Equations of motion for a spectrum-generating algebra: Lipkin Meshkov Glick model

NASA Astrophysics Data System (ADS)

Rosensteel, G.; Rowe, D. J.; Ho, S. Y.

2008-01-01

For a spectrum-generating Lie algebra, a generalized equations-of-motion scheme determines numerical values of excitation energies and algebra matrix elements. In the approach to the infinite particle number limit or, more generally, whenever the dimension of the quantum state space is very large, the equations-of-motion method may achieve results that are impractical to obtain by diagonalization of the Hamiltonian matrix. To test the method's effectiveness, we apply it to the well-known Lipkin-Meshkov-Glick (LMG) model to find its low-energy spectrum and associated generator matrix elements in the eigenenergy basis. When the dimension of the LMG representation space is 106, computation time on a notebook computer is a few minutes. For a large particle number in the LMG model, the low-energy spectrum makes a quantum phase transition from a nondegenerate harmonic vibrator to a twofold degenerate harmonic oscillator. The equations-of-motion method computes critical exponents at the transition point.

On the validity of cosmological Fisher matrix forecasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolz, Laura; Kilbinger, Martin; Weller, Jochen

2012-09-01

We present a comparison of Fisher matrix forecasts for cosmological probes with Monte Carlo Markov Chain (MCMC) posterior likelihood estimation methods. We analyse the performance of future Dark Energy Task Force (DETF) stage-III and stage-IV dark-energy surveys using supernovae, baryon acoustic oscillations and weak lensing as probes. We concentrate in particular on the dark-energy equation of state parameters w{sub 0} and w{sub a}. For purely geometrical probes, and especially when marginalising over w{sub a}, we find considerable disagreement between the two methods, since in this case the Fisher matrix can not reproduce the highly non-elliptical shape of the likelihood function.more » More quantitatively, the Fisher method underestimates the marginalized errors for purely geometrical probes between 30%-70%. For cases including structure formation such as weak lensing, we find that the posterior probability contours from the Fisher matrix estimation are in good agreement with the MCMC contours and the forecasted errors only changing on the 5% level. We then explore non-linear transformations resulting in physically-motivated parameters and investigate whether these parameterisations exhibit a Gaussian behaviour. We conclude that for the purely geometrical probes and, more generally, in cases where it is not known whether the likelihood is close to Gaussian, the Fisher matrix is not the appropriate tool to produce reliable forecasts.« less

Application of the matrix exponential kernel

NASA Technical Reports Server (NTRS)

Rohach, A. F.

1972-01-01

A point matrix kernel for radiation transport, developed by the transmission matrix method, has been used to develop buildup factors and energy spectra through slab layers of different materials for a point isotropic source. Combinations of lead-water slabs were chosen for examples because of the extreme differences in shielding properties of these two materials.

Perturbation theory corrections to the two-particle reduced density matrix variational method.

PubMed

Juhasz, Tamas; Mazziotti, David A

2004-07-15

In the variational 2-particle-reduced-density-matrix (2-RDM) method, the ground-state energy is minimized with respect to the 2-particle reduced density matrix, constrained by N-representability conditions. Consider the N-electron Hamiltonian H(lambda) as a function of the parameter lambda where we recover the Fock Hamiltonian at lambda=0 and we recover the fully correlated Hamiltonian at lambda=1. We explore using the accuracy of perturbation theory at small lambda to correct the 2-RDM variational energies at lambda=1 where the Hamiltonian represents correlated atoms and molecules. A key assumption in the correction is that the 2-RDM method will capture a fairly constant percentage of the correlation energy for lambda in (0,1] because the nonperturbative 2-RDM approach depends more significantly upon the nature rather than the strength of the two-body Hamiltonian interaction. For a variety of molecules we observe that this correction improves the 2-RDM energies in the equilibrium bonding region, while the 2-RDM energies at stretched or nearly dissociated geometries, already highly accurate, are not significantly changed. At equilibrium geometries the corrected 2-RDM energies are similar in accuracy to those from coupled-cluster singles and doubles (CCSD), but at nonequilibrium geometries the 2-RDM energies are often dramatically more accurate as shown in the bond stretching and dissociation data for water and nitrogen. (c) 2004 American Institute of Physics.

Ab initio R-matrix calculations of e+-molecule scattering

NASA Technical Reports Server (NTRS)

Danby, Grahame; Tennyson, Jonathan

1990-01-01

The adaptation of the molecular R-matrix method, originally developed for electron-molecule collision studies, to positron scattering is discussed. Ab initio R-matrix calculations are presented for collisions of low energy positrons with a number of diatomic systems including H2, HF and N2. Differential elastic cross sections for positron-H2 show a minimum at about 45 deg for collision energies between 0.3 and 0.5 Ryd. The calculations predict a bound state of positronHF. Calculations on inelastic processes in N2 and O2 are also discussed.

Vibrational excitation and dissociative attachment of a triatomic molecule: CO/sub 2/ in the collinear approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, C.F.; Light, J.C.

1986-02-01

The effective R-matrix model and the R-matrix propagative method applied earlier to elec- tron--diatomic-molecule scattering are extended to treat dissociative attachment of collinear triatomic molecules. To describe the vibrational excitation and dissociative attachment of CO/sub 2/ in the 4-eV region, the nuclear dynamics is solved on a Wall-Porter potential-energy surface. A hybrid approach is developed in which the L/sup 2/ and R-matrix propagation methods are combined to evaluate the global R matrix. Our calculations show that it is easier to excite the symmetric mode vibrations than the asymmetric mode vibrations. Our results also show that the observed structures in themore » energy dependence of the dissociative attachment cross sections are due to the vibrational states of the negative ion (CO/sub 2/ /sup -/) and not to the vibrational states of the CO fragment.« less

Method of multivariate spectral analysis

DOEpatents

Keenan, Michael R.; Kotula, Paul G.

2004-01-06

A method of determining the properties of a sample from measured spectral data collected from the sample by performing a multivariate spectral analysis. The method can include: generating a two-dimensional matrix A containing measured spectral data; providing a weighted spectral data matrix D by performing a weighting operation on matrix A; factoring D into the product of two matrices, C and S.sup.T, by performing a constrained alternating least-squares analysis of D=CS.sup.T, where C is a concentration intensity matrix and S is a spectral shapes matrix; unweighting C and S by applying the inverse of the weighting used previously; and determining the properties of the sample by inspecting C and S. This method can be used to analyze X-ray spectral data generated by operating a Scanning Electron Microscope (SEM) with an attached Energy Dispersive Spectrometer (EDS).

Matrix-free and material-enhanced laser desorption/ionization mass spectrometry for the analysis of low molecular weight compounds.

PubMed

Rainer, Matthias; Qureshi, Muhammad Nasimullah; Bonn, Günther Karl

2011-06-01

The application of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) for the analysis of low molecular weight (LMW) compounds, such as pharmacologically active constituents or metabolites, is usually hampered by employing conventional MALDI matrices owing to interferences caused by matrix molecules below 700 Da. As a consequence, interpretation of mass spectra remains challenging, although matrix suppression can be achieved under certain conditions. Unlike the conventional MALDI methods which usually suffer from background signals, matrix-free techniques have become more and more popular for the analysis of LMW compounds. In this review we describe recently introduced materials for laser desorption/ionization (LDI) as alternatives to conventionally applied MALDI matrices. In particular, we want to highlight a new method for LDI which is referred to as matrix-free material-enhanced LDI (MELDI). In matrix-free MELDI it could be clearly shown, that besides chemical functionalities, the material's morphology plays a crucial role regarding energy-transfer capabilities. Therefore, it is of great interest to also investigate parameters such as particle size and porosity to study their impact on the LDI process. Especially nanomaterials such as diamond-like carbon, C(60) fullerenes and nanoparticulate silica beads were found to be excellent energy-absorbing materials in matrix-free MELDI.

Size Reduction of Hamiltonian Matrix for Large-Scale Energy Band Calculations Using Plane Wave Bases

NASA Astrophysics Data System (ADS)

Morifuji, Masato

2018-01-01

We present a method of reducing the size of a Hamiltonian matrix used in calculations of electronic states. In the electronic states calculations using plane wave basis functions, a large number of plane waves are often required to obtain precise results. Even using state-of-the-art techniques, the Hamiltonian matrix often becomes very large. The large computational time and memory necessary for diagonalization limit the widespread use of band calculations. We show a procedure of deriving a reduced Hamiltonian constructed using a small number of low-energy bases by renormalizing high-energy bases. We demonstrate numerically that the significant speedup of eigenstates evaluation is achieved without losing accuracy.

Energy Dissipation of Rayleigh Waves due to Absorption Along the Path by the Use of Finite Element Method

DTIC Science & Technology

1979-07-31

3 x 3 t Strain vector a ij,j Space derivative of the stress tensor Fi Force vector per unit volume o Density x CHAPTER III F Total force K Stiffness...matrix 6Vector displacements M Mass matrix B Space operating matrix DO Matrix moduli 2 x 3 DZ Operating matrix in Z direction N Matrix of shape...dissipating medium the deformation of a solid is a function of time, temperature and space . Creep phenomenon is a deformation process in which there is

S -matrix calculations of energy levels of sodiumlike ions

DOE PAGES

Sapirstein, J.; Cheng, K. T.

2015-06-24

A recent S -matrix-based QED calculation of energy levels of the lithium isoelectronic sequence is extended to the general case of a valence electron outside an arbitrary filled core. Emphasis is placed on modifications of the lithiumlike formulas required because more than one core state is present, and an unusual feature of the two-photon exchange contribution involving autoionizing states is discussed. Here, the method is illustrated with a calculation of the energy levels of sodiumlike ions, with results for 3s 1/2, 3p 1/2, and 3p 3/2 energies tabulated for the range Z = 30 – 100 . Comparison with experimentmore » and other calculations is given, and prospects for extension of the method to ions with more complex electronic structure discussed.« less

Design for the fabrication of high efficiency solar cells

DOEpatents

Simmons, Joseph H.

1998-01-01

A method and apparatus for a photo-active region for generation of free carriers when a first surface is exposed to optical radiation. The photo-active region includes a conducting transparent matrix and clusters of semiconductor materials embedded within the conducting transparent matrix. The clusters are arranged in the matrix material so as to define at least a first distribution of cluster sizes ranging from those with the highest bandgap energy near a light incident surface of the photo-active region to those with the smallest bandgap energy near an opposite second surface of the photo-active region. Also disclosed is a method and apparatus for a solar cell. The solar cell includes a photo-active region containing a plurality of semiconductor clusters of varying sizes as described.

Energy conserving, linear scaling Born-Oppenheimer molecular dynamics.

PubMed

Cawkwell, M J; Niklasson, Anders M N

2012-10-07

Born-Oppenheimer molecular dynamics simulations with long-term conservation of the total energy and a computational cost that scales linearly with system size have been obtained simultaneously. Linear scaling with a low pre-factor is achieved using density matrix purification with sparse matrix algebra and a numerical threshold on matrix elements. The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [A. M. N. Niklasson, Phys. Rev. Lett. 100, 123004 (2008)] yields microcanonical trajectories with the approximate forces obtained from the linear scaling method that exhibit no systematic drift over hundreds of picoseconds and which are indistinguishable from trajectories computed using exact forces.

Excitation energies from range-separated time-dependent density and density matrix functional theory.

PubMed

Pernal, Katarzyna

2012-05-14

Time-dependent density functional theory (TD-DFT) in the adiabatic formulation exhibits known failures when applied to predicting excitation energies. One of them is the lack of the doubly excited configurations. On the other hand, the time-dependent theory based on a one-electron reduced density matrix functional (time-dependent density matrix functional theory, TD-DMFT) has proven accurate in determining single and double excitations of H(2) molecule if the exact functional is employed in the adiabatic approximation. We propose a new approach for computing excited state energies that relies on functionals of electron density and one-electron reduced density matrix, where the latter is applied in the long-range region of electron-electron interactions. A similar approach has been recently successfully employed in predicting ground state potential energy curves of diatomic molecules even in the dissociation limit, where static correlation effects are dominating. In the paper, a time-dependent functional theory based on the range-separation of electronic interaction operator is rigorously formulated. To turn the approach into a practical scheme the adiabatic approximation is proposed for the short- and long-range components of the coupling matrix present in the linear response equations. In the end, the problem of finding excitation energies is turned into an eigenproblem for a symmetric matrix. Assignment of obtained excitations is discussed and it is shown how to identify double excitations from the analysis of approximate transition density matrix elements. The proposed method used with the short-range local density approximation (srLDA) and the long-range Buijse-Baerends density matrix functional (lrBB) is applied to H(2) molecule (at equilibrium geometry and in the dissociation limit) and to Be atom. The method accounts for double excitations in the investigated systems but, unfortunately, the accuracy of some of them is poor. The quality of the other excitations is in general much better than that offered by TD-DFT-LDA or TD-DMFT-BB approximations if the range-separation parameter is properly chosen. The latter remains an open problem.

Free energies from dynamic weighted histogram analysis using unbiased Markov state model.

PubMed

Rosta, Edina; Hummer, Gerhard

2015-01-13

The weighted histogram analysis method (WHAM) is widely used to obtain accurate free energies from biased molecular simulations. However, WHAM free energies can exhibit significant errors if some of the biasing windows are not fully equilibrated. To account for the lack of full equilibration, we develop the dynamic histogram analysis method (DHAM). DHAM uses a global Markov state model to obtain the free energy along the reaction coordinate. A maximum likelihood estimate of the Markov transition matrix is constructed by joint unbiasing of the transition counts from multiple umbrella-sampling simulations along discretized reaction coordinates. The free energy profile is the stationary distribution of the resulting Markov matrix. For this matrix, we derive an explicit approximation that does not require the usual iterative solution of WHAM. We apply DHAM to model systems, a chemical reaction in water treated using quantum-mechanics/molecular-mechanics (QM/MM) simulations, and the Na(+) ion passage through the membrane-embedded ion channel GLIC. We find that DHAM gives accurate free energies even in cases where WHAM fails. In addition, DHAM provides kinetic information, which we here use to assess the extent of convergence in each of the simulation windows. DHAM may also prove useful in the construction of Markov state models from biased simulations in phase-space regions with otherwise low population.

Double ionization in R -matrix theory using a two-electron outer region

NASA Astrophysics Data System (ADS)

Wragg, Jack; Parker, J. S.; van der Hart, H. W.

2015-08-01

We have developed a two-electron outer region for use within R -matrix theory to describe double ionization processes. The capability of this method is demonstrated for single-photon double ionization of He in the photon energy region between 80 and 180 eV. The cross sections are in agreement with established data. The extended R -matrix with time dependence method also provides information on higher-order processes, as demonstrated by the identification of signatures for sequential double ionization processes involving an intermediate He+ state with n =2 .

The Shock and Vibration Digest. Volume 16, Number 1

DTIC Science & Technology

1984-01-01

investigation of the measure- ment of frequency band average loss factors of structural components for use in the statistical energy analysis method of...stiffness. Matrix methods Key Words: Finite element technique. Statistical energy analysis . Experimental techniques. Framed structures, Com- puter...programs In order to further understand the practical application of the statistical energy analysis , a two section plate-like frame structure is

Interfacial Reaction During High Energy Ball Milling Dispersion of Carbon Nanotubes into Ti6Al4V

NASA Astrophysics Data System (ADS)

Adegbenjo, A. O.; Olubambi, P. A.; Potgieter, J. H.; Nsiah-Baafi, E.; Shongwe, M. B.

2017-12-01

The unique thermal and mechanical properties of carbon nanotubes (CNTs) have made them choice reinforcements for metal matrix composites (MMCs). However, there still remains a critical challenge in achieving homogeneous dispersion of CNTs in metallic matrices. Although high energy ball milling (HEBM) has been reported as an effective method of dispersing CNTs into metal matrices, a careful selection of the milling parameters is important not to compromise the structural integrity of CNTs which may cause interfacial reactions with the matrix. In this study, multi-walled carbon nanotubes (MWCNTs) were purified by annealing in argon and vacuum atmospheres at 1000 and 1800 °C, respectively, for 5 h to remove possible metallic catalyst impurities. Subsequently, 1, 2 and 3 wt.% MWCNTs were dispersed by adapted HEBM into Ti6Al4V alloy metal matrix. Raman spectroscopy (RS), x-ray diffraction, scanning electron microscopy, energy-dispersive x-ray spectrometry and transmission electron microscopy techniques were used to characterize the as-received and annealed MWCNTs, as well as the admixed MWCNT/Ti6Al4V nanocomposite powders. The experimental results showed that vacuum annealing successfully eliminated retained nickel (Ni) catalysts from MWCNTs, while the adapted HEBM method achieved a relative homogeneous dispersion of MWCNTs into the Ti6Al4V matrix and helped to control interfacial reactions between defective MWCNTs and the metal matrix.

Apparatus and system for multivariate spectral analysis

DOEpatents

Keenan, Michael R.; Kotula, Paul G.

2003-06-24

An apparatus and system for determining the properties of a sample from measured spectral data collected from the sample by performing a method of multivariate spectral analysis. The method can include: generating a two-dimensional matrix A containing measured spectral data; providing a weighted spectral data matrix D by performing a weighting operation on matrix A; factoring D into the product of two matrices, C and S.sup.T, by performing a constrained alternating least-squares analysis of D=CS.sup.T, where C is a concentration intensity matrix and S is a spectral shapes matrix; unweighting C and S by applying the inverse of the weighting used previously; and determining the properties of the sample by inspecting C and S. This method can be used by a spectrum analyzer to process X-ray spectral data generated by a spectral analysis system that can include a Scanning Electron Microscope (SEM) with an Energy Dispersive Detector and Pulse Height Analyzer.

Surface tension mediated conversion of light to work

DOEpatents

Okawa, David; Pastine, Stefan J; Zettl, Alexander K; Frechet, Jean M. J

2014-12-02

Disclosed are a method and apparatus for converting light energy to mechanical energy by modification of surface tension on a supporting fluid. The apparatus comprises an object which may be formed as a composite object comprising a support matrix and a highly light absorptive material. The support matrix may comprise a silicon polymer. The highly light absorptive material may comprise vertically aligned carbon nanotubes (VANTs) embedded in the support matrix. The composite object is supported on a fluid. By exposing the highly light absorptive material to light, heat is generated, which changes the surface tension of the composite object, causing it to move physically within the fluid.

Joint Strength Control at the Fiber/Matrix Interface during the Production of Polymer Composite Materials Reinforced with High Performance Fibers

NASA Astrophysics Data System (ADS)

Kudinov, Vladimir V.; Korneeva, Natalia V.

2010-06-01

The paper presents the results obtained in the study of the joint strength between polymer matrix and high performance polyethylene fiber. The fiber/matrix joints simulate the unit cell of the fiber-reinforced composite materials. Effect of heat treatment on the composite properties at the interface was estimated by a multifilament wet-pull-out method. It was found that the joint strength may be increased with the help of extra heart treatment. Both the energy to peak load and the energy to failure for CM joints at various stages of loading were determined.

Variational second order density matrix study of F3-: importance of subspace constraints for size-consistency.

PubMed

van Aggelen, Helen; Verstichel, Brecht; Bultinck, Patrick; Van Neck, Dimitri; Ayers, Paul W; Cooper, David L

2011-02-07

Variational second order density matrix theory under "two-positivity" constraints tends to dissociate molecules into unphysical fractionally charged products with too low energies. We aim to construct a qualitatively correct potential energy surface for F(3)(-) by applying subspace energy constraints on mono- and diatomic subspaces of the molecular basis space. Monoatomic subspace constraints do not guarantee correct dissociation: the constraints are thus geometry dependent. Furthermore, the number of subspace constraints needed for correct dissociation does not grow linearly with the number of atoms. The subspace constraints do impose correct chemical properties in the dissociation limit and size-consistency, but the structure of the resulting second order density matrix method does not exactly correspond to a system of noninteracting units.

Nonlocal low-rank and sparse matrix decomposition for spectral CT reconstruction

NASA Astrophysics Data System (ADS)

Niu, Shanzhou; Yu, Gaohang; Ma, Jianhua; Wang, Jing

2018-02-01

Spectral computed tomography (CT) has been a promising technique in research and clinics because of its ability to produce improved energy resolution images with narrow energy bins. However, the narrow energy bin image is often affected by serious quantum noise because of the limited number of photons used in the corresponding energy bin. To address this problem, we present an iterative reconstruction method for spectral CT using nonlocal low-rank and sparse matrix decomposition (NLSMD), which exploits the self-similarity of patches that are collected in multi-energy images. Specifically, each set of patches can be decomposed into a low-rank component and a sparse component, and the low-rank component represents the stationary background over different energy bins, while the sparse component represents the rest of the different spectral features in individual energy bins. Subsequently, an effective alternating optimization algorithm was developed to minimize the associated objective function. To validate and evaluate the NLSMD method, qualitative and quantitative studies were conducted by using simulated and real spectral CT data. Experimental results show that the NLSMD method improves spectral CT images in terms of noise reduction, artifact suppression and resolution preservation.

A sparse matrix-vector multiplication based algorithm for accurate density matrix computations on systems of millions of atoms

NASA Astrophysics Data System (ADS)

Ghale, Purnima; Johnson, Harley T.

2018-06-01

We present an efficient sparse matrix-vector (SpMV) based method to compute the density matrix P from a given Hamiltonian in electronic structure computations. Our method is a hybrid approach based on Chebyshev-Jackson approximation theory and matrix purification methods like the second order spectral projection purification (SP2). Recent methods to compute the density matrix scale as O(N) in the number of floating point operations but are accompanied by large memory and communication overhead, and they are based on iterative use of the sparse matrix-matrix multiplication kernel (SpGEMM), which is known to be computationally irregular. In addition to irregularity in the sparse Hamiltonian H, the nonzero structure of intermediate estimates of P depends on products of H and evolves over the course of computation. On the other hand, an expansion of the density matrix P in terms of Chebyshev polynomials is straightforward and SpMV based; however, the resulting density matrix may not satisfy the required constraints exactly. In this paper, we analyze the strengths and weaknesses of the Chebyshev-Jackson polynomials and the second order spectral projection purification (SP2) method, and propose to combine them so that the accurate density matrix can be computed using the SpMV computational kernel only, and without having to store the density matrix P. Our method accomplishes these objectives by using the Chebyshev polynomial estimate as the initial guess for SP2, which is followed by using sparse matrix-vector multiplications (SpMVs) to replicate the behavior of the SP2 algorithm for purification. We demonstrate the method on a tight-binding model system of an oxide material containing more than 3 million atoms. In addition, we also present the predicted behavior of our method when applied to near-metallic Hamiltonians with a wide energy spectrum.

An efficient basis set representation for calculating electrons in molecules

DOE PAGES

Jones, Jeremiah R.; Rouet, Francois -Henry; Lawler, Keith V.; ...

2016-04-27

The method of McCurdy, Baertschy, and Rescigno, is generalised to obtain a straightforward, surprisingly accurate, and scalable numerical representation for calculating the electronic wave functions of molecules. It uses a basis set of product sinc functions arrayed on a Cartesian grid, and yields 1 kcal/mol precision for valence transition energies with a grid resolution of approximately 0.1 bohr. The Coulomb matrix elements are replaced with matrix elements obtained from the kinetic energy operator. A resolution-of-the-identity approximation renders the primitive one- and two-electron matrix elements diagonal; in other words, the Coulomb operator is local with respect to the grid indices. Themore » calculation of contracted two-electron matrix elements among orbitals requires only O( Nlog (N)) multiplication operations, not O( N 4), where N is the number of basis functions; N = n 3 on cubic grids. The representation not only is numerically expedient, but also produces energies and properties superior to those calculated variationally. Absolute energies, absorption cross sections, transition energies, and ionisation potentials are reported for 1- (He +, H + 2), 2- (H 2, He), 10- (CH 4), and 56-electron (C 8H 8) systems.« less

Method for preparing polyolefin composites containing a phase change material

DOEpatents

Salyer, Ival O.

1990-01-01

A composite useful in thermal energy storage, said composite being formed of a polyolefin matrix having a phase change material such as a crystalline alkyl hydrocarbon incorporated therein. The composite is useful in forming pellets, sheets or fibers having thermal energy storage characteristics; methods for forming the composite are also disclosed.

Top Quark Mass Measurement in the Lepton + Jets Channel Using a Matrix Element Method and \\textit{in situ} Jet Energy Calibration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aaltonen, T.; /Helsinki Inst. of Phys.; Alvarez Gonzalez, B.

A precision measurement of the top quark mass m{sub t} is obtained using a sample of t{bar t} events from p{bar p} collisions at the Fermilab Tevatron with the CDF II detector. Selected events require an electron or muon, large missing transverse energy, and exactly four high-energy jets, at least one of which is tagged as coming from a b quark. A likelihood is calculated using a matrix element method with quasi-Monte Carlo integration taking into account finite detector resolution and jet mass effects. The event likelihood is a function of m{sub t} and a parameter {Delta}{sub JES} used tomore » calibrate the jet energy scale in situ. Using a total of 1087 events, a value of m{sub t} = 173.0 {+-} 1.2 GeV/c{sup 2} is measured.« less

Top Quark Mass Measurement in the lepton+jets Channel Using a Matrix Element Method and in situ Jet Energy Calibration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aaltonen, T.; Brucken, E.; Devoto, F.

A precision measurement of the top quark mass m{sub t} is obtained using a sample of tt events from pp collisions at the Fermilab Tevatron with the CDF II detector. Selected events require an electron or muon, large missing transverse energy, and exactly four high-energy jets, at least one of which is tagged as coming from a b quark. A likelihood is calculated using a matrix element method with quasi-Monte Carlo integration taking into account finite detector resolution and jet mass effects. The event likelihood is a function of m{sub t} and a parameter {Delta}{sub JES} used to calibrate themore » jet energy scale in situ. Using a total of 1087 events in 5.6 fb{sup -1} of integrated luminosity, a value of m{sub t}=173.0{+-}1.2 GeV/c{sup 2} is measured.« less

The development of control and monitoring system on marine current renewable energy Case study: strait of Toyapakeh - Nusa Penida, Bali

NASA Astrophysics Data System (ADS)

Arief, I. S.; Suherman, I. H.; Wardani, A. Y.; Baidowi, A.

2017-05-01

Control and monitoring system is a continuous process of securing the asset in the Marine Current Renewable Energy. A control and monitoring system is existed each critical components which is embedded in Failure Mode Effect Analysis (FMEA) method. As the result, the process in this paper developed through a matrix sensor. The matrix correlated to critical components and monitoring system which supported by sensors to conduct decision-making.

Matrix resin effects in composite delamination - Mode I fracture aspects

NASA Technical Reports Server (NTRS)

Hunston, Donald L.; Moulton, Richard J.; Johnston, Norman J.; Bascom, Willard D.

1987-01-01

A number of thermoset, toughened thermoset, and thermoplastic resin matrix systems were characterized for Mode I critical strain energy release rates, and their composites were tested for interlaminar critical strain energy release rates using the double cantilever beam method. A clear correlation is found between the two sets of data. With brittle resins, the interlaminar critical strain energy release rates are somewhat larger than the neat resin values due to a full transfer of the neat resin toughness to the composite and toughening mechanisms associated with crack growth. With tougher matrices, the higher critical strain energy release rates are only partially transferred to the composites, presumably because the fibers restrict the crack-tip deformation zones.

The Development of a Finite Volume Method for Modeling Sound in Coastal Ocean Environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, Wen; Yang, Zhaoqing; Copping, Andrea E.

: As the rapid growth of marine renewable energy and off-shore wind energy, there have been concerns that the noises generated from construction and operation of the devices may interfere marine animals’ communication. In this research, a underwater sound model is developed to simulate sound prorogation generated by marine-hydrokinetic energy (MHK) devices or offshore wind (OSW) energy platforms. Finite volume and finite difference methods are developed to solve the 3D Helmholtz equation of sound propagation in the coastal environment. For finite volume method, the grid system consists of triangular grids in horizontal plane and sigma-layers in vertical dimension. A 3Dmore » sparse matrix solver with complex coefficients is formed for solving the resulting acoustic pressure field. The Complex Shifted Laplacian Preconditioner (CSLP) method is applied to efficiently solve the matrix system iteratively with MPI parallelization using a high performance cluster. The sound model is then coupled with the Finite Volume Community Ocean Model (FVCOM) for simulating sound propagation generated by human activities in a range-dependent setting, such as offshore wind energy platform constructions and tidal stream turbines. As a proof of concept, initial validation of the finite difference solver is presented for two coastal wedge problems. Validation of finite volume method will be reported separately.« less

Transparent conductive nano-composites

DOEpatents

Geohegan, David Bruce; Ivanov, Ilia N; Puretzky, Alexander A; Jesse, Stephen; Hu, Bin; Garrett, Matthew; Zhao, Bin

2013-09-24

The present invention, in one embodiment, provides a method of forming an organic electric device that includes providing a plurality of carbon nanostructures; and dispersing the plurality of carbon nanostructures in a polymeric matrix to provide a polymeric composite, wherein when the plurality of carbon nanostructures are present at a first concentration an interface of the plurality of carbon nanostructures and the polymeric matrix is characterized by charge transport when an external energy is applied, and when the plurality of carbon nanostructures are present at a second concentration the interface of the plurality of carbon nanostructures and the polymeric matrix are characterized by exciton dissociation when an external energy is applied, wherein the first concentration is less than the second concentration.

Transparent conductive nano-composites

DOEpatents

Geohegan, David Bruce [Knoxville, TN; Ivanov, Ilia N [Knoxville, TN; Puretzky, Alexander A [Knoxville, TN; Jesse, Stephen [Knoxville, TN; Hu, Bin [Knoxville, TN; Garrett, Matthew [Knoxville, TN; Zhao, Bin [Easley, SC

2011-04-12

The present invention, in one embodiment, provides a method of forming an organic electric device that includes providing a plurality of carbon nanostructures; and dispersing the plurality of carbon nanostructures in a polymeric matrix to provide a polymeric composite, wherein when the plurality of carbon nanostructures are present at a first concentration an interface of the plurality of carbon nanostructures and the polymeric matrix is characterized by charge transport when an external energy is applied, and when the plurality of carbon nanostructures are present at a second concentration the interface of the plurality of carbon nanostructures and the polymeric matrix are characterized by exciton dissociation when an external energy is applied, wherein the first concentration is less than the second concentration.

On the use of transition matrix methods with extended ensembles.

PubMed

Escobedo, Fernando A; Abreu, Charlles R A

2006-03-14

Different extended ensemble schemes for non-Boltzmann sampling (NBS) of a selected reaction coordinate lambda were formulated so that they employ (i) "variable" sampling window schemes (that include the "successive umbrella sampling" method) to comprehensibly explore the lambda domain and (ii) transition matrix methods to iteratively obtain the underlying free-energy eta landscape (or "importance" weights) associated with lambda. The connection between "acceptance ratio" and transition matrix methods was first established to form the basis of the approach for estimating eta(lambda). The validity and performance of the different NBS schemes were then assessed using as lambda coordinate the configurational energy of the Lennard-Jones fluid. For the cases studied, it was found that the convergence rate in the estimation of eta is little affected by the use of data from high-order transitions, while it is noticeably improved by the use of a broader window of sampling in the variable window methods. Finally, it is shown how an "elastic" window of sampling can be used to effectively enact (nonuniform) preferential sampling over the lambda domain, and how to stitch the weights from separate one-dimensional NBS runs to produce a eta surface over a two-dimensional domain.

Finding a Hadamard matrix by simulated annealing of spin vectors

NASA Astrophysics Data System (ADS)

Bayu Suksmono, Andriyan

2017-05-01

Reformulation of a combinatorial problem into optimization of a statistical-mechanics system enables finding a better solution using heuristics derived from a physical process, such as by the simulated annealing (SA). In this paper, we present a Hadamard matrix (H-matrix) searching method based on the SA on an Ising model. By equivalence, an H-matrix can be converted into a seminormalized Hadamard (SH) matrix, whose first column is unit vector and the rest ones are vectors with equal number of -1 and +1 called SH-vectors. We define SH spin vectors as representation of the SH vectors, which play a similar role as the spins on Ising model. The topology of the lattice is generalized into a graph, whose edges represent orthogonality relationship among the SH spin vectors. Starting from a randomly generated quasi H-matrix Q, which is a matrix similar to the SH-matrix without imposing orthogonality, we perform the SA. The transitions of Q are conducted by random exchange of {+, -} spin-pair within the SH-spin vectors that follow the Metropolis update rule. Upon transition toward zeroth energy, the Q-matrix is evolved following a Markov chain toward an orthogonal matrix, at which the H-matrix is said to be found. We demonstrate the capability of the proposed method to find some low-order H-matrices, including the ones that cannot trivially be constructed by the Sylvester method.

Response Matrix Monte Carlo for electron transport

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ballinger, C.T.; Nielsen, D.E. Jr.; Rathkopf, J.A.

1990-11-01

A Response Matrix Monte Carol (RMMC) method has been developed for solving electron transport problems. This method was born of the need to have a reliable, computationally efficient transport method for low energy electrons (below a few hundred keV) in all materials. Today, condensed history methods are used which reduce the computation time by modeling the combined effect of many collisions but fail at low energy because of the assumptions required to characterize the electron scattering. Analog Monte Carlo simulations are prohibitively expensive since electrons undergo coulombic scattering with little state change after a collision. The RMMC method attempts tomore » combine the accuracy of an analog Monte Carlo simulation with the speed of the condensed history methods. The combined effect of many collisions is modeled, like condensed history, except it is precalculated via an analog Monte Carol simulation. This avoids the scattering kernel assumptions associated with condensed history methods. Results show good agreement between the RMMC method and analog Monte Carlo. 11 refs., 7 figs., 1 tabs.« less

Connection between the regular approximation and the normalized elimination of the small component in relativistic quantum theory

NASA Astrophysics Data System (ADS)

Filatov, Michael; Cremer, Dieter

2005-02-01

The regular approximation to the normalized elimination of the small component (NESC) in the modified Dirac equation has been developed and presented in matrix form. The matrix form of the infinite-order regular approximation (IORA) expressions, obtained in [Filatov and Cremer, J. Chem. Phys. 118, 6741 (2003)] using the resolution of the identity, is the exact matrix representation and corresponds to the zeroth-order regular approximation to NESC (NESC-ZORA). Because IORA (=NESC-ZORA) is a variationally stable method, it was used as a suitable starting point for the development of the second-order regular approximation to NESC (NESC-SORA). As shown for hydrogenlike ions, NESC-SORA energies are closer to the exact Dirac energies than the energies from the fifth-order Douglas-Kroll approximation, which is much more computationally demanding than NESC-SORA. For the application of IORA (=NESC-ZORA) and NESC-SORA to many-electron systems, the number of the two-electron integrals that need to be evaluated (identical to the number of the two-electron integrals of a full Dirac-Hartree-Fock calculation) was drastically reduced by using the resolution of the identity technique. An approximation was derived, which requires only the two-electron integrals of a nonrelativistic calculation. The accuracy of this approach was demonstrated for heliumlike ions. The total energy based on the approximate integrals deviates from the energy calculated with the exact integrals by less than 5×10-9hartree units. NESC-ZORA and NESC-SORA can easily be implemented in any nonrelativistic quantum chemical program. Their application is comparable in cost with that of nonrelativistic methods. The methods can be run with density functional theory and any wave function method. NESC-SORA has the advantage that it does not imply a picture change.

Finite-element grid improvement by minimization of stiffness matrix trace

NASA Technical Reports Server (NTRS)

Kittur, Madan G.; Huston, Ronald L.; Oswald, Fred B.

1989-01-01

A new and simple method of finite-element grid improvement is presented. The objective is to improve the accuracy of the analysis. The procedure is based on a minimization of the trace of the stiffness matrix. For a broad class of problems this minimization is seen to be equivalent to minimizing the potential energy. The method is illustrated with the classical tapered bar problem examined earlier by Prager and Masur. Identical results are obtained.

Finite-element grid improvement by minimization of stiffness matrix trace

NASA Technical Reports Server (NTRS)

Kittur, Madan G.; Huston, Ronald L.; Oswald, Fred B.

1987-01-01

A new and simple method of finite-element grid improvement is presented. The objective is to improve the accuracy of the analysis. The procedure is based on a minimization of the trace of the stiffness matrix. For a broad class of problems this minimization is seen to be equivalent to minimizing the potential energy. The method is illustrated with the classical tapered bar problem examined earlier by Prager and Masur. Identical results are obtained.

Calculating Relativistic Transition Matrix Elements for Hydrogenic Atoms Using Monte Carlo Methods

NASA Astrophysics Data System (ADS)

Alexander, Steven; Coldwell, R. L.

2015-03-01

The nonrelativistic transition matrix elements for hydrogen atoms can be computed exactly and these expressions are given in a number of classic textbooks. The relativistic counterparts of these equations can also be computed exactly but these expressions have been described in only a few places in the literature. In part, this is because the relativistic equations lack the elegant simplicity of the nonrelativistic equations. In this poster I will describe how variational Monte Carlo methods can be used to calculate the energy and properties of relativistic hydrogen atoms and how the wavefunctions for these systems can be used to calculate transition matrix elements.

Sensitivity Modulation of Upconverting Thermometry through Engineering Phonon Energy of a Matrix.

PubMed

Suo, Hao; Guo, Chongfeng; Zheng, Jiming; Zhou, Bo; Ma, Chonggeng; Zhao, Xiaoqi; Li, Ting; Guo, Ping; Goldys, Ewa M

2016-11-09

Investigation of the unclear influential factors to thermal sensing capability is the only way to achieve highly sensitive thermometry, which is greatly needed to meet the growing demand for potential sensing applications. Here, the effect from the phonon energy of a matrix on the sensitivity of upconversion (UC) microthermometers is elaborately discussed using a controllable method. Uniform truncated octahedral YF 3 :Er 3+ /Yb 3+ microcrystals were prepared by a hydrothermal approach, and phase transformation from YF 3 to YOF and Y 2 O 3 with nearly unchanged morphology and size was successfully realized by controlling the annealing temperature. The phonon energies of blank matrixes were determined by FT-IR spectra and Raman scattering. Upon 980 nm excitation, phonon energy-dependent UC emitting color was finely tuned from green to yellow for three samples, and the mechanisms were proposed. Thermal sensing behaviors based on the TCLs ( 2 H 11/2 / 4 S 3/2 ) were evaluated, and the sensitivities gradually grew with the increase in the matrix's phonon energy. According to chemical bond theory and first-principle calculations, the most intrinsic factors associated with thermometric ability were qualitatively demonstrated through analyzing the inner relation between the phonon energy and bond covalency. The exciting results provide guiding insights into employing appropriate host materials with desired thermometric ability while offering the possibility of highly accurate measurement of temperature.

Theoretical approach to embed nanocrystallites into a bulk crystalline matrix and the embedding influence on the electronic band structure and optical properties of the resulting heterostructures

NASA Astrophysics Data System (ADS)

Balagan, Semyon A.; Nazarov, Vladimir U.; Shevlyagin, Alexander V.; Goroshko, Dmitrii L.; Galkin, Nikolay G.

2018-06-01

We develop an approach and present results of the combined molecular dynamics and density functional theory calculations of the structural and optical properties of the nanometer-sized crystallites embedded in a bulk crystalline matrix. The method is designed and implemented for both compatible and incompatible lattices of the nanocrystallite (NC) and the host matrix, when determining the NC optimal orientation relative to the matrix constitutes a challenging problem. We suggest and substantiate an expression for the cost function of the search algorithm, which is the energy per supercell generalized for varying number of atoms in the latter. The epitaxial relationships at the Si/NC interfaces and the optical properties are obtained and found to be in a reasonable agreement with experimental data. Dielectric functions show significant sensitivity to the NC’s orientation relative to the matrix at energies below 0.5 eV.

Theoretical approach to embed nanocrystallites into a bulk crystalline matrix and the embedding influence on the electronic band structure and optical properties of the resulting heterostructures.

PubMed

Balagan, Semyon Anatolyevich; Nazarov, Vladimir U; Shevlyagin, Alexander Vladimirovich; Goroshko, Dmitrii L; Galkin, N G

2018-05-03

We develop an approach and present results of the combined molecular dynamics and density functional theory calculations of the structural and optical properties of the nanometer-sized crystallites embedded in a bulk crystalline matrix. The method is designed and implemented for both compatible and incompatible lattices of the nanocrystallite (NC) and the host matrix, when determining the NC optimal orientation relative to the matrix constitutes a challenging problem. We suggest and substantiate an expression for the cost function of the search algorithm, which is the energy per supercell generalized for varying number of atoms in the latter. The epitaxial relationships at the Si/NC interfaces and the optical properties are obtained and found to be in a reasonable agreement with experimental data. Dielectric functions show significant sensitivity to the NC's orientation relative to the matrix at energies below 0.5 eV. © 2018 IOP Publishing Ltd.

Low-energy electron scattering from CO. 2: Ab-initio study using the frame-transformation theory

NASA Technical Reports Server (NTRS)

Chandra, N.

1976-01-01

The Wigner-Eisenbud R matrix method has been combined with the frame transformation theory to study electron scattering from molecular systems. The R matrix, calculated at the boundary point of the molecular core radius, has been transformed to the space frame in order to continue the solution of the scattering equations in the outer region where rotational motion of the nuclei is taken into account. This procedure has been applied to a model calculation of thermal energy electron scattering from CO.

Efficient evaluation of the Coulomb force in the Gaussian and finite-element Coulomb method.

PubMed

Kurashige, Yuki; Nakajima, Takahito; Sato, Takeshi; Hirao, Kimihiko

2010-06-28

We propose an efficient method for evaluating the Coulomb force in the Gaussian and finite-element Coulomb (GFC) method, which is a linear-scaling approach for evaluating the Coulomb matrix and energy in large molecular systems. The efficient evaluation of the analytical gradient in the GFC is not straightforward as well as the evaluation of the energy because the SCF procedure with the Coulomb matrix does not give a variational solution for the Coulomb energy. Thus, an efficient approximate method is alternatively proposed, in which the Coulomb potential is expanded in the Gaussian and finite-element auxiliary functions as done in the GFC. To minimize the error in the gradient not just in the energy, the derived functions of the original auxiliary functions of the GFC are used additionally for the evaluation of the Coulomb gradient. In fact, the use of the derived functions significantly improves the accuracy of this approach. Although these additional auxiliary functions enlarge the size of the discretized Poisson equation and thereby increase the computational cost, it maintains the near linear scaling as the GFC and does not affects the overall efficiency of the GFC approach.

WE-FG-207B-04: Noise Suppression for Energy-Resolved CT Via Variance Weighted Non-Local Filtration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harms, J; Zhu, L

Purpose: The photon starvation problem is exacerbated in energy-resolved CT, since the detected photons are shared by multiple energy channels. Using pixel similarity-based non-local filtration, we aim to produce accurate and high-resolution energy-resolved CT images with significantly reduced noise. Methods: Averaging CT images reconstructed from different energy channels reduces noise at the price of losing spectral information, while conventional denoising techniques inevitably degrade image resolution. Inspired by the fact that CT images of the same object at different energies share the same structures, we aim to reduce noise of energy-resolved CT by averaging only pixels of similar materials - amore » non-local filtration technique. For each CT image, an empirical exponential model is used to calculate the material similarity between two pixels based on their CT values and the similarity values are organized in a matrix form. A final similarity matrix is generated by averaging these similarity matrices, with weights inversely proportional to the estimated total noise variance in the sinogram of different energy channels. Noise suppression is achieved for each energy channel via multiplying the image vector by the similarity matrix. Results: Multiple scans on a tabletop CT system are used to simulate 6-channel energy-resolved CT, with energies ranging from 75 to 125 kVp. On a low-dose acquisition at 15 mA of the Catphan©600 phantom, our method achieves the same image spatial resolution as a high-dose scan at 80 mA with a noise standard deviation (STD) lower by a factor of >2. Compared with another non-local noise suppression algorithm (ndiNLM), the proposed algorithms obtains images with substantially improved resolution at the same level of noise reduction. Conclusion: We propose a noise-suppression method for energy-resolved CT. Our method takes full advantage of the additional structural information provided by energy-resolved CT and preserves image values at each energy level. Research reported in this publication was supported by the National Institute Of Biomedical Imaging And Bioengineering of the National Institutes of Health under Award Number R21EB019597. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.« less

Efficient calculation of beyond RPA correlation energies in the dielectric matrix formalism

NASA Astrophysics Data System (ADS)

Beuerle, Matthias; Graf, Daniel; Schurkus, Henry F.; Ochsenfeld, Christian

2018-05-01

We present efficient methods to calculate beyond random phase approximation (RPA) correlation energies for molecular systems with up to 500 atoms. To reduce the computational cost, we employ the resolution-of-the-identity and a double-Laplace transform of the non-interacting polarization propagator in conjunction with an atomic orbital formalism. Further improvements are achieved using integral screening and the introduction of Cholesky decomposed densities. Our methods are applicable to the dielectric matrix formalism of RPA including second-order screened exchange (RPA-SOSEX), the RPA electron-hole time-dependent Hartree-Fock (RPA-eh-TDHF) approximation, and RPA renormalized perturbation theory using an approximate exchange kernel (RPA-AXK). We give an application of our methodology by presenting RPA-SOSEX benchmark results for the L7 test set of large, dispersion dominated molecules, yielding a mean absolute error below 1 kcal/mol. The present work enables calculating beyond RPA correlation energies for significantly larger molecules than possible to date, thereby extending the applicability of these methods to a wider range of chemical systems.

Spectrofluorimetric assessment of hydrochlorothiazide using optical sensor nano-composite terbium ion doped in sol-gel matrix.

PubMed

Youssef, A O

2012-05-01

A new, simple, sensitive and selective spectrofluorimetric method for the determination of Hydrochlorothiazide was developed in acetonitrile at pH 6.2. The Hydrochlorothiazide can remarkably enhance the luminescence intensity of the Tb(3+) ion doped in sol-gel matrix at λ(ex) = 370 nm. The intensity of the emission band of Tb(3+) ion doped in sol-gel matrix was increased due to the energy transfer from the triplet excited state of Hydrochlorothiazide to ((5)D(4)) excited energy state of Tb(3) ion. The enhancement of the emission band of Tb(3+) ion doped in sol-gel matrix at ((5)D(4)→(7)F(5)) 545 nm was directly proportion to the concentration of Hydrochlorothiazide with a dynamic ranges of 5.0 × 10(-10)-5.0 × 10(-6) mol L(-1) and detection limit of 2.2 × 10(-11) mol L(-1).

The program LOPT for least-squares optimization of energy levels

NASA Astrophysics Data System (ADS)

Kramida, A. E.

2011-02-01

The article describes a program that solves the least-squares optimization problem for finding the energy levels of a quantum-mechanical system based on a set of measured energy separations or wavelengths of transitions between those energy levels, as well as determining the Ritz wavelengths of transitions and their uncertainties. The energy levels are determined by solving the matrix equation of the problem, and the uncertainties of the Ritz wavenumbers are determined from the covariance matrix of the problem. Program summaryProgram title: LOPT Catalogue identifier: AEHM_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEHM_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 19 254 No. of bytes in distributed program, including test data, etc.: 427 839 Distribution format: tar.gz Programming language: Perl v.5 Computer: PC, Mac, Unix workstations Operating system: MS Windows (XP, Vista, 7), Mac OS X, Linux, Unix (AIX) RAM: 3 Mwords or more Word size: 32 or 64 Classification: 2.2 Nature of problem: The least-squares energy-level optimization problem, i.e., finding a set of energy level values that best fits the given set of transition intervals. Solution method: The solution of the least-squares problem is found by solving the corresponding linear matrix equation, where the matrix is constructed using a new method with variable substitution. Restrictions: A practical limitation on the size of the problem N is imposed by the execution time, which scales as N and depends on the computer. Unusual features: Properly rounds the resulting data and formats the output in a format suitable for viewing with spreadsheet editing software. Estimates numerical errors resulting from the limited machine precision. Running time: 1 s for N=100, or 60 s for N=400 on a typical PC.

A real time spectrum to dose conversion system

NASA Technical Reports Server (NTRS)

Farmer, B. J.; Johnson, J. H.; Bagwell, R. G.

1972-01-01

A system has been developed which permits the determination of dose in real time or near real time directly from the pulse-height output of a radiation spectrometer. The technique involves the use of the resolution matrix of a spectrometer, the radiation energy-to-dose conversion function, and the geometrical factors, although the order of matrix operations is reversed. The new technique yields a result which is mathematically identical to the standard method while requiring no matrix manipulations or resolution matrix storage in the remote computer. It utilizes only a single function for each type dose required and each geometric factor involved.

Accurate Exchange-Correlation Energies for the Warm Dense Electron Gas.

PubMed

Malone, Fionn D; Blunt, N S; Brown, Ethan W; Lee, D K K; Spencer, J S; Foulkes, W M C; Shepherd, James J

2016-09-09

The density matrix quantum Monte Carlo (DMQMC) method is used to sample exact-on-average N-body density matrices for uniform electron gas systems of up to 10^{124} matrix elements via a stochastic solution of the Bloch equation. The results of these calculations resolve a current debate over the accuracy of the data used to parametrize finite-temperature density functionals. Exchange-correlation energies calculated using the real-space restricted path-integral formalism and the k-space configuration path-integral formalism disagree by up to ∼10% at certain reduced temperatures T/T_{F}≤0.5 and densities r_{s}≤1. Our calculations confirm the accuracy of the configuration path-integral Monte Carlo results available at high density and bridge the gap to lower densities, providing trustworthy data in the regime typical of planetary interiors and solids subject to laser irradiation. We demonstrate that the DMQMC method can calculate free energies directly and present exact free energies for T/T_{F}≥1 and r_{s}≤2.

Coupled Modeling of Hydrodynamics and Sound in Coastal Ocean for Renewable Ocean Energy Development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, Wen; Jung, Ki Won; Yang, Zhaoqing

An underwater sound model was developed to simulate sound propagation from marine and hydrokinetic energy (MHK) devices or offshore wind (OSW) energy platforms. Finite difference methods were developed to solve the 3D Helmholtz equation for sound propagation in the coastal environment. A 3D sparse matrix solver with complex coefficients was formed for solving the resulting acoustic pressure field. The Complex Shifted Laplacian Preconditioner (CSLP) method was applied to solve the matrix system iteratively with MPI parallelization using a high performance cluster. The sound model was then coupled with the Finite Volume Community Ocean Model (FVCOM) for simulating sound propagation generatedmore » by human activities, such as construction of OSW turbines or tidal stream turbine operations, in a range-dependent setting. As a proof of concept, initial validation of the solver is presented for two coastal wedge problems. This sound model can be useful for evaluating impacts on marine mammals due to deployment of MHK devices and OSW energy platforms.« less

Solutions of the two-dimensional Hubbard model: Benchmarks and results from a wide range of numerical algorithms

DOE PAGES

LeBlanc, J. P. F.; Antipov, Andrey E.; Becca, Federico; ...

2015-12-14

Numerical results for ground-state and excited-state properties (energies, double occupancies, and Matsubara-axis self-energies) of the single-orbital Hubbard model on a two-dimensional square lattice are presented, in order to provide an assessment of our ability to compute accurate results in the thermodynamic limit. Many methods are employed, including auxiliary-field quantum Monte Carlo, bare and bold-line diagrammatic Monte Carlo, method of dual fermions, density matrix embedding theory, density matrix renormalization group, dynamical cluster approximation, diffusion Monte Carlo within a fixed-node approximation, unrestricted coupled cluster theory, and multireference projected Hartree-Fock methods. Comparison of results obtained by different methods allows for the identification ofmore » uncertainties and systematic errors. The importance of extrapolation to converged thermodynamic-limit values is emphasized. Furthermore, cases where agreement between different methods is obtained establish benchmark results that may be useful in the validation of new approaches and the improvement of existing methods.« less

Dynamical mean-field theory, density-matrix embedding theory, and rotationally invariant slave bosons: A unified perspective

NASA Astrophysics Data System (ADS)

Ayral, Thomas; Lee, Tsung-Han; Kotliar, Gabriel

2017-12-01

We present a unified perspective on dynamical mean-field theory (DMFT), density-matrix embedding theory (DMET), and rotationally invariant slave bosons (RISB). We show that DMET can be regarded as a simplification of the RISB method where the quasiparticle weight is set to unity. This relation makes it easy to transpose extensions of a given method to another: For instance, a temperature-dependent version of RISB can be used to derive a temperature-dependent free-energy formula for DMET.

Constructing the GW self-energy of a point defect from the perfect crystal and the near neighborhood of the defect

NASA Astrophysics Data System (ADS)

Skachkov, Dmitry; van Schilfgaarde, Mark; Lambrecht, Walter

The full-potential linearized muffin-tin orbital method allows for a real space representation of the GW or quasi-particle self-consistent (QS)GW self-energy ΣR , L ; R' + T , L'. This can be used to construct the self-energy matrix for a point defect system in a large supercell from that of the perfect crystal in the primitive cell and the self-energy of the defect site and its near neighborhood, obtained self-consistently in a smaller supercell. At the interface between both regions we can average the two types of ΣR , L ; R' + T , L' matrix blocks. The result relies on the limited range of the self-energy matrix in real space. It means that we can calculate the quasiparticle energy levels of the defect system at essentially the cost of a DFT calculation and a few QSGW calculations for relatively small systems. The approach presently focuses on quasiparticle energy levels of band structures of the defect system rather than total energies. We will present test results for AsGa\\ in GaAs, ZnGe in ZnGeN2, NO, VO, VZn, and NO - VZn in ZnO. Supported by the US-DOE-BES under Grant No. DE-SC0008933.

Inelastic scattering matrix elements for the nonadiabatic collision B(2P1/2)+H2(1Sigmag+,j)<-->B(2P3/2)+H2(1Sigmag+,j').

PubMed

Weeks, David E; Niday, Thomas A; Yang, Sang H

2006-10-28

Inelastic scattering matrix elements for the nonadiabatic collision B(2P1/2)+H2(1Sigmag+,j)<-->B(2P3/2)+H2(1Sigmag+,j') are calculated using the time dependent channel packet method (CPM). The calculation employs 1 2A', 2 2A', and 1 2A" adiabatic electronic potential energy surfaces determined by numerical computation at the multireference configuration-interaction level [M. H. Alexander, J. Chem. Phys. 99, 6041 (1993)]. The 1 2A' and 2 2A', adiabatic electronic potential energy surfaces are transformed to yield diabatic electronic potential energy surfaces that, when combined with the total B+H2 rotational kinetic energy, yield a set of effective potential energy surfaces [M. H. Alexander et al., J. Chem. Phys. 103, 7956 (1995)]. Within the framework of the CPM, the number of effective potential energy surfaces used for the scattering matrix calculation is then determined by the size of the angular momentum basis used as a representation. Twenty basis vectors are employed for these calculations, and the corresponding effective potential energy surfaces are identified in the asymptotic limit by the H2 rotor quantum numbers j=0, 2, 4, 6 and B electronic states 2Pja, ja=1/2, 3/2. Scattering matrix elements are obtained from the Fourier transform of the correlation function between channel packets evolving in time on these effective potential energy surfaces. For these calculations the H2 bond length is constrained to a constant value of req=1.402 a.u. and state to state scattering matrix elements corresponding to a total angular momentum of J=1/2 are discussed for j=0<-->j'=0,2,4 and 2P1/2<-->2P1/2, 2P3/2 over a range of total energy between 0.0 and 0.01 a.u.

The TileCal Online Energy Estimation for the Next LHC Operation Period

NASA Astrophysics Data System (ADS)

Sotto-Maior Peralva, B.; ATLAS Collaboration

2015-05-01

The ATLAS Tile Calorimeter (TileCal) is the detector used in the reconstruction of hadrons, jets and missing transverse energy from the proton-proton collisions at the Large Hadron Collider (LHC). It covers the central part of the ATLAS detector (|η| < 1.6). The energy deposited by the particles is read out by approximately 5,000 cells, with double readout channels. The signal provided by the readout electronics for each channel is digitized at 40 MHz and its amplitude is estimated by an optimal filtering algorithm, which expects a single signal with a well-defined shape. However, the LHC luminosity is expected to increase leading to pile-up that deforms the signal of interest. Due to limited resources, the current hardware setup, which is based on Digital Signal Processors (DSP), does not allow the implementation of sophisticated energy estimation methods that deal with the pile-up. Therefore, the technique to be employed for online energy estimation in TileCal for next LHC operation period must be based on fast filters such as the Optimal Filter (OF) and the Matched Filter (MF). Both the OF and MF methods envisage the use of the background second order statistics in its design, more precisely the covariance matrix. However, the identity matrix has been used to describe this quantity. Although this approximation can be valid for low luminosity LHC, it leads to biased estimators under pile- up conditions. Since most of the TileCal cell present low occupancy, the pile-up, which is often modeled by a non-Gaussian distribution, can be seen as outlier events. Consequently, the classical covariance matrix estimation does not describe correctly the second order statistics of the background for the majority of the events, as this approach is very sensitive to outliers. As a result, the OF (or MF) coefficients are miscalculated leading to a larger variance and biased energy estimator. This work evaluates the usage of a robust covariance estimator, namely the Minimum Covariance Determinant (MCD) algorithm, to be applied in the OF design. The goal of the MCD estimator is to find a number of observations whose classical covariance matrix has the lowest determinant. Hence, this procedure avoids taking into account low likelihood events to describe the background. It is worth mentioning that the background covariance matrix as well as the OF coefficients for each TileCal channel are computed offline and stored for both online and offline use. In order to evaluate the impact of the MCD estimator on the performance of the OF, simulated data sets were used. Different average numbers of interactions per bunch crossing and bunch spacings were tested. The results show that the estimation of the background covariance matrix through MCD improves significantly the final energy resolution with respect to the identity matrix which is currently used. Particularly, for high occupancy cells, the final energy resolution is improved by more than 20%. Moreover, the use of the classical covariance matrix degrades the energy resolution for the majority of TileCal cells.

A component prediction method for flue gas of natural gas combustion based on nonlinear partial least squares method.

PubMed

Cao, Hui; Yan, Xingyu; Li, Yaojiang; Wang, Yanxia; Zhou, Yan; Yang, Sanchun

2014-01-01

Quantitative analysis for the flue gas of natural gas-fired generator is significant for energy conservation and emission reduction. The traditional partial least squares method may not deal with the nonlinear problems effectively. In the paper, a nonlinear partial least squares method with extended input based on radial basis function neural network (RBFNN) is used for components prediction of flue gas. For the proposed method, the original independent input matrix is the input of RBFNN and the outputs of hidden layer nodes of RBFNN are the extension term of the original independent input matrix. Then, the partial least squares regression is performed on the extended input matrix and the output matrix to establish the components prediction model of flue gas. A near-infrared spectral dataset of flue gas of natural gas combustion is used for estimating the effectiveness of the proposed method compared with PLS. The experiments results show that the root-mean-square errors of prediction values of the proposed method for methane, carbon monoxide, and carbon dioxide are, respectively, reduced by 4.74%, 21.76%, and 5.32% compared to those of PLS. Hence, the proposed method has higher predictive capabilities and better robustness.

Method Of Signal Amplification In Multi-Chromophore Luminescence Sensors

DOEpatents

Levitsky, Igor A.; Krivoshlykov, Sergei G.

2004-02-03

A fluorescence-based method for highly sensitive and selective detection of analyte molecules is proposed. The method employs the energy transfer between two or more fluorescent chromophores in a carefully selected polymer matrix. In one preferred embodiment, signal amplification has been achieved in the fluorescent sensing of dimethyl methylphosphonate (DMMP) using two dyes, 3-aminofluoranthene (AM) and Nile Red (NR), in a hydrogen bond acidic polymer matrix. The selected polymer matrix quenches the fluorescence of both dyes and shifts dye emission and absorption spectra relative to more inert matrices. Upon DMMP sorption, the AM fluorescence shifts to the red at the same time the NR absorption shifts to the blue, resulting in better band overlap and increased energy transfer between chromophores. In another preferred embodiment, the sensitive material is incorporated into an optical fiber system enabling efficient excitation of the dye and collecting the fluorescent signal form the sensitive material on the remote end of the system. The proposed method can be applied to multichromophore luminescence sensor systems incorporating N-chromophores leading to N-fold signal amplification and improved selectivity. The method can be used in all applications where highly sensitive detection of basic gases, such as dimethyl methylphosphonate (DMMP), Sarin, Soman and other chemical warfare agents having basic properties, is required, including environmental monitoring, chemical industry and medicine.

A real-space stochastic density matrix approach for density functional electronic structure.

PubMed

Beck, Thomas L

2015-12-21

The recent development of real-space grid methods has led to more efficient, accurate, and adaptable approaches for large-scale electrostatics and density functional electronic structure modeling. With the incorporation of multiscale techniques, linear-scaling real-space solvers are possible for density functional problems if localized orbitals are used to represent the Kohn-Sham energy functional. These methods still suffer from high computational and storage overheads, however, due to extensive matrix operations related to the underlying wave function grid representation. In this paper, an alternative stochastic method is outlined that aims to solve directly for the one-electron density matrix in real space. In order to illustrate aspects of the method, model calculations are performed for simple one-dimensional problems that display some features of the more general problem, such as spatial nodes in the density matrix. This orbital-free approach may prove helpful considering a future involving increasingly parallel computing architectures. Its primary advantage is the near-locality of the random walks, allowing for simultaneous updates of the density matrix in different regions of space partitioned across the processors. In addition, it allows for testing and enforcement of the particle number and idempotency constraints through stabilization of a Feynman-Kac functional integral as opposed to the extensive matrix operations in traditional approaches.

Prediction of thermal cycling induced matrix cracking

NASA Technical Reports Server (NTRS)

Mcmanus, Hugh L.

1992-01-01

Thermal fatigue has been observed to cause matrix cracking in laminated composite materials. A method is presented to predict transverse matrix cracks in composite laminates subjected to cyclic thermal load. Shear lag stress approximations and a simple energy-based fracture criteria are used to predict crack densities as a function of temperature. Prediction of crack densities as a function of thermal cycling is accomplished by assuming that fatigue degrades the material's inherent resistance to cracking. The method is implemented as a computer program. A simple experiment provides data on progressive cracking of a laminate with decreasing temperature. Existing data on thermal fatigue is also used. Correlations of the analytical predictions to the data are very good. A parametric study using the analytical method is presented which provides insight into material behavior under cyclical thermal loads.

Anderson acceleration and application to the three-temperature energy equations

NASA Astrophysics Data System (ADS)

An, Hengbin; Jia, Xiaowei; Walker, Homer F.

2017-10-01

The Anderson acceleration method is an algorithm for accelerating the convergence of fixed-point iterations, including the Picard method. Anderson acceleration was first proposed in 1965 and, for some years, has been used successfully to accelerate the convergence of self-consistent field iterations in electronic-structure computations. Recently, the method has attracted growing attention in other application areas and among numerical analysts. Compared with a Newton-like method, an advantage of Anderson acceleration is that there is no need to form the Jacobian matrix. Thus the method is easy to implement. In this paper, an Anderson-accelerated Picard method is employed to solve the three-temperature energy equations, which are a type of strong nonlinear radiation-diffusion equations. Two strategies are used to improve the robustness of the Anderson acceleration method. One strategy is to adjust the iterates when necessary to satisfy the physical constraint. Another strategy is to monitor and, if necessary, reduce the matrix condition number of the least-squares problem in the Anderson-acceleration implementation so that numerical stability can be guaranteed. Numerical results show that the Anderson-accelerated Picard method can solve the three-temperature energy equations efficiently. Compared with the Picard method without acceleration, Anderson acceleration can reduce the number of iterations by at least half. A comparison between a Jacobian-free Newton-Krylov method, the Picard method, and the Anderson-accelerated Picard method is conducted in this paper.

On the matrix Fourier filtering problem for a class of models of nonlinear optical systems with a feedback

NASA Astrophysics Data System (ADS)

Razgulin, A. V.; Sazonova, S. V.

2017-09-01

A novel statement of the Fourier filtering problem based on the use of matrix Fourier filters instead of conventional multiplier filters is considered. The basic properties of the matrix Fourier filtering for the filters in the Hilbert-Schmidt class are established. It is proved that the solutions with a finite energy to the periodic initial boundary value problem for the quasi-linear functional differential diffusion equation with the matrix Fourier filtering Lipschitz continuously depend on the filter. The problem of optimal matrix Fourier filtering is formulated, and its solvability for various classes of matrix Fourier filters is proved. It is proved that the objective functional is differentiable with respect to the matrix Fourier filter, and the convergence of a version of the gradient projection method is also proved.

Lead free Bi0.5Na0.5TiO3 (BNT) and polyvinylidene fluoride (PVDF) based nanocomposite for energy storage applications

NASA Astrophysics Data System (ADS)

Pradhan, Lagen Kumar; Pandey, Rabichandra; Kumar, Sunil; Kar, Manoranjan

2018-05-01

Novel ceramic-polymer nanocomposites have great potential for electrical energy storage applications due to its high energy storage density. In the present work, BNT and PVDF based flexible polymer nanocomposites (BNT-PVDF) with different volume fraction (ϕ = 0, 5, 10, 15) were fabricated by solution casting method. Enhancement in beta phase of PVDF polymer matrix with the volume fraction (ϕ = 5, 10, 15) of BNT has been confirmed by X-ray diffraction (XRD) technique as well as Fourier transform infrared (FTIR) spectroscopy analysis. The enhancement of β phase increases as compared to (α) phases with volume fraction (ϕ) of nanofiller (BNT) in the matrix (PVDF) due to internal stress at the interface as well as structural modification of PVDF matrix. BNT-PVDF nanocomposites (with ϕ=10) showed a high dielectric constant (ɛr ≈ 78) relative to pure PVDF (ɛr ≈ 10) at 100 Hz. In addition to this, it exhibits relaxor type ferroelectric behavior with energy storage efficiency up to 77% for the volume fraction (ϕ) of 10.

Multiple cracking of unidirectional and cross-ply ceramic matrix composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuo, W.S.; Chou, T.W.

1995-03-01

This paper examines the multiple cracking behavior of unidirectional and cross-ply ceramic matrix composites. For unidirectional composites, a model of concentric cylinders with finite crack spacing and debonding length is introduced. Stresses in the fiber and matrix are found and then applied to predict the composite moduli. Using an energy balance method, critical stresses for matrix cracking initiation are predicted. Effects of interfacial shear stress, debonding length and bonding energy on the critical stress are studied. All the three composite systems examined show that the critical stress for the completely debonded case is lower than that for the perfectly bondedmore » case. For crossply composites, an extensive study has been made for the transverse cracking in 90{degree} plies and the matrix cracking in 0{degree} plies. One transverse cracking and four matrix cracking modes are studied, and closed-form solutions of the critical stresses are obtained. The results indicate that the case of combined matrix and transverse crackings with associated fiber/matrix interfacial sliding in the 0{degree} plies gives the lowest critical stress for matrix cracking. The theoretical predictions are compared with experimental data of SiC/CAS cross-ply composites; both results demonstrated that an increase in the transverse ply thickness reduces the critical stress for matrix cracking in the longitudinal plies. The effects of fiber volume fraction and fiber modulus on the critical stress have been quantified. Thermal residual stresses are included in the analysis.« less

An approach for the assessment of the statistical aspects of the SEA coupling loss factors and the vibrational energy transmission in complex aircraft structures: Experimental investigation and methods benchmark

NASA Astrophysics Data System (ADS)

Bouhaj, M.; von Estorff, O.; Peiffer, A.

2017-09-01

In the application of Statistical Energy Analysis "SEA" to complex assembled structures, a purely predictive model often exhibits errors. These errors are mainly due to a lack of accurate modelling of the power transmission mechanism described through the Coupling Loss Factors (CLF). Experimental SEA (ESEA) is practically used by the automotive and aerospace industry to verify and update the model or to derive the CLFs for use in an SEA predictive model when analytical estimates cannot be made. This work is particularly motivated by the lack of procedures that allow an estimate to be made of the variance and confidence intervals of the statistical quantities when using the ESEA technique. The aim of this paper is to introduce procedures enabling a statistical description of measured power input, vibration energies and the derived SEA parameters. Particular emphasis is placed on the identification of structural CLFs of complex built-up structures comparing different methods. By adopting a Stochastic Energy Model (SEM), the ensemble average in ESEA is also addressed. For this purpose, expressions are obtained to randomly perturb the energy matrix elements and generate individual samples for the Monte Carlo (MC) technique applied to derive the ensemble averaged CLF. From results of ESEA tests conducted on an aircraft fuselage section, the SEM approach provides a better performance of estimated CLFs compared to classical matrix inversion methods. The expected range of CLF values and the synthesized energy are used as quality criteria of the matrix inversion, allowing to assess critical SEA subsystems, which might require a more refined statistical description of the excitation and the response fields. Moreover, the impact of the variance of the normalized vibration energy on uncertainty of the derived CLFs is outlined.

Matrix-Assisted Plasma Atomization Emission Spectrometry for Surface Sampling Elemental Analysis

PubMed Central

Yuan, Xin; Zhan, Xuefang; Li, Xuemei; Zhao, Zhongjun; Duan, Yixiang

2016-01-01

An innovative technology has been developed involving a simple and sensitive optical spectrometric method termed matrix-assisted plasma atomization emission spectrometry (MAPAES) for surface sampling elemental analysis using a piece of filter paper (FP) for sample introduction. MAPAES was carried out by direct interaction of the plasma tail plume with the matrix surface. The FP absorbs energy from the plasma source and releases combustion heating to the analytes originally present on its surface, thus to promote the atomization and excitation process. The matrix-assisted plasma atomization excitation phenomenon was observed for multiple elements. The FP matrix served as the partial energy producer and also the sample substrate to adsorb sample solution. Qualitative and quantitative determinations of metal ions were achieved by atomic emission measurements for elements Ba, Cu, Eu, In, Mn, Ni, Rh and Y. The detection limits were down to pg level with linear correlation coefficients better than 0.99. The proposed MAPAES provides a new way for atomic spectrometry which offers advantages of fast analysis speed, little sample consumption, less sample pretreatment, small size, and cost-effective. PMID:26762972

Relativistic calculation of correlational energy for a helium-like atom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palchikov, V.G.

