 belongs to the OPRⅡ subgroup and shares a high degree of identity with other higher plant OPR proteins. The quantitative real-time PCR results indicated that the expression of TaOPR2 is inhibited by abscisic acid (ABA), salicylic acid (SA), gibberellic acid (GA3), low temperatures and high salinity. In contrast, the expression of TaOPR2 can be induced by wounding, drought and methyl jasmonate (MeJA). Furthermore, the transcription level of TaOPR2 increased after infection with Puccinia striiformis f. sp. tritici and Puccinia recondite f. sp. tritici. TaOPR2 has NADPH-dependent oxidoreductase activity. In addition, the constitutive expression of TaOPR2 can rescue the male sterility phenotype of Arabidopsis mutant opr3. These results suggest that TaOPR2 is involved in the biosynthesis of jasmonic acid (JA) in wheat.

  12. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them

    SciTech Connect

    Gray, Kevin A.; Zhao, Lishan; Cayouette, Michelle H.


    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  13. Celluloytic enzymes, nucleic acids encoding them and methods for making and using them

    SciTech Connect

    Gray, Kevin A; Zhao, Lishan; Cayouette, Michelle H


    The invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  14. Deletion of genes encoding fatty acid desaturases leads to alterations in stress sensitivity in Pichia pastoris.


    Zhang, Meng; Liu, Zhe; Yu, Qilin; Mao, Jiwei; Zhang, Biao; Xing, Laijun; Li, Mingchun


    Unsaturated fatty acids (UFAs) are key compounds which have important roles in maintaining cell membrane physiological functions and the adaption to tough conditions. Defects of fatty acid desaturases will change cellular UFA constitution. Pichia pastoris GS115 has four fatty acid desaturase genes, namely FAD9A, FAD9B, FAD12 and FAD15. Their products catalyze the synthesis of three kinds of UFAs, oleic acid (catalyzed by Fad9A and Fad9B), linoleic acid (catalyzed by Fad12) and α-linolenic acid (catalyzed by Fad15), respectively. In this study, we found that deletion of FAD12 led to increased resistance to oxidative stress. Cellular lipid peroxidation levels declined in the fad12Δ mutant upon H2O2 treatment. Cellular fatty acids compositions were changed with the increased expression of FAD9A. On the other hand, deletion of FAD9A resulted in increased tolerance to the plasma membrane (PM) damage agent SDS, and PM deformation was not detected in the fad9AΔ mutant under this stress. Our results showed that UFAs are related to cell adaption to adverse environmental changes.

  15. Cellulolytic enzymes, nucleic acids encoding them and methods for making and using them


    Gray, Kevin A.; Zhao, Lishan; Cayouette, Michelle H.


    The invention provides polypeptides having any cellulolytic activity, e.g., a cellulase activity, a endoglucanase, a cellobiohydrolase, a beta-glucosidase, a xylanase, a mannanse, a .beta.-xylosidase, an arabinofuranosidase, and/or an oligomerase activity, polynucleotides encoding these polypeptides, and methods of making and using these polynucleotides and polypeptides. In one aspect, the invention is directed to polypeptides having any cellulolytic activity, e.g., a cellulase activity, e.g., endoglucanase, cellobiohydrolase, beta-glucosidase, xylanase, mannanse, .beta.-xylosidase, arabinofuranosidase, and/or oligomerase activity, including thermostable and thermotolerant activity, and polynucleotides encoding these enzymes, and making and using these polynucleotides and polypeptides. In one aspect, the invention provides polypeptides having an oligomerase activity, e.g., enzymes that convert recalcitrant soluble oligomers to fermentable sugars in the saccharification of biomass. The polypeptides of the invention can be used in a variety of pharmaceutical, agricultural, food and feed processing and industrial contexts. The invention also provides compositions or products of manufacture comprising mixtures of enzymes comprising at least one enzyme of this invention.

  16. The maize (Zea mays ssp. mays var. B73) genome encodes 33 members of the purple acid phosphatase family

    PubMed Central

    González-Muñoz, Eliécer; Avendaño-Vázquez, Aida-Odette; Montes, Ricardo A. Chávez; de Folter, Stefan; Andrés-Hernández, Liliana; Abreu-Goodger, Cei; Sawers, Ruairidh J. H.


    Purple acid phosphatases (PAPs) play an important role in plant phosphorus nutrition, both by liberating phosphorus from organic sources in the soil and by modulating distribution within the plant throughout growth and development. Furthermore, members of the PAP protein family have been implicated in a broader role in plant mineral homeostasis, stress responses and development. We have identified 33 candidate PAP encoding gene models in the maize (Zea mays ssp. mays var. B73) reference genome. The maize Pap family includes a clear single-copy ortholog of the Arabidopsis gene AtPAP26, shown previously to encode both major intracellular and secreted acid phosphatase activities. Certain groups of PAPs present in Arabidopsis, however, are absent in maize, while the maize family contains a number of expansions, including a distinct radiation not present in Arabidopsis. Analysis of RNA-sequencing based transcriptome data revealed accumulation of maize Pap transcripts in multiple plant tissues at multiple stages of development, and increased accumulation of specific transcripts under low phosphorus availability. These data suggest the maize PAP family as a whole to have broad significance throughout the plant life cycle, while highlighting potential functional specialization of individual family members. PMID:26042133

  17. The maize (Zea mays ssp. mays var. B73) genome encodes 33 members of the purple acid phosphatase family.


    González-Muñoz, Eliécer; Avendaño-Vázquez, Aida-Odette; Montes, Ricardo A Chávez; de Folter, Stefan; Andrés-Hernández, Liliana; Abreu-Goodger, Cei; Sawers, Ruairidh J H


    Purple acid phosphatases (PAPs) play an important role in plant phosphorus nutrition, both by liberating phosphorus from organic sources in the soil and by modulating distribution within the plant throughout growth and development. Furthermore, members of the PAP protein family have been implicated in a broader role in plant mineral homeostasis, stress responses and development. We have identified 33 candidate PAP encoding gene models in the maize (Zea mays ssp. mays var. B73) reference genome. The maize Pap family includes a clear single-copy ortholog of the Arabidopsis gene AtPAP26, shown previously to encode both major intracellular and secreted acid phosphatase activities. Certain groups of PAPs present in Arabidopsis, however, are absent in maize, while the maize family contains a number of expansions, including a distinct radiation not present in Arabidopsis. Analysis of RNA-sequencing based transcriptome data revealed accumulation of maize Pap transcripts in multiple plant tissues at multiple stages of development, and increased accumulation of specific transcripts under low phosphorus availability. These data suggest the maize PAP family as a whole to have broad significance throughout the plant life cycle, while highlighting potential functional specialization of individual family members. PMID:26042133

  18. Cloning and characterization of a complementary deoxyribonucleic acid encoding haploid-specific alanine-rich acidic protein located on chromosome-X.


    Uchida, K; Tsuchida, J; Tanaka, H; Koga, M; Nishina, Y; Nozaki, M; Yoshinaga, K; Toshimori, K; Matsumiya, K; Okuyama, A; Nishimune, Y


    We have isolated a cDNA clone encoding a germ cell-specific protein from an expression cDNA library prepared from the mouse testis using testis-specific polyclonal antibodies. Northern blot analysis showed a transcript of 1.1 kilobases exclusively expressed in haploid germ cells of the testis. Sequence analysis of the cDNA revealed one long open reading frame consisting of 238 deduced amino acids, rich in basic amino acids in the N-terminal one-third that also contained the nuclear localization signal, and rich in acidic amino acids, including two type of acidic alanine-rich repeats, in the rest of the deduced protein. The protein having a molecular weight of approximately 55 kDa and an isoelectric point of pH 4.3-4.7 was also exclusively detected in the testis by Western blot analysis. As the cDNA was located on chromosome-X, Halap-X (haploid-specific alanine-rich acidic protein located on chromosome-X) was proposed for the name of the protein encoded by the cDNA. Immunohistochemical observation revealed that the Halap-X protein was predominantly present in the nucleoplasm of round spermatids but gradually decreased as spermatids matured, followed by the subsequent appearance in the cytoplasm of elongating spermatids. Thus, the Halap-X protein was transferred from the nuclei to the cytoplasm during the spermatid maturation when the chromatin condensation and transformation of the nuclei occurred. The Halap-X may facilitate specific association of nuclear DNA with some basic chromosomal proteins and play important roles in the process of chromatin condensation. PMID:10993819

  19. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    SciTech Connect

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.


    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  20. Visible sensing of nucleic acid sequences using a genetically encodable unmodified mRNA probe.


    Narita, Atsushi; Ogawa, Kazumasa; Sando, Shinsuke; Aoyama, Yasuhiro


    We previously reported a molecular beacon-mRNA (MB-mRNA) strategy for nucleic acid detection/sensing in a cell-free translation system using unmodified RNA as a probe. Here in this presentation, we report that a combination with RNase H activity, which induces an additional process of irreversible cleavage of MB-domain, achieves an improved sequence selectivity (one nucleotide selectivity) and an enhanced sensitivity. This improved system finally enabled visible sensing of target nucleic acid sequence at a single nucleotide resolution under isothermal conditions.

  1. The IBO germination quantitative trait locus encodes a phosphatase 2C-related variant with a nonsynonymous amino acid change that interferes with abscisic acid signaling.


    Amiguet-Vercher, Amélia; Santuari, Luca; Gonzalez-Guzman, Miguel; Depuydt, Stephen; Rodriguez, Pedro L; Hardtke, Christian S


    Natural genetic variation is crucial for adaptability of plants to different environments. Seed dormancy prevents precocious germination in unsuitable conditions and is an adaptation to a major macro-environmental parameter, the seasonal variation in temperature and day length. Here we report the isolation of IBO, a quantitative trait locus (QTL) that governs c. 30% of germination rate variance in an Arabidopsis recombinant inbred line (RIL) population derived from the parental accessions Eilenburg-0 (Eil-0) and Loch Ness-0 (Lc-0). IBO encodes an uncharacterized phosphatase 2C-related protein, but neither the Eil-0 nor the Lc-0 variant, which differ in a single amino acid, have any appreciable phosphatase activity in in vitro assays. However, we found that the amino acid change in the Lc-0 variant of the IBO protein confers reduced germination rate. Moreover, unlike the Eil-0 variant of the protein, the Lc-0 variant can interfere with the activity of the phosphatase 2C ABSCISIC ACID INSENSITIVE 1 in vitro. This suggests that the Lc-0 variant possibly interferes with abscisic acid signaling, a notion that is supported by physiological assays. Thus, we isolated an example of a QTL allele with a nonsynonymous amino acid change that might mediate local adaptation of seed germination timing. PMID:25490966

  2. Evaluation of DNA encoding acidic ribosomal protein P2 of Cryptosporidium parvum as a potential vaccine candidate for cryptosporidiosis.


    Benitez, Alvaro; Priest, Jeffrey W; Ehigiator, Humphrey N; McNair, Nina; Mead, Jan R


    The Cryptosporidium parvum acidic ribosomal protein P2 (CpP2) is an important immunodominant marker in C. parvum infection. In this study, the CpP2 antigen was evaluated as a vaccine candidate using a DNA vaccine model in adult C57BL/6 IL-12 knockout (KO) mice, which are susceptible to C. parvum infection. Our data show that subcutaneous immunization in the ear with DNA encoding CpP2 (CpP2-DNA) cloned into the pUMVC4b vector induced a significant anti-CpP2 IgG antibody response that was predominantly of the IgG1 isotype. Compared to control KO mice immunized with plasmid alone, CpP2-immunized mice demonstrated specific in vitro spleen cell proliferation as well as enhanced IFN-γ production to recombinant CpP2. Further, parasite loads in CpP2 DNA-immunized mice were compared to control mice challenged with C. parvum oocysts. Although a trend in reduction of infection was observed in the CpP2 DNA-immunized mice, differences between groups were not statistically significant. These results suggest that a DNA vaccine encoding the C. parvum P2 antigen is able to provide an effective means of eliciting humoral and cellular responses and has the potential to generate protective immunity against C. parvum infection but may require using alternative vectors or adjuvant to generate a more potent and balanced response.

  3. Investigation of the fatty acid transporter-encoding genes SLC27A3 and SLC27A4 in autism

    PubMed Central

    Maekawa, Motoko; Iwayama, Yoshimi; Ohnishi, Tetsuo; Toyoshima, Manabu; Shimamoto, Chie; Hisano, Yasuko; Toyota, Tomoko; Balan, Shabeesh; Matsuzaki, Hideo; Iwata, Yasuhide; Takagai, Shu; Yamada, Kohei; Ota, Motonori; Fukuchi, Satoshi; Okada, Yohei; Akamatsu, Wado; Tsujii, Masatsugu; Kojima, Nobuhiko; Owada, Yuji; Okano, Hideyuki; Mori, Norio; Yoshikawa, Takeo


    The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. During fetal and postnatal periods of development, the growing brain requires a reliable supply of fatty acids. Because autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. Here, we confirmed the expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system. Additionally, we resequenced the SLC27A3 and SLC27A4 genes using 267 ASD patient and 1140 control samples and detected 47 (44 novel and 29 nonsynonymous) and 30 (17 novel and 14 nonsynonymous) variants for the SLC27A3 and SLC27A4, respectively, revealing that they are highly polymorphic with multiple rare variants. The SLC27A4 Ser209 allele was more frequently represented in ASD samples. Furthermore, we showed that a SLC27A4 Ser209 mutant resulted in significantly higher fluorescently-labeled fatty acid uptake into bEnd3 cells, a mouse brain capillary-derived endothelial cell line, compared with SLC27A4 Gly209, suggesting that the functional change may contribute to ASD pathophysiology. PMID:26548558

  4. Investigation of the fatty acid transporter-encoding genes SLC27A3 and SLC27A4 in autism.


    Maekawa, Motoko; Iwayama, Yoshimi; Ohnishi, Tetsuo; Toyoshima, Manabu; Shimamoto, Chie; Hisano, Yasuko; Toyota, Tomoko; Balan, Shabeesh; Matsuzaki, Hideo; Iwata, Yasuhide; Takagai, Shu; Yamada, Kohei; Ota, Motonori; Fukuchi, Satoshi; Okada, Yohei; Akamatsu, Wado; Tsujii, Masatsugu; Kojima, Nobuhiko; Owada, Yuji; Okano, Hideyuki; Mori, Norio; Yoshikawa, Takeo


    The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. During fetal and postnatal periods of development, the growing brain requires a reliable supply of fatty acids. Because autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. Here, we confirmed the expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system. Additionally, we resequenced the SLC27A3 and SLC27A4 genes using 267 ASD patient and 1140 control samples and detected 47 (44 novel and 29 nonsynonymous) and 30 (17 novel and 14 nonsynonymous) variants for the SLC27A3 and SLC27A4, respectively, revealing that they are highly polymorphic with multiple rare variants. The SLC27A4 Ser209 allele was more frequently represented in ASD samples. Furthermore, we showed that a SLC27A4 Ser209 mutant resulted in significantly higher fluorescently-labeled fatty acid uptake into bEnd3 cells, a mouse brain capillary-derived endothelial cell line, compared with SLC27A4 Gly209, suggesting that the functional change may contribute to ASD pathophysiology.

  5. Investigation of the fatty acid transporter-encoding genes SLC27A3 and SLC27A4 in autism.


    Maekawa, Motoko; Iwayama, Yoshimi; Ohnishi, Tetsuo; Toyoshima, Manabu; Shimamoto, Chie; Hisano, Yasuko; Toyota, Tomoko; Balan, Shabeesh; Matsuzaki, Hideo; Iwata, Yasuhide; Takagai, Shu; Yamada, Kohei; Ota, Motonori; Fukuchi, Satoshi; Okada, Yohei; Akamatsu, Wado; Tsujii, Masatsugu; Kojima, Nobuhiko; Owada, Yuji; Okano, Hideyuki; Mori, Norio; Yoshikawa, Takeo


    The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. During fetal and postnatal periods of development, the growing brain requires a reliable supply of fatty acids. Because autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. Here, we confirmed the expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system. Additionally, we resequenced the SLC27A3 and SLC27A4 genes using 267 ASD patient and 1140 control samples and detected 47 (44 novel and 29 nonsynonymous) and 30 (17 novel and 14 nonsynonymous) variants for the SLC27A3 and SLC27A4, respectively, revealing that they are highly polymorphic with multiple rare variants. The SLC27A4 Ser209 allele was more frequently represented in ASD samples. Furthermore, we showed that a SLC27A4 Ser209 mutant resulted in significantly higher fluorescently-labeled fatty acid uptake into bEnd3 cells, a mouse brain capillary-derived endothelial cell line, compared with SLC27A4 Gly209, suggesting that the functional change may contribute to ASD pathophysiology. PMID:26548558

  6. Investigation of the fatty acid transporter-encoding genes SLC27A3 and SLC27A4 in autism

    PubMed Central

    Maekawa, Motoko; Iwayama, Yoshimi; Ohnishi, Tetsuo; Toyoshima, Manabu; Shimamoto, Chie; Hisano, Yasuko; Toyota, Tomoko; Balan, Shabeesh; Matsuzaki, Hideo; Iwata, Yasuhide; Takagai, Shu; Yamada, Kohei; Ota, Motonori; Fukuchi, Satoshi; Okada, Yohei; Akamatsu, Wado; Tsujii, Masatsugu; Kojima, Nobuhiko; Owada, Yuji; Okano, Hideyuki; Mori, Norio; Yoshikawa, Takeo


    The solute carrier 27A (SLC27A) gene family encodes fatty acid transport proteins (FATPs) and includes 6 members. During fetal and postnatal periods of development, the growing brain requires a reliable supply of fatty acids. Because autism spectrum disorders (ASD) are now recognized as disorders caused by impaired early brain development, it is possible that functional abnormalities of SLC27A genes may contribute to the pathogenesis of ASD. Here, we confirmed the expression of SLC27A3 and SLC27A4 in human neural stem cells derived from human induced pluripotent stem cells, which suggested their involvement in the developmental stage of the central nervous system. Additionally, we resequenced the SLC27A3 and SLC27A4 genes using 267 ASD patient and 1140 control samples and detected 47 (44 novel and 29 nonsynonymous) and 30 (17 novel and 14 nonsynonymous) variants for the SLC27A3 and SLC27A4, respectively, revealing that they are highly polymorphic with multiple rare variants. The SLC27A4 Ser209 allele was more frequently represented in ASD samples. Furthermore, we showed that a SLC27A4 Ser209 mutant resulted in significantly higher fluorescently-labeled fatty acid uptake into bEnd3 cells, a mouse brain capillary-derived endothelial cell line, compared with SLC27A4 Gly209, suggesting that the functional change may contribute to ASD pathophysiology. PMID:26548558

  7. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)


    Freimuth, Paul I.