This paper presents an analytical method for calculating the firstorder correlational energy from the electron interaction, taking account of lag effects. Explicit analytical expressions are obtained for radial matrix elements. The nonrelativistic limit is investigated. The given method may be used to calculate correlation effects in higher orders of perturbation theory (second and higher orders with respect to 1/z) using the Strum expansion for the Coulomb Green's functions.

Emergy Algebra: Improving Matrix Methods for Calculating Tranformities

EPA Science Inventory

Transformity is one of the core concepts in Energy Systems Theory and it is fundamental to the calculation of emergy. Accurate evaluation of transformities and other emergy per unit values is essential for the broad acceptance, application and further development of emergy method...

Attractive electron-electron interactions within robust local fitting approximations.

PubMed

Merlot, Patrick; Kjærgaard, Thomas; Helgaker, Trygve; Lindh, Roland; Aquilante, Francesco; Reine, Simen; Pedersen, Thomas Bondo

2013-06-30

An analysis of Dunlap's robust fitting approach reveals that the resulting two-electron integral matrix is not manifestly positive semidefinite when local fitting domains or non-Coulomb fitting metrics are used. We present a highly local approximate method for evaluating four-center two-electron integrals based on the resolution-of-the-identity (RI) approximation and apply it to the construction of the Coulomb and exchange contributions to the Fock matrix. In this pair-atomic resolution-of-the-identity (PARI) approach, atomic-orbital (AO) products are expanded in auxiliary functions centered on the two atoms associated with each product. Numerical tests indicate that in 1% or less of all Hartree-Fock and Kohn-Sham calculations, the indefinite integral matrix causes nonconvergence in the self-consistent-field iterations. In these cases, the two-electron contribution to the total energy becomes negative, meaning that the electronic interaction is effectively attractive, and the total energy is dramatically lower than that obtained with exact integrals. In the vast majority of our test cases, however, the indefiniteness does not interfere with convergence. The total energy accuracy is comparable to that of the standard Coulomb-metric RI method. The speed-up compared with conventional algorithms is similar to the RI method for Coulomb contributions; exchange contributions are accelerated by a factor of up to eight with a triple-zeta quality basis set. A positive semidefinite integral matrix is recovered within PARI by introducing local auxiliary basis functions spanning the full AO product space, as may be achieved by using Cholesky-decomposition techniques. Local completion, however, slows down the algorithm to a level comparable with or below conventional calculations. Copyright © 2013 Wiley Periodicals, Inc.

Finite element analysis of damped vibrations of laminated composite plates

NASA Astrophysics Data System (ADS)

Hu, Baogang

1992-11-01

Damped free vibrations of composite laminates are subjected to macromechanical analysis. Two models are developed: a viscoelastic damping model and a specific damping capacity model. The important symmetry property of the damping matrix is retained in both models. A modified modal strain energy method is proposed for evaluating modal damping in the viscoelastic model using a real (instead of a complex) eigenvalue problem solution. Numerical studies of multidegree of freedom systems are conducted to illustrate the improved accuracy of the method compared to the modal strain energy method. The experimental data reported in the literature for damped free vibrations in both polymer matrix and metal matrix composites were used in finite element analysis to test and compare the damping models. The natural frequencies and modal damping were obtained using both the viscoelastic and specific models. Results from both models are in satisfactory agreement with experimental data. Both models were found to be reasonably accurate for systems with low damping. Parametric studies were conducted to examine the effects on damping of the side to thickness ratio, the principal moduli ratio, the total number of layers, the ply angle, and the boundary conditions.

Linear-scaling implementation of molecular response theory in self-consistent field electronic-structure theory.

PubMed

Coriani, Sonia; Høst, Stinne; Jansík, Branislav; Thøgersen, Lea; Olsen, Jeppe; Jørgensen, Poul; Reine, Simen; Pawłowski, Filip; Helgaker, Trygve; Sałek, Paweł

2007-04-21

A linear-scaling implementation of Hartree-Fock and Kohn-Sham self-consistent field theories for the calculation of frequency-dependent molecular response properties and excitation energies is presented, based on a nonredundant exponential parametrization of the one-electron density matrix in the atomic-orbital basis, avoiding the use of canonical orbitals. The response equations are solved iteratively, by an atomic-orbital subspace method equivalent to that of molecular-orbital theory. Important features of the subspace method are the use of paired trial vectors (to preserve the algebraic structure of the response equations), a nondiagonal preconditioner (for rapid convergence), and the generation of good initial guesses (for robust solution). As a result, the performance of the iterative method is the same as in canonical molecular-orbital theory, with five to ten iterations needed for convergence. As in traditional direct Hartree-Fock and Kohn-Sham theories, the calculations are dominated by the construction of the effective Fock/Kohn-Sham matrix, once in each iteration. Linear complexity is achieved by using sparse-matrix algebra, as illustrated in calculations of excitation energies and frequency-dependent polarizabilities of polyalanine peptides containing up to 1400 atoms.

A general solution strategy of modified power method for higher mode solutions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Peng; Lee, Hyunsuk; Lee, Deokjung, E-mail: deokjung@unist.ac.kr

2016-01-15

A general solution strategy of the modified power iteration method for calculating higher eigenmodes has been developed and applied in continuous energy Monte Carlo simulation. The new approach adopts four features: 1) the eigen decomposition of transfer matrix, 2) weight cancellation for higher modes, 3) population control with higher mode weights, and 4) stabilization technique of statistical fluctuations using multi-cycle accumulations. The numerical tests of neutron transport eigenvalue problems successfully demonstrate that the new strategy can significantly accelerate the fission source convergence with stable convergence behavior while obtaining multiple higher eigenmodes at the same time. The advantages of the newmore » strategy can be summarized as 1) the replacement of the cumbersome solution step of high order polynomial equations required by Booth's original method with the simple matrix eigen decomposition, 2) faster fission source convergence in inactive cycles, 3) more stable behaviors in both inactive and active cycles, and 4) smaller variances in active cycles. Advantages 3 and 4 can be attributed to the lower sensitivity of the new strategy to statistical fluctuations due to the multi-cycle accumulations. The application of the modified power method to continuous energy Monte Carlo simulation and the higher eigenmodes up to 4th order are reported for the first time in this paper. -- Graphical abstract: -- Highlights: •Modified power method is applied to continuous energy Monte Carlo simulation. •Transfer matrix is introduced to generalize the modified power method. •All mode based population control is applied to get the higher eigenmodes. •Statistic fluctuation can be greatly reduced using accumulated tally results. •Fission source convergence is accelerated with higher mode solutions.« less

Dynamical mean-field theory, density-matrix embedding theory, and rotationally invariant slave bosons: A unified perspective

DOE PAGES

Ayral, Thomas; Lee, Tsung-Han; Kotliar, Gabriel

2017-12-26

In this paper, we present a unified perspective on dynamical mean-field theory (DMFT), density-matrix embedding theory (DMET), and rotationally invariant slave bosons (RISB). We show that DMET can be regarded as a simplification of the RISB method where the quasiparticle weight is set to unity. Finally, this relation makes it easy to transpose extensions of a given method to another: For instance, a temperature-dependent version of RISB can be used to derive a temperature-dependent free-energy formula for DMET.

Dynamical mean-field theory, density-matrix embedding theory, and rotationally invariant slave bosons: A unified perspective

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ayral, Thomas; Lee, Tsung-Han; Kotliar, Gabriel

In this paper, we present a unified perspective on dynamical mean-field theory (DMFT), density-matrix embedding theory (DMET), and rotationally invariant slave bosons (RISB). We show that DMET can be regarded as a simplification of the RISB method where the quasiparticle weight is set to unity. Finally, this relation makes it easy to transpose extensions of a given method to another: For instance, a temperature-dependent version of RISB can be used to derive a temperature-dependent free-energy formula for DMET.

G W calculations using the spectral decomposition of the dielectric matrix: Verification, validation, and comparison of methods

DOE PAGES

Pham, T. Anh; Nguyen, Huy -Viet; Rocca, Dario; ...

2013-04-26

Inmore » a recent paper we presented an approach to evaluate quasiparticle energies based on the spectral decomposition of the static dielectric matrix. This method does not require the calculation of unoccupied electronic states or the direct diagonalization of large dielectric matrices, and it avoids the use of plasmon-pole models. The numerical accuracy of the approach is controlled by a single parameter, i.e., the number of eigenvectors used in the spectral decomposition of the dielectric matrix. Here we present a comprehensive validation of the method, encompassing calculations of ionization potentials and electron affinities of various molecules and of band gaps for several crystalline and disordered semiconductors. Lastly, we demonstrate the efficiency of our approach by carrying out G W calculations for systems with several hundred valence electrons.« less

Truncated Conjugate Gradient: An Optimal Strategy for the Analytical Evaluation of the Many-Body Polarization Energy and Forces in Molecular Simulations.

PubMed

Aviat, Félix; Levitt, Antoine; Stamm, Benjamin; Maday, Yvon; Ren, Pengyu; Ponder, Jay W; Lagardère, Louis; Piquemal, Jean-Philip

2017-01-10

We introduce a new class of methods, denoted as Truncated Conjugate Gradient(TCG), to solve the many-body polarization energy and its associated forces in molecular simulations (i.e. molecular dynamics (MD) and Monte Carlo). The method consists in a fixed number of Conjugate Gradient (CG) iterations. TCG approaches provide a scalable solution to the polarization problem at a user-chosen cost and a corresponding optimal accuracy. The optimality of the CG-method guarantees that the number of the required matrix-vector products are reduced to a minimum compared to other iterative methods. This family of methods is non-empirical, fully adaptive, and provides analytical gradients, avoiding therefore any energy drift in MD as compared to popular iterative solvers. Besides speed, one great advantage of this class of approximate methods is that their accuracy is systematically improvable. Indeed, as the CG-method is a Krylov subspace method, the associated error is monotonically reduced at each iteration. On top of that, two improvements can be proposed at virtually no cost: (i) the use of preconditioners can be employed, which leads to the Truncated Preconditioned Conjugate Gradient (TPCG); (ii) since the residual of the final step of the CG-method is available, one additional Picard fixed point iteration ("peek"), equivalent to one step of Jacobi Over Relaxation (JOR) with relaxation parameter ω, can be made at almost no cost. This method is denoted by TCG-n(ω). Black-box adaptive methods to find good choices of ω are provided and discussed. Results show that TPCG-3(ω) is converged to high accuracy (a few kcal/mol) for various types of systems including proteins and highly charged systems at the fixed cost of four matrix-vector products: three CG iterations plus the initial CG descent direction. Alternatively, T(P)CG-2(ω) provides robust results at a reduced cost (three matrix-vector products) and offers new perspectives for long polarizable MD as a production algorithm. The T(P)CG-1(ω) level provides less accurate solutions for inhomogeneous systems, but its applicability to well-conditioned problems such as water is remarkable, with only two matrix-vector product evaluations.

Truncated Conjugate Gradient: An Optimal Strategy for the Analytical Evaluation of the Many-Body Polarization Energy and Forces in Molecular Simulations

PubMed Central

2016-01-01

We introduce a new class of methods, denoted as Truncated Conjugate Gradient(TCG), to solve the many-body polarization energy and its associated forces in molecular simulations (i.e. molecular dynamics (MD) and Monte Carlo). The method consists in a fixed number of Conjugate Gradient (CG) iterations. TCG approaches provide a scalable solution to the polarization problem at a user-chosen cost and a corresponding optimal accuracy. The optimality of the CG-method guarantees that the number of the required matrix-vector products are reduced to a minimum compared to other iterative methods. This family of methods is non-empirical, fully adaptive, and provides analytical gradients, avoiding therefore any energy drift in MD as compared to popular iterative solvers. Besides speed, one great advantage of this class of approximate methods is that their accuracy is systematically improvable. Indeed, as the CG-method is a Krylov subspace method, the associated error is monotonically reduced at each iteration. On top of that, two improvements can be proposed at virtually no cost: (i) the use of preconditioners can be employed, which leads to the Truncated Preconditioned Conjugate Gradient (TPCG); (ii) since the residual of the final step of the CG-method is available, one additional Picard fixed point iteration (“peek”), equivalent to one step of Jacobi Over Relaxation (JOR) with relaxation parameter ω, can be made at almost no cost. This method is denoted by TCG-n(ω). Black-box adaptive methods to find good choices of ω are provided and discussed. Results show that TPCG-3(ω) is converged to high accuracy (a few kcal/mol) for various types of systems including proteins and highly charged systems at the fixed cost of four matrix-vector products: three CG iterations plus the initial CG descent direction. Alternatively, T(P)CG-2(ω) provides robust results at a reduced cost (three matrix-vector products) and offers new perspectives for long polarizable MD as a production algorithm. The T(P)CG-1(ω) level provides less accurate solutions for inhomogeneous systems, but its applicability to well-conditioned problems such as water is remarkable, with only two matrix-vector product evaluations. PMID:28068773

Discharging a DC bus capacitor of an electrical converter system

DOEpatents

Kajouke, Lateef A; Perisic, Milun; Ransom, Ray M

2014-10-14

A system and method of discharging a bus capacitor of a bidirectional matrix converter of a vehicle are presented here. The method begins by electrically shorting the AC interface of the converter after an AC energy source is disconnected from the AC interface. The method continues by arranging a plurality of switching elements of a second energy conversion module into a discharge configuration to establish an electrical current path from a first terminal of an isolation module, through an inductive element, and to a second terminal of the isolation module. The method also modulates a plurality of switching elements of a first energy conversion module, while maintaining the discharge configuration of the second energy conversion module, to at least partially discharge a DC bus capacitor.

Analysis on the hot spot and trend of the foreign assembly building research

NASA Astrophysics Data System (ADS)

Bi, Xiaoqing; Luo, Yanbing

2017-03-01

First of all, the paper analyzes the research on the front of the assembly building in the past 15 years. This article mainly adopts the method of CO word analysis, construct the co word matrix, correlation matrix, and then into a dissimilarity matrix, and on this basis, using factor analysis, cluster analysis and multi scale analysis method to study the structure of prefabricated construction field display. Finally, the results of the analysis are discussed, and summarized the current research focus of foreign prefabricated construction mainly concentrated in 7 aspects: embankment construction, wood construction, bridge construction, crane layout, PCM wall and glass system, based on neural network test, energy saving and recycling, and forecast the future trend of development study.

Effect of Fiber Poisson Contraction on Matrix Multicracking Evolution of Fiber-Reinforced Ceramic-Matrix Composites

NASA Astrophysics Data System (ADS)

Longbiao, Li

2015-12-01

An analytical methodology has been developed to investigate the effect of fiber Poisson contraction on matrix multicracking evolution of fiber-reinforced ceramic-matrix composites (CMCs). The modified shear-lag model incorporated with the Coulomb friction law is adopted to solve the stress distribution in the interface slip region and intact region of the damaged composite. The critical matrix strain energy criterion which presupposes the existence of an ultimate or critical strain energy limit beyond which the matrix fails has been adopted to describe matrix multicracking of CMCs. As more energy is placed into the composite, matrix fractures and the interface debonding occurs to dissipate the extra energy. The interface debonded length under the process of matrix multicracking is obtained by treating the interface debonding as a particular crack propagation problem along the fiber/matrix interface. The effects of the interfacial frictional coefficient, fiber Poisson ratio, fiber volume fraction, interface debonded energy and cycle number on the interface debonding and matrix multicracking evolution have been analyzed. The theoretical results are compared with experimental data of unidirectional SiC/CAS, SiC/CAS-II and SiC/Borosilicate composites.

Experimental and Numerical Analysis of Axially Compressed Circular Cylindrical Fiber-Reinforced Panels with Various Boundary Conditions.

DTIC Science & Technology

1981-10-01

Numerical predictions used in the compari- sons were obtained from the energy -based, finite-difference computer proqram CLAPP. Test specimens were clamped...edges V LONGITUDINAL STIFFENERS 45 I. Introduction 45 2. Stiffener Strain Energy 46 3. Stiffener Energy in Matrix Form 47 4. Displacement Continuity 49...that theoretical bifurcation loads predicted by the energy method represent upper bounds to the classical bifurcation loads associated with the test

Modeling for Matrix Multicracking Evolution of Cross-ply Ceramic-Matrix Composites Using Energy Balance Approach

NASA Astrophysics Data System (ADS)

Longbiao, Li

2015-12-01

The matrix multicracking evolution of cross-ply ceramic-matrix composites (CMCs) has been investigated using energy balance approach. The multicracking of cross-ply CMCs was classified into five modes, i.e., (1) mode 1: transverse multicracking; (2) mode 2: transverse multicracking and matrix multicracking with perfect fiber/matrix interface bonding; (3) mode 3: transverse multicracking and matrix multicracking with fiber/matrix interface debonding; (4) mode 4: matrix multicracking with perfect fiber/matrix interface bonding; and (5) mode 5: matrix multicracking with fiber/matrix interface debonding. The stress distributions of four cracking modes, i.e., mode 1, mode 2, mode 3 and mode 5, are analysed using shear-lag model. The matrix multicracking evolution of mode 1, mode 2, mode 3 and mode 5, has been determined using energy balance approach. The effects of ply thickness and fiber volume fraction on matrix multicracking evolution of cross-ply CMCs have been investigated.

Inclusion models of tensile fracture in fiber-reinforced brittle-matrix composites. Ph.D. Thesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsai, W.

1993-12-31

Inclusion models of tensile fracture in fiber-reinforced brittle-matrix composites are proposed in this study. Three stages of matrix cracking including initiation of microcracks, propagation of a bridged crack and multiplication of periodic cracks are modeled using the unique approach - Eshelby`s equivalent inclusion method. Moreover, the interfacial debonding may occur during matrix cracking and is taken into account by the present analysis. After interfacial debonding initiates, the fiber slides against the friction which is assumed to be constant in chapter 2 and chapter 3. However, the fiber-matrix interfaces are assumed to be Coulomb`s friction controlled in chapter 4. Energy releasemore » rate and crack resistance are obtained analytically. From the fracture criterion, the equivalence of energy release rate and crack resistance, the critical applied stress is also obtained. On the critical applied stress the effects of material parameters such as interfacial frictional stress, interfacial surface energy, volume fraction of fibers, misfit strain are evaluated. These evaluations are important for the purpose of material design. Finally, it is attempted in chapter 5 to solve the crack-inhomogeneity interaction problem inhomogeneities. First, the formulation of two inhomogeneities without overlapping is derived in detail. When one of the inhomogeneities is the penny-shape crack and the other one is the ellipsoidal inhomogeneity, the interaction energy between the crack and the applied stress and the energy release rate of the crack are evaluated. Based on the framework of this chapter, one can deal with the real configuration including many inhomogeneities in the similar way. Also, the misfit strains due to thermal mismatch, phase transformation et al. can be included in the present analysis with no difficulty.« less

Unfolding the prompt gamma ray spectra measured in a Lanthanum Bromide detector using GRAVEL method

NASA Astrophysics Data System (ADS)

De, S.; Thomas, R. G.; Rout, P. C.; Suryanarayana, S. V.; Nayak, B. K.; Saxena, A.

2018-02-01

Prompt fission Upsilon -ray energy spectra in spontaneous fission of 252Cf has been measured using a 6'' LaBr3(Ce) detector. Unfolding of the measured Upsilon -ray energy spectra has been carried out using GRAVEL method. The response matrix of the detector has been simulated using GEANT4 and the unfolding of Upsilon -ray energy spectra for 60Co and 137Cs sources have been validated. This unfolding technique has then been applied to the prompt gamma spectra obtained from the spontaneous fission of 252Cf.

Density-functional expansion methods: evaluation of LDA, GGA, and meta-GGA functionals and different integral approximations.

PubMed

Giese, Timothy J; York, Darrin M

2010-12-28

We extend the Kohn-Sham potential energy expansion (VE) to include variations of the kinetic energy density and use the VE formulation with a 6-31G* basis to perform a "Jacob's ladder" comparison of small molecule properties using density functionals classified as being either LDA, GGA, or meta-GGA. We show that the VE reproduces standard Kohn-Sham DFT results well if all integrals are performed without further approximation, and there is no substantial improvement in using meta-GGA functionals relative to GGA functionals. The advantages of using GGA versus LDA functionals becomes apparent when modeling hydrogen bonds. We furthermore examine the effect of using integral approximations to compute the zeroth-order energy and first-order matrix elements, and the results suggest that the origin of the short-range repulsive potential within self-consistent charge density-functional tight-binding methods mainly arises from the approximations made to the first-order matrix elements.

Computing wave functions in multichannel collisions with non-local potentials using the R-matrix method

NASA Astrophysics Data System (ADS)

Bonitati, Joey; Slimmer, Ben; Li, Weichuan; Potel, Gregory; Nunes, Filomena

2017-09-01

The calculable form of the R-matrix method has been previously shown to be a useful tool in approximately solving the Schrodinger equation in nuclear scattering problems. We use this technique combined with the Gauss quadrature for the Lagrange-mesh method to efficiently solve for the wave functions of projectile nuclei in low energy collisions (1-100 MeV) involving an arbitrary number of channels. We include the local Woods-Saxon potential, the non-local potential of Perey and Buck, a Coulomb potential, and a coupling potential to computationally solve for the wave function of two nuclei at short distances. Object oriented programming is used to increase modularity, and parallel programming techniques are introduced to reduce computation time. We conclude that the R-matrix method is an effective method to predict the wave functions of nuclei in scattering problems involving both multiple channels and non-local potentials. Michigan State University iCER ACRES REU.

Feasibility for direct rapid energy dispersive X-ray fluorescence (EDXRF) and scattering analysis of complex matrix liquids by partial least squares.

PubMed

Angeyo, K H; Gari, S; Mustapha, A O; Mangala, J M

2012-11-01

The greatest challenge to material characterization by XRF technique is encountered in direct trace analysis of complex matrices. We exploited partial least squares (PLS) in conjunction with energy dispersive X-ray fluorescence and scattering (EDXRFS) spectrometry to rapidly (200 s) analyze lubricating oils. The PLS-EDXRFS method affords non-invasive quality assurance (QA) analysis of complex matrix liquids as it gave optimistic results for both heavy- and low-Z metal additives. Scatter peaks may further be used for QA characterization via the light elements. Copyright © 2012 Elsevier Ltd. All rights reserved.

Accurate and efficient calculation of excitation energies with the active-space particle-particle random phase approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Du; Yang, Weitao

An efficient method for calculating excitation energies based on the particle-particle random phase approximation (ppRPA) is presented. Neglecting the contributions from the high-lying virtual states and the low-lying core states leads to the significantly smaller active-space ppRPA matrix while keeping the error to within 0.05 eV from the corresponding full ppRPA excitation energies. The resulting computational cost is significantly reduced and becomes less than the construction of the non-local Fock exchange potential matrix in the self-consistent-field (SCF) procedure. With only a modest number of active orbitals, the original ppRPA singlet-triplet (ST) gaps as well as the low-lying single and doublemore » excitation energies can be accurately reproduced at much reduced computational costs, up to 100 times faster than the iterative Davidson diagonalization of the original full ppRPA matrix. For high-lying Rydberg excitations where the Davidson algorithm fails, the computational savings of active-space ppRPA with respect to the direct diagonalization is even more dramatic. The virtues of the underlying full ppRPA combined with the significantly lower computational cost of the active-space approach will significantly expand the applicability of the ppRPA method to calculate excitation energies at a cost of O(K^{4}), with a prefactor much smaller than a single SCF Hartree-Fock (HF)/hybrid functional calculation, thus opening up new possibilities for the quantum mechanical study of excited state electronic structure of large systems.« less

Accurate and efficient calculation of excitation energies with the active-space particle-particle random phase approximation

DOE PAGES

Zhang, Du; Yang, Weitao

2016-10-13

An efficient method for calculating excitation energies based on the particle-particle random phase approximation (ppRPA) is presented. Neglecting the contributions from the high-lying virtual states and the low-lying core states leads to the significantly smaller active-space ppRPA matrix while keeping the error to within 0.05 eV from the corresponding full ppRPA excitation energies. The resulting computational cost is significantly reduced and becomes less than the construction of the non-local Fock exchange potential matrix in the self-consistent-field (SCF) procedure. With only a modest number of active orbitals, the original ppRPA singlet-triplet (ST) gaps as well as the low-lying single and doublemore » excitation energies can be accurately reproduced at much reduced computational costs, up to 100 times faster than the iterative Davidson diagonalization of the original full ppRPA matrix. For high-lying Rydberg excitations where the Davidson algorithm fails, the computational savings of active-space ppRPA with respect to the direct diagonalization is even more dramatic. The virtues of the underlying full ppRPA combined with the significantly lower computational cost of the active-space approach will significantly expand the applicability of the ppRPA method to calculate excitation energies at a cost of O(K^{4}), with a prefactor much smaller than a single SCF Hartree-Fock (HF)/hybrid functional calculation, thus opening up new possibilities for the quantum mechanical study of excited state electronic structure of large systems.« less

The multifacet graphically contracted function method. I. Formulation and implementation

NASA Astrophysics Data System (ADS)

Shepard, Ron; Gidofalvi, Gergely; Brozell, Scott R.

2014-08-01

The basic formulation for the multifacet generalization of the graphically contracted function (MFGCF) electronic structure method is presented. The analysis includes the discussion of linear dependency and redundancy of the arc factor parameters, the computation of reduced density matrices, Hamiltonian matrix construction, spin-density matrix construction, the computation of optimization gradients for single-state and state-averaged calculations, graphical wave function analysis, and the efficient computation of configuration state function and Slater determinant expansion coefficients. Timings are given for Hamiltonian matrix element and analytic optimization gradient computations for a range of model problems for full-CI Shavitt graphs, and it is observed that both the energy and the gradient computation scale as O(N2n4) for N electrons and n orbitals. The important arithmetic operations are within dense matrix-matrix product computational kernels, resulting in a computationally efficient procedure. An initial implementation of the method is used to present applications to several challenging chemical systems, including N2 dissociation, cubic H8 dissociation, the symmetric dissociation of H2O, and the insertion of Be into H2. The results are compared to the exact full-CI values and also to those of the previous single-facet GCF expansion form.

The multifacet graphically contracted function method. I. Formulation and implementation.

PubMed

Shepard, Ron; Gidofalvi, Gergely; Brozell, Scott R

2014-08-14

The basic formulation for the multifacet generalization of the graphically contracted function (MFGCF) electronic structure method is presented. The analysis includes the discussion of linear dependency and redundancy of the arc factor parameters, the computation of reduced density matrices, Hamiltonian matrix construction, spin-density matrix construction, the computation of optimization gradients for single-state and state-averaged calculations, graphical wave function analysis, and the efficient computation of configuration state function and Slater determinant expansion coefficients. Timings are given for Hamiltonian matrix element and analytic optimization gradient computations for a range of model problems for full-CI Shavitt graphs, and it is observed that both the energy and the gradient computation scale as O(N(2)n(4)) for N electrons and n orbitals. The important arithmetic operations are within dense matrix-matrix product computational kernels, resulting in a computationally efficient procedure. An initial implementation of the method is used to present applications to several challenging chemical systems, including N2 dissociation, cubic H8 dissociation, the symmetric dissociation of H2O, and the insertion of Be into H2. The results are compared to the exact full-CI values and also to those of the previous single-facet GCF expansion form.

Price elasticity matrix of demand in power system considering demand response programs

NASA Astrophysics Data System (ADS)

Qu, Xinyao; Hui, Hongxun; Yang, Shengchun; Li, Yaping; Ding, Yi

2018-02-01

The increasing renewable energy power generations have brought more intermittency and volatility to the electric power system. Demand-side resources can improve the consumption of renewable energy by demand response (DR), which becomes one of the important means to improve the reliability of power system. In price-based DR, the sensitivity analysis of customer’s power demand to the changing electricity prices is pivotal for setting reasonable prices and forecasting loads of power system. This paper studies the price elasticity matrix of demand (PEMD). An improved PEMD model is proposed based on elasticity effect weight, which can unify the rigid loads and flexible loads. Moreover, the structure of PEMD, which is decided by price policies and load types, and the calculation method of PEMD are also proposed. Several cases are studied to prove the effectiveness of this method.

Relationships between surface free energy, surface texture parameters and controlled drug release in hydrophilic matrices.

PubMed

Saurí, J; Suñé-Negre, J M; Díaz-Marcos, J; Vilana, J; Millán, D; Ticó, J R; Miñarro, M; Pérez-Lozano, P; García-Montoya, E

2015-01-15

The study of controlled release and drug release devices has been dominated by considerations of the bulk or average properties of material or devices. Yet the outermost surface atoms play a central role in their performance. The objective of this article has been to characterize the surface of hydrophilic matrix tablets using the contact angle (CA) method to ascertain the surface free energy, and atomic force microscopy (AFM) and confocal microscopy (CM) for the physical characterization of the surface of the hydrophilic matrix. The surface free energy results obtained show that hydroxypropylmethylcellulose K15M hinders the spreading of water on the surface of the tablet, such that the concentration of HPMC K15M increases the reaction rate of the hydrophobic interactions between the chains of HPMC K15M which increases with respect to the rate of penetration of water into the tablet. In this study, we developed a new method to characterize the swelling of the tablets and established a relationship between the new method based on microswelling and the swelling ratio parameter. The surface texture parameters have been determined and the morphology of the tablets of the different formulations and the evolution of the surface morphology after interacting with the water, swelling and forming a gel layer were characterized. This work represents significant progress in the characterization of matrix tablets. Copyright © 2014 Elsevier B.V. All rights reserved.

Theorems on symmetries and flux conservation in radiative transfer using the matrix operator theory.

NASA Technical Reports Server (NTRS)

Kattawar, G. W.

1973-01-01

The matrix operator approach to radiative transfer is shown to be a very powerful technique in establishing symmetry relations for multiple scattering in inhomogeneous atmospheres. Symmetries are derived for the reflection and transmission operators using only the symmetry of the phase function. These results will mean large savings in computer time and storage for performing calculations for realistic planetary atmospheres using this method. The results have also been extended to establish a condition on the reflection matrix of a boundary in order to preserve reciprocity. Finally energy conservation is rigorously proven for conservative scattering in inhomogeneous atmospheres.

Analytical representation of dynamical quantities in G W from a matrix resolvent

NASA Astrophysics Data System (ADS)

Gesenhues, J.; Nabok, D.; Rohlfing, M.; Draxl, C.

2017-12-01

The power of the G W formalism is, to a large extent, based on the explicit treatment of dynamical correlations in the self-energy. This dynamics is taken into account by calculating the energy dependence of the screened Coulomb interaction W , followed by a convolution with the Green's function G . In order to obtain the energy dependence of W the prevalent methods are plasmon-pole models and numerical integration techniques. In this paper, we discuss an alternative approach, in which the energy-dependent screening is calculated by determining the resolvent, which is set up from a matrix representation of the dielectric function. On the one hand, this refrains from a numerical energy convolution and allows one to actually write down the energy dependence of W explicitly (like in the plasmon-pole models). On the other hand, the method is at least as accurate as the numerical approaches due to its multipole nature. We discuss the theoretical setup in some detail, give insight into the computational aspects, and present results for Si, C, GaAs, and LiF. Finally, we argue that the analytic representability is not only useful for educational purposes but may also be of avail for the development of theory that goes beyond G W .

Online blind source separation using incremental nonnegative matrix factorization with volume constraint.

PubMed

Zhou, Guoxu; Yang, Zuyuan; Xie, Shengli; Yang, Jun-Mei

2011-04-01

Online blind source separation (BSS) is proposed to overcome the high computational cost problem, which limits the practical applications of traditional batch BSS algorithms. However, the existing online BSS methods are mainly used to separate independent or uncorrelated sources. Recently, nonnegative matrix factorization (NMF) shows great potential to separate the correlative sources, where some constraints are often imposed to overcome the non-uniqueness of the factorization. In this paper, an incremental NMF with volume constraint is derived and utilized for solving online BSS. The volume constraint to the mixing matrix enhances the identifiability of the sources, while the incremental learning mode reduces the computational cost. The proposed method takes advantage of the natural gradient based multiplication updating rule, and it performs especially well in the recovery of dependent sources. Simulations in BSS for dual-energy X-ray images, online encrypted speech signals, and high correlative face images show the validity of the proposed method.

Acceleration of intensity-modulated radiotherapy dose calculation by importance sampling of the calculation matrices.

PubMed

Thieke, Christian; Nill, Simeon; Oelfke, Uwe; Bortfeld, Thomas

2002-05-01

In inverse planning for intensity-modulated radiotherapy, the dose calculation is a crucial element limiting both the maximum achievable plan quality and the speed of the optimization process. One way to integrate accurate dose calculation algorithms into inverse planning is to precalculate the dose contribution of each beam element to each voxel for unit fluence. These precalculated values are stored in a big dose calculation matrix. Then the dose calculation during the iterative optimization process consists merely of matrix look-up and multiplication with the actual fluence values. However, because the dose calculation matrix can become very large, this ansatz requires a lot of computer memory and is still very time consuming, making it not practical for clinical routine without further modifications. In this work we present a new method to significantly reduce the number of entries in the dose calculation matrix. The method utilizes the fact that a photon pencil beam has a rapid radial dose falloff, and has very small dose values for the most part. In this low-dose part of the pencil beam, the dose contribution to a voxel is only integrated into the dose calculation matrix with a certain probability. Normalization with the reciprocal of this probability preserves the total energy, even though many matrix elements are omitted. Three probability distributions were tested to find the most accurate one for a given memory size. The sampling method is compared with the use of a fully filled matrix and with the well-known method of just cutting off the pencil beam at a certain lateral distance. A clinical example of a head and neck case is presented. It turns out that a sampled dose calculation matrix with only 1/3 of the entries of the fully filled matrix does not sacrifice the quality of the resulting plans, whereby the cutoff method results in a suboptimal treatment plan.

Polyolefin composites containing a phase change material

DOEpatents

Salyer, Ival O.

1991-01-01

A composite useful in thermal energy storage, said composite being formed of a polyolefin matrix having a phase change material such as a crystalline alkyl hydrocarbon incorporated therein, said polyolefin being thermally form stable; the composite is useful in forming pellets, sheets or fibers having thermal energy storage characteristics; methods for forming the composite are also disclosed.

Methanol production from Eucalyptus wood chips. Working document I. The Florida Eucalyptus energy farm: silvicultural methods and considerations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fishkind, H.H.

The silvicultural matrix within which the nation's first large scale wood energy plantation will develop is described in detail. The relevant literature reviewed is identified and distilled. The plantation history, site preparation, planting, species selection, maintenance and management, harvesting, and the Eucalyptus biomass production estimates are presented.

Study of electron impact inelastic scattering of chlorine molecule (Cl2)

NASA Astrophysics Data System (ADS)

Yadav, Hitesh; Vinodkumar, Minaxi; Limbachiya, Chetan; Vinodkumar, P. C.

2018-02-01

A theoretical study is carried out for electron interactions with the chlorine molecule (Cl2) for incident energies ranging from 0.01 to 5000 eV. This wide range of energy has allowed us to investigate a variety of processes and report data on symmetric excitation energies, dissociative electron attachment (DEA), total excitation cross sections, and ionization cross section (Q ion) along with total inelastic cross sections (Q inel). The present study is important since Cl2 is a prominent gas for plasma etching and its anionic atoms are important in the etching of semiconductor wafers. In order to compute the total inelastic cross sections, we have employed the ab initio R-matrix method (0.01 to 15 eV) together with the spherical complex optical potential method (∼15 to 5000 eV). The R-matrix calculations are performed using a close coupling method, and we have used DEA estimator via Quantemol-N to calculate the DEA fragmentation and cross sections. The present study finds overall good agreement with the available experimental data. Total excitation and inelastic cross sections of e-{{{Cl}}}2 scattering for a wide energy range (0.01 to 5 keV) are reported for the first time, to the best of our knowledge.

Composites incorporated a conductive polymer nanofiber network

DOEpatents

Pozzo, Lilo Danielle; Newbloom, Gregory

2017-04-11

Methods of forming composites that incorporate networks of conductive polymer nanofibers are provided. Networks of less-than conductive polymers are first formed and then doped with a chemical dopant to provide networks of conductive polymers. The networks of conductive polymers are then incorporated into a matrix in order to improve the conductivity of the matrix. The formed composites are useful as conductive coatings for applications including electromagnetic energy management on exterior surfaces of vehicles.

SU-G-TeP1-15: Toward a Novel GPU Accelerated Deterministic Solution to the Linear Boltzmann Transport Equation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, R; Fallone, B; Cross Cancer Institute, Edmonton, AB

Purpose: To develop a Graphic Processor Unit (GPU) accelerated deterministic solution to the Linear Boltzmann Transport Equation (LBTE) for accurate dose calculations in radiotherapy (RT). A deterministic solution yields the potential for major speed improvements due to the sparse matrix-vector and vector-vector multiplications and would thus be of benefit to RT. Methods: In order to leverage the massively parallel architecture of GPUs, the first order LBTE was reformulated as a second order self-adjoint equation using the Least Squares Finite Element Method (LSFEM). This produces a symmetric positive-definite matrix which is efficiently solved using a parallelized conjugate gradient (CG) solver. Themore » LSFEM formalism is applied in space, discrete ordinates is applied in angle, and the Multigroup method is applied in energy. The final linear system of equations produced is tightly coupled in space and angle. Our code written in CUDA-C was benchmarked on an Nvidia GeForce TITAN-X GPU against an Intel i7-6700K CPU. A spatial mesh of 30,950 tetrahedral elements was used with an S4 angular approximation. Results: To avoid repeating a full computationally intensive finite element matrix assembly at each Multigroup energy, a novel mapping algorithm was developed which minimized the operations required at each energy. Additionally, a parallelized memory mapping for the kronecker product between the sparse spatial and angular matrices, including Dirichlet boundary conditions, was created. Atomicity is preserved by graph-coloring overlapping nodes into separate kernel launches. The one-time mapping calculations for matrix assembly, kronecker product, and boundary condition application took 452±1ms on GPU. Matrix assembly for 16 energy groups took 556±3s on CPU, and 358±2ms on GPU using the mappings developed. The CG solver took 93±1s on CPU, and 468±2ms on GPU. Conclusion: Three computationally intensive subroutines in deterministically solving the LBTE have been formulated on GPU, resulting in two orders of magnitude speedup. Funding support from Natural Sciences and Engineering Research Council and Alberta Innovates Health Solutions. Dr. Fallone is a co-founder and CEO of MagnetTx Oncology Solutions (under discussions to license Alberta bi-planar linac MR for commercialization).« less

Positive semidefinite tensor factorizations of the two-electron integral matrix for low-scaling ab initio electronic structure.

PubMed

Hoy, Erik P; Mazziotti, David A

2015-08-14

Tensor factorization of the 2-electron integral matrix is a well-known technique for reducing the computational scaling of ab initio electronic structure methods toward that of Hartree-Fock and density functional theories. The simplest factorization that maintains the positive semidefinite character of the 2-electron integral matrix is the Cholesky factorization. In this paper, we introduce a family of positive semidefinite factorizations that generalize the Cholesky factorization. Using an implementation of the factorization within the parametric 2-RDM method [D. A. Mazziotti, Phys. Rev. Lett. 101, 253002 (2008)], we study several inorganic molecules, alkane chains, and potential energy curves and find that this generalized factorization retains the accuracy and size extensivity of the Cholesky factorization, even in the presence of multi-reference correlation. The generalized family of positive semidefinite factorizations has potential applications to low-scaling ab initio electronic structure methods that treat electron correlation with a computational cost approaching that of the Hartree-Fock method or density functional theory.

Exploiting the spatial locality of electron correlation within the parametric two-electron reduced-density-matrix method

NASA Astrophysics Data System (ADS)

DePrince, A. Eugene; Mazziotti, David A.

2010-01-01

The parametric variational two-electron reduced-density-matrix (2-RDM) method is applied to computing electronic correlation energies of medium-to-large molecular systems by exploiting the spatial locality of electron correlation within the framework of the cluster-in-molecule (CIM) approximation [S. Li et al., J. Comput. Chem. 23, 238 (2002); J. Chem. Phys. 125, 074109 (2006)]. The 2-RDMs of individual molecular fragments within a molecule are determined, and selected portions of these 2-RDMs are recombined to yield an accurate approximation to the correlation energy of the entire molecule. In addition to extending CIM to the parametric 2-RDM method, we (i) suggest a more systematic selection of atomic-orbital domains than that presented in previous CIM studies and (ii) generalize the CIM method for open-shell quantum systems. The resulting method is tested with a series of polyacetylene molecules, water clusters, and diazobenzene derivatives in minimal and nonminimal basis sets. Calculations show that the computational cost of the method scales linearly with system size. We also compute hydrogen-abstraction energies for a series of hydroxyurea derivatives. Abstraction of hydrogen from hydroxyurea is thought to be a key step in its treatment of sickle cell anemia; the design of hydroxyurea derivatives that oxidize more rapidly is one approach to devising more effective treatments.

Matrix-Assisted Laser Desorption/Ionisation - High-Energy Collision-Induced Dissociation of Steroids: Analysis of Oxysterols in Rat Brain

PubMed Central

Wang, Yuqin; Hornshaw, Martin; Alvelius, Gunvor; Bodin, Karl; Liu, Suya; Sjövall, Jan; Griffiths, William J.

2008-01-01

Neutral steroids have traditionally been analysed by gas chromatography – mass spectrometry (GC-MS) after necessary derivatisation reactions. However, GC-MS is unsuitable for the analysis of many conjugated steroids and those with unsuspected functional groups. Here we describe an alternative analytical method specifically designed for the analysis of oxosteroids and those with a 3β-hydroxy-Δ5 or 5α-hydrogen-3β-hydroxy structure. Steroids were derivatised with Girard P (GP) hydrazine to give GP hydrazones which are charged species and readily analysed by matrix-assisted laser desorption/ionization mass spectrometry. The resulting [M]+ ions were then subjected to high-energy collision-induced dissociation on a tandem time-of-flight instrument. The product-ion spectra give structurally informative fragment-ion patterns. The sensitivity of the analytical method is such that steroids structures can be determined from low pg (low fmole) amounts of sample. The utility of the method has been demonstrated by the analysis of oxysterols extracted from rat brain. PMID:16383324

Self-energy matrices for electron transport calculations within the real-space finite-difference formalism

NASA Astrophysics Data System (ADS)

Tsukamoto, Shigeru; Ono, Tomoya; Hirose, Kikuji; Blügel, Stefan

2017-03-01

The self-energy term used in transport calculations, which describes the coupling between electrode and transition regions, is able to be evaluated only from a limited number of the propagating and evanescent waves of a bulk electrode. This obviously contributes toward the reduction of the computational expenses in transport calculations. In this paper, we present a mathematical formula for reducing the computational expenses further without using any approximation and without losing accuracy. So far, the self-energy term has been handled as a matrix with the same dimension as the Hamiltonian submatrix representing the interaction between an electrode and a transition region. In this work, through the singular-value decomposition of the submatrix, the self-energy matrix is handled as a smaller matrix, whose dimension is the rank number of the Hamiltonian submatrix. This procedure is practical in the case of using the pseudopotentials in a separable form, and the computational expenses for determining the self-energy matrix are reduced by 90% when employing a code based on the real-space finite-difference formalism and projector-augmented wave method. In addition, this technique is applicable to the transport calculations using atomic or localized basis sets. Adopting the self-energy matrices obtained from this procedure, we present the calculation of the electron transport properties of C20 molecular junctions. The application demonstrates that the electron transmissions are sensitive to the orientation of the molecule with respect to the electrode surface. In addition, channel decomposition of the scattering wave functions reveals that some unoccupied C20 molecular orbitals mainly contribute to the electron conduction through the molecular junction.

Matrix cracking in laminated composites under monotonic and cyclic loadings

NASA Technical Reports Server (NTRS)

Allen, David H.; Lee, Jong-Won

1991-01-01

An analytical model based on the internal state variable (ISV) concept and the strain energy method is proposed for characterizing the monotonic and cyclic response of laminated composites containing matrix cracks. A modified constitution is formulated for angle-ply laminates under general in-plane mechanical loading and constant temperature change. A monotonic matrix cracking criterion is developed for predicting the crack density in cross-ply laminates as a function of the applied laminate axial stress. An initial formulation for a cyclic matrix cracking criterion for cross-ply laminates is also discussed. For the monotonic loading case, a number of experimental data and well-known models are compared with the present study for validating the practical applicability of the ISV approach.

The density matrix method in photonic bandgap and antiferromagnetic materials

NASA Astrophysics Data System (ADS)

Barrie, Scott B.

In this thesis, a theory for dispersive polaritonic bandgap (DPBG) and photonic bandgap (PBG) materials is developed. An ensemble of multi-level nanoparticles, such as non-interacting two-, three- and four-level atoms doped in DPBG and PBG materials is considered. The optical properties of these materials such as spontaneous emission, line broadening, fluorescence and narrowing of the natural linewidth have been studied using the density matrix method. Numerical simulations for these properties have been performed for the DPBG materials SiC and InAs, and for a PBG material with a 20 percent gap-to-midgap ratio. When a three-level nanoparticle is doped into a DPBG material, it is predicted that one or two bound states exist when one or both resonance energies, respectively, lie in the bandgap. It is shown when a resonance energy lies below the bandgap, its spectral density peak weakens and broadens as the resonance energy increases to the lower band edge. For the first time it is predicted that when a nanoparticle's resonance energy lies above the bandgap, its spectral density peak weakens and broadens as the resonance energy increases. A relation is also found between spectral structure and gap-to-midgap ratios. The dressed states of a two-level atom doped into a DPBG material under the influence of an intense monochromatic laser field are examined. The splitting of the dressed state energies is calculated, and it is predicted that the splitting depends on the polariton density of states and the Rabi frequency of laser field. The fluoresence is also examined, and for the first time two distinct control processes are found for the transition from one peak to three peaks. It was previously known that the Rabi frequency controlled the Stark effect, but this thesis predicts that the local of the peak with respect to the optical bandgap can cause a transition from one to three peaks even with a weak Rabi frequency. The transient linewidth narrowing of PBG crystal emission peaks doped with four-level atoms is studied. It is found that linewidth narrowing is only dependent upon time delay when the resonance energy is not near a band edge. This is a new discovery. The density matrix method is employed to find the critical magnetic field at which spin flopping occurs in antiferromagnetic high temperature superconductors. It is found that this magnetic field depends upon the temperature, the anisotropy parameter and the doping concentration. Results are calculated for 1-2-3 HTSCs. Keywords. Quantum Optics, Density Matrix, Photonic Bandgap Materials, Dispersive Polaritonic Bandgap Materials, Antiferromagnets.

Effects of calibration methods on quantitative material decomposition in photon-counting spectral computed tomography using a maximum a posteriori estimator.

PubMed

Curtis, Tyler E; Roeder, Ryan K

2017-10-01

Advances in photon-counting detectors have enabled quantitative material decomposition using multi-energy or spectral computed tomography (CT). Supervised methods for material decomposition utilize an estimated attenuation for each material of interest at each photon energy level, which must be calibrated based upon calculated or measured values for known compositions. Measurements using a calibration phantom can advantageously account for system-specific noise, but the effect of calibration methods on the material basis matrix and subsequent quantitative material decomposition has not been experimentally investigated. Therefore, the objective of this study was to investigate the influence of the range and number of contrast agent concentrations within a modular calibration phantom on the accuracy of quantitative material decomposition in the image domain. Gadolinium was chosen as a model contrast agent in imaging phantoms, which also contained bone tissue and water as negative controls. The maximum gadolinium concentration (30, 60, and 90 mM) and total number of concentrations (2, 4, and 7) were independently varied to systematically investigate effects of the material basis matrix and scaling factor calibration on the quantitative (root mean squared error, RMSE) and spatial (sensitivity and specificity) accuracy of material decomposition. Images of calibration and sample phantoms were acquired using a commercially available photon-counting spectral micro-CT system with five energy bins selected to normalize photon counts and leverage the contrast agent k-edge. Material decomposition of gadolinium, calcium, and water was performed for each calibration method using a maximum a posteriori estimator. Both the quantitative and spatial accuracy of material decomposition were most improved by using an increased maximum gadolinium concentration (range) in the basis matrix calibration; the effects of using a greater number of concentrations were relatively small in magnitude by comparison. The material basis matrix calibration was more sensitive to changes in the calibration methods than the scaling factor calibration. The material basis matrix calibration significantly influenced both the quantitative and spatial accuracy of material decomposition, while the scaling factor calibration influenced quantitative but not spatial accuracy. Importantly, the median RMSE of material decomposition was as low as ~1.5 mM (~0.24 mg/mL gadolinium), which was similar in magnitude to that measured by optical spectroscopy on the same samples. The accuracy of quantitative material decomposition in photon-counting spectral CT was significantly influenced by calibration methods which must therefore be carefully considered for the intended diagnostic imaging application. © 2017 American Association of Physicists in Medicine.

Potential energy distribution (PED) analysis of DFT calculated IR spectra of the most stable Li, Na, and Cu(I) diformate molecules

NASA Astrophysics Data System (ADS)

Jamróz, M. H.; Dobrowolski, J. Cz.

2001-05-01

For the most stable Li, Na, and Cu(I) diformates we present the vibrational spectra, supported by potential energy distribution (PED) analysis, and the interaction energies between formic acid and metal formate by the DFT (B3PW91) method. PED analysis of the theoretical spectra forms the basis for the elucidation of the future matrix isolation IR spectra.

Fuzzy comprehensive evaluation for grid-connected performance of integrated distributed PV-ES systems

NASA Astrophysics Data System (ADS)

Lv, Z. H.; Li, Q.; Huang, R. W.; Liu, H. M.; Liu, D.

2016-08-01

Based on the discussion about topology structure of integrated distributed photovoltaic (PV) power generation system and energy storage (ES) in single or mixed type, this paper focuses on analyzing grid-connected performance of integrated distributed photovoltaic and energy storage (PV-ES) systems, and proposes a comprehensive evaluation index system. Then a multi-level fuzzy comprehensive evaluation method based on grey correlation degree is proposed, and the calculations for weight matrix and fuzzy matrix are presented step by step. Finally, a distributed integrated PV-ES power generation system connected to a 380 V low voltage distribution network is taken as the example, and some suggestions are made based on the evaluation results.

Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

PubMed

Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

2014-10-28

Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

High-energy X-ray detection by hafnium-doped organic-inorganic hybrid scintillators prepared by sol-gel method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Yan; Koshimizu, Masanori, E-mail: koshi@qpc.che.tohoku.ac.jp; Yahaba, Natsuna

2014-04-28

With the aim of enhancing the efficiency with which plastic scintillators detect high-energy X-rays, hafnium-doped organic-inorganic hybrid scintillators were fabricated via a sol-gel method. Transmission electron microscopy of sampled material reveals the presence of Hf{sub x}Si{sub 1−x}O{sub 2} nanoparticles, dispersed in a polymer matrix that constitutes the active material of the X-ray detector. With Hf{sub x}Si{sub 1−x}O{sub 2} nanoparticles incorporated in the polymer matrix, the absorption edge and the luminescence wavelength is shifted, which we attribute to Mie scattering. The detection efficiency for 67.4-keV X-rays in a 0.6-mm-thick piece of this material is two times better than the same thicknessmore » of a commercial plastic scintillator-NE142.« less

Determining partial differential cross sections for low-energy electron photodetachment involving conical intersections using the solution of a Lippmann-Schwinger equation constructed with standard electronic structure techniques.

PubMed

Han, Seungsuk; Yarkony, David R

2011-05-07

A method for obtaining partial differential cross sections for low energy electron photodetachment in which the electronic states of the residual molecule are strongly coupled by conical intersections is reported. The method is based on the iterative solution to a Lippmann-Schwinger equation, using a zeroth order Hamiltonian consisting of the bound nonadiabatically coupled residual molecule and a free electron. The solution to the Lippmann-Schwinger equation involves only standard electronic structure techniques and a standard three-dimensional free particle Green's function quadrature for which fast techniques exist. The transition dipole moment for electron photodetachment, is a sum of matrix elements each involving one nonorthogonal orbital obtained from the solution to the Lippmann-Schwinger equation. An expression for the electron photodetachment transition dipole matrix element in terms of Dyson orbitals, which does not make the usual orthogonality assumptions, is derived.

The application of nonlinear programming and collocation to optimal aeroassisted orbital transfers

NASA Astrophysics Data System (ADS)

Shi, Y. Y.; Nelson, R. L.; Young, D. H.; Gill, P. E.; Murray, W.; Saunders, M. A.

1992-01-01

Sequential quadratic programming (SQP) and collocation of the differential equations of motion were applied to optimal aeroassisted orbital transfers. The Optimal Trajectory by Implicit Simulation (OTIS) computer program codes with updated nonlinear programming code (NZSOL) were used as a testbed for the SQP nonlinear programming (NLP) algorithms. The state-of-the-art sparse SQP method is considered to be effective for solving large problems with a sparse matrix. Sparse optimizers are characterized in terms of memory requirements and computational efficiency. For the OTIS problems, less than 10 percent of the Jacobian matrix elements are nonzero. The SQP method encompasses two phases: finding an initial feasible point by minimizing the sum of infeasibilities and minimizing the quadratic objective function within the feasible region. The orbital transfer problem under consideration involves the transfer from a high energy orbit to a low energy orbit.

Matrix Methods for Solving Hartree-Fock Equations in Atomic Structure Calculations and Line Broadening

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gomez, Thomas; Nagayama, Taisuke; Fontes, Chris

Atomic structure of N-electron atoms is often determined by solving the Hartree-Fock equations, which are a set of integro-differential equations. The integral part of the Hartree-Fock equations treats electron exchange, but the Hartree-Fock equations are not often treated as an integro-differential equation. The exchange term is often approximated as an inhomogeneous or an effective potential so that the Hartree-Fock equations become a set of ordinary differential equations (which can be solved using the usual shooting methods). Because the Hartree-Fock equations are an iterative-refinement method, the inhomogeneous term relies on the previous guess of the wavefunction. In addition, there are numericalmore » complications associated with solving inhomogeneous differential equations. This work uses matrix methods to solve the Hartree-Fock equations as an integro-differential equation. It is well known that a derivative operator can be expressed as a matrix made of finite-difference coefficients; energy eigenvalues and eigenvectors can be obtained by using linear-algebra packages. The integral (exchange) part of the Hartree-Fock equation can be approximated as a sum and written as a matrix. The Hartree-Fock equations can be solved as a matrix that is the sum of the differential and integral matrices. We compare calculations using this method against experiment and standard atomic structure calculations. This matrix method can also be used to solve for free-electron wavefunctions, thus improving how the atoms and free electrons interact. Here, this technique is important for spectral line broadening in two ways: it improves the atomic structure calculations, and it improves the motion of the plasma electrons that collide with the atom.« less

Matrix Methods for Solving Hartree-Fock Equations in Atomic Structure Calculations and Line Broadening

DOE PAGES

Gomez, Thomas; Nagayama, Taisuke; Fontes, Chris; ...

2018-04-23

Atomic structure of N-electron atoms is often determined by solving the Hartree-Fock equations, which are a set of integro-differential equations. The integral part of the Hartree-Fock equations treats electron exchange, but the Hartree-Fock equations are not often treated as an integro-differential equation. The exchange term is often approximated as an inhomogeneous or an effective potential so that the Hartree-Fock equations become a set of ordinary differential equations (which can be solved using the usual shooting methods). Because the Hartree-Fock equations are an iterative-refinement method, the inhomogeneous term relies on the previous guess of the wavefunction. In addition, there are numericalmore » complications associated with solving inhomogeneous differential equations. This work uses matrix methods to solve the Hartree-Fock equations as an integro-differential equation. It is well known that a derivative operator can be expressed as a matrix made of finite-difference coefficients; energy eigenvalues and eigenvectors can be obtained by using linear-algebra packages. The integral (exchange) part of the Hartree-Fock equation can be approximated as a sum and written as a matrix. The Hartree-Fock equations can be solved as a matrix that is the sum of the differential and integral matrices. We compare calculations using this method against experiment and standard atomic structure calculations. This matrix method can also be used to solve for free-electron wavefunctions, thus improving how the atoms and free electrons interact. Here, this technique is important for spectral line broadening in two ways: it improves the atomic structure calculations, and it improves the motion of the plasma electrons that collide with the atom.« less

Minimizing energy dissipation of matrix multiplication kernel on Virtex-II

NASA Astrophysics Data System (ADS)

Choi, Seonil; Prasanna, Viktor K.; Jang, Ju-wook

2002-07-01

In this paper, we develop energy-efficient designs for matrix multiplication on FPGAs. To analyze the energy dissipation, we develop a high-level model using domain-specific modeling techniques. In this model, we identify architecture parameters that significantly affect the total energy (system-wide energy) dissipation. Then, we explore design trade-offs by varying these parameters to minimize the system-wide energy. For matrix multiplication, we consider a uniprocessor architecture and a linear array architecture to develop energy-efficient designs. For the uniprocessor architecture, the cache size is a parameter that affects the I/O complexity and the system-wide energy. For the linear array architecture, the amount of storage per processing element is a parameter affecting the system-wide energy. By using maximum amount of storage per processing element and minimum number of multipliers, we obtain a design that minimizes the system-wide energy. We develop several energy-efficient designs for matrix multiplication. For example, for 6×6 matrix multiplication, energy savings of upto 52% for the uniprocessor architecture and 36% for the linear arrary architecture is achieved over an optimized library for Virtex-II FPGA from Xilinx.

Correlation matrix renormalization theory for correlated-electron materials with application to the crystalline phases of atomic hydrogen

DOE PAGES

Zhao, Xin; Liu, Jun; Yao, Yong-Xin; ...

2018-01-23

Developing accurate and computationally efficient methods to calculate the electronic structure and total energy of correlated-electron materials has been a very challenging task in condensed matter physics and materials science. Recently, we have developed a correlation matrix renormalization (CMR) method which does not assume any empirical Coulomb interaction U parameters and does not have double counting problems in the ground-state total energy calculation. The CMR method has been demonstrated to be accurate in describing both the bonding and bond breaking behaviors of molecules. In this study, we extend the CMR method to the treatment of electron correlations in periodic solidmore » systems. By using a linear hydrogen chain as a benchmark system, we show that the results from the CMR method compare very well with those obtained recently by accurate quantum Monte Carlo (QMC) calculations. We also study the equation of states of three-dimensional crystalline phases of atomic hydrogen. We show that the results from the CMR method agree much better with the available QMC data in comparison with those from density functional theory and Hartree-Fock calculations.« less

Correlation matrix renormalization theory for correlated-electron materials with application to the crystalline phases of atomic hydrogen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Xin; Liu, Jun; Yao, Yong-Xin

Developing accurate and computationally efficient methods to calculate the electronic structure and total energy of correlated-electron materials has been a very challenging task in condensed matter physics and materials science. Recently, we have developed a correlation matrix renormalization (CMR) method which does not assume any empirical Coulomb interaction U parameters and does not have double counting problems in the ground-state total energy calculation. The CMR method has been demonstrated to be accurate in describing both the bonding and bond breaking behaviors of molecules. In this study, we extend the CMR method to the treatment of electron correlations in periodic solidmore » systems. By using a linear hydrogen chain as a benchmark system, we show that the results from the CMR method compare very well with those obtained recently by accurate quantum Monte Carlo (QMC) calculations. We also study the equation of states of three-dimensional crystalline phases of atomic hydrogen. We show that the results from the CMR method agree much better with the available QMC data in comparison with those from density functional theory and Hartree-Fock calculations.« less

Quasi-stationary states of an electron with linearly dependent effective mass in an open nanostructure within transmission coefficient and S-matrix methods

NASA Astrophysics Data System (ADS)

Seti, Julia; Tkach, Mykola; Voitsekhivska, Oxana

2018-03-01

The exact solutions of the Schrödinger equation for a double-barrier open semiconductor plane nanostructure are obtained by using two different approaches, within the model of the rectangular potential profile and the continuous position-dependent effective mass of the electron. The transmission coefficient and scattering matrix are calculated for the double-barrier nanostructure. The resonance energies and resonance widths of the electron quasi-stationary states are analyzed as a function of the size of the near-interface region between wells and barriers, where the effective mass linearly depends on the coordinate. It is established that, in both methods, the increasing size affects in a qualitatively similar way the spectral characteristics of the states, shifting the resonance energies into the low- or high-energy region and increasing the resonance widths. It is shown that the relative difference of resonance energies and widths of a certain state, obtained in the model of position-dependent effective mass and in the widespread abrupt model in physically correct range of near-interface sizes, does not exceed 0.5% and 5%, respectively, independently of the other geometrical characteristics of the structure.

Potential Use of {sup 18}F-fluorodeoxyglucose Positron Emission Tomography–Based Quantitative Imaging Features for Guiding Dose Escalation in Stage III Non-Small Cell Lung Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fried, David V., E-mail: dvfried@mdanderson.org; Graduate School of Biomedical Sciences, The University of Texas MD Anderson Cancer Center, Houston, Texas; Mawlawi, Osama

2016-02-01

Purpose: To determine whether previously identified quantitative image features (QIFs) based on {sup 18}F-fluorodeoxyglucose positron emission tomography (FDG-PET) (co-occurrence matrix energy and solidity) are able to isolate subgroups of patients who would receive a benefit or detriment from dose escalation in terms of overall survival (OS) or progression-free survival (PFS). Methods and Materials: Subgroups of a previously analyzed 225 patient cohort were generated with the use of 5-percentile increment cutoff values of disease solidity and primary tumor co-occurrence matrix energy. The subgroups were analyzed with a log-rank test to determine whether there was a difference in OS and PFS betweenmore » patients treated with 60 to 70 Gy and those receiving 74 Gy. Results: In the entire patient cohort, there was no statistical difference in terms of OS or PFS between patients receiving 74 Gy and those receiving 60 to 70 Gy. It was qualitatively observed that as disease solidity and primary co-occurrence matrix energy increased, patients receiving 74 Gy had an improved OS and PFS compared with those receiving 60 to 70 Gy. The opposite trend (detriment of receiving 74 Gy) was also observed regarding low values of disease solidity and primary co-occurrence matrix energy. Conclusions: FDG-PET–based QIFs were found to be capable of isolating subgroups of patients who received a benefit or detriment from dose escalation.« less

Collision for Li++He System. I. Potential Curves and Non-Adiabatic Coupling Matrix Elements

NASA Astrophysics Data System (ADS)

Yoshida, Junichi; O-Ohata, Kiyosi

1984-02-01

The potential curves and the non-adiabatic coupling matrix elements for the Li++He collision system were computed. The SCF molecular orbitals were constructed with the CGTO atomic bases centered on each nucleus and the center of mass of two nuclei. The SCF and CI calculations were done at various internuclear distances in the range of 0.1˜25.0 a.u. The potential energies and the wavefunctions were calculated with good approximation over whole internuclear distance. The non-adiabatic coupling matrix elements were calculated with the tentative method in which the ETF are approximately taken into account.

Multilayer composite material and method for evaporative cooling

NASA Technical Reports Server (NTRS)

Buckley, Theresa M. (Inventor)

2002-01-01

A multilayer composite material and method for evaporative cooling of a person employs an evaporative cooling liquid that changes phase from a liquid to a gaseous state to absorb thermal energy. The evaporative cooling liquid is absorbed into a superabsorbent material enclosed within the multilayer composite material. The multilayer composite material has a high percentage of the evaporative cooling liquid in the matrix. The cooling effect can be sustained for an extended period of time because of the high percentage of phase change liquid that can be absorbed into the superabsorbent. Such a composite can be used for cooling febrile patients by evaporative cooling as the evaporative cooling liquid in the matrix changes from a liquid to a gaseous state to absorb thermal energy. The composite can be made with a perforated barrier material around the outside to regulate the evaporation rate of the phase change liquid. Alternatively, the composite can be made with an imperveous barrier material or semipermeable membrane on one side to prevent the liquid from contacting the person's skin. The evaporative cooling liquid in the matrix can be recharged by soaking the material in the liquid. The multilayer composite material can be fashioned into blankets, garments and other articles.

The multifacet graphically contracted function method. I. Formulation and implementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shepard, Ron; Brozell, Scott R.; Gidofalvi, Gergely

2014-08-14

The basic formulation for the multifacet generalization of the graphically contracted function (MFGCF) electronic structure method is presented. The analysis includes the discussion of linear dependency and redundancy of the arc factor parameters, the computation of reduced density matrices, Hamiltonian matrix construction, spin-density matrix construction, the computation of optimization gradients for single-state and state-averaged calculations, graphical wave function analysis, and the efficient computation of configuration state function and Slater determinant expansion coefficients. Timings are given for Hamiltonian matrix element and analytic optimization gradient computations for a range of model problems for full-CI Shavitt graphs, and it is observed that bothmore » the energy and the gradient computation scale as O(N{sup 2}n{sup 4}) for N electrons and n orbitals. The important arithmetic operations are within dense matrix-matrix product computational kernels, resulting in a computationally efficient procedure. An initial implementation of the method is used to present applications to several challenging chemical systems, including N{sub 2} dissociation, cubic H{sub 8} dissociation, the symmetric dissociation of H{sub 2}O, and the insertion of Be into H{sub 2}. The results are compared to the exact full-CI values and also to those of the previous single-facet GCF expansion form.« less

Recursive Factorization of the Inverse Overlap Matrix in Linear-Scaling Quantum Molecular Dynamics Simulations.

PubMed

Negre, Christian F A; Mniszewski, Susan M; Cawkwell, Marc J; Bock, Nicolas; Wall, Michael E; Niklasson, Anders M N

2016-07-12

We present a reduced complexity algorithm to compute the inverse overlap factors required to solve the generalized eigenvalue problem in a quantum-based molecular dynamics (MD) simulation. Our method is based on the recursive, iterative refinement of an initial guess of Z (inverse square root of the overlap matrix S). The initial guess of Z is obtained beforehand by using either an approximate divide-and-conquer technique or dynamical methods, propagated within an extended Lagrangian dynamics from previous MD time steps. With this formulation, we achieve long-term stability and energy conservation even under the incomplete, approximate, iterative refinement of Z. Linear-scaling performance is obtained using numerically thresholded sparse matrix algebra based on the ELLPACK-R sparse matrix data format, which also enables efficient shared-memory parallelization. As we show in this article using self-consistent density-functional-based tight-binding MD, our approach is faster than conventional methods based on the diagonalization of overlap matrix S for systems as small as a few hundred atoms, substantially accelerating quantum-based simulations even for molecular structures of intermediate size. For a 4158-atom water-solvated polyalanine system, we find an average speedup factor of 122 for the computation of Z in each MD step.

Phase dilemma in natural orbital functional theory from the N-representability perspective

NASA Astrophysics Data System (ADS)

Mitxelena, Ion; Rodriguez-Mayorga, Mauricio; Piris, Mario

2018-06-01

Any rigorous approach to first-order reduced density matrix ( Γ) functional theory faces the phase dilemma, that is, having to deal with a large number of possible combinations of signs in terms of the electron-electron interaction energy. This problem was discovered by reducing a ground-state energy generated from an approximate N-particle wavefunction into a functional of Γ, known as the top-down method. Here, we show that the phase dilemma also appears in the bottom-up method, in which the functional E[ Γ] is generated by progressive inclusion of N-representability conditions on the reconstructed two-particle reduced density matrix. It is shown that an adequate choice of signs is essential to accurately describe model systems with strong non-dynamic (static) electron correlation, specifically, the one-dimensional Hubbard model with periodic boundary conditions and hydrogen rings. For the latter, the Piris natural orbital functional 7 (PNOF7), with phases equal to -1 for the inter-pair energy terms containing the exchange-time-inversion integrals, agrees with exact diagonalization results.

Optimization of Multiple and Multipurpose Reservoir System Operations by Using Matrix Structure (Case Study: Karun and Dez Reservoir Dams)

PubMed Central

Othman, Faridah; Taghieh, Mahmood

2016-01-01

Optimal operation of water resources in multiple and multipurpose reservoirs is very complicated. This is because of the number of dams, each dam’s location (Series and parallel), conflict in objectives and the stochastic nature of the inflow of water in the system. In this paper, performance optimization of the system of Karun and Dez reservoir dams have been studied and investigated with the purposes of hydroelectric energy generation and providing water demand in 6 dams. On the Karun River, 5 dams have been built in the series arrangements, and the Dez dam has been built parallel to those 5 dams. One of the main achievements in this research is the implementation of the structure of production of hydroelectric energy as a function of matrix in MATLAB software. The results show that the role of objective function structure for generating hydroelectric energy in weighting method algorithm is more important than water supply. Nonetheless by implementing ε- constraint method algorithm, we can both increase hydroelectric power generation and supply around 85% of agricultural and industrial demands. PMID:27248152

Relativistic coupled-cluster-theory analysis of energies, hyperfine-structure constants, and dipole polarizabilities of Cd+

NASA Astrophysics Data System (ADS)

Li, Cheng-Bin; Yu, Yan-Mei; Sahoo, B. K.

2018-02-01

Roles of electron correlation effects in the determination of attachment energies, magnetic-dipole hyperfine-structure constants, and electric-dipole (E 1 ) matrix elements of the low-lying states in the singly charged cadmium ion (Cd+) have been analyzed. We employ the singles and doubles approximated relativistic coupled-cluster (RCC) method to calculate these properties. Intermediate results from the Dirac-Hartree-Fock approximation,the second-order many-body perturbation theory, and considering only the linear terms of the RCC method are given to demonstrate propagation of electron correlation effects in this ion. Contributions from important RCC terms are also given to highlight the importance of various correlation effects in the evaluation of these properties. At the end, we also determine E 1 polarizabilities (αE 1) of the ground and 5 p 2P1 /2 ;3 /2 states of Cd+ in the ab initio approach. We estimate them again by replacing some of the E 1 matrix elements and energies from the measurements to reduce their uncertainties so that they can be used in the high-precision experiments of this ion.

New generation nuclear fuel structures: Dense particles in selectively soluble matrix

NASA Astrophysics Data System (ADS)

Devlin, Dave; Jarvinen, Gordon; Patterson, Brian; Pattillo, Steve; Valdez, James; Liu, X.-Y.; Phillips, Jonathan

2009-11-01

We have developed a technology for dispersing sub-millimeter sized fuel particles within a bulk matrix that can be selectively dissolved. This may enable the generation of advanced nuclear fuels with easy separation of actinides and fission products. The large kinetic energy of the fission products results in most of them escaping from the sub-millimeter sized fuel particles and depositing in the matrix during burning of the fuel in the reactor. After the fuel is used and allowed to cool for a period of time, the matrix can be dissolved and the fission products removed for disposal while the fuel particles are collected by filtration for recycle. The success of such an approach would meet a major goal of the GNEP program to provide advanced recycle technology for nuclear energy production. The benefits of such an approach include (1) greatly reduced cost of the actinide/fission product separation process, (2) ease of recycle of the fuel particles, and (3) a radiation barrier to prevent theft or diversion of the recycled fuel particles during the time they are re-fabricated into new fuel. In this study we describe a method to make surrogate nuclear fuels of micrometer scale W (shell)/Mo (core) or HfO 2 particles embedded in an MgO matrix that allows easy separation of the fission products and their embedded particles. In brief, the method consists of physically mixing W-Mo or hafnia particles with an MgO precursor. Heating the mixture, in air or argon, without agitation, to a temperature is required for complete decomposition of the precursor. The resulting material was examined using chemical analysis, scanning electron microscopy, X-ray diffraction and micro X-ray computed tomography and found to consist of evenly dispersed particles in an MgO + matrix. We believe this methodology can be extended to actinides and other matrix materials.

Neutronic fuel element fabrication

DOEpatents

Korton, George

2004-02-24

This disclosure describes a method for metallurgically bonding a complete leak-tight enclosure to a matrix-type fuel element penetrated longitudinally by a multiplicity of coolant channels. Coolant tubes containing solid filler pins are disposed in the coolant channels. A leak-tight metal enclosure is then formed about the entire assembly of fuel matrix, coolant tubes and pins. The completely enclosed and sealed assembly is exposed to a high temperature and pressure gas environment to effect a metallurgical bond between all contacting surfaces therein. The ends of the assembly are then machined away to expose the pin ends which are chemically leached from the coolant tubes to leave the coolant tubes with internal coolant passageways. The invention described herein was made in the course of, or under, a contract with the U.S. Atomic Energy Commission. It relates generally to fuel elements for neutronic reactors and more particularly to a method for providing a leak-tight metal enclosure for a high-performance matrix-type fuel element penetrated longitudinally by a multiplicity of coolant tubes. The planned utilization of nuclear energy in high-performance, compact-propulsion and mobile power-generation systems has necessitated the development of fuel elements capable of operating at high power densities. High power densities in turn require fuel elements having high thermal conductivities and good fuel retention capabilities at high temperatures. A metal clad fuel element containing a ceramic phase of fuel intimately mixed with and bonded to a continuous refractory metal matrix has been found to satisfy the above requirements. Metal coolant tubes penetrate the matrix to afford internal cooling to the fuel element while providing positive fuel retention and containment of fission products generated within the fuel matrix. Metal header plates are bonded to the coolant tubes at each end of the fuel element and a metal cladding or can completes the fuel-matrix enclosure by encompassing the sides of the fuel element between the header plates.

Dynamically biased statistical model for the ortho/para conversion in the H2 + H3+ → H3+ + H2 reaction.

PubMed

Gómez-Carrasco, Susana; González-Sánchez, Lola; Aguado, Alfredo; Sanz-Sanz, Cristina; Zanchet, Alexandre; Roncero, Octavio

2012-09-07

In this work we present a dynamically biased statistical model to describe the evolution of the title reaction from statistical to a more direct mechanism, using quasi-classical trajectories (QCT). The method is based on the one previously proposed by Park and Light [J. Chem. Phys. 126, 044305 (2007)]. A recent global potential energy surface is used here to calculate the capture probabilities, instead of the long-range ion-induced dipole interactions. The dynamical constraints are introduced by considering a scrambling matrix which depends on energy and determine the probability of the identity/hop/exchange mechanisms. These probabilities are calculated using QCT. It is found that the high zero-point energy of the fragments is transferred to the rest of the degrees of freedom, what shortens the lifetime of H(5)(+) complexes and, as a consequence, the exchange mechanism is produced with lower proportion. The zero-point energy (ZPE) is not properly described in quasi-classical trajectory calculations and an approximation is done in which the initial ZPE of the reactants is reduced in QCT calculations to obtain a new ZPE-biased scrambling matrix. This reduction of the ZPE is explained by the need of correcting the pure classical level number of the H(5)(+) complex, as done in classical simulations of unimolecular processes and to get equivalent quantum and classical rate constants using Rice-Ramsperger-Kassel-Marcus theory. This matrix allows to obtain a ratio of hop/exchange mechanisms, α(T), in rather good agreement with recent experimental results by Crabtree et al. [J. Chem. Phys. 134, 194311 (2011)] at room temperature. At lower temperatures, however, the present simulations predict too high ratios because the biased scrambling matrix is not statistical enough. This demonstrates the importance of applying quantum methods to simulate this reaction at the low temperatures of astrophysical interest.

Dynamically biased statistical model for the ortho/para conversion in the H2+H3+ --> H3++ H2 reaction

NASA Astrophysics Data System (ADS)

Gómez-Carrasco, Susana; González-Sánchez, Lola; Aguado, Alfredo; Sanz-Sanz, Cristina; Zanchet, Alexandre; Roncero, Octavio

2012-09-01

In this work we present a dynamically biased statistical model to describe the evolution of the title reaction from statistical to a more direct mechanism, using quasi-classical trajectories (QCT). The method is based on the one previously proposed by Park and Light [J. Chem. Phys. 126, 044305 (2007), 10.1063/1.2430711]. A recent global potential energy surface is used here to calculate the capture probabilities, instead of the long-range ion-induced dipole interactions. The dynamical constraints are introduced by considering a scrambling matrix which depends on energy and determine the probability of the identity/hop/exchange mechanisms. These probabilities are calculated using QCT. It is found that the high zero-point energy of the fragments is transferred to the rest of the degrees of freedom, what shortens the lifetime of H_5^+ complexes and, as a consequence, the exchange mechanism is produced with lower proportion. The zero-point energy (ZPE) is not properly described in quasi-classical trajectory calculations and an approximation is done in which the initial ZPE of the reactants is reduced in QCT calculations to obtain a new ZPE-biased scrambling matrix. This reduction of the ZPE is explained by the need of correcting the pure classical level number of the H_5^+ complex, as done in classical simulations of unimolecular processes and to get equivalent quantum and classical rate constants using Rice-Ramsperger-Kassel-Marcus theory. This matrix allows to obtain a ratio of hop/exchange mechanisms, α(T), in rather good agreement with recent experimental results by Crabtree et al. [J. Chem. Phys. 134, 194311 (2011), 10.1063/1.3587246] at room temperature. At lower temperatures, however, the present simulations predict too high ratios because the biased scrambling matrix is not statistical enough. This demonstrates the importance of applying quantum methods to simulate this reaction at the low temperatures of astrophysical interest.

Construction of the energy matrix for complex atoms. Part VIII: Hyperfine structure HPC calculations for terbium atom

NASA Astrophysics Data System (ADS)

Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy

2017-11-01

A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.

Analysis of Particulate Composite Behavior Based on Nonlinear Elasticity and an Improved Mori-Tanaka Theory

DTIC Science & Technology

1998-09-01

to characterize the weakening constraint power of the matrix as opposed to earlier analyses that used an additional eigenstrain term. It also...matrix Poisson ratio was constant and the inclusions were rigid, he showed that the disturbed strain and the eigenstrain in the Eshelby method could...Eshelby, elastic properties, prediction, energy balance, mechanical behavior, eigenstrain , nonlinear dcd03e So7S&3 UNCLASSIFIED SECURITY CLASSIFICATION OF FORM (Highest classification of Title, Abstract, Keywords)

Carbon based sample supports and matrices for laser desorption/ ionization mass spectrometry.

PubMed

Rainer, Matthias; Najam-ul-Haq, Muhammad; Huck, Christian W; Vallant, Rainer M; Heigl, Nico; Hahn, Hans; Bakry, Rania; Bonn, Günther K

2007-01-01

Laser desorption/ionization mass spectrometry (LDI-MS) is a widespread and powerful technique for mass analysis allowing the soft ionization of molecules such as peptides, proteins and carbohydrates. In many applications, an energy absorbing matrix has to be added to the analytes in order to protect them from being fragmented by direct laser beam. LDI-MS in conjunction with matrix is commonly referred as matrix-assisted LDI (MALDI). One of the striking disadvantages of this method is the desorption of matrix molecules, which causes interferences originating from matrix background ions in lower mass range (< 1000 Da). This has been led to the development of a variety of different carbon based LDI sample supports, which are capable of absorbing laser light and simultaneously transfering energy to the analytes for desorption. Furthermore carbon containing sample supports are used as carrier materials for the specific binding and preconcentration of molecules out of complex samples. Their subsequent analysis with MALDI mass spectrometry allows performing studies in metabolomics and proteomics. Finally a thin layer of carbon significantly improves sensitivity concerning detection limit. Analytes in low femtomole and attomole range can be detected in this regard. In the present article, these aspects are reviewed from patents where nano-based carbon materials are comprehensively utilized.

Energy dispersive X-ray fluorescence determination of cadmium in uranium matrix using Cd Kα line excited by continuum

NASA Astrophysics Data System (ADS)

Dhara, Sangita; Misra, N. L.; Aggarwal, S. K.; Venugopal, V.

2010-06-01

An energy dispersive X-ray fluorescence method for determination of cadmium (Cd) in uranium (U) matrix using continuum source of excitation was developed. Calibration and sample solutions of cadmium, with and without uranium were prepared by mixing different volumes of standard solutions of cadmium and uranyl nitrate, both prepared in suprapure nitric acid. The concentration of Cd in calibration solutions and samples was in the range of 6 to 90 µg/mL whereas the concentration of Cd with respect to U ranged from 90 to 700 µg/g of U. From the calibration solutions and samples containing uranium, the major matrix uranium was selectively extracted using 30% tri-n-butyl phosphate in dodecane. Fixed volumes (1.5 mL) of aqueous phases thus obtained were taken directly in specially designed in-house fabricated leak proof Perspex sample cells for the energy dispersive X-ray fluorescence measurements and calibration plots were made by plotting Cd Kα intensity against respective Cd concentration. For the calibration solutions not having uranium, the energy dispersive X-ray fluorescence spectra were measured without any extraction and Cd calibration plots were made accordingly. The results obtained showed a precision of 2% (1 σ) and the results deviated from the expected values by < 4% on average.

Dynamic Algorithms for Transition Matrix Generation

NASA Astrophysics Data System (ADS)

Yevick, David; Lee, Yong Hwan

The methods of [D. Yevick, Int. J. Mod. Phys. C, 1650041] for constructing transition matrices are applied to the two dimensional Ising model. Decreasing the system temperature during the acquisition of the matrix elements yields a reasonably precise specific heat curve for a 32x32 spin system for a limited number (50-100M) of realizations. If the system is instead evolved to first higher and then lower energies within a restricted interval that is steadily displaced in energy as the computation proceeds, a modification which permits backward displacements up to a certain lower bound for each forward step ensures acceptable accuracy. Additional constraints on the transition rule are also investigated. The Natural Sciences and Engineering Research Council of Canada (NSERC) and CIENA are acknowledged for financial support.

The Renner-Teller effect in HCCCl(+)(X̃(2)Π) studied by zero-kinetic energy photoelectron spectroscopy and ab initio calculations.

PubMed

Sun, Wei; Dai, Zuyang; Wang, Jia; Mo, Yuxiang

2015-05-21

The spin-vibronic energy levels of the chloroacetylene cation up to 4000 cm(-1) above the ground state have been measured using the one-photon zero-kinetic energy photoelectron spectroscopic method. The spin-vibronic energy levels have also been calculated using a diabatic model, in which the potential energy surfaces are expressed by expansions of internal coordinates, and the Hamiltonian matrix equation is solved using a variational method with harmonic basis functions. The calculated spin-vibronic energy levels are in good agreement with the experimental data. The Renner-Teller (RT) parameters describing the vibronic coupling for the H-C≡C bending mode (ε4), Cl-C≡C bending mode (ε5), the cross-mode vibronic coupling (ε45) of the two bending vibrations, and their vibrational frequencies (ω4 and ω5) have also been determined using an effective Hamiltonian matrix treatment. In comparison with the spin-orbit interaction, the RT effect in the H-C≡C bending (ε4) mode is strong, while the RT effect in the Cl-C≡C bending mode is weak. There is a strong cross-mode vibronic coupling of the two bending vibrations, which may be due to a vibronic resonance between the two bending vibrations. The spin-orbit energy splitting of the ground state has been determined for the first time and is found to be 209 ± 2 cm(-1).

Density-matrix based determination of low-energy model Hamiltonians from ab initio wavefunctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Changlani, Hitesh J.; Zheng, Huihuo; Wagner, Lucas K.

2015-09-14

We propose a way of obtaining effective low energy Hubbard-like model Hamiltonians from ab initio quantum Monte Carlo calculations for molecular and extended systems. The Hamiltonian parameters are fit to best match the ab initio two-body density matrices and energies of the ground and excited states, and thus we refer to the method as ab initio density matrix based downfolding. For benzene (a finite system), we find good agreement with experimentally available energy gaps without using any experimental inputs. For graphene, a two dimensional solid (extended system) with periodic boundary conditions, we find the effective on-site Hubbard U{sup ∗}/t tomore » be 1.3 ± 0.2, comparable to a recent estimate based on the constrained random phase approximation. For molecules, such parameterizations enable calculation of excited states that are usually not accessible within ground state approaches. For solids, the effective Hamiltonian enables large-scale calculations using techniques designed for lattice models.« less

Sputtering yields of carbon based materials under high particle flux with low energy

NASA Astrophysics Data System (ADS)

Nakamura, K.; Nagase, A.; Dairaku, M.; Akiba, M.; Araki, M.; Okumura, Y.

1995-04-01

A new ion source which can produce high particle flux beams at low energies has been developed. This paper presents preliminary results on the sputtering yield of the carbon fiber reinforced composites (CFCs) measured with the new ion source. The sputtering yields of 1D and 2D CFCs, which are candidate materials for the divertor armour tiles, have been measured by the weight loss method under the hydrogen and deuterium particle fluxes of 2 ˜ 7 × 10 20/m 2 s at 50 ˜ 150 eV. Preferential sputtering of the matrix was observed on CFCs which included the matrix of 40 ˜ 60 w%. The energy dependence of the sputtering yields was weak. The sputtering yields of CFCs normally irradiated with deuterium beam were from 0.073 to 0.095, and were around three times larger than those with hydrogen beam.

Coupled Cluster Method with Single and Double Excitations Tailored by Matrix Product State Wave Functions.

PubMed

Veis, Libor; Antalík, Andrej; Brabec, Jiří; Neese, Frank; Legeza, Örs; Pittner, Jiří

2016-10-03

In the past decade, the quantum chemical version of the density matrix renormalization group (DMRG) method has established itself as the method of choice for calculations of strongly correlated molecular systems. Despite its favorable scaling, it is in practice not suitable for computations of dynamic correlation. We present a novel method for accurate "post-DMRG" treatment of dynamic correlation based on the tailored coupled cluster (CC) theory in which the DMRG method is responsible for the proper description of nondynamic correlation, whereas dynamic correlation is incorporated through the framework of the CC theory. We illustrate the potential of this method on prominent multireference systems, in particular, N 2 and Cr 2 molecules and also oxo-Mn(Salen), for which we have performed the first post-DMRG computations in order to shed light on the energy ordering of the lowest spin states.

Grassmann matrix quantum mechanics

DOE PAGES

Anninos, Dionysios; Denef, Frederik; Monten, Ruben

2016-04-21

We explore quantum mechanical theories whose fundamental degrees of freedom are rectangular matrices with Grassmann valued matrix elements. We study particular models where the low energy sector can be described in terms of a bosonic Hermitian matrix quantum mechanics. We describe the classical curved phase space that emerges in the low energy sector. The phase space lives on a compact Kähler manifold parameterized by a complex matrix, of the type discovered some time ago by Berezin. The emergence of a semiclassical bosonic matrix quantum mechanics at low energies requires that the original Grassmann matrices be in the long rectangular limit.more » In conclusion, we discuss possible holographic interpretations of such matrix models which, by construction, are endowed with a finite dimensional Hilbert space.« less

Accuracy of the energy-corrected sudden (ECS) scaling procedure for rotational excitation of CO by collisions with Ar

NASA Technical Reports Server (NTRS)

Green, S.; Cochrane, D. L.; Truhlar, D. G.

1986-01-01

The utility of the energy-corrected sudden (ECS) scaling method is evaluated on the basis of how accurately it predicts the entire matrix of state-to-state rate constants, when the fundamental rate constants are independently known. It is shown for the case of Ar-CO collisions at 500 K that when a critical impact parameter is about 1.75-2.0 A, the ECS method yields excellent excited state rates on the average and has an rms error of less than 20 percent.

Rapid detection of undesired cosmetic ingredients by matrix-assisted laser desorption ionization time-of-flight mass spectrometry.

PubMed

Ouyang, Jie; An, Dongli; Chen, Tengteng; Lin, Zhiwei

2017-10-01

In recent years, cosmetic industry profits soared due to the widespread use of cosmetics, which resulted in illicit manufacturers and products of poor quality. Therefore, the rapid and accurate detection of the composition of cosmetics has become crucial. At present, numerous methods, such as gas chromatography and liquid chromatography-mass spectrometry, were available for the analysis of cosmetic ingredients. However, these methods present several limitations, such as failure to perform comprehensive and rapid analysis of the samples. Compared with other techniques, matrix-assisted laser desorption ionization time-of-flight mass spectrometry offered the advantages of wide detection range, fast speed and high accuracy. In this article, we briefly summarized how to select a suitable matrix and adjust the appropriate laser energy. We also discussed the rapid identification of undesired ingredients, focusing on antibiotics and hormones in cosmetics.

Infrared spectroscopic probing of dimethylamine clusters in an Ar matrix.

PubMed

Li, Siyang; Kjaergaard, Henrik G; Du, Lin

2016-02-01

Amines have many atmospheric sources and their clusters play an important role in aerosol nucleation processes. Clusters of a typical amine, dimethylamine (DMA), of different sizes were measured with matrix isolation IR (infrared) and NIR (near infrared) spectroscopy. The NIR vibrations are more separated and therefore it is easier to distinguish different sizes of clusters in this region. The DMA clusters, up to DMA tetramer, have been optimized using density functional methods, and the geometries, binding energies and thermodynamic properties of DMA clusters were obtained. The computed frequencies and intensities of NH-stretching vibrations in the DMA clusters were used to interpret the experimental spectra. We have identified the fundamental transitions of the bonded NH-stretching vibration and the first overtone transitions of the bonded and free NH-stretching vibration in the DMA clusters. Based on the changes in vibrational intensities during the annealing processes, the growth of clusters was clearly observed. The results of annealing processes indicate that DMA molecules tend to form larger clusters with lower energies under matrix temperatures, which is also supported by the calculated reaction energies of cluster formation. Copyright © 2015. Published by Elsevier B.V.

UKRmol: a low-energy electron- and positron-molecule scattering suite

NASA Astrophysics Data System (ADS)

Carr, J. M.; Galiatsatos, P. G.; Gorfinkiel, J. D.; Harvey, A. G.; Lysaght, M. A.; Madden, D.; Mašín, Z.; Plummer, M.; Tennyson, J.; Varambhia, H. N.

2012-03-01

We describe the UK computational implementation of the R-matrix method for the treatment of electron and positron scattering from molecules. Recent developments in the UKRmol suite are detailed together with the collision processes it is enabling us to treat.

Generalization of the Kohn-Sham system that can represent arbitrary one-electron density matrices

DOE PAGES

Hubertus J. J. van Dam

2016-04-27

Density functional theory is currently the most widely applied method in electronic structure theory. The Kohn-Sham method, based on a fictitious system of noninteracting particles, is the workhorse of the theory. The particular form of the Kohn-Sham wave function admits only idempotent one-electron density matrices whereas wave functions of correlated electrons in post-Hartree-Fock methods invariably have fractional occupation numbers. Here we show that by generalizing the orbital concept and introducing a suitable dot product as well as a probability density, a noninteracting system can be chosen that can represent the one-electron density matrix of any system, even one with fractionalmore » occupation numbers. This fictitious system ensures that the exact electron density is accessible within density functional theory. It can also serve as the basis for reduced density matrix functional theory. Moreover, to aid the analysis of the results the orbitals may be assigned energies from a mean-field Hamiltonian. This produces energy levels that are akin to Hartree-Fock orbital energies such that conventional analyses based on Koopmans' theorem are available. Lastly, this system is convenient in formalisms that depend on creation and annihilation operators as they are trivially applied to single-determinant wave functions.« less

Hybrid matrix method for stable numerical analysis of the propagation of Dirac electrons in gapless bilayer graphene superlattices

NASA Astrophysics Data System (ADS)

Briones-Torres, J. A.; Pernas-Salomón, R.; Pérez-Álvarez, R.; Rodríguez-Vargas, I.

2016-05-01

Gapless bilayer graphene (GBG), like monolayer graphene, is a material system with unique properties, such as anti-Klein tunneling and intrinsic Fano resonances. These properties rely on the gapless parabolic dispersion relation and the chiral nature of bilayer graphene electrons. In addition, propagating and evanescent electron states coexist inherently in this material, giving rise to these exotic properties. In this sense, bilayer graphene is unique, since in most material systems in which Fano resonance phenomena are manifested an external source that provides extended states is required. However, from a numerical standpoint, the presence of evanescent-divergent states in the eigenfunctions linear superposition representing the Dirac spinors, leads to a numerical degradation (the so called Ωd problem) in the practical applications of the standard Coefficient Transfer Matrix (K) method used to study charge transport properties in Bilayer Graphene based multi-barrier systems. We present here a straightforward procedure based in the hybrid compliance-stiffness matrix method (H) that can overcome this numerical degradation. Our results show that in contrast to standard matrix method, the proposed H method is suitable to study the transmission and transport properties of electrons in GBG superlattice since it remains numerically stable regardless the size of the superlattice and the range of values taken by the input parameters: the energy and angle of the incident electrons, the barrier height and the thickness and number of barriers. We show that the matrix determinant can be used as a test of the numerical accuracy in real calculations.

Subthreshold resonances and resonances in the R -matrix method for binary reactions and in the Trojan horse method

NASA Astrophysics Data System (ADS)

Mukhamedzhanov, A. M.; Shubhchintak, Bertulani, C. A.

2017-08-01

In this paper we discuss the R -matrix approach to treat the subthreshold resonances for the single-level and one-channel and for the single-level and two-channel cases. In particular, the expression relating the asymptotic normalization coefficient (ANC) with the observable reduced width, when the subthreshold bound state is the only channel or coupled with an open channel, which is a resonance, is formulated. Since the ANC plays a very important role in nuclear astrophysics, these relations significantly enhance the power of the derived equations. We present the relationship between the resonance width and the ANC for the general case and consider two limiting cases: wide and narrow resonances. Different equations for the astrophysical S factors in the R -matrix approach are presented. After that we discuss the Trojan horse method (THM) formalism. The developed equations are obtained using the surface-integral formalism and the generalized R -matrix approach for the three-body resonant reactions. It is shown how the Trojan horse (TH) double-differential cross section can be expressed in terms of the on-the-energy-shell astrophysical S factor for the binary subreaction. Finally, we demonstrate how the THM can be used to calculate the astrophysical S factor for the neutron generator 13C(α ,n )16O in low-mass AGB stars. At astrophysically relevant energies this astrophysical S factor is controlled by the threshold level 1 /2+,Ex=6356 keV. Here, we reanalyzed recent TH data taking into account more accurately the three-body effects and using both assumptions that the threshold level is a subthreshold bound state or it is a resonance state.

Wave vector modification of the infinite order sudden approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sachs, J.G.; Bowman, J.M.

1980-10-15

A simple method is proposed to modify the infinite order sudden approximation (IOS) in order to extend its region of quantitative validity. The method involves modifying the phase of the IOS scattering matrix to include a part calculated at the outgoing relative kinetic energy as well as a part calculated at the incoming kinetic energy. An immediate advantage of this modification is that the resulting S matrix is symmetric. We also present a closely related method in which the relative kinetic energies used in the calculation of the phase are determined from quasiclassical trajectory calculations. A set of trajectories ismore » run with the initial state being the incoming state, and another set is run with the initial state being the outgoing state, and the average final relative kinetic energy of each set is obtained. One part of the S-operator phase is then calculated at each of these kinetic energies. We apply these methods to vibrationally inelastic collinear collisions of an atom and a harmonic oscillator, and calculate transition probabilities P/sub n/1..-->..nf for three model systems. For systems which are sudden, or nearly so, the agreement with exact quantum close-coupling calculations is substantially improved over standard IOS ones when ..delta..n=such thatub f/-n/sub i/ is large, and the corresponding transition probability is small, i.e., less than 0.1. However, the modifications we propose will not improve the accuracy of the IOS transition probabilities for any collisional system unless the standard form of IOS already gives at least qualitative agreement with exact quantal calculations. We also suggest comparisons between some classical quantities and sudden predictions which should help in determining the validity of the sudden approximation. This is useful when exact quantal data is not available for comparison.« less

Wave vector modification of the infinite order sudden approximation

NASA Astrophysics Data System (ADS)

Sachs, Judith Grobe; Bowman, Joel M.

1980-10-01

A simple method is proposed to modify the infinite order sudden approximation (IOS) in order to extend its region of quantitative validity. The method involves modifying the phase of the IOS scattering matrix to include a part calculated at the outgoing relative kinetic energy as well as a part calculated at the incoming kinetic energy. An immediate advantage of this modification is that the resulting S matrix is symmetric. We also present a closely related method in which the relative kinetic energies used in the calculation of the phase are determined from quasiclassical trajectory calculations. A set of trajectories is run with the initial state being the incoming state, and another set is run with the initial state being the outgoing state, and the average final relative kinetic energy of each set is obtained. One part of the S-operator phase is then calculated at each of these kinetic energies. We apply these methods to vibrationally inelastic collinear collisions of an atom and a harmonic oscillator, and calculate transition probabilities Pn1→nf for three model systems. For systems which are sudden, or nearly so, the agreement with exact quantum close-coupling calculations is substantially improved over standard IOS ones when Δn=‖nf-ni‖ is large, and the corresponding transition probability is small, i.e., less than 0.1. However, the modifications we propose will not improve the accuracy of the IOS transition probabilities for any collisional system unless the standard form of IOS already gives at least qualitative agreement with exact quantal calculations. We also suggest comparisons between some classical quantities and sudden predictions which should help in determining the validity of the sudden approximation. This is useful when exact quantal data is not available for comparison.

Self-consistent field for fragmented quantum mechanical model of large molecular systems.

PubMed

Jin, Yingdi; Su, Neil Qiang; Xu, Xin; Hu, Hao

2016-01-30

Fragment-based linear scaling quantum chemistry methods are a promising tool for the accurate simulation of chemical and biomolecular systems. Because of the coupled inter-fragment electrostatic interactions, a dual-layer iterative scheme is often employed to compute the fragment electronic structure and the total energy. In the dual-layer scheme, the self-consistent field (SCF) of the electronic structure of a fragment must be solved first, then followed by the updating of the inter-fragment electrostatic interactions. The two steps are sequentially carried out and repeated; as such a significant total number of fragment SCF iterations is required to converge the total energy and becomes the computational bottleneck in many fragment quantum chemistry methods. To reduce the number of fragment SCF iterations and speed up the convergence of the total energy, we develop here a new SCF scheme in which the inter-fragment interactions can be updated concurrently without converging the fragment electronic structure. By constructing the global, block-wise Fock matrix and density matrix, we prove that the commutation between the two global matrices guarantees the commutation of the corresponding matrices in each fragment. Therefore, many highly efficient numerical techniques such as the direct inversion of the iterative subspace method can be employed to converge simultaneously the electronic structure of all fragments, reducing significantly the computational cost. Numerical examples for water clusters of different sizes suggest that the method shall be very useful in improving the scalability of fragment quantum chemistry methods. © 2015 Wiley Periodicals, Inc.

Damping mathematical modelling and dynamic responses for FRP laminated composite plates with polymer matrix

NASA Astrophysics Data System (ADS)

Liu, Qimao

2018-02-01

This paper proposes an assumption that the fibre is elastic material and polymer matrix is viscoelastic material so that the energy dissipation depends only on the polymer matrix in dynamic response process. The damping force vectors in frequency and time domains, of FRP (Fibre-Reinforced Polymer matrix) laminated composite plates, are derived based on this assumption. The governing equations of FRP laminated composite plates are formulated in both frequency and time domains. The direct inversion method and direct time integration method for nonviscously damped systems are employed to solve the governing equations and achieve the dynamic responses in frequency and time domains, respectively. The computational procedure is given in detail. Finally, dynamic responses (frequency responses with nonzero and zero initial conditions, free vibration, forced vibrations with nonzero and zero initial conditions) of a FRP laminated composite plate are computed using the proposed methodology. The proposed methodology in this paper is easy to be inserted into the commercial finite element analysis software. The proposed assumption, based on the theory of material mechanics, needs to be further proved by experiment technique in the future.

Formulation and dissolution kinetics study of hydrophilic matrix tablets with tramadol hydrochloride and different co-processed dry binders.

PubMed

Komersová, Alena; Lochař, Václav; Myslíková, Kateřina; Mužíková, Jitka; Bartoš, Martin

2016-12-01

The aim of this study is to present the possibility of using of co-processed dry binders for formulation of matrix tablets with drug controlled release. Hydrophilic matrix tablets with tramadol hydrochloride, hypromellose and different co-processed dry binders were prepared by direct compression method. Hypromelloses Methocel™ K4M Premium CR or Methocel™ K100M Premium CR were used as controlled release agents and Prosolv® SMCC 90 or Disintequik™ MCC 25 were used as co-processed dry binders. Homogeneity of the tablets was evaluated using scanning electron microscopy and energy dispersive X-ray microanalysis. The release of tramadol hydrochloride from prepared formulations was studied by dissolution test method. The dissolution profiles obtained were evaluated by non-linear regression analysis, release rate constants and other kinetic parameters were determined. It was found that matrix tablets based on Prosolv® SMCC 90 and Methocel™ Premium CR cannot control the tramadol release effectively for >12h and tablets containing Disintequik™ MCC 25 and Methocel™ Premium CR >8h. Copyright © 2016 Elsevier B.V. All rights reserved.

Implementation of polyatomic MCTDHF capability

NASA Astrophysics Data System (ADS)

Haxton, Daniel; Jones, Jeremiah; Rescigno, Thomas; McCurdy, C. William; Ibrahim, Khaled; Williams, Sam; Vecharynski, Eugene; Rouet, Francois-Henry; Li, Xiaoye; Yang, Chao

2015-05-01

The implementation of the Multiconfiguration Time-Dependent Hartree-Fock method for poly- atomic molecules using a cartesian product grid of sinc basis functions will be discussed. The focus will be on two key components of the method: first, the use of a resolution-of-the-identity approximation; sec- ond, the use of established techniques for triple Toeplitz matrix algebra using fast Fourier transform over distributed memory architectures (MPI 3D FFT). The scaling of two-electron matrix element transformations is converted from O(N4) to O(N log N) by including these components. Here N = n3, with n the number of points on a side. We test the prelim- inary implementation by calculating absorption spectra of small hydro- carbons, using approximately 16-512 points on a side. This work is supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under the Early Career program, and by the offices of BES and Advanced Scientific Computing Research, under the SciDAC program.

Study on the Effect of Surface Energy of Polypropylene/Polyamide12 polymer Hybrid Matrix Reinforced with Virgin and Recycled Carbon Fiber

NASA Astrophysics Data System (ADS)

Sena Maia, Bruno

The presented work is focused on characterization of thermal treated recycled and virgin carbon fibers. Their thermal performances, chemical surface composition and its influence on interfacial adhesion phenomena on PP/PA12 hybrid matrix were compared using TGA, FTIR and XPS analysis. Additionally, differences between hybrid matrix structural performances of PP/PA12 using both surface modifiers PMPPIC and MAPP were investigated. Final mechanical properties improvements between 8% up to 17% were reached by addition of PMPPIC in PP/PA12 hybrid matrix. For PP/PA12 matrix reinforcement using virgin and recycled carbon fibers, impact energy was improved up to 98% compared with MAPP modified matrix leading to a novel composite with good energy absorption. Finally, wettability studies and surface free energy analysis of all materials studied support the effect of the addition of PMPPIC, MAPP and carbon fibers in final composite surface thermodynamics bringing important data correlation between interfacial adhesion mechanisms and final composite performance.

Sustainable energy planning decision using the intuitionistic fuzzy analytic hierarchy process: choosing energy technology in Malaysia: necessary modifications

NASA Astrophysics Data System (ADS)

Al-Qudaimi, Abdullah; Kumar, Amit

2018-05-01

Recently, Abdullah and Najib (International Journal of Sustainable Energy 35(4): 360-377, 2016) proposed an intuitionistic fuzzy analytic hierarchy process to deal with uncertainty in decision-making and applied it to establish preference in the sustainable energy planning decision-making of Malaysia. This work may attract the researchers of other countries to choose energy technology for their countries. However, after a deep study of the published paper (International Journal of Sustainable Energy 35(4): 362-377, 2016), it is noticed that the expression used by Abdullah and Najib in Step 6 of their proposed method for evaluating the intuitionistic fuzzy entropy of each aggregate of each row of intuitionistic fuzzy matrix is not valid. Therefore, it is not genuine to use the method proposed by Abdullah and Najib for solving real-life problems. The aim of this paper was to suggest the required necessary modifications for resolving the flaws of the Abdullah and Najib method.

Characterization of Deuterated-xylene Scintillator as a Neutron Spectrometer

DOE PAGES

Di Fulvio, Angela; Becchetti, F. D.; Raymond, R. S.; ...

2016-11-16

We have experimentally characterized the neutron light output response functions of a deuterated-xylene scintillator for neutron energies lower than 10 MeV. We then used the response matrix to unfold the energy distribution of neutrons produced via several reactions, i.e. spontaneous fission, d(d,n)3He, 27Al(d,n)28Si, and 9Be(alpha,n)12C. Organic scintillators based on deuterated compounds show a fast response and good gamma-neutron discrimination capability, similar to proton-based scintillators. Deuterated scintillators can also effectively provide neutron spectra by unfolding measured data with the detector response matrix, without the need of time-of-flight. Deuteron recoils, produced by elastic collisions between deuterium and impinging neutrons, are preferentially forward-scattered.more » This non-isotropic reaction results in distinct peaks in the response functions to monoenergetic neutrons. In this work, we evaluated a custom-fabricated 7.62 cm x 7.62 cm deuterated-xylene (EJ301D) liquid scintillator. This liquid has a low volatility and higher flash point, compared to benzene-based deuterated detectors, e.g. EJ315 and NE230. We measured the EJ301D detector neutron response matrix (up to 6 MeV neutron energy) using an intense Cf252 source and the time-of-flight technique. The number of response functions obtained using our method is only limited by counting statistics and by the experimentally achievable energy resolution. Multi-channel unfolding was performed successfully for neutron spectra with different energy spectra.« less

Energy Finite Element Analysis for Computing the High Frequency Vibration of the Aluminum Testbed Cylinder and Correlating the Results to Test Data

NASA Technical Reports Server (NTRS)

Vlahopoulos, Nickolas

2005-01-01

The Energy Finite Element Analysis (EFEA) is a finite element based computational method for high frequency vibration and acoustic analysis. The EFEA solves with finite elements governing differential equations for energy variables. These equations are developed from wave equations. Recently, an EFEA method for computing high frequency vibration of structures either in vacuum or in contact with a dense fluid has been presented. The presence of fluid loading has been considered through added mass and radiation damping. The EFEA developments were validated by comparing EFEA results to solutions obtained by very dense conventional finite element models and solutions from classical techniques such as statistical energy analysis (SEA) and the modal decomposition method for bodies of revolution. EFEA results have also been compared favorably with test data for the vibration and the radiated noise generated by a large scale submersible vehicle. The primary variable in EFEA is defined as the time averaged over a period and space averaged over a wavelength energy density. A joint matrix computed from the power transmission coefficients is utilized for coupling the energy density variables across any discontinuities, such as change of plate thickness, plate/stiffener junctions etc. When considering the high frequency vibration of a periodically stiffened plate or cylinder, the flexural wavelength is smaller than the interval length between two periodic stiffeners, therefore the stiffener stiffness can not be smeared by computing an equivalent rigidity for the plate or cylinder. The periodic stiffeners must be regarded as coupling components between periodic units. In this paper, Periodic Structure (PS) theory is utilized for computing the coupling joint matrix and for accounting for the periodicity characteristics.

Global solutions of restricted open-shell Hartree-Fock theory from semidefinite programming with applications to strongly correlated quantum systems.

PubMed

Veeraraghavan, Srikant; Mazziotti, David A

2014-03-28

We present a density matrix approach for computing global solutions of restricted open-shell Hartree-Fock theory, based on semidefinite programming (SDP), that gives upper and lower bounds on the Hartree-Fock energy of quantum systems. While wave function approaches to Hartree-Fock theory yield an upper bound to the Hartree-Fock energy, we derive a semidefinite relaxation of Hartree-Fock theory that yields a rigorous lower bound on the Hartree-Fock energy. We also develop an upper-bound algorithm in which Hartree-Fock theory is cast as a SDP with a nonconvex constraint on the rank of the matrix variable. Equality of the upper- and lower-bound energies guarantees that the computed solution is the globally optimal solution of Hartree-Fock theory. The work extends a previously presented method for closed-shell systems [S. Veeraraghavan and D. A. Mazziotti, Phys. Rev. A 89, 010502-R (2014)]. For strongly correlated systems the SDP approach provides an alternative to the locally optimized Hartree-Fock energies and densities with a certificate of global optimality. Applications are made to the potential energy curves of C2, CN, Cr2, and NO2.

Universality of quantum information in chaotic CFTs

NASA Astrophysics Data System (ADS)

Lashkari, Nima; Dymarsky, Anatoly; Liu, Hong

2018-03-01

We study the Eigenstate Thermalization Hypothesis (ETH) in chaotic conformal field theories (CFTs) of arbitrary dimensions. Assuming local ETH, we compute the reduced density matrix of a ball-shaped subsystem of finite size in the infinite volume limit when the full system is an energy eigenstate. This reduced density matrix is close in trace distance to a density matrix, to which we refer as the ETH density matrix, that is independent of all the details of an eigenstate except its energy and charges under global symmetries. In two dimensions, the ETH density matrix is universal for all theories with the same value of central charge. We argue that the ETH density matrix is close in trace distance to the reduced density matrix of the (micro)canonical ensemble. We support the argument in higher dimensions by comparing the Von Neumann entropy of the ETH density matrix with the entropy of a black hole in holographic systems in the low temperature limit. Finally, we generalize our analysis to the coherent states with energy density that varies slowly in space, and show that locally such states are well described by the ETH density matrix.

Quantum propagation and confinement in 1D systems using the transfer-matrix method

NASA Astrophysics Data System (ADS)

Pujol, Olivier; Carles, Robert; Pérez, José-Philippe

2014-05-01

The aim of this article is to provide some Matlab scripts to the teaching community in quantum physics. The scripts are based on the transfer-matrix formalism and offer a very efficient and versatile tool to solve problems of a physical object (electron, proton, neutron, etc) with one-dimensional (1D) stationary potential energy. Resonant tunnelling through a multiple-barrier or confinement in wells of various shapes is particularly analysed. The results are quantitatively discussed with semiconductor heterostructures, harmonic and anharmonic molecular vibrations, or neutrons in a gravity field. Scripts and other examples (hydrogen-like ions and transmission by a smooth variation of potential energy) are available freely at http://www-loa.univ-lille1.fr/˜pujol in three languages: English, French and Spanish.

Non-collinear magnetism with analytic Bond-Order Potentials

NASA Astrophysics Data System (ADS)

Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

2015-03-01

The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

Extending density functional embedding theory for covalently bonded systems.

PubMed

Yu, Kuang; Carter, Emily A

2017-12-19

Quantum embedding theory aims to provide an efficient solution to obtain accurate electronic energies for systems too large for full-scale, high-level quantum calculations. It adopts a hierarchical approach that divides the total system into a small embedded region and a larger environment, using different levels of theory to describe each part. Previously, we developed a density-based quantum embedding theory called density functional embedding theory (DFET), which achieved considerable success in metals and semiconductors. In this work, we extend DFET into a density-matrix-based nonlocal form, enabling DFET to study the stronger quantum couplings between covalently bonded subsystems. We name this theory density-matrix functional embedding theory (DMFET), and we demonstrate its performance in several test examples that resemble various real applications in both chemistry and biochemistry. DMFET gives excellent results in all cases tested thus far, including predicting isomerization energies, proton transfer energies, and highest occupied molecular orbital-lowest unoccupied molecular orbital gaps for local chromophores. Here, we show that DMFET systematically improves the quality of the results compared with the widely used state-of-the-art methods, such as the simple capped cluster model or the widely used ONIOM method.

The calculation of the contributions to low energy e+H2 scattering from sigma u+ and Pion u symmetries using the Kohn variational method

NASA Technical Reports Server (NTRS)

Armour, E. A. G.; Baker, D. J.; Plummer, M.

1990-01-01

Above incident energies of about 2 eV, the contribution to the total cross section in positron+H2 scattering from the sigma g+ symmetry is insufficient to account for the experimental value. Calculations carried out of the lowest partial waves of sigma u+ symmetry and Pion u symmetry using the Kohn variational method are described. The contributions to the total cross section from the two equivalent partial waves of Pion u symmetry significantly reduce the discrepancy with experiment up to incident energies of 4 to 5 eV. Comparisons are made with recent R-matrix calculations performed by Danby and Tennyson.

Singlet oxygen Triplet Energy Transfer based imaging technology for mapping protein-protein proximity in intact cells

PubMed Central

To, Tsz-Leung; Fadul, Michael J.; Shu, Xiaokun

2014-01-01

Many cellular processes are carried out by large protein complexes that can span several tens of nanometers. Whereas Forster resonance energy transfer has a detection range of <10 nm, here we report the theoretical development and experimental demonstration of a new fluorescence imaging technology with a detection range of up to several tens of nanometers: singlet oxygen triplet energy transfer. We demonstrate that our method confirms the topology of a large protein complex in intact cells, which spans from the endoplasmic reticulum to the outer mitochondrial membrane and the matrix. This new method is thus suited for mapping protein proximity in large protein complexes. PMID:24905026

Suppression of activation energy and superconductivity by the addition of Al{sub 2}O{sub 3} nanoparticles in CuTl-1223 matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jabbar, Abdul; Qasim, Irfan; Mumtaz, M.

2014-05-28

Low anisotropic (Cu{sub 0.5}Tl{sub 0.5})Ba{sub 2}Ca{sub 2}Cu{sub 3}O{sub 10−δ} (CuTl-1223) high T{sub c} superconducting matrix was synthesized by solid-state reaction and Al{sub 2}O{sub 3} nanoparticles were prepared separately by co-precipitation method. Al{sub 2}O{sub 3} nanoparticles were added with different concentrations during the final sintering cycle of CuTl-1223 superconducting matrix to get the required (Al{sub 2}O{sub 3}){sub y}/CuTl-1223, y = 0.0, 0.5, 0.7, 1.0, and 1.5 wt. %, composites. The samples were characterized by X-ray diffraction (XRD), scanning electron microscopy, energy dispersive X-ray, and dc-resistivity (ρ) measurements. The activation energy and superconductivity were suppressed with increasing concentration of Al{sub 2}O{sub 3} nanoparticles in (CuTl-1223) matrix.more » The XRD analysis showed that the addition of Al{sub 2}O{sub 3} nanoparticles did not affect the crystal structure of the parent CuTl-1223 superconducting phase. The suppression of activation energy and superconducting properties is most probably due to weak flux pinning in the samples. The possible reason of weak flux pinning is reduction of weak links and enhanced inter-grain coupling due to the presence of Al{sub 2}O{sub 3} nanoparticles at the grain boundaries. The presence of Al{sub 2}O{sub 3} nanoparticles at the grain boundaries possibly reduced the number of flux pinning centers, which were present in the form of weak links in the pure CuTl-1223 superconducting matrix. The increase in the values of inter-grain coupling (α) deduced from the fluctuation induced conductivity analysis with the increased concentration of Al{sub 2}O{sub 3} nanoparticles is a theoretical evidence of improved inter-grain coupling.« less

Characterization of the energy-dependent uncertainty and correlation in silicon neutron displacement damage metrics

NASA Astrophysics Data System (ADS)

Griffin, Patrick; Rochman, Dimitri; Koning, Arjan

2017-09-01

A rigorous treatment of the uncertainty in the underlying nuclear data on silicon displacement damage metrics is presented. The uncertainty in the cross sections and recoil atom spectra are propagated into the energy-dependent uncertainty contribution in the silicon displacement kerma and damage energy using a Total Monte Carlo treatment. An energy-dependent covariance matrix is used to characterize the resulting uncertainty. A strong correlation between different reaction channels is observed in the high energy neutron contributions to the displacement damage metrics which supports the necessity of using a Monte Carlo based method to address the nonlinear nature of the uncertainty propagation.

Energy transfer and reaction dynamics of matrix-isolated 1,2-difluoroethane-d4

NASA Astrophysics Data System (ADS)

Raff, Lionel M.

1990-09-01

The molecular dynamics of vibrationally excited 1,2-difluoroethane-d4 isolated in Ar, Kr, and Xe matrices at 12 K are investigated using trajectory methods. The matrix model is an fcc crystal containing 125 unit cells with 666 atoms in a cubic (5×5×5) arrangement. It is assumed that 1,2-difluoroethane-d4 is held interstitially within the volume bounded by the innermost unit cell of the crystal. The transport effects of the bulk are simulated using the velocity reset method introduced by Riley, Coltrin, and Diestler [J. Chem. Phys. 88, 5934 (1988)]. The system potential is written as the separable sum of a lattice potential, a lattice-molecule interaction and a gas-phase potential for 1,2-difluoroethane. The first two of these are assumed to have pairwise form while the molecular potential is a modified form of the global potential previously developed for 1,2-difluoroethane [J. Phys. Chem. 91, 3266 (1987)]. Calculated sublimation energies for the pure crystals are in good accord with the experimental data. The distribution of metastable-state energies for matrix-isolated 1,2-difluoroethane-d4 is Gaussian in form. In krypton, the full width at half maximum for the distribution is 0.37 eV. For a total excitation energy of 6.314 eV, the observed dynamic processes are vibrational relaxation, orientational exchange, and four-center DF elimination reactions. The first of these processes is characterized by a near linear, first-order decay curve with rate coefficients in the range 1.30-1.48×1011 s-1. The average rates in krypton and xenon are nearly equal. The process is slightly slower in argon. The decay curves exhibit characteristic high-frequency oscillations that are generally seen in energy transfer studies. It is demonstrated that these oscillations are associated with the frequencies for intramolecular energy transfer so that the entire frequency spectrum for such transfer processes can be obtained from the Fourier transform of the decay curve. Orientational exchange is shown to occur with much greater frequency as the unit cell spacing decreases. The occurrence of orientational exchange generally results in a very rapid dissipation of molecular rotational energy to the lattice which causes a characteristic break to occur in the decay curve. It is shown that 16% of the total energy transfer to the lattice in argon is a result of such rotational energy transfer. The propensity for four-center DF elimination is found to be greater in argon than in either krypton or xenon. The relaxation data show that this effect is not the result of different energy transfer rates but is probably associated with steric effects resulting from the smaller lattice dimensions in argon. Isotope effects upon the energy partitioning in unimolecular reactions of 1,2-difluoroethane and upon the energy transfer dynamics under matrix-isolation conditions are also reported.

The mechanical properties measurement of multiwall carbon nanotube reinforced nanocrystalline aluminum matrix composite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Manjula, E-mail: manjula.physics@gmail.com; Pal, Hemant; Sharma, Vimal

Nanocrystalline aluminum matrix composite containing carbon nanotubes were fabricated using physical mixing method followed by cold pressing. The microstructure of the composite has been investigated using X-ray diffraction, scanning electron microscopy and energy dispersive spectroscopy techniques. These studies revealed that the carbon nanotubes were homogeneously dispersed throughout the metal matrix. The consolidated samples were pressureless sintered in inert atmosphere to further actuate a strong interface between carbon nanotubes and aluminum matrix. The nanoindentation tests carried out on considered samples showed that with the addition of 0.5 wt% carbon nanotubes, the hardness and elastic modulus of the aluminum matrix increased bymore » 21.2 % and 2 % repectively. The scratch tests revealed a decrease in the friction coefficient of the carbon nanotubes reinforced composite due to the presence of lubricating interfacial layer. The prepared composites were promising entities to be used in the field of sporting goods, construction materials and automobile industries.« less

The use of an analytic Hamiltonian matrix for solving the hydrogenic atom

NASA Astrophysics Data System (ADS)

Bhatti, Mohammad

2001-10-01

The non-relativistic Hamiltonian corresponding to the Shrodinger equation is converted into analytic Hamiltonian matrix using the kth order B-splines functions. The Galerkin method is applied to the solution of the Shrodinger equation for bound states of hydrogen-like systems. The program Mathematica is used to create analytic matrix elements and exact integration is performed over the knot-sequence of B-splines and the resulting generalized eigenvalue problem is solved on a specified numerical grid. The complete basis set and the energy spectrum is obtained for the coulomb potential for hydrogenic systems with Z less than 100 with B-splines of order eight. Another application is given to test the Thomas-Reiche-Kuhn sum rule for the hydrogenic systems.

IR-MALDESI MASS SPECTROMETRY IMAGING OF BIOLOGICAL TISSUE SECTIONS USING ICE AS A MATRIX

PubMed Central

Robichaud, Guillaume; Barry, Jeremy A.; Muddiman, David C.

2014-01-01

Infrared Matrix-Assisted Laser Desorption Electrospray Ionization (IR-MALDESI) Mass Spectrometry imaging of biological tissue sections using a layer of deposited ice as an energy absorbing matrix was investigated. Dynamics of plume ablation were first explored using a nanosecond exposure shadowgraphy system designed to simultaneously collect pictures of the plume with a camera and collect the FT-ICR mass spectrum corresponding to that same ablation event. Ablation of fresh tissue analyzed with and without using ice as a matrix were both compared using this technique. Effect of spot-to-spot distance, number of laser shots per pixel and tissue condition (matrix) on ion abundance was also investigated for 50 µm thick tissue sections. Finally, the statistical method called design of experiments was used to compare source parameters and determine the optimal conditions for IR-MALDESI of tissue sections using deposited ice as a matrix. With a better understanding of the fundamentals of ablation dynamics and a systematic approach to explore the experimental space, it was possible to improve ion abundance by nearly one order of magnitude. PMID:24385399

Probabilistic homogenization of random composite with ellipsoidal particle reinforcement by the iterative stochastic finite element method

NASA Astrophysics Data System (ADS)

Sokołowski, Damian; Kamiński, Marcin

2018-01-01

This study proposes a framework for determination of basic probabilistic characteristics of the orthotropic homogenized elastic properties of the periodic composite reinforced with ellipsoidal particles and a high stiffness contrast between the reinforcement and the matrix. Homogenization problem, solved by the Iterative Stochastic Finite Element Method (ISFEM) is implemented according to the stochastic perturbation, Monte Carlo simulation and semi-analytical techniques with the use of cubic Representative Volume Element (RVE) of this composite containing single particle. The given input Gaussian random variable is Young modulus of the matrix, while 3D homogenization scheme is based on numerical determination of the strain energy of the RVE under uniform unit stretches carried out in the FEM system ABAQUS. The entire series of several deterministic solutions with varying Young modulus of the matrix serves for the Weighted Least Squares Method (WLSM) recovery of polynomial response functions finally used in stochastic Taylor expansions inherent for the ISFEM. A numerical example consists of the High Density Polyurethane (HDPU) reinforced with the Carbon Black particle. It is numerically investigated (1) if the resulting homogenized characteristics are also Gaussian and (2) how the uncertainty in matrix Young modulus affects the effective stiffness tensor components and their PDF (Probability Density Function).

New way for determining electron energy levels in quantum dots arrays using finite difference method

NASA Astrophysics Data System (ADS)

Dujardin, F.; Assaid, E.; Feddi, E.

2018-06-01

Electronic states are investigated in quantum dots arrays, depending on the type of cubic Bravais lattice (primitive, body centered or face centered) according to which the dots are arranged, the size of the dots and the interdot distance. It is shown that the ground state energy level can undergo significant variations when these parameters are modified. The results were obtained by means of finite difference method which has proved to be easily adaptable, efficient and precise. The symmetry properties of the lattice have been used to reduce the size of the Hamiltonian matrix.

A multi-dimensional Smolyak collocation method in curvilinear coordinates for computing vibrational spectra

DOE Office of Scientific and Technical Information (OSTI.GOV)

Avila, Gustavo, E-mail: Gustavo-Avila@telefonica.net; Carrington, Tucker, E-mail: Tucker.Carrington@queensu.ca

In this paper, we improve the collocation method for computing vibrational spectra that was presented in Avila and Carrington, Jr. [J. Chem. Phys. 139, 134114 (2013)]. Using an iterative eigensolver, energy levels and wavefunctions are determined from values of the potential on a Smolyak grid. The kinetic energy matrix-vector product is evaluated by transforming a vector labelled with (nondirect product) grid indices to a vector labelled by (nondirect product) basis indices. Both the transformation and application of the kinetic energy operator (KEO) scale favorably. Collocation facilitates dealing with complicated KEOs because it obviates the need to calculate integrals of coordinatemore » dependent coefficients of differential operators. The ideas are tested by computing energy levels of HONO using a KEO in bond coordinates.« less

Systematic R -matrix analysis of the 13C(p ,γ )14N capture reaction

NASA Astrophysics Data System (ADS)

Chakraborty, Suprita; deBoer, Richard; Mukherjee, Avijit; Roy, Subinit

2015-04-01

Background: The proton capture reaction 13C(p ,γ )14N is an important reaction in the CNO cycle during hydrogen burning in stars with mass greater than the mass of the Sun. It also occurs in astrophysical sites such as red giant stars: the asymptotic giant branch (AGB) stars. The low energy astrophysical S factor of this reaction is dominated by a resonance state at an excitation energy of around 8.06 MeV (Jπ=1-,T =1 ) in 14N. The other significant contributions come from the low energy tail of the broad resonance with Jπ=0-,T =1 at an excitation of 8.78 MeV and the direct capture process. Purpose: Measurements of the low energy astrophysical S factor of the radiative capture reaction 13C(p ,γ )14N reported extrapolated values of S (0 ) that differ by about 30 % . Subsequent R -matrix analysis and potential model calculations also yielded significantly different values for S (0 ) . The present work intends to look into the discrepancy through a detailed R -matrix analysis with emphasis on the associated uncertainties. Method: A systematic reanalysis of the available decay data following the capture to the Jπ=1-,T =1 resonance state of 14N around 8.06 MeV excitation had been performed within the framework of the R -matrix method. A simultaneous analysis of the 13C(p ,p0 ) data, measured over a similar energy range, was carried out with the capture data. The data for the ground state decay of the broad resonance state (Jπ=0-,T =1 ) around 8.78 MeV excitations was included as well. The external capture model along with the background poles to simulate the internal capture contribution were used to estimate the direct capture contribution. The asymptotic normalization constants (ANCs) for all states were extracted from the capture data. The multichannel, multilevel R -matrix code azure2 was used for the calculation. Results: The values of the astrophysical S factor at zero relative energy, resulting from the present analysis, are found to be consistent within the error bars for the two sets of capture data used. However, it is found from the fits to the elastic scattering data that the position of the Jπ=1-,T =1 resonance state is uncertain by about 0.6 keV, preferring an excitation energy value of 8.062 MeV. Also the extracted ANC values for the states of 14N corroborate the values from the transfer reaction studies. The reaction rates from the present calculation are about 10 -15 % lower than the values of the NACRE II compilation but compare well with those from NACRE I. Conclusion: The precise energy of the Jπ=1-,T =1 resonance level around 8.06 MeV in 14N must be determined. Further measurements around and below 100 keV with precision are necessary to reduce the uncertainty in the S -factor value at zero relative energy.

Research on the recycling industry development model for typical exterior plastic components of end-of-life passenger vehicle based on the SWOT method.

PubMed

Zhang, Hongshen; Chen, Ming

2013-11-01

In-depth studies on the recycling of typical automotive exterior plastic parts are significant and beneficial for environmental protection, energy conservation, and sustainable development of China. In the current study, several methods were used to analyze the recycling industry model for typical exterior parts of passenger vehicles in China. The strengths, weaknesses, opportunities, and challenges of the current recycling industry for typical exterior parts of passenger vehicles were analyzed comprehensively based on the SWOT method. The internal factor evaluation matrix and external factor evaluation matrix were used to evaluate the internal and external factors of the recycling industry. The recycling industry was found to respond well to all the factors and it was found to face good developing opportunities. Then, the cross-link strategies analysis for the typical exterior parts of the passenger car industry of China was conducted based on the SWOT analysis strategies and established SWOT matrix. Finally, based on the aforementioned research, the recycling industry model led by automobile manufacturers was promoted. Copyright © 2013 Elsevier Ltd. All rights reserved.

Recursive Factorization of the Inverse Overlap Matrix in Linear Scaling Quantum Molecular Dynamics Simulations

DOE PAGES

Negre, Christian F. A; Mniszewski, Susan M.; Cawkwell, Marc Jon; ...

2016-06-06

We present a reduced complexity algorithm to compute the inverse overlap factors required to solve the generalized eigenvalue problem in a quantum-based molecular dynamics (MD) simulation. Our method is based on the recursive iterative re nement of an initial guess Z of the inverse overlap matrix S. The initial guess of Z is obtained beforehand either by using an approximate divide and conquer technique or dynamically, propagated within an extended Lagrangian dynamics from previous MD time steps. With this formulation, we achieve long-term stability and energy conservation even under incomplete approximate iterative re nement of Z. Linear scaling performance ismore » obtained using numerically thresholded sparse matrix algebra based on the ELLPACK-R sparse matrix data format, which also enables e cient shared memory parallelization. As we show in this article using selfconsistent density functional based tight-binding MD, our approach is faster than conventional methods based on the direct diagonalization of the overlap matrix S for systems as small as a few hundred atoms, substantially accelerating quantum-based simulations even for molecular structures of intermediate size. For a 4,158 atom water-solvated polyalanine system we nd an average speedup factor of 122 for the computation of Z in each MD step.« less

The role of fiber and matrix in crash energy absorption of composite materials

NASA Technical Reports Server (NTRS)

Farley, G. L.; Bird, R. K.; Modlin, J. T.

1986-01-01

Static crushing tests were conducted on tube specimens fabricated from graphite/epoxy, Kevlar/epoxy and hybrid combinations of graphite-Kevlar/epoxy to examine the influence the fiber and matrix constitutive properties and laminate architecture have on energy absorption. Fiber and matrix ultimate failure strain were determined to significantly effect energy absorption. The energy absorption capability of high ultimate failure strain materials (AS-6/F185 and AS-6/HST-7) was less than materials having lower ultimate failure strain. Lamina stacking sequence had up to a 300 percent change in energy absorption for the materials tested. Hybridizing with graphite and Kevlar reinforcements resulted in materials with high energy absorption capabilities that have postcrushing integrity.

Highly sensitive and selective spectrofluorimetric determination of metoclopramide hydrochloride in pharmaceutical tablets and serum samples using Eu3+ ion doped in sol-gel matrix.

PubMed

Attia, M S; Aboaly, M M

2010-06-30

A simple, sensitive and selective spectrofluorimetric method for the determination of Metoclopramide hydrochloride (MCP) is developed. The MCP can remarkably enhances the luminescence intensity of the Eu(3+) ion doped in sol-gel matrix at lambda(ex)=380 nm in DMSO at pH 8.7. The intensity of the emission band of Eu(3+) ion doped in sol-gel matrix increases due to energy transfer from MCP to Eu(3+) in the excited state. The enhancement of the emission band of Eu(3+) ion doped in sol-gel matrix at 617 nm was found to be directly proportional to the concentration of MCP with a dynamic range of 5 x 10(-9) - 1.0 x 10(-6) mol L(-1) and detection limit of 2.2 x10(-11) mol L(-1). Copyright 2010 Elsevier B.V. All rights reserved.

Soft-landing ion mobility of silver clusters for small-molecule matrix-assisted laser desorption ionization mass spectrometry and imaging of latent fingerprints.

PubMed

Walton, Barbara L; Verbeck, Guido F

2014-08-19

Matrix-assisted laser desorption ionization (MALDI) imaging is gaining popularity, but matrix effects such as mass spectral interference and damage to the sample limit its applications. Replacing traditional matrices with silver particles capable of equivalent or increased photon energy absorption from the incoming laser has proven to be beneficial for low mass analysis. Not only can silver clusters be advantageous for low mass compound detection, but they can be used for imaging as well. Conventional matrix application methods can obstruct samples, such as fingerprints, rendering them useless after mass analysis. The ability to image latent fingerprints without causing damage to the ridge pattern is important as it allows for further characterization of the print. The application of silver clusters by soft-landing ion mobility allows for enhanced MALDI and preservation of fingerprint integrity.

Fast evaluation of scaled opposite spin second-order Møller-Plesset correlation energies using auxiliary basis expansions and exploiting sparsity.

PubMed

Jung, Yousung; Shao, Yihan; Head-Gordon, Martin

2007-09-01

The scaled opposite spin Møller-Plesset method (SOS-MP2) is an economical way of obtaining correlation energies that are computationally cheaper, and yet, in a statistical sense, of higher quality than standard MP2 theory, by introducing one empirical parameter. But SOS-MP2 still has a fourth-order scaling step that makes the method inapplicable to very large molecular systems. We reduce the scaling of SOS-MP2 by exploiting the sparsity of expansion coefficients and local integral matrices, by performing local auxiliary basis expansions for the occupied-virtual product distributions. To exploit sparsity of 3-index local quantities, we use a blocking scheme in which entire zero-rows and columns, for a given third global index, are deleted by comparison against a numerical threshold. This approach minimizes sparse matrix book-keeping overhead, and also provides sufficiently large submatrices after blocking, to allow efficient matrix-matrix multiplies. The resulting algorithm is formally cubic scaling, and requires only moderate computational resources (quadratic memory and disk space) and, in favorable cases, is shown to yield effective quadratic scaling behavior in the size regime we can apply it to. Errors associated with local fitting using the attenuated Coulomb metric and numerical thresholds in the blocking procedure are found to be insignificant in terms of the predicted relative energies. A diverse set of test calculations shows that the size of system where significant computational savings can be achieved depends strongly on the dimensionality of the system, and the extent of localizability of the molecular orbitals. Copyright 2007 Wiley Periodicals, Inc.

Design of specially adapted reactive coordinates to economically compute potential and kinetic energy operators including geometry relaxation

NASA Astrophysics Data System (ADS)

Thallmair, Sebastian; Roos, Matthias K.; de Vivie-Riedle, Regina

2016-06-01

Quantum dynamics simulations require prior knowledge of the potential energy surface as well as the kinetic energy operator. Typically, they are evaluated in a low-dimensional subspace of the full configuration space of the molecule as its dimensionality increases proportional to the number of atoms. This entails the challenge to find the most suitable subspace. We present an approach to design specially adapted reactive coordinates spanning this subspace. In addition to the essential geometric changes, these coordinates take into account the relaxation of the non-reactive coordinates without the necessity of performing geometry optimizations at each grid point. The method is demonstrated for an ultrafast photoinduced bond cleavage in a commonly used organic precursor for the generation of electrophiles. The potential energy surfaces for the reaction as well as the Wilson G-matrix as part of the kinetic energy operator are shown for a complex chemical reaction, both including the relaxation of the non-reactive coordinates on equal footing. A microscopic interpretation of the shape of the G-matrix elements allows to analyze the impact of the non-reactive coordinates on the kinetic energy operator. Additionally, we compare quantum dynamics simulations with and without the relaxation of the non-reactive coordinates included in the kinetic energy operator to demonstrate its influence.

Design of specially adapted reactive coordinates to economically compute potential and kinetic energy operators including geometry relaxation.

PubMed

Thallmair, Sebastian; Roos, Matthias K; de Vivie-Riedle, Regina

2016-06-21

Quantum dynamics simulations require prior knowledge of the potential energy surface as well as the kinetic energy operator. Typically, they are evaluated in a low-dimensional subspace of the full configuration space of the molecule as its dimensionality increases proportional to the number of atoms. This entails the challenge to find the most suitable subspace. We present an approach to design specially adapted reactive coordinates spanning this subspace. In addition to the essential geometric changes, these coordinates take into account the relaxation of the non-reactive coordinates without the necessity of performing geometry optimizations at each grid point. The method is demonstrated for an ultrafast photoinduced bond cleavage in a commonly used organic precursor for the generation of electrophiles. The potential energy surfaces for the reaction as well as the Wilson G-matrix as part of the kinetic energy operator are shown for a complex chemical reaction, both including the relaxation of the non-reactive coordinates on equal footing. A microscopic interpretation of the shape of the G-matrix elements allows to analyze the impact of the non-reactive coordinates on the kinetic energy operator. Additionally, we compare quantum dynamics simulations with and without the relaxation of the non-reactive coordinates included in the kinetic energy operator to demonstrate its influence.

Development of advanced polymer nanocomposite capacitors

NASA Astrophysics Data System (ADS)

Mendoza, Miguel

The current development of modern electronics has driven the need for new series of energy storage devices with higher energy density and faster charge/discharge rate. Batteries and capacitors are two of the most widely used energy storage devices. Compared with batteries, capacitors have higher power density and significant higher charge/discharge rate. Therefore, high energy density capacitors play a significant role in modern electronic devices, power applications, space flight technologies, hybrid electric vehicles, portable defibrillators, and pulse power applications. Dielectric film capacitors represent an exceptional alternative for developing high energy density capacitors due to their high dielectric constants, outstanding breakdown voltages, and flexibility. The implementation of high aspect ratio dielectric inclusions such as nanowires into polymer capacitors could lead to further enhancement of its energy density. Therefore, this research effort is focused on the development of a new series of dielectric capacitors composed of nanowire reinforced polymer matrix composites. This concept of nanocomposite capacitors combines the extraordinary physical and chemical properties of the one-dimension (1D) nanoceramics and high dielectric strength of polymer matrices, leading to a capacitor with improved dielectric properties and energy density. Lead-free sodium niobate (NaNbO3) and lead-containing lead magnesium niobate-lead titanate (0.65PMN-0.35PT) nanowires were synthesized following hydrothermal and sol-gel approaches, respectively. The as-prepared nanowires were mixed with a polyvinylidene fluoride (PVDF) matrix using solution-casting method for nanocomposites fabrication. The dielectric constants and breakdown voltages of the NaNbO3/PVDF and 0.65PMN-0.35PT/PVDF nanocomposites were measured under different frequency ranges and temperatures in order to determine their maximum energy (J/cm3) and specific (J/g) densities. The electrical properties of the synthesized nanoceramics were compared with commercially available barium titanate (BaTiO3) and lead zirconate titanate Pb(ZrxTi1-x)O3 powders embedded into a PVDF matrix. The resulting dielectric film capacitors represent an excellent alternative energy storage device for future high energy density applications.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niu, T; Dong, X; Petrongolo, M

Purpose: Dual energy CT (DECT) imaging plays an important role in advanced imaging applications due to its material decomposition capability. Direct decomposition via matrix inversion suffers from significant degradation of image signal-to-noise ratios, which reduces clinical value. Existing de-noising algorithms achieve suboptimal performance since they suppress image noise either before or after the decomposition and do not fully explore the noise statistical properties of the decomposition process. We propose an iterative image-domain decomposition method for noise suppression in DECT, using the full variance-covariance matrix of the decomposed images. Methods: The proposed algorithm is formulated in the form of least-square estimationmore » with smoothness regularization. It includes the inverse of the estimated variance-covariance matrix of the decomposed images as the penalty weight in the least-square term. Performance is evaluated using an evaluation phantom (Catphan 600) and an anthropomorphic head phantom. Results are compared to those generated using direct matrix inversion with no noise suppression, a de-noising method applied on the decomposed images, and an existing algorithm with similar formulation but with an edge-preserving regularization term. Results: On the Catphan phantom, our method retains the same spatial resolution as the CT images before decomposition while reducing the noise standard deviation of decomposed images by over 98%. The other methods either degrade spatial resolution or achieve less low-contrast detectability. Also, our method yields lower electron density measurement error than direct matrix inversion and reduces error variation by over 97%. On the head phantom, it reduces the noise standard deviation of decomposed images by over 97% without blurring the sinus structures. Conclusion: We propose an iterative image-domain decomposition method for DECT. The method combines noise suppression and material decomposition into an iterative process and achieves both goals simultaneously. The proposed algorithm shows superior performance on noise suppression with high image spatial resolution and low-contrast detectability. This work is supported by a Varian MRA grant.« less

Delamination micromechanics analysis

NASA Technical Reports Server (NTRS)

Adams, D. F.; Mahishi, J. M.

1985-01-01

A three-dimensional finite element analysis was developed which includes elastoplastic, orthotropic material response, and fracture initiation and propagation. Energy absorption due to physical failure processes characteristic of the heterogeneous and anisotropic nature of composite materials is modeled. A local energy release rate in the presence of plasticity was defined and used as a criterion to predict the onset and growth of cracks in both micromechanics and macromechanics analyses. This crack growth simulation technique is based upon a virtual crack extension method. A three-dimensional finite element micromechanics model is used to study the effects of broken fibers, cracked matrix and fiber-matrix debond on the fracture toughness of the unidirectional composite. The energy release rates at the onset of unstable crack growth in the micromechanics analyses are used as critical energy release rates in the macromechanics analysis. This integrated micromechanical and macromechanical fracture criterion is shown to be very effective in predicting the onset and growth of cracks in general multilayered composite laminates by applying the criterion to a single-edge notched graphite/epoxy laminate subjected to implane tension normal to the notch.

Pair 2-electron reduced density matrix theory using localized orbitals

NASA Astrophysics Data System (ADS)

Head-Marsden, Kade; Mazziotti, David A.