    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  8. Ribosomal Synthesis of Macrocyclic Peptides in Vitro and in Vivo Mediated by Genetically Encoded Amino-Thiol Unnatural Amino Acids

    PubMed Central

    Frost, John R.; Jacob, Nicholas T.; Papa, Louis J.; Owens, Andrew E.


    A versatile method for orchestrating the formation of side-chain-to-tail cyclic peptides from ribosomally derived polypeptide precursors is reported. Upon ribosomal incorporation into intein-containing precursor proteins, designer unnatural amino acids bearing side-chain 1,3- or 1,2-aminothiol functionalities are able to promote the cyclization of a downstream target peptide sequence via a C-terminal ligation/ring contraction mechanism. Using this approach, peptide macrocycles of variable size and composition could be generated in a pH-triggered manner in vitro, or directly in living bacterial cells. This methodology furnishes a new platform for the creation and screening of genetically encoded libraries of conformationally constrained peptides. This strategy was applied to identify and isolate a low micromolar streptavidin binder (KD = 1.1 µM) from a library of cyclic peptides produced in E. coli, thereby illustrating its potential toward aiding the discovery of functional peptide macrocycles. PMID:25933125

  9. Molecular cloning, encoding sequence, and expression of vaccinia virus nucleic acid-dependent nucleoside triphosphatase gene.

    PubMed Central

    Rodriguez, J F; Kahn, J S; Esteban, M


    A rabbit poxvirus genomic library contained within the expression vector lambda gt11 was screened with polyclonal antiserum prepared against vaccinia virus nucleic acid-dependent nucleoside triphosphatase (NTPase)-I enzyme. Five positive phage clones containing from 0.72- to 2.5-kilobase-pair (kbp) inserts expressed a beta-galactosidase fusion protein that was reactive by immunoblotting with the NTPase-I antibody. Hybridization analysis allowed the location of this gene within the vaccinia HindIIID restriction fragment. From the known nucleotide sequence of the 16-kbp vaccinia HindIIID fragment, we identified a region that contains a 1896-base open reading frame coding for a 631-amino acid protein. Analysis of the complete sequence revealed a highly basic protein, with hydrophilic COOH and NH2 termini, various hydrophobic domains, and no significant homology to other known proteins. Translational studies demonstrate that NTPase-I belongs to a late class of viral genes. This protein is highly conserved among Orthopoxviruses. Images PMID:3025846

  10. Interactions Between Fatty Acid Transport Proteins, Genes That Encode for Them, and Exercise: A Systematic Review.


    Jayewardene, Avindra F; Mavros, Yorgi; Reeves, Anneliese; Hancock, Dale P; Gwinn, Tom; Rooney, Kieron B


    Long-chain fatty acid (LCFA) movement into skeletal muscle involves a highly mediated process in which lipid rafts are utilized in the cellular membrane, involving numerous putative plasma membrane-associated LCFA transport proteins. The process of LCFA uptake and oxidation is of particular metabolic significance both at rest and during light to moderate exercise. A comprehensive systematic search of electronic databases was conducted to investigate whether exercise alters protein and/or gene expression of putative LCFA transport proteins. There were 31 studies meeting all eligibility criteria, of these 13 utilized an acute exercise protocol and 18 examined chronic exercise adaptations. Seventeen involved a study design incorporating an exercise stimulus, while the remaining 14 incorporated a combined exercise and diet stimulus. Divergent data relating to acute exercise, as well as prolonged exercise training (≥3 weeks), on protein content (PC) response was identified for proteins CD36, FABPpm and CAV1. Messenger ribonucleic acid (mRNA) data did not always correspond to functional PC, supporting previous suggestions of a disconnect due to potentially limiting factors post gene expression. The large array of study designs, cohorts, and primary dependent variables within the studies included in the present review elucidate the complexity of the interaction between exercise and LCFA transport proteins. Summary of the results in the present review validate the need for further targeted investigation within this topic, and provide an important information base for such research. J. Cell. Physiol. 231: 1671-1687, 2016. © 2015 Wiley Periodicals, Inc.

  11. Molecular cloning, encoding sequence, and expression of vaccinia virus nucleic acid-dependent nucleoside triphosphatase gene.


    Rodriguez, J F; Kahn, J S; Esteban, M


    A rabbit poxvirus genomic library contained within the expression vector lambda gt11 was screened with polyclonal antiserum prepared against vaccinia virus nucleic acid-dependent nucleoside triphosphatase (NTPase)-I enzyme. Five positive phage clones containing from 0.72- to 2.5-kilobase-pair (kbp) inserts expressed a beta-galactosidase fusion protein that was reactive by immunoblotting with the NTPase-I antibody. Hybridization analysis allowed the location of this gene within the vaccinia HindIIID restriction fragment. From the known nucleotide sequence of the 16-kbp vaccinia HindIIID fragment, we identified a region that contains a 1896-base open reading frame coding for a 631-amino acid protein. Analysis of the complete sequence revealed a highly basic protein, with hydrophilic COOH and NH2 termini, various hydrophobic domains, and no significant homology to other known proteins. Translational studies demonstrate that NTPase-I belongs to a late class of viral genes. This protein is highly conserved among Orthopoxviruses.

  12. The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein.

    PubMed Central

    Finkelstein, R R; Wang, M L; Lynch, T J; Rao, S; Goodman, H M


    Arabidopsis abscisic acid (ABA)-insensitive abi4 mutants have pleiotropic defects in seed development, including decreased sensitivity to ABA inhibition of germination and altered seed-specific gene expression. This phenotype is consistent with a role for ABI4 in regulating seed responses to ABA and/or seed-specific signals. We isolated the ABI4 gene by positional cloning and confirmed its identity by complementation analysis. The predicted protein product shows homology to a plant-specific family of transcriptional regulators characterized by a conserved DNA binding domain, the APETALA 2 domain. The single mutant allele identified has a single base pair deletion, resulting in a frameshift that should disrupt the C-terminal half of the protein but leave the presumed DNA binding domain intact. Expression analyses showed that despite the seed-specific nature of the mutant phenotype, ABI4 expression is not seed specific. PMID:9634591

  13. The hppA gene of Helicobacter pylori encodes the class C acid phosphatase precursor.


    Godlewska, Renata; Bujnicki, Janusz M; Ostrowski, Jerzy; Jagusztyn-Krynicka, Elzbieta K


    Screening of the Helicobacter pylori genomic library with sera from infected humans and from immunized rabbits resulted in identification of the 25 kDa protein cell envelope (HppA) which exhibits acid phosphatase activity. Enzyme activity was demonstrated by specific enzymatic assays with whole-cell protein preparations of H. pylori strain N6 and from Escherichia coli carrying the hppA gene (pUWM192). HppA showed optimum activity at pH 5.6 and was resistant to inhibition by EDTA. Bioinformatics analysis and site-directed mutagenesis of two putative active site residues (D73 and D192) provide further insight into the sequence-structure-function relationships of HppA as a member of the DDDD phosphohydrolase superfamily.

  14. Early region 1B of adenovirus 2 encodes two coterminal proteins of 495 and 155 amino acid residues.

    PubMed Central

    Anderson, C W; Schmitt, R C; Smart, J E; Lewis, J B


    Partial sequence analysis of tryptic peptides has identified the E1B-495R (E1b-57K) (early transcription region 1B of 495 amino acid residues, with an approximate molecular weight of 57,000) protein of adenovirus 2 as encoded by the 495 amino acid open reading frame located in the adenovirus 2 DNA sequence between nucleotides 2016 and 3500. Additional proteins of 16,000 Mr and 18,000 Mr that are related to the E1B-495R protein were identified by cell-free translation of hybridization-selected mRNA. Analysis of [35S]methionine-containing amino terminal tryptic peptides by thin-layer chromatography showed that the E1B-495R, E1B-18K, and E1B-16K proteins all begin at the same initiation codon. The E1B-495R protein from 293 cells also has the same initial tryptic peptide, acetyl-methionyl-glutamyl-arginine. Sequence analysis of E1B-18K tryptic peptides indicated that this protein also has the same carboxy terminus as the E1B-495R protein and that it is derived from an mRNA that is spliced to remove sequences between nucleotides 2250 and 3269, resulting in a protein product of 155 amino acid residues. Analysis of E1B-16K tryptic peptides has not yet revealed the carboxy terminal structure of this protein. Both the E1B-495R and the E1B-155R (E1B-18K) proteins, as well as the E1B-16K protein, were precipitated from cell-free translations and from extracts of infected cells by antiserum against an amino terminal nonapeptide common to these proteins. Images PMID:6323739

  15. Analysis of genes encoding the 2,4-dichlorophenoxyacetic acid-degrading enzyme from Sphingomonas agrestis 58-1.


    Shimojo, Mitsuhiro; Kawakami, Mitsuyasu; Amada, Kei


    A 2,4-dichlorophenoxy acetic acid (2,4-D)-degrading bacterium, strain 58-1, was newly isolated from soil samples collected in the Fukuoka Prefecture, Japan, and grown on an enrichment culture medium containing 2,4-D as the sole carbon source. Phylogenic analysis identified strain 58-1 as Sphingomonas agrestis. In 2,4-D degraders, classes I, II, and III inherit the tfdA, cadA, and tfdAalpha genes, respectively, and the results from degenerate-PCR indicated that this strain belongs to the class II degraders. A clone that includes the cadA gene homolog of S. agrestis 58-1 was screened from a library by using the PCR amplified fragment as a DNA probe. The cloned fragment was sequenced and found to consist of 5043 nucleotides and include 3 open reading frames (orfs). The orf1, orf2, and orf3 genes encode polypeptides consisting of 412, 448, and 177 amino acids, respectively. The Orf2 product shares a high degree of sequence similarity (92%) with the large subunit of 2,4-D oxygenase from the Bradyrhizobium sp. strain HW13, which belongs to the class III 2,4-D degraders, while the orf3 product shared 63% sequence similarity with the small subunit of 2,4-D oxygenase from the strain HW13. The results of the functional expression analysis using various deletion mutants in Escherichia coli revealed that the expression of both orf2 and orf3 genes, but not orf1, is essential for the conversion of 2,4-D to 2,4-DCP. From these results, we conclude the first isolation of 2,4-D oxygenase genes from a class II 2,4-D degrader.

  16. Ventricular zone gene-1 (vzg-1) encodes a lysophosphatidic acid receptor expressed in neurogenic regions of the developing cerebral cortex

    PubMed Central


    Neocortical neuroblast cell lines were used to clone G-protein-coupled receptor (GPCR) genes to study signaling mechanisms regulating cortical neurogenesis. One putative GPCR gene displayed an in situ expression pattern enriched in cortical neurogenic regions and was therefore named ventricular zone gene-1 (vzg-1). The vzg-1 cDNA hybridized to a 3.8-kb mRNA transcript and encoded a protein with a predicted molecular mass of 41-42 kD, confirmed by Western blot analysis. To assess its function, vzg-1 was overexpressed in a cell line from which it was cloned, inducing serum-dependent "cell rounding." Lysophosphatidic acid (LPA), a bioactive lipid present in high concentrations in serum, reproduced the effect seen with serum alone. Morphological responses to other related phospholipids or to thrombin, another agent that induces cell rounding through a GPCR, were not observed in vzg-1 overexpressing cells. Vzg-1 overexpression decreased the EC50 of both cell rounding and Gi activation in response to LPA. Pertussis toxin treatment inhibited vzg-1-dependent LPA-mediated Gi activation, but had no effect on cell rounding. Membrane binding studies indicated that vzg-1 overexpression increased specific LPA binding. These analyses identify the vzg-1 gene product as a receptor for LPA, suggesting the operation of LPA signaling mechanisms in cortical neurogenesis. Vzg-1 therefore provides a link between extracellular LPA and the activation of LPA- mediated signaling pathways through a single receptor and will allow new investigations into LPA signaling both in neural and nonneural systems. PMID:8922387

  17. Genetic Structure Associated with blaOXA-18, Encoding a Clavulanic Acid-Inhibited Extended-Spectrum Oxacillinase▿

    PubMed Central

    Naas, Thierry; Namdari, Fatemeh; Bogaerts, Pierre; Huang, Te-Din; Glupczynski, Youri; Nordmann, Patrice


    The genetic environment of the blaOXA-18 gene encoding a peculiar clavulanic acid-inhibitable Ambler class D extended-spectrum β-lactamase was determined from the prototype OXA-18-producing Pseudomonas aeruginosa MUS clinical isolate. An 8.2-kb genomic DNA fragment containing blaOXA-18 was cloned from P. aeruginosa MUS. Although most oxacillinases are located in integrons, blaOXA-18 lacked gene cassette-specific features. It was bracketed by two duplicated sequences containing ISCR19, a novel insertion sequence of the ISCR family of mobile elements; ΔintI1, a truncated integrase gene; and a truncated Δaac6′-Ib gene cassette. It is likely that ISCR19 was at the origin of the blaOXA-18 gene mobilization by a rolling-circle transposition event followed by homologous recombination. Furthermore, analysis of the cloned genomic DNA fragment revealed the presence of the integron-containing blaOXA-20 gene. Concomitantly, three P. aeruginosa clinical isolates, displaying a synergy image as determined by double-disk diffusion tests on cloxacillin-containing plates, were isolated from three patients hospitalized in different wards over a 9-month period at the Saint-Luc University hospital (Brussels, Belgium). These isolates were positive by PCR for blaOXA-18 and blaOXA-20 genes, genetically related to P. aeruginosa MUS as determined by pulsed-field gel electrophoresis, and carried the same blaOXA-18/blaOXA-20-associated genetic structures. This report characterized the genetic elements likely at the origin of blaOXA-18 gene mobilization in P. aeruginosa and suggests the spread of oxacillin-type extended-spectrum β-lactamases in P. aeruginosa at the Saint-Luc University hospital of Brussels, Belgium. PMID:18663027

  18. Two Sets of Paralogous Genes Encode the Enzymes Involved in the Early Stages of Clavulanic Acid and Clavam Metabolite Biosynthesis in Streptomyces clavuligerus

    PubMed Central

    Tahlan, Kapil; Park, Hyeon Ung; Wong, Annie; Beatty, Perrin H.; Jensen, Susan E.


    Recently, a second copy of a gene encoding proclavaminate amidinohydrolase (pah1), an enzyme involved in the early stages of clavulanic acid and clavam metabolite biosynthesis in Streptomyces clavuligerus, was identified and isolated. Using Southern analysis, we have now isolated second copies of the genes encoding the carboxyethylarginine synthase (ceaS) and β-lactam synthetase (bls) enzymes. These new paralogues are given the gene designations ceaS1 and bls1 and are located immediately upstream of pah1 on the chromosome. Furthermore, sequence analysis of the region downstream of pah1 revealed a second copy of a gene encoding ornithine acetyltransferase (oat1), thus indicating the presence of a cluster of paralogue genes. ceaS1, bls1, and oat1 display 73, 60, and 63% identities, respectively, at the nucleotide level to the original ceaS2, bls2, and oat2 genes from the clavulanic acid gene cluster. Single mutants defective in ceaS1, bls1, or oat1 were prepared and characterized and were found to be affected to variable degrees in their ability to produce clavulanic acid and clavam metabolites. Double mutants defective in both copies of the genes were also prepared and tested. The ceaS1/ceaS2 and the bls1/bls2 mutant strains were completely blocked in clavulanic acid and clavam metabolite biosynthesis. On the other hand, oat1/oat2 double mutants still produced some clavulanic acid and clavam metabolites. This may be attributed to the presence of the argJ gene in S. clavuligerus, which encodes yet another ornithine acetyltransferase enzyme that may be able to compensate for the lack of OAT1 and -2 in the double mutants. PMID:14982786

  19. Formation of indigo and related compounds from indolecarboxylic acids by aromatic acid-degrading bacteria: chromogenic reactions for cloning genes encoding dioxygenases that act on aromatic acids.

    PubMed Central

    Eaton, R W; Chapman, P J


    The p-cumate-degrading strain Pseudomonas putida F1 and the m- and p-toluate-degrading strain P. putida mt-2 transform indole-2-carboxylate and indole-3-carboxylate to colored products identified here as indigo, indirubin, and isatin. A mechanism by which these products could be formed spontaneously following dioxygenase-catalyzed dihydroxylation of the indolecarboxylates is proposed. Indolecarboxylates were employed as chromogenic substrates for identifying recombinant bacteria carrying genes encoding p-cumate dioxygenase and toluate dioxygenase. Dioxygenase gene-carrying bacteria could be readily distinguished as dark green-blue colonies among other colorless recombinant Escherichia coli colonies on selective agar plates containing either indole-2-carboxylate or indole-3-carboxylate. PMID:7592495

  20. Control of Acid Resistance Pathways of Enterohemorrhagic Escherichia coli Strain EDL933 by PsrB, a Prophage-Encoded AraC-Like Regulator

    PubMed Central

    Yang, Ji; Russell, Thomas W.; Hocking, Dianna M.; Bender, Jennifer K.; Srikhanta, Yogitha N.; Tauschek, Marija


    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 causes bloody diarrhea and hemolytic-uremic syndrome (HUS) and is the most prevalent E. coli serotype associated with food-borne illness worldwide. This pathogen is transmitted via the fecal-oral route and has a low infectious dose that has been estimated to be between 10 and 100 cells. We and others have previously identified three prophage-encoded AraC-like transcriptional regulators, PatE, PsrA, and PsrB in the EHEC O157:H7 EDL933 strain. Our analysis showed that PatE plays an important role in facilitating survival of EHEC under a number of acidic conditions, but the contribution of PsrA and PsrB to acid resistance (AR) was unknown. Here, we investigated the involvement of PsrA and PsrB in the survival of E. coli O157:H7 in acid. Our results showed that PsrB, but not PsrA, enhanced the survival of strain EDL933 under various acidic conditions. Transcriptional analysis using promoter-lacZ reporters and electrophoretic mobility shift assays demonstrated that PsrB activates transcription of the hdeA operon, which encodes a major acid stress chaperone, by interacting with its promoter region. Furthermore, using a mouse model, we showed that expression of PsrB significantly enhanced the ability of strain EDL933 to overcome the acidic barrier of the mouse stomach. Taken together, our results indicate that EDL933 acquired enhanced acid tolerance via horizontally acquired regulatory genes encoding transcriptional regulators that activate its AR machinery. PMID:25368119

  1. Bordetella pertussis waaA Encodes a Monofunctional 2-Keto-3-Deoxy-d-manno-Octulosonic Acid Transferase That Can Complement an Escherichia coli waaA Mutation

    PubMed Central

    Isobe, Tomoko; White, Kimberley A.; Allen, Andrew G.; Peacock, Michael; Raetz, Christian R. H.; Maskell, Duncan J.