2017-08-01

Full configuration interaction (FCI) restricted to a pairing space yields size-extensive correlation energies but its cost scales exponentially with molecular size. Restricting the variational two-electron reduced-density-matrix (2-RDM) method to represent the same pairing space yields an accurate lower bound to the pair FCI energy at a mean-field-like computational scaling of O (r3) where r is the number of orbitals. In this paper, we show that localized molecular orbitals can be employed to generate an efficient, approximately size-extensive pair 2-RDM method. The use of localized orbitals eliminates the substantial cost of optimizing iteratively the orbitals defining the pairing space without compromising accuracy. In contrast to the localized orbitals, the use of canonical Hartree-Fock molecular orbitals is shown to be both inaccurate and non-size-extensive. The pair 2-RDM has the flexibility to describe the spectra of one-electron RDM occupation numbers from all quantum states that are invariant to time-reversal symmetry. Applications are made to hydrogen chains and their dissociation, n-acene from naphthalene through octacene, and cadmium telluride 2-, 3-, and 4-unit polymers. For the hydrogen chains, the pair 2-RDM method recovers the majority of the energy obtained from similar calculations that iteratively optimize the orbitals. The localized-orbital pair 2-RDM method with its mean-field-like computational scaling and its ability to describe multi-reference correlation has important applications to a range of strongly correlated phenomena in chemistry and physics.

Studies of singlet Rydberg series of LiH derived from Li(nl) + H(1s), with n ≤ 6 and l ≤ 4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gim, Yeongrok; Department of Chemistry, Ajou University, Suwon 443-749; Lee, Chun-Woo, E-mail: clee@ajou.ac.kr

2014-10-14

The 50 singlet states of LiH composed of 49 Rydberg states and one non-Rydberg ionic state derivable from Li(nl) + H(1s), with n ≤ 6 and l ≤ 4, are studied using the multi-reference configuration interaction method combined with the Stuttgart/Köln group's effective core potential/core polarization potential method. Basis functions that can yield energy levels up to the 6g orbital of Li have been developed, and they are used with a huge number of universal Kaufmann basis functions for Rydberg states. The systematics and regularities of the physical properties such as potential energies, quantum defects, permanent dipole moments, transition dipolemore » moments, and nonadiabatic coupling matrix elements of the Rydberg series are studied. The behaviors of potential energy curves and quantum defect curves are explained using the Fermi approximation. The permanent dipole moments of the Rydberg series reveal that they are determined by the sizes of the Rydberg orbitals, which are proportional to n{sup 2}. Interesting mirror relationships of the dipole moments are observed between l-mixed Rydberg series, with the rule Δl = ±1, except for s–d mixing, which is also accompanied by n-mixing. The members of the l-mixed Rydberg series have dipole moments with opposite directions. The first derivatives of the dipole moment curves, which show the charge-transfer component, clearly show not only mirror relationships in terms of direction but also oscillations. The transition dipole moment matrix elements of the Rydberg series are determined by the small-r region, with two consequences. One is that the transition dipole moment matrix elements show n{sup −3/2} dependence. The other is that the magnitudes of the transition dipole moment matrix elements decrease rapidly as l increases.« less

Studies of singlet Rydberg series of LiH derived from Li(nl) + H(1s), with n ≤ 6 and l ≤ 4

NASA Astrophysics Data System (ADS)

Gim, Yeongrok; Lee, Chun-Woo

2014-10-01

The 50 singlet states of LiH composed of 49 Rydberg states and one non-Rydberg ionic state derivable from Li(nl) + H(1s), with n ≤ 6 and l ≤ 4, are studied using the multi-reference configuration interaction method combined with the Stuttgart/Köln group's effective core potential/core polarization potential method. Basis functions that can yield energy levels up to the 6g orbital of Li have been developed, and they are used with a huge number of universal Kaufmann basis functions for Rydberg states. The systematics and regularities of the physical properties such as potential energies, quantum defects, permanent dipole moments, transition dipole moments, and nonadiabatic coupling matrix elements of the Rydberg series are studied. The behaviors of potential energy curves and quantum defect curves are explained using the Fermi approximation. The permanent dipole moments of the Rydberg series reveal that they are determined by the sizes of the Rydberg orbitals, which are proportional to n2. Interesting mirror relationships of the dipole moments are observed between l-mixed Rydberg series, with the rule Δl = ±1, except for s-d mixing, which is also accompanied by n-mixing. The members of the l-mixed Rydberg series have dipole moments with opposite directions. The first derivatives of the dipole moment curves, which show the charge-transfer component, clearly show not only mirror relationships in terms of direction but also oscillations. The transition dipole moment matrix elements of the Rydberg series are determined by the small-r region, with two consequences. One is that the transition dipole moment matrix elements show n-3/2 dependence. The other is that the magnitudes of the transition dipole moment matrix elements decrease rapidly as l increases.

Red-ultraviolet photoluminescence tuning by Ni nanocrystals in epitaxial SrTiO3 matrix

NASA Astrophysics Data System (ADS)

Xiong, Z. W.; Cao, L. H.

2018-07-01

In this work, the self-organized Ni nanocrystals (NCs) were embedded in the epitaxial SrTiO3 matrix using pulsed laser deposition method. With the in-situ monitoring of reflection high-energy electron diffraction, both matrix and NCs could be precisely engineered with desired qualities by regulating the growth conditions according to the full release of stress energy at the interfaces of Ni NCs and SrTiO3. We achieved a controllable strained system according to the transformation of growth modes from three dimensional (3D) islands of Ni NCs to 2D layer-by-layer of SrTiO3, corresponding to the (1 1 1) and (0 0 l) orientation for Ni and SrTiO3, respectively. With the increase of Ni NCs concentration, the absorption intensity is increasing in the regions of 190-300 nm, and the band gap is gradually decreased. Besides, photoluminescence (PL) spectra reveal that the energy levels of Ni 3d bands contribute to the different PL colors, further inducing the enhancement of PL intensity and red-shift of emission peaks. Compared with the pure SrTiO3 published in the literature, much wider ranges of PL emission from red to ultraviolet can be tuned by the Ni NCs.

A novel approach for the fabrication of all-inorganic nanocrystal solids: Semiconductor matrix encapsulated nanocrystal arrays

NASA Astrophysics Data System (ADS)

Moroz, Pavel

Growing fossil fuels consumption compels researchers to find new alternative pathways to produce energy. Along with new materials for the conversion of different types of energy into electricity innovative methods for efficient processing of energy sources are also introduced. The main criteria for the success of such materials and methods are the low cost and compelling performance. Among different types of materials semiconductor nanocrystals are considered as promising candidates for the role of the efficient and cheap absorbers for solar energy applications. In addition to the anticipated cost reduction, the integration of nanocrystals (NC) into device architectures is inspired by the possibility of tuning the energy of electrical charges in NCs via nanoparticle size. However, the stability of nanocrystals in photovoltaic devices is limited by the stability of organic ligands which passivate the surface of semiconductors to preserve quantum confinement. The present work introduces a new strategy for low-temperature processing of colloidal nanocrystals into all-inorganic films: semiconductor matrix encapsulated nanocrystal arrays (SMENA). This methodology goes beyond the traditional ligand-interlinking scheme and relies on the encapsulation of morphologically-defined nanocrystal arrays into a matrix of a wide-band gap semiconductor, which preserves optoelectronic properties of individual nanoparticles. Fabricated solids exhibit excellent thermal stability, which is attributed to the heteroepitaxial structure of nanocrystal-matrix interfaces. The main characteristics and properties of these solids were investigated and compared with ones of traditionally fabricated nanocrystal films using standard spectroscopic, optoelectronic and electronic techniques. As a proof of concept, we. We also characterized electron transport phenomena in different types of nanocrystal films using all-optical approach. By measuring excited carrier lifetimes in either ligand-linked or matrix-encapsulated PbS nanocrystal films containing a tunable fraction of insulating ZnS domains, we uniquely distinguish the dynamics of charge scattering on defects from other processes of exciton dissociation. The measured times are subsequently used to estimate the diffusion length and the carrier mobility for each film type within hopping transport regime. It is demonstrated that nanocrystal films encapsulated into semiconductor matrices exhibit a lower probability of charge scattering than nanocrystal solids cross-linked with either 3-mercaptopropionic acid or 1,2-ethanedithiol molecular linkers. The suppression of carrier scattering in matrix-encapsulated nanocrystal films is attributed to a relatively low density of surface defects at nanocrystal/matrix interfaces. High stability and low density of defects made it possible to fabricate infrared-emitting nanocrystal solids. Presently, an important challenge facing the development of nanocrystal infrared emitters concerns the fact that both the emission quantum yield and the stability of colloidal nanoparticles become compromised when nanoparticle solutions are processed into solids. Here, we address this issue by developing an assembly technique that encapsulates infrared-emitting PbS NCs into crystalline CdS matrices, designed to preserve NC emission characteristics upon film processing. Here, the morphology of these matrices was designed to suppress the nonradiative carrier decay, whereby increasing the exciton lifetime up to 1 mus, and boosting the emission quantum yield to an unprecedented 3.7% for inorganically encapsulated PbS NC solids.

First-principles method for calculating the rate constants of internal-conversion and intersystem-crossing transitions.

PubMed

Valiev, R R; Cherepanov, V N; Baryshnikov, G V; Sundholm, D

2018-02-28

A method for calculating the rate constants for internal-conversion (k IC ) and intersystem-crossing (k ISC ) processes within the adiabatic and Franck-Condon (FC) approximations is proposed. The applicability of the method is demonstrated by calculation of k IC and k ISC for a set of organic and organometallic compounds with experimentally known spectroscopic properties. The studied molecules were pyrromethene-567 dye, psoralene, hetero[8]circulenes, free-base porphyrin, naphthalene, and larger polyacenes. We also studied fac-Alq 3 and fac-Ir(ppy) 3 , which are important molecules in organic light emitting diodes (OLEDs). The excitation energies were calculated at the multi-configuration quasi-degenerate second-order perturbation theory (XMC-QDPT2) level, which is found to yield excitation energies in good agreement with experimental data. Spin-orbit coupling matrix elements, non-adiabatic coupling matrix elements, Huang-Rhys factors, and vibrational energies were calculated at the time-dependent density functional theory (TDDFT) and complete active space self-consistent field (CASSCF) levels. The computed fluorescence quantum yields for the pyrromethene-567 dye, psoralene, hetero[8]circulenes, fac-Alq 3 and fac-Ir(ppy) 3 agree well with experimental data, whereas for the free-base porphyrin, naphthalene, and the polyacenes, the obtained quantum yields significantly differ from the experimental values, because the FC and adiabatic approximations are not accurate for these molecules.

Frequency-domain elastic full waveform inversion using encoded simultaneous sources

NASA Astrophysics Data System (ADS)

Jeong, W.; Son, W.; Pyun, S.; Min, D.

2011-12-01

Currently, numerous studies have endeavored to develop robust full waveform inversion and migration algorithms. These processes require enormous computational costs, because of the number of sources in the survey. To avoid this problem, the phase encoding technique for prestack migration was proposed by Romero (2000) and Krebs et al. (2009) proposed the encoded simultaneous-source inversion technique in the time domain. On the other hand, Ben-Hadj-Ali et al. (2011) demonstrated the robustness of the frequency-domain full waveform inversion with simultaneous sources for noisy data changing the source assembling. Although several studies on simultaneous-source inversion tried to estimate P- wave velocity based on the acoustic wave equation, seismic migration and waveform inversion based on the elastic wave equations are required to obtain more reliable subsurface information. In this study, we propose a 2-D frequency-domain elastic full waveform inversion technique using phase encoding methods. In our algorithm, the random phase encoding method is employed to calculate the gradients of the elastic parameters, source signature estimation and the diagonal entries of approximate Hessian matrix. The crosstalk for the estimated source signature and the diagonal entries of approximate Hessian matrix are suppressed with iteration as for the gradients. Our 2-D frequency-domain elastic waveform inversion algorithm is composed using the back-propagation technique and the conjugate-gradient method. Source signature is estimated using the full Newton method. We compare the simultaneous-source inversion with the conventional waveform inversion for synthetic data sets of the Marmousi-2 model. The inverted results obtained by simultaneous sources are comparable to those obtained by individual sources, and source signature is successfully estimated in simultaneous source technique. Comparing the inverted results using the pseudo Hessian matrix with previous inversion results provided by the approximate Hessian matrix, it is noted that the latter are better than the former for deeper parts of the model. This work was financially supported by the Brain Korea 21 project of Energy System Engineering, by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2010-0006155), by the Energy Efficiency & Resources of the Korea Institute of Energy Technology Evaluation and Planning (KETEP) grant funded by the Korea government Ministry of Knowledge Economy (No. 2010T100200133).

A Measurement of the Top Quark Mass in 1.96 TeV Proton-Antiproton Collisions Using a Novel Matrix Element Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freeman, John

A measurement of the top quark mass in tmore » $$\\bar{t}$$ → l + jets candidate events, obtained from p$$\\bar{p}$$ collisions at √s = 1.96 TeV at the Fermilab Tevatron using the CDF II detector, is presented. The measurement approach is that of a matrix element method. For each candidate event, a two dimensional likelihood is calculated in the top pole mass and a constant scale factor, 'JES', where JES multiplies the input particle jet momenta and is designed to account for the systematic uncertainty of the jet momentum reconstruction. As with all matrix element techniques, the method involves an integration using the Standard Model matrix element for t$$\\bar{t}$$ production and decay. However, the technique presented is unique in that the matrix element is modified to compensate for kinematic assumptions which are made to reduce computation time. Background events are dealt with through use of an event observable which distinguishes signal from background, as well as through a cut on the value of an event's maximum likelihood. Results are based on a 955 pb -1 data sample, using events with a high-p T lepton and exactly four high-energy jets, at least one of which is tagged as coming from a b quark; 149 events pass all the selection requirements. They find M meas = 169.8 ± 2.3(stat.) ± 1.4(syst.) GeV/c 2.« less

Charge-transfer contributions to the excitonic coupling matrix element in BODIPY-based energy transfer cassettes

NASA Astrophysics Data System (ADS)

Spiegel, J. Dominik; Lyskov, Igor; Kleinschmidt, Martin; Marian, Christel M.

2017-01-01

BODIPY-based dyads serve as model systems for the investigation of excitation energy transfer (EET). Through-space EET is brought about by direct and exchange interactions between the transition densities of donor and acceptor localized states. The presence of a molecular linker gives rise to additional charge transfer (CT) contributions. Here, we present a novel approach for the calculation of the excitonic coupling matrix element (ECME) including CT contributions which is based on supermolecular one-electron transition density matrices (STD). The validity of the approach is assessed for a model system of two π -stacked ethylene molecules at varying intermolecular separation. Wave functions and electronic excitation energies of five EET cassettes comprising anthracene as exciton donor and BODIPY as exciton acceptor are obtained by the redesigned combined density functional theory and multireference configuration interaction (DFT/MRCI-R) method. CT contributions to the ECME are shown to be important in the covalently linked EET cassettes.

Implementation of real-time energy management strategy based on reinforcement learning for hybrid electric vehicles and simulation validation

PubMed Central

Kong, Zehui; Liu, Teng

2017-01-01

To further improve the fuel economy of series hybrid electric tracked vehicles, a reinforcement learning (RL)-based real-time energy management strategy is developed in this paper. In order to utilize the statistical characteristics of online driving schedule effectively, a recursive algorithm for the transition probability matrix (TPM) of power-request is derived. The reinforcement learning (RL) is applied to calculate and update the control policy at regular time, adapting to the varying driving conditions. A facing-forward powertrain model is built in detail, including the engine-generator model, battery model and vehicle dynamical model. The robustness and adaptability of real-time energy management strategy are validated through the comparison with the stationary control strategy based on initial transition probability matrix (TPM) generated from a long naturalistic driving cycle in the simulation. Results indicate that proposed method has better fuel economy than stationary one and is more effective in real-time control. PMID:28671967

Implementation of real-time energy management strategy based on reinforcement learning for hybrid electric vehicles and simulation validation.

PubMed

Kong, Zehui; Zou, Yuan; Liu, Teng

2017-01-01

To further improve the fuel economy of series hybrid electric tracked vehicles, a reinforcement learning (RL)-based real-time energy management strategy is developed in this paper. In order to utilize the statistical characteristics of online driving schedule effectively, a recursive algorithm for the transition probability matrix (TPM) of power-request is derived. The reinforcement learning (RL) is applied to calculate and update the control policy at regular time, adapting to the varying driving conditions. A facing-forward powertrain model is built in detail, including the engine-generator model, battery model and vehicle dynamical model. The robustness and adaptability of real-time energy management strategy are validated through the comparison with the stationary control strategy based on initial transition probability matrix (TPM) generated from a long naturalistic driving cycle in the simulation. Results indicate that proposed method has better fuel economy than stationary one and is more effective in real-time control.

Resonant electronic excitation energy transfer by exchange mechanism in the quantum dot system

NASA Astrophysics Data System (ADS)

Chikalova-Luzina, O. P.; Samosvat, D. M.; Vyatkin, V. M.; Zegrya, G. G.

2017-11-01

A microscopic theory of nonradiative resonance energy transfer between spherical A3B5 semiconductor quantum dots by the exchange mechanism is suggested. The interdot Coulomb interaction is taken into consideration. It is assumed that the quantum dot-donor and the quantum dot-acceptor are made from the same A3B5 compound and are embedded in the matrix of another material that produces potential barriers for electrons and holes. The dependences of the energy transfer rate on the quantum-dot system parameters are found in the frame of the Kane model that provides the most adequate description of the real spectra of A3B5 semiconductors. The analytical treatment is carried out with using the density matrix method, which enabled us to perform an energy transfer analysis both in the weak-interaction approximation and in the strong-interaction approximation. The numerical calculations showed the saturation of the energy transfer rate at the distances between the donor and the acceptor approaching the contact one. The contributions of the exchange and direct Coulomb intractions can be of the same order at the small distances and can have the same value in the saturation range.

Regeneration of an aqueous solution from an acid gas absorption process by matrix stripping

DOEpatents

Rochelle, Gary T [Austin, TX; Oyenekan, Babatunde A [Katy, TX

2011-03-08

Carbon dioxide and other acid gases are removed from gaseous streams using aqueous absorption and stripping processes. By replacing the conventional stripper used to regenerate the aqueous solvent and capture the acid gas with a matrix stripping configuration, less energy is consumed. The matrix stripping configuration uses two or more reboiled strippers at different pressures. The rich feed from the absorption equipment is split among the strippers, and partially regenerated solvent from the highest pressure stripper flows to the middle of sequentially lower pressure strippers in a "matrix" pattern. By selecting certain parameters of the matrix stripping configuration such that the total energy required by the strippers to achieve a desired percentage of acid gas removal from the gaseous stream is minimized, further energy savings can be realized.

Neutrinoless double-β decay of Se82 in the shell model: Beyond the closure approximation

NASA Astrophysics Data System (ADS)

Sen'kov, R. A.; Horoi, M.; Brown, B. A.

2014-05-01

We recently proposed a method [R. A. Senkov and M. Horoi, Phys. Rev. C 88, 064312 (2013), 10.1103/PhysRevC.88.064312] to calculate the standard nuclear matrix elements for neutrinoless double-β decay (0νββ) of Ca48 going beyond the closure approximation. Here we extend this analysis to the important case of Se82, which was chosen as the base isotope for the upcoming SuperNEMO experiment. We demonstrate that by using a mixed method that considers information from closure and nonclosure approaches, one can get excellent convergence properties for the nuclear matrix elements, which allows one to avoid unmanageable computational costs. We show that in contrast with the closure approximation the mixed approach has a very weak dependence on the average closure energy. The matrix elements for the heavy neutrino-exchange mechanism that could contribute to the 0νββ decay of Se82 are also presented.

N-representability-driven reconstruction of the two-electron reduced-density matrix for a real-time time-dependent electronic structure method

NASA Astrophysics Data System (ADS)

Jeffcoat, David B.; DePrince, A. Eugene

2014-12-01

Propagating the equations of motion (EOM) for the one-electron reduced-density matrix (1-RDM) requires knowledge of the corresponding two-electron RDM (2-RDM). We show that the indeterminacy of this expression can be removed through a constrained optimization that resembles the variational optimization of the ground-state 2-RDM subject to a set of known N-representability conditions. Electronic excitation energies can then be obtained by propagating the EOM for the 1-RDM and following the dipole moment after the system interacts with an oscillating external electric field. For simple systems with well-separated excited states whose symmetry differs from that of the ground state, excitation energies obtained from this method are comparable to those obtained from full configuration interaction computations. Although the optimized 2-RDM satisfies necessary N-representability conditions, the procedure cannot guarantee a unique mapping from the 1-RDM to the 2-RDM. This deficiency is evident in the mean-field-quality description of transitions to states of the same symmetry as the ground state, as well as in the inability of the method to describe Rabi oscillations.

Density matrix renormalization group simulations of SU(N ) Heisenberg chains using standard Young tableaus: Fundamental representation and comparison with a finite-size Bethe ansatz

NASA Astrophysics Data System (ADS)

Nataf, Pierre; Mila, Frédéric

2018-04-01

We develop an efficient method to perform density matrix renormalization group simulations of the SU(N ) Heisenberg chain with open boundary conditions taking full advantage of the SU(N ) symmetry of the problem. This method is an extension of the method previously developed for exact diagonalizations and relies on a systematic use of the basis of standard Young tableaux. Concentrating on the model with the fundamental representation at each site (i.e., one particle per site in the fermionic formulation), we have benchmarked our results for the ground-state energy up to N =8 and up to 420 sites by comparing them with Bethe ansatz results on open chains, for which we have derived and solved the Bethe ansatz equations. The agreement for the ground-state energy is excellent for SU(3) (12 digits). It decreases with N , but it is still satisfactory for N =8 (six digits). Central charges c are also extracted from the entanglement entropy using the Calabrese-Cardy formula and agree with the theoretical values expected from the SU (N) 1 Wess-Zumino-Witten conformal field theories.

Time-independent quantum dynamics for diatom-surface scattering

NASA Astrophysics Data System (ADS)

Saalfrank, Peter; Miller, William H.

1993-06-01

Two time-independent quantum reactive scattering methods, namely, the S-matrix Kohn technique to compute the full S-matrix, and the absorbing boundary Green's function method to compute cumulative reaction probabilities, are applied here to the case of diatom-surface scattering. In both cases a discrete variable representation for the operators is used. We test the methods for two- and three-dimensional uncorrugated potential energy surfaces, which have been used earlier by Halstead et al. [J. Chem. Phys. 93, 2359 (1990)] and by Sheng et al. [J. Chem. Phys. 97, 684 (1992)] in studies of H2 dissociating on metal substrates with theoretical techniques different from those applied here. We find overall but not always perfect agreement with these earlier studies. Based on ab initio data and experiment, a new, six-dimensional potential energy surface for the dissociative chemisorption of H2 on Ni(100) is proposed. Two- and three-dimensional cuts through the new potential are performed to illustrate special dynamical aspects of this particular molecule-surface reaction: (i) the role of corrugation effects, (ii) the importance of the ``cartwheel'' rotation of H2, and (iii) the role of the ``helicopter'' degree of freedom for the adsorbing molecule.

Recent Advances in Resonance Region Nuclear Data Measurements and Analyses for Supporting Nuclear Energy Applications

NASA Astrophysics Data System (ADS)

Dunn, Michael

2008-10-01

For over 30 years, the Oak Ridge National Laboratory (ORNL) has performed research and development to provide more accurate nuclear cross-section data in the resonance region. The ORNL Nuclear Data (ND) Program consists of four complementary areas of research: (1) cross-section measurements at the Oak Ridge Electron Linear Accelerator; (2) resonance analysis methods development with the SAMMY R-matrix analysis software; (3) cross-section evaluation development; and (4) cross-section processing methods development with the AMPX software system. The ND Program is tightly coupled with nuclear fuel cycle analyses and radiation transport methods development efforts at ORNL. Thus, nuclear data work is performed in concert with nuclear science and technology needs and requirements. Recent advances in each component of the ORNL ND Program have led to improvements in resonance region measurements, R-matrix analyses, cross-section evaluations, and processing capabilities that directly support radiation transport research and development. Of particular importance are the improvements in cross-section covariance data evaluation and processing capabilities. The benefit of these advances to nuclear science and technology research and development will be discussed during the symposium on Nuclear Physics Research Connections to Nuclear Energy.

Implementation of rigorous renormalization group method for ground space and low-energy states of local Hamiltonians

NASA Astrophysics Data System (ADS)

Roberts, Brenden; Vidick, Thomas; Motrunich, Olexei I.

2017-12-01

The success of polynomial-time tensor network methods for computing ground states of certain quantum local Hamiltonians has recently been given a sound theoretical basis by Arad et al. [Math. Phys. 356, 65 (2017), 10.1007/s00220-017-2973-z]. The convergence proof, however, relies on "rigorous renormalization group" (RRG) techniques which differ fundamentally from existing algorithms. We introduce a practical adaptation of the RRG procedure which, while no longer theoretically guaranteed to converge, finds matrix product state ansatz approximations to the ground spaces and low-lying excited spectra of local Hamiltonians in realistic situations. In contrast to other schemes, RRG does not utilize variational methods on tensor networks. Rather, it operates on subsets of the system Hilbert space by constructing approximations to the global ground space in a treelike manner. We evaluate the algorithm numerically, finding similar performance to density matrix renormalization group (DMRG) in the case of a gapped nondegenerate Hamiltonian. Even in challenging situations of criticality, large ground-state degeneracy, or long-range entanglement, RRG remains able to identify candidate states having large overlap with ground and low-energy eigenstates, outperforming DMRG in some cases.

Electronic Absorption Spectra of Neutral Perylene (C20H12), Terrylene (C30H16), and Quaterrylene (C40H20) and their Positive and Negative Ions: Ne Matrix-Isolation Spectroscopy and Time Dependent Density Functional Theory Calculations

NASA Technical Reports Server (NTRS)

Halasinski, Thomas M.; Weisman, Jennifer L.; Lee, Timothy J.; Salama, Farid; Head-Gordon, Martin; Kwak, Dochan (Technical Monitor)

2002-01-01

We present a full experimental and theoretical study of an interesting series of polycyclic aromatic hydrocarbons, the oligorylenes. The absorption spectra of perylene, terrylene and quaterrylene in neutral, cationic and anionic charge states are obtained by matrix-isolation spectroscopy in Ne. The experimental spectra are dominated by a bright state that red shifts with growing molecular size. Excitation energies and state symmetry assignments are supported by calculations using time dependent density functional theory methods. These calculations also provide new insight into the observed trends in oscillator strength and excitation energy for the bright states: the oscillator strength per unit mass of carbon increases along the series.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Quasi-particle energy spectra in local reduced density matrix functional theory.

PubMed

Lathiotakis, Nektarios N; Helbig, Nicole; Rubio, Angel; Gidopoulos, Nikitas I

2014-10-28

Recently, we introduced [N. N. Lathiotakis, N. Helbig, A. Rubio, and N. I. Gidopoulos, Phys. Rev. A 90, 032511 (2014)] local reduced density matrix functional theory (local RDMFT), a theoretical scheme capable of incorporating static correlation effects in Kohn-Sham equations. Here, we apply local RDMFT to molecular systems of relatively large size, as a demonstration of its computational efficiency and its accuracy in predicting single-electron properties from the eigenvalue spectrum of the single-particle Hamiltonian with a local effective potential. We present encouraging results on the photoelectron spectrum of molecular systems and the relative stability of C20 isotopes. In addition, we propose a modelling of the fractional occupancies as functions of the orbital energies that further improves the efficiency of the method useful in applications to large systems and solids.

Iron oxide nanomatrix facilitating metal ionization in matrix-assisted laser desorption/ionization mass spectrometry.

PubMed

Obena, Rofeamor P; Lin, Po-Chiao; Lu, Ying-Wei; Li, I-Che; del Mundo, Florian; Arco, Susan dR; Nuesca, Guillermo M; Lin, Chung-Chen; Chen, Yu-Ju

2011-12-15

The significance and epidemiological effects of metals to life necessitate the development of direct, efficient, and rapid method of analysis. Taking advantage of its simple, fast, and high-throughput features, we present a novel approach to metal ion detection by matrix-functionalized magnetic nanoparticle (matrix@MNP)-assisted MALDI-MS. Utilizing 21 biologically and environmentally relevant metal ion solutions, the performance of core and matrix@MNP against conventional matrixes in MALDI-MS and laser desorption ionization (LDI) MS were systemically tested to evaluate the versatility of matrix@MNP as ionization element. The matrix@MNPs provided 20- to >100-fold enhancement on detection sensitivity of metal ions and unambiguous identification through characteristic isotope patterns and accurate mass (<5 ppm), which may be attributed to its multifunctional role as metal chelator, preconcentrator, absorber, and reservoir of energy. Together with the comparison on the ionization behaviors of various metals having different ionization potentials (IP), we formulated a metal ionization mechanism model, alluding to the role of exciton pooling in matrix@MNP-assisted MALDI-MS. Moreover, the detection of Cu in spiked tap water demonstrated the practicability of this new approach as an efficient and direct alternative tool for fast, sensitive, and accurate determination of trace metal ions in real samples.

Symbolic computation of the Hartree-Fock energy from a chiral EFT three-nucleon interaction at N 2LO

NASA Astrophysics Data System (ADS)

Gebremariam, B.; Bogner, S. K.; Duguet, T.

2010-06-01

We present the first of a two-part Mathematica notebook collection that implements a symbolic approach for the application of the density matrix expansion (DME) to the Hartree-Fock (HF) energy from a chiral effective field theory (EFT) three-nucleon interaction at N 2LO. The final output from the notebooks is a Skyrme-like energy density functional that provides a quasi-local approximation to the non-local HF energy. In this paper, we discuss the derivation of the HF energy and its simplification in terms of the scalar/vector-isoscalar/isovector parts of the one-body density matrix. Furthermore, a set of steps is described and illustrated on how to extend the approach to other three-nucleon interactions. Program summaryProgram title: SymbHFNNN Catalogue identifier: AEGC_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEGC_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 96 666 No. of bytes in distributed program, including test data, etc.: 378 083 Distribution format: tar.gz Programming language: Mathematica 7.1 Computer: Any computer running Mathematica 6.0 and later versions Operating system: Windows Xp, Linux/Unix RAM: 256 Mb Classification: 5, 17.16, 17.22 Nature of problem: The calculation of the HF energy from the chiral EFT three-nucleon interaction at N 2LO involves tremendous spin-isospin algebra. The problem is compounded by the need to eventually obtain a quasi-local approximation to the HF energy, which requires the HF energy to be expressed in terms of scalar/vector-isoscalar/isovector parts of the one-body density matrix. The Mathematica notebooks discussed in this paper solve the latter issue. Solution method: The HF energy from the chiral EFT three-nucleon interaction at N 2LO is cast into a form suitable for an automatic simplification of the spin-isospin traces. Several Mathematica functions and symbolic manipulation techniques are used to obtain the result in terms of the scalar/vector-isoscalar/isovector parts of the one-body density matrix. Running time: Several hours

Efficient calculation of the polarizability: a simplified effective-energy technique

NASA Astrophysics Data System (ADS)

Berger, J. A.; Reining, L.; Sottile, F.

2012-09-01

In a recent publication [J.A. Berger, L. Reining, F. Sottile, Phys. Rev. B 82, 041103(R) (2010)] we introduced the effective-energy technique to calculate in an accurate and numerically efficient manner the GW self-energy as well as the polarizability, which is required to evaluate the screened Coulomb interaction W. In this work we show that the effective-energy technique can be used to further simplify the expression for the polarizability without a significant loss of accuracy. In contrast to standard sum-over-state methods where huge summations over empty states are required, our approach only requires summations over occupied states. The three simplest approximations we obtain for the polarizability are explicit functionals of an independent- or quasi-particle one-body reduced density matrix. We provide evidence of the numerical accuracy of this simplified effective-energy technique as well as an analysis of our method.

Multi-Scale Low-Entropy Method for Optimizing the Processing Parameters during Automated Fiber Placement

PubMed Central

Han, Zhenyu; Sun, Shouzheng; Fu, Hongya; Fu, Yunzhong

2017-01-01

Automated fiber placement (AFP) process includes a variety of energy forms and multi-scale effects. This contribution proposes a novel multi-scale low-entropy method aiming at optimizing processing parameters in an AFP process, where multi-scale effect, energy consumption, energy utilization efficiency and mechanical properties of micro-system could be taken into account synthetically. Taking a carbon fiber/epoxy prepreg as an example, mechanical properties of macro–meso–scale are obtained by Finite Element Method (FEM). A multi-scale energy transfer model is then established to input the macroscopic results into the microscopic system as its boundary condition, which can communicate with different scales. Furthermore, microscopic characteristics, mainly micro-scale adsorption energy, diffusion coefficient entropy–enthalpy values, are calculated under different processing parameters based on molecular dynamics method. Low-entropy region is then obtained in terms of the interrelation among entropy–enthalpy values, microscopic mechanical properties (interface adsorbability and matrix fluidity) and processing parameters to guarantee better fluidity, stronger adsorption, lower energy consumption and higher energy quality collaboratively. Finally, nine groups of experiments are carried out to verify the validity of the simulation results. The results show that the low-entropy optimization method can reduce void content effectively, and further improve the mechanical properties of laminates. PMID:28869520

Multi-Scale Low-Entropy Method for Optimizing the Processing Parameters during Automated Fiber Placement.

PubMed

Han, Zhenyu; Sun, Shouzheng; Fu, Hongya; Fu, Yunzhong

2017-09-03

Automated fiber placement (AFP) process includes a variety of energy forms and multi-scale effects. This contribution proposes a novel multi-scale low-entropy method aiming at optimizing processing parameters in an AFP process, where multi-scale effect, energy consumption, energy utilization efficiency and mechanical properties of micro-system could be taken into account synthetically. Taking a carbon fiber/epoxy prepreg as an example, mechanical properties of macro-meso-scale are obtained by Finite Element Method (FEM). A multi-scale energy transfer model is then established to input the macroscopic results into the microscopic system as its boundary condition, which can communicate with different scales. Furthermore, microscopic characteristics, mainly micro-scale adsorption energy, diffusion coefficient entropy-enthalpy values, are calculated under different processing parameters based on molecular dynamics method. Low-entropy region is then obtained in terms of the interrelation among entropy-enthalpy values, microscopic mechanical properties (interface adsorbability and matrix fluidity) and processing parameters to guarantee better fluidity, stronger adsorption, lower energy consumption and higher energy quality collaboratively. Finally, nine groups of experiments are carried out to verify the validity of the simulation results. The results show that the low-entropy optimization method can reduce void content effectively, and further improve the mechanical properties of laminates.

Resonance-state properties from a phase shift analysis with the S -matrix pole method and the effective-range method

NASA Astrophysics Data System (ADS)

Irgaziev, B. F.; Orlov, Yu. V.

2015-02-01

Asymptotic normalization coefficients (ANCs) are fundamental nuclear constants playing an important role in nuclear physics and astrophysics. We derive a new useful relationship between ANCs of the Gamow radial wave function and the renormalized (due to the Coulomb interaction) Coulomb-nuclear partial scattering amplitude. We use an analytical approximation in the form of a series for the nonresonant part of the phase shift which can be analytically continued to the point of an isolated resonance pole in the complex plane of the momentum. Earlier, this method which we call the S -matrix pole method was used by us to find the resonance pole energy. We find the corresponding fitting parameters for the 5He,5Li , and 16O concrete resonance states. Additionally, based on the theory of the effective range, we calculate the parameters of the p3 /2 and p1 /2 resonance states of the nuclei 5He and 5Li and compare them with the results obtained by the S -matrix pole method. ANC values are found which can be used to calculate the reaction rate through the 16O resonances which lie slightly above the threshold for the α 12C channel.

Nature of Driving Force for Protein Folding: A Result From Analyzing the Statistical Potential

NASA Astrophysics Data System (ADS)

Li, Hao; Tang, Chao; Wingreen, Ned S.

1997-07-01

In a statistical approach to protein structure analysis, Miyazawa and Jernigan derived a 20×20 matrix of inter-residue contact energies between different types of amino acids. Using the method of eigenvalue decomposition, we find that the Miyazawa-Jernigan matrix can be accurately reconstructed from its first two principal component vectors as Mij = C0+C1\\(qi+qj\\)+C2qiqj, with constant C's, and 20 q values associated with the 20 amino acids. This regularity is due to hydrophobic interactions and a force of demixing, the latter obeying Hildebrand's solubility theory of simple liquids.

Derivation of general analytic gradient expressions for density-fitted post-Hartree-Fock methods: An efficient implementation for the density-fitted second-order Møller–Plesset perturbation theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bozkaya, Uğur, E-mail: ugur.bozkaya@atauni.edu.tr

General analytic gradient expressions (with the frozen-core approximation) are presented for density-fitted post-HF methods. An efficient implementation of frozen-core analytic gradients for the second-order Møller–Plesset perturbation theory (MP2) with the density-fitting (DF) approximation (applying to both reference and correlation energies), which is denoted as DF-MP2, is reported. The DF-MP2 method is applied to a set of alkanes, conjugated dienes, and noncovalent interaction complexes to compare the computational cost of single point analytic gradients with MP2 with the resolution of the identity approach (RI-MP2) [F. Weigend and M. Häser, Theor. Chem. Acc. 97, 331 (1997); R. A. Distasio, R. P. Steele,more » Y. M. Rhee, Y. Shao, and M. Head-Gordon, J. Comput. Chem. 28, 839 (2007)]. In the RI-MP2 method, the DF approach is used only for the correlation energy. Our results demonstrate that the DF-MP2 method substantially accelerate the RI-MP2 method for analytic gradient computations due to the reduced input/output (I/O) time. Because in the DF-MP2 method the DF approach is used for both reference and correlation energies, the storage of 4-index electron repulsion integrals (ERIs) are avoided, 3-index ERI tensors are employed instead. Further, as in case of integrals, our gradient equation is completely avoid construction or storage of the 4-index two-particle density matrix (TPDM), instead we use 2- and 3-index TPDMs. Hence, the I/O bottleneck of a gradient computation is significantly overcome. Therefore, the cost of the generalized-Fock matrix (GFM), TPDM, solution of Z-vector equations, the back transformation of TPDM, and integral derivatives are substantially reduced when the DF approach is used for the entire energy expression. Further application results show that the DF approach introduce negligible errors for closed-shell reaction energies and equilibrium bond lengths.« less

A METHOD FOR IN-SITU CHARACTERIZATION OF RF HEATING IN PARALLEL TRANSMIT MRI

PubMed Central

Alon, Leeor; Deniz, Cem Murat; Brown, Ryan; Sodickson, Daniel K.; Zhu, Yudong

2012-01-01

In ultra high field magnetic resonance imaging, parallel radio-frequency (RF) transmission presents both opportunities and challenges for specific absorption rate (SAR) management. On one hand, parallel transmission provides flexibility in tailoring electric fields in the body while facilitating magnetization profile control. On the other hand, it increases the complexity of energy deposition as well as possibly exacerbating local SAR by improper design or delivery of RF pulses. This study shows that the information needed to characterize RF heating in parallel transmission is contained within a local power correlation matrix. Building upon a calibration scheme involving a finite number of magnetic resonance thermometry measurements, the present work establishes a way of estimating the local power correlation matrix. Determination of this matrix allows prediction of temperature change for an arbitrary parallel transmit RF pulse. In the case of a three transmit coil MR experiment in a phantom, determination and validation of the power correlation matrix was conducted in less than 200 minutes with induced temperature changes of <4 degrees C. Further optimization and adaptation are possible, and simulations evaluating potential feasibility for in vivo use are presented. The method allows general characteristics indicative of RF coil/pulse safety determined in situ. PMID:22714806

Multi-jet Merging with NLO Matrix Elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siegert, Frank; /Freiburg U.; Hoche, Stefan

2011-08-18

In the algorithm presented here, the ME+PS approach to merge samples of tree-level matrix elements into inclusive event samples is combined with the POWHEG method, which includes exact next-to-leading order matrix elements in the parton shower. The advantages of the method are discussed and the quality of its implementation in SHERPA is exemplified by results for e{sup +}e{sup -} annihilation into hadrons at LEP, for deep-inelastic lepton-nucleon scattering at HERA, for Drell-Yan lepton-pair production at the Tevatron and for W{sup +}W{sup -}-production at LHC energies. The simulation of hard QCD radiation in parton-shower Monte Carlos has seen tremendous progress overmore » the last years. It was largely stimulated by the need for more precise predictions at LHC energies where the large available phase space allows additional hard QCD radiation alongside known Standard Model processes or even signals from new physics. Two types of algorithms have been developed, which allow to improve upon the soft-collinear approximations made in the parton shower, such that hard radiation is simulated according to exact matrix elements. In the ME+PS approach [1] higher-order tree-level matrix elements for different final-state jet multiplicity are merged with each other and with subsequent parton shower emissions to generate an inclusive sample. Such a prescription is invaluable for analyses which are sensitive to final states with a large jet multiplicity. The only remaining deficiency of such tree-level calculations is the large uncertainty stemming from scale variations. The POWHEG method [2] solves this problem for the lowest multiplicity subprocess by combining full NLO matrix elements with the parton shower. While this leads to NLO accuracy in the inclusive cross section and the exact radiation pattern for the first emission, it fails to describe higher-order emissions with improved accuracy. Thus it is not sufficient if final states with high jet multiplicities are considered. With the complementary advantages of these two approaches, the question arises naturally whether it would be possible to combine them into an even more powerful one. Such a combined algorithm was independently developed in [5] and [6]. Here a summary of the algorithm is given and predictions from corresponding Monte-Carlo predictions are presented.« less

Synthesis and Luminescence Properties of Transparent Nanocrystalline GdF3:Tb Glass-Ceramic Scintillator.

PubMed

Lee, Gyuhyon; Savage, Nicholas; Wagner, Brent; Zhang, Yuelan; Jacobs, Benjamin; Menkara, Hisham; Summers, Christopher; Kang, Zhitao

2014-03-01

Transparent glass-ceramic containing rare-earth doped halide nanocrystals exhibits enhanced luminescence performance. In this study, a glass-ceramic with Tb doped gadolinium fluoride nanocrystals embedded in an aluminosilicate glass matrix is investigated for X-ray imaging applications. The nanocrystalline glass-ceramic scintillator was prepared by a melt-quench method followed by an anneal. The GdF 3 :Tb nanocrystals precipitated within the oxide glass matrix during the processing and their luminescence and scintillation properties were investigated. In this nanocomposite scintillator system, the incorporation of high atomic number Gd compound into the glass matrix increases the X-ray stopping power of the glass scintillator, and effective energy transfer between Gd 3+ and Tb 3+ ions in the nanocrystals enhances the scintillation efficiency.

Synthesis and Luminescence Properties of Transparent Nanocrystalline GdF3:Tb Glass-Ceramic Scintillator

PubMed Central

Lee, Gyuhyon; Savage, Nicholas; Wagner, Brent; Zhang, Yuelan; Jacobs, Benjamin; Menkara, Hisham; Summers, Christopher; Kang, Zhitao

2014-01-01

Transparent glass-ceramic containing rare-earth doped halide nanocrystals exhibits enhanced luminescence performance. In this study, a glass-ceramic with Tb doped gadolinium fluoride nanocrystals embedded in an aluminosilicate glass matrix is investigated for X-ray imaging applications. The nanocrystalline glass-ceramic scintillator was prepared by a melt-quench method followed by an anneal. The GdF3:Tb nanocrystals precipitated within the oxide glass matrix during the processing and their luminescence and scintillation properties were investigated. In this nanocomposite scintillator system, the incorporation of high atomic number Gd compound into the glass matrix increases the X-ray stopping power of the glass scintillator, and effective energy transfer between Gd3+ and Tb3+ ions in the nanocrystals enhances the scintillation efficiency. PMID:24610960

Charge Resolution of the Silicon Matrix of the ATIC Experiment

NASA Technical Reports Server (NTRS)

Zatsepin, V. I.; Adams, J. H., Jr.; Ahn, H. S.; Bashindzhagyan, G. L.; Batkov, K. E.; Case, G.; Christl, M.; Ganel, O.; Fazely, A. R.; Ganel, O.;

Towards a multiconfigurational method of increments

NASA Astrophysics Data System (ADS)

Fertitta, E.; Koch, D.; Paulus, B.; Barcza, G.; Legeza, Ö.

2018-06-01

The method of increments (MoI) allows one to successfully calculate cohesive energies of bulk materials with high accuracy, but it encounters difficulties when calculating dissociation curves. The reason is that its standard formalism is based on a single Hartree-Fock (HF) configuration whose orbitals are localised and used for the many-body expansion. In situations where HF does not allow a size-consistent description of the dissociation, the MoI cannot be guaranteed to yield proper results either. Herein, we address the problem by employing a size-consistent multiconfigurational reference for the MoI formalism. This leads to a matrix equation where a coupling derived by the reference itself is employed. In principle, such an approach allows one to evaluate approximate values for the ground as well as excited states energies. While the latter are accurate close to the avoided crossing only, the ground state results are very promising for the whole dissociation curve, as shown by the comparison with density matrix renormalisation group benchmarks. We tested this two-state constant-coupling MoI on beryllium rings of different sizes and studied the error introduced by the constant coupling.

Heterogeneous Distribution of Carbonaceous Material in Murchison Matrix: In Situ Observations Using Energy Filtered Transmission Electron Microscopy

NASA Technical Reports Server (NTRS)

Brearley, Adrian J.

2002-01-01

Energy filtered TEM (Transmission Electron Microscopy) has been used to study the location of carbonaceous material in situ in Murchison matrix. Carbon occurs frequently as narrow rims around sulfide grains, but is rare in regions of matrix that are dominated by phyllosilicates. Additional information is contained in the original extended abstract.

Hyperspherical close-coupling calculations for charge-transfer cross sections in He2++H(1s) collisions at low energies

NASA Astrophysics Data System (ADS)

Liu, Chien-Nan; Le, Anh-Thu; Morishita, Toru; Esry, B. D.; Lin, C. D.

2003-05-01

A theory for ion-atom collisions at low energies based on the hyperspherical close-coupling (HSCC) method is presented. In hyperspherical coordinates the wave function is expanded in analogy to the Born-Oppenheimer approximation where the adiabatic channel functions are calculated with B-spline basis functions while the coupled hyperradial equations are solved by a combination of R-matrix propagation and the slow/smooth variable discretization method. The HSCC method is applied to calculate charge-transfer cross sections for He2++H(1s)→He+(n=2)+H+ reactions at center-of-mass energies from 10 eV to 4 keV. The results are shown to be in general good agreement with calculations based on the molecular orbital (MO) expansion method where electron translation factors (ETF’s) or switching functions have been incorporated in each MO. However, discrepancies were found at very low energies. It is shown that the HSCC method can be used to study low-energy ion-atom collisions without the need to introduce the ad hoc ETF’s, and the results are free from ambiguities associated with the traditional MO expansion approach.

A B-spline Galerkin method for the Dirac equation

NASA Astrophysics Data System (ADS)

Froese Fischer, Charlotte; Zatsarinny, Oleg

2009-06-01

The B-spline Galerkin method is first investigated for the simple eigenvalue problem, y=-λy, that can also be written as a pair of first-order equations y=λz, z=-λy. Expanding both y(r) and z(r) in the B basis results in many spurious solutions such as those observed for the Dirac equation. However, when y(r) is expanded in the B basis and z(r) in the dB/dr basis, solutions of the well-behaved second-order differential equation are obtained. From this analysis, we propose a stable method ( B,B) basis for the Dirac equation and evaluate its accuracy by comparing the computed and exact R-matrix for a wide range of nuclear charges Z and angular quantum numbers κ. When splines of the same order are used, many spurious solutions are found whereas none are found for splines of different order. Excellent agreement is obtained for the R-matrix and energies for bound states for low values of Z. For high Z, accuracy requires the use of a grid with many points near the nucleus. We demonstrate the accuracy of the bound-state wavefunctions by comparing integrals arising in hyperfine interaction matrix elements with exact analytic expressions. We also show that the Thomas-Reiche-Kuhn sum rule is not a good measure of the quality of the solutions obtained by the B-spline Galerkin method whereas the R-matrix is very sensitive to the appearance of pseudo-states.

Systems and methods for reducing transient voltage spikes in matrix converters

DOEpatents

Kajouke, Lateef A.; Perisic, Milun; Ransom, Ray M.

2013-06-11

Systems and methods are provided for delivering energy using an energy conversion module that includes one or more switching elements. An exemplary electrical system comprises a DC interface, an AC interface, an isolation module, a first conversion module between the DC interface and the isolation module, and a second conversion module between the AC interface and the isolation module. A control module is configured to operate the first conversion module to provide an injection current to the second conversion module to reduce a magnitude of a current through a switching element of the second conversion module before opening the switching element.

Energy and contact of the one-dimensional Fermi polaron at zero and finite temperature.

PubMed

Doggen, E V H; Kinnunen, J J

2013-07-12

We use the T-matrix approach for studying highly polarized homogeneous Fermi gases in one dimension with repulsive or attractive contact interactions. Using this approach, we compute ground state energies and values for the contact parameter that show excellent agreement with exact and other numerical methods at zero temperature, even in the strongly interacting regime. Furthermore, we derive an exact expression for the value of the contact parameter in one dimension at zero temperature. The model is then extended and used for studying the temperature dependence of ground state energies and the contact parameter.

Energy in elastic fiber embedded in elastic matrix containing incident SH wave

NASA Technical Reports Server (NTRS)

Williams, James H., Jr.; Nagem, Raymond J.

1989-01-01

A single elastic fiber embedded in an infinite elastic matrix is considered. An incident plane SH wave is assumed in the infinite matrix, and an expression is derived for the total energy in the fiber due to the incident SH wave. A nondimensional form of the fiber energy is plotted as a function of the nondimensional wavenumber of the SH wave. It is shown that the fiber energy attains maximum values at specific values of the wavenumber of the incident wave. The results obtained here are interpreted in the context of phenomena observed in acousto-ultrasonic experiments on fiber reinforced composite materials.

Theoretical development and first-principles analysis of strongly correlated systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Chen

A variety of quantum many-body methods have been developed for studying the strongly correlated electron systems. We have also proposed a computationally efficient and accurate approach, named the correlation matrix renormalization (CMR) method, to address the challenges. The initial implementation of the CMR method is designed for molecules which have theoretical advantages, including small size of system, manifest mechanism and strongly correlation effect such as bond breaking process. The theoretic development and benchmark tests of the CMR method are included in this thesis. Meanwhile, ground state total energy is the most important property of electronic calculations. We also investigated anmore » alternative approach to calculate the total energy, and extended this method for magnetic anisotropy energy (MAE) of ferromagnetic materials. In addition, another theoretical tool, dynamical mean- field theory (DMFT) on top of the DFT , has also been used in electronic structure calculations for an Iridium oxide to study the phase transition, which results from an interplay of the d electrons' internal degrees of freedom.« less

X-ray peak broadening analysis of AA 6061{sub 100-x} - x wt.% Al{sub 2}O{sub 3} nanocomposite prepared by mechanical alloying

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sivasankaran, S., E-mail: sivasankarangs1979@gmail.com; Sivaprasad, K., E-mail: ksp@nitt.edu; Narayanasamy, R., E-mail: narayan@nitt.edu

2011-07-15

Nanocrystalline AA 6061 alloy reinforced with alumina (0, 4, 8, and 12 wt.%) in amorphized state composite powder was synthesized by mechanical alloying and consolidated by conventional powder metallurgy route. The as-milled and as-sintered (573 K and 673 K) nanocomposites were characterized by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The peaks corresponding to fine alumina was not observed by XRD patterns due to amorphization. Using high-resolution transmission electron microscope, it is confirmed that the presence of amorphized alumina observed in Al lattice fringes. The crystallite size, lattice strain, deformation stress, and strain energy density of AA 6061 matrixmore » were determined precisely from the first five most intensive reflection of XRD using simple Williamson-Hall models; uniform deformation model, uniform stress deformation model, and uniform energy density deformation model. Among the developed models, uniform energy density deformation model was observed to be the best fit and realistic model for mechanically alloyed powders. This model evidenced the more anisotropic nature of the ball milled powders. The XRD peaks of as-milled powder samples demonstrated a considerable broadening with percentage of reinforcement due to grain refinement and lattice distortions during same milling time (40 h). The as-sintered (673 K) unreinforced AA 6061 matrix crystallite size from well fitted uniform energy density deformation model was 98 nm. The as-milled and as-sintered (673 K) nanocrystallite matrix sizes for 12 wt.% Al{sub 2}O{sub 3} well fitted by uniform energy density deformation model were 38 nm and 77 nm respectively, which indicate that the fine Al{sub 2}O{sub 3} pinned the matrix grain boundary and prevented the grain growth during sintering. Finally, the lattice parameter of Al matrix in as-milled and as-sintered conditions was also investigated in this paper. Research highlights: {yields} Integral breadth methods using various Williamson-Hall models were investigated for line profile analysis. {yields} Uniform energy density deformation model is observed to the best realistic model. {yields} The present analysis is used for understanding the stress and the strain present in the nanocomposites.« less

On the stiffness matrix of the intervertebral joint: application to total disk replacement.

PubMed

O'Reilly, Oliver M; Metzger, Melodie F; Buckley, Jenni M; Moody, David A; Lotz, Jeffrey C

2009-08-01

The traditional method of establishing the stiffness matrix associated with an intervertebral joint is valid only for infinitesimal rotations, whereas the rotations featured in spinal motion are often finite. In the present paper, a new formulation of this stiffness matrix is presented, which is valid for finite rotations. This formulation uses Euler angles to parametrize the rotation, an associated basis, which is known as the dual Euler basis, to describe the moments, and it enables a characterization of the nonconservative nature of the joint caused by energy loss in the poroviscoelastic disk and ligamentous support structure. As an application of the formulation, the stiffness matrix of a motion segment is experimentally determined for the case of an intact intervertebral disk and compared with the matrices associated with the same segment after the insertion of a total disk replacement system. In this manner, the matrix is used to quantify the changes in the intervertebral kinetics associated with total disk replacements. As a result, this paper presents the first such characterization of the kinetics of a total disk replacement.

Spin orbit coupling for molecular ab initio density matrix renormalization group calculations: Application to g-tensors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roemelt, Michael, E-mail: michael.roemelt@theochem.rub.de

Spin Orbit Coupling (SOC) is introduced to molecular ab initio density matrix renormalization group (DMRG) calculations. In the presented scheme, one first approximates the electronic ground state and a number of excited states of the Born-Oppenheimer (BO) Hamiltonian with the aid of the DMRG algorithm. Owing to the spin-adaptation of the algorithm, the total spin S is a good quantum number for these states. After the non-relativistic DMRG calculation is finished, all magnetic sublevels of the calculated states are constructed explicitly, and the SOC operator is expanded in the resulting basis. To this end, spin orbit coupled energies and wavefunctionsmore » are obtained as eigenvalues and eigenfunctions of the full Hamiltonian matrix which is composed of the SOC operator matrix and the BO Hamiltonian matrix. This treatment corresponds to a quasi-degenerate perturbation theory approach and can be regarded as the molecular equivalent to atomic Russell-Saunders coupling. For the evaluation of SOC matrix elements, the full Breit-Pauli SOC Hamiltonian is approximated by the widely used spin-orbit mean field operator. This operator allows for an efficient use of the second quantized triplet replacement operators that are readily generated during the non-relativistic DMRG algorithm, together with the Wigner-Eckart theorem. With a set of spin-orbit coupled wavefunctions at hand, the molecular g-tensors are calculated following the scheme proposed by Gerloch and McMeeking. It interprets the effective molecular g-values as the slope of the energy difference between the lowest Kramers pair with respect to the strength of the applied magnetic field. Test calculations on a chemically relevant Mo complex demonstrate the capabilities of the presented method.« less

Cardiac mitochondrial matrix and respiratory complex protein phosphorylation

PubMed Central

Covian, Raul

2012-01-01

It has become appreciated over the last several years that protein phosphorylation within the cardiac mitochondrial matrix and respiratory complexes is extensive. Given the importance of oxidative phosphorylation and the balance of energy metabolism in the heart, the potential regulatory effect of these classical signaling events on mitochondrial function is of interest. However, the functional impact of protein phosphorylation and the kinase/phosphatase system responsible for it are relatively unknown. Exceptions include the well-characterized pyruvate dehydrogenase and branched chain α-ketoacid dehydrogenase regulatory system. The first task of this review is to update the current status of protein phosphorylation detection primarily in the matrix and evaluate evidence linking these events with enzymatic function or protein processing. To manage the scope of this effort, we have focused on the pathways involved in energy metabolism. The high sensitivity of modern methods of detecting protein phosphorylation and the low specificity of many kinases suggests that detection of protein phosphorylation sites without information on the mole fraction of phosphorylation is difficult to interpret, especially in metabolic enzymes, and is likely irrelevant to function. However, several systems including protein translocation, adenine nucleotide translocase, cytochrome c, and complex IV protein phosphorylation have been well correlated with enzymatic function along with the classical dehydrogenase systems. The second task is to review the current understanding of the kinase/phosphatase system within the matrix. Though it is clear that protein phosphorylation occurs within the matrix, based on 32P incorporation and quantitative mass spectrometry measures, the kinase/phosphatase system responsible for this process is ill-defined. An argument is presented that remnants of the much more labile bacterial protein phosphoryl transfer system may be present in the matrix and that the evaluation of this possibility will require the application of approaches developed for bacterial cell signaling to the mitochondria. PMID:22886415

Matrix elements of vibration kinetic energy operator of tetrahedral molecules in non-orthogonal-dependent coordinates

NASA Astrophysics Data System (ADS)

Protasevich, Alexander E.; Nikitin, Andrei V.

2018-01-01

In this work, we propose an algorithm for calculating the matrix elements of the kinetic energy operator for tetrahedral molecules. This algorithm uses the dependent six-angle coordinates (6A) and takes into account the full symmetry of molecules. Unlike A.V. Nikitin, M. Rey, and Vl. G. Tyuterev who operate with the kinetic energy operator only in Radau orthogonal coordinates, we consider a general case. The matrix elements are shown to be a sum of products of one-dimensional integrals.

High-Energy Anomaly in the Angle-Resolved Photoemission Spectra of Nd2-xCexCuO4: Evidence for a Matrix Element Effect

NASA Astrophysics Data System (ADS)

Rienks, E. D. L.; ńrrälä, M.; Lindroos, M.; Roth, F.; Tabis, W.; Yu, G.; Greven, M.; Fink, J.

2014-09-01

We use polarization-dependent angle-resolved photoemission spectroscopy (ARPES) to study the high-energy anomaly (HEA) in the dispersion of Nd2-xCexCuO4, x =0.123. We find that at particular photon energies the anomalous, waterfall-like dispersion gives way to a broad, continuous band. This suggests that the HEA is a matrix element effect: it arises due to a suppression of the intensity of the broadened quasiparticle band in a narrow momentum range. We confirm this interpretation experimentally, by showing that the HEA appears when the matrix element is suppressed deliberately by changing the light polarization. Calculations of the matrix element using atomic wave functions and simulation of the ARPES intensity with one-step model calculations provide further evidence for this scenario. The possibility to detect the full quasiparticle dispersion further allows us to extract the high-energy self-energy function near the center and at the edge of the Brillouin zone.

High-energy anomaly in the angle-resolved photoemission spectra of Nd(2-x)Ce(x)CuO₄: evidence for a matrix element effect.

PubMed

Rienks, E D L; Ärrälä, M; Lindroos, M; Roth, F; Tabis, W; Yu, G; Greven, M; Fink, J

2014-09-26

We use polarization-dependent angle-resolved photoemission spectroscopy (ARPES) to study the high-energy anomaly (HEA) in the dispersion of Nd(2-x)Ce(x)CuO₄, x=0.123. We find that at particular photon energies the anomalous, waterfall-like dispersion gives way to a broad, continuous band. This suggests that the HEA is a matrix element effect: it arises due to a suppression of the intensity of the broadened quasiparticle band in a narrow momentum range. We confirm this interpretation experimentally, by showing that the HEA appears when the matrix element is suppressed deliberately by changing the light polarization. Calculations of the matrix element using atomic wave functions and simulation of the ARPES intensity with one-step model calculations provide further evidence for this scenario. The possibility to detect the full quasiparticle dispersion further allows us to extract the high-energy self-energy function near the center and at the edge of the Brillouin zone.

Residual thermal and moisture influences on the strain energy release rate analysis of local delaminations from matrix cracks

NASA Technical Reports Server (NTRS)

Obrien, T. K.

1991-01-01

An analysis utilizing laminated plate theory is developed to calculate the strain energy release rate associated with local delaminations originating at off-axis, single ply, matrix cracks in laminates subjected to uniaxial loads. The analysis includes the contribution of residual thermal and moisture stresses to the strain energy released. Examples are calculated for the strain energy release rate associated with local delaminations originating at 90 degrees and angle-ply (non-90 degrees) matrix ply cracks in glass epoxy and graphite epoxy laminates. The solution developed may be used to assess the relative contribution of mechanical, residual thermal, and moisture stresses on the strain energy release rate for local delamination for a variety of layups and materials.

Improved Dielectric Properties and Energy Storage Density of Poly(vinylidene fluoride-co-hexafluoropropylene) Nanocomposite with Hydantoin Epoxy Resin Coated BaTiO3.

PubMed

Luo, Hang; Zhang, Dou; Jiang, Chao; Yuan, Xi; Chen, Chao; Zhou, Kechao

2015-04-22

Energy storage materials are urgently demanded in modern electric power supply and renewable energy systems. The introduction of inorganic fillers to polymer matrix represents a promising avenue for the development of high energy density storage materials, which combines the high dielectric constant of inorganic fillers with supernal dielectric strength of polymer matrix. However, agglomeration and phase separation of inorganic fillers in the polymer matrix remain the key barriers to promoting the practical applications of the composites for energy storage. Here, we developed a low-cost and environmentally friendly route to modifying BaTiO3 (BT) nanoparticles by a kind of water-soluble hydantoin epoxy resin. The modified BT nanoparticles exhibited homogeneous dispersion in the ferroelectric polymer poly(vinylidene fluoride-co-hexafluoropropylene) (P(VDF-HFP)) matrix and strong interfacial adhesion with the polymer matrix. The dielectric constants of the nanocomposites increased significantly with the increase of the coated BT loading, while the dielectric loss of the nanocomposites was still as low as that of the pure P(VDF-HFP). The energy storage density of the nanocomposites was largely enhanced with the coated BT loading at the same electric field. The nanocomposite with 20 vol % BT exhibited an estimated maximum energy density of 8.13 J cm(-3), which was much higher than that of pure P(VDF-HFP) and other dielectric polymers. The findings of this research could provide a feasible approach to produce high energy density materials for practical application in energy storage.

Mussel-inspired Fluoro-Polydopamine Functionalization of Titanium Dioxide Nanowires for Polymer Nanocomposites with Significantly Enhanced Energy Storage Capability.

PubMed

Wang, Guanyao; Huang, Xingyi; Jiang, Pingkai

2017-02-22

High-dielectric-constant polymer nanocomposites are demonstrated to show great promise as energy storage materials. However, the large electrical mismatch and incompatibility between nanofillers and polymer matrix usually give rise to significantly reduced breakdown strength and weak energy storage capability. Therefore, rational selection and elaborate functionalization of nanofillers to optimize the performance of polymer nanocomposites are vital. Herein, inspired by adhesive proteins in mussels, a facile modification by fluoro-polydopamine is employed to reinforce the compatibility of TiO 2 nanowires in the fluoropolymer matrix. The loading of 2.5 vol % f-DOPA@TiO 2 NWs leads to an ultrahigh discharged energy density of 11.48 J cm -3 at 530 MV m -1 , more than three times of commercial biaxial-oriented polypropylene (BOPP, 3.56 J cm -3 at 600 MV m -1 ). A gratifying high energy density of 9.12 J cm -3 has also been obtained with nanofiller loading as high as 15 vol % at 360 MV m -1 , which is nearly double to that of pure P(VDF-HFP) (4.76 J cm -3 at 360 MV m -1 ). This splendid energy storage capability seems to rival or exceed most of previously reported nano-TiO 2 based nanocomposites. The methods presented here provide deep insights into the design of polymer nanocomposites for energy storage applications.

Mussel-inspired Fluoro-Polydopamine Functionalization of Titanium Dioxide Nanowires for Polymer Nanocomposites with Significantly Enhanced Energy Storage Capability

NASA Astrophysics Data System (ADS)

Wang, Guanyao; Huang, Xingyi; Jiang, Pingkai

2017-02-01

High-dielectric-constant polymer nanocomposites are demonstrated to show great promise as energy storage materials. However, the large electrical mismatch and incompatibility between nanofillers and polymer matrix usually give rise to significantly reduced breakdown strength and weak energy storage capability. Therefore, rational selection and elaborate functionalization of nanofillers to optimize the performance of polymer nanocomposites are vital. Herein, inspired by adhesive proteins in mussels, a facile modification by fluoro-polydopamine is employed to reinforce the compatibility of TiO2 nanowires in the fluoropolymer matrix. The loading of 2.5 vol % f-DOPA@TiO2 NWs leads to an ultrahigh discharged energy density of 11.48 J cm-3 at 530 MV m-1, more than three times of commercial biaxial-oriented polypropylene (BOPP, 3.56 J cm-3 at 600 MV m-1). A gratifying high energy density of 9.12 J cm-3 has also been obtained with nanofiller loading as high as 15 vol % at 360 MV m-1, which is nearly double to that of pure P(VDF-HFP) (4.76 J cm-3 at 360 MV m-1). This splendid energy storage capability seems to rival or exceed most of previously reported nano-TiO2 based nanocomposites. The methods presented here provide deep insights into the design of polymer nanocomposites for energy storage applications.

Design of specially adapted reactive coordinates to economically compute potential and kinetic energy operators including geometry relaxation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thallmair, Sebastian; Lehrstuhl für BioMolekulare Optik, Ludwig-Maximilians-Universität München, D-80538 München; Roos, Matthias K.

Quantum dynamics simulations require prior knowledge of the potential energy surface as well as the kinetic energy operator. Typically, they are evaluated in a low-dimensional subspace of the full configuration space of the molecule as its dimensionality increases proportional to the number of atoms. This entails the challenge to find the most suitable subspace. We present an approach to design specially adapted reactive coordinates spanning this subspace. In addition to the essential geometric changes, these coordinates take into account the relaxation of the non-reactive coordinates without the necessity of performing geometry optimizations at each grid point. The method is demonstratedmore » for an ultrafast photoinduced bond cleavage in a commonly used organic precursor for the generation of electrophiles. The potential energy surfaces for the reaction as well as the Wilson G-matrix as part of the kinetic energy operator are shown for a complex chemical reaction, both including the relaxation of the non-reactive coordinates on equal footing. A microscopic interpretation of the shape of the G-matrix elements allows to analyze the impact of the non-reactive coordinates on the kinetic energy operator. Additionally, we compare quantum dynamics simulations with and without the relaxation of the non-reactive coordinates included in the kinetic energy operator to demonstrate its influence.« less

Electron capture rates in stars studied with heavy ion charge exchange reactions

NASA Astrophysics Data System (ADS)

Bertulani, C. A.

2018-01-01

Indirect methods using nucleus-nucleus reactions at high energies (here, high energies mean ~ 50 MeV/nucleon and higher) are now routinely used to extract information of interest for nuclear astrophysics. This is of extreme relevance as many of the nuclei involved in stellar evolution are short-lived. Therefore, indirect methods became the focus of recent studies carried out in major nuclear physics facilities. Among such methods, heavy ion charge exchange is thought to be a useful tool to infer Gamow-Teller matrix elements needed to describe electron capture rates in stars and also double beta-decay experiments. In this short review, I provide a theoretical guidance based on a simple reaction model for charge exchange reactions.

Density matrix modeling of quantum cascade lasers without an artificially localized basis: A generalized scattering approach

NASA Astrophysics Data System (ADS)

Pan, Andrew; Burnett, Benjamin A.; Chui, Chi On; Williams, Benjamin S.

2017-08-01

We derive a density matrix (DM) theory for quantum cascade lasers (QCLs) that describes the influence of scattering on coherences through a generalized scattering superoperator. The theory enables quantitative modeling of QCLs, including localization and tunneling effects, using the well-defined energy eigenstates rather than the ad hoc localized basis states required by most previous DM models. Our microscopic approach to scattering also eliminates the need for phenomenological transition or dephasing rates. We discuss the physical interpretation and numerical implementation of the theory, presenting sets of both energy-resolved and thermally averaged equations, which can be used for detailed or compact device modeling. We illustrate the theory's applications by simulating a high performance resonant-phonon terahertz (THz) QCL design, which cannot be easily or accurately modeled using conventional DM methods. We show that the theory's inclusion of coherences is crucial for describing localization and tunneling effects consistent with experiment.

Line Coupling Effects in the Isotropic Raman Spectra of N2: A Quantum Calculation at Room Temperature

NASA Technical Reports Server (NTRS)

Thibault, Franck; Boulet, Christian; Ma, Qiancheng

2014-01-01

We present quantum calculations of the relaxation matrix for the Q branch of N2 at room temperature using a recently proposed N2-N2 rigid rotor potential. Close coupling calculations were complemented by coupled states studies at high energies and provide about 10200 two-body state-to state cross sections from which the needed one-body cross-sections may be obtained. For such temperatures, convergence has to be thoroughly analyzed since such conditions are close to the limit of current computational feasibility. This has been done using complementary calculations based on the energy corrected sudden formalism. Agreement of these quantum predictions with experimental data is good, but the main goal of this work is to provide a benchmark relaxation matrix for testing more approximate methods which remain of a great utility for complex molecular systems at room (and higher) temperatures.

A variation-perturbation method for atomic and molecular interactions. I - Theory. II - The interaction potential and van der Waals molecule for Ne-HF

NASA Astrophysics Data System (ADS)

Gallup, G. A.; Gerratt, J.

1985-09-01

The van der Waals energy between the two parts of a system is a very small fraction of the total electronic energy. In such cases, calculations have been based on perturbation theory. However, such an approach involves certain difficulties. For this reason, van der Waals energies have also been directly calculated from total energies. But such a method has definite limitations as to the size of systems which can be treated, and recently ab initio calculations have been combined with damped semiempirical long-range dispersion potentials to treat larger systems. In this procedure, large basis set superposition errors occur, which must be removed by the counterpoise method. The present investigation is concerned with an approach which is intermediate between the previously considered procedures. The first step in the new approach involves a variational calculation based upon valence bond functions. The procedure includes also the optimization of excited orbitals, and an approximation of atomic integrals and Hamiltonian matrix elements.

Analytical derivatives of the individual state energies in ensemble density functional theory method. I. General formalism

DOE PAGES

Filatov, Michael; Liu, Fang; Martínez, Todd J.

2017-07-21

The state-averaged (SA) spin restricted ensemble referenced Kohn-Sham (REKS) method and its state interaction (SI) extension, SI-SA-REKS, enable one to describe correctly the shape of the ground and excited potential energy surfaces of molecules undergoing bond breaking/bond formation reactions including features such as conical intersections crucial for theoretical modeling of non-adiabatic reactions. Until recently, application of the SA-REKS and SI-SA-REKS methods to modeling the dynamics of such reactions was obstructed due to the lack of the analytical energy derivatives. Here, the analytical derivatives of the individual SA-REKS and SI-SA-REKS energies are derived. The final analytic gradient expressions are formulated entirelymore » in terms of traces of matrix products and are presented in the form convenient for implementation in the traditional quantum chemical codes employing basis set expansions of the molecular orbitals. Finally, we will describe the implementation and benchmarking of the derived formalism in a subsequent article of this series.« less

Estimation of geopotential from satellite-to-satellite range rate data: Numerical results

NASA Technical Reports Server (NTRS)

Thobe, Glenn E.; Bose, Sam C.

1987-01-01

A technique for high-resolution geopotential field estimation by recovering the harmonic coefficients from satellite-to-satellite range rate data is presented and tested against both a controlled analytical simulation of a one-day satellite mission (maximum degree and order 8) and then against a Cowell method simulation of a 32-day mission (maximum degree and order 180). Innovations include: (1) a new frequency-domain observation equation based on kinetic energy perturbations which avoids much of the complication of the usual Keplerian element perturbation approaches; (2) a new method for computing the normalized inclination functions which unlike previous methods is both efficient and numerically stable even for large harmonic degrees and orders; (3) the application of a mass storage FFT to the entire mission range rate history; (4) the exploitation of newly discovered symmetries in the block diagonal observation matrix which reduce each block to the product of (a) a real diagonal matrix factor, (b) a real trapezoidal factor with half the number of rows as before, and (c) a complex diagonal factor; (5) a block-by-block least-squares solution of the observation equation by means of a custom-designed Givens orthogonal rotation method which is both numerically stable and tailored to the trapezoidal matrix structure for fast execution.

Iterative image-domain decomposition for dual-energy CT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niu, Tianye; Dong, Xue; Petrongolo, Michael

2014-04-15

Purpose: Dual energy CT (DECT) imaging plays an important role in advanced imaging applications due to its capability of material decomposition. Direct decomposition via matrix inversion suffers from significant degradation of image signal-to-noise ratios, which reduces clinical values of DECT. Existing denoising algorithms achieve suboptimal performance since they suppress image noise either before or after the decomposition and do not fully explore the noise statistical properties of the decomposition process. In this work, the authors propose an iterative image-domain decomposition method for noise suppression in DECT, using the full variance-covariance matrix of the decomposed images. Methods: The proposed algorithm ismore » formulated in the form of least-square estimation with smoothness regularization. Based on the design principles of a best linear unbiased estimator, the authors include the inverse of the estimated variance-covariance matrix of the decomposed images as the penalty weight in the least-square term. The regularization term enforces the image smoothness by calculating the square sum of neighboring pixel value differences. To retain the boundary sharpness of the decomposed images, the authors detect the edges in the CT images before decomposition. These edge pixels have small weights in the calculation of the regularization term. Distinct from the existing denoising algorithms applied on the images before or after decomposition, the method has an iterative process for noise suppression, with decomposition performed in each iteration. The authors implement the proposed algorithm using a standard conjugate gradient algorithm. The method performance is evaluated using an evaluation phantom (Catphan©600) and an anthropomorphic head phantom. The results are compared with those generated using direct matrix inversion with no noise suppression, a denoising method applied on the decomposed images, and an existing algorithm with similar formulation as the proposed method but with an edge-preserving regularization term. Results: On the Catphan phantom, the method maintains the same spatial resolution on the decomposed images as that of the CT images before decomposition (8 pairs/cm) while significantly reducing their noise standard deviation. Compared to that obtained by the direct matrix inversion, the noise standard deviation in the images decomposed by the proposed algorithm is reduced by over 98%. Without considering the noise correlation properties in the formulation, the denoising scheme degrades the spatial resolution to 6 pairs/cm for the same level of noise suppression. Compared to the edge-preserving algorithm, the method achieves better low-contrast detectability. A quantitative study is performed on the contrast-rod slice of Catphan phantom. The proposed method achieves lower electron density measurement error as compared to that by the direct matrix inversion, and significantly reduces the error variation by over 97%. On the head phantom, the method reduces the noise standard deviation of decomposed images by over 97% without blurring the sinus structures. Conclusions: The authors propose an iterative image-domain decomposition method for DECT. The method combines noise suppression and material decomposition into an iterative process and achieves both goals simultaneously. By exploring the full variance-covariance properties of the decomposed images and utilizing the edge predetection, the proposed algorithm shows superior performance on noise suppression with high image spatial resolution and low-contrast detectability.« less

Photoisomerization and photochemistry of matrix-isolated 3-furaldehyde.

PubMed

Kuş, Nihal; Reva, Igor; Fausto, Rui

2010-12-02

3-Furaldehyde (3FA) was isolated in an argon matrix at 12 K and studied using FTIR spectroscopy and quantum chemistry. The molecule has two conformers, with trans and cis orientation of the O=C-C=C dihedral angle. At the B3LYP/6-311++G(d,p) level of theory, the trans form was computed to be ca. 4 kJ mol(-1) more stable than the cis form. The relative stability of the two conformers was explained using the natural bond orbital (NBO) method. In fair agreement with their calculated relative energies and the high barrier of rotamerization (ca. 34 kJ mol(-1) from trans to cis), the trans and cis conformers were trapped in an argon matrix from the compound room temperature gas phase in proportion ~7:1. The experimentally observed vibrational signatures of the two forms are in a good agreement with the theoretically calculated spectra. Broad-band UV-irradiation (λ > 234 nm) of the matrix-isolated compound resulted in partial trans → cis isomerization, which ended at a photostationary state with the trans/cis ratio being ca. 1.85:1. This result was interpreted based on results of time-dependent DFT calculations. Irradiation at higher energies (λ > 200 nm) led to decarbonylation of the compound, yielding furan, cyclopropene-3-carbaldehyde, and two C(3)H(4) isomers: cyclopropene and propadiene.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weldu, Yemane W., E-mail: ywweldem@ucalgary.ca; Assefa, Getachew; Athena Chair in Life Cycle Assessment in Design

A roadmap for a more sustainable energy strategy is complex, as its development interacts critically with the economic, social, and environmental dimensions of sustainable development. This paper applied an impact matrix method to evaluate the environmental sustainability and to identify the desirable policy objectives of biomass-based energy strategy for the case of Alberta. A matrix with the sustainability domains on one axis and areas of environmental impact on the other was presented to evaluate the nexus effect of policy objectives and bioenergy production. As per to our analysis, economic diversification, technological innovation, and resource conservation came up as the desirablemore » policy objectives of sustainable development for Alberta because they demonstrated environmental benefits in all environmental impact categories, namely climate change, human health, and ecosystem. On the other hand, human health and ecosystem impacts were identified as trade-offs when the policy objectives for sustainability were energy security, job creation, and climate change. Thus, bioenergy can mitigate climate change but may impact human health and ecosystem which then in turn can become issues of concern. Energy strategies may result in shifting of risks from one environmental impact category to another, and from one sustainable domain to another if the technical and policy-related issues are not identified.« less

Investigations on Mechanical Behaviour of Micro Graphite Particulates Reinforced Al-7Si Alloy Composites

NASA Astrophysics Data System (ADS)

Nagaraj, N.; Mahendra, K. V.; Nagaral, Madeva

2018-02-01

Micro particulates reinforced metal matrix composites are finding wide range of applications in automotive and sports equipment manufacturing industries. In the present study, an attempt has been made to develop Al-7Si-micro graphite particulates reinforced composites by using liquid melt method. 3 and 6 wt. % of micro graphite particulates were added to the Al-7Si base matrix. Microstructural characterization was done by using scanning electron microscope and energy dispersive spectroscope. Mechanical behaviour of Al-7Si-3 and 6 wt. % composites were evaluated as per ASTM standards. Scanning electron micrographs revealed the uniform distribution of micro graphite particulates in the Al-7Si alloy matrix. EDS analysis confirmed the presence of B and C elements in graphite reinforced composites. Further, it was noted that ultimate tensile and yield strength of Al-7Si alloy increased with the addition of 3 and 6wt. % of graphite particulates. Hardness of graphite reinforced composites was lesser than the base matrix.

Quantitative multi-color FRET measurements by Fourier lifetime excitation-emission matrix spectroscopy.

PubMed

Zhao, Ming; Huang, Run; Peng, Leilei

2012-11-19

Förster resonant energy transfer (FRET) is extensively used to probe macromolecular interactions and conformation changes. The established FRET lifetime analysis method measures the FRET process through its effect on the donor lifetime. In this paper we present a method that directly probes the time-resolved FRET signal with frequency domain Fourier lifetime excitation-emission matrix (FLEEM) measurements. FLEEM separates fluorescent signals by their different phonon energy pathways from excitation to emission. The FRET process generates a unique signal channel that is initiated by donor excitation but ends with acceptor emission. Time-resolved analysis of the FRET EEM channel allows direct measurements on the FRET process, unaffected by free fluorophores that might be present in the sample. Together with time-resolved analysis on non-FRET channels, i.e. donor and acceptor EEM channels, time resolved EEM analysis allows precise quantification of FRET in the presence of free fluorophores. The method is extended to three-color FRET processes, where quantification with traditional methods remains challenging because of the significantly increased complexity in the three-way FRET interactions. We demonstrate the time-resolved EEM analysis method with quantification of three-color FRET in incompletely hybridized triple-labeled DNA oligonucleotides. Quantitative measurements of the three-color FRET process in triple-labeled dsDNA are obtained in the presence of free single-labeled ssDNA and double-labeled dsDNA. The results establish a quantification method for studying multi-color FRET between multiple macromolecules in biochemical equilibrium.

Quantitative multi-color FRET measurements by Fourier lifetime excitation-emission matrix spectroscopy

PubMed Central

Zhao, Ming; Huang, Run; Peng, Leilei

2012-01-01

Förster resonant energy transfer (FRET) is extensively used to probe macromolecular interactions and conformation changes. The established FRET lifetime analysis method measures the FRET process through its effect on the donor lifetime. In this paper we present a method that directly probes the time-resolved FRET signal with frequency domain Fourier lifetime excitation-emission matrix (FLEEM) measurements. FLEEM separates fluorescent signals by their different phonon energy pathways from excitation to emission. The FRET process generates a unique signal channel that is initiated by donor excitation but ends with acceptor emission. Time-resolved analysis of the FRET EEM channel allows direct measurements on the FRET process, unaffected by free fluorophores that might be present in the sample. Together with time-resolved analysis on non-FRET channels, i.e. donor and acceptor EEM channels, time resolved EEM analysis allows precise quantification of FRET in the presence of free fluorophores. The method is extended to three-color FRET processes, where quantification with traditional methods remains challenging because of the significantly increased complexity in the three-way FRET interactions. We demonstrate the time-resolved EEM analysis method with quantification of three-color FRET in incompletely hybridized triple-labeled DNA oligonucleotides. Quantitative measurements of the three-color FRET process in triple-labeled dsDNA are obtained in the presence of free single-labeled ssDNA and double-labeled dsDNA. The results establish a quantification method for studying multi-color FRET between multiple macromolecules in biochemical equilibrium. PMID:23187535

Short-range correlations in carbon-12, oxygen-16, and neon-20: Intrinsic properties

NASA Technical Reports Server (NTRS)

Braley, R. C.; Ford, W. F.; Becker, R. L.; Patterson, M. R.

1972-01-01

The Brueckner-Hartree-Fock (BHF) method has been applied to nuclei whose intrinsic structure is nonspherical. Reaction matrix elements were calculated as functions of starting energy for the Hamada-Johnston interaction using the Pauli operator appropriate to O-16 and a shifted oscillator spectrum for virtual excited states. Binding energies, single particle energies, radii, and shape deformations of the intrinsic state, in ordinary as well as renormalized BHF, are discussed and compared with previous HF studies and with experiment when possible. Results are presented for C-12, 0-16 and Ne-20. It is found that the binding energies and radii are too small, but that separation energies are well reproduced when the renormalized theory is used.

Deconvolution of Energy Spectra in the ATIC Experiment

NASA Technical Reports Server (NTRS)

Batkov, K. E.; Panov, A. D.; Adams, J. H.; Ahn, H. S.; Bashindzhagyan, G. L.; Chang, J.; Christl, M.; Fazley, A. R.; Ganel, O.; Gunasigha, R. M.;

Molecular properties of excited electronic state: Formalism, implementation, and applications of analytical second energy derivatives within the framework of the time-dependent density functional theory/molecular mechanics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zeng, Qiao; Liang, WanZhen, E-mail: liangwz@xmu.edu.cn; Liu, Jie

2014-05-14

This work extends our previous works [J. Liu and W. Z. Liang, J. Chem. Phys. 135, 014113 (2011); J. Liu and W. Z. Liang, J. Chem. Phys. 135, 184111 (2011)] on analytical excited-state energy Hessian within the framework of time-dependent density functional theory (TDDFT) to couple with molecular mechanics (MM). The formalism, implementation, and applications of analytical first and second energy derivatives of TDDFT/MM excited state with respect to the nuclear and electric perturbations are presented. Their performances are demonstrated by the calculations of adiabatic excitation energies, and excited-state geometries, harmonic vibrational frequencies, and infrared intensities for a number ofmore » benchmark systems. The consistent results with the full quantum mechanical method and other hybrid theoretical methods indicate the reliability of the current numerical implementation of developed algorithms. The computational accuracy and efficiency of the current analytical approach are also checked and the computational efficient strategies are suggested to speed up the calculations of complex systems with many MM degrees of freedom. Finally, we apply the current analytical approach in TDDFT/MM to a realistic system, a red fluorescent protein chromophore together with part of its nearby protein matrix. The calculated results indicate that the rearrangement of the hydrogen bond interactions between the chromophore and the protein matrix is responsible for the large Stokes shift.« less

Impact Ionization: Beyond the Golden Rule

DTIC Science & Technology

1992-01-01

3]. Hence, the use electronic kinetic energy, H. is the phonon bath Hamil- of Monte Carlo methods combined with density matrix tonian, HA, is the...0 o5 () Wace i.a (bN w...,,,ae (W ( Ib) k- Figure 2. (a) Ionization rate in the 1 11 > direction. Figure 3. (a) Equal ionization rate curves in the k

Influence of different crosslinking treatments on the physical properties of collagen membranes.

PubMed

Charulatha, V; Rajaram, A

2003-02-01

The physical properties of collagen-based biomaterials are profoundly influenced by the method and extent of crosslinking. In this study, the influence of various crosslinking treatments on the physical properties of reconstituted collagen membranes was assessed. Five crosslinking agents viz., GTA, DMS, DTBP, a combination of DMS and GTA and acyl azide method were used to stabilize collagen matrices. Crosslinking density, swelling ratio, thermo-mechanical properties, stress-strain characteristics and resistance to collagenase digestion were determined to evaluate the physical properties of crosslinked matrices. GTA treatment induced the maximum number of crosslinks (13) while DMS treatment induced the minimum (7). Of the two diimidoesters (DMS and DTBP), DTBP was a more effective crosslinking agent due to the presence of disulphide bonds in the DTBP crosslinks. T(s) for DTBP and DMS crosslinked collagen were 80 degrees C and 70 degrees C, and their HIT values were 5.4 and 2.85MN/m(2), respectively. Low concentration of GTA (0.01%) increased the crosslinking density of an already crosslinked matrix (DMS treated matrix) from 7 to 12. Lowest fracture energy was observed for the acyl azide treated matrix (0.61MJ/m(3)) while the highest was observed for the GTA treated matrix (1.97MJ/m(3)). The tensile strength of GTA treated matrix was maximum (12.4MPa) and that of acyl azide treated matrix was minimum (7.2MPa). GTA, DTBP and acyl azide treated matrices were equally resistant to collagenase degradation with approximately 6% solubilization after 5h while the DMS treated was least stable with 52.4% solubilization after the same time period. The spatial orientation of amino acid side chain residues on collagen plays an important role in determining the crosslinking density and consequent physical properties of the collagen matrix.

Efficient and accurate treatment of electron correlations with correlation matrix renormalization theory

DOE PAGES

Yao, Y. X.; Liu, J.; Liu, C.; ...

2015-08-28

We present an efficient method for calculating the electronic structure and total energy of strongly correlated electron systems. The method extends the traditional Gutzwiller approximation for one-particle operators to the evaluation of the expectation values of two particle operators in the many-electron Hamiltonian. The method is free of adjustable Coulomb parameters, and has no double counting issues in the calculation of total energy, and has the correct atomic limit. We demonstrate that the method describes well the bonding and dissociation behaviors of the hydrogen and nitrogen clusters, as well as the ammonia composed of hydrogen and nitrogen atoms. We alsomore » show that the method can satisfactorily tackle great challenging problems faced by the density functional theory recently discussed in the literature. The computational workload of our method is similar to the Hartree-Fock approach while the results are comparable to high-level quantum chemistry calculations.« less

Nature of Driving Force for Protein Folding-- A Result From Analyzing the Statistical Potential

NASA Astrophysics Data System (ADS)

Li, Hao; Tang, Chao; Wingreen, Ned S.

1998-03-01

In a statistical approach to protein structure analysis, Miyazawa and Jernigan (MJ) derived a 20× 20 matrix of inter-residue contact energies between different types of amino acids. Using the method of eigenvalue decomposition, we find that the MJ matrix can be accurately reconstructed from its first two principal component vectors as M_ij=C_0+C_1(q_i+q_j)+C2 qi q_j, with constant C's, and 20 q values associated with the 20 amino acids. This regularity is due to hydrophobic interactions and a force of demixing, the latter obeying Hildebrand's solubility theory of simple liquids.

Photoionization of the beryllium isoelectronic sequence: Relativistic and nonrelativistic R-matrix calculations

NASA Astrophysics Data System (ADS)

Chu, Wei-Chun

The photoionization of the beryllium-like isoelectronic series has been studied. The bound state wave functions of the target ions were built with CIV3 program. The relativistic Breit-Pauli R-matrix method was used to calculate the cross sections in the photon energy range between the ionization threshold and 1s24 f7/2 threshold for each ion. For the total cross sections of Be, B+, C+2, N+3, and O +4, our results match experiment well. The comparison between the present work and other theoretical works are also discussed. We show the comparison with our LS results as it indicates the importance of relativistic effects on different ions. In the analysis, the resonances converging to 1 s22lj and 1s 23lj were identified and characterized with quantum defects, energies and widths using the eigenphase sum methodology. We summarize the general appearance of resonances along the resonance series and along the isoelectronic sequence. Partial cross sections are also reported systematically along the sequence. All calculations were performed on the NERSC system. INDEX WORDS: Photoionization, R-matrix, Cross section, Beryllium-like ion, Resonance

Contact solution algorithms

NASA Technical Reports Server (NTRS)

Tielking, John T.

1989-01-01

Two algorithms for obtaining static contact solutions are described in this presentation. Although they were derived for contact problems involving specific structures (a tire and a solid rubber cylinder), they are sufficiently general to be applied to other shell-of-revolution and solid-body contact problems. The shell-of-revolution contact algorithm is a method of obtaining a point load influence coefficient matrix for the portion of shell surface that is expected to carry a contact load. If the shell is sufficiently linear with respect to contact loading, a single influence coefficient matrix can be used to obtain a good approximation of the contact pressure distribution. Otherwise, the matrix will be updated to reflect nonlinear load-deflection behavior. The solid-body contact algorithm utilizes a Lagrange multiplier to include the contact constraint in a potential energy functional. The solution is found by applying the principle of minimum potential energy. The Lagrange multiplier is identified as the contact load resultant for a specific deflection. At present, only frictionless contact solutions have been obtained with these algorithms. A sliding tread element has been developed to calculate friction shear force in the contact region of the rolling shell-of-revolution tire model.

Optoelectronics of inverted type-I CdS/CdSe core/crown quantum ring

NASA Astrophysics Data System (ADS)

Bose, Sumanta; Fan, Weijun; Zhang, Dao Hua

2017-10-01

Inverted type-I heterostructure core/crown quantum rings (QRs) are quantum-efficient luminophores, whose spectral characteristics are highly tunable. Here, we study the optoelectronic properties of type-I core/crown CdS/CdSe QRs in the zincblende phase—over contrasting lateral size and crown width. For this, we inspect their strain profiles, transition energies, transition matrix elements, spatial charge densities, electronic bandstructures, band-mixing probabilities, optical gain spectra, maximum optical gains, and differential optical gains. Our framework uses an effective-mass envelope function theory based on the 8-band k ṡ p method employing the valence force field model for calculating the atomic strain distributions. The gain calculations are based on the density-matrix equation and take into consideration the excitonic effects with intraband scattering. Variations in the QR lateral size and relative widths of core and crown (ergo the composition) affect their energy levels, band-mixing probabilities, optical transition matrix elements, emission wavelengths/intensities, etc. The optical gain of QRs is also strongly dimension and composition dependent with further dependency on the injection carrier density causing the band-filling effect. They also affect the maximum and differential gain at varying dimensions and compositions.

Time-dependent density-functional tight-binding method with the third-order expansion of electron density

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less

Time-dependent density-functional tight-binding method with the third-order expansion of electron density.

PubMed

Nishimoto, Yoshio

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.

Microscopically based energy density functionals for nuclei using the density matrix expansion. II. Full optimization and validation

NASA Astrophysics Data System (ADS)

Navarro Pérez, R.; Schunck, N.; Dyhdalo, A.; Furnstahl, R. J.; Bogner, S. K.

2018-05-01

Background: Energy density functional methods provide a generic framework to compute properties of atomic nuclei starting from models of nuclear potentials and the rules of quantum mechanics. Until now, the overwhelming majority of functionals have been constructed either from empirical nuclear potentials such as the Skyrme or Gogny forces, or from systematic gradient-like expansions in the spirit of the density functional theory for atoms. Purpose: We seek to obtain a usable form of the nuclear energy density functional that is rooted in the modern theory of nuclear forces. We thus consider a functional obtained from the density matrix expansion of local nuclear potentials from chiral effective field theory. We propose a parametrization of this functional carefully calibrated and validated on selected ground-state properties that is suitable for large-scale calculations of nuclear properties. Methods: Our energy functional comprises two main components. The first component is a non-local functional of the density and corresponds to the direct part (Hartree term) of the expectation value of local chiral potentials on a Slater determinant. Contributions to the mean field and the energy of this term are computed by expanding the spatial, finite-range components of the chiral potential onto Gaussian functions. The second component is a local functional of the density and is obtained by applying the density matrix expansion to the exchange part (Fock term) of the expectation value of the local chiral potential. We apply the UNEDF2 optimization protocol to determine the coupling constants of this energy functional. Results: We obtain a set of microscopically constrained functionals for local chiral potentials from leading order up to next-to-next-to-leading order with and without three-body forces and contributions from Δ excitations. These functionals are validated on the calculation of nuclear and neutron matter, nuclear mass tables, single-particle shell structure in closed-shell nuclei, and the fission barrier of 240Pu. Quantitatively, they perform noticeably better than the more phenomenological Skyrme functionals. Conclusions: The inclusion of higher-order terms in the chiral perturbation expansion seems to produce a systematic improvement in predicting nuclear binding energies while the impact on other observables is not really significant. This result is especially promising since all the fits have been performed at the single-reference level of the energy density functional approach, where important collective correlations such as center-of-mass correction, rotational correction, or zero-point vibrational energies have not been taken into account yet.

Computational study of the electronic spectra of the rare gas fluorohydrides HRgF (Rg = Ar, Kr, Xe, Rn)

NASA Astrophysics Data System (ADS)

van Hoeve, Miriam D.; Klobukowski, Mariusz

2018-03-01

Simulation of the electronic spectra of HRgF (Rg = Ar, Kr, Xe, Rn) was carried out using the time-dependent density functional method, with the CAMB3LYP functional and several basis sets augmented with even-tempered diffuse functions. A full spectral assignment for the HRgF systems was done. The effect of the rare gas matrix on the HRgF (Rg = Ar and Kr) spectra was investigated and it was found that the matrix blue-shifted the spectra. Scalar relativistic effects on the spectra were also studied and it was found that while the excitation energies of HArF and HKrF were insignificantly affected by relativistic effects, most of the excitation energies of HXeF and HRnF were red-shifted. Spin-orbit coupling was found to significantly affect excitation energies in HRnF. Analysis of performance of the model core potential basis set relative to all-electron (AE) basis sets showed that the former basis set increased computational efficiency and gave results similar to those obtained with the AE basis set.

Calibrations for charged particle tracking and measurements of w photoproduction with the GlueX detector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Staib, Michael

The GlueX experiment is a new experimental facility at Jefferson Lab in Newport News, VA. The experiment aims to map out the spectrum of hybrid mesons in the light quark sector. Measurements of the spin-density matrix elements in omega photoproduction are performed with a linear polarized photon beam on an unpolarized proton target, and presented in bins of Mandelstam t for beam energies of 8.4-9.0 GeV. The spin-density matrix elements are exclusively measured through two decays of the omega meson: omega -> pi^+ pi^- pi^0 and omega ->pi^0 gamma. A description of the experimental apparatus is presented. Several methods usedmore » in the calibration of the charged particle tracking system are described. These measurements greatly improve the world statistics in this energy range. These are the first results measured through the omega ->pi^0 gamma decay at this energy. Results are generally consistent with a theoretical model based on diffractive production with Pomeron and pseudoscalar exchange in the t-channel.« less

Multiconfiguration Molecular Mechanics Based on Combined Quantum Mechanical and Molecular Mechanical Calculations.

PubMed

Lin, Hai; Zhao, Yan; Tishchenko, Oksana; Truhlar, Donald G

2006-09-01

The multiconfiguration molecular mechanics (MCMM) method is a general algorithm for generating potential energy surfaces for chemical reactions by fitting high-level electronic structure data with the help of molecular mechanical (MM) potentials. It was previously developed as an extension of standard MM to reactive systems by inclusion of multidimensional resonance interactions between MM configurations corresponding to specific valence bonding patterns, with the resonance matrix element obtained from quantum mechanical (QM) electronic structure calculations. In particular, the resonance matrix element is obtained by multidimensional interpolation employing a finite number of geometries at which electronic-structure calculations of the energy, gradient, and Hessian are carried out. In this paper, we present a strategy for combining MCMM with hybrid quantum mechanical molecular mechanical (QM/MM) methods. In the new scheme, electronic-structure information for obtaining the resonance integral is obtained by means of hybrid QM/MM calculations instead of fully QM calculations. As such, the new strategy can be applied to the studies of very large reactive systems. The new MCMM scheme is tested for two hydrogen-transfer reactions. Very encouraging convergence is obtained for rate constants including tunneling, suggesting that the new MCMM method, called QM/MM-MCMM, is a very general, stable, and efficient procedure for generating potential energy surfaces for large reactive systems. The results are found to converge well with respect to the number of Hessians. The results are also compared to calculations in which the resonance integral data are obtained by pure QM, and this illustrates the sensitivity of reaction rate calculations to the treatment of the QM-MM border. For the smaller of the two systems, comparison is also made to direct dynamics calculations in which the potential energies are computed quantum mechanically on the fly.

Global Patch Matching

NASA Astrophysics Data System (ADS)

Huang, X.; Hu, K.; Ling, X.; Zhang, Y.; Lu, Z.; Zhou, G.

2017-09-01

This paper introduces a novel global patch matching method that focuses on how to remove fronto-parallel bias and obtain continuous smooth surfaces with assuming that the scenes covered by stereos are piecewise continuous. Firstly, simple linear iterative cluster method (SLIC) is used to segment the base image into a series of patches. Then, a global energy function, which consists of a data term and a smoothness term, is built on the patches. The data term is the second-order Taylor expansion of correlation coefficients, and the smoothness term is built by combing connectivity constraints and the coplanarity constraints are combined to construct the smoothness term. Finally, the global energy function can be built by combining the data term and the smoothness term. We rewrite the global energy function in a quadratic matrix function, and use least square methods to obtain the optimal solution. Experiments on Adirondack stereo and Motorcycle stereo of Middlebury benchmark show that the proposed method can remove fronto-parallel bias effectively, and produce continuous smooth surfaces.

Evaluation of Matrix9 silicon photomultiplier array for small-animal PET

PubMed Central

Du, Junwei; Schmall, Jeffrey P.; Yang, Yongfeng; Di, Kun; Roncali, Emilie; Mitchell, Gregory S.; Buckley, Steve; Jackson, Carl; Cherry, Simon R.

2015-01-01

Purpose: The MatrixSL-9-30035-OEM (Matrix9) from SensL is a large-area silicon photomultiplier (SiPM) photodetector module consisting of a 3 × 3 array of 4 × 4 element SiPM arrays (total of 144 SiPM pixels) and incorporates SensL’s front-end electronics board and coincidence board. Each SiPM pixel measures 3.16 × 3.16 mm2 and the total size of the detector head is 47.8 × 46.3 mm2. Using 8 × 8 polished LSO/LYSO arrays (pitch 1.5 mm) the performance of this detector system (SiPM array and readout electronics) was evaluated with a view for its eventual use in small-animal positron emission tomography (PET). Methods: Measurements of noise, signal, signal-to-noise ratio, energy resolution, flood histogram quality, timing resolution, and array trigger error were obtained at different bias voltages (28.0–32.5 V in 0.5 V intervals) and at different temperatures (5 °C–25 °C in 5 °C degree steps) to find the optimal operating conditions. Results: The best measured signal-to-noise ratio and flood histogram quality for 511 keV gamma photons were obtained at a bias voltage of 30.0 V and a temperature of 5 °C. The energy resolution and timing resolution under these conditions were 14.2% ± 0.1% and 4.2 ± 0.1 ns, respectively. The flood histograms show that all the crystals in the 1.5 mm pitch LSO array can be clearly identified and that smaller crystal pitches can also be resolved. Flood histogram quality was also calculated using different center of gravity based positioning algorithms. Improved and more robust results were achieved using the local 9 pixels for positioning along with an energy offset calibration. To evaluate the front-end detector readout, and multiplexing efficiency, an array trigger error metric is introduced and measured at different lower energy thresholds. Using a lower energy threshold greater than 150 keV effectively eliminates any mispositioning between SiPM arrays. Conclusions: In summary, the Matrix9 detector system can resolve high-resolution scintillator arrays common in small-animal PET with adequate energy resolution and timing resolution over a large detector area. The modular design of the Matrix9 detector allows it to be used as a building block for simple, low channel-count, yet high performance, small animal PET or PET/MRI systems. PMID:25652479

Evaluation of Matrix9 silicon photomultiplier array for small-animal PET

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, Junwei, E-mail: jwdu@ucdavis.edu; Schmall, Jeffrey P.; Yang, Yongfeng

Purpose: The MatrixSL-9-30035-OEM (Matrix9) from SensL is a large-area silicon photomultiplier (SiPM) photodetector module consisting of a 3 × 3 array of 4 × 4 element SiPM arrays (total of 144 SiPM pixels) and incorporates SensL’s front-end electronics board and coincidence board. Each SiPM pixel measures 3.16 × 3.16 mm{sup 2} and the total size of the detector head is 47.8 × 46.3 mm{sup 2}. Using 8 × 8 polished LSO/LYSO arrays (pitch 1.5 mm) the performance of this detector system (SiPM array and readout electronics) was evaluated with a view for its eventual use in small-animal positron emission tomographymore » (PET). Methods: Measurements of noise, signal, signal-to-noise ratio, energy resolution, flood histogram quality, timing resolution, and array trigger error were obtained at different bias voltages (28.0–32.5 V in 0.5 V intervals) and at different temperatures (5 °C–25 °C in 5 °C degree steps) to find the optimal operating conditions. Results: The best measured signal-to-noise ratio and flood histogram quality for 511 keV gamma photons were obtained at a bias voltage of 30.0 V and a temperature of 5 °C. The energy resolution and timing resolution under these conditions were 14.2% ± 0.1% and 4.2 ± 0.1 ns, respectively. The flood histograms show that all the crystals in the 1.5 mm pitch LSO array can be clearly identified and that smaller crystal pitches can also be resolved. Flood histogram quality was also calculated using different center of gravity based positioning algorithms. Improved and more robust results were achieved using the local 9 pixels for positioning along with an energy offset calibration. To evaluate the front-end detector readout, and multiplexing efficiency, an array trigger error metric is introduced and measured at different lower energy thresholds. Using a lower energy threshold greater than 150 keV effectively eliminates any mispositioning between SiPM arrays. Conclusions: In summary, the Matrix9 detector system can resolve high-resolution scintillator arrays common in small-animal PET with adequate energy resolution and timing resolution over a large detector area. The modular design of the Matrix9 detector allows it to be used as a building block for simple, low channel-count, yet high performance, small animal PET or PET/MRI systems.« less

Nanostructural Characteristics and Interfacial Properties of Polymer Fibers in Cement Matrix.

PubMed

Shalchy, Faezeh; Rahbar, Nima

2015-08-12

Concrete is the most used material in the world. It is also one of the most versatile yet complex materials that humans have used for construction. However, an important weakness of concrete (cement-based composites) is its low tensile properties. Therefore, over the past 30 years many studies were focused on improving its tensile properties using a variety of physical and chemical methods. One of the most successful attempts is to use polymer fibers in the structure of concrete to obtain a composite with high tensile strength and ductility. The advantages of polymer fiber as reinforcing material in concrete, both with regard to reducing environmental pollution and the positive effects on a country's economy, are beyond dispute. However, a thorough understanding of the mechanical behavior of fiber-reinforced concrete requires a knowledge of fiber/matrix interfaces at the nanoscale. In this study, a combination of atomistic simulations and experimental techniques has been used to study the nanostructure of fiber/matrix interfaces. A new model for calcium-silicate-hydrate (C-S-H)/fiber interfaces is also proposed on the basis of scanning electron microscopy (SEM) and energy-dispersive X-ray spectroscopy (EDX) analyses. Finally, the adhesion energy between the C-S-H gel and three different polymeric fibers (poly(vinyl alcohol), nylon-6, and polypropylene) were numerically studied at the atomistic level because adhesion plays a key role in the design of ductile fiber-reinforced composites. The mechanisms of adhesion as a function of the nanostructure of fiber/matrix interfaces are further studied and discussed. It is observed that the functional group in the structure of polymer macromolecule affects the adhesion energy primarily by changing the C/S ratio of the C-S-H at the interface and by absorbing additional positive ions in the C-S-H structure.

Time-dependent quantum transport: An efficient method based on Liouville-von-Neumann equation for single-electron density matrix

NASA Astrophysics Data System (ADS)

Xie, Hang; Jiang, Feng; Tian, Heng; Zheng, Xiao; Kwok, Yanho; Chen, Shuguang; Yam, ChiYung; Yan, YiJing; Chen, Guanhua

2012-07-01

Basing on our hierarchical equations of motion for time-dependent quantum transport [X. Zheng, G. H. Chen, Y. Mo, S. K. Koo, H. Tian, C. Y. Yam, and Y. J. Yan, J. Chem. Phys. 133, 114101 (2010), 10.1063/1.3475566], we develop an efficient and accurate numerical algorithm to solve the Liouville-von-Neumann equation. We solve the real-time evolution of the reduced single-electron density matrix at the tight-binding level. Calculations are carried out to simulate the transient current through a linear chain of atoms, with each represented by a single orbital. The self-energy matrix is expanded in terms of multiple Lorentzian functions, and the Fermi distribution function is evaluated via the Padè spectrum decomposition. This Lorentzian-Padè decomposition scheme is employed to simulate the transient current. With sufficient Lorentzian functions used to fit the self-energy matrices, we show that the lead spectral function and the dynamics response can be treated accurately. Compared to the conventional master equation approaches, our method is much more efficient as the computational time scales cubically with the system size and linearly with the simulation time. As a result, the simulations of the transient currents through systems containing up to one hundred of atoms have been carried out. As density functional theory is also an effective one-particle theory, the Lorentzian-Padè decomposition scheme developed here can be generalized for first-principles simulation of realistic systems.

Telescope for x ray and gamma ray studies in astrophysics

NASA Technical Reports Server (NTRS)

Weaver, W. D.; Desai, Upendra D.

1993-01-01

Imaging of x-rays has been achieved by various methods in astrophysics, nuclear physics, medicine, and material science. A new method for imaging x-ray and gamma-ray sources avoids the limitations of previously used imaging devices. Images are formed in optical wavelengths by using mirrors or lenses to reflect and refract the incoming photons. High energy x-ray and gamma-ray photons cannot be reflected except at grazing angles and pass through lenses without being refracted. Therefore, different methods must be used to image x-ray and gamma-ray sources. Techniques using total absorption, or shadow casting, can provide images in x-rays and gamma-rays. This new method uses a coder made of a pair of Fresnel zone plates and a detector consisting of a matrix of CsI scintillators and photodiodes. The Fresnel zone plates produce Moire patterns when illuminated by an off-axis source. These Moire patterns are deconvolved using a stepped sine wave fitting or an inverse Fourier transform. This type of coder provides the capability of an instantaneous image with sub-arcminute resolution while using a detector with only a coarse position-sensitivity. A matrix of the CsI/photodiode detector elements provides the necessary coarse position-sensitivity. The CsI/photodiode detector also allows good energy resolution. This imaging system provides advantages over previously used imaging devices in both performance and efficiency.

2DRMP: A suite of two-dimensional R-matrix propagation codes

NASA Astrophysics Data System (ADS)

Scott, N. S.; Scott, M. P.; Burke, P. G.; Stitt, T.; Faro-Maza, V.; Denis, C.; Maniopoulou, A.

2009-12-01

The R-matrix method has proved to be a remarkably stable, robust and efficient technique for solving the close-coupling equations that arise in electron and photon collisions with atoms, ions and molecules. During the last thirty-four years a series of related R-matrix program packages have been published periodically in CPC. These packages are primarily concerned with low-energy scattering where the incident energy is insufficient to ionise the target. In this paper we describe 2DRMP, a suite of two-dimensional R-matrix propagation programs aimed at creating virtual experiments on high performance and grid architectures to enable the study of electron scattering from H-like atoms and ions at intermediate energies. Program summaryProgram title: 2DRMP Catalogue identifier: AEEA_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEEA_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 196 717 No. of bytes in distributed program, including test data, etc.: 3 819 727 Distribution format: tar.gz Programming language: Fortran 95, MPI Computer: Tested on CRAY XT4 [1]; IBM eServer 575 [2]; Itanium II cluster [3] Operating system: Tested on UNICOS/lc [1]; IBM AIX [2]; Red Hat Linux Enterprise AS [3] Has the code been vectorised or parallelised?: Yes. 16 cores were used for small test run Classification: 2.4 External routines: BLAS, LAPACK, PBLAS, ScaLAPACK Subprograms used: ADAZ_v1_1 Nature of problem: 2DRMP is a suite of programs aimed at creating virtual experiments on high performance architectures to enable the study of electron scattering from H-like atoms and ions at intermediate energies. Solution method: Two-dimensional R-matrix propagation theory. The (r,r) space of the internal region is subdivided into a number of subregions. Local R-matrices are constructed within each subregion and used to propagate a global R-matrix, ℜ, across the internal region. On the boundary of the internal region ℜ is transformed onto the IERM target state basis. Thus, the two-dimensional R-matrix propagation technique transforms an intractable problem into a series of tractable problems enabling the internal region to be extended far beyond that which is possible with the standard one-sector codes. A distinctive feature of the method is that both electrons are treated identically and the R-matrix basis states are constructed to allow for both electrons to be in the continuum. The subregion size is flexible and can be adjusted to accommodate the number of cores available. Restrictions: The implementation is currently restricted to electron scattering from H-like atoms and ions. Additional comments: The programs have been designed to operate on serial computers and to exploit the distributed memory parallelism found on tightly coupled high performance clusters and supercomputers. 2DRMP has been systematically and comprehensively documented using ROBODoc [4] which is an API documentation tool that works by extracting specially formatted headers from the program source code and writing them to documentation files. Running time: The wall clock running time for the small test run using 16 cores and performed on [3] is as follows: bp (7 s); rint2 (34 s); newrd (32 s); diag (21 s); amps (11 s); prop (24 s). References:HECToR, CRAY XT4 running UNICOS/lc, http://www.hector.ac.uk/, accessed 22 July, 2009. HPCx, IBM eServer 575 running IBM AIX, http://www.hpcx.ac.uk/, accessed 22 July, 2009. HP Cluster, Itanium II cluster running Red Hat Linux Enterprise AS, Queen s University Belfast, http://www.qub.ac.uk/directorates/InformationServices/Research/HighPerformanceComputing/Services/Hardware/HPResearch/, accessed 22 July, 2009. Automating Software Documentation with ROBODoc, http://www.xs4all.nl/~rfsber/Robo/, accessed 22 July, 2009.

Modeling of trim panels in the energy finite element analysis

NASA Astrophysics Data System (ADS)

Moravaeji, Seyed-Javid

Modeling a trim panel is divided into finding the power exchange through two different paths: (i) the connection of the outer and inner panels (ii) through the layers directly. The vibrational power exchanged through the mounts is modeled as the connection of two parallel plates connected via a beam. Wave matrices representing plates and beams are derived separately; then a matrix method is proposed to solve for the wave amplitudes and hence the vibrational power exchange between the plates accordingly. A closed form formula for the case of connection of two identical plates is derived. For the power transmission loss directly through the layers, first transfer matrices representing layers made of different materials is considered. New matrices for a porous layer are derived. A method of finding the layered structure transfer matrix is proposed. It is concluded that in general a single isotropic layer cannot replace a structure accurately. Finally, on the basis of an equivalent transfer matrix, an optimization process for is proposed to replace the panel by a suitable set of layers.

Analytic regularization of uniform cubic B-spline deformation fields.

PubMed

Shackleford, James A; Yang, Qi; Lourenço, Ana M; Shusharina, Nadya; Kandasamy, Nagarajan; Sharp, Gregory C

2012-01-01

Image registration is inherently ill-posed, and lacks a unique solution. In the context of medical applications, it is desirable to avoid solutions that describe physically unsound deformations within the patient anatomy. Among the accepted methods of regularizing non-rigid image registration to provide solutions applicable to medical practice is the penalty of thin-plate bending energy. In this paper, we develop an exact, analytic method for computing the bending energy of a three-dimensional B-spline deformation field as a quadratic matrix operation on the spline coefficient values. Results presented on ten thoracic case studies indicate the analytic solution is between 61-1371x faster than a numerical central differencing solution.

A discrimination method for the detection of pneumonia using chest radiograph.

PubMed

Noor, Norliza Mohd; Rijal, Omar Mohd; Yunus, Ashari; Abu-Bakar, S A R

2010-03-01

This paper presents a statistical method for the detection of lobar pneumonia when using digitized chest X-ray films. Each region of interest was represented by a vector of wavelet texture measures which is then multiplied by the orthogonal matrix Q(2). The first two elements of the transformed vectors were shown to have a bivariate normal distribution. Misclassification probabilities were estimated using probability ellipsoids and discriminant functions. The result of this study recommends the detection of pneumonia by constructing probability ellipsoids or discriminant function using maximum energy and maximum column sum energy texture measures where misclassification probabilities were less than 0.15. 2009 Elsevier Ltd. All rights reserved.

A comparative study of methods for describing non-adiabatic coupling: diabatic representation of the 1Sigma +/1Pi HOH and HHO conical intersections

NASA Astrophysics Data System (ADS)

Dobbyn, Abigail J.; Knowles, Peter J.

A number of established techniques for obtaining diabatic electronic states in small molecules are critically compared for the example of the X and B states in the water molecule, which contribute to the two lowest-energy conical intersections. Integration of the coupling matrix elements and analysis of configuration mixing coefficients both produce reliable diabatic states globally. Methods relying on diagonalization of dipole moment and angular momentum operators are shown to fail in large regions of coordinate space. However, the use of transition angular momentum matrix elements involving the A state, which is degenerate with B at the conical intersections, is successful globally, provided that an appropriate choice of coordinates is made. Long range damping of non-adiabatic coupling to give correct asymptotic mixing angles also is investigated.

UB Matrix Implementation for Inelastic Neutron Scattering Experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lumsden, Mark D; Robertson, Lee; Yethiraj, Mohana

The UB matrix approach has been extended to handle inelastic neutron scattering experiments with differing k{sub i} and k{sub f}. We have considered the typical goniometer employed on triple-axis and time-of-flight spectrometers. Expressions are derived to allow for calculation of the UB matrix and for converting from observables to Q-energy space. In addition, we have developed appropriate modes for calculation of angles for a specified Q-energy position.

Conductance of two-dimensional waveguide in presence of the Rashba spin-orbit interaction

NASA Astrophysics Data System (ADS)

Liu, Duan-Yang; Xia, Jian-Bai

2018-04-01

By using the transfer matrix method, we investigated spin transport in some straight structures in presence of the Rashba spin-orbit interaction. It is proved that the interference of two spin states is the same as that in one-dimensional Datta-Das spin field-effect transistor. The conductance of these structures has been calculated. Conductance quantization is common in these waveguides when we change the Fermi energy and the width of the waveguide. Using a periodic system of quadrate stubs and changing the Fermi energy, a nearly square-wave conductance can be obtained in some regions of the Fermi energy.

Spectroscopic accuracy directly from quantum chemistry: application to ground and excited states of beryllium dimer.

PubMed

Sharma, Sandeep; Yanai, Takeshi; Booth, George H; Umrigar, C J; Chan, Garnet Kin-Lic

2014-03-14

We combine explicit correlation via the canonical transcorrelation approach with the density matrix renormalization group and initiator full configuration interaction quantum Monte Carlo methods to compute a near-exact beryllium dimer curve, without the use of composite methods. In particular, our direct density matrix renormalization group calculations produce a well-depth of D(e) = 931.2 cm(-1) which agrees very well with recent experimentally derived estimates D(e) = 929.7±2 cm(-1) [J. M. Merritt, V. E. Bondybey, and M. C. Heaven, Science 324, 1548 (2009)] and D(e) = 934.6 cm(-1) [K. Patkowski, V. Špirko, and K. Szalewicz, Science 326, 1382 (2009)], as well the best composite theoretical estimates, D(e) = 938±15 cm(-1) [K. Patkowski, R. Podeszwa, and K. Szalewicz, J. Phys. Chem. A 111, 12822 (2007)] and D(e) = 935.1±10 cm(-1) [J. Koput, Phys. Chem. Chem. Phys. 13, 20311 (2011)]. Our results suggest possible inaccuracies in the functional form of the potential used at shorter bond lengths to fit the experimental data [J. M. Merritt, V. E. Bondybey, and M. C. Heaven, Science 324, 1548 (2009)]. With the density matrix renormalization group we also compute near-exact vertical excitation energies at the equilibrium geometry. These provide non-trivial benchmarks for quantum chemical methods for excited states, and illustrate the surprisingly large error that remains for 1 ¹Σ(g)⁻ state with approximate multi-reference configuration interaction and equation-of-motion coupled cluster methods. Overall, we demonstrate that explicitly correlated density matrix renormalization group and initiator full configuration interaction quantum Monte Carlo methods allow us to fully converge to the basis set and correlation limit of the non-relativistic Schrödinger equation in small molecules.

The gas chromatographic determination of volatile fatty acids in wastewater samples: evaluation of experimental biases in direct injection method against thermal desorption method.

PubMed

Ullah, Md Ahsan; Kim, Ki-Hyun; Szulejko, Jan E; Cho, Jinwoo

2014-04-11

The production of short-chained volatile fatty acids (VFAs) by the anaerobic bacterial digestion of sewage (wastewater) affords an excellent opportunity to alternative greener viable bio-energy fuels (i.e., microbial fuel cell). VFAs in wastewater (sewage) samples are commonly quantified through direct injection (DI) into a gas chromatograph with a flame ionization detector (GC-FID). In this study, the reliability of VFA analysis by the DI-GC method has been examined against a thermal desorption (TD-GC) method. The results indicate that the VFA concentrations determined from an aliquot from each wastewater sample by the DI-GC method were generally underestimated, e.g., reductions of 7% (acetic acid) to 93.4% (hexanoic acid) relative to the TD-GC method. The observed differences between the two methods suggest the possibly important role of the matrix effect to give rise to the negative biases in DI-GC analysis. To further explore this possibility, an ancillary experiment was performed to examine bias patterns of three DI-GC approaches. For instance, the results of the standard addition (SA) method confirm the definite role of matrix effect when analyzing wastewater samples by DI-GC. More importantly, their biases tend to increase systematically with increasing molecular weight and decreasing VFA concentrations. As such, the use of DI-GC method, if applied for the analysis of samples with a complicated matrix, needs a thorough validation to improve the reliability in data acquisition. Copyright © 2014 Elsevier B.V. All rights reserved.

Excitation energies of dissociating H2: A problematic case for the adiabatic approximation of time-dependent density functional theory

NASA Astrophysics Data System (ADS)

Gritsenko, O. V.; van Gisbergen, S. J. A.; Görling, A.; Baerends, E. J.

2000-11-01

Time-dependent density functional theory (TDDFT) is applied for calculation of the excitation energies of the dissociating H2 molecule. The standard TDDFT method of adiabatic local density approximation (ALDA) totally fails to reproduce the potential curve for the lowest excited singlet 1Σu+ state of H2. Analysis of the eigenvalue problem for the excitation energies as well as direct derivation of the exchange-correlation (xc) kernel fxc(r,r',ω) shows that ALDA fails due to breakdown of its simple spatially local approximation for the kernel. The analysis indicates a complex structure of the function fxc(r,r',ω), which is revealed in a different behavior of the various matrix elements K1c,1cxc (between the highest occupied Kohn-Sham molecular orbital ψ1 and virtual MOs ψc) as a function of the bond distance R(H-H). The effect of nonlocality of fxc(r,r') is modeled by using different expressions for the corresponding matrix elements of different orbitals. Asymptotically corrected ALDA (ALDA-AC) expressions for the matrix elements K12,12xc(στ) are proposed, while for other matrix elements the standard ALDA expressions are retained. This approach provides substantial improvement over the standard ALDA. In particular, the ALDA-AC curve for the lowest singlet excitation qualitatively reproduces the shape of the exact curve. It displays a minimum and approaches a relatively large positive energy at large R(H-H). ALDA-AC also produces a substantial improvement for the calculated lowest triplet excitation, which is known to suffer from the triplet instability problem of the restricted KS ground state. Failure of the ALDA for the excitation energies is related to the failure of the local density as well as generalized gradient approximations to reproduce correctly the polarizability of dissociating H2. The expression for the response function χ is derived to show the origin of the field-counteracting term in the xc potential, which is lacking in the local density and generalized gradient approximations and which is required to obtain a correct polarizability.

Applications of fuzzy ranking methods to risk-management decisions

NASA Astrophysics Data System (ADS)

Mitchell, Harold A.; Carter, James C., III

1993-12-01

The Department of Energy is making significant improvements to its nuclear facilities as a result of more stringent regulation, internal audits, and recommendations from external review groups. A large backlog of upgrades has resulted. Currently, a prioritization method is being utilized which relies on a matrix of potential consequence and probability of occurrence. The attributes of the potential consequences considered include likelihood, exposure, public health and safety, environmental impact, site personnel safety, public relations, legal liability, and business loss. This paper describes an improved method which utilizes fuzzy multiple attribute decision methods to rank proposed improvement projects.

Consistent force field modeling of matrix isolated molecules. V. Minimum energy path potential to the conformer conversion of 1,2-difluoroethane: Ar 364, ab initio calculation of electric multipole moments and electric polarization contribution to the conversion barrier

NASA Astrophysics Data System (ADS)

Gunde, R.; Ha, T.-K.; Günthard, H. H.

1990-08-01

In this paper results of consistent force field modeling (CFF) of the potential function to conversion of the gauche (g) to the trans (t) conformer of 1,2-difluoroethane (DFE) isolated in an argon matrix will be reported. Starting point are locally stable configurations gDFE:Ar 364 (defect GH1) and tDFE:Ar 364 (TH1) obtained in previous work from CFF modeling of a cube shaped Ar 364 fragment containing one DFE molecule in its center. Using the dihedral angle of DFE as an independent parameter the minimum energy path of the conversion process gDFE:Ar 364→tDFE:Ar 364 will be determined by CFF energy minimization. Determination of the minimum energy path is found to require large numbers of energy minimization steps and to lead to a rather complicated motion of the molecule with respect to the crystal fragment. Surprisingly the molecule-matrix interactions lead to a reduction of the g-t barrier by ≈500 cal/mol and to a stabilization of the trans species by ≈500 cal/mol. This finding is a consequence of a delicate interplay of matrix-molecule and matrix-matrix interactions. Calculation of the electric polarization energy (induced dipole-first-order polarization approximation) is based on extended ab initio calculations of dipole and quadrupole moments and a bond polarizability estimate of the first-order polarizability of DFE as a function of the internal rotation angle, on Fourier expansion of multipole components and use of symmetry for reduction of the order of the linear system defining the (self-consistent) induced dipole moments of all Ar atoms. Electric polarization is found to alter the potential function of the conversion process in a profound way: the g-t barrier and the t-g energy difference are increased to ≈3000 cal/mol and to ≈1500 cal/mol respectively (≈2500 and ≈530 cal/mol respectively for free DFE). Further applications of the technique developed in this work to related problems of matrix isolated molecules, e.g., vibrational matrix shifts will be discussed.

Rapid fusion method for the determination of refractory thorium and uranium isotopes in soil samples

DOE PAGES

Maxwell, Sherrod L.; Hutchison, Jay B.; McAlister, Daniel R.

2015-02-14

Recently, approximately 80% of participating laboratories failed to accurately determine uranium isotopes in soil samples in the U.S Department of Energy Mixed Analyte Performance Evaluation Program (MAPEP) Session 30, due to incomplete dissolution of refractory particles in the samples. Failing laboratories employed acid dissolution methods, including hydrofluoric acid, to recover uranium from the soil matrix. The failures illustrate the importance of rugged soil dissolution methods for the accurate measurement of analytes in the sample matrix. A new rapid fusion method has been developed by the Savannah River National Laboratory (SRNL) to prepare 1-2 g soil sample aliquots very quickly, withmore » total dissolution of refractory particles. Soil samples are fused with sodium hydroxide at 600 ºC in zirconium crucibles to enable complete dissolution of the sample. Uranium and thorium are separated on stacked TEVA and TRU extraction chromatographic resin cartridges, prior to isotopic measurements by alpha spectrometry on cerium fluoride microprecipitation sources. Plutonium can also be separated and measured using this method. Batches of 12 samples can be prepared for measurement in <5 hours.« less

Thermal analysis on Al7075/Al2O3 metal matrix composites fabricated by stir casting process

NASA Astrophysics Data System (ADS)

Jacob, S.; Shajin, S.; Gnanavel, C.

2017-03-01

Metal matrix Composites (MMC’s) have evoked a keen interest in recent times for various applications in aerospace, renewable energy and automotive industries due to their superior strength, low cost, easy availability and high temperature resistance [1]. The crack and propagation occurs in conventional materials without any appreciable indication in a short span. Hence composite materials are preferred nowadays to overcome this problem [2]. The process of metal matrix composites (MMC’s) is to unite the enviable attributes of metals and ceramics. The Stir casting method is used for producing aluminium metal matrix composites (AMC’s). A key challenge of the process is to spread the ceramic particles to achieve a defect free microstructure [2]. By carefully selecting stir casting processing specification, such as stirring time, temperature of the melt and blade angle, the desired microstructure can be obtained. The focus of this work is to develop a high strength particulate strengthen aluminium metal matrix composites, and Al7075 was selected which can offer high strength without much disturbing ductility of metal matrix [4]. The composites will be examined using standard metallurgical and mechanical tests. The cast composites are analysed to Laser flash analysis (LFA) to determine Thermal conductivity [5]. Also changes in microstructure are determined by using SEM analysis.

Detection of Amine Impurity and Quality Assessment of the MALDI Matrix α-Cyano-4-Hydroxy-Cinnamic Acid for Peptide Analysis in the amol Range

NASA Astrophysics Data System (ADS)

Rechthaler, Justyna; Pittenauer, Ernst; Schaub, Tanner M.; Allmaier, Günter

2013-05-01

We have studied sample preparation conditions to increase the reproducibility of positive UV-MALDI-TOF mass spectrometry of peptides in the amol range. By evaluating several α-cyano-4-hydroxy-cinnamic acid (CHCA) matrix batches and preparation protocols, it became apparent that two factors have a large influence on the reproducibility and the quality of the generated peptide mass spectra: (1) the selection of the CHCA matrix, which allows the most sensitive measurements and an easier finding of the "sweet spots," and (2) the amount of the sample volume deposited onto the thin crystalline matrix layer. We have studied in detail the influence of a contaminant, coming from commercial CHCA matrix batches, on sensitivity of generated peptide mass spectra in the amol as well as fmol range of a tryptic peptide mixture. The structure of the contaminant, N, N-dimethylbutyl amine, was determined by applying MALDI-FT-ICR mass spectrometry experiments for elemental composition and MALDI high energy CID experiments utilizing a tandem mass spectrometer (TOF/RTOF). A recrystallization of heavily contaminated CHCA batches that reduces or eliminates the determined impurity is described. Furthermore, a fast and reliable method for the assessment of CHCA matrix batches prior to tryptic peptide MALDI mass spectrometric analyses is presented.

Dynamic shear-lag model for understanding the role of matrix in energy dissipation in fiber-reinforced composites.

PubMed

Liu, Junjie; Zhu, Wenqing; Yu, Zhongliang; Wei, Xiaoding

2018-07-01

Lightweight and high impact performance composite design is a big challenge for scientists and engineers. Inspired from well-known biological materials, e.g., the bones, spider silk, and claws of mantis shrimp, artificial composites have been synthesized for engineering applications. Presently, the design of ballistic resistant composites mainly emphasizes the utilization of light and high-strength fibers, whereas the contribution from matrix materials receives less attention. However, recent ballistic experiments on fiber-reinforced composites challenge our common sense. The use of matrix with "low-grade" properties enhances effectively the impact performance. In this study, we establish a dynamic shear-lag model to explore the energy dissipation through viscous matrix materials in fiber-reinforced composites and the associations of energy dissipation characteristics with the properties and geometries of constituents. The model suggests that an enhancement in energy dissipation before the material integrity is lost can be achieved by tuning the shear modulus and viscosity of a matrix. Furthermore, our model implies that an appropriately designed staggered microstructure, adopted by many natural composites, can repeatedly activate the energy dissipation process and thus improve dramatically the impact performance. This model demonstrates the role of matrix in energy dissipation, and stimulates new advanced material design concepts for ballistic applications. Biological composites found in nature often possess exceptional mechanical properties that man-made materials haven't be able to achieve. For example, it is predicted that a pencil thick spider silk thread can stop a flying Boeing airplane. Here, by proposing a dynamic shear-lag model, we investigate the relationships between the impact performance of a composite with the dimensions and properties of its constituents. Our analysis suggests that the impact performance of fiber-reinforced composites could improve surprisingly with "low-grade" matrix materials, and discontinuities (often regarded as "defects") may play an important role in energy dissipation. Counter-intuitive as it may seem, our work helps understanding the secrets of the outstanding dynamic properties of some biological materials, and inspire novel ideas for man-made composites. Copyright © 2018 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Low energy electron-molecule scattering using the R-matrix method

NASA Astrophysics Data System (ADS)

Gorfinkiel, Jimena

2014-10-01

The study of electron-molecule collisions continues to attract significant interest stimulated, in no small part, by the need for collisional data to model a number of physical environments and applied processes (e.g. the modelling of focused electron beam induced deposition and the description of the interaction of radiation with biological matter). This need for electron scattering data (cross sections but also information on the temporary negative ions, TNI, that can be formed) has motivated the renewed development of theoretical methodology and their computational implementation. I will present the latest developments in the study of low energy electron scattering from molecules and molecular clusters using the R-matrix method. Recent calculations on electron collisions with biologically relevant molecules have shed light on the formation of core-excited TNI these larger targets. The picture that emerges is much more complex than previously thought. I will discuss some examples as well as current and future developments of the methodology and software in order to provide more accurate collisional data (in particular cross sections) for bigger targets. In collaboration with Zdenek Masin, The Open University. This work was partially supported by EPSRC.

An adhesive contact mechanics formulation based on atomistically induced surface traction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fan, Houfu; Ren, Bo; Li, Shaofan, E-mail: shaofan@berkeley.edu

2015-12-01

In this work, we have developed a novel multiscale computational contact formulation based on the generalized Derjuguin approximation for continua that are characterized by atomistically enriched constitutive relations in order to study macroscopic interaction between arbitrarily shaped deformable continua. The proposed adhesive contact formulation makes use of the microscopic interaction forces between individual particles in the interacting bodies. In particular, the double-layer volume integral describing the contact interaction (energy, force vector, matrix) is converted into a double-layer surface integral through a mathematically consistent approach that employs the divergence theorem and a special partitioning technique. The proposed contact model is formulatedmore » in the nonlinear continuum mechanics framework and implemented using the standard finite element method. With no large penalty constant, the stiffness matrix of the system will in general be well-conditioned, which is of great significance for quasi-static analysis. Three numerical examples are presented to illustrate the capability of the proposed method. Results indicate that with the same mesh configuration, the finite element computation based on the surface integral approach is faster and more accurate than the volume integral based approach. In addition, the proposed approach is energy preserving even in a very long dynamic simulation.« less

Polyethylene composites containing a phase change material having a C14 straight chain hydrocarbon

DOEpatents

Salyer, Ival O.

1987-01-01

A composite useful in thermal energy storage, said composite being formed of a polyethylene matrix having a straight chain alkyl hydrocarbon incorporated therein, said polyethylene being crosslinked to such a degree that said polyethylene matrix is form stable and said polyethylene matrix is capable of absorbing at least 10% by weight of said straight chain alkyl hydrocarbon; the composite is useful in forming pellets or sheets having thermal energy storage characteristics.

Multireference quantum chemistry through a joint density matrix renormalization group and canonical transformation theory.

PubMed

Yanai, Takeshi; Kurashige, Yuki; Neuscamman, Eric; Chan, Garnet Kin-Lic

2010-01-14

We describe the joint application of the density matrix renormalization group and canonical transformation theory to multireference quantum chemistry. The density matrix renormalization group provides the ability to describe static correlation in large active spaces, while the canonical transformation theory provides a high-order description of the dynamic correlation effects. We demonstrate the joint theory in two benchmark systems designed to test the dynamic and static correlation capabilities of the methods, namely, (i) total correlation energies in long polyenes and (ii) the isomerization curve of the [Cu(2)O(2)](2+) core. The largest complete active spaces and atomic orbital basis sets treated by the joint DMRG-CT theory in these systems correspond to a (24e,24o) active space and 268 atomic orbitals in the polyenes and a (28e,32o) active space and 278 atomic orbitals in [Cu(2)O(2)](2+).

Compressive and shear buckling analysis of metal matrix composite sandwich panels under different thermal environments

NASA Technical Reports Server (NTRS)

Ko, William L.; Jackson, Raymond H.

1993-01-01

Combined inplane compressive and shear buckling analysis was conducted on flat rectangular sandwich panels using the Raleigh-Ritz minimum energy method with a consideration of transverse shear effect of the sandwich core. The sandwich panels were fabricated with titanium honeycomb core and laminated metal matrix composite face sheets. The results show that slightly slender (along unidirectional compressive loading axis) rectangular sandwich panels have the most desirable stiffness-to-weight ratios for aerospace structural applications; the degradation of buckling strength of sandwich panels with rising temperature is faster in shear than in compression; and the fiber orientation of the face sheets for optimum combined-load buckling strength of sandwich panels is a strong function of both loading condition and panel aspect ratio. Under the same specific weight and panel aspect ratio, a sandwich panel with metal matrix composite face sheets has much higher buckling strength than one having monolithic face sheets.

Effects of lattice morphology upon reaction dynamics in matrix-isolated systems

NASA Astrophysics Data System (ADS)

Raff, Lionel M.

1992-11-01

The dynamics of the cis-d2-ethylene+F2 addition reaction and the subsequent reaction dynamics of the products isolated in vapor-deposited Ar matrices at 12 K are investigated using trajectory methods that incorporate nonstatistical sampling to enhance the reaction probabilities. The matrix-isolated cis-d2-ethylene+F2 system is generated using a combination of Monte Carlo, damped trajectory, and volume contraction methods. Transport effects of the bulk are simulated using the velocity reset procedure developed by Riley et al. [J. Chem. Phys. 88, 5934 (1988)]. The potential-energy hypersurface is the same as that employed in our previous investigations of the matrix-isolated, decomposition dynamics of 1,2-difluoroethane-d4 and the bimolecular cis-d2-ethylene+F2 system in face-centered-cubic (fcc) matrices [J. Chem. Phys. 93, 3160 (1990); 95, 8901 (1991)]. It is found that matrices generated by these methods are amorphous with numerous vacancies and other imperfections. On the average, there are approximately three vacancies about each lattice atom compared to the fcc crystal. The calculated lattice density is about 82% that for a bulk fcc Ar solid. Computed radial distribution functions resemble those expected for a liquid which exhibits some short-range order. The imperfections of the lattice remain even after substantial annealing at 50 K. The calculated energy relaxation rate to the lattice phonon modes in these amorphous matrices is about a factor of 4 less than that for a close-packed fcc lattice. The 1,2-difluoroethane product is formed primarily via an αβ-addition process, as is the case for fcc matrices. However, the prominence of this pathway is greatly reduced. The major process leading to a fluoroethylene elimination product in amorphous matrices involves an atomic addition mechanism. Such a reaction path accounts for 94% of the elimination reactions. The probability of internal rotation about the C■C double bond in the fluoroethylene product is increased fivefold over that for fcc lattices. The calculated stabilization/elimination product ratio, the cis/trans ratios of fluoroethylene products, and the HF/DF elimination ratio are all found to be in fair to good accord with the reported experimental data. It is concluded that accurate simulation of matrix-isolation experiments requires a matrix model that properly represents the lattice structure present in the experiments.

Linear algebraic methods applied to intensity modulated radiation therapy.

PubMed

Crooks, S M; Xing, L

2001-10-01

Methods of linear algebra are applied to the choice of beam weights for intensity modulated radiation therapy (IMRT). It is shown that the physical interpretation of the beam weights, target homogeneity and ratios of deposited energy can be given in terms of matrix equations and quadratic forms. The methodology of fitting using linear algebra as applied to IMRT is examined. Results are compared with IMRT plans that had been prepared using a commercially available IMRT treatment planning system and previously delivered to cancer patients.

Molecular Structure and Free Energy Landscape for Electron Transport in the Deca-Heme Cytochrome MtrF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Breuer, Marian; Zarzycki, Piotr P.; Shi, Liang

2012-12-01

The free energy profile for electron flow through the bacterial deca-heme cytochrome MtrF has been computed using thermodynamic integration and classical molecular dynamics. The extensive calculations on two versions of the structure help validate the method and results, because differences in the profiles can be related to differences in the charged amino acids local to specific heme groups. First estimates of reorganization free energies λ yield a range consistent with expectations for partially solvent exposed cofactors, and reveal an activation energy range surmountable for electron flow. Future work will aim at increasing the accuracy of λ with polarizable force fieldmore » dynamics and quantum chemical energy gap calculations, as well as quantum chemical computation of electronic coupling matrix elements.« less

Improvement of non-destructive fissile mass assays in α low-level waste drums: A matrix correction method based on neutron capture gamma-rays and a neutron generator

NASA Astrophysics Data System (ADS)

Jallu, F.; Loche, F.

2008-08-01

Within the framework of radioactive waste control, non-destructive assay (NDA) methods may be employed. The active neutron interrogation (ANI) method is now well-known and effective in quantifying low α-activity fissile masses (mainly 235U, 239Pu, 241Pu) with low densities, i.e. less than about 0.4, in radioactive waste drums of volumes up to 200 l. The PROMpt Epithermal and THErmal interrogation Experiment (PROMETHEE [F. Jallu, A. Mariani, C. Passard, A.-C. Raoux, H. Toubon, Alpha low level waste control: improvement of the PROMETHEE 6 assay system performances. Nucl. Technol. 153 (January) (2006); C. Passard, A. Mariani, F. Jallu, J. Romeyer-Dherber, H. Recroix, M. Rodriguez, J. Loridon, C. Denis, PROMETHEE: an alpha low level waste assay system using passive and active neutron measurement methods. Nucl. Technol. 140 (December) (2002) 303-314]) based on ANI has been under development since 1996 to reach the incinerating α low level waste (LLW) criterion of about 50 Bq[α] per gram of crude waste (≈50 μg Pu) in 118 l drums on the date the drums are conditioned. Difficulties arise when dealing with matrices containing neutron energy moderators such as H and neutron absorbents such as Cl. These components may have a great influence on the fissile mass deduced from the neutron signal measured by ANI. For example, the calibration coefficient measured in a 118 l drum containing a cellulose matrix (density d = 0.144 g cm -3) may be 50 times higher than that obtained in a poly-vinyl-chloride matrix ( d = 0.253 g cm -3). Without any information on the matrix, the fissile mass is often overestimated due to safety procedures and by considering the most disadvantageous calibration coefficient corresponding to the most absorbing and moderating calibration matrix. The work discussed in this paper was performed at the CEA Nuclear Measurement Laboratory in France. It concerns the development of a matrix effect correction method, which consists in identifying and quantifying the matrix components by using prompt gamma-rays following neutron capture. The method aims to refine the value of the adequate calibration coefficient used for ANI analysis. This paper presents the final results obtained for 118 l waste drums with low α-activity and low density. This paper discusses the experimental and modelling studies and describes the development of correction abacuses based on gamma-ray spectrometry signals.