    Bordetella pertussis lipopolysaccharide (LPS) contains a single 2-keto-3-deoxy-d-manno-octulosonic acid (Kdo) residue, whereas LPS from Escherichia coli contains at least two. Here we report that B. pertussis waaA encodes an enzyme capable of transferring only a single Kdo during the biosynthesis of LPS and that this activity is sufficient to complement an E. coli waaA mutation. PMID:10198035

  2. Selective heterogeneous acid catalyzed esterification of N-terminal sulfyhdryl fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our interest in thiol fatty acids lies in their antioxidative, free radical scavenging, and metal ion scavenging capabilities as applied to cosmeceutical and skin care formulations. The retail market is filled with products containing the disulfide-containing free fatty acid, lipoic acid. These pr...

  3. The Saccharomyces Cerevisiae Spt8 Gene Encodes a Very Acidic Protein That Is Functionally Related to Spt3 and Tata-Binding Protein

    PubMed Central

    Eisenmann, D. M.; Chapon, C.; Roberts, S. M.; Dollard, C.; Winston, F.


    Mutations in the Saccharomyces cerevisiae SPT8 gene were previously isolated as suppressors of retrotransposon insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Mutations in SPT8 confer phenotypes similar to those caused by particular mutations in SPT15, which encodes the TATA-binding protein (TBP). These phenotypes are also similar to those caused by mutations in the SPT3 gene, which encodes a protein that directly interacts with TBP. We have now cloned and sequenced the SPT8 gene and have shown that it encodes a predicted protein of 602 amino acids with an extremely acidic amino terminus. In addition, the predicted SPT8 amino acid sequence contains one copy of a sequence motif found in multiple copies in a number of other eukaryotic proteins, including the β subunit of heterotrimeric G proteins. To investigate further the relationship between SPT8, SPT3 and TBP, we have analyzed the effect of an spt8 null mutation in combination with different spt3 and spt15 mutations. This genetic analysis has shown that an spt8 deletion mutation is suppressed by particular spt3 alleles. Taken together with previous results, these data suggest that the SPT8 protein is required, directly or indirectly, for TBP function at particular promoters and that the role of SPT8 may be to promote a functional interaction between SPT3 and TBP. PMID:8088510

  4. Identification, cloning, sequencing, and overexpression of the gene encoding proclavaminate amidino hydrolase and characterization of protein function in clavulanic acid biosynthesis.

    PubMed Central

    Wu, T K; Busby, R W; Houston, T A; McIlwaine, D B; Egan, L A; Townsend, C A


    Proclavaminate amidino hydrolase (PAH) catalyzes the reaction of guanidinoproclavaminic acid to proclavaminic acid and urea, a central step in the biosynthesis of the beta-lactamase inhibitor clavulanic acid. The gene encoding this enzyme (pah) was tentatively identified within the clavulanic acid biosynthetic cluster in Streptomyces clavuligerus by translation to a protein of the correct molecular mass (33 kDa) and appreciable sequence homology to agmatine ureohydrolase (M.B.W. Szumanski and S.M. Boyle, J. Bacteriol. 172:538-547, 1990) and several arginases, a correlation similarly recognized by Aidoo et al. (K. A. Aidoo, A. Wong, D. C. Alexander, R. A. R. Rittammer, and S. E. Jensen, Gene 147:41-46, 1994). Overexpression of the putative open reading frame as a 76-kDa fusion to the maltose-binding protein gave a protein having the catalytic activity sought. Cleavage of this protein with factor Xa gave PAH whose N terminus was slightly modified by the addition of four amino acids but exhibited unchanged substrate specificity and kinetic properties. Directly downstream of pah lies the gene encoding clavaminate synthase 2, an enzyme that carries out three distinct oxidative transformations in the in vivo formation of clavulanic acid. After the first of these oxidations, however, no further reaction was found to occur in vitro without the intervention of PAH. We have demonstrated that concurrent use of recombinant clavaminate synthase 2 and PAH results in the successful conversion of deoxyguanidinoproclavaminic acid to clavaminic acid, a four-step transformation. PAH has a divalent metal requirement, pH activity profile, and kinetic properties similar to those of other proteins of the broader arginase class. PMID:7601835

  5. Two Oligopeptide-Permease-Encoding Genes in the Clavulanic Acid Cluster of Streptomyces clavuligerus Are Essential for Production of the β-Lactamase Inhibitor

    PubMed Central

    Lorenzana, Luis M.; Pérez-Redondo, Rosario; Santamarta, Irene; Martín, Juan F.; Liras, Paloma


    orf7 (oppA1) and orf15 (oppA2) are located 8 kb apart in the clavulanic acid gene cluster of Streptomyces clavuligerus and encode proteins which are 48.0% identical. These proteins show sequence similarity to periplasmic oligopeptide-binding proteins. Mutant S. clavuligerus oppA1::acc, disrupted in oppA1, lacks clavulanic acid production. Clavulanic acid production is restored by transformation with plasmid pIJ699-oppA1, which carries oppA1, but not with the multicopy plasmid pIJ699-oppA2, which carries oppA2. The mutant S. clavuligerus oppA2::aph also lacks clavulanic acid production, shows a bald phenotype, and overproduces holomycin (5). Clavulanic acid production at low levels is restored in the oppA2-disrupted mutants by transformation with plasmid pIJ699-oppA2, but it is not complemented by the multicopy plasmid pIJ699-oppA1. Both genes encode oligopeptide permeases with different substrate specificities. The disrupted S. clavuligerus oppA2::aph is not able to grow on RPPGFSPFR (Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg; bradykinin), but both mutants grow on VAPG (Val-Ala-Pro-Gly) as the only nitrogen source, indicating differences in the peptide bound by the proteins encoded by both genes. The null S. clavuligerus oppA1::acc and S. clavuligerus oppA2::aph mutants are more resistant to the toxic tripeptide phosphinothricyl-alanyl-alanine (also named bialaphos) than the wild-type strain, suggesting that this peptide might be transported by these peptide-binding proteins. PMID:15150229

  6. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.


    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario


    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  7. Expression of ccaR, Encoding the Positive Activator of Cephamycin C and Clavulanic Acid Production in Streptomyces clavuligerus, Is Dependent on bldG

    PubMed Central

    Bignell, Dawn R. D.; Tahlan, Kapil; Colvin, Kimberley R.; Jensen, Susan E.; Leskiw, Brenda K.


    In Streptomyces coelicolor, bldG encodes a putative anti-anti-sigma factor that regulates both aerial hypha formation and antibiotic production, and a downstream transcriptionally linked open reading frame (orf3) encodes a putative anti-sigma factor protein. A cloned DNA fragment from Streptomyces clavuligerus contained an open reading frame that encoded a protein showing 92% identity to the S. coelicolor BldG protein and 91% identity to the BldG ortholog in Streptomyces avermitilis. Sequencing of the region downstream of bldG in S. clavuligerus revealed the presence of an open reading frame encoding a protein showing 72 and 69% identity to the ORF3 proteins in S. coelicolor and S. avermitilis, respectively. Northern analysis indicated that, as in S. coelicolor, the S. clavuligerus bldG gene is expressed as both a monocistronic and a polycistronic transcript, the latter including the downstream orf3 gene. High-resolution S1 nuclease mapping of S. clavuligerus bldG transcripts revealed the presence of three bldG-specific promoters, and analysis of expression of a bldGp-egfp reporter indicated that the bldG promoter is active at various stages of development and in both substrate and aerial hyphae. A bldG null mutant was defective in both morphological differentiation and in the production of secondary metabolites, such as cephamycin C, clavulanic acid, and the 5S clavams. This inability to produce cephamycin C and clavulanic acid was due to the absence of the CcaR transcriptional regulator, which controls the expression of biosynthetic genes for both secondary metabolites as well as the expression of a second regulator of clavulanic acid biosynthesis, ClaR. This makes bldG the first regulatory protein identified in S. clavuligerus that functions upstream of CcaR and ClaR in a regulatory cascade to control secondary metabolite production. PMID:15793135

  8. The Arabidopsis thaliana ABSCISIC ACID-INSENSITIVE8 encodes a novel protein mediating abscisic acid and sugar responses essential for growth.


    Brocard-Gifford, Inès; Lynch, Tim J; Garcia, M Emily; Malhotra, Bhupinder; Finkelstein, Ruth R


    Abscisic acid (ABA) regulates many aspects of plant growth and development, yet many ABA response mutants present only subtle phenotypic defects, especially in the absence of stress. By contrast, the ABA-insensitive8 (abi8) mutant, isolated on the basis of ABA-resistant germination, also displays severely stunted growth, defective stomatal regulation, altered ABA-responsive gene expression, delayed flowering, and male sterility. The stunted growth of the mutant is not rescued by gibberellin, brassinosteroid, or indoleacetic acid application and is not attributable to excessive ethylene response, but supplementing the medium with Glc improves viability and root growth. In addition to exhibiting Glc-dependent growth, reflecting decreased expression of sugar-mobilizing enzymes, abi8 mutants are resistant to Glc levels that induce developmental arrest of wild-type seedlings. Studies of genetic interactions demonstrate that ABA hypersensitivity conferred by the ABA-hypersensitive1 mutation or overexpression of ABI3 or ABI5 does not suppress the dwarfing and Glc dependence caused by abi8 but partially suppresses ABA-resistant germination. By contrast, the ABA-resistant germination of abi8 is epistatic to the hypersensitivity caused by ethylene-insensitive2 (ein2) and ein3 mutations, yet ABI8 appears to act in a distinct Glc response pathway from these EIN loci. ABI8 encodes a protein with no domains of known function but belongs to a small plant-specific protein family. Database searches indicate that it is allelic to two dwarf mutants, elongation defective1 and kobito1, previously shown to disrupt cell elongation, cellulose synthesis, vascular differentiation, and root meristem maintenance. The cell wall defects appear to be a secondary effect of the mutations because Glc treatment restores root growth and vascular differentiation but not cell elongation. Although the ABI8 transcript accumulates in all tested plant organs in both wild-type and ABA response mutants, an

  9. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    NASA Technical Reports Server (NTRS)

    Lu, C.; Fedoroff, N.


    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  10. Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase.

    PubMed Central

    Llanos, R M; Harris, C J; Hillier, A J; Davidson, B E


    The discovery of a novel multicistronic operon that encodes phosphofructokinase, pyruvate kinase, and lactate dehydrogenase in the lactic acid bacterium Lactococcus lactis is reported. The three genes in the operon, designated pfk, pyk, and ldh, contain 340, 502, and 325 codons, respectively. The intergenic distances are 87 bp between pfk and pyk and 117 bp between pyk and ldh. Plasmids containing pfk and pyk conferred phosphofructokinase and pyruvate kinase activity, respectively, on their host. The identity of ldh was established previously by the same approach (R. M. Llanos, A. J. Hillier, and B. E. Davidson, J. Bacteriol. 174:6956-6964, 1992). Each of the genes is preceded by a potential ribosome binding site. The operon is expressed in a 4.1-kb transcript. The 5' end of the transcript was determined to be a G nucleotide positioned 81 bp upstream from the pfk start codon. The pattern of codon usage within the operon is highly biased, with 11 unused amino acid codons. This degree of bias suggests that the operon is highly expressed. The three proteins encoded on the operon are key enzymes in the Embden-Meyerhoff pathway, the central pathway of energy production and lactic acid synthesis in L. lactis. For this reason, we have called the operon the las (lactic acid synthesis) operon. Images PMID:8478320

  11. Characterization of the Streptomyces clavuligerus argC gene encoding N-acetylglutamyl-phosphate reductase: expression in Streptomyces lividans and effect on clavulanic acid production.

    PubMed Central

    Ludovice, M; Martin, J F; Carrachas, P; Liras, P


    The argC gene of Streptomyces clavuligerus encoding N-acetylglutamyl-phosphate reductase (AGPR) has been cloned by complementation of argC mutants Streptomyces lividans 1674 and Escherichia coli XC33. The gene is contained in an open reading frame of 1,023 nucleotides which encodes a protein of 340 amino acids with a deduced molecular mass of 35,224 Da. The argC gene is linked to argE, as shown by complementation of argE mutants of E. coli. Expression of argC from cloned DNA fragments carrying the gene leads to high levels of AGPR in wild-type S. lividans and in the argC mutant S. lividans 1674. Formation of AGPR is repressed by addition of arginine to the culture medium. The protein encoded by the argC gene is very similar to the AGPRs of Streptomyces coelicolor, Bacillus subtilis, and E. coli and, to a lesser degree, to the homologous enzymes of Saccharomyces cerevisiae and Anabaena spp. A conserved PGCYPT domain present in all the AGPR sequences suggests that this may be the active center of the protein. Transformation of S. clavuligerus 328, an argC auxotroph deficient in clavulanic acid biosynthesis, with plasmid pULML30, carrying the cloned argC gene, restored both prototrophy and antibiotic production. Images PMID:1339424

  12. Edwardsiella ictaluri Encodes an Acid Activated Urease that is Required for Intracellular Replication in Channel Catfish Ictalurus punctatus Macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genomic analysis indicated that Edwardsiella ictaluri encodes a putative ureasepathogenicity island containing 9 open reading frames, including urea and ammonium transporters. In vitro studies with the wild-type E. ictaluri and a ureG::kan urease mutant strain indicated that E. ictaluri is significa...

  13. Spectroscopic Studies of R(+)-α-Lipoic Acid—Cyclodextrin Complexes

    PubMed Central

    Ikuta, Naoko; Tanaka, Akira; Otsubo, Ayako; Ogawa, Noriko; Yamamoto, Hiromitsu; Mizukami, Tomoyuki; Arai, Shoji; Okuno, Masayuki; Terao, Keiji; Matsugo, Seiichi


    α-Lipoic acid (ALA) has a chiral center at the C6 position, and exists as two enantiomers, R(+)-ALA (RALA) and S(−)-ALA (SALA). RALA is naturally occurring, and is a cofactor for mitochondrial enzymes, therefore playing a major role in energy metabolism. However, RALA cannot be used for pharmaceuticals or nutraceuticals because it readily polymerizes via a 1,2-dithiolane ring-opening when exposed to light or heat. So, it is highly desired to find out the method to stabilize RALA. The purpose of this study is to provide the spectroscopic information of stabilized RALA and SALA through complexation with cyclodextrins (CDs), α-CD, β-CD and γ-CD and to examine the physical characteristics of the resultant complexes in the solid state. The RALA-CD structures were elucidated based on the micro fourier transform infrared (FT-IR) and Raman analyses. The FT-IR results showed that the C=O stretching vibration of RALA appeared at 1717 cm−1 and then shifted on formation of the RALA-CD complexes. The Raman spectra showed that the S–S and C–S stretching vibrations for RALA at 511 cm−1 (S–S), 631 cm−1 (C–S) and 675 cm−1 (C–S) drastically weakened and almost disappeared upon complexation with CDs. Several peaks indicative of O–H vibrations also shifted or changed in intensity. These results indicate that RALA and CDs form host-guest complexes by interacting with one another. PMID:25387076

  14. A high-fat diet and the threonine-encoding allele (Thr54) polymorphism of fatty acid-binding protein 2 reduce plasma triglyceride-rich lipoproteins.


    McColley, Steven P; Georgopoulos, Angeliki; Young, Lindsay R; Kurzer, Mindy S; Redmon, J Bruce; Raatz, Susan K


    The threonine-encoding allele (Thr54) of the fatty acid-binding protein 2 (FABP2) DNA polymorphism is associated with increased triglyceride (TG)-rich lipoproteins (TRL). We hypothesized that the TRL response to diets of varied fat content is affected by the FABP2 A54T polymorphism, specifically that a high-fat diet would reduce TRL and that the Thr54 allele would have an enhanced response. Sixteen healthy, postmenopausal women completed a crossover dietary intervention that included three 8-week, isoenergetic diet treatments. The treatments consisted of high fat (40% of energy as fat), low fat (20% of energy), and low fat + n-3 fatty acids (20% of energy plus 3% as n-3 fatty acids). Eight subjects were homozygous for the wild type (Ala54/Ala54) of the FABP2 polymorphism, whereas 8 subjects had at least 1 Thr54 allele (7, Ala54/Thr54; 1, Thr54/Thr54). High-fat diet showed significantly reduced plasma TGs, chylomicron TG, and very low-density lipoprotein TG from baseline in all participants. Although carriers of the Thr54 allele of the FABP2 polymorphism had significantly reduced TRL, there is no evidence of an interaction, which does not support our hypothesis. The alanine-encoding allele did not influence the dietary effects on the plasma lipids. PMID:21840466

  15. Encoding Dictionaries.

    ERIC Educational Resources Information Center

    Ide, Nancy


    Describes problems in devising a Text Encoding Initiative (TEI) encoding format for dictionaries. Asserts that the high degree of structuring and compression of information are among the most complex text types treated in the TEI. Concludes that the source of some TEI problems lies in the design of Standard Generalized Markup Language (SGML). (CFR)

  16. OsNAC2 encoding a NAC transcription factor that affects plant height through mediating the gibberellic acid pathway in rice.