Excited states in polydiacetylene chains: A density matrix renormalization group study

NASA Astrophysics Data System (ADS)

Barcza, Gergely; Barford, William; Gebhard, Florian; Legeza, Örs

2013-06-01

We study theoretically polydiacetylene chains diluted in their monomer matrix. We employ the density matrix renormalization group method on finite chains to calculate the ground state and low-lying excitations of the corresponding Peierls-Hubbard-Ohno Hamiltonian which is characterized by the electron transfer amplitude t0 between nearest neighbors, by the electron-phonon coupling constant α, by the Hubbard interaction U, and by the long-range interaction V. We treat the lattice relaxation in the adiabatic limit, i.e., we calculate the polaronic lattice distortions for each excited state. Using chains with up to 102 lattice sites, we can safely perform the extrapolation to the thermodynamic limit for the ground-state energy and conformation, the single-particle gap, and the energies of the singlet exciton, the triplet ground state, and the optical excitation of the triplet ground state. The corresponding gaps are known with high precision from experiments. We determine a coherent parameter set (t0*=2.4eV,α*=3.4eV/Å,U*=6eV,V*=3eV) from a fit of the experimental gap energies to the theoretical values which we obtain for 81 parameter points in the four-dimensional search space (t0,α,U,V). We identify dark in-gap states in the singlet and triplet sectors as seen in experiments. Using a fairly stiff spring constant, the length of our unit cell is about 1% larger than its experimental value.

Analysis of transition-metal acetylacetonate complexes by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

PubMed

Wyatt, Mark F; Havard, Stephen; Stein, Bridget K; Brenton, A Gareth

2008-01-01

Transition-metal acetylacetonate complexes of the form Metal(acac)(2), where Metal = Fe(II), Co(II), Ni(II), Cu(II), and Zn(II), and Metal(acac)(3), where Metal = V(III), Cr(III), Mn(III), Fe(III), and Co(III), were investigated by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS). The data was acquired using the aprotic, electron transfer matrix, 2-[(2E)-3-(4-tert-butylphenyl)-2-methylprop-2-enylidene]malononitrile (DCTB), and the observation of positive radical ions is shown clearly to depend on the metal element and the oxidation state it occupies. The ionization energy of DCTB was calculated to be 8.08 eV by density functional theory methods, which is notably lower than the experimental value, but within the range of other computational values. This value is very close to those of the analytes, so the existing electron transfer mechanism which is based on the ionization energies of the matrix and analyte, cannot be used predictively. Similarly, the data neither proves nor disproves the validity of the existing electron transfer ionization mechanism, with respect to metal coordination complexes without strong chromophores. In this case, periodic trends may be more useful in explaining the observed species and the prediction of species from sets of similar complexes. The addition of a sodium salt benefits the MALDI-TOFMS characterization of certain compounds studied, but the benefit of the addition of ammonium or silver salts is negligible.

Positron collisions with acetylene calculated using the R-matrix with pseudo-states method

NASA Astrophysics Data System (ADS)

Zhang, Rui; Galiatsatos, Pavlos G.; Tennyson, Jonathan

2011-10-01

Eigenphase sums, total cross sections and differential cross sections are calculated for low-energy collisions of positrons with C2H2. The calculations demonstrate that the use of appropriate pseudo-state expansions very significantly improves the representation of this process giving both realistic eigenphases and cross sections. Differential cross sections are strongly forward peaked in agreement with the measurements. These calculations are computationally very demanding; even with improved procedures for matrix diagonalization, fully converged calculations are too expensive with current computer resources. Nonetheless, the calculations show clear evidence for the formation of a virtual state but no indication that acetylene actually binds a positron at its equilibrium geometry.

Blending Determinism with Evolutionary Computing: Applications to the Calculation of the Molecular Electronic Structure of Polythiophene.

PubMed

Sarkar, Kanchan; Sharma, Rahul; Bhattacharyya, S P

2010-03-09

A density matrix based soft-computing solution to the quantum mechanical problem of computing the molecular electronic structure of fairly long polythiophene (PT) chains is proposed. The soft-computing solution is based on a "random mutation hill climbing" scheme which is modified by blending it with a deterministic method based on a trial single-particle density matrix [P((0))(R)] for the guessed structural parameters (R), which is allowed to evolve under a unitary transformation generated by the Hamiltonian H(R). The Hamiltonian itself changes as the geometrical parameters (R) defining the polythiophene chain undergo mutation. The scale (λ) of the transformation is optimized by making the energy [E(λ)] stationary with respect to λ. The robustness and the performance levels of variants of the algorithm are analyzed and compared with those of other derivative free methods. The method is further tested successfully with optimization of the geometry of bipolaron-doped long PT chains.

H∞ memory feedback control with input limitation minimization for offshore jacket platform stabilization

NASA Astrophysics Data System (ADS)

Yang, Jia Sheng

2018-06-01

In this paper, we investigate a H∞ memory controller with input limitation minimization (HMCIM) for offshore jacket platforms stabilization. The main objective of this study is to reduce the control consumption as well as protect the actuator when satisfying the requirement of the system performance. First, we introduce a dynamic model of offshore platform with low order main modes based on mode reduction method in numerical analysis. Then, based on H∞ control theory and matrix inequality techniques, we develop a novel H∞ memory controller with input limitation. Furthermore, a non-convex optimization model to minimize input energy consumption is proposed. Since it is difficult to solve this non-convex optimization model by optimization algorithm, we use a relaxation method with matrix operations to transform this non-convex optimization model to be a convex optimization model. Thus, it could be solved by a standard convex optimization solver in MATLAB or CPLEX. Finally, several numerical examples are given to validate the proposed models and methods.

Fracture resistance measurement of advanced ceramics at elevated-temperatures using Chevron-notched specimens and other novel techniques

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jenkins, M.G.

1995-12-31

The quasi-static fracture behavior of advanced ceramics was assessed in the temperature range of 20{degrees} to 1400{degrees}C. Chevron-notched, three-point flexure specimens and a laser-based CMOD measurement systems were used in testing. Types of materials characterized included monolithic ceramics (SiC, Si{sub 3}N{sub 4}, MgAl{sub 2}O{sub 4}), self-reinforced monoliths (acicular-grained Si{sub 3}N{sub 4}, acicular grained mullite), and ceramic matrix composites (SiC whisker/Al{sub 2}O{sub 3} matrix, TiB{sub 2} particulate/SiC matrix, SiC fibre/CVI SiC matrix, Al{sub 2}O{sub 3} fibre/CVI SiC matrix). Fracture resistance behaviour of the materials was quantified as three distinct regimes of the fracture histories. At crack initiation, the apparent fracture toughnessmore » was evaluated as the critical stress intensity factor, K{sub IC}. During stable crack propagation, the crack growth resistance was characterized by the instantaneous strain energy release rate, G{sub R} using a compliance method assuming linear-elastic unloading to calculate the effective crack lengths. At final fracture, the complete fracture process was quantified using the work-of-fracture, WOF, which can be equated to the fracture surface energy for linearelastic materials. Results indicate that the chevron-notched, three-point flexure specimen facilitates the study of fracture behavior in a wide range of brittle and quasi-brittle materials at elevated temperatures. The unique features of the chevron geometry, which are automatic, in-situ crack initiation and inherent stable crack growth, are crucial to the successful evaluation of the fracture tests.« less

A high performance porous flat-plate solar collector

NASA Technical Reports Server (NTRS)

Lansing, F. L.; Clarke, V.; Reynolds, R.

1979-01-01

A solar collector employing a porous matrix as a solar absorber and heat exchanger is presented and its application in solar air heaters is discussed. The collector is composed of a metallic matrix with a porous surface which acts as a large set of cavity radiators; cold air flows through the matrix plate and exchanges heat with the thermally stratified layers of the matrix. A steady-state thermal analysis of the collector is used to determine collector temperature distributions for the cases of an opaque surface matrix with total absorption of solar energy at the surface, and a diathermanous matrix with successive solar energy absorption at each depth. The theoretical performance of the porous flat plate collector is shown to exceed greatly that of a solid flat plate collector using air as the working medium for any given set of operational conditions. An experimental collector constructed using commercially available, low cost steel wool as the matrix has been found to have thermal efficiencies from 73 to 86%.

Förster-type energy transfer as a probe for changes in local fluctuations of the protein matrix.

PubMed

Somogyi, B; Matkó, J; Papp, S; Hevessy, J; Welch, G R; Damjanovich, S

1984-07-17

Much evidence, on both theoretical and experimental sides, indicates the importance of local fluctuations (in energy levels, conformational substates, etc.) of the macromolecular matrix in the biological activity of proteins. We describe here a novel application of the Förster-type energy-transfer process capable of monitoring changes both in local fluctuations and in conformational states of macromolecules. A new energy-transfer parameter, f, is defined as an average transfer efficiency, [E], normalized by the actual average quantum efficiency of the donor fluorescence, [phi D]. A simple oscillator model (for a one donor-one acceptor system) is presented to show the sensitivity of this parameter to changes in amplitudes of local fluctuations. The different modes of averaging (static, dynamic, and intermediate cases) occurring for a given value of the average transfer rate, [kt], and the experimental requirements as well as limitations of the method are also discussed. The experimental tests were performed on the ribonuclease T1-pyridoxamine 5'-phosphate conjugate (a one donor-one acceptor system) by studying the change of the f parameter with temperature, an environmental parameter expectedly perturbing local fluctuations of proteins. The parameter f increased with increasing temperature as expected on the basis of the oscillator model, suggesting that it really reflects changes of fluctuation amplitudes (significant changes in the orientation factor, k2, as well as in the spectral properties of the fluorophores can be excluded by anisotropy measurements and spectral investigations). Possibilities of the general applicability of the method are also discussed.

Investigating the Use of the Intel Xeon Phi for Event Reconstruction

NASA Astrophysics Data System (ADS)

Sherman, Keegan; Gilfoyle, Gerard

2014-09-01

The physics goal of Jefferson Lab is to understand how quarks and gluons form nuclei and it is being upgraded to a higher, 12-GeV beam energy. The new CLAS12 detector in Hall B will collect 5-10 terabytes of data per day and will require considerable computing resources. We are investigating tools, such as the Intel Xeon Phi, to speed up the event reconstruction. The Kalman Filter is one of the methods being studied. It is a linear algebra algorithm that estimates the state of a system by combining existing data and predictions of those measurements. The tools required to apply this technique (i.e. matrix multiplication, matrix inversion) are being written using C++ intrinsics for Intel's Xeon Phi Coprocessor, which uses the Many Integrated Cores (MIC) architecture. The Intel MIC is a new high-performance chip that connects to a host machine through the PCIe bus and is built to run highly vectorized and parallelized code making it a well-suited device for applications such as the Kalman Filter. Our tests of the MIC optimized algorithms needed for the filter show significant increases in speed. For example, matrix multiplication of 5x5 matrices on the MIC was able to run up to 69 times faster than the host core. The physics goal of Jefferson Lab is to understand how quarks and gluons form nuclei and it is being upgraded to a higher, 12-GeV beam energy. The new CLAS12 detector in Hall B will collect 5-10 terabytes of data per day and will require considerable computing resources. We are investigating tools, such as the Intel Xeon Phi, to speed up the event reconstruction. The Kalman Filter is one of the methods being studied. It is a linear algebra algorithm that estimates the state of a system by combining existing data and predictions of those measurements. The tools required to apply this technique (i.e. matrix multiplication, matrix inversion) are being written using C++ intrinsics for Intel's Xeon Phi Coprocessor, which uses the Many Integrated Cores (MIC) architecture. The Intel MIC is a new high-performance chip that connects to a host machine through the PCIe bus and is built to run highly vectorized and parallelized code making it a well-suited device for applications such as the Kalman Filter. Our tests of the MIC optimized algorithms needed for the filter show significant increases in speed. For example, matrix multiplication of 5x5 matrices on the MIC was able to run up to 69 times faster than the host core. Work supported by the University of Richmond and the US Department of Energy.

Polypropylene/Polyaniline Nanofiber/Reduced Graphene Oxide Nanocomposite with Enhanced Electrical, Dielectric, and Ferroelectric Properties for a High Energy Density Capacitor.

PubMed

Cho, Sunghun; Kim, Minkyu; Lee, Jun Seop; Jang, Jyongsik

2015-10-14

This work demonstrates a ternary nanocomposite system, composed of polypropylene (PP), redoped PANI (r-PANI) nanofibers, and reduced graphene oxides (RGOs), for use in a high energy density capacitor. r-PANI nanofibers were fabricated by the combination methods of chemical oxidation polymerization and secondary doping processes, resulting in higher conductivity (σ≈156 S cm(-1)) than that of the primarily doped PANI nanofibers (σ≈16 S cm(-1)). RGO sheets with high electron mobility and thermal stability can enhance the conductivity of r-PANI/RGO (σ≈220 S cm(-1)) and thermal stability of PP matrix. These findings could be extended to combine the advantages of r-PANI nanofibers and RGO sheets for developing an efficient means of preparing PP/r-PANI/RGO nanocomposite. When the r-PANI/RGO cofillers (10 vol %) were added to PP matrix, the resulting PP/r-PANI/RGO nanocomposite exhibited high dielectric constant (ε'≈51.8) with small dielectric loss (ε″≈9.3×10(-3)). Furthermore, the PP/r-PANI/RGO nanocomposite was used for an energy-harvesting device, which demonstrated high energy density (Ue≈12.6 J cm(-3)) and breakdown strength (E≈5.86×10(3) kV cm(-1)).

Flexible nano-GFO/PVDF piezoelectric-polymer nano-composite films for mechanical energy harvesting

NASA Astrophysics Data System (ADS)

Mishra, Monali; Roy, Amritendu; Dash, Sukalyan; Mukherjee, Somdutta

2018-03-01

Owing to the persistent quest of renewable energy technology, piezoelectric energy harvesters are gathering considerable research interest due to their potential in driving microelectronic devices with small power requirement. Electrical energy (milli to microwatt range) is generated from mechanical counterparts such as vibrations of machines, human motion, flowing water etc. based on the principles of piezoelectricity. Flexible high piezoelectric constant (d33) ceramic/polymer composites are crucial components for fabricating these energy harvesters. The polymer composites composed of gallium ferrite nanoparticles and polyvinylidene fluoride (PVDF) as the matrix have been synthesized by solvent casting method. First, 8 wt. % PVDF was dissolved in DMF and then different compositions of GaFeO3 or GFO (10, 20, 30 wt. %) (with respect to PVDF only) nanocomposites were synthesized. The phase of the synthesized nanocomposites were studied by X- Ray diffraction which shows that with the increase in the GFO concentration, the intensity of diffraction peaks of PVDF steadily decreased and GFO peaks became increasingly sharp. As the concentration of GFO increases in the PVDF polymer matrix, band gap is also increased albeit to a small extent. The maximum measured output voltage and current during mechanical pressing and releasing conditions were found to be ~ 3.5 volt and 4 nA, respectively in 30 wt % GFO-PVDF composite, comparable to the available literature.

The finite scaling for S = 1 XXZ chains with uniaxial single-ion-type anisotropy

NASA Astrophysics Data System (ADS)

Wang, Honglei; Xiong, Xingliang

2014-03-01

The scaling behavior of criticality for spin-1 XXZ chains with uniaxial single-ion-type anisotropy is investigated by employing the infinite matrix product state representation with the infinite time evolving block decimation method. At criticality, the accuracy of the ground state of a system is limited by the truncation dimension χ of the local Hilbert space. We present four evidences for the scaling of the entanglement entropy, the largest eigenvalue of the Schmidt decomposition, the correlation length, and the connection between the actual correlation length ξ and the energy. The result shows that the finite scalings are governed by the central charge of the critical system. Also, it demonstrates that the infinite time evolving block decimation algorithm by the infinite matrix product state representation can be a quite accurate method to simulate the critical properties at criticality.

On the use of the generalized SPRT method in the equivalent hard sphere approximation for nuclear data evaluation

NASA Astrophysics Data System (ADS)

Noguere, Gilles; Archier, Pascal; Bouland, Olivier; Capote, Roberto; Jean, Cyrille De Saint; Kopecky, Stefan; Schillebeeckx, Peter; Sirakov, Ivan; Tamagno, Pierre

2017-09-01

A consistent description of the neutron cross sections from thermal energy up to the MeV region is challenging. One of the first steps consists in optimizing the optical model parameters using average resonance parameters, such as the neutron strength functions. They can be derived from a statistical analysis of the resolved resonance parameters, or calculated with the generalized form of the SPRT method by using scattering matrix elements provided by optical model calculations. One of the difficulties is to establish the contributions of the direct and compound nucleus reactions. This problem was solved by using a slightly modified average R-Matrix formula with an equivalent hard sphere radius deduced from the phase shift originating from the potential. The performances of the proposed formalism are illustrated with results obtained for the 238U+n nuclear systems.

Reconstructing Space- and Energy-Dependent Exciton Generation in Solution-Processed Inverted Organic Solar Cells.

PubMed

Wang, Yuheng; Zhang, Yajie; Lu, Guanghao; Feng, Xiaoshan; Xiao, Tong; Xie, Jing; Liu, Xiaoyan; Ji, Jiahui; Wei, Zhixiang; Bu, Laju

2018-04-25

Photon absorption-induced exciton generation plays an important role in determining the photovoltaic properties of donor/acceptor organic solar cells with an inverted architecture. However, the reconstruction of light harvesting and thus exciton generation at different locations within organic inverted device are still not well resolved. Here, we investigate the film depth-dependent light absorption spectra in a small molecule donor/acceptor film. Including depth-dependent spectra into an optical transfer matrix method allows us to reconstruct both film depth- and energy-dependent exciton generation profiles, using which short-circuit current and external quantum efficiency of the inverted device are simulated and compared with the experimental measurements. The film depth-dependent spectroscopy, from which we are able to simultaneously reconstruct light harvesting profile, depth-dependent composition distribution, and vertical energy level variations, provides insights into photovoltaic process. In combination with appropriate material processing methods and device architecture, the method proposed in this work will help optimizing film depth-dependent optical/electronic properties for high-performance solar cells.

Apparatus and method for identification of matrix materials in which transuranic elements are embedded using thermal neutron capture gamma-ray emission

DOEpatents

Close, D.A.; Franks, L.A.; Kocimski, S.M.

1984-08-16

An invention is described that enables the quantitative simultaneous identification of the matrix materials in which fertile and fissile nuclides are embedded to be made along with the quantitative assay of the fertile and fissile materials. The invention also enables corrections for any absorption of neutrons by the matrix materials and by the measurement apparatus by the measurement of the prompt and delayed neutron flux emerging from a sample after the sample is interrogated by simultaneously applied neutrons and gamma radiation. High energy electrons are directed at a first target to produce gamma radiation. A second target receives the resulting pulsed gamma radiation and produces neutrons from the interaction with the gamma radiation. These neutrons are slowed by a moderator surrounding the sample and bathe the sample uniformly, generating second gamma radiation in the interaction. The gamma radiation is then resolved and quantitatively detected, providing a spectroscopic signature of the constituent elements contained in the matrix and in the materials within the vicinity of the sample. (LEW)

Fabrication and Characterization of Plasma-Sprayed Carbon-Fiber-Reinforced Aluminum Composites

NASA Astrophysics Data System (ADS)

Xiong, Jiang-tao; Zhang, Hao; Peng, Yu; Li, Jing-long; Zhang, Fu-sheng

2018-04-01

Carbon fiber ( C f)/Al specimens were fabricated by plasma-spraying aluminum powder on unidirectional carbon fiber bundles (CFBs) layer by layer, followed by a densification heat treatment process. The microstructure and chemical composition of the C f/Al composites were examined by scanning electron microscopy and energy-dispersive spectrometry. The CFBs were completely enveloped by aluminum matrix, and the peripheral regions of the CFBs were wetted by aluminum. In the wetted region, no significant Al4C3 reaction layer was found at the interface between the carbon fibers and aluminum matrix. The mechanical properties of the C f/Al specimens were evaluated. When the carbon fiber volume fraction (CFVF) was 9.2%, the ultimate tensile strength (UTS) of the C f/Al composites reached 138.3 MPa with elongation of 4.7%, 2.2 times the UTS of the Al matrix (i.e., 63 MPa). This strength ratio (between the UTS of C f/Al and the Al matrix) is higher than for most C f/Al composites fabricated by the commonly used method of liquid-based processing at the same CFVF level.

Matrix isolation as a tool for studying interstellar chemical reactions

NASA Technical Reports Server (NTRS)

Ball, David W.; Ortman, Bryan J.; Hauge, Robert H.; Margrave, John L.

1989-01-01

Since the identification of the OH radical as an interstellar species, over 50 molecular species were identified as interstellar denizens. While identification of new species appears straightforward, an explanation for their mechanisms of formation is not. Most astronomers concede that large bodies like interstellar dust grains are necessary for adsorption of molecules and their energies of reactions, but many of the mechanistic steps are unknown and speculative. It is proposed that data from matrix isolation experiments involving the reactions of refractory materials (especially C, Si, and Fe atoms and clusters) with small molecules (mainly H2, H2O, CO, CO2) are particularly applicable to explaining mechanistic details of likely interstellar chemical reactions. In many cases, matrix isolation techniques are the sole method of studying such reactions; also in many cases, complexations and bond rearrangements yield molecules never before observed. The study of these reactions thus provides a logical basis for the mechanisms of interstellar reactions. A list of reactions is presented that would simulate interstellar chemical reactions. These reactions were studied using FTIR-matrix isolation techniques.

Fine structure transitions in Fe XIV

NASA Astrophysics Data System (ADS)

Nahar, Sultana N.

2013-07-01

Results are reported for Fe XIV energy levels and transitions obtained from the ab initio relativistic Breit-Pauli R-matrix (BPRM) method. BPRM method developed under the Iron Project is capable of calculating very large number of fine structure energy levels and corresponding transitions. However, unlike in the atomic structure calculations, where levels are identified spectroscopically based on the leading percentage contributions of configurations, BPRM is incapable of such identification of the levels and hence the transitions. The main reason for it is that the percentage contributions can not be determined exactly from the large number of channels in the R-matrix space. The present report describes an identification method that uses considerations of quantum defects of channels, contributions of channel from outer regions, Hund's rule, and angular momenta algebra for addition and completeness of fine structure components. The present calculations are carried out using a close coupling wave function expansion that included 26 core excitations from configurations 2s22p63s2, 2s22p63s3p,2s22p63p2,2s22p63s3d, and 2s22p63p3d. A total of 1002 fine structure levels with n ⩽ 10, l⩽9, and 0.5 ⩽J⩽ 9.5 with even and odd parities and the corresponding 130,520 electric dipole allowed (E1) fine structure transitions, a most complete set for astrophysical modelings of spectral analysis and opacities, is presented. Large number of new energy levels are found and identified. The energies agree very well, mostly in less than 1% with the highest being 1.9%, with the 68 observed fine structure levels. While the high lying levels may have some uncertainty, an overall accuracy of energy levels should be within 10%. BPRM transitions have been benchmarked with the existing most accurate calculated transition probabilities with very good agreement for most cases. Based on the accuracy of the method and comparisons, most of the transitions can be rated with A (⩽10%) to C (⩽30%).

Micromechanics Modeling of Composites Subjected to Multiaxial Progressive Damage in the Constituents

NASA Technical Reports Server (NTRS)

Bednarcyk, Brett A.; Aboudi, Jacob; Amold, Steven M.

2010-01-01

The high-fidelity generalized method of cells composite micromechanics model is extended to include constituent-scale progressive damage via a proposed damage model. The damage model assumes that all material nonlinearity is due to damage in the form of reduced stiffness, and it uses six scalar damage variables (three for tension and three for compression) to track the damage. Damage strains are introduced that account for interaction among the strain components and that also allow the development of the damage evolution equations based on the constituent material uniaxial stress strain response. Local final-failure criteria are also proposed based on mode-specific strain energy release rates and total dissipated strain energy. The coupled micromechanics-damage model described herein is applied to a unidirectional E-glass/epoxy composite and a proprietary polymer matrix composite. Results illustrate the capability of the coupled model to capture the vastly different character of the monolithic (neat) resin matrix and the composite in response to far-field tension, compression, and shear loading.

Topical report to Morgantown Energy Technology Center for the interfacial coatings for ceramic-matrix composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1997-01-09

This report summarizes the task conducted to examine various activities on interface development for ceramic-matrix composites (CMCs) intended for high-temperature applications. While several articles have been published on the subject of CMC interfaces, the purpose of this report is to describe the various ongoing efforts on interface concepts, material selection, and issues related to processing methods employed for developing interface coatings. The most exciting and new development in the field is the discovery of monazite as a potential interface material for mullite- and alumina-based composites. Monazite offers two critical properties to the CMC system; a weakly bonded layer due tomore » its non-wetting behavior and chemical compatibility with both alumina and mullite up to very high temperatures (> 1,600 C). A description of the Department of Energy-related activities and some thoughts on processing issues, interface testing, and effects of processing on fiber strength are given.« less

Cormack Research Project: Glasgow University

NASA Technical Reports Server (NTRS)

Skinner, Susan; Ryan, James M.

1998-01-01

The aim of this project was to investigate and improve upon existing methods of analysing data from COMITEL on the Gamma Ray Observatory for neutrons emitted during solar flares. In particular, a strategy for placing confidence intervals on neutron energy distributions, due to uncertainties on the response matrix has been developed. We have also been able to demonstrate the superior performance of one of a range of possible statistical regularization strategies. A method of generating likely models of neutron energy distributions has also been developed as a tool to this end. The project involved solving an inverse problem with noise being added to the data in various ways. To achieve this pre-existing C code was used to run Fortran subroutines which performed statistical regularization on the data.

Fem Formulation of Heat Transfer in Cylindrical Porous Medium

NASA Astrophysics Data System (ADS)

Azeem; Khaleed, H. M. T.; Soudagar, Manzoor Elahi M.

2017-08-01

Heat transfer in porous medium can be derived from the fundamental laws of flow in porous region ass given by Henry Darcy. The fluid flow and energy transport inside the porous medium can be described with the help of momentum and energy equations. The heat transfer in cylindrical porous medium differs from its counterpart in radial and axial coordinates. The present work is focused to discuss the finite element formulation of heat transfer in cylindrical porous medium. The basic partial differential equations are derived using Darcy law which is the converted into a set of algebraic equations with the help of finite element method. The resulting equations are solved by matrix method for two solution variables involved in the coupled equations.

Spin formalism and applications to new physics searches

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haber, H.E.

1994-12-01

An introduction to spin techniques in particle physics is given. Among the topics covered are: helicity formalism and its applications to the decay and scattering of spin-1/2 and spin-1 particles, techniques for evaluating helicity amplitudes (including projection operator methods and the spinor helicity method), and density matrix techniques. The utility of polarization and spin correlations for untangling new physics beyond the Standard Model at future colliders such as the LHC and a high energy e{sup +}e{sup {minus}} linear collider is then considered. A number of detailed examples are explored including the search for low-energy supersymmetry, a non-minimal Higgs boson sector,more » and new gauge bosons beyond the W{sup {+-}} and Z.« less

Significantly improved dielectric performances of nanocomposites via loading two-dimensional core-shell structure Bi2Te3@SiO2 nanosheets

NASA Astrophysics Data System (ADS)

Chen, Jianwen; Wang, Xiucai; Yu, Xinmei; Fan, Yun; Duan, Zhikui; Jiang, Yewen; Yang, Faquan; Zhou, Yuexia

2018-07-01

Polymer/semiconductor-insulator nanocomposites can display high dielectric constants with a relatively low dissipation factor under low electric fields, and thus seem to promising for high energy density capacitors. Here, a novel nanocomposite films is developed by loading two-dimensional (2D) core-shell structure Bi2Te3@SiO2 nanosheets in the poly (vinylidene fluoride-hexafluoro propylene) (P(VDF-HFP)) polymer matrix. The 2D Bi2Te3 nanosheets were prepared through simple microwave-assisted method. The experimental results suggesting that the SiO2 shell layer between the fillers and polymer matrix could effectively improve the dielectric constant, dielectric loss, AC conductivity, and breakdown strength of composites films. The composite films load with 10 vol.% 2D Bi2Te3@SiO2 nanosheets exhibits a high dielectric constant of 70.3 at 1 kHz and relatively low dielectric loss of 0.058 at 1 kHz. The finite element simulation of electric field and electric current density distribution revealed that the SiO2 shell layer between the fillers and polymer matrix could effectively improve the energy loss, local electric field strength, and breakdown strength of composite films. Therefore, this work will provide a promising route to achieve high-performance capacitors.

Structure of the Odd-Odd Nucleus {sup 188}Re

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balodis, M.; Berzins, J.; Simonova, L.

2009-01-28

Thermal neutron capture gamma-ray spectra for {sup 187}Re(n,{gamma}){sup 188}Re reaction were measured. Singles and coincidence spectra were detected in order to develop the level scheme. The evaluation is in progress, of which the first results are obtained from the analysis of coincidence spectra, allowing to check the level scheme below 500 keV excitation energy. Seven low-energy negative parity bands are developed in order to find better energies for rotational levels. With a good confidence, a few positive parity bands are developed as well. Rotor plus two quasiparticle model calculations, employing effective matrix element method are performed for the system ofmore » six negative parity rotational bands.« less

The dependence of the tunneling characteristic on the electronic energy bands and the carrier’s states of Graphene superlattice

NASA Astrophysics Data System (ADS)

Yang, C. H.; Shen, G. Z.; Ao, Z. M.; Xu, Y. W.

2016-09-01

Using the transfer matrix method, the carrier tunneling properties in graphene superlattice generated by the Thue-Morse sequence and Kolakoski sequence are investigated. The positions and strength of the transmission can be modulated by the barrier structures, the incident energy and angle, the height and width of the potential. These carriers tunneling characteristic can be understood from the energy band structures in the corresponding superlattice systems and the carrier’s states in well/barriers. The transmission peaks above the critical incident angle rely on the carrier’s resonance in the well regions. The structural diversity can modulate the electronic and transport properties, thus expanding its applications.

10 CFR Appendix J1 to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Automatic and Semi-Automatic Clothes...

Code of Federal Regulations, 2014 CFR

2014-01-01

... clothes washer design can achieve spin speeds in the 500g range. When this matrix is repeated 3 times, a...) or an equivalent extractor with same basket design (i.e. diameter, length, volume, and hole... materially inaccurate comparative data, field testing may be appropriate for establishing an acceptable test...

Novel Modulation Method for Multidirectional Matrix Converter

PubMed Central

Misron, Norhisam; Aris, Ishak Bin; Yamada, Hiroaki

2014-01-01

This study presents a new modulation method for multidirectional matrix converter (MDMC), based on the direct duty ratio pulse width modulation (DDPWM). In this study, a new structure of MDMC has been proposed to control the power flow direction through the stand-alone battery based system and hybrid vehicle. The modulation method acts based on the average voltage over one switching period concept. Therefore, in order to determine the duty ratio for each switch, the instantaneous input voltages are captured and compared with triangular waveform continuously. By selecting the proper switching pattern and changing the slope of the carriers, the sinusoidal input current can be synthesized with high power factor and desired output voltage. The proposed system increases the discharging time of the battery by injecting the power to the system from the generator and battery at the same time. Thus, it makes the battery life longer and saves more energy. This paper also derived necessary equation for proposed modulation method as well as detail of analysis and modulation algorithm. The theoretical and modulation concepts presented have been verified in MATLAB simulation. PMID:25298969

Biophotonic applications of eigenchannels in a scattering medium (Conference Presentation)

NASA Astrophysics Data System (ADS)

Kim, Moonseok; Choi, Wonjun; Choi, Youngwoon; Yoon, Changhyeong; Choi, Wonshik

2016-03-01

When waves travel through disordered media such as ground glass and skin tissues, they are scattered multiple times. Most of the incoming energy bounces back at the superficial layers and only a small fraction can penetrate deep inside. This has been a limiting factor for the working depth of various optical techniques. We present a systematic method to enhance wave penetration to the scattering media. Specifically, we measured the reflection matrix of a disordered medium with wide angular coverage for each orthogonal polarization states. From the reflection matrix, we identified reflection eigenchannels of the medium, and shaped the incident wave into the reflection eigenchannel with smallest eigenvalue, which we call anti-reflection mode. This makes reflectance reduced and wave penetration increased as a result of the energy conservation. We demonstrated transmission enhancement by more than a factor of 3 by the coupling of the incident waves to the anti-reflection modes. Based on the uneven distribution of eigenvalues of reflection eigenchannels, we further developed an iterative feedback control method for finding and coupling light to anti-reflection modes. Since this adaptive control method can keep up with sample perturbation, it promotes the applicability of exploiting reflection eigenchannels. Our approach of delivering light deep into the scattering media will contribute to enhancing the sensitivity of detecting objects hidden under scattering layers, which is universal problem ranging from geology to life science.

Application of vacuum stability test to determine thermal decomposition kinetics of nitramines bonded by polyurethane matrix

NASA Astrophysics Data System (ADS)

Elbeih, Ahmed; Abd-Elghany, Mohamed; Elshenawy, Tamer

2017-03-01

Vacuum stability test (VST) is mainly used to study compatibility and stability of energetic materials. In this work, VST has been investigated to study thermal decomposition kinetics of four cyclic nitramines, 1,3,5-trinitro-1,3,5-triazinane (RDX) and 1,3,5,7-tetranitro-1,3,5,7-tetrazocane (HMX), cis-1,3,4,6-tetranitrooctahydroimidazo-[4,5-d]imidazole (BCHMX), 2,4,6,8,10,12-hexanitro-2,4,6,8,10,12-hexaazaisowurtzitane (ε-HNIW, CL-20), bonded by polyurethane matrix based on hydroxyl terminated polybutadiene (HTPB). Model fitting and model free (isoconversional) methods have been applied to determine the decomposition kinetics from VST results. For comparison, the decomposition kinetics were determined isothermally by ignition delay technique and non-isothermally by Advanced Kinetics and Technology Solution (AKTS) software. The activation energies for thermolysis obtained by isoconversional method based on VST technique of RDX/HTPB, HMX/HTPB, BCHMX/HTPB and CL20/HTPB were 157.1, 203.1, 190.0 and 176.8 kJ mol-1 respectively. Model fitting method proved that the mechanism of thermal decomposition of BCHMX/HTPB is controlled by the nucleation model while all the other studied PBXs are controlled by the diffusion models. A linear relationship between the ignition temperatures and the activation energies was observed. BCHMX/HTPB is interesting new PBX in the research stage.

Second-order perturbation theory with a density matrix renormalization group self-consistent field reference function: theory and application to the study of chromium dimer.

PubMed

Kurashige, Yuki; Yanai, Takeshi

2011-09-07

We present a second-order perturbation theory based on a density matrix renormalization group self-consistent field (DMRG-SCF) reference function. The method reproduces the solution of the complete active space with second-order perturbation theory (CASPT2) when the DMRG reference function is represented by a sufficiently large number of renormalized many-body basis, thereby being named DMRG-CASPT2 method. The DMRG-SCF is able to describe non-dynamical correlation with large active space that is insurmountable to the conventional CASSCF method, while the second-order perturbation theory provides an efficient description of dynamical correlation effects. The capability of our implementation is demonstrated for an application to the potential energy curve of the chromium dimer, which is one of the most demanding multireference systems that require best electronic structure treatment for non-dynamical and dynamical correlation as well as large basis sets. The DMRG-CASPT2/cc-pwCV5Z calculations were performed with a large (3d double-shell) active space consisting of 28 orbitals. Our approach using large-size DMRG reference addressed the problems of why the dissociation energy is largely overestimated by CASPT2 with the small active space consisting of 12 orbitals (3d4s), and also is oversensitive to the choice of the zeroth-order Hamiltonian. © 2011 American Institute of Physics

Comparisons of Damage Evolution between 2D C/SiC and SiC/SiC Ceramic-Matrix Composites under Tension-Tension Cyclic Fatigue Loading at Room and Elevated Temperatures

PubMed Central

Li, Longbiao

2016-01-01

In this paper, comparisons of damage evolution between 2D C/SiC and SiC/SiC ceramic-matrix composites (CMCs) under tension–tension cyclic fatigue loading at room and elevated temperatures have been investigated. Fatigue hysteresis loops models considering multiple matrix cracking modes in 2D CMCs have been developed based on the damage mechanism of fiber sliding relative to the matrix in the interface debonded region. The relationships between the fatigue hysteresis loops, fatigue hysteresis dissipated energy, fatigue peak stress, matrix multiple cracking modes, and interface shear stress have been established. The effects of fiber volume fraction, fatigue peak stress and matrix cracking mode proportion on fatigue hysteresis dissipated energy and interface debonding and sliding have been analyzed. The experimental fatigue hysteresis dissipated energy of 2D C/SiC and SiC/SiC composites at room temperature, 550 °C, 800 °C, and 1100 °C in air, and 1200 °C in vacuum corresponding to different fatigue peak stresses and cycle numbers have been analyzed. The interface shear stress degradation rate has been obtained through comparing the experimental fatigue hysteresis dissipated energy with theoretical values. Fatigue damage evolution in C/SiC and SiC/SiC composites has been compared using damage parameters of fatigue hysteresis dissipated energy and interface shear stress degradation rate. It was found that the interface shear stress degradation rate increases at elevated temperature in air compared with that at room temperature, decreases with increasing loading frequency at room temperature, and increases with increasing fatigue peak stress at room and elevated temperatures. PMID:28773966

Free energy calculations: an efficient adaptive biasing potential method.

PubMed

Dickson, Bradley M; Legoll, Frédéric; Lelièvre, Tony; Stoltz, Gabriel; Fleurat-Lessard, Paul

2010-05-06

We develop an efficient sampling and free energy calculation technique within the adaptive biasing potential (ABP) framework. By mollifying the density of states we obtain an approximate free energy and an adaptive bias potential that is computed directly from the population along the coordinates of the free energy. Because of the mollifier, the bias potential is "nonlocal", and its gradient admits a simple analytic expression. A single observation of the reaction coordinate can thus be used to update the approximate free energy at every point within a neighborhood of the observation. This greatly reduces the equilibration time of the adaptive bias potential. This approximation introduces two parameters: strength of mollification and the zero of energy of the bias potential. While we observe that the approximate free energy is a very good estimate of the actual free energy for a large range of mollification strength, we demonstrate that the errors associated with the mollification may be removed via deconvolution. The zero of energy of the bias potential, which is easy to choose, influences the speed of convergence but not the limiting accuracy. This method is simple to apply to free energy or mean force computation in multiple dimensions and does not involve second derivatives of the reaction coordinates, matrix manipulations nor on-the-fly adaptation of parameters. For the alanine dipeptide test case, the new method is found to gain as much as a factor of 10 in efficiency as compared to two basic implementations of the adaptive biasing force methods, and it is shown to be as efficient as well-tempered metadynamics with the postprocess deconvolution giving a clear advantage to the mollified density of states method.

Development of a radiographic method for measuring the discrete spectrum of the electron beam from a plasma focus device

NASA Astrophysics Data System (ADS)

Shamsian, Neda; Bidabadi, Babak Shirani; Pirjamadi, Hosein

2017-07-01

An indirect method is proposed for measuring the relative energy spectrum of the pulsed electron beam of a plasma focus device. The Bremsstrahlung x-ray, generated by the collision of electrons against the anode surface, was measured behind lead filters with various thicknesses using a radiographic film system. A matrix equation was considered in order to explain the relation between the x-ray dose and the spectral amplitudes of the electron beam. The electron spectrum of the device was measured at 0.6 mbar argon and 22 kV charging voltage, in four discrete energy intervals extending up to 500 keV. The results of the experiments show that most of the electrons are emitted in the 125-375 keV energy range and the spectral amplitude becomes negligible beyond 375 keV.

Charge transfer and ionization in collisions of Si3+ with H from low to high energy

NASA Astrophysics Data System (ADS)

Wang, J. G.; He, B.; Ning, Y.; Liu, C. L.; Yan, J.; Stancil, P. C.; Schultz, D. R.

2006-11-01

Charge transfer processes due to collisions of ground state Si3+(3sS1) ions with atomic hydrogen are investigated using the quantum-mechanical molecular-orbital close-coupling (MOCC) and classical-trajectory Monte Carlo (CTMC) methods. The MOCC calculations utilize ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained from Herrero [J. Phys. B 29, 5583 (1996)] which were calculated with a full configuration-interaction method. Total and state-selective single-electron capture cross sections are obtained for collision energies from 0.01eV/u to 1MeV/u . Total and state-selective rate coefficients are also presented for temperatures from 2×103K to 107K . Comparison with existing data reveals that the total CTMC cross sections are in good agreement with the experimental measurements at the higher considered energies and that previous Landau-Zener calculations underestimate the total rate coefficients by a factor of up to two. The CTMC calculations of target ionization are presented for high energies.

Density functional theory for molecular and periodic systems using density fitting and continuous fast multipole method: Analytical gradients.

PubMed

Łazarski, Roman; Burow, Asbjörn Manfred; Grajciar, Lukáš; Sierka, Marek

2016-10-30

A full implementation of analytical energy gradients for molecular and periodic systems is reported in the TURBOMOLE program package within the framework of Kohn-Sham density functional theory using Gaussian-type orbitals as basis functions. Its key component is a combination of density fitting (DF) approximation and continuous fast multipole method (CFMM) that allows for an efficient calculation of the Coulomb energy gradient. For exchange-correlation part the hierarchical numerical integration scheme (Burow and Sierka, Journal of Chemical Theory and Computation 2011, 7, 3097) is extended to energy gradients. Computational efficiency and asymptotic O(N) scaling behavior of the implementation is demonstrated for various molecular and periodic model systems, with the largest unit cell of hematite containing 640 atoms and 19,072 basis functions. The overall computational effort of energy gradient is comparable to that of the Kohn-Sham matrix formation. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

A texture-component Avrami model for predicting recrystallization textures, kinetics and grain size

NASA Astrophysics Data System (ADS)

Raabe, Dierk

2007-03-01

The study presents an analytical model for predicting crystallographic textures and the final grain size during primary static recrystallization of metals using texture components. The kinetics is formulated as a matrix variant of the Johnson-Mehl-Avrami-Kolmogorov equation. The matrix form is required since the kinetic and crystallographic evolution of the microstructure is described in terms of a limited set of growing (recrystallizing) and swept (deformed) texture components. The number of components required (5-10) defines the order of the matrix since the kinetic coupling occurs between all recrystallizing and all deformed components. Each such couple is characterized by corresponding values for the nucleation energy and grain boundary mobility. The values of these parameters can be obtained by analytical or numerical coarse graining according to a renormalization scheme which replaces many individual grains which grow via recrystallization in a deformed texture component by a single equivalent recrystallization texture component or by fitting to experimental data. Each deformed component is further characterized by an average stored deformation energy. Each element of the kinetic matrix, reflecting one of the possible couplings between a deformed and a recrystallizing texture component, is then derived in each time step by a set of two differential equations. The first equation describes the thermally activated nucleation and growth processes for the expanded (free) volume for a particular couple of a deformed and a recrystallizing texture component and the second equation is used for calculating the constrained (real) volume for that couple which corrects the free volume for those portions of the deformation component which were already swept. The new method is particularly developed for the fast and physically based process simulation of recrystallization textures with respect to processing. The present paper introduces the method and applies it to the primary recrystallization of low carbon steels.

Consensus of satellite cluster flight using an energy-matching optimal control method

NASA Astrophysics Data System (ADS)

Luo, Jianjun; Zhou, Liang; Zhang, Bo

2017-11-01

This paper presents an optimal control method for consensus of satellite cluster flight under a kind of energy matching condition. Firstly, the relation between energy matching and satellite periodically bounded relative motion is analyzed, and the satellite energy matching principle is applied to configure the initial conditions. Then, period-delayed errors are adopted as state variables to establish the period-delayed errors dynamics models of a single satellite and the cluster. Next a novel satellite cluster feedback control protocol with coupling gain is designed, so that the satellite cluster periodically bounded relative motion consensus problem (period-delayed errors state consensus problem) is transformed to the stability of a set of matrices with the same low dimension. Based on the consensus region theory in the research of multi-agent system consensus issues, the coupling gain can be obtained to satisfy the requirement of consensus region and decouple the satellite cluster information topology and the feedback control gain matrix, which can be determined by Linear quadratic regulator (LQR) optimal method. This method can realize the consensus of satellite cluster period-delayed errors, leading to the consistency of semi-major axes (SMA) and the energy-matching of satellite cluster. Then satellites can emerge the global coordinative cluster behavior. Finally the feasibility and effectiveness of the present energy-matching optimal consensus for satellite cluster flight is verified through numerical simulations.

Mesh refinement in finite element analysis by minimization of the stiffness matrix trace

NASA Technical Reports Server (NTRS)

Kittur, Madan G.; Huston, Ronald L.

1989-01-01

Most finite element packages provide means to generate meshes automatically. However, the user is usually confronted with the problem of not knowing whether the mesh generated is appropriate for the problem at hand. Since the accuracy of the finite element results is mesh dependent, mesh selection forms a very important step in the analysis. Indeed, in accurate analyses, meshes need to be refined or rezoned until the solution converges to a value so that the error is below a predetermined tolerance. A-posteriori methods use error indicators, developed by using the theory of interpolation and approximation theory, for mesh refinements. Some use other criterions, such as strain energy density variation and stress contours for example, to obtain near optimal meshes. Although these methods are adaptive, they are expensive. Alternatively, a priori methods, until now available, use geometrical parameters, for example, element aspect ratio. Therefore, they are not adaptive by nature. An adaptive a-priori method is developed. The criterion is that the minimization of the trace of the stiffness matrix with respect to the nodal coordinates, leads to a minimization of the potential energy, and as a consequence provide a good starting mesh. In a few examples the method is shown to provide the optimal mesh. The method is also shown to be relatively simple and amenable to development of computer algorithms. When the procedure is used in conjunction with a-posteriori methods of grid refinement, it is shown that fewer refinement iterations and fewer degrees of freedom are required for convergence as opposed to when the procedure is not used. The mesh obtained is shown to have uniform distribution of stiffness among the nodes and elements which, as a consequence, leads to uniform error distribution. Thus the mesh obtained meets the optimality criterion of uniform error distribution.

Matrix Converter Interface for a Wind Energy Conversion System: Issues and Limitations

NASA Astrophysics Data System (ADS)

Patki, Chetan; Agarwal, Vivek

2009-08-01

Variable speed grid connected wind energy systems sometimes involve AC-AC power electronic interface between the generator and the grid. Matrix converter is an attractive option for such applications. Variable speed of the wind generator demands variable voltage variable frequency at the generator terminal. Matrix converter is used in this work to generate such a supply. Also, matrix converter can be appropriately controlled to compensate the grid for non-linear, reactive loads. However, any change of power factor on the grid side reflects on the voltage magnitude on the wind generator side. It is highlighted that this may contradict the maximum power point tracking control requirements. All the results of this work are presented.

The Principle of Energetic Consistency

NASA Technical Reports Server (NTRS)

Cohn, Stephen E.

2009-01-01

A basic result in estimation theory is that the minimum variance estimate of the dynamical state, given the observations, is the conditional mean estimate. This result holds independently of the specifics of any dynamical or observation nonlinearity or stochasticity, requiring only that the probability density function of the state, conditioned on the observations, has two moments. For nonlinear dynamics that conserve a total energy, this general result implies the principle of energetic consistency: if the dynamical variables are taken to be the natural energy variables, then the sum of the total energy of the conditional mean and the trace of the conditional covariance matrix (the total variance) is constant between observations. Ensemble Kalman filtering methods are designed to approximate the evolution of the conditional mean and covariance matrix. For them the principle of energetic consistency holds independently of ensemble size, even with covariance localization. However, full Kalman filter experiments with advection dynamics have shown that a small amount of numerical dissipation can cause a large, state-dependent loss of total variance, to the detriment of filter performance. The principle of energetic consistency offers a simple way to test whether this spurious loss of variance limits ensemble filter performance in full-blown applications. The classical second-moment closure (third-moment discard) equations also satisfy the principle of energetic consistency, independently of the rank of the conditional covariance matrix. Low-rank approximation of these equations offers an energetically consistent, computationally viable alternative to ensemble filtering. Current formulations of long-window, weak-constraint, four-dimensional variational methods are designed to approximate the conditional mode rather than the conditional mean. Thus they neglect the nonlinear bias term in the second-moment closure equation for the conditional mean. The principle of energetic consistency implies that, to precisely the extent that growing modes are important in data assimilation, this term is also important.

A review of the matrix-exponential formalism in radiative transfer

NASA Astrophysics Data System (ADS)

Efremenko, Dmitry S.; Molina García, Víctor; Gimeno García, Sebastián; Doicu, Adrian

2017-07-01

This paper outlines the matrix exponential description of radiative transfer. The eigendecomposition method which serves as a basis for computing the matrix exponential and for representing the solution in a discrete ordinate setting is considered. The mathematical equivalence of the discrete ordinate method, the matrix operator method, and the matrix Riccati equations method is proved rigorously by means of the matrix exponential formalism. For optically thin layers, approximate solution methods relying on the Padé and Taylor series approximations to the matrix exponential, as well as on the matrix Riccati equations, are presented. For optically thick layers, the asymptotic theory with higher-order corrections is derived, and parameterizations of the asymptotic functions and constants for a water-cloud model with a Gamma size distribution are obtained.

A Study of Feature Extraction Using Divergence Analysis of Texture Features

NASA Technical Reports Server (NTRS)

Hallada, W. A.; Bly, B. G.; Boyd, R. K.; Cox, S.

1982-01-01

An empirical study of texture analysis for feature extraction and classification of high spatial resolution remotely sensed imagery (10 meters) is presented in terms of specific land cover types. The principal method examined is the use of spatial gray tone dependence (SGTD). The SGTD method reduces the gray levels within a moving window into a two-dimensional spatial gray tone dependence matrix which can be interpreted as a probability matrix of gray tone pairs. Haralick et al (1973) used a number of information theory measures to extract texture features from these matrices, including angular second moment (inertia), correlation, entropy, homogeneity, and energy. The derivation of the SGTD matrix is a function of: (1) the number of gray tones in an image; (2) the angle along which the frequency of SGTD is calculated; (3) the size of the moving window; and (4) the distance between gray tone pairs. The first three parameters were varied and tested on a 10 meter resolution panchromatic image of Maryville, Tennessee using the five SGTD measures. A transformed divergence measure was used to determine the statistical separability between four land cover categories forest, new residential, old residential, and industrial for each variation in texture parameters.

Electric field induced optical gain of a hydrogenic impurity in a Cd{sub 0.8}Zn{sub 0.2}Se/ZnSe parabolic quantum dot

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jasmine, P. Christina Lily; Peter, A. John, E-mail: a.john.peter@gmail.com

The dependence of electric field on the electronic and optical properties is investigated in a Cd{sub 0.8}Zn{sub 0.2}Se/ZnSe quantum dot. The hydrogenic binding energy, in the presence of electric field, is calculated with the spatial confinement effect. The electric field dependent optical gain with the photon energy is found using compact density matrix method. The results show that the electric field has a great influence on the optical properties of II-VI semiconductor quantum dot.

Charge and Spin Dynamics of the Hubbard Chains

NASA Technical Reports Server (NTRS)

Park, Youngho; Liang, Shoudan

1999-01-01

We calculate the local correlation functions of charge and spin for the one-chain and two-chain Hubbard model using density matrix renormalization group method and the recursion technique. Keeping only finite number of states we get good accuracy for the low energy excitations. We study the charge and spin gaps, bandwidths and weights of the spectra for various values of the on-site Coulomb interaction U and the electron filling. In the low energy part, the local correlation functions are different for the charge and spin. The bandwidths are proportional to t for the charge and J for the spin respectively.

Elastic alpha-particle resonances as evidence of clustering at high excitation in 40Ca

NASA Astrophysics Data System (ADS)

Norrby, M.; Lönnroth, T.; Goldberg, V. Z.; Rogachev, G. V.; Golovkov, M. S.; Källman, K.-M.; Lattuada, M.; Perov, S. V.; Romano, S.; Skorodumov, B. B.; Tiourin, G. P.; Trzaska, W. H.; Tumino, A.; Vorontsov, A. N.

2011-08-01

The elastic-scattering reaction 36Ar + α was studied using the Thick Target Inverse Kinematics technique. Data were taken at a beam energy of 150 MeV in a reaction chamber filled with 4He gas, corresponding to the excitation region of 12-20 MeV in 40Ca. Using a simplified R -matrix method of analysis energies, widths and spin assignments were obtained for 137 resonances. The structure is discussed within the concept of α-cluster structure in the quasi-continuum of 40Ca and is compared to other nuclei in the same mass region.

LCMV beamforming for a novel wireless local positioning system: a stationarity analysis

NASA Astrophysics Data System (ADS)

Tong, Hui; Zekavat, Seyed A.

2005-05-01

In this paper, we discuss the implementation of Linear Constrained Minimum Variance (LCMV) beamforming (BF) for a novel Wireless Local Position System (WLPS). WLPS main components are: (a) a dynamic base station (DBS), and (b) a transponder (TRX), both mounted on mobiles. WLPS might be considered as a node in a Mobile Adhoc NETwork (MANET). Each TRX is assigned an identification (ID) code. DBS transmits periodic short bursts of energy which contains an ID request (IDR) signal. The TRX transmits back its ID code (a signal with a limited duration) to the DBS as soon as it detects the IDR signal. Hence, the DBS receives non-continuous signals transmitted by TRX. In this work, we assume asynchronous Direct-Sequence Code Division Multiple Access (DS-CDMA) transmission from the TRX with antenna array/LCMV BF mounted at the DBS, and we discuss the implementation of the observed signal covariance matrix for LCMV BF. In LCMV BF, the observed covariance matrix should be estimated. Usually sample covariance matrix (SCM) is used to estimate this covariance matrix assuming a stationary model for the observed data which is the case in many communication systems. However, due to the non-stationary behavior of the received signal in WLPS systems, SCM does not lead to a high WLPS performance compared to even a conventional beamformer. A modified covariance matrix estimation method which utilizes the cyclostationarity property of WLPS system is introduced as a solution to this problem. It is shown that this method leads to a significant improvement in the WLPS performance.

Efficient solution of the simplified P N equations

DOE PAGES

Hamilton, Steven P.; Evans, Thomas M.

2014-12-23

We show new solver strategies for the multigroup SPN equations for nuclear reactor analysis. By forming the complete matrix over space, moments, and energy a robust set of solution strategies may be applied. Moreover, power iteration, shifted power iteration, Rayleigh quotient iteration, Arnoldi's method, and a generalized Davidson method, each using algebraic and physics-based multigrid preconditioners, have been compared on C5G7 MOX test problem as well as an operational PWR model. These results show that the most ecient approach is the generalized Davidson method, that is 30-40 times faster than traditional power iteration and 6-10 times faster than Arnoldi's method.

Substantial enhancement of energy storage capability in polymer nanocomposites by encapsulation of BaTiO3 NWs with variable shell thickness.

PubMed

Wang, Guanyao; Huang, Yanhui; Wang, Yuxin; Jiang, Pingkai; Huang, Xingyi

2017-08-09

Dielectric polymer nanocomposites have received keen interest due to their potential application in energy storage. Nevertheless, the large contrast in dielectric constant between the polymer and nanofillers usually results in a significant decrease of breakdown strength of the nanocomposites, which is unfavorable for enhancing energy storage capability. Herein, BaTiO 3 nanowires (NWs) encapsulated by TiO 2 shells of variable thickness were utilized to fabricate dielectric polymer nanocomposites. Compared with nanocomposites with bare BaTiO 3 NWs, significantly enhanced energy storage capability was achieved for nanocomposites with TiO 2 encapsulated BaTiO 3 NWs. For instance, an ultrahigh energy density of 9.53 J cm -3 at 440 MV m -1 could be obtained for nanocomposites comprising core-shell structured nanowires, much higher than that of nanocomposites with 5 wt% raw ones (5.60 J cm -3 at 360 MV m -1 ). The discharged energy density of the proposed nanocomposites with 5 wt% mTiO 2 @BaTiO 3 -1 NWs at 440 MV m -1 seems to rival or exceed those of some previously reported nanocomposites (mostly comprising core-shell structured nanofillers). More notably, this study revealed that the energy storage capability of the nanocomposites can be tailored by the TiO 2 shell thickness. Finite element simulations were employed to analyze the electric field distribution in the nanocomposites. The enhanced energy storage capability should be mainly attributed to the smoother gradient of dielectric constant between the nanofillers and polymer matrix, which alleviated the electric field concentration and leakage current in the polymer matrix. The methods and results herein offer a feasible approach to construct high-energy-density polymer nanocomposites with core-shell structured nanowires.

Thin-film-based CdTe photovoltaic module characterization: measurements and energy prediction improvement.

PubMed

Lay-Ekuakille, A; Arnesano, A; Vergallo, P

2013-01-01

Photovoltaic characterization is a topic of major interest in the field of renewable energy. Monocrystalline and polycrystalline modules are mostly used and, hence characterized since many laboratories have data of them. Conversely, cadmium telluride (CdTe), as thin-film module are, in some circumstances, difficult to be used for energy prediction. This work covers outdoor testing of photovoltaic modules, in particular that regarding CdTe ones. The scope is to obtain temperature coefficients that best predict the energy production. A First Solar (K-275) module has been used for the purposes of this research. Outdoor characterizations were performed at Department of Innovation Engineering, University of Salento, Lecce, Italy. The location of Lecce city represents a typical site in the South Italy. The module was exposed outdoor and tested under clear sky conditions as well as under cloudy sky ones. During testing, the global-inclined irradiance varied between 0 and 1500 W/m(2). About 37,000 I-V characteristics were acquired, allowing to process temperature coefficients as a function of irradiance and ambient temperature. The module was characterized by measuring the full temperature-irradiance matrix in the range from 50 to 1300 W/m(2) and from -1 to 40 W/m(2) from October 2011 to February 2012. Afterwards, the module energy output, under real conditions, was calculated with the "matrix method" of SUPSI-ISAAC and the results were compared with the five months energy output data of the same module measured with the outdoor energy yield facility in Lecce.

Thin-film-based CdTe photovoltaic module characterization: Measurements and energy prediction improvement

NASA Astrophysics Data System (ADS)

Lay-Ekuakille, A.; Arnesano, A.; Vergallo, P.

2013-01-01

Photovoltaic characterization is a topic of major interest in the field of renewable energy. Monocrystalline and polycrystalline modules are mostly used and, hence characterized since many laboratories have data of them. Conversely, cadmium telluride (CdTe), as thin-film module are, in some circumstances, difficult to be used for energy prediction. This work covers outdoor testing of photovoltaic modules, in particular that regarding CdTe ones. The scope is to obtain temperature coefficients that best predict the energy production. A First Solar (K-275) module has been used for the purposes of this research. Outdoor characterizations were performed at Department of Innovation Engineering, University of Salento, Lecce, Italy. The location of Lecce city represents a typical site in the South Italy. The module was exposed outdoor and tested under clear sky conditions as well as under cloudy sky ones. During testing, the global-inclined irradiance varied between 0 and 1500 W/m2. About 37 000 I-V characteristics were acquired, allowing to process temperature coefficients as a function of irradiance and ambient temperature. The module was characterized by measuring the full temperature-irradiance matrix in the range from 50 to 1300 W/m2 and from -1 to 40 W/m2 from October 2011 to February 2012. Afterwards, the module energy output, under real conditions, was calculated with the "matrix method" of SUPSI-ISAAC and the results were compared with the five months energy output data of the same module measured with the outdoor energy yield facility in Lecce.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hur, Tae-Bong; Fazio, James; Romanov, Vyacheslav

Due to increasing atmospheric CO2 concentrations causing the global energy and environmental crises, geological sequestration of carbon dioxide is now being actively considered as an attractive option to mitigate greenhouse gas emissions. One of the important strategies is to use deep unminable coal seams, for those generally contain significant quantities of coal bed methane that can be recovered by CO2 injection through enhanced coal bed natural gas production, as a method to safely store CO2. It has been well known that the adsorbing CO2 molecules introduce structural deformation, such as distortion, shrinkage, or swelling, of the adsorbent of coal organicmore » matrix. The accurate investigations of CO2 sorption capacity as well as of adsorption behavior need to be performed under the conditions that coals deform. The U.S. Department of Energy-National Energy Technology Laboratory and Regional University Alliance are conducting carbon dioxide sorption isotherm experiments by using manometric analysis method for estimation of CO2 sorption capacity of various coal samples and are constructing a gravimetric apparatus which has a visual window cell. The gravimetric apparatus improves the accuracy of carbon dioxide sorption capacity and provides feasibility for the observation of structural deformation of coal sample while carbon dioxide molecules interact with coal organic matrix. The CO2 sorption isotherm measurements have been conducted for moist and dried samples of the Central Appalachian Basin (Russell County, VA) coal seam, received from the SECARB partnership, at the temperature of 55 C.« less

Thermodynamic characterization of networks using graph polynomials

NASA Astrophysics Data System (ADS)

Ye, Cheng; Comin, César H.; Peron, Thomas K. DM.; Silva, Filipi N.; Rodrigues, Francisco A.; Costa, Luciano da F.; Torsello, Andrea; Hancock, Edwin R.

2015-09-01

In this paper, we present a method for characterizing the evolution of time-varying complex networks by adopting a thermodynamic representation of network structure computed from a polynomial (or algebraic) characterization of graph structure. Commencing from a representation of graph structure based on a characteristic polynomial computed from the normalized Laplacian matrix, we show how the polynomial is linked to the Boltzmann partition function of a network. This allows us to compute a number of thermodynamic quantities for the network, including the average energy and entropy. Assuming that the system does not change volume, we can also compute the temperature, defined as the rate of change of entropy with energy. All three thermodynamic variables can be approximated using low-order Taylor series that can be computed using the traces of powers of the Laplacian matrix, avoiding explicit computation of the normalized Laplacian spectrum. These polynomial approximations allow a smoothed representation of the evolution of networks to be constructed in the thermodynamic space spanned by entropy, energy, and temperature. We show how these thermodynamic variables can be computed in terms of simple network characteristics, e.g., the total number of nodes and node degree statistics for nodes connected by edges. We apply the resulting thermodynamic characterization to real-world time-varying networks representing complex systems in the financial and biological domains. The study demonstrates that the method provides an efficient tool for detecting abrupt changes and characterizing different stages in network evolution.

Breaking the theoretical scaling limit for predicting quasiparticle energies: the stochastic GW approach.

PubMed

Neuhauser, Daniel; Gao, Yi; Arntsen, Christopher; Karshenas, Cyrus; Rabani, Eran; Baer, Roi

2014-08-15

We develop a formalism to calculate the quasiparticle energy within the GW many-body perturbation correction to the density functional theory. The occupied and virtual orbitals of the Kohn-Sham Hamiltonian are replaced by stochastic orbitals used to evaluate the Green function G, the polarization potential W, and, thereby, the GW self-energy. The stochastic GW (sGW) formalism relies on novel theoretical concepts such as stochastic time-dependent Hartree propagation, stochastic matrix compression, and spatial or temporal stochastic decoupling techniques. Beyond the theoretical interest, the formalism enables linear scaling GW calculations breaking the theoretical scaling limit for GW as well as circumventing the need for energy cutoff approximations. We illustrate the method for silicon nanocrystals of varying sizes with N_{e}>3000 electrons.

Evaluation of a new neutron energy spectrum unfolding code based on an Adaptive Neuro-Fuzzy Inference System (ANFIS).

PubMed

Hosseini, Seyed Abolfazl; Esmaili Paeen Afrakoti, Iman

2018-01-17

The purpose of the present study was to reconstruct the energy spectrum of a poly-energetic neutron source using an algorithm developed based on an Adaptive Neuro-Fuzzy Inference System (ANFIS). ANFIS is a kind of artificial neural network based on the Takagi-Sugeno fuzzy inference system. The ANFIS algorithm uses the advantages of both fuzzy inference systems and artificial neural networks to improve the effectiveness of algorithms in various applications such as modeling, control and classification. The neutron pulse height distributions used as input data in the training procedure for the ANFIS algorithm were obtained from the simulations performed by MCNPX-ESUT computational code (MCNPX-Energy engineering of Sharif University of Technology). Taking into account the normalization condition of each energy spectrum, 4300 neutron energy spectra were generated randomly. (The value in each bin was generated randomly, and finally a normalization of each generated energy spectrum was performed). The randomly generated neutron energy spectra were considered as output data of the developed ANFIS computational code in the training step. To calculate the neutron energy spectrum using conventional methods, an inverse problem with an approximately singular response matrix (with the determinant of the matrix close to zero) should be solved. The solution of the inverse problem using the conventional methods unfold neutron energy spectrum with low accuracy. Application of the iterative algorithms in the solution of such a problem, or utilizing the intelligent algorithms (in which there is no need to solve the problem), is usually preferred for unfolding of the energy spectrum. Therefore, the main reason for development of intelligent algorithms like ANFIS for unfolding of neutron energy spectra is to avoid solving the inverse problem. In the present study, the unfolded neutron energy spectra of 252Cf and 241Am-9Be neutron sources using the developed computational code were found to have excellent agreement with the reference data. Also, the unfolded energy spectra of the neutron sources as obtained using ANFIS were more accurate than the results reported from calculations performed using artificial neural networks in previously published papers. © The Author(s) 2018. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

Efficient sparse matrix-matrix multiplication for computing periodic responses by shooting method on Intel Xeon Phi

NASA Astrophysics Data System (ADS)

Stoykov, S.; Atanassov, E.; Margenov, S.

2016-10-01

Many of the scientific applications involve sparse or dense matrix operations, such as solving linear systems, matrix-matrix products, eigensolvers, etc. In what concerns structural nonlinear dynamics, the computations of periodic responses and the determination of stability of the solution are of primary interest. Shooting method iswidely used for obtaining periodic responses of nonlinear systems. The method involves simultaneously operations with sparse and dense matrices. One of the computationally expensive operations in the method is multiplication of sparse by dense matrices. In the current work, a new algorithm for sparse matrix by dense matrix products is presented. The algorithm takes into account the structure of the sparse matrix, which is obtained by space discretization of the nonlinear Mindlin's plate equation of motion by the finite element method. The algorithm is developed to use the vector engine of Intel Xeon Phi coprocessors. It is compared with the standard sparse matrix by dense matrix algorithm and the one developed by Intel MKL and it is shown that by considering the properties of the sparse matrix better algorithms can be developed.

Method of forming a ceramic matrix composite and a ceramic matrix component

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Diego, Peter; Zhang, James

A method of forming a ceramic matrix composite component includes providing a formed ceramic member having a cavity, filling at least a portion of the cavity with a ceramic foam. The ceramic foam is deposited on a barrier layer covering at least one internal passage of the cavity. The method includes processing the formed ceramic member and ceramic foam to obtain a ceramic matrix composite component. Also provided is a method of forming a ceramic matrix composite blade and a ceramic matrix composite component.

Comparison of Cyclic Hysteresis Behavior between Cross-Ply C/SiC and SiC/SiC Ceramic-Matrix Composites

PubMed Central

Li, Longbiao

2016-01-01

In this paper, the comparison of cyclic hysteresis behavior between cross-ply C/SiC and SiC/SiC ceramic-matrix composites (CMCs) has been investigated. The interface slip between fibers and the matrix existed in the matrix cracking mode 3 and mode 5, in which matrix cracking and interface debonding occurred in the 0° plies are considered as the major reason for hysteresis loops of cross-ply CMCs. The hysteresis loops of cross-ply C/SiC and SiC/SiC composites corresponding to different peak stresses have been predicted using present analysis. The damage parameter, i.e., the proportion of matrix cracking mode 3 in the entire matrix cracking modes of the composite, and the hysteresis dissipated energy increase with increasing peak stress. The damage parameter and hysteresis dissipated energy of C/SiC composite under low peak stress are higher than that of SiC/SiC composite; However, at high peak stress, the damage extent inside of cross-ply SiC/SiC composite is higher than that of C/SiC composite as more transverse cracks and matrix cracks connect together. PMID:28787861

Comparison of Cyclic Hysteresis Behavior between Cross-Ply C/SiC and SiC/SiC Ceramic-Matrix Composites.

PubMed

Li, Longbiao

2016-01-19

In this paper, the comparison of cyclic hysteresis behavior between cross-ply C/SiC and SiC/SiC ceramic-matrix composites (CMCs) has been investigated. The interface slip between fibers and the matrix existed in the matrix cracking mode 3 and mode 5, in which matrix cracking and interface debonding occurred in the 0° plies are considered as the major reason for hysteresis loops of cross-ply CMCs. The hysteresis loops of cross-ply C/SiC and SiC/SiC composites corresponding to different peak stresses have been predicted using present analysis. The damage parameter, i.e. , the proportion of matrix cracking mode 3 in the entire matrix cracking modes of the composite, and the hysteresis dissipated energy increase with increasing peak stress. The damage parameter and hysteresis dissipated energy of C/SiC composite under low peak stress are higher than that of SiC/SiC composite; However, at high peak stress, the damage extent inside of cross-ply SiC/SiC composite is higher than that of C/SiC composite as more transverse cracks and matrix cracks connect together.

Evaluation of Nanomaterial Approaches to Damping in Epoxy Resin and Carbon Fiber/Epoxy Composite Structures by Dynamic Mechanical Analysis

NASA Technical Reports Server (NTRS)

Miller, G.; Heimann, Paula J.; Scheiman, Daniel A.; Duffy, Kirsten P.; Johnston, J. Chris; Roberts, Gary D.

2013-01-01

Vibration mitigation in composite structures has been demonstrated through widely varying methods which include both active and passive damping. Recently, nanomaterials have been investigated as a viable approach to composite vibration damping due to the large surface available to generate energy dissipation through friction. This work evaluates the influence of dispersed nanoparticles on the damping ratio of an epoxy matrix. Limited benefit was observed through dispersion methods, however nanoparticle application as a coating resulting in up to a three-fold increase in damping.

Application and Analysis on Graphene Materials

NASA Astrophysics Data System (ADS)

Li, Guogang; Qi, Jiaojiao

2018-01-01

Graphene is made up of carbon six-member ring cycle of two dimensional honeycomb lattice structure, it can warp as zero dimension of fullerenes, roll into a one-dimensional of carbon nanotubes or stack into a three dimensional graphite. Because of this kind of structure makes it not only have excellent electrical and mechanical properties, but also can be used as reinforced metal matrix composites, which can be used in catalyst carrier, energy storage and environmental protection. It has become a hot topic in recent years. Based on the existing research both at home and abroad, this paper focuses on the importance of the choice of graphene dispersion method to improve the mechanical properties of graphene materials, and summarizes the existing problems of graphene reinforced metal matrix composites.

Implementing transmission eigenchannels of disordered media by a binary-control digital micromirror device

NASA Astrophysics Data System (ADS)

Kim, Donggyu; Choi, Wonjun; Kim, Moonseok; Moon, Jungho; Seo, Keumyoung; Ju, Sanghyun; Choi, Wonshik

2014-11-01

We report a method for measuring the transmission matrix of a disordered medium using a binary-control of a digital micromirror device (DMD). With knowledge of the measured transmission matrix, we identified the transmission eigenchannels of the medium. We then used binary control of the DMD to shape the wavefront of incident waves and to experimentally couple light to individual eigenchannels. When the wave was coupled to the eigenchannel with the largest eigenvalue, in particular, we were able to achieve about two times more energy transmission than the mean transmittance of the medium. Our study provides an elaborated use of the DMD as a high-speed wavefront shaping device for controlling the multiple scattering of waves in highly scattering media.

Numerical Manifold Method for the Forced Vibration of Thin Plates during Bending

PubMed Central

Jun, Ding; Song, Chen; Wei-Bin, Wen; Shao-Ming, Luo; Xia, Huang

2014-01-01

A novel numerical manifold method was derived from the cubic B-spline basis function. The new interpolation function is characterized by high-order coordination at the boundary of a manifold element. The linear elastic-dynamic equation used to solve the bending vibration of thin plates was derived according to the principle of minimum instantaneous potential energy. The method for the initialization of the dynamic equation and its solution process were provided. Moreover, the analysis showed that the calculated stiffness matrix exhibited favorable performance. Numerical results showed that the generalized degrees of freedom were significantly fewer and that the calculation accuracy was higher for the manifold method than for the conventional finite element method. PMID:24883403

Asymptotic states and the definition of the S-matrix in quantum gravity

NASA Astrophysics Data System (ADS)

Wiesendanger, C.

2013-04-01

Viewing gravitational energy-momentum p_G^\\mu as equal by observation, but different in essence from inertial energy-momentum p_I^\\mu naturally leads to the gauge theory of volume-preserving diffeomorphisms of an inner Minkowski space M4. The generalized asymptotic free scalar, Dirac and gauge fields in that theory are canonically quantized, the Fock spaces of stationary states are constructed and the gravitational limit—mapping the gravitational energy-momentum onto the inertial energy-momentum to account for their observed equality—is introduced. Next the S-matrix in quantum gravity is defined as the gravitational limit of the transition amplitudes of asymptotic in- to out-states in the gauge theory of volume-preserving diffeomorphisms. The so-defined S-matrix relates in- and out-states of observable particles carrying gravitational equal to inertial energy-momentum. Finally, generalized Lehmann-Symanzik-Zimmermann reduction formulae for scalar, Dirac and gauge fields are established which allow us to express S-matrix elements as the gravitational limit of truncated Fourier-transformed vacuum expectation values of time-ordered products of field operators of the interacting theory. Together with the generating functional of the latter established in Wiesendanger (2011 arXiv:1103.1012) any transition amplitude can in principle be computed consistently to any order in perturbative quantum gravity.

Complex Correlation Kohn-T Method of Calculating Total and Elastic Cross Sections. Part 1; Electron-Hydrogen Elastic Scattering

NASA Technical Reports Server (NTRS)

Bhatia, A. K.; Temkin, A.; Fisher, Richard R. (Technical Monitor)

2001-01-01

We report on the first part of a study of electron-hydrogen scattering, using a method which allows for the ab initio calculation of total and elastic cross sections at higher energies. In its general form the method uses complex 'radial' correlation functions, in a (Kohn) T-matrix formalism. The titled method, abbreviated Complex Correlation Kohn T (CCKT) method, is reviewed, in the context of electron-hydrogen scattering, including the derivation of the equation for the (complex) scattering function, and the extraction of the scattering information from the latter. The calculation reported here is restricted to S-waves in the elastic region, where the correlation functions can be taken, without loss of generality, to be real. Phase shifts are calculated using Hylleraas-type correlation functions with up to 95 terms. Results are rigorous lower bounds; they are in general agreement with those of Schwartz, but they are more accurate and outside his error bounds at a couple of energies,

Software for Processing Flight and Simulated Data of the ATIC Experiment

NASA Technical Reports Server (NTRS)

Panov, A. D.; Adams, J. H., Jr.; Ahn, H. S.; Bashindzhagyan, G. L.; Batkov, K. E.; Case, G.; Christl, M.; Chang, J.; Fazely, A. R.; Ganel, O.;

Advanced Tomographic Imaging Methods for the Analysis of Materials

DTIC Science & Technology

1991-08-01

used in composite manufacture: aluminum, silicon carbide, and titanium aluminide . Also depicted in Fig. 2 are the energy intervals which can...SiC-fiber (SCS6) in a titanium - aluminide matrix. The contrast between SiC and AtIis only 10% over a broad eiaergy range. Therefore, distinguishing the...borehole logging, orrodent detection on turbine blades , kerogen analysis of shale, and contents of coals (sulfur, minerals, and btu). APSTNG

Scattering Matrix Elements for the Nonadiabatic Collision

DTIC Science & Technology

2010-12-01

orthogonality relationship expressed in (77). This technique, known as the Channel Packet Method (CPM), is laid out by Weeks and Tannor [2...time and energy are Fourier transform pairs, and share the same relationship as the coordinate/momentum pairs: max min 2E t t π ∆ = − (99) As...elements, will exibit ringing. Selection of an inappropriatly large time step introduces an erroneous phase shift in the correlation funtion . This

Method of fabricating electrodes including high-capacity, binder-free anodes for lithium-ion batteries

DOEpatents

Ban, Chunmei; Wu, Zhuangchun; Dillon, Anne C.

2017-01-10

An electrode (110) is provided that may be used in an electrochemical device (100) such as an energy storage/discharge device, e.g., a lithium-ion battery, or an electrochromic device, e.g., a smart window. Hydrothermal techniques and vacuum filtration methods were applied to fabricate the electrode (110). The electrode (110) includes an active portion (140) that is made up of electrochemically active nanoparticles, with one embodiment utilizing 3d-transition metal oxides to provide the electrochemical capacity of the electrode (110). The active material (140) may include other electrochemical materials, such as silicon, tin, lithium manganese oxide, and lithium iron phosphate. The electrode (110) also includes a matrix or net (170) of electrically conductive nanomaterial that acts to connect and/or bind the active nanoparticles (140) such that no binder material is required in the electrode (110), which allows more active materials (140) to be included to improve energy density and other desirable characteristics of the electrode. The matrix material (170) may take the form of carbon nanotubes, such as single-wall, double-wall, and/or multi-wall nanotubes, and be provided as about 2 to 30 percent weight of the electrode (110) with the rest being the active material (140).

Effect of reinforcement morphology on matrix microcracking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sridhar, N.; Srolovitz, D.J.; Rickman, J.M.

1996-03-01

The authors quantitatively examine the conditions under which a particle matrix misfit leads to matrix crack growth as a function of inclusion shape. Such misfit stresses and cracks can be generated by thermal expansion mismatch, generated by cooling a brittle matrix containing ductile inclusions. Using fracture mechanics and perturbation theory, they analyze the case of a penny-shaped crack interacting with a misfitting spheroidal inclusion. A simple and direct relationship is established between the strain energy release rate and the physical and geometrical properties of the system including: the thermal expansion mismatch, temperature change, the crack and inclusion sizes, the elasticmore » properties of the medium and the shape of the inclusion. In particular, the effects of inclusion shape on the stress intensity factors and strain energy release rate are analytically determined for nearly spherical inclusions. The authors use this information to determine the minimum crack size for crack growth to occur and the maximum size to which cracks may grown. The maximum crack size corresponds to the case where the elastic strain energy released upon crack growth is no longer sufficient to compensate for energy expended in extending the crack as the crack is growing into the rapidly decreasing stress field. The authors employ a nominally exact numerical procedure to study the effects of whiskers and platelets (i.e. spheroids very different from spheres) on matrix cracking. It is found that upon cooling a composite containing ductile inclusions, the propensity for matrix cracking is maximized for reinforcement shapes close to that of a sphere.« less

Rheological principles of development hetero-modulus and hetero-viscous complex materials with extreme dynamic strength

NASA Astrophysics Data System (ADS)

Gömze, L. A.; Gömze, L. N.

2017-02-01

Materials with different crystalline and morphological compositions have different chemical, physical, mechanical and rheological properties, including wear protection, melting temperature, module of elasticity and viscosity. Examining the material structures and behaviors of differentceramic bodies and CMCs under high speed collisions in several years the authors have understood the advantages of hetero-modulus and hetero-viscous complex material systems to absorb and dissipate the kinetic energy of objects during high speed collisions. Applying the rheo-mechanical principles the authors successfully developed a new family of hetero-modulus and hetero-viscous alumina matrix composite materials with extreme mechanical properties including dynamic strength. These new corundum-matrix composite materials reinforced with Si2ON 2, Si3N4 , SiAlON and AlN submicron and nanoparticles have excellent dynamic strength during collisions with high density metallic bodies with speeds about 1000 m/sec or more. At the same time in the alumina matrix composites can be observed a phase transformation of submicron and nanoparticles of alpha and beta silicone-nitride crystals into cubicc-Si3N4 diamond-like particles can be observed, when the high speed collision processes are taken place in vacuum or oxygen-free atmosphere. Using the rheological principles and the energy engorgement by fractures, heating and melting of components the authors successfully developed several new hetero-modulus, hetero-viscous and hetero-plastic complex materials. These materials generally are based on ceramic matrixes and components having different melting temperatures and modules of elasticity from low values like carbon and light metals (Mg, Al, Ti, Si) up to very high values like boride, nitride and carbide ceramics. Analytical methods applied in this research were scanning electron microscopy, X-ray diffractions and energy dispersive spectrometry. Digital image analysis was applied to microscopy results to enhance the results of transformations.

Ultralow-Carbon Nanotube-Toughened Epoxy: The Critical Role of a Double-Layer Interface.

PubMed

Liu, Jingwei; Chen, Chao; Feng, Yuezhan; Liao, Yonggui; Ye, Yunsheng; Xie, Xiaolin; Mai, Yiu-Wing

2018-01-10

Understanding the chemistry and structure of interfaces within epoxy resins is important for studying the mechanical properties of nanofiller-filled nanocomposites as well as for developing high-performance polymer nanocomposites. Despite the intensive efforts to construct nanofiller/matrix interfaces, few studies have demonstrated an enhanced stress-transferring efficiency while avoiding unfavorable deformation due to undesirable interface fractures. Here, we report an optimized method to prepare epoxy-based nanocomposites whose interfaces are chemically modulated by poly(glycidyl methacrylate)-block-poly(hexyl methacrylate) (PGMA-b-PHMA)-functionalized multiwalled carbon nanotubes (bc@fMWNTs) and also offer a fundamental explanation of crack growth behavior and the toughening mechanism of the resulting nanocomposites. The presence of block copolymers on the surface of the MWNT results in a promising double-layered interface, in which (1) the outer-layered PGMA segment provides good dispersion in and strong interface bonding with the epoxy matrix, which enhances load transfer efficiency and debonding stress, and (2) the interlayered rubbery PHMA segment around the MWNT provides the maximum removable space for nanotubes as well as triggering cavitation while promoting local plastic matrix deformation, for example, shear banding to dissipate fracture energy. An outstanding toughening effect is achieved with only a 0.05 wt % carbon nanotube loading with the bc@fMWNT, that is, needing only a 20-times lower loading to obtain improvements in fracture toughness comparable to epoxy-based nanocomposites. The enhancements of their corresponding ultimate mode-I fracture toughnesses and fracture energies are 4 times higher than those of pristine MWNT-filled epoxy. These results demonstrate that a MWNT/epoxy interface could be optimized by changing the component structure of grafted modifiers, thereby facilitating the transfer of both mechanical load and energy dissipation across the nanofiller/matrix interface. This work provides a new route for the rational design and development of polymer nanocomposites with exceptional mechanical performance.

Electrolyte matrix for molten carbonate fuel cells

DOEpatents

Huang, C.M.; Yuh, C.Y.

1999-02-09

A matrix is described for a carbonate electrolyte including a support material and an additive constituent having a relatively low melting temperature and a relatively high coefficient of thermal expansion. The additive constituent is from 3 to 45 weight percent of the matrix and is formed from raw particles whose diameter is in a range of 0.1 {micro}m to 20 {micro}m and whose aspect ratio is in a range of 1 to 50. High energy intensive milling is used to mix the support material and additive constituent during matrix formation. Also disclosed is the use of a further additive constituent comprising an alkaline earth containing material. The further additive is mixed with the support material using high energy intensive milling. 5 figs.

Electrolyte matrix for molten carbonate fuel cells

DOEpatents

Huang, Chao M.; Yuh, Chao-Yi

1999-01-01

A matrix for a carbonate electrolyte including a support material and an additive constituent having a relatively low melting temperature and a relatively high coefficient of thermal expansion. The additive constituent is from 3 to 45 weight percent of the matrix and is formed from raw particles whose diameter is in a range of 0.1 .mu.m to 20 .mu.m and whose aspect ratio is in a range of 1 to 50. High energy intensive milling is used to mix the support material and additive constituent during matrix formation. Also disclosed is the use of a further additive constituent comprising an alkaline earth containing material. The further additive is mixed with the support material using high energy intensive milling.

Matrix elements of N-particle explicitly correlated Gaussian basis functions with complex exponential parameters

NASA Astrophysics Data System (ADS)

Bubin, Sergiy; Adamowicz, Ludwik

2006-06-01

In this work we present analytical expressions for Hamiltonian matrix elements with spherically symmetric, explicitly correlated Gaussian basis functions with complex exponential parameters for an arbitrary number of particles. The expressions are derived using the formalism of matrix differential calculus. In addition, we present expressions for the energy gradient that includes derivatives of the Hamiltonian integrals with respect to the exponential parameters. The gradient is used in the variational optimization of the parameters. All the expressions are presented in the matrix form suitable for both numerical implementation and theoretical analysis. The energy and gradient formulas have been programed and used to calculate ground and excited states of the He atom using an approach that does not involve the Born-Oppenheimer approximation.

Matrix elements of N-particle explicitly correlated Gaussian basis functions with complex exponential parameters.

PubMed

Bubin, Sergiy; Adamowicz, Ludwik

2006-06-14

In this work we present analytical expressions for Hamiltonian matrix elements with spherically symmetric, explicitly correlated Gaussian basis functions with complex exponential parameters for an arbitrary number of particles. The expressions are derived using the formalism of matrix differential calculus. In addition, we present expressions for the energy gradient that includes derivatives of the Hamiltonian integrals with respect to the exponential parameters. The gradient is used in the variational optimization of the parameters. All the expressions are presented in the matrix form suitable for both numerical implementation and theoretical analysis. The energy and gradient formulas have been programmed and used to calculate ground and excited states of the He atom using an approach that does not involve the Born-Oppenheimer approximation.

Matrix completion by deep matrix factorization.

PubMed

Fan, Jicong; Cheng, Jieyu

2018-02-01

Conventional methods of matrix completion are linear methods that are not effective in handling data of nonlinear structures. Recently a few researchers attempted to incorporate nonlinear techniques into matrix completion but there still exists considerable limitations. In this paper, a novel method called deep matrix factorization (DMF) is proposed for nonlinear matrix completion. Different from conventional matrix completion methods that are based on linear latent variable models, DMF is on the basis of a nonlinear latent variable model. DMF is formulated as a deep-structure neural network, in which the inputs are the low-dimensional unknown latent variables and the outputs are the partially observed variables. In DMF, the inputs and the parameters of the multilayer neural network are simultaneously optimized to minimize the reconstruction errors for the observed entries. Then the missing entries can be readily recovered by propagating the latent variables to the output layer. DMF is compared with state-of-the-art methods of linear and nonlinear matrix completion in the tasks of toy matrix completion, image inpainting and collaborative filtering. The experimental results verify that DMF is able to provide higher matrix completion accuracy than existing methods do and DMF is applicable to large matrices. Copyright © 2017 Elsevier Ltd. All rights reserved.

Interpretation of the Precision Matrix and Its Application in Estimating Sparse Brain Connectivity during Sleep Spindles from Human Electrocorticography Recordings

PubMed Central

Das, Anup; Sampson, Aaron L.; Lainscsek, Claudia; Muller, Lyle; Lin, Wutu; Doyle, John C.; Cash, Sydney S.; Halgren, Eric; Sejnowski, Terrence J.

2017-01-01

The correlation method from brain imaging has been used to estimate functional connectivity in the human brain. However, brain regions might show very high correlation even when the two regions are not directly connected due to the strong interaction of the two regions with common input from a third region. One previously proposed solution to this problem is to use a sparse regularized inverse covariance matrix or precision matrix (SRPM) assuming that the connectivity structure is sparse. This method yields partial correlations to measure strong direct interactions between pairs of regions while simultaneously removing the influence of the rest of the regions, thus identifying regions that are conditionally independent. To test our methods, we first demonstrated conditions under which the SRPM method could indeed find the true physical connection between a pair of nodes for a spring-mass example and an RC circuit example. The recovery of the connectivity structure using the SRPM method can be explained by energy models using the Boltzmann distribution. We then demonstrated the application of the SRPM method for estimating brain connectivity during stage 2 sleep spindles from human electrocorticography (ECoG) recordings using an 8 × 8 electrode array. The ECoG recordings that we analyzed were from a 32-year-old male patient with long-standing pharmaco-resistant left temporal lobe complex partial epilepsy. Sleep spindles were automatically detected using delay differential analysis and then analyzed with SRPM and the Louvain method for community detection. We found spatially localized brain networks within and between neighboring cortical areas during spindles, in contrast to the case when sleep spindles were not present. PMID:28095202

Residual strain gradient determination in metal matrix composites by synchrotron X-ray energy dispersive diffraction

NASA Technical Reports Server (NTRS)

Kuntz, Todd A.; Wadley, Haydn N. G.; Black, David R.

1993-01-01

An X-ray technique for the measurement of internal residual strain gradients near the continuous reinforcements of metal matrix composites has been investigated. The technique utilizes high intensity white X-ray radiation from a synchrotron radiation source to obtain energy spectra from small (0.001 cu mm) volumes deep within composite samples. The viability of the technique was tested using a model system with 800 micron Al203 fibers and a commercial purity titanium matrix. Good agreement was observed between the measured residual radial and hoop strain gradients and those estimated from a simple elastic concentric cylinders model. The technique was then used to assess the strains near (SCS-6) silicon carbide fibers in a Ti-14Al-21Nb matrix after consolidation processing. Reasonable agreement between measured and calculated strains was seen provided the probe volume was located 50 microns or more from the fiber/matrix interface.

Thermodynamic properties of water in confined environments: a Monte Carlo study

NASA Astrophysics Data System (ADS)

Gladovic, Martin; Bren, Urban; Urbic, Tomaž

2018-05-01

Monte Carlo simulations of Mercedes-Benz water in a crowded environment were performed. The simulated systems are representative of both composite, porous or sintered materials and living cells with typical matrix packings. We studied the influence of overall temperature as well as the density and size of matrix particles on water density, particle distributions, hydrogen bond formation and thermodynamic quantities. Interestingly, temperature and space occupancy of matrix exhibit a similar effect on water properties following the competition between the kinetic and the potential energy of the system, whereby temperature increases the kinetic and matrix packing decreases the potential contribution. A novel thermodynamic decomposition approach was applied to gain insight into individual contributions of different types of inter-particle interactions. This decomposition proved to be useful and in good agreement with the total thermodynamic quantities especially at higher temperatures and matrix packings, where higher-order potential-energy mixing terms lose their importance.

Key-Generation Algorithms for Linear Piece In Hand Matrix Method

NASA Astrophysics Data System (ADS)

Tadaki, Kohtaro; Tsujii, Shigeo

The linear Piece In Hand (PH, for short) matrix method with random variables was proposed in our former work. It is a general prescription which can be applicable to any type of multivariate public-key cryptosystems for the purpose of enhancing their security. Actually, we showed, in an experimental manner, that the linear PH matrix method with random variables can certainly enhance the security of HFE against the Gröbner basis attack, where HFE is one of the major variants of multivariate public-key cryptosystems. In 1998 Patarin, Goubin, and Courtois introduced the plus method as a general prescription which aims to enhance the security of any given MPKC, just like the linear PH matrix method with random variables. In this paper we prove the equivalence between the plus method and the primitive linear PH matrix method, which is introduced by our previous work to explain the notion of the PH matrix method in general in an illustrative manner and not for a practical use to enhance the security of any given MPKC. Based on this equivalence, we show that the linear PH matrix method with random variables has the substantial advantage over the plus method with respect to the security enhancement. In the linear PH matrix method with random variables, the three matrices, including the PH matrix, play a central role in the secret-key and public-key. In this paper, we clarify how to generate these matrices and thus present two probabilistic polynomial-time algorithms to generate these matrices. In particular, the second one has a concise form, and is obtained as a byproduct of the proof of the equivalence between the plus method and the primitive linear PH matrix method.

Sparse subspace clustering for data with missing entries and high-rank matrix completion.

PubMed

Fan, Jicong; Chow, Tommy W S

2017-09-01

Many methods have recently been proposed for subspace clustering, but they are often unable to handle incomplete data because of missing entries. Using matrix completion methods to recover missing entries is a common way to solve the problem. Conventional matrix completion methods require that the matrix should be of low-rank intrinsically, but most matrices are of high-rank or even full-rank in practice, especially when the number of subspaces is large. In this paper, a new method called Sparse Representation with Missing Entries and Matrix Completion is proposed to solve the problems of incomplete-data subspace clustering and high-rank matrix completion. The proposed algorithm alternately computes the matrix of sparse representation coefficients and recovers the missing entries of a data matrix. The proposed algorithm recovers missing entries through minimizing the representation coefficients, representation errors, and matrix rank. Thorough experimental study and comparative analysis based on synthetic data and natural images were conducted. The presented results demonstrate that the proposed algorithm is more effective in subspace clustering and matrix completion compared with other existing methods. Copyright © 2017 Elsevier Ltd. All rights reserved.

Calculating Path-Dependent Travel Time Prediction Variance and Covariance for the SALSA3D Global Tomographic P-Velocity Model with a Distributed Parallel Multi-Core Computer

NASA Astrophysics Data System (ADS)

Hipp, J. R.; Encarnacao, A.; Ballard, S.; Young, C. J.; Phillips, W. S.; Begnaud, M. L.

2011-12-01

Recently our combined SNL-LANL research team has succeeded in developing a global, seamless 3D tomographic P-velocity model (SALSA3D) that provides superior first P travel time predictions at both regional and teleseismic distances. However, given the variable data quality and uneven data sampling associated with this type of model, it is essential that there be a means to calculate high-quality estimates of the path-dependent variance and covariance associated with the predicted travel times of ray paths through the model. In this paper, we show a methodology for accomplishing this by exploiting the full model covariance matrix. Our model has on the order of 1/2 million nodes, so the challenge in calculating the covariance matrix is formidable: 0.9 TB storage for 1/2 of a symmetric matrix, necessitating an Out-Of-Core (OOC) blocked matrix solution technique. With our approach the tomography matrix (G which includes Tikhonov regularization terms) is multiplied by its transpose (GTG) and written in a blocked sub-matrix fashion. We employ a distributed parallel solution paradigm that solves for (GTG)-1 by assigning blocks to individual processing nodes for matrix decomposition update and scaling operations. We first find the Cholesky decomposition of GTG which is subsequently inverted. Next, we employ OOC matrix multiply methods to calculate the model covariance matrix from (GTG)-1 and an assumed data covariance matrix. Given the model covariance matrix we solve for the travel-time covariance associated with arbitrary ray-paths by integrating the model covariance along both ray paths. Setting the paths equal gives variance for that path. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

First and second energy derivative analyses for open-shell self-consistent field wavefunctions

NASA Astrophysics Data System (ADS)

Yamaguchi, Yukio; Schaefer, Henry F., III; Frenking, Gernot

A study of first and second derivatives of the orbital, electronic, nuclear and total energies for the self-consistent field (SCF) wavefunction has been applied to general open-shell SCF systems. The diagonal elements of the Lagrangian matrix for the general open-shell SCF wavefunction are adapted as the 'oŕbital' energies. The first and second derivatives of the orbital energies in terms of the normal coordinates are determined via the finite difference method, while those of the electronic, nuclear and total energies are obtained by analytical techniques. Using three low lying states of the CH2 and H2CO molecules as examples, it is demonstrated that the derivatives of the SCF energetic quantities with respect to the normal coordinates provide useful chemical information concerning the respective molecular structures and reactivities. The conventional concept of the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) has been extended to the molecular vibrational motion, and the terminology of vibrationally active MOs (va-MOs), va-HOMO and va-LUMO has been introduced for each normal coordinate. The energy derivative analysis method may be used as a powerful semi-quantitative modelin understanding and interpreting various chemical phenomena.

Investigations on the properties of NH4HCO3 filled natural rubber based magnetorheological elastomers (MREs)

NASA Astrophysics Data System (ADS)

Fan, Lili; Wang, Guoping; Wang, Wenju; Shi, Guanxin; Yang, Fufeng; Rui, Xiaoting

2018-04-01

Various anisotropic magnetorheological elastomers (MREs) were synthesized using the rubber mixing technique. Magnetic and temperature distributions of the experimental equipment and test instruments were analyzed by the ANSYS. NH4HCO3 was filled in the natural rubber matrix to modify properties of MREs. Microstructures and compositions of samples were studied by the scanning electron microscope (SEM), the energy dispersive x-ray spectroscopy (EDAX) analysis and x-ray powder diffraction (XRD). Via vibrating sample magnetometer (VSM) and density functional theory (DFT) method, the magnetic property of carbonyl iron (CI) was illuminated. The shear storage modulus and MR effect of MREs were investigated by the dynamic mechanical analyzer (DMA). It indicated that distributions of magnetic and temperature in the experimental and testing devices were uniform. Before vulcanization, CI particles were uniformly distributed in the matrix, while a CI chain structure was formed and embedded in the matrix after the vulcanization process. Moderate addition of NH4HCO3 accelerated the rubber vulcanization and enhanced the MR effect.

Tribological Properties of Aluminium Alloy Composites Reinforced with Multi-Layer Graphene—The Influence of Spark Plasma Texturing Process

PubMed Central

Kostecki, Marek; Woźniak, Jarosław; Cygan, Tomasz; Petrus, Mateusz; Olszyna, Andrzej

2017-01-01

Self-lubricating composites are designed to obtain materials that reduce energy consumption, improve heat dissipation between moving bodies, and eliminate the need for external lubricants. The use of a solid lubricant in bulk composite material always involves a significant reduction in its mechanical properties, which is usually not an optimal solution. The growing interest in multilayer graphene (MLG), characterised by interesting properties as a component of composites, encouraged the authors to use it as an alternative solid lubricant in aluminium matrix composites instead of graphite. Aluminium alloy 6061 matrix composite reinforced with 2–15 vol % of MLG were synthesised by the spark plasma sintering process (SPS) and its modification, spark plasma texturing (SPT), involving deformation of the pre-sintered body in a larger diameter matrix. It was found that the application of the SPT method improves the density and hardness of the composites, resulting in improved tribological properties, particularly in the higher load regime. PMID:28796172

Symmetrical or Non-Symmetrical Debonds at Fiber-Matrix Interfaces: A Study by BEM and Finite Fracture Mechanics on Elastic Interfaces

NASA Astrophysics Data System (ADS)

Muñoz-Reja, Mar; Távara, Luis; Mantič, Vladislav

A recently proposed criterion is used to study the behavior of debonds produced at a fiber-matrix interface. The criterion is based on the Linear Elastic-(Perfectly) Brittle Interface Model (LEBIM) combined with a Finite Fracture Mechanics (FFM) approach, where the stress and energy criteria are suitably coupled. Special attention is given to the discussion about the symmetry of the debond onset and growth in an isolated single fiber specimen under uniaxial transverse tension. A common composite material system, glass fiber-epoxy matrix, is considered. The present methodology uses a two-dimensional (2D) Boundary Element Method (BEM) code to carry out the analysis of interface failure. The present results show that a non-symmetrical interface crack configuration (debonds at one side only) is produced by a lower critical remote load than the symmetrical case (debonds at both sides). Thus, the non-symmetrical solution is the preferred one, which agrees with the experimental evidences found in the literature.

Transport properties of dilute α -Fe (X ) solid solutions (X = C, N, O)

NASA Astrophysics Data System (ADS)

Schuler, Thomas; Nastar, Maylise

2016-06-01

We extend the self-consistent mean field (SCMF) method to the calculation of the Onsager matrix of Fe-based interstitial solid solutions. Both interstitial jumps and substitutional atom-vacancy exchanges are accounted for. A general procedure is introduced to split the Onsager matrix of a dilute solid solution into intrinsic cluster Onsager matrices, and extract from them flux-coupling ratios, mobilities, and association-dissociation rates for each cluster. The formalism is applied to vacancy-interstitial solute pairs in α -Fe (V X pairs, X = C, N, O), with ab initio based thermodynamic and kinetic parameters. Convergence of the cluster mobility contribution gives a controlled estimation of the cluster definition distance, taking into account both its thermodynamic and kinetic properties. Then, the flux-coupling behavior of each V X pair is discussed, and qualitative understanding is achieved from the comparison between various contributions to the Onsager matrix. Also, the effect of low-activation energy second-nearest-neighbor interstitial solute jumps around a vacancy on these results is addressed.

Nanotubular Toughening Inclusions

NASA Technical Reports Server (NTRS)

Park, Cheol (Inventor); Working, Dennis C. (Inventor); Siochi, Emilie J. (Inventor); Harrison, Joycelyn S. (Inventor)

2017-01-01

Conventional toughening agents are typically rubbery materials or small molecular weight molecules, which mostly sacrifice the intrinsic properties of a matrix such as modulus, strength, and thermal stability as side effects. On the other hand, high modulus inclusions tend to reinforce elastic modulus very efficiently, but not the strength very well. For example, mechanical reinforcement with inorganic inclusions often degrades the composite toughness, encountering a frequent catastrophic brittle failure triggered by minute chips and cracks. Thus, toughening generally conflicts with mechanical reinforcement. Carbon nanotubes have been used as efficient reinforcing agents in various applications due to their combination of extraordinary mechanical, electrical, and thermal properties. Moreover, nanotubes can elongate more than 20% without yielding or breaking, and absorb significant amounts of energy during deformation, which enables them to also be an efficient toughening agent, as well as excellent reinforcing inclusion. Accordingly, an improved toughening method is provided by incorporating nanotubular inclusions into a host matrix, such as thermoset and thermoplastic polymers or ceramics without detrimental effects on the intrinsic physical properties of the matrix.

Nanotubular Toughening Inclusions

NASA Technical Reports Server (NTRS)

Park, Cheol (Inventor); Working, Dennis C. (Inventor); Siochi, Emilie J. (Inventor); Harrison, Joycelyn S. (Inventor)

2015-01-01

Conventional toughening agents are typically rubbery materials or small molecular weight molecules, which mostly sacrifice the intrinsic properties of a matrix such as modulus, strength, and thermal stability as side effects. On the other hand, high modulus inclusions tend to reinforce elastic modulus very efficiently, but not the strength very well. For example, mechanical reinforcement with inorganic inclusions often degrades the composite toughness, encountering a frequent catastrophic brittle failure triggered by minute chips and cracks. Thus, toughening generally conflicts with mechanical reinforcement. Carbon nanotubes have been used as efficient reinforcing agents in various applications due to their combination of extraordinary mechanical, electrical, and thermal properties. Moreover, nanotubes can elongate more than 20% without yielding or breaking, and absorb significant amounts of energy during deformation, which enables them to also be an efficient toughening agent, as well as excellent reinforcing inclusion. Accordingly, an improved toughening method is provided by incorporating nanotubular inclusions into a host matrix, such as thermoset and thermoplastic polymers or ceramics without detrimental effects on the matrix's intrinsic physical properties.

MALDI In-Source Decay of Protein: The Mechanism of c-Ion Formation

PubMed Central

Takayama, Mitsuo

2016-01-01

The in-source decay (ISD) phenomenon, the fragmentation at an N–Cα bond of a peptide backbone that occurs within several tens of nanoseconds in the ion-source in matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS), is discussed from the standpoints of the discovery and early publications dealing with MALDI-ISD, the formation of c-ions in energy-sudden desorption/ionization methods, the formation of radical species in a MALDI, model construction for ISD, and matrix materials that are suitable for use in MALDI-ISD. The formation of c-ions derived from peptides and proteins in MALDI-ISD can be rationalized by a mechanism involving intermolecular hydrogen transfer, denoted as the “Takayama’s model” by De Pauw’s group (Anal. Chem. 79: 8678–8685, 2007). It should be emphasized that the model for MALDI-ISD was constructed on the basis of X-ray crystallography and scanning probe microscopy (SPM) analyses of matrix crystals, as well as the use of isotopically-labelled peptides. PMID:27162707

The Effectiveness of the Component Impact Test Method for the Side Impact Injury Assessment of the Door Trim

NASA Astrophysics Data System (ADS)

Youn, Younghan; Koo, Jeong-Seo

The complete evaluation of the side vehicle structure and the occupant protection is only possible by means of the full scale side impact crash test. But, auto part manufacturers such as door trim makers can not conduct the test especially when the vehicle is under the developing process. The main objective of this study is to obtain the design guidelines by a simple component level impact test. The relationship between the target absorption energy and impactor speed were examined using the energy absorbed by the door trim. Since each different vehicle type required different energy levels on the door trim. A simple impact test method was developed to estimate abdominal injury by measuring reaction force of the impactor. The reaction force will be converted to a certain level of the energy by the proposed formula. The target of absorption energy for door trim only and the impact speed of simple impactor are derived theoretically based on the conservation of energy. With calculated speed of dummy and the effective mass of abdomen, the energy allocated in the abdomen area of door trim was calculated. The impactor speed can be calculated based on the equivalent energy of door trim absorbed during the full crash test. With the proposed design procedure for the door trim by a simple impact test method was demonstrated to evaluate the abdominal injury. This paper describes a study that was conducted to determine sensitivity of several design factors for reducing abdominal injury values using the matrix of orthogonal array method. In conclusion, with theoretical considerations and empirical test data, the main objective, standardization of door trim design using the simple impact test method was established.

Experiences in autotuning matrix multiplication for energy minimization on GPUs

DOE PAGES

Anzt, Hartwig; Haugen, Blake; Kurzak, Jakub; ...

2015-05-20

In this study, we report extensive results and analysis of autotuning the computationally intensive graphics processing units kernel for dense matrix–matrix multiplication in double precision. In contrast to traditional autotuning and/or optimization for runtime performance only, we also take the energy efficiency into account. For kernels achieving equal performance, we show significant differences in their energy balance. We also identify the memory throughput as the most influential metric that trades off performance and energy efficiency. Finally, as a result, the performance optimal case ends up not being the most efficient kernel in overall resource use.

Thouless energy and multifractality across the many-body localization transition

NASA Astrophysics Data System (ADS)

Serbyn, Maksym; Papić, Z.; Abanin, Dmitry A.

2017-09-01

Thermal and many-body localized phases are separated by a dynamical phase transition of a new kind. We analyze the distribution of off-diagonal matrix elements of local operators across this transition in two different models of disordered spin chains. We show that the behavior of matrix elements can be used to characterize the breakdown of thermalization and to extract the many-body Thouless energy. We find that upon increasing the disorder strength the system enters a critical region around the many-body localization transition. The properties of the system in this region are: (i) the Thouless energy becomes smaller than the level spacing, (ii) the matrix elements show critical dependence on the energy difference, and (iii) the matrix elements, viewed as amplitudes of a fictitious wave function, exhibit strong multifractality. This critical region decreases with the system size, which we interpret as evidence for a diverging correlation length at the many-body localization transition. Our findings show that the correlation length becomes larger than the accessible system sizes in a broad range of disorder strength values and shed light on the critical behavior near the many-body localization transition.

On the Origins of the Linear Free Energy Relationships: Exploring the Nature of the Off-Diagonal Coupling Elements in SN2 Reactions

PubMed Central

Rosta, Edina; Warshel, Arieh

2012-01-01

Understanding the relationship between the adiabatic free energy profiles of chemical reactions and the underlining diabatic states is central to the description of chemical reactivity. The diabatic states form the theoretical basis of Linear Free Energy Relationships (LFERs) and thus play a major role in physical organic chemistry and related fields. However, the theoretical justification for some of the implicit LFER assumptions has not been fully established by quantum mechanical studies. This study follows our earlier works1,2 and uses the ab initio frozen density functional theory (FDFT) method3 to evaluate both the diabatic and adiabatic free energy surfaces and to determine the corresponding off-diagonal coupling matrix elements for a series of SN2 reactions. It is found that the off-diagonal coupling matrix elements are almost the same regardless of the nucleophile and the leaving group but change upon changing the central group. Furthermore, it is also found that the off diagonal elements are basically the same in gas phase and in solution, even when the solvent is explicitly included in the ab initio calculations. Furthermore, our study establishes that the FDFT diabatic profiles are parabolic to a good approximation thus providing a first principle support to the origin of LFER. These findings further support the basic approximation of the EVB treatment. PMID:23329895

Generation of gas-phase ions from charged clusters: an important ionization step causing suppression of matrix and analyte ions in matrix-assisted laser desorption/ionization mass spectrometry.

PubMed

Lou, Xianwen; van Dongen, Joost L J; Milroy, Lech-Gustav; Meijer, E W

2016-12-30

Ionization in matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a very complicated process. It has been reported that quaternary ammonium salts show extremely strong matrix and analyte suppression effects which cannot satisfactorily be explained by charge transfer reactions. Further investigation of the reasons causing these effects can be useful to improve our understanding of the MALDI process. The dried-droplet and modified thin-layer methods were used as sample preparation methods. In the dried-droplet method, analytes were co-crystallized with matrix, whereas in the modified thin-layer method analytes were deposited on the surface of matrix crystals. Model compounds, tetrabutylammonium iodide ([N(Bu) 4 ]I), cesium iodide (CsI), trihexylamine (THA) and polyethylene glycol 600 (PEG 600), were selected as the test analytes given their ability to generate exclusively pre-formed ions, protonated ions and metal ion adducts respectively in MALDI. The strong matrix suppression effect (MSE) observed using the dried-droplet method might disappear using the modified thin-layer method, which suggests that the incorporation of analytes in matrix crystals contributes to the MSE. By depositing analytes on the matrix surface instead of incorporating in the matrix crystals, the competition for evaporation/ionization from charged matrix/analyte clusters could be weakened resulting in reduced MSE. Further supporting evidence for this inference was found by studying the analyte suppression effect using the same two sample deposition methods. By comparing differences between the mass spectra obtained via the two sample preparation methods, we present evidence suggesting that the generation of gas-phase ions from charged matrix/analyte clusters may induce significant suppression of matrix and analyte ions. The results suggest that the generation of gas-phase ions from charged matrix/analyte clusters is an important ionization step in MALDI-MS. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

A robust method of computing finite difference coefficients based on Vandermonde matrix

NASA Astrophysics Data System (ADS)

Zhang, Yijie; Gao, Jinghuai; Peng, Jigen; Han, Weimin

2018-05-01

When the finite difference (FD) method is employed to simulate the wave propagation, high-order FD method is preferred in order to achieve better accuracy. However, if the order of FD scheme is high enough, the coefficient matrix of the formula for calculating finite difference coefficients is close to be singular. In this case, when the FD coefficients are computed by matrix inverse operator of MATLAB, inaccuracy can be produced. In order to overcome this problem, we have suggested an algorithm based on Vandermonde matrix in this paper. After specified mathematical transformation, the coefficient matrix is transformed into a Vandermonde matrix. Then the FD coefficients of high-order FD method can be computed by the algorithm of Vandermonde matrix, which prevents the inverse of the singular matrix. The dispersion analysis and numerical results of a homogeneous elastic model and a geophysical model of oil and gas reservoir demonstrate that the algorithm based on Vandermonde matrix has better accuracy compared with matrix inverse operator of MATLAB.

Adsorption studies of Cd(II) onto Al 2O 3/Nb 2O 5 mixed oxide dispersed on silica matrix and its on-line preconcentration and determination by flame atomic absorption spectrometry

NASA Astrophysics Data System (ADS)

Mendonça Costa, Lucimara; Ribeiro, Emerson Schwingel; Segatelli, Mariana Gava; do Nascimento, Danielle Raphael; de Oliveira, Fernanda Midori; Tarley, César Ricardo Teixeira

2011-05-01

The present study describes the adsorption characteristic of Cd(II) onto Nb 2O 5/Al 2O 3 mixed oxide dispersed on silica matrix. The characterization of the adsorbent has been carried out by infrared spectroscopy (IR), scanning electronic microscopy (SEM), energy dispersive spectroscopy (EDS), energy dispersive X-ray fluorescence analysis (EDXRF) and specific surface area ( SBET). From batch experiments, adsorption kinetic of Cd(II) was described by a pseudo-second-order kinetic model. The Langmuir linear isotherm fitted to the experimental adsorption isotherm very well, and the maximum adsorption capacity was found to be 17.88 mg g -1. Using the effective material, a method for Cd(II) preconcentration at trace level was developed. The method was based on on-line adsorption of Cd(II) onto SiO 2/Al 2O 3/Nb 2O 5 at pH 8.64, in which the quantitative desorption occurs with 1.0 mol L -1 hydrochloric acid towards FAAS detector. The experimental parameters related to the system were studied by means of multivariate analysis, using 2 4 full factorial design and Doehlert matrix. The effect of SO 42-, Cu 2+, Zn 2+ and Ni 2+ foreign ions showed no interference at 1:100 analyte:interferent proportion. Under the most favorable experimental conditions, the preconcentration system provided a preconcentration factor of 18.4 times, consumption index of 1.08 mL, sample throughput of 14 h -1, concentration efficiency of 4.35 min -1, linear range from 5.0 up to 35.0 μg L -1 and limits of detection and quantification of 0.19 and 0.65 μg L -1 respectively. The feasibility of the proposed method for Cd(II) determination was assessed by analysis of water samples, cigarette sample and certified reference materials TORT-2 (Lobster hepatopancreas) and DOLT-4 (Dogfish liver).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, X; Petrongolo, M; Wang, T

Purpose: A general problem of dual-energy CT (DECT) is that the decomposition is sensitive to noise in the two sets of dual-energy projection data, resulting in severely degraded qualities of decomposed images. We have previously proposed an iterative denoising method for DECT. Using a linear decomposition function, the method does not gain the full benefits of DECT on beam-hardening correction. In this work, we expand the framework of our iterative method to include non-linear decomposition models for noise suppression in DECT. Methods: We first obtain decomposed projections, which are free of beam-hardening artifacts, using a lookup table pre-measured on amore » calibration phantom. First-pass material images with high noise are reconstructed from the decomposed projections using standard filter-backprojection reconstruction. Noise on the decomposed images is then suppressed by an iterative method, which is formulated in the form of least-square estimation with smoothness regularization. Based on the design principles of a best linear unbiased estimator, we include the inverse of the estimated variance-covariance matrix of the decomposed images as the penalty weight in the least-square term. Analytical formulae are derived to compute the variance-covariance matrix from the measured decomposition lookup table. Results: We have evaluated the proposed method via phantom studies. Using non-linear decomposition, our method effectively suppresses the streaking artifacts of beam-hardening and obtains more uniform images than our previous approach based on a linear model. The proposed method reduces the average noise standard deviation of two basis materials by one order of magnitude without sacrificing the spatial resolution. Conclusion: We propose a general framework of iterative denoising for material decomposition of DECT. Preliminary phantom studies have shown the proposed method improves the image uniformity and reduces noise level without resolution loss. In the future, we will perform more phantom studies to further validate the performance of the purposed method. This work is supported by a Varian MRA grant.« less

An updated Lagrangian discontinuous Galerkin hydrodynamic method for gas dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Tong; Shashkov, Mikhail Jurievich; Morgan, Nathaniel Ray

Here, we present a new Lagrangian discontinuous Galerkin (DG) hydrodynamic method for gas dynamics. The new method evolves conserved unknowns in the current configuration, which obviates the Jacobi matrix that maps the element in a reference coordinate system or the initial coordinate system to the current configuration. The density, momentum, and total energy (ρ, ρu, E) are approximated with conservative higher-order Taylor expansions over the element and are limited toward a piecewise constant field near discontinuities using a limiter. Two new limiting methods are presented for enforcing the bounds on the primitive variables of density, velocity, and specific internal energymore » (ρ, u, e). The nodal velocity, and the corresponding forces, are calculated by solving an approximate Riemann problem at the element nodes. An explicit second-order method is used to temporally advance the solution. This new Lagrangian DG hydrodynamic method conserves mass, momentum, and total energy. 1D Cartesian coordinates test problem results are presented to demonstrate the accuracy and convergence order of the new DG method with the new limiters.« less

An updated Lagrangian discontinuous Galerkin hydrodynamic method for gas dynamics

DOE PAGES

Wu, Tong; Shashkov, Mikhail Jurievich; Morgan, Nathaniel Ray; ...

2018-04-09

Here, we present a new Lagrangian discontinuous Galerkin (DG) hydrodynamic method for gas dynamics. The new method evolves conserved unknowns in the current configuration, which obviates the Jacobi matrix that maps the element in a reference coordinate system or the initial coordinate system to the current configuration. The density, momentum, and total energy (ρ, ρu, E) are approximated with conservative higher-order Taylor expansions over the element and are limited toward a piecewise constant field near discontinuities using a limiter. Two new limiting methods are presented for enforcing the bounds on the primitive variables of density, velocity, and specific internal energymore » (ρ, u, e). The nodal velocity, and the corresponding forces, are calculated by solving an approximate Riemann problem at the element nodes. An explicit second-order method is used to temporally advance the solution. This new Lagrangian DG hydrodynamic method conserves mass, momentum, and total energy. 1D Cartesian coordinates test problem results are presented to demonstrate the accuracy and convergence order of the new DG method with the new limiters.« less

Primary combination of phase-field and discrete dislocation dynamics methods for investigating athermal plastic deformation in various realistic Ni-base single crystal superalloy microstructures

NASA Astrophysics Data System (ADS)

Gao, Siwen; Rajendran, Mohan Kumar; Fivel, Marc; Ma, Anxin; Shchyglo, Oleg; Hartmaier, Alexander; Steinbach, Ingo

2015-10-01

Three-dimensional discrete dislocation dynamics (DDD) simulations in combination with the phase-field method are performed to investigate the influence of different realistic Ni-base single crystal superalloy microstructures with the same volume fraction of {γ\\prime} precipitates on plastic deformation at room temperature. The phase-field method is used to generate realistic microstructures as the boundary conditions for DDD simulations in which a constant high uniaxial tensile load is applied along different crystallographic directions. In addition, the lattice mismatch between the γ and {γ\\prime} phases is taken into account as a source of internal stresses. Due to the high antiphase boundary energy and the rare formation of superdislocations, precipitate cutting is not observed in the present simulations. Therefore, the plastic deformation is mainly caused by dislocation motion in γ matrix channels. From a comparison of the macroscopic mechanical response and the dislocation evolution for different microstructures in each loading direction, we found that, for a given {γ\\prime} phase volume fraction, the optimal microstructure should possess narrow and homogeneous γ matrix channels.

Effects of Fiber/Matrix Interface and its Composition on Mechanical Properties of Hi Nicalon/Celsian Composites

NASA Technical Reports Server (NTRS)

Bansal, Narottam P.; Eldridge, Jeffrey I.

1998-01-01

Fiber-reinforced ceramic matrix composites (CMC) are prospective candidate materials for high temperature structural applications in aerospace, energy conservation, power generation, nuclear, petrochemical, and other industries. At NASA Lewis, we are investigating celsian matrix composites reinforced with various types of silicon carbide fibers. The objective of the present study was to investigate the effects of fiber/matrix interface and its composition on the mechanical properties of silicon carbide (Hi-Nicalon) fiber-reinforced celsian matrix composites.

Shadow poles in coupled-channel problems calculated with the Berggren basis

NASA Astrophysics Data System (ADS)

Id Betan, R. M.; Kruppa, A. T.; Vertse, T.

2018-02-01

Background: In coupled-channels models the poles of the scattering S matrix are located on different Riemann sheets. Physical observables are affected mainly by poles closest to the physical region but sometimes shadow poles have considerable effect too. Purpose: The purpose of this paper is to show that in coupled-channels problems all poles of the S matrix can be located by an expansion in terms of a properly constructed complex-energy basis. Method: The Berggren basis is used for expanding the coupled-channels solutions. Results: The locations of the poles of the S matrix for the Cox potential, constructed for coupled-channels problems, were numerically calculated and compared with the exact ones. In a nuclear physics application the Jπ=3 /2+ resonant poles of 5He were calculated in a phenomenological two-channel model. The properties of both the normal and shadow resonances agree with previous findings. Conclusions: We have shown that, with an appropriately chosen Berggren basis, all poles of the S matrix including the shadow poles can be determined. We have found that the shadow pole of 5He migrates between Riemann sheets if the coupling strength is varied.

Relativistic many-body calculation of energies, transition rates, lifetimes, and multipole polarizabilities in Cs-like La iii

NASA Astrophysics Data System (ADS)

Safronova, U. I.; Safronova, M. S.

2014-05-01

Excitation energies of the [Xe]nd (n =5-9), [Xe]ns (n =6-10), [Xe]np (n =6-9), [Xe]nf (n =4-8), and [Xe]ng (n =5-8) states in La iii, where [Xe] = 1s22s22p63s23p63d104s24p64d105s25p6, are evaluated. Electric dipole matrix elements for the allowed transitions between the low-lying [Xe]nd, [Xe]ns, [Xe]np, [Xe]nf, and [Xe]ng states in the La iii ion are calculated using the high-precision relativistic all-order method where all single, double, and partial triple excitations of the Dirac-Fock wave functions are included to all orders of perturbation theory. Recommended values are provided for a large number of electric dipole matrix elements, oscillator strengths, transition rates, and lifetimes. Scalar and tensor polarizabilities of the states listed above are evaluated. The uncertainties of the recommended values are estimated. Electric quadrupole and magnetic dipole matrix elements are calculated to determine lifetimes of the 5d5/2 and 6s metastable levels. The ground-state E1, E2, and E3 static polarizabilities are calculated. This work provides recommended values critically evaluated for their accuracy for a number of La iii atomic properties for use in planning and analysis of various experiments as well as theoretical modeling.

Humic acids as both matrix for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and adsorbent for magnetic solid phase extraction.

PubMed

Zhao, Qin; Xu, Jing; Yin, Jia; Feng, Yu-Qi

2015-08-19

In the present study, humic acids (HAs) were applied as both a matrix for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and an adsorbent of magnetic solid phase extraction (MSPE) for the first time. As natural macromolecule compounds, HAs are inherently highly functionalized and contain laser energy absorbing-transferring aromatic structures. This special molecular structure made HAs a good candidate for use as a MALDI matrix in small molecule analysis. At the same time, due to its good adsorption ability, HAs was prepared as MSPE adsorbent via a simple co-mixing method, in which the commercially available HAs were directly mixed with Fe3O4 magnetic nanoparticles (MNPs) in a mortar and grinded evenly and completely. In this process, MNPs were physically wrapped and adhered to tiny HAs leading to the formation of magnetic HAs (MHAs). To verify the bi-function of the MHAs, Rhodamine B (RdB) was chosen as model compound. Our results show that the combination of MHAs-based MSPE and MALDI-TOF-MS can provide a rapid and sensitive method for the determination of RdB in chili oil. The whole analytical procedure could be completed within 30 min for simultaneous determination of more than 20 samples, and the limit of quantitation for RdB was found to be 0.02 μg/g. The recoveries in chili oil were in the range 73.8-81.5% with the RSDs less than 21.3% (intraday) and 20.3% (interday). The proposed strategy has potential applications for high-throughput analysis of small molecules in complex samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Making LULUCF matrix of Korea by Approach 2&3

NASA Astrophysics Data System (ADS)

Hwang, J.; Jang, R.; Seong, M.; Yim, J.; Jeon, S. W.

2017-12-01

To establish and implement policies in response to climate change, it is very important to identify domestic greenhouse gas emission sources and sinks, and accurately calculate emissions and removals from each source and sink. The IPCC Guideline requires the establishment of six sectors of energy, industrial processes, solvents and other product use, agriculture, Land-Use Change and Forestry (LULUCF) and waste in estimating GHG inventories. LULUCF is divided into 6 categories according to land use, purpose, and type, and then it calculates greenhouse gas emission/absorption amount due to artificial activities according to each land use category and greenhouse gas emission/absorption amount according to land use change. The IPCC Guideline provides three approaches to how to create a LULUCF discipline matrix. According to the IPCC Guidelines, it is a principle to divide into the land use that is maintained and the land use area changed to other lands. However, Korea currently uses Approach 1, which is based on statistical data, it is difficult to detect changed area. Therefore, in this study, we are going to do a preliminary work for constructing the LULUCF matrix at Approach 2 & 3 level. NFI data, GIS, and RS data were used to build the matrix of Approach 2 method by Sampling method. For used for Approach 3, we analyzed the four thematic maps - Cadastral Map, Land Cover Map, Forest Type Map, and Biotope Map - representing land cover and utilization in terms of legal, property, quantitative and qualitative aspects. There is a difference between these maps because their purpose, resolution, timing and spatial range are different. Comparing these maps is important because it can help for decide map which is suitable for constructing the LULUCF matrix.Keywords: LULUCF, GIS/RS, IPCC Guideline, Approach 2&3, Thematic Maps

Comparison of two Galerkin quadrature methods

DOE PAGES

Morel, Jim E.; Warsa, James; Franke, Brian C.; ...

2017-02-21

Here, we compare two methods for generating Galerkin quadratures. In method 1, the standard S N method is used to generate the moment-to-discrete matrix and the discrete-to-moment matrix is generated by inverting the moment-to-discrete matrix. This is a particular form of the original Galerkin quadrature method. In method 2, which we introduce here, the standard S N method is used to generate the discrete-to-moment matrix and the moment-to-discrete matrix is generated by inverting the discrete-to-moment matrix. With an N-point quadrature, method 1 has the advantage that it preserves N eigenvalues and N eigenvectors of the scattering operator in a pointwisemore » sense. With an N-point quadrature, method 2 has the advantage that it generates consistent angular moment equations from the corresponding S N equations while preserving N eigenvalues of the scattering operator. Our computational results indicate that these two methods are quite comparable for the test problem considered.« less

Comparison of two Galerkin quadrature methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morel, Jim E.; Warsa, James; Franke, Brian C.

Here, we compare two methods for generating Galerkin quadratures. In method 1, the standard S N method is used to generate the moment-to-discrete matrix and the discrete-to-moment matrix is generated by inverting the moment-to-discrete matrix. This is a particular form of the original Galerkin quadrature method. In method 2, which we introduce here, the standard S N method is used to generate the discrete-to-moment matrix and the moment-to-discrete matrix is generated by inverting the discrete-to-moment matrix. With an N-point quadrature, method 1 has the advantage that it preserves N eigenvalues and N eigenvectors of the scattering operator in a pointwisemore » sense. With an N-point quadrature, method 2 has the advantage that it generates consistent angular moment equations from the corresponding S N equations while preserving N eigenvalues of the scattering operator. Our computational results indicate that these two methods are quite comparable for the test problem considered.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hurtubise, R.J.

Interaction models were developed for moisture effects on room-temperature fluorescence (RTF) and room-temperature phosphorescence (RTP) of compounds adsorbed on filter paper. The models described both dynamic and matrix quenching and also related the Young modulus of filter paper to quenching of phosphor on moist filter paper. Photophysical parameters for lumiphors in solution and on solid matrices were compared. Results showed that for some compounds, solid-matrix luminescence has greater analytical potential than solution luminescence. Also, the solid-matrix systems into one of two categories depending on how the intersystem crossing rate constants change with temperature. The first study was carried out onmore » effects of heavy atom on solid-matrix luminescence. With some heavy atoms, maximum solid-matrix phosphorescence quantum yield was obtained at room temperature, and there was no need to use low temperature to obtain a strong phosphorescence signal. By studying solid-matrix luminescence properties of phosphors adsorbed on sodium acetate and deuterated sodium acetate, an interaction model was developed for p-aminobenzoic acid anion adsorbed on sodium acetate. It was shown that the energy-gap law was applicable to solid-matrix luminescence. Also, deuterated phenanthrene and undeuterated phenanthrene were used to study nonradiative transition of excited triplet state of adsorbed phosphors. Heat capacities of several solid matrices were obtained vs temperature and related to vibrational coupling of solid matrix with phosphor. Photophysical study was performed on the hydrolysis products of benzo(a)pyrene-DNA adducts. Also, an analytical method was developed for tetrols in human lung fractions. Work was initiated on the formation of room temperature glasses with glucose and trehalose. Also, work has begun for the development of an oxygen sensor by measuring the RTP quenching of triphenylene on filter paper.« less

Aggregation of carbon dioxide sequestration storage assessment units

USGS Publications Warehouse

Blondes, Madalyn S.; Schuenemeyer, John H.; Olea, Ricardo A.; Drew, Lawrence J.

2013-01-01

The U.S. Geological Survey is currently conducting a national assessment of carbon dioxide (CO2) storage resources, mandated by the Energy Independence and Security Act of 2007. Pre-emission capture and storage of CO2 in subsurface saline formations is one potential method to reduce greenhouse gas emissions and the negative impact of global climate change. Like many large-scale resource assessments, the area under investigation is split into smaller, more manageable storage assessment units (SAUs), which must be aggregated with correctly propagated uncertainty to the basin, regional, and national scales. The aggregation methodology requires two types of data: marginal probability distributions of storage resource for each SAU, and a correlation matrix obtained by expert elicitation describing interdependencies between pairs of SAUs. Dependencies arise because geologic analogs, assessment methods, and assessors often overlap. The correlation matrix is used to induce rank correlation, using a Cholesky decomposition, among the empirical marginal distributions representing individually assessed SAUs. This manuscript presents a probabilistic aggregation method tailored to the correlations and dependencies inherent to a CO2 storage assessment. Aggregation results must be presented at the basin, regional, and national scales. A single stage approach, in which one large correlation matrix is defined and subsets are used for different scales, is compared to a multiple stage approach, in which new correlation matrices are created to aggregate intermediate results. Although the single-stage approach requires determination of significantly more correlation coefficients, it captures geologic dependencies among similar units in different basins and it is less sensitive to fluctuations in low correlation coefficients than the multiple stage approach. Thus, subsets of one single-stage correlation matrix are used to aggregate to basin, regional, and national scales.

Investigation of dynamic properties of a polymer matrix composite with different angles of fiber orientations

NASA Astrophysics Data System (ADS)

Kadioglu, F.; Coskun, T.; Elfarra, M.

2018-05-01

For the dynamic values of fiber-reinforced polymer matrix composite materials, elastic modulus and damping values are emphasized, and the two are desired to be high as much as possible, as the first is related to load bearing capacity, the latter provides the capability of energy absorption. In the composites, while fibers are usually utilized for reinforcement providing high elastic modulus and so high strength, matrix introduces a medium for high damping. Correct measurement of damping values is a critical step in designing composite materials. The aim of the current study is to measure the dynamic values of a glass fiber-reinforced polymer matrix composite, Hexply 913/33%/UD280, produced by Hexcel, using a vibrating beam technique. The specimens with different angles of fiber orientations (0, ±10°, ±20°, ±35, ±45°, ±55°, ±70, ±80 and 90) were manufactured from the composite prepreg and subjected to the clamped-free boundary conditions. Two different methods, the half power bandwidth and the logarithmic free decay, were used to measure the damping values to be able to compare the results. It has been revealed that the dynamic values are affected by the fiber orientations; for high flexural modulus the specimens with small angles of orientation, but for high damping those with large angles of orientation should be preferred. In general, the results are comparable, and the free decay method gave smaller values compared to the bandwidth method, with a little exception. It is suggested that the results (data) obtained from the test can be used for modal analysis reliably.

Time-Dependent Density Functional Theory for Open Systems and Its Applications.

PubMed

Chen, Shuguang; Kwok, YanHo; Chen, GuanHua

2018-02-20

Photovoltaic devices, electrochemical cells, catalysis processes, light emitting diodes, scanning tunneling microscopes, molecular electronics, and related devices have one thing in common: open quantum systems where energy and matter are not conserved. Traditionally quantum chemistry is confined to isolated and closed systems, while quantum dissipation theory studies open quantum systems. The key quantity in quantum dissipation theory is the reduced system density matrix. As the reduced system density matrix is an O(M! × M!) matrix, where M is the number of the particles of the system of interest, quantum dissipation theory can only be employed to simulate systems of a few particles or degrees of freedom. It is thus important to combine quantum chemistry and quantum dissipation theory so that realistic open quantum systems can be simulated from first-principles. We have developed a first-principles method to simulate the dynamics of open electronic systems, the time-dependent density functional theory for open systems (TDDFT-OS). Instead of the reduced system density matrix, the key quantity is the reduced single-electron density matrix, which is an N × N matrix where N is the number of the atomic bases of the system of interest. As the dimension of the key quantity is drastically reduced, the TDDFT-OS can thus be used to simulate the dynamics of realistic open electronic systems and efficient numerical algorithms have been developed. As an application, we apply the method to study how quantum interference develops in a molecular transistor in time domain. We include electron-phonon interaction in our simulation and show that quantum interference in the given system is robust against nuclear vibration not only in the steady state but also in the transient dynamics. As another application, by combining TDDFT-OS with Ehrenfest dynamics, we study current-induced dissociation of water molecules under scanning tunneling microscopy and follow its time dependent dynamics. Given the rapid development in ultrafast experiments with atomic resolution in recent years, time dependent simulation of open electronic systems will be useful to gain insight and understanding of such experiments. This Account will mainly focus on the practical aspects of the TDDFT-OS method, describing the numerical implementation and demonstrating the method with applications.

The Silicon Matrix as a Charge Detector in the ATIC Experiment

NASA Technical Reports Server (NTRS)

Zatsepin, V. I.; Adams, J. H.; Ahn, H. S.; Bashindzhagyan, G. L.; Batkov, K. E.; Chang, J.; Christl, M.; Fazely, A. R.; Ganel, O.; Gunasingha, R. M.

2004-01-01

The Advanced Thin Ionization Calorimeter (ATIC) was built for series of long- duration balloon flights in Antarctica. Its main goal is to measure energy spectra of cosmic ray nuclei from protons up to iron nuclei over a wide energy range from 30 GeV up to 100 TeV. The ATIC balloon experiment had its first, test flight that lasted for 16 days from 28 Dec 2000 to 13 Jan 2OO1 around the continent. The ATIC spectrometer consists of a fully active BGO calorimeter, scintillator hodoscopes and a silicon matrix. The silicon matrix, consisting of 4480 pixels, was used as a charge detector in the experiment. About 25 million cosmic ray events were detected during the flight. In the paper, the charge spectrum obtained with the silicon matrix is analyzed.

On the damping capacity of cast irons

NASA Astrophysics Data System (ADS)

Golovin, S. A.

2012-07-01

The treatment of experimental data on the amplitude-dependent internal friction (ADIF) in terms of various theoretical models has revealed a staged character and the main mechanisms of the processes of energy dissipation in graphite with increasing amplitude of vibrations upon cyclic loading. It is shown that the level of the damping capacity of lamellar cast iron depends on the relationship between the elastic and strength characteristics of graphite and the matrix phase. In cast irons with a rigid matrix structure (pearlite, martensite), the energy dissipation is determined by the volume fraction and morphology of the initial graphite phase. In cast irons with a softer metallic phase (ferrite), the contact interaction of graphite inclusions with the matrix and the properties of the matrix introduce additional sources of high damping.

Quantum critical spin-2 chain with emergent SU(3) symmetry.

PubMed

Chen, Pochung; Xue, Zhi-Long; McCulloch, I P; Chung, Ming-Chiang; Huang, Chao-Chun; Yip, S-K

2015-04-10

We study the quantum critical phase of an SU(2) symmetric spin-2 chain obtained from spin-2 bosons in a one-dimensional lattice. We obtain the scaling of the finite-size energies and entanglement entropy by exact diagonalization and density-matrix renormalization group methods. From the numerical results of the energy spectra, central charge, and scaling dimension we identify the conformal field theory describing the whole critical phase to be the SU(3)_{1} Wess-Zumino-Witten model. We find that, while the Hamiltonian is only SU(2) invariant, in this critical phase there is an emergent SU(3) symmetry in the thermodynamic limit.

Three-Particle Complexes in Two-Dimensional Semiconductors

NASA Astrophysics Data System (ADS)

Ganchev, Bogdan; Drummond, Neil; Aleiner, Igor; Fal'ko, Vladimir

2015-03-01

We evaluate binding energies of trions X±, excitons bound by a donor or acceptor charge XD (A ) , and overcharged acceptors or donors in two-dimensional atomic crystals by mapping the three-body problem in two dimensions onto one particle in a three-dimensional potential treatable by a purposely developed boundary-matching-matrix method. We find that in monolayers of transition metal dichalcogenides the dissociation energy of X± is typically much larger than that of localized exciton complexes, so that trions are more resilient to heating, despite the fact that their recombination line in optics is less redshifted from the exciton line than the line of XD (A ) .

Effect of long-range correlation on the metal-insulator transition in a disordered molecular crystal

NASA Astrophysics Data System (ADS)

Unge, Mikael; Stafström, Sven

2006-12-01

Localization lengths of the electronic states in a disordered two-dimensional system, resembling highly anisotropic molecular crystals such as pentacene, have been calculated numerically using the transfer matrix method. The disorder is based on a model with small random fluctuations of induced molecular dipole moments which give rise to long-range correlated disorder in the on-site energies as well as a coupling between the on-site energies and the intermolecular interactions. Our calculations show that molecular crystals such as pentacene can exhibit states with very long localization lengths with a possibility to reach a truly metallic state.

Method of producing a hybrid matrix fiber composite

DOEpatents

Deteresa, Steven J [Livermore, CA; Lyon, Richard E [Absecon, NJ; Groves, Scott E [Brentwood, CA

2006-03-28

Hybrid matrix fiber composites having enhanced compressive performance as well as enhanced stiffness, toughness and durability suitable for compression-critical applications. The methods for producing the fiber composites using matrix hybridization. The hybrid matrix fiber composites comprised of two chemically or physically bonded matrix materials, whereas the first matrix materials are used to impregnate multi-filament fibers formed into ribbons and the second matrix material is placed around and between the fiber ribbons that are impregnated with the first matrix material and both matrix materials are cured and solidified.

Infrared Spectroscopy of 1-CHOLOROMETHYLALLYL and 1-METHYLALLYL Radicals Produced in a Solid Para-Hydrogen Matrix.

NASA Astrophysics Data System (ADS)

Bahou, Mohammed; Wu, Jen-Yu; Tanaka, Keiichi; Lee, Yuan-Pern

2012-06-01

The reaction of chlorine atoms with trans-1,3-butadiene in solid para-hydrogen (p-H_2) matrix has been studied using Fourier transform infrared spectroscopy. When a mixture of Cl_2, trans-1,3-butadiene and p-H_2 was deposited onto a cold target at 3 K and irradiated by UV light at 365 nm, new intense lines at 809.0, 962.1, 1240.6 cm-1 and several weaker ones appeared. The carrier of this spectrum was assigned to the 1-chloromethylallyl radical, - (CH_2CHCH)CH_2Cl, based on the anharmonic vibrational frequencies calculated with the DFT method, indicating that the addition of the Cl atom to trans-1,3-butadiene occurs primarily at the terminal carbon atom. This is in sharp contrast to the reaction of chlorine atoms with propene in a solid p-H_2 matrix in which the addition of Cl to the central carbon atom to produce selectively the 2-chloropropyl is favored due to the steric effects. The energy diagram calculated with B3PW91 method supports this selective reaction process because 1) the channel from trans-1,3-butadiene to 1-chloro-methylallyl is almost barrierless (0.4 kcal/mol), and 2) isomereization from 1-chloromethylally to the 2-chloro-3-buten-1-yl radical, CH_2CHCHClCH_2 - by migration of Cl atom from the terminal to the central C atom, hardly occur in the p-H_2 matrix because of the isomerization barrier height (18.8 kcal/mol). We also observed a second set of lines with intense ones at 781.6, 957.93, 1433.6 cm-1 and several weaker ones when the UV-irradiated Cl_2/trans-1,3-butadiene/p-H_2 matrix was further irradiated with infrared light from a globar source. These lines are assigned to the 1-methylallyl radical, - (CH_2CHCH)CH_3, produced from reaction of 1,3-butadiene with an H atom that was produced from the reaction of Cl atoms with IR-irradiated p-H_2, Cl + H_2^* → H + HCl. The energy diagram calculated at the G3//B3LYP level similarly supports the reaction process to form selectively 1-methylallyl in the p-H_2 matrix. J. C. Amicangelo and Y. P. Lee, J. Phys. Chem. Lett. 1, 1956 (2010). J. L. Millerngelo, J. Phys. Chem. A 108, 2268 (2004).

Exciton States in a Gaussian Confining Potential Well

NASA Astrophysics Data System (ADS)

Xie, Wen-Fang; Gu, Juan

2003-11-01

We consider the problem of an electron-hole pair in a Gaussian confining potential well. This problem is treated within the effective-mass approximation framework using the method of numerical matrix diagonalization. The energy levels of the low-lying states are calculated as a function of the electron-hole effective mass ratio and the size of the confining potential. The project supported by National Natural Science Foundation of China under Grant No. 10275014

Approximate method of variational Bayesian matrix factorization/completion with sparse prior

NASA Astrophysics Data System (ADS)

Kawasumi, Ryota; Takeda, Koujin

2018-05-01

We derive the analytical expression of a matrix factorization/completion solution by the variational Bayes method, under the assumption that the observed matrix is originally the product of low-rank, dense and sparse matrices with additive noise. We assume the prior of a sparse matrix is a Laplace distribution by taking matrix sparsity into consideration. Then we use several approximations for the derivation of a matrix factorization/completion solution. By our solution, we also numerically evaluate the performance of a sparse matrix reconstruction in matrix factorization, and completion of a missing matrix element in matrix completion.