    Chen, Xu; Lu, Songchong; Wang, Yaofeng; Zhang, Xuan; Lv, Bo; Luo, Liqiong; Xi, Dandan; Shen, Jiabin; Ma, Hong; Ming, Feng


    Plant height and flowering time are key agronomic traits affecting yield in rice (Oryza sativa). In this study, we investigated the functions in rice growth and development of OsNAC2, encoding a NAC transcription factor in rice. Transgenic plants that constitutively expressed OsNAC2 had shorter internodes, shorter spikelets, and were more insensitive to gibberellic acid (GA(3)). In addition, the levels of GAs decreased in OsNAC2 overexpression plants, compared with the wild-type. Moreover, flowering was delayed for approximately 5 days in transgenic lines. The transcription of Hd3a, a flowering-time related gene, was suppressed in transgenic lines. In addition, transgenic Arabidopsis plants expressing OsNAC2 were also more insensitive to GA(3). The expression levels of GA biosynthetic genes OsKO2 and OsKAO were repressed. The expression of OsSLRL, encoding a repressor in the GA signal pathway, and OsEATB, which encodes a repressor of GA biosynthesis, were both enhanced. Western blotting indicated that DELLA also accumulated at the protein level. Dual-luciferase reporter analyses, yeast one-hybrid assays and ChIP-qPCR suggested that OsNAC2 directly interacted with the promoter of OsEATB and OsKO2. Taken together, we proposed that OsNAC2 is a negative regulator of the plant height and flowering time, which acts by directly regulating key genes of the GA pathway in rice.

  17. Mutations in the Arabidopsis Lst8 and Raptor genes encoding partners of the TOR complex, or inhibition of TOR activity decrease abscisic acid (ABA) synthesis.


    Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie


    The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis.

  18. Molecular cloning of a cDNA encoding a novel fatty acid-binding protein from rat skin.


    Watanabe, R; Fujii, H; Odani, S; Sakakibara, J; Yamamoto, A; Ito, M; Ono, T


    A novel skin-type fatty acid-binding protein, termed cutaneous(C)-FABP, has been purified from rat skin and a cDNA clone for this protein has been identified. The purified protein had the ability to bind long chain fatty acids like other rat FABPs. The deduced amino acid sequence of the cDNA clone comprises residues yielding a molecular mass for the polypeptide of 15.1 kDa and exhibits around 50% identity to myelin P2 protein, adipocyte FABP and heart FABP. Our results propose that C-FABP is a new member of the FABP family.

  19. aguA, the gene encoding an extracellular alpha-glucuronidase from Aspergillus tubingensis, is specifically induced on xylose and not on glucuronic acid.


    de Vries, R P; Poulsen, C H; Madrid, S; Visser, J


    An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.

  20. Organization and chromosomal localization of the gene encoding the mouse acid labile subunit of the insulin-like growth factor binding complex.

    PubMed Central

    Boisclair, Y R; Seto, D; Hsieh, S; Hurst, K R; Ooi, G T


    After birth, most of insulin-like growth factor I and II (IGFs) circulate as a ternary complex formed by the association of IGF binding protein 3-IGF complexes with a serum protein called acid-labile subunit (ALS). ALS retains the IGF binding protein-3-IGF complexes in the vascular compartment and extends the t1/2 of IGFs in the circulation. Synthesis of ALS occurs mainly in liver after birth and is stimulated by growth hormone. To study the basis for this regulation, we cloned and characterized the mouse ALS gene. Comparison of genomic and cDNA sequences indicated that the gene is composed of two exons separated by a 1126-bp intron. Exon 1 encodes the first 5 amino acids of the signal peptide and contributes the first nucleotide of codon 6. Exon 2 contributes the last 2 nt of codon 6 and encodes the remaining 17 amino acids of the signal peptide as well as the 580 amino acids of the mature protein. The polyadenylylation signal, ATTAAA, is located 241 bp from the termination codon. The cDNA and genomic DNA diverge 16 bp downstream from this signal. Transcription initiation was mapped to 11 sites over a 140-bp TATA-less region. The DNA fragment extending from nt -805 to -11 (ATG, +1) directed basal and growth hormone-regulated expression of a luciferase reporter plasmid in the rat liver cell line H4-II-E. Finally, the ALS gene was mapped to mouse chromosome 17 by fluorescence in situ hybridization. Images Fig. 3 Fig. 5 PMID:8816745

  1. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    SciTech Connect

    Safford, R.; de Silva, J.; Lucas, C.; Windust, J.H.C.; Shedden, J.; James, C.M.; Sidebottom, C.M.; Slabas, A.R.; Tombs, M.P.; Hughes, S.G.


    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from approx. 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH.

  2. Cross-species conservation of complementary amino acid-ribonucleobase interactions and their potential for ribosome-free encoding

    PubMed Central

    Cannon, John G. D.; Sherman, Rachel M.; Wang, Victoria M. Y.; Newman, Grace A.


    The role of amino acid-RNA nucleobase interactions in the evolution of RNA translation and protein-mRNA autoregulation remains an open area of research. We describe the inference of pairwise amino acid-RNA nucleobase interaction preferences using structural data from known RNA-protein complexes. We observed significant matching between an amino acid’s nucleobase affinity and corresponding codon content in both the standard genetic code and mitochondrial variants. Furthermore, we showed that knowledge of nucleobase preferences allows statistically significant prediction of protein primary sequence from mRNA using purely physiochemical information. Interestingly, ribosomal primary sequences were more accurately predicted than non-ribosomal sequences, suggesting a potential role for direct amino acid-nucleobase interactions in the genesis of amino acid-based ribosomal components. Finally, we observed matching between amino acid-nucleobase affinities and corresponding mRNA sequences in 35 evolutionarily diverse proteomes. We believe these results have important implications for the study of the evolutionary origins of the genetic code and protein-mRNA cross-regulation. PMID:26656258

  3. Diversity of acid stress resistant variants of Listeria monocytogenes and the potential role of ribosomal protein S21 encoded by rpsU

    PubMed Central

    Metselaar, Karin I.; den Besten, Heidy M. W.; Boekhorst, Jos; van Hijum, Sacha A. F. T.; Zwietering, Marcel H.; Abee, Tjakko


    The dynamic response of microorganisms to environmental conditions depends on the behavior of individual cells within the population. Adverse environments can select for stable stress resistant subpopulations. In this study, we aimed to get more insight in the diversity within Listeria monocytogenes LO28 populations, and the genetic basis for the increased resistance of stable resistant fractions isolated after acid exposure. Phenotypic cluster analysis of 23 variants resulted in three clusters and four individual variants and revealed multiple-stress resistance, with both unique and overlapping features related to stress resistance, growth, motility, biofilm formation, and virulence indicators. A higher glutamate decarboxylase activity correlated with increased acid resistance. Whole genome sequencing revealed mutations in rpsU, encoding ribosomal protein S21 in the largest phenotypic cluster, while mutations in ctsR, which were previously shown to be responsible for increased resistance of heat and high hydrostatic pressure resistant variants, were not found in the acid resistant variants. This underlined that large population diversity exists within one L. monocytogenes strain and that different adverse conditions drive selection for different variants. The finding that acid stress selects for rpsU variants provides potential insights in the mechanisms underlying population diversity of L. monocytogenes. PMID:26005439

  4. Ectopic expression of Arabidopsis genes encoding salicylic acid- and jasmonic acid-related proteins confers partial resistance to soybean cyst nematode (Heterodera glycines) in transgenic soybean roots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background. Extensive studies using the model system Arabidopsis thaliana to elucidate plant defense signaling and pathway networks indicate that salicylic acid (SA) is the key hormone triggering the plant defense response against biotrophic and hemi-biotrophic pathogens, while jasmonic acid (JA) an...

  5. The brown midrib3 (bm3) mutation in maize occurs in the gene encoding caffeic acid O-methyltransferase.

    PubMed Central

    Vignols, F; Rigau, J; Torres, M A; Capellades, M; Puigdomènech, P


    The brown midrib mutations are among the earliest described in maize. Plants containing a brown midrib mutation exhibit a reddish brown pigmentation of the leaf midrib starting when there are four to six leaves. These mutations are known to alter lignin composition and digestibility of plants and therefore constitute prime candidates in the breeding of silage maize. Here, we show that two independent brown midrib3 (bm3) mutations have resulted from structural changes in the COMT gene, which encodes the enzyme O-methyltransferase (COMT; EC, involved in lignin biosynthesis. Our results indicate that the bm3-1 allele (the reference mutant allele) has arisen from an insertional event producing a COMT mRNA altered in both size and amount. By sequencing a COMT cDNA clone obtained from bm3-1 maize, a retrotransposon with homology to the B5 element has been found to be inserted near the junction of the 3' coding region of the COMT gene intron. The second bm3 allele, bm3-2, has resulted from a deletion of part of the COMT gene. These alterations of the COMT gene were confirmed by DNA gel blot and polymerase chain reaction amplification analyses. These results clearly demonstrate that mutations at the COMT gene give a brown midrib3 phenotype. Thus, the gene genetically recognized as bm3 is the same as the one coding for COMT. PMID:7773015

  6. Biosynthesis of pipecolic acid by RapL, a lysine cyclodeaminase encoded in the rapamycin gene cluster.


    Gatto, Gregory J; Boyne, Michael T; Kelleher, Neil L; Walsh, Christopher T


    Rapamycin, FK506, and FK520 are immunosuppressant macrolactone natural products comprised of predominantly polyketide-based core structures. A single nonproteinogenic pipecolic acid residue is installed into the scaffold by a nonribosomal peptide synthetase that also performs the subsequent macrocyclization step at the carbonyl group of this amino acid. It has been assumed that pipecolic acid is generated from lysine by the cyclodeaminases RapL/FkbL. Herein we report the heterologous overexpression and purification of RapL and validate its ability to convert L-lysine to L-pipecolic acid by a cyclodeamination reaction that involves redox catalysis. RapL also accepts L-ornithine as a substrate, albeit with a significantly reduced catalytic efficiency. Turnover is presumed to encompass a reversible oxidation at the alpha-amine, internal cyclization, and subsequent re-reduction of the cyclic delta1-piperideine-2-carboxylate intermediate. As isolated, RapL has about 0.17 equiv of tightly bound NAD+, suggesting that the enzyme is incompletely loaded when overproduced in E. coli. In the presence of exogenous NAD+, the initial rate is elevated 8-fold with a Km of 2.3 microM for the cofactor, consistent with some release and rebinding of NAD+ during catalytic cycles. Through the use of isotopically labeled substrates, we have confirmed mechanistic details of the cyclodeaminase reaction, including loss of the alpha-amine and retention of the hydrogen atom at the alpha-carbon. In addition to the characterization of a critical enzyme in the biosynthesis of a medically important class of natural products, this work represents the first in vitro characterization of a lysine cyclodeaminase, a member of a unique group of enzymes which utilize the nicotinamide cofactor in a catalytic manner. PMID:16536560

  7. Secretion of the acid trehalase encoded by the CgATH1 gene allows trehalose fermentation by Candida glabrata.


    Zilli, D M W; Lopes, R G; Alves, S L; Barros, L M; Miletti, L C; Stambuk, B U


    The emergent pathogen Candida glabrata differs from other yeasts because it assimilates only two sugars, glucose and the disaccharide trehalose. Since rapid identification tests are based on the ability of this yeast to rapidly hydrolyze trehalose, in this work a biochemical and molecular characterization of trehalose catabolism by this yeast was performed. Our results show that C. glabrata consumes and ferments trehalose, with parameters similar to those observed during glucose fermentation. The presence of glucose in the medium during exponential growth on trehalose revealed extracellular hydrolysis of the sugar by a cell surface acid trehalase with a pH optimum of 4.4. Approximately ∼30% of the total enzymatic activity is secreted into the medium during growth on trehalose or glycerol. The secreted enzyme shows an apparent molecular mass of 275 kDa in its native form, but denaturant gel electrophoresis revealed a protein with ∼130 kDa, which due to its migration pattern and strong binding to concanavalin A, indicates that it is probably a dimeric glycoprotein. The secreted acid trehalase shows high affinity and activity for trehalose, with Km and Vmax values of 3.4 mM and 80 U (mg protein)(-1), respectively. Cloning of the CgATH1 gene (CAGLOK05137g) from de C. glabrata genome, a gene showing high homology to fungal acid trehalases, allowed trehalose fermentation after heterologous expression in Saccharomyces cerevisiae.

  8. Gramicidin S biosynthesis operon containing the structural genes grsA and grsB has an open reading frame encoding a protein homologous to fatty acid thioesterases.

    PubMed Central

    Krätzschmar, J; Krause, M; Marahiel, M A


    The DNA sequence of about 5.9 kilobase pairs (kbp) of the gramicidin S biosynthesis operon (grs) was determined. Three open reading frames were identified; the corresponding genes, called grsT, grsA, and grsB, were found to be organized in one transcriptional unit, not two as previously reported (M. Krause and M. A. Marahiel, J. Bacteriol. 170:4669-4674, 1988). The entire nucleotide sequence of grsA, coding for the 126.663-kilodalton gramicidin S synthetase 1, grsT, encoding a 29.191-kilodalton protein of unknown function, and 732 bp of the 5' end of grsB, encoding the gramicidin S synthetase 2, were determined. A single initiation site of transcription 81 bp upstream of the grsT initiation condon GTG was identified by high-resolution S1 mapping studies. The sequence of the grsA gene product showed a high degree of homology to the tyrocidine synthetase 1 (TycA protein), and that of grsT exhibited a significant degree of homology to vertebrate fatty acid thioesterases. Images PMID:2477357

  9. Asparagusic acid.


    Mitchell, Stephen C; Waring, Rosemary H


    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications.

  10. Asparagusic acid.


    Mitchell, Stephen C; Waring, Rosemary H


    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications. PMID:24099657

  11. Expression of genes encoding enzymes involved in the one carbon cycle in rat placenta is determined by maternal micronutrients (folic acid, vitamin B12) and omega-3 fatty acids.


    Khot, Vinita; Kale, Anvita; Joshi, Asmita; Chavan-Gautam, Preeti; Joshi, Sadhana


    We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency) leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR) and methionine synthase , but higher cystathionine b-synthase (CBS) and Phosphatidylethanolamine-N-methyltransferase (PEMT) as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE), phosphatidylcholine (PC), in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.

  12. Characterization of cDNAs encoding the chick retinoic acid receptor gamma 2 and preferential distribution of retinoic acid receptor gamma transcripts during chick skin development.


    Michaille, J J; Blanchet, S; Kanzler, B; Garnier, J M; Dhouailly, D


    Retinoic acid receptors alpha, beta and gamma (RAR alpha, beta and gamma) are ligand-inductible transcriptional activators which belong to the steroid/thyroid hormone receptor superfamily. At least two major isoforms (1 and 2) of each RAR arise by differential use of two promoters and alternative splicing. In mouse, the three RAR genes are expressed in stage- and tissue-specific patterns during embryonic development. In order to understand the role of the different RARs in chick, RAR gamma 2 cDNAs were isolated from an 8.5-day (stage 35 of Hamburger and Hamilton) chick embryo skin library. The deduced chick RAR gamma 2 amino acid sequence displays uncommon features such as 21 specific amino acid replacements, 12 of them being clustered in the amino-terminal region (domains A2 and B), and a truncated acidic carboxy-terminal region (F domain). However, the pattern of RAR gamma expression in chick embryo resembles that reported in mouse, particularly in skin where RAR gamma expression occurs in both the dermal and epidermal layers at the beginning of feather formation, and is subsequently restricted to the differentiating epidermal cells. Northern blot analysis suggests that different RAR gamma isoforms could be successively required during chick development.

  13. Amplification of an MFS transporter encoding gene penT significantly stimulates penicillin production and enhances the sensitivity of Penicillium chrysogenum to phenylacetic acid.


    Yang, Jing; Xu, Xinxin; Liu, Gang


    Penicillin is historically important as the first discovered drug against bacterial infections in human. Although the penicillin biosynthetic pathway and regulatory mechanism have been well studied in Penicillium chrysogenum, the compartmentation and molecular transport of penicillin or its precursors are still poorly understood. In search of the genomic database, more than 830 open reading frames (ORFs) were found to encode transmembrane proteins of P. chrysogenum. In order to investigate their roles on penicillin production, one of them (penT) was selected and cloned. The deduced protein of penT belongs to the major facilitator superfamily (MFS) and contains 12 transmembrane spanning domains (TMS). During fermentation, the transcription of penT was greatly induced by penicillin precursors phenylacetic acid (PAA) and phenoxyacetic acid (POA). Knock-down of penT resulted in significant decrease of penicillin production, while over-expression of penT under the promoter of trpC enhanced the penicillin production. Introduction of an additional penT in the wild-type strain of P. chrysogenum doubled the penicillin production and enhanced the sensitivity of P. chrysogenum to the penicillin precursors PAA or POA. These results indicate that penT stimulates penicillin production probably through enhancing the translocation of penicillin precursors across fungal cellular membrane.

  14. Chlorophenol hydroxylase activity encoded by TfdB from 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading Bradyrhizobium sp. strain RD5-C2.


    Huong, Nguyen L; Itoh, Kazuhito; Miyamoto, Masao; Suyama, Kousuke; Yamamoto, Hiroki


    The tfdB gene encoding chlorophenol hydroxylase and its homolog were found in 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading strain RD5-C2, which belongs to Bradyrhizobium sp. of alpha-Proteobacteria. The nucleotide and deduced amino acid sequence identities of the two genes, designated tfdBa and tfdBb, were 60% and 57% respectively. Their nucleotide sequences most closely matched those of previously reported tfdB, which consisted of those from 2,4-D-degrading beta- and gamma-Proteobacteria and Sphingomonas sp. in alpha-Proteobacteria, with 61-67% identity. The TfdBa expressed in Escherichia coli showed the highest activity for 2,4-dichlorophenol but a narrower range of activity for the other chlorophenols than previously reported TfdBs. In the case of TfdBb, however, no observable activity for any chlorophenols or phenol was detected, although production of a protein with an appropriate molecular size was observed. Based on codon usage patterns and the GC content of the genes, it probable that the tfdBa genes in the 2,4-D-degrading Bradyrhizobium sp. were obtained through horizontal gene transfer.

  15. Retinoic Acid Induces Embryonic Stem Cell Differentiation by Altering Both Encoding RNA and microRNA Expression.


    Zhang, Jingcheng; Gao, Yang; Yu, Mengying; Wu, Haibo; Ai, Zhiying; Wu, Yongyan; Liu, Hongliang; Du, Juan; Guo, Zekun; Zhang, Yong


    Retinoic acid (RA) is a vitamin A metabolite that is essential for early embryonic development and promotes stem cell neural lineage specification; however, little is known regarding the impact of RA on mRNA transcription and microRNA levels on embryonic stem cell differentiation. Here, we present mRNA microarray and microRNA high-output sequencing to clarify how RA regulates gene expression. Using mRNA microarray analysis, we showed that RA repressed pluripotency-associated genes while activating ectoderm markers in mouse embryonic stem cells (mESCs). Moreover, RA modulated the DNA methylation of mESCs by altering the expression of epigenetic-associated genes such as Dnmt3b and Dnmt3l. Furthermore, H3K4me2, a pluripotent histone modification, was repressed by RA stimulation. From microRNA sequence data, we identified two downregulated microRNAs, namely, miR-200b and miR-200c, which regulated the pluripotency of stem cells. We found that miR-200b or miR-200c deficiency suppressed the expression of pluripotent genes, including Oct4 and Nanog, and activated the expression of the ectodermal marker gene Nestin. These results demonstrate that retinoid induces mESCs to differentiate by regulating miR-200b/200c. Our findings provide the landscapes of mRNA and microRNA gene networks and indicate the crucial role of miR-200b/200c in the RA-induced differentiation of mESCs.

  16. Suppression of 9-cis-Epoxycarotenoid Dioxygenase, Which Encodes a Key Enzyme in Abscisic Acid Biosynthesis, Alters Fruit Texture in Transgenic Tomato1[W][OA

    PubMed Central

    Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping


    Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp). PMID:22108525

  17. Reduced expression of kan-1 (encoding putative bile acid-CoA-amino acid N-acyltransferase) mRNA in livers of rats after partial hepatectomy and during sepsis.

    PubMed Central

    Furutani, M; Arii, S; Higashitsuji, H; Mise, M; Fukumoto, M; Takano, S; Nakayama, H; Imamura, M; Fujita, J


    We isolated a cDNA clone, kan-1, from a rat liver cDNA library using a reverse transcriptase PCR cloning method. The kan-1 cDNA encoded a polypeptide of 420 amino acids, and was 70 and 69% identical in nucleotide and amino acid sequences respectively with human liver bile acid-CoA-amino acid N-acyltransferase (BAT). Thus Kan-1 is probably a rat homologue of human BAT (rBAT). Kan-1/rBAT mRNA was mainly expressed in the livers of adult rats and rats immediately after, but not before, birth. It was expressed in the hepatocytes, the sinusoidal endothelial cells and the Kupffer cells of the liver. An anti-Kan-1/rBAT polyclonal antibody detected a protein of molecular mass 46 kDa in the liver. After partial hepatectomy, the levels of Kan-1/rBAT mRNA decreased at 6 and 12 h in the regenerating liver. In a sepsis model, hepatic expression of Kan-1/rBAT mRNA decreased at 6 and 12 h after caecal ligation and puncture. The kinetics of Kan-1/rBAT mRNA expression suggests that it may play a role in acute-phase reactions. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7575455

  18. Lipophilic and polar interaction forces between acidic drugs and membrane phospholipids encoded in IAM-HPLC indexes: their role in membrane partition and relationships with BBB permeation data.


    Grumetto, Lucia; Carpentiero, Carmen; Di Vaio, Paola; Frecentese, Francesco; Barbato, Francesco


    The membrane phospholipid affinity data, log k(w)(IAM), for 18 acidic and unionized drugs spanning a wide lipophilicity range were measured by HPLC on two different phospholipid stationary phases, i.e. IAM.PC.MG and IAM.PC.DD2. These data related weakly with both log P(N) values, the n-octanol/water partition coefficients of the neutral forms, and log D(7.4) values, the n-octanol/water partition coefficients of the mixtures of neutral and ionized forms at pH 7.4. The lack of collinearity confirms that, differently from partition in n-octanol/water, partition in phospholipids encodes not only lipophilic/hydrophobic intermolecular recognition forces but also ionic bonds, due to electrostatic interactions between electrically charged species and phospholipids, according to the "pH piston hypothesis". Since, differently from bases, electrostatic interactions between acids and phospholipids take place at the surface of phospholipid layers (choline moieties), and not near their lipophilic core (phosphate moieties), they were parameterized by a new procedure yielding "Δ'log k(w)(IAM)" parameters, i.e. the difference between the IAM retention factors observed for the analytes and those of neutral compounds with the same n-octanol partition values displayed by the analytes at pH 7.4. All acidic analytes, but one, and all unionized analytes, but the unionizable ones, showed positive Δ'log k(w)(IAM) values, indicating that they partition stronger in phospholipids than in n-octanol. Log BB values (capability to pass BBB) weakly related with both lipophilicity and phospholipid affinity values; in contrast they are inversely related with Δ'log k(w)(IAM) values. The relationships between log BB and Δ'log k(w)(IAM) practically overlapped the previously found log BB/Δlog k(w)(IAM) relationships for bases. The excess of polar interaction component between acidic drugs and phospholipids, mainly electrostatic forces, although enhancing partition in phospholipids, hinders membrane

  19. Amino acid discrimination by the nuclear encoded mitochondrial arginyl-tRNA synthetase of the larva of a bruchid beetle (Caryedes brasiliensis) from northwestern Costa Rica.


    Leisinger, Anne-Katrin; Janzen, Daniel H; Hallwachs, Winnie; Igloi, Gabor L


    L-canavanine, the toxic guanidinooxy analogue of L-arginine, is the product of plant secondary metabolism. The need for a detoxifying mechanism for the producer plant is self-evident but the larvae of the bruchid beetle Caryedes brasiliensis, that is itself a non-producer, have specialized in feeding on the Lcanavanine-containing seeds of Dioclea megacarpa. The evolution of a seed predator that can imitate the enzymatic abilities of the host permits us to address the question of whether the same problem of amino acid recognition in two different kingdoms has been solved by the same mechanism. A discriminating arginyl-tRNA synthetase, detected in a crude C. brasiliensis larval extract, was proposed to be responsible for insect's ability to survive the diet of L-canavanine (Rosenthal, G. A., Dahlman, D. L., and Janzen, D. H. (1976) A novel means for dealing with L-canavanine, a toxic metabolite. Science 192, 256e258). Since the arginyl-tRNA synthetase of at least three genetic compartments (insect cytoplasmic, insect mitochondrial and insect gut microflora) may participate in conferring L-canavanine resistance, we investigated whether the nuclear-encoded C. brasiliensis mitochondrial arginyl-tRNA synthetase plays a role in this discrimination. Steady state kinetics of the cloned, recombinant enzyme have revealed and quantified an amino acid discriminating potential of the mitochondrial enzyme that is sufficient to account for the overall L-canavanine misincorporation rate observed in vivo. As in the cytoplasmic enzyme of the L-canavanine producer plant, the mitochondrial arginyl-tRNA synthetases from a specialist seed predator relies on a kinetic discrimination that prevents L-canavanine misincorporation into proteins. PMID:24446543

  20. ScChi, Encoding an Acidic Class III Chitinase of Sugarcane, Confers Positive Responses to Biotic and Abiotic Stresses in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Fu, Zhiwei; Yang, Yuting; Guo, Jinlong; Wang, Shanshan; Que, Youxiong


    Chitinases (EC, expressed during the plant-pathogen interaction, are associated with plant defense against pathogens. In the present study, a positive correlation between chitinase activity and sugarcane smut resistance was found. ScChi (GenBank accession no. KF664180), a Class III chitinase gene, encoded a 31.37 kDa polypeptide, was cloned and identified. Subcellular localization revealed ScChi targeting to the nucleus, cytoplasm and the plasma membrane. Real-time quantitative PCR (RT-qPCR) results showed that ScChi was highly expressed in leaf and stem epidermal tissues. The ScChi transcript was both higher and maintained longer in the resistance cultivar during challenge with Sporisorium scitamineum. The ScChi also showed an obvious induction of transcription after treatment with SA (salicylic acid), H2O2, MeJA (methyl jasmonate), ABA (abscisic acid), NaCl, CuCl2, PEG (polyethylene glycol) and low temperature (4 °C). The expression levels of ScChi and six immunity associated marker genes were upregulated by the transient overexpression of ScChi. Besides, histochemical assay of Nicotiana benthamiana leaves overexpressing pCAMBIA 1301-ScChi exhibited deep DAB (3,3′-diaminobenzidinesolution) staining color and high conductivity, indicating the high level of H2O2 accumulation. These results suggest a close relationship between the expression of ScChi and plant immunity. In conclusion, the positive responses of ScChi to the biotic and abiotic stimuli reveal that this gene is a stress-related gene of sugarcane. PMID:24552874

  1. FcLDP1, a Gene Encoding a Late Embryogenesis Abundant (LEA) Domain Protein, Responds to Brassinosteroids and Abscisic Acid during the Development of Fruits in Fragaria chiloensis.


    Espinoza, Analía; Contreras, Rodrigo; Zúñiga, Gustavo E; Herrera, Raúl; Moya-León, María Alejandra; Norambuena, Lorena; Handford, Michael


    White Chilean strawberries (Fragaria chiloensis) are non-climacteric fruits, with an exotic color and aroma. In order to discover genes involved in the development of these fruits, we identified a fragment of a gene encoding a late embryogenesis abundant domain protein, FcLDP1, that was expressed in early stages of fruit development, particularly in receptacles. Hormones play key roles in regulating the development of non-climacteric fruits. We show that the brassinosteroid content of the white strawberry varies during development. Additionally, FcLDP1 as well as the closest ortholog in the woodland strawberry, F. vesca (FvLDP1) possess multiple brassinosteroid, as well as abscisic acid (ABA) response motifs in the promoter region, consistent with the response of transiently expressed FcLDP1 promoter-GFP fusions to these hormones, and the rise in FcLDP1 transcript levels in white strawberry fruits treated with brassinosteroids or ABA. These findings suggest that both hormones regulate FcLDP1 expression during the development of white strawberries.

  2. FcLDP1, a Gene Encoding a Late Embryogenesis Abundant (LEA) Domain Protein, Responds to Brassinosteroids and Abscisic Acid during the Development of Fruits in Fragaria chiloensis.


    Espinoza, Analía; Contreras, Rodrigo; Zúñiga, Gustavo E; Herrera, Raúl; Moya-León, María Alejandra; Norambuena, Lorena; Handford, Michael


    White Chilean strawberries (Fragaria chiloensis) are non-climacteric fruits, with an exotic color and aroma. In order to discover genes involved in the development of these fruits, we identified a fragment of a gene encoding a late embryogenesis abundant domain protein, FcLDP1, that was expressed in early stages of fruit development, particularly in receptacles. Hormones play key roles in regulating the development of non-climacteric fruits. We show that the brassinosteroid content of the white strawberry varies during development. Additionally, FcLDP1 as well as the closest ortholog in the woodland strawberry, F. vesca (FvLDP1) possess multiple brassinosteroid, as well as abscisic acid (ABA) response motifs in the promoter region, consistent with the response of transiently expressed FcLDP1 promoter-GFP fusions to these hormones, and the rise in FcLDP1 transcript levels in white strawberry fruits treated with brassinosteroids or ABA. These findings suggest that both hormones regulate FcLDP1 expression during the development of white strawberries. PMID:27379111

  3. FcLDP1, a Gene Encoding a Late Embryogenesis Abundant (LEA) Domain Protein, Responds to Brassinosteroids and Abscisic Acid during the Development of Fruits in Fragaria chiloensis

    PubMed Central

    Espinoza, Analía; Contreras, Rodrigo; Zúñiga, Gustavo E.; Herrera, Raúl; Moya-León, María Alejandra; Norambuena, Lorena; Handford, Michael


    White Chilean strawberries (Fragaria chiloensis) are non-climacteric fruits, with an exotic color and aroma. In order to discover genes involved in the development of these fruits, we identified a fragment of a gene encoding a late embryogenesis abundant domain protein, FcLDP1, that was expressed in early stages of fruit development, particularly in receptacles. Hormones play key roles in regulating the development of non-climacteric fruits. We show that the brassinosteroid content of the white strawberry varies during development. Additionally, FcLDP1 as well as the closest ortholog in the woodland strawberry, F. vesca (FvLDP1) possess multiple brassinosteroid, as well as abscisic acid (ABA) response motifs in the promoter region, consistent with the response of transiently expressed FcLDP1 promoter-GFP fusions to these hormones, and the rise in FcLDP1 transcript levels in white strawberry fruits treated with brassinosteroids or ABA. These findings suggest that both hormones regulate FcLDP1 expression during the development of white strawberries. PMID:27379111

  4. Deletion of a gene encoding an amino acid transporter in the midgut membrane causes resistance to a Bombyx parvo-like virus.


    Ito, Katsuhiko; Kidokoro, Kurako; Sezutsu, Hideki; Nohata, Junko; Yamamoto, Kimiko; Kobayashi, Isao; Uchino, Keiro; Kalyebi, Andrew; Eguchi, Ryokitsu; Hara, Wajiro; Tamura, Toshiki; Katsuma, Susumu; Shimada, Toru; Mita, Kazuei; Kadono-Okuda, Keiko


    Bombyx mori densovirus type 2 (BmDNV-2), a parvo-like virus, replicates only in midgut columnar cells and causes fatal disease. The resistance expressed in some silkworm strains against the virus is determined by a single gene, nsd-2, which is characterized as nonsusceptibility irrespective of the viral dose. However, the responsible gene has been unknown. We isolated the nsd-2 gene by positional cloning. The virus resistance is caused by a 6-kb deletion in the ORF of a gene encoding a 12-pass transmembrane protein, a member of an amino acid transporter family, and expressed only in midgut. Germ-line transformation with a wild-type transgene expressed in the midgut restores susceptibility, showing that the defective membrane protein is responsible for resistance. Cumulatively, our data show that the membrane protein is a functional receptor for BmDNV-2. This is a previously undescribed report of positional cloning of a mutant gene in Bombyx and isolation of an absolute virus resistance gene in insects. PMID:18495929

  5. PNA-encoded chemical libraries.


    Zambaldo, Claudio; Barluenga, Sofia; Winssinger, Nicolas


    Peptide nucleic acid (PNA)-encoded chemical libraries along with DNA-encoded libraries have provided a powerful new paradigm for library synthesis and ligand discovery. PNA-encoding stands out for its compatibility with standard solid phase synthesis and the technology has been used to prepare libraries of peptides, heterocycles and glycoconjugates. Different screening formats have now been reported including selection-based and microarray-based methods that have yielded specific ligands against diverse target classes including membrane receptors, lectins and challenging targets such as Hsp70.

  6. Pectobacterium atrosepticum and Pectobacterium carotovorum Harbor Distinct, Independently Acquired Integrative and Conjugative Elements Encoding Coronafacic Acid that Enhance Virulence on Potato Stems

    PubMed Central

    Panda, Preetinanda; Vanga, Bhanupratap R.; Lu, Ashley; Fiers, Mark; Fineran, Peter C.; Butler, Ruth; Armstrong, Karen; Ronson, Clive W.; Pitman, Andrew R.


    Integrative and conjugative elements (ICEs) play a central role in the evolution of bacterial virulence, their transmission between bacteria often leading to the acquisition of virulence factors that alter host range or aggressiveness. Much is known about the functions of the virulence determinants that ICEs harbor, but little is understood about the cryptic effects of ICEs on their host cell. In this study, the importance of horizontally acquired island 2 (HAI2), an ICE in the genome of Pectobacterium atrosepticum SCRI1043, was studied using a strain in which the entire ICE had been removed by CRISPR-Cas-mediated genome editing. HAI2 encodes coronafacic acid, a virulence factor that enhances blackleg disease of potato stems caused by P. atrosepticum SCRI1043. As expected, deletion of HAI2 resulted in reduced blackleg symptoms in potato stems. A subsequent screen for HAI2-related ICEs in other strains of the Pectobacterium genus revealed their ubiquitous nature in P. atrosepticum. Yet, HAI2-related ICEs were only detected in the genomes of a few P. carotovorum strains. These strains were notable as blackleg causing strains belonging to two different subspecies of P. carotovorum. Sequence analysis of the ICEs in different strains of both P. atrosepticum and P. carotovorum confirmed that they were diverse and were present in different locations on the genomes of their bacterial host, suggesting that the cfa cluster was probably acquired independently on a number of occasions via chromosomal insertion of related ICEs. Excision assays also demonstrated that the ICEs in both P. atrosepticum and P. carotovorum are mobilized from the host chromosome. Thus, the future spread of these ICEs via lateral gene transfer might contribute to an increase in the prevalence of blackleg-causing strains of P. carotovorum. PMID:27065965

  7. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.


    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov


    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum.

  8. DNA-binding properties of gene-5 protein encoded by bacteriophage M13. 2. Further characterization of the different binding modes for poly- and oligodeoxynucleic acids.