Resonance Energy Transfer Studies from Derivatives of Thiophene Substituted 1,3,4-Oxadiazoles to Coumarin-334 Dye in Liquid and Dye-Doped Polymer Media

NASA Astrophysics Data System (ADS)

Naik, Lohit; Deshapande, Narahari; Khazi, Imtiyaz Ahamed M.; Malimath, G. H.

2018-02-01

In the present work, we have carried out energy transfer studies using newly synthesised derivatives of thiophene substituted 1,3,4-oxadiazoles namely, 2-(-4-(thiophene-3-yl)phenyl)-5-(5-(thiophene-3-yl)thiophene-2-yl)-1,3,4-oxadiazole [TTO], 2-(-4-(benzo[b]thiophene-2-yl)phenyl)-5-(5-(benzo[b]thiophene-2-yl)-1,3,4-oxadiozole [TBO] and 2-(4-(4-(trifluoromethyl)phenyl)phenyl)-5-(5-(4-(trifluoromethyl)phenyl)thiophen-2-yl)-1,3,4-oxadiazole [TMO] as donors and laser dye coumarin-334 as acceptor in ethanol and dye-doped polymer (poly(methyl methacrylate) (PMMA)) media following steady-state and time-resolved fluorescence methods. Bimolecular quenching constant ( k q), translation diffusion rate parameter ( k d), diffusion length ( D l), critical transfer distance ( R 0), donor- acceptor distance ( r) and energy transfer efficiency ( E T) are calculated. It is observed that, critical transfer distance is more than the diffusion length for all the pairs. Further, bimolecular quenching constant is also more than the translation diffusion rate parameter. Hence, our experimental findings suggest that overall energy transfer is due to Förster resonance energy transfer (FRET) between donor and acceptor in both the media and for all the pairs. In addition, considerable increase in fluorescence intensity and energy transfer efficiency is observed in dye-doped polymer matrix systems as compared to liquid media. This suggests that, these donor-acceptor pairs doped in PMMA matrix may be used for applications such as energy transfer dye lasers (ETDL) to improve the efficiency and photostability, to enhance tunability and for plastic scintillation detectors.

The fast algorithm of spark in compressive sensing

NASA Astrophysics Data System (ADS)

Xie, Meihua; Yan, Fengxia

2017-01-01

Compressed Sensing (CS) is an advanced theory on signal sampling and reconstruction. In CS theory, the reconstruction condition of signal is an important theory problem, and spark is a good index to study this problem. But the computation of spark is NP hard. In this paper, we study the problem of computing spark. For some special matrixes, for example, the Gaussian random matrix and 0-1 random matrix, we obtain some conclusions. Furthermore, for Gaussian random matrix with fewer rows than columns, we prove that its spark equals to the number of its rows plus one with probability 1. For general matrix, two methods are given to compute its spark. One is the method of directly searching and the other is the method of dual-tree searching. By simulating 24 Gaussian random matrixes and 18 0-1 random matrixes, we tested the computation time of these two methods. Numerical results showed that the dual-tree searching method had higher efficiency than directly searching, especially for those matrixes which has as much as rows and columns.

Fragment charge difference method for estimating donor-acceptor electronic coupling: Application to DNA π-stacks

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.; Rösch, Notker

2002-09-01

The purpose of this communication is two-fold. We introduce the fragment charge difference (FCD) method to estimate the electron transfer matrix element HDA between a donor D and an acceptor A, and we apply this method to several aspects of hole transfer electronic couplings in π-stacks of DNA, including systems with several donor-acceptor sites. Within the two-state model, our scheme can be simplified to recover a convenient estimate of the electron transfer matrix element HDA=(1-Δq2)1/2(E2-E1)/2 based on the vertical excitation energy E2-E1 and the charge difference Δq between donor and acceptor. For systems with strong charge separation, Δq≳0.95, one should resort to the FCD method. As favorable feature, we demonstrate the stability of the FCD approach for systems which require an approach beyond the two-state model. On the basis of ab initio calculations of various DNA related systems, we compared three approaches for estimating the electronic coupling: the minimum splitting method, the generalized Mulliken-Hush (GMH) scheme, and the FCD approach. We studied the sensitivity of FCD and GMH couplings to the donor-acceptor energy gap and found both schemes to be quite robust; they are applicable also in cases where donor and acceptor states are off resonance. In the application to π-stacks of DNA, we demonstrated for the Watson-Crick pair dimer [(GC),(GC)] how structural changes considerably affect the coupling strength of electron hole transfer. For models of three Watson-Crick pairs, we showed that the two-state model significantly overestimates the hole transfer coupling whereas simultaneous treatment of several states leads to satisfactory results.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peterson, R.C.; Garard, R.J.; Lokhandwala, K.K.

The crush behavior (specific energy absorption and crush load stability) of unidirectional fiber composite rods having tougher matrices than vinyl ester were investigated and compared with the crush behavior of similar specimens having a vinyl ester matrix. The matrices were a cyclic polyester and two rubber-toughened vinyl esters. The specific energy absorption with the cyclic polyester matrix, 180 MJ/m{sup 3}, was slightly lower than that with the vinyl ester matrix, 230 MJ/m{sup 3}. On the other hand, the crush stability was markedly better. The average deviation of the crush load about the mean was as small as 3.5% with themore » cyclic polyester matrix, in contrast to about 12% with the vinyl ester matrix. The higher ductility of the cyclic polyester and the good fiber-matrix bond strength together resulted in less fracturing of the matrix and more uniform kink-band formation across the composite cross section than occurred with the vinyl ester matrix. There was also a reduction in the tendency for fibers at the periphery of the rod to splay outward rather than being crushed. Of the two rubber-toughened vinyl ester matrices, a 30% reduction was found in the average deviation of the crush load about the mean with the matrix toughened with a core-shell material, although no improvement was found with the CTBN rubber-modified vinyl ester resin.« less

Analysis of coke beverages by total-reflection X-ray fluorescence

NASA Astrophysics Data System (ADS)

Fernández-Ruiz, Ramón; von Bohlen, Alex; Friedrich K, E. Josue; Redrejo, M. J.

2018-07-01

The influence of the organic content, sample preparation process and the morphology of the depositions of two types of Coke beverage, traditional and light Coke, have been investigated by mean of Total-reflection X-ray Fluorescence (TXRF) spectrometry. Strong distortions of the nominal concentration values, up to 128% for P, have been detected in the analysis of traditional Coke by different preparation methods. These differences have been correlated with the edge X-ray energies of the elements analyzed being more pronounced for the lighter elements. The influence of the organic content (mainly sugar) was evaluated comparing traditional and light Coke analytical TXRF results. Three sample preparation methods have been evaluated as follows: direct TXRF analysis of the sample only adding internal standard, TXRF analysis after open vessel acid digestion and TXRF analysis after high pressure and temperature microwave-assisted acid digestion. Strong correlations were detected between quantitative results, methods of preparation and energies of the X-ray absorption edges of quantified elements. In this way, a decay behavior for the concentration differences between preparation methods and the energies of the X-ray absorption edges of each element were observed. The observed behaviors were modeled with exponential decay functions obtaining R2 correlation coefficients from 0.989 to 0.992. The strong absorption effect observed, and even possible matrix effect, can be explained by the inherent high organic content of the evaluated samples and also by the morphology and average thickness of the TXRF depositions observed. As main conclusion of this work, the analysis of light elements in samples with high organic content by TXRF, i.e. medical, biological, food or any other organic matrixes should be taken carefully. In any case, the direct analysis is not recommended and a previous microwave-assisted acid digestion, or similar, is mandatory, for the correct elemental quantification by TXRF.

Investigation of the fiber/matrix interphase under high loading rates

NASA Astrophysics Data System (ADS)

Tanoglu, Metin

2000-10-01

This research focuses on characterization of the interphases of various sized E-glass-fiber/epoxy-amine systems under high loading rates. The systems include unsized, epoxy-amine compatible, and epoxy-amine incompatible glass fibers. A new experimental technique (dynamic micro-debonding technique) was developed to directly characterize the fiber/matrix interphase properties under various loading rates. Displacement rates of up to 3000 mum/sec that induce high-strain-rate interphase loading were obtained using the rapid expansion capability of the piezoelectric actuators (PZT). A straightforward data reduction scheme, which does not require complex numerical solutions, was also developed by employing thin specimens. This method enables quantification of the strength and specific absorbed energies due to debonding and frictional sliding. Moreover, the technique offers the potential to obtain the shear stress/strain response of the interphases at various rates. A new methodology was also developed to independently investigate the properties of the fiber/matrix interphase. This methodology is based on the assumption that the portion of sizing bound to the glass fiber strongly affects the interphase formation. Conventional burnout and acetone extraction experiments in conjunction with nuclear magnetic spectroscopy were used to determine the composition of the bound sizing. Using the determined composition, model interphase compounds were made to replicate the actual interphase and tested utilizing dynamic mechanical analyzer (DMA) and differential scanning calorimeter (DSC) techniques. The rate-dependent behavior of the model interphase materials and the bulk epoxy matrix were characterized by constructing storage modulus master curves as a function of strain rate using the time-temperature superposition principle. The results of dynamic micro-debonding experiments showed that the values of interphase strength and specific absorbed energies vary dependent on the sizing and exhibited significant sensitivity to loading rates. The unsized fibers exhibit greater energy-absorbing capability that could provide better ballistic resistance while the compatible sized fibers show higher strength values that improve the structural integrity of the polymeric composites. The calculated interphase shear modulus values from micro-debonding experiments increase with the loading rate consistent with DMA results. In addition, significantly higher amounts of energy are absorbed within the frictional sliding regime compared to debonding. Characterization of model interphase compounds revealed that the interphase formed due to the presence of bound sizing has a Tg below room temperature, a modulus more compliant than that of the bulk matrix, and a thickness of about 10 nm. The results showed that the properties of the interphases are significantly affected by the interphase network structure.

Conservative supra-characteristics method for splitting the hyperbolic systems of gasdynamics for real and perfect gases

NASA Technical Reports Server (NTRS)

Lombard, C. K.

1982-01-01

A conservative flux difference splitting is presented for the hyperbolic systems of gasdynamics. The stable robust method is suitable for wide application in a variety of schemes, explicit or implicit, iterative or direct, for marching in either time or space. The splitting is modeled on the local quasi one dimensional characteristics system for multi-dimensional flow similar to Chakravarthy's nonconservative split coefficient matrix method; but, as the result of maintaining global conservation, the method is able to capture sharp shocks correctly. The embedded characteristics formulation is cast in a primitive variable the volumetric internal energy (rather than the pressure) that is effective for treating real as well as perfect gases. Finally the relationship of the splitting to characteristics boundary conditions is discussed and the associated conservative matrix formulation for a computed blown wall boundary condition is developed as an example. The theoretical development employs and extends the notion of Roe of constructing stable upwind difference formulae by sending split simple one sided flux difference pieces to appropriate mesh sites. The developments are also believed to have the potential for aiding in the analysis of both existing and new conservative difference schemes.

Application of Semi-Definite Programming for Many-Fermion Systems

NASA Astrophysics Data System (ADS)

Zhao, Zhengji; Braams, Bastiaan; Fukuda, Mituhiro; Overton, Michael

2003-03-01

The ground state energy and other important observables of a many-fermion system with one- and two-body interactions only can all be obtained from the first order and second order Reduced Density Matrices (RDM's) of the system. Using these density matrices and a family of associated representability conditions one may obtain an approximation method for electronic structure theory that is in the mathematical form of Semi-Definite Programming (SDP): minimize a linear matrix functional over a space of positive semidefinite matrices subject to linear constraints. The representability conditions are some known necessary conditions, starting with the well-known P, Q, and G conditions [Claude Garrod and Jerome K. Percus, Reducation of the N-Particle Variational Problem, J. Math. Phys. 5 (1964) 1756-1776]. The RDM method with SDP has great potential advantages over the wave function method when the particle number N is large. The dimension of the full configuration space increases exponentially with N, but in RDM method with SDP the dimension of the objective matrix (which includes RDM's) increases only polynomially with N. We will report on the effect of adding the generalized three-index conditions proposed in [R. M. Erdahl, Representability, Int. J. Quantum Chem. 13 (1978) 697-718].

Analysis of mechanical properties anisotropy of nanomodified carbon fibre-reinforced woven composites

NASA Astrophysics Data System (ADS)

Ruslantsev, A. N.; Portnova, Ya M.; Tairova, L. P.; Dumansky, A. M.

2016-10-01

The polymer binder cracking problem arises while designing and maintaining polymer composite-based aircraft load-bearing members. Some technological methods are used to solve this problem. In particular the injection of nanoagents can block the initiation and growth of microscopic cracks. Crack propagation can also be blocked if the strain energy release is not related with fracturing. One of the possible ways for such energy release is creep. Testing of the anisotropy of the woven carbon fibre reinforced plastic elastic characteristics and creep have been conducted. The samples with different layouts have been made of woven carbon fibre laminate BMI-3/3692 with nanomodified bismaleimide matrix. This matrix has a higher glass transition temperature and improved mechanical properties. The deformation regularities have been analyzed, layer elastic characteristics have been determined. The constitutive equations describing composite material creep have been obtained and its parameters have been defined. Experimental and calculated creep curves have been plotted. It was found that the effects of rheology arise as the direction of load does not match the direction of reinforcing fibres of the material.

Total rate imaging with x-rays (TRIX)--a simple method of forming a non-projection x-ray image in the SEM using an energy dispersive detector and its application to biological specimens.

PubMed

Ingram, P; Shelburne, J D

1980-01-01

X-ray images can be formed in a conventional scanning electron microscope equipped with a Si(Li) energy dispersive spectrometer. All the x-ray events generated in the electron beam scanning process are synchronously displayed in the same manner as for dot maps. The quasi-digital image formed using Total Rate Imaging with X-rays (TRIX) exhibits good gray scale contrast and is dependent on topography, orientation and atomic number. Although this latter dependence is complex, it has been found useful in locating several types of inclusions in lung tissue (silicosis), human alveolar macrophages and cigarette smoke condensate. This is because of the greater depth of penetration of x-rays than backscattered electrons (BSE) usually used for such localizations in a matrix, and the negligible sensitivity of the Si(Li) detector to x-rays from an organic biological matrix. The optimum procedure is to use a combination of TRIX and BSE to investigate such specimens.

Quasi-degenerate perturbation theory using matrix product states

NASA Astrophysics Data System (ADS)

Sharma, Sandeep; Jeanmairet, Guillaume; Alavi, Ali

2016-01-01

In this work, we generalize the recently proposed matrix product state perturbation theory (MPSPT) for calculating energies of excited states using quasi-degenerate (QD) perturbation theory. Our formulation uses the Kirtman-Certain-Hirschfelder canonical Van Vleck perturbation theory, which gives Hermitian effective Hamiltonians at each order, and also allows one to make use of Wigner's 2n + 1 rule. Further, our formulation satisfies Granovsky's requirement of model space invariance which is important for obtaining smooth potential energy curves. Thus, when we use MPSPT with the Dyall Hamiltonian, we obtain a model space invariant version of quasi-degenerate n-electron valence state perturbation theory (NEVPT), a property that the usual formulation of QD-NEVPT2 based on a multipartitioning technique lacked. We use our method on the benchmark problems of bond breaking of LiF which shows ionic to covalent curve crossing and the twist around the double bond of ethylene where significant valence-Rydberg mixing occurs in the excited states. In accordance with our previous work, we find that multi-reference linearized coupled cluster theory is more accurate than other multi-reference theories of similar cost.

Wavelets in electronic structure calculations

NASA Astrophysics Data System (ADS)

Modisette, Jason Perry

1997-09-01

Ab initio calculations of the electronic structure of bulk materials and large clusters are not possible on today's computers using current techniques. The storage and diagonalization of the Hamiltonian matrix are the limiting factors in both memory and execution time. The scaling of both quantities with problem size can be reduced by using approximate diagonalization or direct minimization of the total energy with respect to the density matrix in conjunction with a localized basis. Wavelet basis members are much more localized than conventional bases such as Gaussians or numerical atomic orbitals. This localization leads to sparse matrices of the operators that arise in SCF multi-electron calculations. We have investigated the construction of the one-electron Hamiltonian, and also the effective one- electron Hamiltonians that appear in density-functional and Hartree-Fock theories. We develop efficient methods for the generation of the kinetic energy and potential matrices, the Hartree and exchange potentials, and the local exchange-correlation potential of the LDA. Test calculations are performed on one-electron problems with a variety of potentials in one and three dimensions.

Optimized Projection Matrix for Compressive Sensing

NASA Astrophysics Data System (ADS)

Xu, Jianping; Pi, Yiming; Cao, Zongjie

2010-12-01

Compressive sensing (CS) is mainly concerned with low-coherence pairs, since the number of samples needed to recover the signal is proportional to the mutual coherence between projection matrix and sparsifying matrix. Until now, papers on CS always assume the projection matrix to be a random matrix. In this paper, aiming at minimizing the mutual coherence, a method is proposed to optimize the projection matrix. This method is based on equiangular tight frame (ETF) design because an ETF has minimum coherence. It is impossible to solve the problem exactly because of the complexity. Therefore, an alternating minimization type method is used to find a feasible solution. The optimally designed projection matrix can further reduce the necessary number of samples for recovery or improve the recovery accuracy. The proposed method demonstrates better performance than conventional optimization methods, which brings benefits to both basis pursuit and orthogonal matching pursuit.

HO2 rovibrational eigenvalue studies for nonzero angular momentum

NASA Astrophysics Data System (ADS)

Wu, Xudong T.; Hayes, Edward F.

1997-08-01

An efficient parallel algorithm is reported for determining all bound rovibrational energy levels for the HO2 molecule for nonzero angular momentum values, J=1, 2, and 3. Performance tests on the CRAY T3D indicate that the algorithm scales almost linearly when up to 128 processors are used. Sustained performance levels of up to 3.8 Gflops have been achieved using 128 processors for J=3. The algorithm uses a direct product discrete variable representation (DVR) basis and the implicitly restarted Lanczos method (IRLM) of Sorensen to compute the eigenvalues of the polyatomic Hamiltonian. Since the IRLM is an iterative method, it does not require storage of the full Hamiltonian matrix—it only requires the multiplication of the Hamiltonian matrix by a vector. When the IRLM is combined with a formulation such as DVR, which produces a very sparse matrix, both memory and computation times can be reduced dramatically. This algorithm has the potential to achieve even higher performance levels for larger values of the total angular momentum.

Matrix Optical Absorption in UV-MALDI MS

NASA Astrophysics Data System (ADS)

Robinson, Kenneth N.; Steven, Rory T.; Bunch, Josephine

2018-03-01

In ultraviolet matrix-assisted laser desorption/ionization mass spectrometry (UV-MALDI MS) matrix compound optical absorption governs the uptake of laser energy, which in turn has a strong influence on experimental results. Despite this, quantitative absorption measurements are lacking for most matrix compounds. Furthermore, despite the use of UV-MALDI MS to detect a vast range of compounds, investigations into the effects of laser energy have been primarily restricted to single classes of analytes. We report the absolute solid state absorption spectra of the matrix compounds α-cyano-4-hydroxycinnamic acid (CHCA), para-nitroaniline (PNA), 2-mercaptobenzothiazole (MBT), 2,5-dihydroxybenzoic acid (2,5-DHB), and 2,4,6-trihydroxyacetophenone (THAP). The desorption/ionization characteristics of these matrix compounds with respect to laser fluence was investigated using mixed systems of matrix with either angiotensin II, PC(34:1) lipid standard, or haloperidol, acting as representatives for typical classes of analyte encountered in UV-MALDI MS. The first absolute solid phase spectra for PNA, MBT, and THAP are reported; additionally, inconsistencies between previously published spectra for CHCA are resolved. In light of these findings, suggestions are made for experimental optimization with regards to matrix and laser wavelength selection. The relationship between matrix optical cross-section and wavelength-dependant threshold fluence, fluence of maximum ion yield, and R, a new descriptor for the change in ion intensity with fluence, are described. A matrix cross-section of 1.3 × 10-17 cm-2 was identified as a potential minimum for desorption/ionization of analytes.

Matrix Optical Absorption in UV-MALDI MS.

PubMed

Robinson, Kenneth N; Steven, Rory T; Bunch, Josephine

2018-03-01

In ultraviolet matrix-assisted laser desorption/ionization mass spectrometry (UV-MALDI MS) matrix compound optical absorption governs the uptake of laser energy, which in turn has a strong influence on experimental results. Despite this, quantitative absorption measurements are lacking for most matrix compounds. Furthermore, despite the use of UV-MALDI MS to detect a vast range of compounds, investigations into the effects of laser energy have been primarily restricted to single classes of analytes. We report the absolute solid state absorption spectra of the matrix compounds α-cyano-4-hydroxycinnamic acid (CHCA), para-nitroaniline (PNA), 2-mercaptobenzothiazole (MBT), 2,5-dihydroxybenzoic acid (2,5-DHB), and 2,4,6-trihydroxyacetophenone (THAP). The desorption/ionization characteristics of these matrix compounds with respect to laser fluence was investigated using mixed systems of matrix with either angiotensin II, PC(34:1) lipid standard, or haloperidol, acting as representatives for typical classes of analyte encountered in UV-MALDI MS. The first absolute solid phase spectra for PNA, MBT, and THAP are reported; additionally, inconsistencies between previously published spectra for CHCA are resolved. In light of these findings, suggestions are made for experimental optimization with regards to matrix and laser wavelength selection. The relationship between matrix optical cross-section and wavelength-dependant threshold fluence, fluence of maximum ion yield, and R, a new descriptor for the change in ion intensity with fluence, are described. A matrix cross-section of 1.3 × 10 -17 cm -2 was identified as a potential minimum for desorption/ionization of analytes. Graphical Abstract ᅟ.

Sum-rule corrections: a route to error cancellations in correlation matrix renormalisation theory

NASA Astrophysics Data System (ADS)

Liu, C.; Liu, J.; Yao, Y. X.; Wang, C. Z.; Ho, K. M.

2017-03-01

We recently proposed the correlation matrix renormalisation (CMR) theory to efficiently and accurately calculate ground state total energy of molecular systems, based on the Gutzwiller variational wavefunction (GWF) to treat the electronic correlation effects. To help reduce numerical complications and better adapt the CMR to infinite lattice systems, we need to further refine the way to minimise the error originated from the approximations in the theory. This conference proceeding reports our recent progress on this key issue, namely, we obtained a simple analytical functional form for the one-electron renormalisation factors, and introduced a novel sum-rule correction for a more accurate description of the intersite electron correlations. Benchmark calculations are performed on a set of molecules to show the reasonable accuracy of the method.

Laser-assisted photothermal imprinting of nanocomposite

NASA Astrophysics Data System (ADS)

Lu, Y.; Shao, D. B.; Chen, S. C.

2004-08-01

We report on a laser-assisted photothermal imprinting method for directly patterning carbon nanofiber-reinforced polyethylene nanocomposite. A single laser pulse from a solid state Nd :YAG laser (10ns pluse, 532 and 355nm wavelengths) is used to melt/soften a thin skin layer of the polymer nanocomposite. Meanwhile, a fused quartz mold with micro sized surface relief structures is pressed against the surface of the composite. Successful pattern transfer is realized upon releasing the quartz mold. Although polyethylene is transparent to the laser beam, the carbon nanofibers in the high density polyethylene (HDPE) matrix absorb the laser energy and convert it into heat. Numerical heat conduction simulation shows the HDPE matrix is partially melted or softened, allowing for easier imprinting of the relief pattern of the quartz mold.

Broadband optical properties of graphene and HOPG investigated by spectroscopic Mueller matrix ellipsometry

NASA Astrophysics Data System (ADS)

Song, Baokun; Gu, Honggang; Zhu, Simin; Jiang, Hao; Chen, Xiuguo; Zhang, Chuanwei; Liu, Shiyuan

2018-05-01

Optical properties of mono-graphene fabricated by chemical vapor deposition (CVD) and highly oriented pyrolytic graphite (HOPG) are comparatively studied by Mueller matrix ellipsometry (MME) over an ultra-wide energy range of 0.73-6.42 eV. A multilayer stacking model is constructed to describe the CVD mono-graphene, in which the roughness of the glass substrate and the water adsorption on the graphene are considered. We introduce a uniaxial anisotropic dielectric model to parameterize the optical constants of both the graphene and the HOPG. With the established models, broadband optical constants of the graphene and the HOPG are determined from the Mueller matrix spectra based on a point-by-point method and a non-linear regression method, respectively. Two significant absorption peaks at 4.75 eV and 6.31 eV are observed in the extinction coefficient spectra of the mono-graphene, which can be attributed to the von-Hove singularity (i.e., the π-to-π∗ exciton transition) near the M point and the σ-to-σ∗ exciton transition near the Γ point of the Brillouin zone, respectively. Comparatively, only a major absorption peak at 4.96 eV appears in the ordinary extinction coefficient spectra of the HOPG, which is mainly formed by the π-to-π∗ interband transition.

Scenarios and methods that induce protruding or released CNTs after degradation of nanocomposite materials.

PubMed

Hirth, Sabine; Cena, Lorenzo; Cox, Gerhard; Tomović, Zeljko; Peters, Thomas; Wohlleben, Wendel

2013-04-01

Nanocomposite materials may be considered as a low-risk application of nanotechnology, if the nanofillers remain embedded throughout the life-cycle of the products in which they are embedded. We hypothesize that release of free CNTs occurs by a combination of mechanical stress and chemical degradation of the polymer matrix. We experimentally address limiting cases: Mechanically released fragments may show tubular protrusions on their surface. Here we identify these protrusions unambiguously as naked CNTs by chemically resolved microscopy and a suitable preparation protocol. By size-selective quantification of fragments we establish as a lower limit that at least 95 % of the CNTs remain embedded. Contrary to classical fiber composite approaches, we link this phenomenon to matrix materials with only a few percent elongation at break, predicting which materials should still cover their CNT nanofillers after machining. Protruding networks of CNTs remain after photochemical degradation of the matrix, and we show that it takes the worst case combinations of weathering plus high-shear wear to release free CNTs in the order of mg/m 2 /year. Synergy of chemical degradation and mechanical energy input is identified as the priority scenario of CNT release, but its lab simulation by combined methods is still far from real-world validation.

Magnetic response of gelatin ferrogels across the sol-gel transition: the influence of high energy crosslinking on thermal stability.

PubMed

Wisotzki, Emilia I; Eberbeck, Dietmar; Kratz, Harald; Mayr, Stefan G

2016-05-07

As emerging responsive materials, ferrogels have demonstrated significant potential for applications in areas of engineering to regenerative medicine. Promising techniques to study the behavior of magnetic nanoparticles (MNPs) in such matrices include magnetic particle spectroscopy (MPS) and magnetorelaxometry (MRX). This work investigated the magnetic response of gelatin-based ferrogels with increasing temperatures, before and after high energy crosslinking. The particle response was characterized by the nonlinear magnetization using MPS and quasistatic magnetization measurements as well as MRX to discriminate between Néel and Brownian relaxation mechanisms. The effective magnetic response of MNPs in gelatin was suppressed, indicating that the magnetization of the ferrogels was strongly influenced by competing dipole-dipole interactions. Significant changes in the magnetic behavior were observed across the gelatin sol-gel transition, as influenced by the matrix viscosity. These relaxation processes were modeled by Fourier transformation of the Langevin function, combined with a Debye term for the nonlinear magnetic response, for single core MNPs embedded in matrices of changing viscosities. Using high energy electron irradiation as a crosslinking method, modified ferrogels exhibited thermal stability on a range of timescales. However, MRX relaxation times revealed a slight softening around the gelatin sol-gel transition felt by the smallest particles, demonstrating a high sensitivity to observe local changes in the viscoelasticity. Overall, MPS and MRX functioned as non-contact methods to observe changes in the nanorheology around the native sol-gel transition and in crosslinked ferrogels, as well as provided an understanding of how MNPs were integrated into and influenced by the surrounding matrix.

Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully’s fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronicmore » wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.« less

Is energy pooling necessary in ultraviolet matrix-assisted laser desorption/ionization?

PubMed

Lin, Hou-Yu; Song, Botao; Lu, I-Chung; Hsu, Kuo-Tung; Liao, Chih-Yu; Lee, Yin-Yu; Tseng, Chien-Ming; Lee, Yuan-Tseh; Ni, Chi-Kung

2014-01-15

Energy pooling has been suggested as the key process for generating the primary ions during ultraviolet matrix-assisted laser desorption/ionization (UV-MALDI). In previous studies, decreases in fluorescence quantum yields as laser fluence increased for 2-aminobenzoic acid, 2,5-dihydroxybenzoic acid (2,5-DHB), and 3-hydroxypicolinic acid were used as evidence of energy pooling. This work extends the research to other matrices and addresses whether energy pooling is a universal property in UV-MALDI. Energy pooling was investigated in a time-resolved fluorescence experiment by using a short laser pulse (355 nm, 20 ps pulse width) for excitation and a streak camera (1 ps time resolution) for fluorescence detection. The excited-state lifetime of 2,5-DHB decreased with increases in laser fluence. This suggests that a reaction occurs between two excited molecules, and that energy pooling may be one of the possible reactions. However, the excited-state lifetime of 2,4,6-trihydroxyacetophenone (THAP) did not change with increases in laser fluence. The upper limit of the energy pooling rate constant for THAP is estimated to be approximately 100-500 times smaller than that of 2,5-DHB. The small energy pooling rate constant for THAP indicates that the potential contribution of the energy pooling mechanism to the generation of THAP matrix primary ions should be reconsidered. Copyright © 2013 John Wiley & Sons, Ltd.

Comparison of matrix effects in HPLC-MS/MS and UPLC-MS/MS analysis of nine basic pharmaceuticals in surface waters.

PubMed

Van De Steene, Jet C; Lambert, Willy E

2008-05-01

When developing an LC-MS/MS-method matrix effects are a major issue. The effect of co-eluting compounds arising from the matrix can result in signal enhancement or suppression. During method development much attention should be paid to diminishing matrix effects as much as possible. The present work evaluates matrix effects from aqueous environmental samples in the simultaneous analysis of a group of 9 specific pharmaceuticals with HPLC-ESI/MS/MS and UPLC-ESI/MS/MS: flubendazole, propiconazole, pipamperone, cinnarizine, ketoconazole, miconazole, rabeprazole, itraconazole and domperidone. When HPLC-MS/MS is used, matrix effects are substantial and can not be compensated for with analogue internal standards. For different surface water samples different matrix effects are found. For accurate quantification the standard addition approach is necessary. Due to the better resolution and more narrow peaks in UPLC, analytes will co-elute less with interferences during ionisation, so matrix effects could be lower, or even eliminated. If matrix effects are eliminated with this technique, the standard addition method for quantification can be omitted and the overall method will be simplified. Results show that matrix effects are almost eliminated if internal standards (structural analogues) are used. Instead of the time-consuming and labour-intensive standard addition method, with UPLC the internal standardization can be used for quantification and the overall method is substantially simplified.

R-matrix description of particle energy spectra produced by low-energy 3H + 3H reactions

DOE PAGES

Brune, C. R.; Caggiano, J. A.; Sayre, D. B.; ...

2015-07-20

An R-matrix model for three-body final states is presented and applied to a recent measurement of the neutron energy spectrum from the 3H + 3H→ 2n + α reaction. The calculation includes the n alpha and n n interactions in the final state, angular momentum conservation, antisymmetrization, and the interference between different channels. A good fit to the measured spectrum is obtained, where clear evidence for the 5He ground state is observed. The model is also used to predict the alpha-particle spectrum from 3H + 3H as well as particle spectra from 3He + 3He. The R-matrix approach presented heremore » is very general, and can be adapted to a wide variety of problems with three-body final states.« less

Radiative loss and charge exchange in low energy Na - Ca+ collisions

NASA Astrophysics Data System (ADS)

McLaughlin, B. M.; McAlpine, K.; McCann, J. F.; Pattillo, R.; Stancil, P. C.; Forrey, R. C.; Babb, J. F.

2016-05-01

Experiments on radiative loss and capture are currently being performed at the University of Connecticut. In response to this experimental effort we have performed detailed calculations for a variety of loss and capture processes. Several low lying states of the NaCa+ cation are used with the accurate potentials energy curves, transition dipole moments and non-adiabatic coupling matrix elements between the states, obtained at the MRCI+Q level of approximation with the MOLPRO suite of quantum chemistry codes. Cross sections and rate coefficients are calculated for radiative charge transfer (RCX), radiative association (RA) and charge exchange in a fully quantum molecular close-coupling (MOCC) approximation at the higher energies. We use a variety of approaches, the optical potential method, semi-classical and MOCC methods to compare and contrast approximations. In addition a kinetic theory recently applied to SiO is utilized which illustrates the dramatic impact resonances have on the radiative association rates. Supported by NASA and HLRS at Stuttgart University.

Darkness without dark matter and energy - generalized unimodular gravity

NASA Astrophysics Data System (ADS)

Barvinsky, A. O.; Kamenshchik, A. Yu.

2017-11-01

We suggest a Lorentz non-invariant generalization of the unimodular gravity theory, which is classically equivalent to general relativity with a locally inert (devoid of local degrees of freedom) perfect fluid having an equation of state with a constant parameter w. For the range of w near -1 this dark fluid can play the role of dark energy, while for w = 0 this dark dust admits spatial inhomogeneities and can be interpreted as dark matter. We discuss possible implications of this model in the cosmological initial conditions problem. In particular, this is the extension of known microcanonical density matrix predictions for the initial quantum state of the closed cosmology to the case of spatially open Universe, based on the imitation of the spatial curvature by the dark fluid density. We also briefly discuss quantization of this model necessarily involving the method of gauge systems with reducible constraints and the effect of this method on the treatment of recently! suggested mechanism of vacuum energy sequestering.

Current density characteristics in the studies of electromagnetically induced transparency in a GaAs/GaAlAs quantum well

NASA Astrophysics Data System (ADS)

Jayarubi, J.; Peter, A. John

2017-05-01

Confinement potential profiles due to conduction and valence bands are obtained in a Ga0.7Al0.3As/ GaAs/ Ga0.7Al0.3As using variation formulism. The free electron distribution is carried out. The confined energy eigenvalue and its corresponding wavefunctions of charge carriers are found using self-consistent method. The confined energies with the geometrical confinement are computed. The potentials due to charges are done by Poisson equation. The effects of dielectric mismatch between the GaAs and GaAlAs semiconductors are introduced in the effective potential expressions. Transfer matrix method is employed to obtain the respective energies. The transmission probability is obtained for a constant well size. The high current density characteristics as a function of applied voltage is investigated. This investigation on the electromagnetically induced transparency in the photonic material will exploit in fabricating novel nonlinear optical devices in future.

Ghost peaks observed after AP-MALDI experiment may disclose new ionization mechanism of matrix assisted hypersonic velocity impact ionization

PubMed Central

Moskovets, Eugene

2015-01-01

RATIONALE Understanding the mechanisms of MALDI promises improvements in the sensitivity and specificity of many established applications in the field of mass spectrometry. This paper reports a serendipitous observation of a significant ion yield in a post-ionization experiment conducted after the sample has been removed from a standard atmospheric pressure (AP)-MALDI source. This post-ionization is interpreted in terms of collisions of microparticles moving with a hypersonic velocity into a solid surface. Calculations show that the thermal energy released during such collisions is close to that absorbed by the top matrix layer in traditional MALDI. The microparticles, containing both the matrix and analytes, could be detached from a film produced inside the inlet capillary during the sample ablation and accelerated by the flow rushing through the capillary. These observations contribute some new perspective to ion formation in both laser and laserless matrix-assisted ionization. METHODS An AP-MALDI ion source hyphenated with a three-stage high-pressure ion funnel system was utilized for peptide mass analysis. After the laser was turned off and MALDI sample was removed, ions were detected during a gradual reduction of the background pressure in the first funnel. The constant-rate pressure reduction led to the reproducible appearance of different singly- and doubly-charged peptide peaks in mass spectra taken a few seconds after the end of the MALDI analysis of a dried-droplet spot. RESULTS The ion yield as well as the mass range of ions observed with a significant delay after a completion of the primary MALDI analysis depended primarily on the background pressure inside the first funnel. The production of ions in this post-ionization step was exclusively observed during the pressure drop. A lower matrix background and significant increase in relative yield of double-protonated ions are reported. CONCLUSIONS The observations were partially consistent with a model of the supersonic jet from the inlet capillary accelerating detached particles to kinetic energies suitable for matrix-assisted hypersonic-velocity impact ionization. PMID:26212165

KANTBP: A program for computing energy levels, reaction matrix and radial wave functions in the coupled-channel hyperspherical adiabatic approach

NASA Astrophysics Data System (ADS)

Chuluunbaatar, O.; Gusev, A. A.; Abrashkevich, A. G.; Amaya-Tapia, A.; Kaschiev, M. S.; Larsen, S. Y.; Vinitsky, S. I.

2007-10-01

A FORTRAN 77 program is presented which calculates energy values, reaction matrix and corresponding radial wave functions in a coupled-channel approximation of the hyperspherical adiabatic approach. In this approach, a multi-dimensional Schrödinger equation is reduced to a system of the coupled second-order ordinary differential equations on the finite interval with homogeneous boundary conditions of the third type. The resulting system of radial equations which contains the potential matrix elements and first-derivative coupling terms is solved using high-order accuracy approximations of the finite-element method. As a test desk, the program is applied to the calculation of the energy values and reaction matrix for an exactly solvable 2D-model of three identical particles on a line with pair zero-range potentials. Program summaryProgram title: KANTBP Catalogue identifier: ADZH_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADZH_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 4224 No. of bytes in distributed program, including test data, etc.: 31 232 Distribution format: tar.gz Programming language: FORTRAN 77 Computer: Intel Xeon EM64T, Alpha 21264A, AMD Athlon MP, Pentium IV Xeon, Opteron 248, Intel Pentium IV Operating system: OC Linux, Unix AIX 5.3, SunOS 5.8, Solaris, Windows XP RAM: depends on (a) the number of differential equations; (b) the number and order of finite-elements; (c) the number of hyperradial points; and (d) the number of eigensolutions required. Test run requires 30 MB Classification: 2.1, 2.4 External routines: GAULEG and GAUSSJ [W.H. Press, B.F. Flanery, S.A. Teukolsky, W.T. Vetterley, Numerical Recipes: The Art of Scientific Computing, Cambridge University Press, Cambridge, 1986] Nature of problem: In the hyperspherical adiabatic approach [J. Macek, J. Phys. B 1 (1968) 831-843; U. Fano, Rep. Progr. Phys. 46 (1983) 97-165; C.D. Lin, Adv. Atom. Mol. Phys. 22 (1986) 77-142], a multi-dimensional Schrödinger equation for a two-electron system [A.G. Abrashkevich, D.G. Abrashkevich, M. Shapiro, Comput. Phys. Comm. 90 (1995) 311-339] or a hydrogen atom in magnetic field [M.G. Dimova, M.S. Kaschiev, S.I. Vinitsky, J. Phys. B 38 (2005) 2337-2352] is reduced by separating the radial coordinate ρ from the angular variables to a system of second-order ordinary differential equations which contain potential matrix elements and first-derivative coupling terms. The purpose of this paper is to present the finite-element method procedure based on the use of high-order accuracy approximations for calculating approximate eigensolutions for such systems of coupled differential equations. Solution method: The boundary problems for coupled differential equations are solved by the finite-element method using high-order accuracy approximations [A.G. Abrashkevich, D.G. Abrashkevich, M.S. Kaschiev, I.V. Puzynin, Comput. Phys. Comm. 85 (1995) 40-64]. The generalized algebraic eigenvalue problem AF=EBF with respect to pair unknowns ( E,F) arising after the replacement of the differential problem by the finite-element approximation is solved by the subspace iteration method using the SSPACE program [K.J. Bathe, Finite Element Procedures in Engineering Analysis, Englewood Cliffs, Prentice-Hall, New York, 1982]. The generalized algebraic eigenvalue problem (A-EB)F=λDF with respect to pair unknowns (λ,F) arising after the corresponding replacement of the scattering boundary problem in open channels at fixed energy value, E, is solved by the LDL factorization of symmetric matrix and back-substitution methods using the DECOMP and REDBAK programs, respectively [K.J. Bathe, Finite Element Procedures in Engineering Analysis, Englewood Cliffs, Prentice-Hall, New York, 1982]. As a test desk, the program is applied to the calculation of the energy values and reaction matrix for an exactly solvable 2D-model of three identical particles on a line with pair zero-range potentials described in [Yu. A. Kuperin, P.B. Kurasov, Yu.B. Melnikov, S.P. Merkuriev, Ann. Phys. 205 (1991) 330-361; O. Chuluunbaatar, A.A. Gusev, S.Y. Larsen, S.I. Vinitsky, J. Phys. A 35 (2002) L513-L525; N.P. Mehta, J.R. Shepard, Phys. Rev. A 72 (2005) 032728-1-11; O. Chuluunbaatar, A.A. Gusev, M.S. Kaschiev, V.A. Kaschieva, A. Amaya-Tapia, S.Y. Larsen, S.I. Vinitsky, J. Phys. B 39 (2006) 243-269]. For this benchmark model the needed analytical expressions for the potential matrix elements and first-derivative coupling terms, their asymptotics and asymptotics of radial solutions of the boundary problems for coupled differential equations have been produced with help of a MAPLE computer algebra system. Restrictions: The computer memory requirements depend on: (a) the number of differential equations; (b) the number and order of finite-elements; (c) the total number of hyperradial points; and (d) the number of eigensolutions required. Restrictions due to dimension sizes may be easily alleviated by altering PARAMETER statements (see Long Write-Up and listing for details). The user must also supply subroutine POTCAL for evaluating potential matrix elements. The user should supply subroutines ASYMEV (when solving the eigenvalue problem) or ASYMSC (when solving the scattering problem) that evaluate the asymptotics of the radial wave functions at the right boundary point in case of a boundary condition of the third type, respectively. Running time: The running time depends critically upon: (a) the number of differential equations; (b) the number and order of finite-elements; (c) the total number of hyperradial points on interval [0,ρ]; and (d) the number of eigensolutions required. The test run which accompanies this paper took 28.48 s without calculation of matrix potentials on the Intel Pentium IV 2.4 GHz.

Ferroelectric polymer-ceramic composite thick films for energy storage applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Paritosh; Borkar, Hitesh; Singh, B. P.

2014-08-15

We have successfully fabricated large area free standing polyvinylidene fluoride -Pb(Zr{sub 0.52}Ti{sub 0.48})O{sub 3} (PVDF-PZT) ferroelectric polymer-ceramic composite (wt% 80–20, respectively) thick films with an average diameter (d) ∼0.1 meter and thickness (t) ∼50 μm. Inclusion of PZT in PVDF matrix significantly enhanced dielectric constant (from 10 to 25 at 5 kHz) and energy storage capacity (from 11 to 14 J/cm{sup 3}, using polarization loops), respectively, and almost similar leakage current and mechanical strength. Microstructural analysis revealed the presence of α and β crystalline phases and homogeneous distribution of PZT crystals in PVDF matrix. It was also found that apartmore » from the microcrystals, well defined naturally developed PZT nanocrystals were embedded in PVDF matrix. The observed energy density indicates immense potential in PVDF-PZT composites for possible applications as green energy and power density electronic elements.« less

Piezoelectric T-matrix approach and multiple scattering of electroacoustic waves in thin plates

NASA Astrophysics Data System (ADS)

Darabi, Amir; Ruzzene, Massimo; Leamy, Michael J.

2017-12-01

Metamaterial-enhanced harvesting (MEH) of wave energy in thin plates and other structures has appeared recently for powering small sensors and devices. To support continued MEH concept development, this paper proposes a fully coupled T-matrix formulation for analyzing scattering of incident wave energy from a piezoelectric patch attached to a thin plate. More generally, the T-matrix represents an input-output relationship between incident and reflected waves from inclusions in a host layer, and is introduced herein for a piezoelectric patch connected to an external circuit. The utility of a T-matrix formalism is most apparent in scenarios employing multiple piezoelectric harvesters, where it can be re-used with other T-matrices (such as those previously formulated for rigid, void, and elastic inclusions) in a multiple scattering context to compute the total wavefield and other response quantities, such as harvested power. Following development of the requisite T-matrix, harvesting in an example funnel-shaped metamaterial waveguide structure is predicted using the multiple scattering approach. Enhanced wave energy harvesting predictions are verified through comparisons to experimental results of a funnel-shaped waveguide formed by placing rigid aluminum inclusions in, and multiple piezoelectric harvesters on, a Lexan plate. Good agreement with predicted response quantities is noted.

Continuum Level Density of a Coupled-Channel System in the Complex Scaling Method

NASA Astrophysics Data System (ADS)

Suzuki, R.; Kruppa, A. T.; Giraud, B. G.; Katō, K.

2008-06-01

We study the continuum level density (CLD) in the formalism of the complex scaling method (CSM) for coupled-channel systems. We apply the formalism to the ^{4}He = [^{3}H + p] + [^3{He} + n] coupled-channel cluster model where there are resonances at low energy. Numerical calculations of the CLD in the CSM with a finite number of L^{2} basis functions are consistent with the exact result calculated from the S-matrix by solving coupled-channel equations. We also study channel densities. In this framework, the extended completeness relation (ECR) plays an important role.

Study of CdTe quantum dots grown using a two-step annealing method

NASA Astrophysics Data System (ADS)

Sharma, Kriti; Pandey, Praveen K.; Nagpal, Swati; Bhatnagar, P. K.; Mathur, P. C.

2006-02-01

High size dispersion, large average radius of quantum dot and low-volume ratio has been a major hurdle in the development of quantum dot based devices. In the present paper, we have grown CdTe quantum dots in a borosilicate glass matrix using a two-step annealing method. Results of optical characterization and the theoretical model of absorption spectra have shown that quantum dots grown using two-step annealing have lower average radius, lesser size dispersion, higher volume ratio and higher decrease in bulk free energy as compared to quantum dots grown conventionally.

Collectivity in the light radon nuclei measured directly via Coulomb excitation

NASA Astrophysics Data System (ADS)

Gaffney, L. P.; Robinson, A. P.; Jenkins, D. G.; Andreyev, A. N.; Bender, M.; Blazhev, A.; Bree, N.; Bruyneel, B.; Butler, P. A.; Cocolios, T. E.; Davinson, T.; Deacon, A. N.; De Witte, H.; DiJulio, D.; Diriken, J.; Ekström, A.; Fransen, Ch.; Freeman, S. J.; Geibel, K.; Grahn, T.; Hadinia, B.; Hass, M.; Heenen, P.-H.; Hess, H.; Huyse, M.; Jakobsson, U.; Kesteloot, N.; Konki, J.; Kröll, Th.; Kumar, V.; Ivanov, O.; Martin-Haugh, S.; Mücher, D.; Orlandi, R.; Pakarinen, J.; Petts, A.; Peura, P.; Rahkila, P.; Reiter, P.; Scheck, M.; Seidlitz, M.; Singh, K.; Smith, J. F.; Van de Walle, J.; Van Duppen, P.; Voulot, D.; Wadsworth, R.; Warr, N.; Wenander, F.; Wimmer, K.; Wrzosek-Lipska, K.; Zielińska, M.

2015-06-01

Background: Shape coexistence in heavy nuclei poses a strong challenge to state-of-the-art nuclear models, where several competing shape minima are found close to the ground state. A classic region for investigating this phenomenon is in the region around Z =82 and the neutron midshell at N =104 . Purpose: Evidence for shape coexistence has been inferred from α -decay measurements, laser spectroscopy, and in-beam measurements. While the latter allow the pattern of excited states and rotational band structures to be mapped out, a detailed understanding of shape coexistence can only come from measurements of electromagnetic matrix elements. Method: Secondary, radioactive ion beams of 202Rn and 204Rn were studied by means of low-energy Coulomb excitation at the REX-ISOLDE in CERN. Results: The electric-quadrupole (E 2 ) matrix element connecting the ground state and first excited 21+ state was extracted for both 202Rn and 204Rn, corresponding to B (E 2 ;21+→01+) =29-8+8 and 43-12+17 W.u., respectively. Additionally, E 2 matrix elements connecting the 21+ state with the 41+ and 22+ states were determined in 202Rn. No excited 0+ states were observed in the current data set, possibly owing to a limited population of second-order processes at the currently available beam energies. Conclusions: The results are discussed in terms of collectivity and the deformation of both nuclei studied is deduced to be weak, as expected from the low-lying level-energy schemes. Comparisons are also made to state-of-the-art beyond-mean-field model calculations and the magnitude of the transitional quadrupole moments are well reproduced.

Fast Low-Rank Bayesian Matrix Completion With Hierarchical Gaussian Prior Models

NASA Astrophysics Data System (ADS)

Yang, Linxiao; Fang, Jun; Duan, Huiping; Li, Hongbin; Zeng, Bing

2018-06-01

The problem of low rank matrix completion is considered in this paper. To exploit the underlying low-rank structure of the data matrix, we propose a hierarchical Gaussian prior model, where columns of the low-rank matrix are assumed to follow a Gaussian distribution with zero mean and a common precision matrix, and a Wishart distribution is specified as a hyperprior over the precision matrix. We show that such a hierarchical Gaussian prior has the potential to encourage a low-rank solution. Based on the proposed hierarchical prior model, a variational Bayesian method is developed for matrix completion, where the generalized approximate massage passing (GAMP) technique is embedded into the variational Bayesian inference in order to circumvent cumbersome matrix inverse operations. Simulation results show that our proposed method demonstrates superiority over existing state-of-the-art matrix completion methods.

Elaboration, structural and optical investigations of ZnO/epoxy nanocomposites

NASA Astrophysics Data System (ADS)

Moussa, S.; Namouchi, F.; Guermazi, H.

2015-07-01

Hybrid nanocomposites were elaborated by incorporating ZnO nanoparticles into a transparent epoxy polymer matrix, using the direct dispersion method. The effect of the nanoparticles on the structural and optical properties of the polymer matrix was investigated using Fourier transform infrared (FTIR), Raman and UV-Visible spectroscopies. Nanocomposites FTIR spectra showed a variation of band intensities attributed to nanoparticles agglomeration within the polymer. The UV-Visible measurements showed a redshift on the band gap energy of the nanocomposites differently from neat epoxy resin, caused by interactions between ZnO NPs and polymer chains. Raman spectra confirm these interactions and the formation of hydrogen bonds in the nanocomposites. The UV-Visible transmittance spectra revealed that addition of a very low concentration (0.2wt%) of ZnO nanoparticles to a transparent epoxy matrix would maintain high visible-light transparency. The decrease of transmittance with increasing ZnO percentage is due to light scattering which originates from the agglomeration of nanoparticles in the matrix, the mismatch between the refractive index of ZnO and that of the epoxy matrix, and the increase of the surface roughness of the nanocomposite with increasing ZnO addition. Moreover, the UV-vis absorption spectra revealed that adding more than 1wt% ZnO leads to the improvement of the UV shielding properties of the nanocomposites. These results prove that the elaborated ZnO/epoxy nanocomposites can be used as UV shielding materials.

Electronic excitation induced modifications of structural, electrical and optical properties of Cu-C60 nanocomposite thin films

NASA Astrophysics Data System (ADS)

Inani, H.; Singhal, R.; Sharma, P.; Vishnoi, R.; Ojha, S.; Chand, S.; Sharma, G. D.

2017-09-01

High energy ion irradiation significantly affects the size and shape of nanoparticles in composites. Low concentration metal fraction embedded in fullerene matrix in form of nanocomposites was synthesized by thermal co-evaporation method. Swift heavy ion irradiation was performed with 120 MeV Au ion beam on Cu-C60 nanocomposites at different fluences 1 × 1012, 3 × 1012, 6 × 1012, 1 × 1013 and 3 × 1013 ions/cm2. Absorption spectra demonstrated that absorption intensity of nanocomposite thin film was increased whereas absorption modes of fullerene C60 were diminished with fluence. Rutherford backscattering spectroscopy was also performed to estimate the thickness of the film and atomic metal fraction in matrix and found to be 45 nm and 3%, respectively. Transmission electron microscopy was performed for structural and particle size evaluation of Cu nanoparticles (NPs) in fullerene C60 matrix. A growth of Cu nanoparticles is observed at a fluence of 3 × 1013 ions/cm2 with a bi-modal distribution in fullerene C60. Structural evolution of fullerene C60 matrix with increasing fluence of 120 MeV Au ion beam is studied by Raman spectroscopy which shows the amorphization of matrix (fullerene C60) at lower fluence. The growth of Cu nanoparticles is explained using the phenomena of Ostwald ripening.

A theoretical study of the dissociative recombination of SH+ with electrons through the 2Π states of SH.

PubMed

Kashinski, D O; Talbi, D; Hickman, A P; Di Nallo, O E; Colboc, F; Chakrabarti, K; Schneider, I F; Mezei, J Zs

2017-05-28

A quantitative theoretical study of the dissociative recombination of SH + with electrons has been carried out. Multireference, configuration interaction calculations were used to determine accurate potential energy curves for SH + and SH. The block diagonalization method was used to disentangle strongly interacting SH valence and Rydberg states and to construct a diabatic Hamiltonian whose diagonal matrix elements provide the diabatic potential energy curves. The off-diagonal elements are related to the electronic valence-Rydberg couplings. Cross sections and rate coefficients for the dissociative recombination reaction were calculated with a stepwise version of the multichannel quantum defect theory, using the molecular data provided by the block diagonalization method. The calculated rates are compared with the most recent measurements performed on the ion Test Storage Ring (TSR) in Heidelberg, Germany.

Experimental Study of Thermophysical Properties of Peat Fuel

NASA Astrophysics Data System (ADS)

Mikhailov, A. S.; Piralishvili, Sh. A.; Stepanov, E. G.; Spesivtseva, N. S.

2017-03-01

A study has been made of thermophysical properties of peat pellets of higher-than-average reactivity due to the pretreatment of the raw material. A synchronous differential analysis of the produced pellets was performed to determine the gaseous products of their decomposition by the mass-spectroscopy method. The parameters of the mass loss rate, the heat-release function, the activation energy, the rate constant of the combustion reaction, and the volatile yield were compared to the properties of pellets compressed by the traditional method on a matrix pelletizer. It has been determined that as a result of the peat pretreatment, the yield of volatile components increases and the activation energy of the combustion reaction decreases by 17 and 30% respectively compared with the raw fuel. This determines its prospects for burning in an atomized state at coal-fired thermal electric power plants.

An efficient formulation and implementation of the analytic energy gradient method to the single and double excitation coupled-cluster wave function - Application to Cl2O2

NASA Technical Reports Server (NTRS)

Rendell, Alistair P.; Lee, Timothy J.

1991-01-01

The analytic energy gradient for the single and double excitation coupled-cluster (CCSD) wave function has been reformulated and implemented in a new set of programs. The reformulated set of gradient equations have a smaller computational cost than any previously published. The iterative solution of the linear equations and the construction of the effective density matrices are fully vectorized, being based on matrix multiplications. The new method has been used to investigate the Cl2O2 molecule, which has recently been postulated as an important intermediate in the destruction of ozone in the stratosphere. In addition to reporting computational timings, the CCSD equilibrium geometries, harmonic vibrational frequencies, infrared intensities, and relative energetics of three isomers of Cl2O2 are presented.

Matrix isolation infrared spectra and photochemistry of hydantoin.

PubMed

Ildiz, Gulce Ogruc; Nunes, Cláudio M; Fausto, Rui

2013-01-31

Hydantoin (C(3)H(4)N(2)O(2), 2,4-imidazolidinedione) was isolated in argon matrix at 10 K and its infrared spectrum and unimolecular photochemistry were investigated. The molecular structure of the compound was studied both at the DFT(B3LYP) and MP2 levels of approximation with valence triple- and quadruple-ζ basis sets (6-311++G(d,p); cc-pVQZ). It was concluded that the minima in the potential energy surfaces of the molecule correspond to C(1) symmetry structures. However, the energy barrier separating the two-equivalent-by-symmetry minima stays below their zero-point energy, which makes the C(s) symmetry structure, which separates the two minima, the experimentally relevant one. The electronic structure of the molecule was studied in detail by performing the Natural Bond Orbital analysis of its electronic configuration within the DFT(B3LYP)/cc-pVQZ space. The infrared spectrum of the matrix isolated compound was fully assigned also with help of the theoretically predicted spectrum. Upon irradiation at λ = 230 nm, matrix-isolated hydantoin was found to photofragment into isocyanic acid, CO, and methylenimine.

Quantification of 2D elemental distribution maps of intermediate-thick biological sections by low energy synchrotron μ-X-ray fluorescence spectrometry

NASA Astrophysics Data System (ADS)

Kump, P.; Vogel-Mikuš, K.

2018-05-01

Two fundamental-parameter (FP) based models for quantification of 2D elemental distribution maps of intermediate-thick biological samples by synchrotron low energy μ-X-ray fluorescence spectrometry (SR-μ-XRF) are presented and applied to the elemental analysis in experiments with monochromatic focused photon beam excitation at two low energy X-ray fluorescence beamlines—TwinMic, Elettra Sincrotrone Trieste, Italy, and ID21, ESRF, Grenoble, France. The models assume intermediate-thick biological samples composed of measured elements, the sources of the measurable spectral lines, and by the residual matrix, which affects the measured intensities through absorption. In the first model a fixed residual matrix of the sample is assumed, while in the second model the residual matrix is obtained by the iteration refinement of elemental concentrations and an adjusted residual matrix. The absorption of the incident focused beam in the biological sample at each scanned pixel position, determined from the output of a photodiode or a CCD camera, is applied as a control in the iteration procedure of quantification.

Observation of infrared absorption of InAs quantum dot structures in AlGaAs matrix toward high-efficiency solar cells

NASA Astrophysics Data System (ADS)

Yoshikawa, Hirofumi; Watanabe, Katsuyuki; Kotani, Teruhisa; Izumi, Makoto; Iwamoto, Satoshi; Arakawa, Yasuhiko

2018-06-01

In accordance with the detailed balance limit model of single-intermediate-band solar cells (IBSCs), the optimum matrix bandgap and IB–conduction band (CB) energy gap are ∼1.9 and 0.7 eV, respectively. We present the room-temperature polarized infrared absorption of 20 stacked InAs quantum dot (QD) structures in the Al0.32Ga0.68As matrix with a bandgap of ∼1.9 eV for the design of high-efficiency IBSCs by using a multipass waveguide geometry. We find that the IB–CB absorption is almost independent of the light polarization, and estimate the magnitude of the absorption per QD layer to be ∼0.01%. We also find that the IB–CB absorption edge of QD structures with a wide-gap matrix is ∼0.41 eV. These results indicate that both the significant increase in the magnitude of IB–CB absorption and the lower energy of the IB state for the higher IB–CB energy gap are necessary toward the realization of high-efficiency IBSCs.

Effect of Microstructure on the Strength and Fracture Energy of Bimaterial Interfaces.

DTIC Science & Technology

1992-12-31

Bimaterials Interfaces includes three sections: Mechanics of Interfaces, Coating Design for Composite Systems, and Mechanics of Brittle Matrix... Composites . For more details see Executive Summary. 14. SUBJECT TERM 15. NUMBER OF PAGES Effect, Microstructure, Strength, Fracture Energy, Bimatenal...The Role of Interfaces in Fiber-Reinforced Brittle A.G. Evans Matrix Composites F.W. Zok J.B. Davis Article 2. Effects of Fiber Roughness on Interface

Rashba-Zeeman-effect-induced spin filtering energy windows in a quantum wire

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Xianbo, E-mail: xxb-11@hotmail.com; Nie, Wenjie; Chen, Zhaoxia

2014-06-14

We perform a numerical study on the spin-resolved transport in a quantum wire (QW) under the modulation of both Rashba spin-orbit coupling (SOC) and a perpendicular magnetic field by using the developed Usuki transfer-matrix method in combination with the Landauer-Büttiker formalism. Wide spin filtering energy windows can be achieved in this system for unpolarized spin injection. In addition, both the width of energy window and the magnitude of spin conductance within these energy windows can be tuned by varying Rashba SOC strength, which can be apprehended by analyzing the energy dispersions and spin-polarized density distributions inside the QW, respectively. Furthermore » study also demonstrates that these Rashba-SOC-controlled spin filtering energy windows show a strong robustness against disorders. These findings may not only benefit to further understand the spin-dependent transport properties of a QW in the presence of external fields but also provide a theoretical instruction to design a spin filter device.« less

Semistochastic approach to many electron systems

NASA Astrophysics Data System (ADS)

Grossjean, M. K.; Grossjean, M. F.; Schulten, K.; Tavan, P.

1992-08-01

A Pariser-Parr-Pople (PPP) Hamiltonian of an 8π electron system of the molecule octatetraene, represented in a configuration-interaction basis (CI basis), is analyzed with respect to the statistical properties of its matrix elements. Based on this analysis we develop an effective Hamiltonian, which represents virtual excitations by a Gaussian orthogonal ensemble (GOE). We also examine numerical approaches which replace the original Hamiltonian by a semistochastically generated CI matrix. In that CI matrix, the matrix elements of high energy excitations are choosen randomly according to distributions reflecting the statistics of the original CI matrix.

A Truncated Nuclear Norm Regularization Method Based on Weighted Residual Error for Matrix Completion.

PubMed

Qing Liu; Zhihui Lai; Zongwei Zhou; Fangjun Kuang; Zhong Jin

2016-01-01

Low-rank matrix completion aims to recover a matrix from a small subset of its entries and has received much attention in the field of computer vision. Most existing methods formulate the task as a low-rank matrix approximation problem. A truncated nuclear norm has recently been proposed as a better approximation to the rank of matrix than a nuclear norm. The corresponding optimization method, truncated nuclear norm regularization (TNNR), converges better than the nuclear norm minimization-based methods. However, it is not robust to the number of subtracted singular values and requires a large number of iterations to converge. In this paper, a TNNR method based on weighted residual error (TNNR-WRE) for matrix completion and its extension model (ETNNR-WRE) are proposed. TNNR-WRE assigns different weights to the rows of the residual error matrix in an augmented Lagrange function to accelerate the convergence of the TNNR method. The ETNNR-WRE is much more robust to the number of subtracted singular values than the TNNR-WRE, TNNR alternating direction method of multipliers, and TNNR accelerated proximal gradient with Line search methods. Experimental results using both synthetic and real visual data sets show that the proposed TNNR-WRE and ETNNR-WRE methods perform better than TNNR and Iteratively Reweighted Nuclear Norm (IRNN) methods.

Matrix method for acoustic levitation simulation.

PubMed

Andrade, Marco A B; Perez, Nicolas; Buiochi, Flavio; Adamowski, Julio C

2011-08-01

A matrix method is presented for simulating acoustic levitators. A typical acoustic levitator consists of an ultrasonic transducer and a reflector. The matrix method is used to determine the potential for acoustic radiation force that acts on a small sphere in the standing wave field produced by the levitator. The method is based on the Rayleigh integral and it takes into account the multiple reflections that occur between the transducer and the reflector. The potential for acoustic radiation force obtained by the matrix method is validated by comparing the matrix method results with those obtained by the finite element method when using an axisymmetric model of a single-axis acoustic levitator. After validation, the method is applied in the simulation of a noncontact manipulation system consisting of two 37.9-kHz Langevin-type transducers and a plane reflector. The manipulation system allows control of the horizontal position of a small levitated sphere from -6 mm to 6 mm, which is done by changing the phase difference between the two transducers. The horizontal position of the sphere predicted by the matrix method agrees with the horizontal positions measured experimentally with a charge-coupled device camera. The main advantage of the matrix method is that it allows simulation of non-symmetric acoustic levitators without requiring much computational effort.

Mechanical behaviour of staggered array of mineralised collagen fibrils in protein matrix: Effects of fibril dimensions and failure energy in protein matrix.

PubMed

Lai, Zheng Bo; Yan, Cheng

2017-01-01

Many biological composite materials such as bone have demonstrated unique mechanical performance, i.e., a combination of superior stiffness and toughness. It has become increasingly clear that the constituents at the nano- and micro-length scales play a critical role in determining the mechanical performance of these biological composites. In this study, the underlying mechanisms governing the mechanical behaviour of the staggered array of mineralised collagen fibrils (MCF) embedded in extra-fibrillar protein matrix were numerically investigated. The evolution of damage zone in protein was estimated using cohesive zone models (CZM). The results indicate that the mechanisms and mechanical behaviour of MCF array are largely dependent on the MCF dimensions and the intrinsic failure energy in extra-fibrillar protein matrix. Copyright © 2016 Elsevier Ltd. All rights reserved.

Experience of Application of Silicon Matrix as a Charge Detector in the ATIC Experiment

NASA Technical Reports Server (NTRS)

Zatsepin, V. I.; Adams, J. H.; Christl, M. J.

2003-01-01

The Advanced Thin Ionization Calorimeter (ATIC) was built for series of long-duration balloon flights in Antarctica. Its main goal is to measure energy spectra of cosmic ray nuclei from protons up to iron nuclei in the wide range of their energy from 30 GeV up to 100 TeV. The ATIC balloon experiment had its first, test flight that lasted for 16 days from 28 Dec 2000 to 13 Jan 2001 around the South Pole. The ATIC spectrometer consists of a fully active BGO calorimeter, scintillator hodoscopes and a silicon matrix. The silicon matrix consisted of 4480 pixels was used as a charge detector in the experiment. About 25 million cosmic ray events were detected during the flight. In the paper, the charge spectrum obtained with the silicon matrix is analyzed.

Measurement of gamma' precipitates in a nickel-based superalloy using energy-filtered transmission electron microscopy coupled with automated segmenting techniques.

PubMed

Tiley, J S; Viswanathan, G B; Shiveley, A; Tschopp, M; Srinivasan, R; Banerjee, R; Fraser, H L

2010-08-01

Precipitates of the ordered L1(2) gamma' phase (dispersed in the face-centered cubic or FCC gamma matrix) were imaged in Rene 88 DT, a commercial multicomponent Ni-based superalloy, using energy-filtered transmission electron microscopy (EFTEM). Imaging was performed using the Cr, Co, Ni, Ti and Al elemental L-absorption edges in the energy loss spectrum. Manual and automated segmentation procedures were utilized for identification of precipitate boundaries and measurement of precipitate sizes. The automated region growing technique for precipitate identification in images was determined to measure accurately precipitate diameters. In addition, the region growing technique provided a repeatable method for optimizing segmentation techniques for varying EFTEM conditions. (c) 2010 Elsevier Ltd. All rights reserved.

The dynamical conductance of graphene tunnelling structures.

PubMed

Zhang, Huan; Chan, K S; Lin, Zijing

2011-12-16

The dynamical conductances of graphene tunnelling structures were numerically calculated using the scattering matrix method with the interaction effect included in a phenomenological approach. The overall single-barrier dynamical conductance is capacitative. Transmission resonances in the single-barrier structure lead to dips in the capacitative imaginary part of the response. This is different from the ac responses of typical semiconductor nanostructures, where transmission resonances usually lead to inductive peaks. The features of the dips depend on the Fermi energy. When the Fermi energy is below half of the barrier height, the dips are sharper. When the Fermi energy is higher than half of the barrier height, the dips are broader. Inductive behaviours can be observed in a double-barrier structure due to the resonances formed by reflection between the two barriers.

Optical matrix-matrix multiplication method demonstrated by the use of a multifocus hololens

NASA Technical Reports Server (NTRS)

Liu, H. K.; Liang, Y.-Z.

1984-01-01

A method of optical matrix-matrix multiplication is presented. The feasibility of the method is also experimentally demonstrated by the use of a dichromated-gelatin multifocus holographic lens (hololens). With the specific values of matrices chosen, the average percentage error between the theoretical and experimental data of the elements of the output matrix of the multiplication of some specific pairs of 3 x 3 matrices is 0.4 percent, which corresponds to an 8-bit accuracy.

The chitosan - Porphyrazine hybrid materials and their photochemical properties.

PubMed

Chełminiak-Dudkiewicz, Dorota; Ziegler-Borowska, Marta; Stolarska, Magdalena; Sobotta, Lukasz; Falkowski, Michal; Mielcarek, Jadwiga; Goslinski, Tomasz; Kowalonek, Jolanta; Węgrzynowska-Drzymalska, Katarzyna; Kaczmarek, Halina

2018-04-01

Three magnesium sulfanyl porphyrazines differing in the size of peripheral substituents (3,5-dimethoxybenzylsulfanyl, (3,5-dimethoxybenzyloxy)benzylsulfanyl, 3,5-bis[(3,5-bis[(3,5-dimethoxybenzyloxy)benzyloxy]benzylsulfanyl) were exposed to visible and ultraviolet radiation (UV A + B + C) in order to determine their photochemical properties. The course of photochemical reactions in dimethylformamide solutions and the ability of the systems to generate singlet oxygen were studied by UV-Vis spectroscopy, which additionally gave information on aggregation processes. The porphyrazines were found to be stable upon visible light irradiation conditions, but when exposed to high energy UV radiation, the efficient photodegradation of these macrocycles was observed. Therefore, these three magnesium sulfanyl porphyrazines were incorporated into chitosan matrix. The obtained thin films of chitosan doped with porphyrazines were subjected to polychromatic UV-radiation and studied by spectroscopic methods (UV-Vis, FTIR), scanning electron microscopy (SEM) and atomic force microscopy (AFM). Application of chitosan as a polymer matrix for porphyrazines was found to be successful method that effectively stopped the unwelcome degradation of macrocycles, thus worth considering for their photoprotection. In addition, the surface properties of the hybrid material were determined by contact angle measurements and calculation of surface free energy. Intermolecular interactions between these novel porphyrazines and chitosan were detected. The mechanism of photochemical reactions occurring in studied systems has been discussed. Copyright © 2018 Elsevier B.V. All rights reserved.