    Bulsink, H; Harmsen, B J; Hilbers, C W


    The binding of gene-5 protein, encoded by bacteriophage M13, to oligodeoxynucleic acids was studied by means of fluorescence binding experiments, fluorescence depolarization measurements and irreversible dissociation kinetics of the protein.nucleotide complexes with salt. The binding properties thus obtained are compared with those of the binding to polynucleotides, especially at very low salt concentration. It appears that the binding to oligonucleotides is always characterized by a stoichiometry (n) of 2-3 nucleotides/protein, and the absence of cooperativity. In contrast the protein can bind to polynucleotides in two different modes, one with a stoichiometry of n = 3 in the absence of salt and another with n = 4 at moderate salt concentrations. Both modes have a high intramode cooperativity (omega about 500) but are non-interacting and mutually exclusive. For deoxynucleic acids with a chain length of 25-30 residues a transition from oligonucleotide to polynucleotide binding is observed at increasing nucleotide/protein ratio in the solution. The n = 3 polynucleotide binding is very sensitive to the ionic strength and is only detectable at very low salt concentrations. The ionic strength dependency per nucleotide of the n = 4 binding is much less and is comparable with the salt dependency of the oligonucleotide binding. Furthermore it appears that the influence of the salt concentration on the oligonucleotide binding constant is to about the same degree determined by the effect of salt on the association and dissociation rate constants. Model calculations indicate that the fluorescence depolarization titration curves can only be explained by a model for oligonucleotide binding in which a protein dimer binds with its two dimer halves to the same strand. In addition it is only possible to explain the observed effect of the chain length of the oligonucleotide on both the apparent binding constant and the dissociation rate by assuming the existence of interactions

  9. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.


    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  10. Evolution of Bacillus subtilis to enhanced growth at low pressure: up-regulated transcription of des-desKR, encoding the fatty acid desaturase system.


    Fajardo-Cavazos, Patricia; Waters, Samantha M; Schuerger, Andrew C; George, Sheeja; Marois, James J; Nicholson, Wayne L


    The atmospheric pressure on Mars ranges from 1-10 mbar, about 1% of Earth pressure (∼1013 mbar). Low pressure is a growth-inhibitory factor for terrestrial microorganisms on Mars, and a putative low-pressure barrier for growth of Earth bacteria of ∼25 mbar has been postulated. In a previous communication, we described the isolation of a strain of Bacillus subtilis that had evolved enhanced growth ability at the near-inhibitory low pressure of 50 mbar. To explore mechanisms that enabled growth of the low-pressure-adapted strain, numerous genes differentially transcribed between the ancestor strain WN624 and low-pressure-evolved strain WN1106 at 50 mbar were identified by microarray analysis. Among these was a cluster of three candidate genes (des, desK, and desR), whose mRNA levels in WN1106 were higher than the ancestor on the microarrays. Up-regulation of these genes was confirmed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. The des, desK, and desR genes encode the Des membrane fatty acid (FA) desaturase, the DesK sensor kinase, and the DesR response regulator, respectively, which function to maintain membrane fluidity in acute response to temperature downshift. Pressure downshift caused an up-regulation of des mRNA levels only in WN1106, but expression of a des-lacZ transcriptional fusion was unaffected, which suggests that des regulation was different in response to temperature versus pressure downshift. Competition experiments showed that inactivation of the des gene caused a slight, but statistically significant, loss of fitness of strain WN1106 at 50 mbar. Further, analysis of membrane FA composition of cells grown at 1013 versus 50 mbar revealed a decrease in the ratio of unsaturated to saturated FAs but an increase in the ratio of anteiso- to iso-FAs. The present study represents a first step toward identification of molecular mechanisms by which B. subtilis could sense and respond to the novel environmental stress

  11. Conjugated linoleic acid-enriched butter improved memory and up-regulated phospholipase A2 encoding-genes in rat brain tissue.


    Gama, Marco A S; Raposo, Nádia R B; Mury, Fábio B; Lopes, Fernando C F; Dias-Neto, Emmanuel; Talib, Leda L; Gattaz, Wagner F


    Reduced phospholipase A2 (PLA2) activity has been reported in blood cells and in postmortem brains of patients with Alzheimer disease (AD), and there is evidence that conjugated linoleic acid (CLA) modulates the activity of PLA2 groups in non-brain tissues. As CLA isomers were shown to be actively incorporated and metabolized in the brains of rats, we hypothesized that feeding a diet naturally enriched in CLA would affect the activity and expression of Pla 2 -encoding genes in rat brain tissue, with possible implications for memory. To test this hypothesis, Wistar rats were trained for the inhibitory avoidance task and fed a commercial diet (control) or experimental diets containing either low CLA- or CLA-enriched butter for 4 weeks. After this period, the rats were tested for memory retrieval and killed for tissue collection. Hippocampal expression of 19 Pla 2 genes was evaluated by qPCR, and activities of PLA2 groups (cPLA2, iPLA2, and sPLA2) were determined by radioenzymatic assay. Rats fed the high CLA diet had increased hippocampal mRNA levels for specific PLA2 isoforms (iPla 2 g6γ; cPla 2 g4a, sPla 2 g3, sPla 2 g1b, and sPla 2 g12a) and higher enzymatic activity of all PLA2 groups as compared to those fed the control and the low CLA diet. The increment in PLA2 activities correlated significantly with memory enhancement, as assessed by increased latency in the step-down inhibitory avoidance task after 4 weeks of treatment (rs = 0.69 for iPLA2, P < 0.001; rs = 0.81 for cPLA2, P < 0.001; and rs = 0.69 for sPLA2, P < 0.001). In face of the previous reports showing reduced PLA2 activity in AD brains, the present findings suggest that dairy products enriched in cis-9, trans-11 CLA may be useful in the treatment of this disease. PMID:25913570

  12. Down-regulation of messenger ribonucleic acid encoding an importer of sulfoconjugated steroids during human chorionic gonadotropin-induced follicular luteinization in vivo.


    Brown, Kristy A; Bouchard, Nadine; Lussier, Jacques G; Sirois, Jean


    Members of the organic anion transporting polypeptide (SLCO/OATP) superfamily are capable of importing anionic compounds across the lipid bilayer in a sodium-independent manner. Member 2B1 has been shown to transport few substrates, two of which are dihydroepiandrosterone-3-sulfate (DHEA-S) and estrone-3-sulfate. Steroid sulfatase (STS) catalyses the hydrolysis of these steroids into their unconjugated counterparts. The objective of this study was to investigate the regulation of SLCO2B1 and STS mRNAs during human chorionic gonadotropin (hCG)-induced ovulation/luteinization. The equine SLCO2B1 cDNA was cloned and shown to encode a 709-amino acid protein (OATP2B1) that is highly conserved when compared to mammalian orthologs. RT-PCR/Southern blot analyses were performed to study the regulation of SLCO2B1 and STS transcripts in equine preovulatory follicles isolated between 0 and 39h after hCG treatment. Results showed high levels of SLCO2B1 mRNA expression before hCG, with a marked decrease observed in follicles obtained 24-39h post-hCG (P<0.05). Analyses of isolated granulosa and theca interna cells identified high mRNA expression in both cell types prior to hCG treatment, with granulosa cells showing a more rapid SLCO2B1 mRNA down-regulation. No significant change in STS mRNA was observed in intact follicle walls. However, when both cell types were isolated, a significant decrease in STS mRNA was observed in granulosa cells 24-39h post-hCG. Collectively, these results demonstrate that the hCG-dependent induction of follicular luteinization is accompanied by the down-regulation of SLCO2B1 and STS transcripts. Considering that OATP2B1 can import sulfoconjugated DHEA and estrogens, and that STS can remove the sulfonate moiety from these steroids, their down-regulation in luteinizing preovulatory follicles may provide an additional biochemical basis for the decrease in ovarian 17beta-estradiol biosynthesis after the LH surge.

  13. Conjugated linoleic acid-enriched butter improved memory and up-regulated phospholipase A2 encoding-genes in rat brain tissue.


    Gama, Marco A S; Raposo, Nádia R B; Mury, Fábio B; Lopes, Fernando C F; Dias-Neto, Emmanuel; Talib, Leda L; Gattaz, Wagner F


    Reduced phospholipase A2 (PLA2) activity has been reported in blood cells and in postmortem brains of patients with Alzheimer disease (AD), and there is evidence that conjugated linoleic acid (CLA) modulates the activity of PLA2 groups in non-brain tissues. As CLA isomers were shown to be actively incorporated and metabolized in the brains of rats, we hypothesized that feeding a diet naturally enriched in CLA would affect the activity and expression of Pla 2 -encoding genes in rat brain tissue, with possible implications for memory. To test this hypothesis, Wistar rats were trained for the inhibitory avoidance task and fed a commercial diet (control) or experimental diets containing either low CLA- or CLA-enriched butter for 4 weeks. After this period, the rats were tested for memory retrieval and killed for tissue collection. Hippocampal expression of 19 Pla 2 genes was evaluated by qPCR, and activities of PLA2 groups (cPLA2, iPLA2, and sPLA2) were determined by radioenzymatic assay. Rats fed the high CLA diet had increased hippocampal mRNA levels for specific PLA2 isoforms (iPla 2 g6γ; cPla 2 g4a, sPla 2 g3, sPla 2 g1b, and sPla 2 g12a) and higher enzymatic activity of all PLA2 groups as compared to those fed the control and the low CLA diet. The increment in PLA2 activities correlated significantly with memory enhancement, as assessed by increased latency in the step-down inhibitory avoidance task after 4 weeks of treatment (rs = 0.69 for iPLA2, P < 0.001; rs = 0.81 for cPLA2, P < 0.001; and rs = 0.69 for sPLA2, P < 0.001). In face of the previous reports showing reduced PLA2 activity in AD brains, the present findings suggest that dairy products enriched in cis-9, trans-11 CLA may be useful in the treatment of this disease.

  14. The SPI1 gene, encoding a glycosylphosphatidylinositol-anchored cell wall protein, plays a prominent role in the development of yeast resistance to lipophilic weak-acid food preservatives.


    Simões, T; Mira, N P; Fernandes, A R; Sá-Correia, Isabel


    The Saccharomyces cerevisiae SPI1 gene encodes a member of the glycosylphosphatidylinositol-anchored cell wall protein family. In this work we show results indicating that SPI1 expression protects the yeast cell from damage caused by weak acids used as food preservatives. This is documented by a less extended period of adaptation to growth in their presence and by a less inhibited specific growth rate for a parental strain compared with a mutant with SPI1 deleted. Maximal protection exerted by Spi1p against equivalent concentrations of the various weak acids tested was registered for the more lipophilic acids (octanoic acid, followed by benzoic acid) and was minimal for acetic acid. Weak-acid adaptation was found to involve the rapid activation of SPI1 transcription, which is dependent on the presence of the Msn2p transcription factor. Activation of SPI1 transcription upon acetic acid stress also requires Haa1p, whereas this recently described transcription factor has a negligible role in the adaptive response to benzoic acid. The expression of SPI1 was found to play a prominent role in the development of yeast resistance to 1,3-beta-glucanase in benzoic acid-stressed cells, while its involvement in acetic acid-induced resistance to the cell wall-lytic enzyme is slighter. The results are consistent with the notion that Spi1p expression upon weak-acid stress leads to cell wall remodeling, especially for the more lipophilic acids, decreasing cell wall porosity. Decreased cell wall porosity, in turn, reduces access to the plasma membrane, reducing membrane damage, intracellular acidification, and viability loss.

  15. Molecular mechanisms for protein-encoded inheritance

    SciTech Connect

    Wiltzius, Jed J.W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David


    In prion inheritance and transmission, strains are phenotypic variants encoded by protein 'conformations'. However, it is unclear how a protein conformation can be stable enough to endure transmission between cells or organisms. Here we describe new polymorphic crystal structures of segments of prion and other amyloid proteins, which offer two structural mechanisms for the encoding of prion strains. In packing polymorphism, prion strains are encoded by alternative packing arrangements (polymorphs) of {beta}-sheets formed by the same segment of a protein; in segmental polymorphism, prion strains are encoded by distinct {beta}-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring conformations capable of encoding strains. These molecular mechanisms for transfer of protein-encoded information into prion strains share features with the familiar mechanism for transfer of nucleic acid-encoded information into microbial strains, including sequence specificity and recognition by noncovalent bonds.

  16. Effect of alpha lipoic acid on the blood cell count and iron kinetics in hypertensive patients.


    Mendes, Paula Renata Florêncio; Félix, Danielle dos Santos; Silva, Paulo César Dantas da; Pereira, Guêdijany Henrique; Simões, Mônica Oliveira da Silva


    Introducción: El Ácido -Lipóico (ALA) ha sido utilizado como recurso terapéutico para reducir daño oxidativo en la Hipertensión Arterial Sistémica (HAS), pero aún no existen estudios in vivo que reporten sobre su mecanismo de acción en el metabolismo del hierro. Objetivo: Evaluar el efecto antioxidante del ácido Alfa- Lipóico sobre el hemograma y metabolismo del hierro en individuos hipertensos con o sin anemia. Métodos: Estudio clínico doble-ciego, randomizado y controlado con placebo. La muestra fue constituida por 60 individuos hipertensos, distribuidos aleatoriamente en grupo tratamiento (n = 32), que recibió 600 mg/día del ALA por doce semanas y grupo control (n = 28), que recibió el placebo por el mismo período. Fueron analizados antes y después de la intervención, los parámetros del hemograma, Hierro Sérico, Ferritina, Capacidad Latente de Enlace del hierro, Capacidad Total de Enlace del Hierro, Índice de Saturación de la Transferrina (ISI) y Transferrina. Para evaluar las alteraciones entre los grupos, se utilizó el teste t de Student y el análisis de varianza ANOVA, adoptándose el nivel de significación de 5%. Resultados: Después de la intervención, el suplemento con el ALA demostró una asociación estadísticamente significativa (p < 0,05) con la reducción de los leucocitos totales, aumento del número de neutrófilos y reducciones en los niveles de Hierro Sérico e ISI. Conclusión: La administración oral del ALA como un adyuvante terapéutico, altera la respuesta hematológica del leucograma y reduce la absorción del hierro. Cabe senãlar que el mecanismo de quelación de metales por el ácido lipoico puede ser responsable de estos cambios y, en consecuencia, podría desencadenar una condicion de anemia ferropénica en individuos hipertensos.

  17. [Alpha lipoic acid and its antioxidant against cancer and diseases of central sensitization].


    Durand, Marisa; Mach, Núria


    Introducción: El ácido alfa lipoico (ALA) puede controlar y limitar la cantidad de radicales libres, influyendo el desarrollo de patologías como el cáncer o las enfermedades de sensibilización central, aunque los mecanismos moleculares implicados en este proceso aún están dilucidándose. Objetivo: Reunir y contrastar información sobre las propiedades antioxidantes del ALA en la prevención y desarrollo de las patologías relacionadas con el estrés oxidativo. Material y métodos: En este trabajo, se analizan más de 100 artículos publicados en los últimos 20 años que relacionan el consumo de ALA y la prevalencia y desarrollo de patologías relacionadas con el estrés oxidativo. Los artículos han sido obtenidos en diferentes bases de datos (PubMed central, Web of Science, Elsevier Journal, Science Direct), e incluyen experimentos en células, animales y humanos. Las palabras clave utilizadas fueron: cáncer, enfermedades de sensibilización central, radicales libres, y ALA. Resultados y discusión: Se han reunido resultados de trabajos realizados in vitro y en animales de laboratorio en los que se pone de manifiesto el efecto del ALA en el control de la apoptosis celular de diferentes tipos de cánceres mediante un aumento de las especies reactivas de oxígeno, así como también el retardo en el crecimiento de las mismas. Aparte, se ha demostrado que la capacidad antioxidante del ALA y su potencial para regenerar otros antioxidantes es de gran importancia para tratar las patologías de sensibilización central. Conclusiones: El ALA ha demostrado un papel significativo como antioxidante y prooxidante en el cáncer y las patologías de sensibilización central, aunque son necesarias más investigaciones en humanos.

  18. Alpha-lipoic acid protects mitochondrial enzymes and attenuates lipopolysaccharide-induced hypothermia in mice

    EPA Science Inventory

    Abstract: Hypothermia is a key symptom of sepsis and the mechanism(s) leading to hypothermia during sepsis is largely unknown. To investigate a potential mechanism and find an effective treatment for hypothermia in sepsis, we induced hypothermia in mice by lipopolysaccharide (LP...

  19. Cellobiohydrolase variants and polynucleotides encoding same

    SciTech Connect

    Wogulis, Mark


    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  20. Cellobiohydrolase variants and polynucleotides encoding the same

    SciTech Connect

    Wogulis, Mark


    The present invention relates to variants of a parent cellobiohydrolase. The present invention also relates to polynucleotides encoding the cellobiohydrolase variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the cellobiohydrolase variants.

  1. Cellobiohydrolase variants and polynucleotides encoding same


    Wogulis, Mark


    The present invention relates to variants of a parent cellobiohydrolase II. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

  2. Crown gall oncogenesis: evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid.

    PubMed Central

    Thomashow, L S; Reeves, S; Thomashow, M F


    Stable incorporation of tumor-inducing (Ti) plasmid sequences, the T-DNA, into the genomes of dicotyledonous plants results in the formation of crown gall tumors. Previous genetic studies have suggested that the products of the genes encoding transcripts 1 and 2, which are encoded by the TL-DNA region of pTiA6, are responsible for inducing the auxin-independent phenotype of crown gall tissues. Here we report the construction of a plasmid, pMTlacT2, which directs the synthesis of the Mr 49,800 polypeptide encoded by the transcript 2 gene. Cell-free extracts prepared from Escherichia coli harboring this plasmid converted indoleacetamide to indoleacetic acid, the natural auxin of plants; extracts prepared from plasmidless strains of E. coli or strains harboring the cloning vehicle pBR322 did not carry out this reaction. We conclude that the transcript 2 gene of pTiA6 codes for an enzyme that participates in auxin biosynthesis, probably an indoleacetamide hydrolase. Images PMID:6089175

  3. The structures of four bombesins and their cloned precursor-encoding cDNAs from acid-solvated skin secretion of the European yellow-bellied toad, Bombina variegata.


    Bai, Bing; Wang, Hui; Xue, Yilu; Wu, Youjia; Zhou, Mei; Wei, Minjie; Chen, Tianbao; Wang, Lei; Shaw, Chris


    Four different bombesins (bombesin, His(6)-bombesin, Phe(13)-bombesin and Asp(2)-, Phe(4)-SAP-bombesin) have been identified by a systematic sequencing study of peptides in reverse phase HPLC fractions of the skin secretion of the European yellow-bellied toad, Bombina variegata, that had been solvated in 0.1% (v/v) aqueous trifluoroacetic acid (TFA) and stored frozen at -20°C for 12 years. By using a 3'- and 5'-RACE PCR strategy, the corresponding biosynthetic precursor-encoding cDNAs of all four peptides were cloned from a cDNA library made from the same long-term frozen, acid-solvated skin secretion sample following thawing and lyophilization. Canonical bombesin and His(6)-bombesin are classical bombesin sub-family members, whereas Phe(13)-bombesin and Asp(2)-, Phe(4)-SAP-bombesin, belong to the litorin/ranatensin sub-family of bombesin-like peptides (BLPs). Assignment of these peptides to respective sub-families, was based upon both their primary structural similarities and their comparative pharmacological activities. An interesting observation in this study, was that the nucleotide sequences of the open-reading frames of cloned cDNAs encoding bombesin and its His(6)-substituted analog, were identical except for a single base that was responsible for the change observed at the position 6 residue in the mature peptide from Asn to His. In contrast, the precursor cDNA nucleotide sequences encoding the Phe(13)-bombesins, exhibited 53 base differences. The pharmacological activities of synthetic replicates of each bombesin were compared using two different mammalian smooth muscle preparations and all four peptides were found to be active. However, there were significant differences in their relative potencies. PMID:22687368

  4. [The effect of 3-oxypyridine and succinic acid derivatives on obsessive-compulsive activity of mice in marble-burying test].


    Volchegorskiĭ, I A; Miroshnichenko, I Iu; Rassokhina, L M; Faĭzullin, R M; Priakhina, K E


    The effect of domestic derivatives of 3-oxypyridine and succinic acid (emoxipine, reamberin, and mexidol) on obsessive-compulsive behavior of mice was studied in the marble-burying test. Additionally the effect of these drugs on the behavior of animals was assessed in the open field test. Amitriptylin and alpha-lipoic acid were used as reference drugs. It was established that single administration of the investigated drugs in optimal doses, corresponding to therapeutic range in humans, inhibits obsessive-compulsive behavior of mice in the marble-burying test. Amitriptylin and alpha-lipoic acid produced similar effects. It is established that emoxipine stimulates the behavior of mice in the open field after single administration. An increase in the emoxipine dose led to decrease of stimulation and gradual development of sedative effect. Reamberin and mexidol, as well as alpha-lipoic acid and amitriptyline, caused sedation in mice tested in the open field. Inhibiting effect of emoxipine, reamberin, mexidol and alpha-lipoic acid on the obsessive-compulsive behavior in mice directly depended on sedative action of these drugs.

  5. ENCODE data at the ENCODE portal.


    Sloan, Cricket A; Chan, Esther T; Davidson, Jean M; Malladi, Venkat S; Strattan, J Seth; Hitz, Benjamin C; Gabdank, Idan; Narayanan, Aditi K; Ho, Marcus; Lee, Brian T; Rowe, Laurence D; Dreszer, Timothy R; Roe, Greg; Podduturi, Nikhil R; Tanaka, Forrest; Hong, Eurie L; Cherry, J Michael


    The Encyclopedia of DNA Elements (ENCODE) Project is in its third phase of creating a comprehensive catalog of functional elements in the human genome. This phase of the project includes an expansion of assays that measure diverse RNA populations, identify proteins that interact with RNA and DNA, probe regions of DNA hypersensitivity, and measure levels of DNA methylation in a wide range of cell and tissue types to identify putative regulatory elements. To date, results for almost 5000 experiments have been released for use by the scientific community. These data are available for searching, visualization and download at the new ENCODE Portal ( The revamped ENCODE Portal provides new ways to browse and search the ENCODE data based on the metadata that describe the assays as well as summaries of the assays that focus on data provenance. In addition, it is a flexible platform that allows integration of genomic data from multiple projects. The portal experience was designed to improve access to ENCODE data by relying on metadata that allow reusability and reproducibility of the experiments.

  6. Characterization of 19 Genes Encoding Membrane-Bound Fatty Acid Desaturases and their Expression Profiles in Gossypium raimondii Under Low Temperature.


    Liu, Wei; Li, Wei; He, Qiuling; Daud, Muhammad Khan; Chen, Jinhong; Zhu, Shuijin


    To produce unsaturated fatty acids, membrane-bound fatty acid desaturases (FADs) can be exploited to introduce double bonds into the acyl chains of fatty acids. In this study, 19 membrane-bound FAD genes were identified in Gossypium raimondii through database searches and were classified into four different subfamilies based on phylogenetic analysis. All 19 membrane-bound FAD proteins shared three highly conserved histidine boxes, except for GrFAD2.1, which lost the third histidine box in the C-terminal region. In the G. raimondii genome, tandem duplication might have led to the increasing size of the FAD2 cluster in the Omega Desaturase subfamily, whereas segmental duplication appeared to be the dominant mechanism for the expansion of the Sphingolipid and Front-end Desaturase subfamilies. Gene expression analysis showed that seven membrane-bound FAD genes were significantly up-regulated and that five genes were greatly suppressed in G. raimondii leaves exposed to low temperature conditions.

  7. Characterization of 19 Genes Encoding Membrane-Bound Fatty Acid Desaturases and their Expression Profiles in Gossypium raimondii Under Low Temperature

    PubMed Central

    He, Qiuling; Daud, Muhammad Khan; Chen, Jinhong; Zhu, Shuijin


    To produce unsaturated fatty acids, membrane-bound fatty acid desaturases (FADs) can be exploited to introduce double bonds into the acyl chains of fatty acids. In this study, 19 membrane-bound FAD genes were identified in Gossypium raimondii through database searches and were classified into four different subfamilies based on phylogenetic analysis. All 19 membrane-bound FAD proteins shared three highly conserved histidine boxes, except for GrFAD2.1, which lost the third histidine box in the C-terminal region. In the G. raimondii genome, tandem duplication might have led to the increasing size of the FAD2 cluster in the Omega Desaturase subfamily, whereas segmental duplication appeared to be the dominant mechanism for the expansion of the Sphingolipid and Front-end Desaturase subfamilies. Gene expression analysis showed that seven membrane-bound FAD genes were significantly up-regulated and that five genes were greatly suppressed in G. raimondii leaves exposed to low temperature conditions. PMID:25894196

  8. Amino acid sequence of Coprinus macrorhizus peroxidase and cDNA sequence encoding Coprinus cinereus peroxidase. A new family of fungal peroxidases.


    Baunsgaard, L; Dalbøge, H; Houen, G; Rasmussen, E M; Welinder, K G


    Sequence analysis and cDNA cloning of Coprinus peroxidase (CIP) were undertaken to expand the understanding of the relationships of structure, function and molecular genetics of the secretory heme peroxidases from fungi and plants. Amino acid sequencing of Coprinus macrorhizus peroxidase, and cDNA sequencing of Coprinus cinereus peroxidase showed that the mature proteins are identical in amino acid sequence, 343 residues in size and preceded by a 20-residue signal peptide. Their likely identity to peroxidase from Arthromyces ramosus is discussed. CIP has an 8-residue, glycine-rich N-terminal extension blocked with a pyroglutamate residue which is absent in other fungal peroxidases. The presence of pyroglutamate, formed by cyclization of glutamine, and the finding of a minor fraction of a variant form lacking the N-terminal residue, indicate that signal peptidase cleavage is followed by further enzymic processing. CIP is 40-45% identical in amino-acid sequence to 11 lignin peroxidases from four fungal species, and 42-43% identical to the two known Mn-peroxidases. Like these white-rot fungal peroxidases, CIP has an additional segment of approximately 40 residues at the C-terminus which is absent in plant peroxidases. Although CIP is much more similar to horseradish peroxidase (HRP C) in substrate specificity, specific activity and pH optimum than to white-rot fungal peroxidases, the sequences of CIP and HRP C showed only 18% identity. Hence, CIP qualifies as the first member of a new family of fungal peroxidases. The nine invariant residues present in all plant, fungal and bacterial heme peroxidases are also found in CIP. The present data support the hypothesis that only one chromosomal CIP gene exists. In contrast, a large number of secretory plant and fungal peroxidases are expressed from several peroxidase gene clusters. Analyses of three batches of CIP protein and of 49 CIP clones revealed the existence of only two highly similar alleles indicating less

  9. Conformational and functional effects induced by D- and L-amino acid epimerization on a single gene encoded peptide from the skin secretion of Hypsiboas punctatus.


    de Magalhães, Mariana T Q; Barbosa, Eder A; Prates, Maura V; Verly, Rodrigo M; Munhoz, Victor Hugo O; de Araújo, Ivan E; Bloch, Carlos


    Skin secretion of Hypsiboas punctatus is the source of a complex mixture of bioactive compounds where peptides and small proteins prevail, similarly to many other amphibians. Among dozens of molecules isolated from H. punctatus in a proteomic based approach, we report here the structural and functional studies of a novel peptide named Phenylseptin (FFFDTLKNLAGKVIGALT-NH2) that was purified as two naturally occurring D- and L-Phes configurations. The amino acid epimerization and C-terminal amidation for both molecules were confirmed by a combination of techniques including reverse-phase UFLC, ion mobility mass spectrometry, high resolution MS/MS experiments, Edman degradation, cDNA sequencing and solid-phase peptide synthesis. RMSD analysis of the twenty lowest-energy (1)H NMR structures of each peptide revealed a major 90° difference between the two backbones at the first four N-terminal residues and substantial orientation changes of their respective side chains. These structural divergences were considered to be the primary cause of the in vitro quantitative differences in antimicrobial activities between the two molecules. Finally, both molecules elicited equally aversive reactions in mice when delivered orally, an effect that depended entirely on peripheral gustatory pathways. PMID:23565145

  10. A novel abscisic acid- and dehydration-responsive gene family from the resurrection plant Craterostigma plantagineum encodes a plastid-targeted protein with DNA-binding activity.


    Phillips, Jonathan R; Hilbricht, Tobias; Salamini, Francesco; Bartels, Dorothea


    In the desiccation-tolerant resurrection plant Craterostigma plantagineum Hochst. the chloroplasts undergo major ultrastructural changes during dehydration, which are reversible upon rehydration. Such alterations argue the need for efficient protective/stabilising mechanisms to exist. Here we describe a novel gene family that is rapidly and transiently expressed in response to both dehydration and exogenously applied abscisic acid, mostly in the chloroplast-rich palisade layer on the adaxial side of the leaf. Analysis of the putative coding region suggests that the resulting protein is plastid-targeted. This was confirmed using a chimeric green fluorescent protein (GFP) reporter construct in transgenic tobacco plants - hence the gene family is termed Plastid Targeted Protein ( CpPTP). Fluorescence microscopy also revealed that CpPTP was localised in structures similar to proplastid nucleoids in transgenic tobacco ( Nicotiana tabacum L.) BY-2 cells. The ability of CpPTP to interact with DNA was demonstrated through a DNaseI protection assay. A structure-prediction programme suggests that the mature CpPTP is composed almost entirely of a pattern of hydrophobic and hydrophilic residues that form heptad repeats, which are the hallmarks of a coiled-coil domain. Given the localisation and DNA-binding property of the protein, we propose that CpPTP plays a role during the early stages of dehydration-induced chloroplast remodelling.

  11. Isolation of a fission yeast mutant that is sensitive to valproic acid and defective in the gene encoding Ric1, a putative component of Ypt/Rab-specific GEF for Ryh1 GTPase.


    Ma, Yan; Sugiura, Reiko; Zhang, Lili; Zhou, Xin; Takeuchi, Mai; He, Yi; Kuno, Takayoshi


    Valproic acid (VPA) causes various therapeutic and biological effects, but the exact mechanisms underlying these effects, however, remain elusive. To gain insights into the molecular mechanisms of VPA action, we performed in fission yeast a genetic screen for mutants that show VPA hypersensitivity and have identified several membrane-trafficking mutants including vas1-1/vps45 and vas2-1/aps1. Here, we describe the isolation and characterization of vas3-1/ric1-v3, a mutant allele of the ric1 (+) gene encoding a fission yeast homolog of the budding yeast Ric1p, a component of Ypt/Rab-specific guanyl-nucleotide exchange factor (GEF). The Rab GTPase Ryh1 knockout (Deltaryh1) cells and Deltaric1 cells exhibited similar phenotypes. The double knockout Deltaric1Deltaryh1 cells did not display synthetic growth defects. These results are consistent with the notion that Ric1 may be a component of the GEF complex for Ryh1. Overexpression of wild-type Ryh1 and the constitutively active Ryh1Q70L only partially suppressed the phenotypes of ric1-v3 and Deltaric1 cells, and they failed to localize to the Golgi/endosomes in ric1-v3 and Deltaric1 cells. Furthermore, we isolated vps15 (+) gene, encoding a serine/threonine protein kinase, as a dosage-dependent suppressor of the temperature-sensitive phenotype of ric1-v3 mutant, but not that of Deltaric1 cells. Our results showed that the ric1-v3 mutant allele has some residual functional activity and suggest that Vps15 plays a role in the regulation of Ric1 function. In conclusion, Ric1 is a putative component of GEF for Ryh1 and might be regulated by Vps15. Further studies are needed to reveal the mechanism underlying the regulation.

  12. Concordance between isolated cleft palate in mice and alterations within a region including the gene encoding the [beta][sub 3] subunit of the type A [gamma]-aminobutyric acid receptor

    SciTech Connect

    Culiat, C.T.; Stubbs, L.; Nicholls, R.D.; Montgomery, C.S.; Russell, L.B.; Johnson, D.K. ); Rinchik, E.M. Univ. of Florida, Gainesville )


    Genetic and molecular analyses of a number of radiation-induced deletion mutations of the pink-eyed dilution (p) locus in mouse chromosome 7 have identified a specific interval on the genetic map associated with a neonatally lethal mutation that results in cleft palate. This interval, closely linked and distal to p, and bracketed by the genes encoding the [alpha][sub 5] and [beta][sub 3] subunits of the type A [gamma]-aminobutyric acid receptor (Gabra5 and Gabrb3, respectively), contains a gene(s) (cp1; cleft palate 1) necessary for normal palate development. The cp1 interval extends from the distal breakpoint of the prenatally lethal p[sup 83FBFo] deletion to the Gabrb3 locus. Among 20 p deletions tested, there was complete concordance between alterations at the Gabrb3 transcription unit and inability to complement the cleft-palate defect. These mapping data, along with previously described in vivo and in vitro teratological effects of [gamma]-aminobutyric acid or its agonists on palate development, suggest the possibility that a particular type A [gamma]-aminobutyric acid receptor that includes the [beta][sub 3] subunit may be necessary for normal palate development. The placement of the cp1 gene within a defined segment of the larger D15S12h (p)-D15S9h-1 interval in the mouse suggests that the highly homologous region of the human genome, 15q11-q13, be evaluated for a role(s) in human fetal facial development. 29 refs., 4 figs., 1 tab.

  13. Identification of functional BrFAD2-1 gene encoding microsomal delta-12 fatty acid desaturase from Brassica rapa and development of Brassica napus containing high oleic acid contents.


    Jung, Jin Hee; Kim, Hyojin; Go, Young Sam; Lee, Saet Buyl; Hur, Cheol-Goo; Kim, Hyun Uk; Suh, Mi Chung


    Microsomal delta-12 fatty acid desaturase (FAD2) functions in the first committed step of the biosynthesis of polyunsaturated fatty acids via the desaturation of oleic acid to linoleic acid. In this study, two FAD2 genes were identified through genome-wide analysis of Brassica rapa. One BrFAD2-1 gene harbors functional sequence information, but another BrFAD2-2 gene has mutations that generated a premature stop codon, rendering it nonfunctional. From a database of 120,000 B. rapa expressed sequence tags, we determined that all sequences coding for FAD2 corresponded to the BrFAD2-1 gene. The BrFAD2-1 protein was shown to share high sequence homology (71-99%) with FAD2 proteins from other plant species. An intron in the 5'-untranslated region and three histidine boxes in the protein, which are characteristic of plant FAD2 genes, have been well-conserved. BrFAD2-1 transcripts were detected in various organs of B. rapa. When a pBrFAD2-1:mRFP construct was introduced into tobacco epidermal cells, the fluorescent signal was noted in the endoplasmic reticulum. Ectopic expression of BrFAD2-1:mRFP complemented the Arabidopsis fad2-2 mutant. Finally, transgenic Korean rapeseed Tammi containing high oleic acid contents (78 mol%) was developed via the expression of the BrFAD2-1 gene in an antisense orientation. The data demonstrate that B. rapa harbors only one functional FAD2 that can be utilized for the development of the high-oleic acid Korean rapeseed cultivar Tammi, which might be useful for both human consumption and industrial applications.

  14. Miniaturised optical encoder

    NASA Astrophysics Data System (ADS)

    Carr, John; Desmulliez, Marc P. Y.; Weston, Nick; McKendrick, David; Cunningham, Graeme; McFarland, Geoff; Meredith, Wyn; McKee, Andrew; Langton, Conrad; Eddie, Iain


    Optical encoders are pervasive in many sectors of industry including metrology, motion systems, electronics, medical, scanning/ printing, scientific instruments, space research and specialist machine tools. The precision of automated manufacture and assembly has been revolutionised by the adoption of optical diffractive measurement methods. Today's optical encoders comprise discrete components: light source(s), reference and analyser gratings, and a photodiode array that utilise diffractive optic methods to achieve high resolution. However the critical alignment requirements between the optical gratings and to the photodiode array, the bulky nature of the encoder devices and subsequent packaging mean that optical encoders can be prohibitively expensive for many applications and unsuitable for others. We report here on the design, manufacture and test of a miniaturised optical encoder to be used in precision measurement systems. Microsystems manufacturing techniques facilitate the monolithic integration of the traditional encoder components onto a single compound semiconductor chip, radically reducing the size, cost and set-up time. Fabrication of the gratings at the wafer level, by standard photo-lithography, allows for the simultaneous alignment of many devices in a single process step. This development coupled with a unique photodiode configuration not only provides increased performance but also significantly improves the alignment tolerances in both manufacture and set-up. A National Research and Development Corporation type optical encoder chip has been successfully demonstrated under test conditions on both amplitude and phase scales with pitches of 20 micron, 8 micron and 4 micron, showing significantly relaxed alignment tolerances with signal-to-noise ratios greater than 60:1. Various reference mark schemes have also been investigated. Results are presented here.

  15. Gene encoding acetyl-coenzyme A carboxylase


    Roessler, P.G.; Ohlrogge, J.B.


    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives are disclosed which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides. 5 figs.

  16. Gene encoding acetyl-coenzyme A carboxylase


    Roessler, Paul G.; Ohlrogge, John B.


    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives thereof which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides.

  17. Characterization of four plasmids harboured in a Lactobacillus brevis strain encoding a novel bacteriocin, brevicin 925A, and construction of a shuttle vector for lactic acid bacteria and Escherichia coli.


    Wada, Takaomi; Noda, Masafumi; Kashiwabara, Fumi; Jeon, Hyung Joon; Shirakawa, Ayano; Yabu, Hironori; Matoba, Yasuyuki; Kumagai, Takanori; Sugiyama, Masanori


    In this study we isolated over 250 lactic acid bacteria (LAB) candidates from fruit, flowers, vegetables and a fermented food to generate an LAB library. One strain, designated 925A, isolated from kimchi (a traditional Korean fermented dish made from Chinese cabbage) produced a novel type of bacteriocin, brevicin 925A, which is effective against certain LAB, including strains of Lactobacillus, Enterococcus, Streptococcus, Bacillus and Listeria. Strain 925A, identified as Lactobacillus brevis, harboured at least four plasmids and we determined the entire nucleotide sequence of each one. The four plasmids were designated pLB925A01-04, and have molecular sizes of 1815, 3524, 8881 and 65 037 bp, respectively. We obtained bacteriocin non-producing derivatives by treatment of strain 925A with novobiocin. All of these derivatives, which were susceptible to their own antibacterial product, lost the largest plasmid, pLB925A04, suggesting that the genes for bacteriocin biosynthesis (breB and breC) and immunity (breE) are located on pLB925A04. The partial amino acid sequence of purified brevicin 925A and sequence analysis of pLB925A04 showed that breB is the structural gene for brevicin 925A. We constructed a shuttle vector (pLES003, 6134 bp) that can replicate in both Escherichia coli and LAB such as Lactobacillus plantarum, Lb. brevis, Lactobacillus helveticus, Lactobacillus hilgardii and Enterococcus hirae. To determine the function of gene breE, which displays no significant similarity to any other sequences in the blast search database, the gene was inserted into pLES003. A pLB925A04-cured derivative transformed with pLES003 carrying breE acquired immunity to brevicin 925A, suggesting that breE encodes an immunity protein.

  18. Antibody directed to a synthetic peptide encoding the NH2-terminal 16 amino acids of the adenovirus type 2 E1B-53K tumor antigen recognizes the E1B-20K tumor antigen.


    Lucher, L A; Brackmann, K H; Symington, J S; Green, M


    A peptide, H2N-Glu-Arg-Arg-Asn-Pro-Ser-Glu-Arg-Gly-Val-Pro-Ala-Gly-Phe-Ser-Gly-(Cys )COOH, containing the amino acid sequence at the NH2 terminus of the adenovirus type 2 (Ad2) E1B-coded large T antigen (E1B-53K) has been synthesized. Anti-peptide antibody was generated in rabbits and used to immunoprecipitate Ad T antigens from Ad2 early infected cell extracts. In addition to the expected E1B-53K T antigen, anti-peptide antibody precipitated the Ad2 E1B-20K T antigen that was previously shown to be related to E1B-53K (M. Green, K.H. Brackmann, M.A. Cartas, and T. Matsuo, J. Virol. 42, 30-41, 1982). Anti-peptide prepared against the COOH terminus of the E1B-53K T antigen or against the NH2 terminus of the E1B-19K T antigen did not precipitate the E1B-20K T antigen. These data suggest that the Ad2 E1B-20K T antigen initiates translation at nucleotide 2016 in reading frame 3, as does E1B-53K. The viral mRNA that encodes the E1B-20K T antigen has not been identified.

  19. ZmPUMP encodes a fully functional monocot plant uncoupling mitochondrial protein whose affinity to fatty acid is increased with the introduction of a His pair at the second matrix loop

    SciTech Connect

    Favaro, Regiane Degan; Borecky, Jiri; Colombi, Debora; Maia, Ivan G. . E-mail:


    Uncoupling proteins (UCPs) are specialized mitochondrial transporter proteins that uncouple respiration from ATP synthesis. In this study, cDNA encoding maize uncoupling protein (ZmPUMP) was expressed in Escherichia coli and recombinant ZmPUMP reconstituted in liposomes. ZmPUMP activity was associated with a linoleic acid (LA)-mediated H{sup +} efflux with K {sub m} of 56.36 {+-} 0.27 {mu}M and V {sub max} of 66.9 {mu}mol H{sup +} min{sup -1} (mg prot){sup -1}. LA-mediated H{sup +} fluxes were sensitive to ATP inhibition with K {sub i} of 2.61 {+-} 0.36 mM (at pH 7.2), a value similar to those for dicot UCPs. ZmPUMP was also used to investigate the importance of a histidine pair present in the second matrix loop of mammalian UCP1 and absent in plant UCPs. ZmPUMP with introduced His pair (Lys155His and Ala157His) displayed a 1.55-fold increase in LA-affinity while its activity remained unchanged. Our data indicate conserved properties of plant UCPs and suggest an enhancing but not essential role of the histidine pair in proton transport mechanism.

  20. Polarization encoded color camera.


    Schonbrun, Ethan; Möller, Guðfríður; Di Caprio, Giuseppe


    Digital cameras would be colorblind if they did not have pixelated color filters integrated into their image sensors. Integration of conventional fixed filters, however, comes at the expense of an inability to modify the camera's spectral properties. Instead, we demonstrate a micropolarizer-based camera that can reconfigure its spectral response. Color is encoded into a linear polarization state by a chiral dispersive element and then read out in a single exposure. The polarization encoded color camera is capable of capturing three-color images at wavelengths spanning the visible to the near infrared. PMID:24690806

  1. Nucleic acids encoding a cellulose binding domain


    Shoseyov, O.; Shpiegl, I.; Goldstein, M.A.; Doi, R.H.


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 15 figs.

  2. Nucleic acids encoding a cellulose binding domain


    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc A.; Doi, Roy H.


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  3. Plasmids encoding therapeutic agents


    Keener, William K.


    Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

  4. Video Time Encoding Machines

    PubMed Central

    Lazar, Aurel A.; Pnevmatikakis, Eftychios A.


    We investigate architectures for time encoding and time decoding of visual stimuli such as natural and synthetic video streams (movies, animation). The architecture for time encoding is akin to models of the early visual system. It consists of a bank of filters in cascade with single-input multi-output neural circuits. Neuron firing is based on either a threshold-and-fire or an integrate-and-fire spiking mechanism with feedback. We show that analog information is represented by the neural circuits as projections on a set of band-limited functions determined by the spike sequence. Under Nyquist-type and frame conditions, the encoded signal can be recovered from these projections with arbitrary precision. For the video time encoding machine architecture, we demonstrate that band-limited video streams of finite energy can be faithfully recovered from the spike trains and provide a stable algorithm for perfect recovery. The key condition for recovery calls for the number of neurons in the population to be above a threshold value. PMID:21296708

  5. Video time encoding machines.


    Lazar, Aurel A; Pnevmatikakis, Eftychios A


    We investigate architectures for time encoding and time decoding of visual stimuli such as natural and synthetic video streams (movies, animation). The architecture for time encoding is akin to models of the early visual system. It consists of a bank of filters in cascade with single-input multi-output neural circuits. Neuron firing is based on either a threshold-and-fire or an integrate-and-fire spiking mechanism with feedback. We show that analog information is represented by the neural circuits as projections on a set of band-limited functions determined by the spike sequence. Under Nyquist-type and frame conditions, the encoded signal can be recovered from these projections with arbitrary precision. For the video time encoding machine architecture, we demonstrate that band-limited video streams of finite energy can be faithfully recovered from the spike trains and provide a stable algorithm for perfect recovery. The key condition for recovery calls for the number of neurons in the population to be above a threshold value.

  6. Time-Encoded Imagers.

    SciTech Connect

    Marleau, Peter; Brubaker, Erik


    This report provides a short overview of the DNN R&D funded project, Time-Encoded Imagers. The project began in FY11 and concluded in FY14. The Project Description below provides the overall motivation and objectives for the project as well as a summary of programmatic direction. It is followed by a short description of each task and the resulting deliverables.

  7. DNA encoding an. alpha. sub 2B -adrenergic receptor

    SciTech Connect

    Weinshank, R.L.; Hartig, P.R.


    This paper describes an isolated nucleic acid molecule encoding a human alpha 2B-adrenergic receptor. This patent also describes an isolated nucleic acid molecule, wherein the isolated nucleic acid molecule is a DNA molecule and a mammalian cell comprising the DNA molecule.

  8. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


    Dotson, William D.; Greenier, Jennifer; Ding, Hanshu


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated nucleic acids encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acids as well as methods for producing and using the polypeptides.

  9. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


    Dotson, William D.; Greenier, Jennifer; Ding, Hanshu


    The present invention relates to isolated polypeptides having cellulolytic enhancing activity and isolated nucleic acids encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acids as well as methods for producing and using the polypeptides.

  10. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polypeptides having xylanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  13. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  14. Polypeptides having endoglucanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  15. Polypeptides having endoglucanse activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  16. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  17. Polypeptides having xylanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  18. Polypeptides having endoglucanase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  19. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  20. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  1. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  2. Polypeptides having xylanase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  3. Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Tang, Lan; Duan, Junxin


    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  4. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Liu, Ye; Duan, Junxin; Tang, Lan


    The present invention provides isolated polypeptides having endoglucanase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cell comprising the polynucleotides as well as methods of producing and using the polypeptides.

  5. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having cellobiohydrolase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  6. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  7. Polypeptides having endoglucanase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having endoglucanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  8. Polypeptides having xylanase activity and polynucleotides encoding same

    SciTech Connect

    Spodsberg, Nikolaj


    The present invention relates to isolated polypeptides having xylanase activity and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  9. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


    Zhang, Yu; Duan, Junxin; Tang, Lan; Wu, Wenping


    Provided are isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. Also provided are nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  10. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same


    Liu, Ye; Tang, Lan


    The present invention provides isolated polypeptides having cellobiohydrolase activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  11. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same


    Zhang, Yu; Tang, Lan; Henriksen, Svend Hostgaard Bang


    The present invention provides isolated polypeptides having cellulolytic enhancing activity and isolated polynucleotides encoding the polypeptides. The invention also provides nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides.

  12. A Functional dlt Operon, Encoding Proteins Required for Incorporation of d-Alanine in Teichoic Acids in Gram-Positive Bacteria, Confers Resistance to Cationic Antimicrobial Peptides in Streptococcus pneumoniae

    PubMed Central

    Kovács, Márta; Halfmann, Alexander; Fedtke, Iris; Heintz, Manuel; Peschel, Andreas; Vollmer, Waldemar; Hakenbeck, Regine; Brückner, Reinhold


    Streptococcus pneumoniae is one of the few species within the group of low-G +C gram-positive bacteria reported to contain no d-alanine in teichoic acids, although the dltABCD operon encoding proteins responsible for d-alanylation is present in the genomes of two S. pneumoniae strains, the laboratory strain R6 and the clinical isolate TIGR4. The annotation of dltA in R6 predicts a protein, d-alanine-d-alanyl carrier protein ligase (Dcl), that is shorter at the amino terminus than all other Dcl proteins. Translation of dltA could also start upstream of the annotated TTG start codon at a GTG, resulting in the premature termination of dltA translation at a stop codon. Applying a novel integrative translation probe plasmid with Escherichia coli ′lacZ as a reporter, we could demonstrate that dltA translation starts at the upstream GTG. Consequently, S. pneumoniae R6 is a dltA mutant, whereas S. pneumoniae D39, the parental strain of R6, and Rx, another derivative of D39, contained intact dltA genes. Repair of the stop codon in dltA of R6 and insertional inactivation of dltA in D39 and Rx yielded pairs of dltA-deficient and dltA-proficient strains. Subsequent phenotypic analysis showed that dltA inactivation resulted in enhanced sensitivity to the cationic antimicrobial peptides nisin and gallidermin, a phenotype fully consistent with those of dltA mutants of other gram-positive bacteria. In addition, mild alkaline hydrolysis of heat-inactivated whole cells released d-alanine from dltA-proficient strains, but not from dltA mutants. The results of our study suggest that, as in many other low-G+C gram-positive bacteria, teichoic acids of S. pneumoniae contain d-alanine residues in order to protect this human pathogen against the actions of cationic antimicrobial peptides. PMID:16885447

  13. Identification of 9α-Hydroxy-17-Oxo-1,2,3,4,10,19-Hexanorandrostan-5-Oic Acid in Steroid Degradation by Comamonas testosteroni TA441 and Its Conversion to the Corresponding 6-En-5-Oyl Coenzyme A (CoA) Involving Open Reading Frame 28 (ORF28)- and ORF30-Encoded Acyl-CoA Dehydrogenases

    PubMed Central

    Hayashi, Toshiaki; Koshino, Hiroyuki; Malon, Michal; Hirota, Hiroshi; Kudo, Toshiaki


    Comamonas testosteroni TA441 degrades steroids via aromatization and meta-cleavage of the A ring, followed by hydrolysis, and produces 9,17-dioxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid as an intermediate compound. Herein, we identify a new intermediate compound, 9α-hydroxy-17-oxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid. Open reading frame 28 (ORF28)- and ORF30-encoded acyl coenzyme A (acyl-CoA) dehydrogenase was shown to convert the CoA ester of 9α-hydroxy-17-oxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid to the CoA ester of 9α-hydroxy-17-oxo-1,2,3,4,10,19-hexanorandrost-6-en-5-oic acid. A homology search of the deduced amino acid sequences suggested that the ORF30-encoded protein is a member of the acyl-CoA dehydrogenase_fadE6_17_26 family, whereas the deduced amino acid sequence of ORF28 showed no significant similarity to specific acyl-CoA dehydrogenase family proteins. Possible steroid degradation gene clusters similar to the cluster of TA441 appear in bacterial genome analysis data. In these clusters, ORFs similar to ORFs 28 and 30 are often found side by side and ordered in the same manner as ORFs 28 and 30. PMID:25092028

  14. The Text Encoding Initiative: Flexible and Extensible Document Encoding.

    ERIC Educational Resources Information Center

    Barnard, David T.; Ide, Nancy M.


    The Text Encoding Initiative (TEI), an international collaboration aimed at producing a common encoding scheme for complex texts, examines the requirement for generality versus the requirement to handle specialized text types. Discusses how documents and users tax the limits of fixed schemes requiring flexible extensible encoding to support…

  15. [Effect of the B-group vitamin complex on the blood content of saturated and unsaturated fatty acids in patients with ischemic heart disease and hypertension].


    Vodoevich, V P; Buko, V U


    Gas-liquid chromatography was used to study the blood content of saturated and unsaturated fatty acids, under the influence of the functionally-associated vitamin-B complex, in 45 patients with coronary heart disease and essential hypertension. The vitamins were given daily in the following doses: thiamine diphosphate 50 mg, riboflavine 40 mg, calcium pantothenate 200 mg, nicotinic acid 200 mg and lipoic acid 50 mg. Favourable shifts leading to positive clinical effects were recorded in the fatty acid metabolism after 10-day taking the vitamin-B complex: the content of unsaturated (linoleic and arachidonic) fatty acids increased while that of saturated (stearic and palmitic) fatty acids decreased. PMID:3705551

  16. Disorders of phonological encoding.


    Butterworth, B


    Studies of phonological disturbances in aphasic speech are reviewed. It is argued that failure to test for error consistency in individual patients makes it generally improper to draw inferences about specific disorders of phonological encoding. A minimalist interpretation of available data on phonological errors is therefore proposed that involves variable loss of information in transmission between processing subsystems. Proposals for systematic loss or corruption of phonological information in lexical representations or in translation subsystems is shown to be inadequately grounded. The review concludes with some simple methodological prescriptions for future research.

  17. [The effect of reamberin and alpha-lipoic acid on the tolerance to acute cerebral ischemia in experimental diabetes mellitus].


    Volchegorsky, I A; Miroshnichenko, I Yu; Rassokhina, L M; Faizullin, R M


    Цель исследования. Изучение влияния реамберина и α-липоевой кислоты (α-ЛК) на устойчивость мышей с экспериментальным сахарным диабетом (СД) к острому нарушению мозгового кровообращения (ОНМК). Материал и методы. Исследование проводили на мышах с аллоксановым диабетом и субтотальной и тотальной ишемией головного мозга (ГМ). В дополнительных сериях эксперимента было изучено влияние реамберина и α-ЛК на устойчивость к острой гипоксической гипоксии и выраженность гипергликемии при экспериментальном СД. Результаты и заключение. При экспериментальном СД было отмечено снижение устойчивости животных к ОНМК на фоне гипергликемии и увеличения чувствительности к острой гипоксической гипоксии. Установлено, что реамберин и α-ЛК, применяемые в дозах, эквивалентных терапевтическому диапазону для человека на протяжении 14 дней, вызывают повышение устойчивости к ОНМК и острой гипоксической гипоксии у мышей с аллоксановым диабетом, а также уменьшают выраженность гипергликемии на фоне заместительной инсулинотерапии. Установлено, что увеличение устойчивости к ОНМК у мышей с аллоксановым диабетом под действием реамберина и α-ЛК обусловлено антигипоксическим действием этих лекарственных средств и не зависит от их влияния на выраженность гипергликемии. Реамберин превосходил α-ЛК по антигипоксической активности, ОНМК-протективному действию и скорости развития сахароснижающего эффекта при экспериментальном СД.

  18. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, J.D.; Scott-Craig, J.S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is presented. The deduced amino acid sequence is provided. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with vectors and seeds from the plants.

  19. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus.


    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong


    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1-2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1-2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  20. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    PubMed Central

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong


    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteri