Science.gov

Sample records for enhanced small molecule

  1. Enhanced Vibrational Spectroscopies as Tools for Small Molecule Biosensing

    PubMed Central

    Boujday, Souhir; Lamy de la Chapelle, Marc; Srajer, Johannes; Knoll, Wolfgang

    2015-01-01

    In this short summary we summarize some of the latest developments in vibrational spectroscopic tools applied for the sensing of (small) molecules and biomolecules in a label-free mode of operation. We first introduce various concepts for the enhancement of InfraRed spectroscopic techniques, including the principles of Attenuated Total Reflection InfraRed (ATR-IR), (phase-modulated) InfraRed Reflection Absorption Spectroscopy (IRRAS/PM-IRRAS), and Surface Enhanced Infrared Reflection Absorption Spectroscopy (SEIRAS). Particular attention is put on the use of novel nanostructured substrates that allow for the excitation of propagating and localized surface plasmon modes aimed at operating additional enhancement mechanisms. This is then be complemented by the description of the latest development in Surface- and Tip-Enhanced Raman Spectroscopies, again with an emphasis on the detection of small molecules or bioanalytes. PMID:26343666

  2. Experimental Resonance Enhanced Multiphoton Ionization (REMPI) studies of small molecules

    NASA Technical Reports Server (NTRS)

    Dehmer, J. L.; Dehmer, P. M.; Pratt, S. T.; Ohalloran, M. A.; Tomkins, F. S.

    1987-01-01

    Resonance enhanced multiphoton ionization (REMPI) utilizes tunable dye lasers to ionize an atom or molecule by first preparing an excited state by multiphoton absorption and then ionizing that state before it can decay. This process is highly selective with respect to both the initial and resonant intermediate states of the target, and it can be extremely sensitive. In addition, the products of the REMPI process can be detected as needed by analyzing the resulting electrons, ions, fluorescence, or by additional REMPI. This points to a number of exciting opportunities for both basic and applied science. On the applied side, REMPI has great potential as an ultrasensitive, highly selective detector for trace, reactive, or transient species. On the basic side, REMPI affords an unprecedented means of exploring excited state physics and chemistry at the quantum-state-specific level. An overview of current studies of excited molecular states is given to illustrate the principles and prospects of REMPI.

  3. Natural small-molecule enhancers of autophagy induce autophagic cell death in apoptosis-defective cells

    PubMed Central

    Law, Betty Yuen Kwan; Chan, Wai Kit; Xu, Su Wei; Wang, Jing Rong; Bai, Li Ping; Liu, Liang; Wong, Vincent Kam Wai

    2014-01-01

    Resistance of cancer cells to chemotherapy is a significant problem in oncology, and the development of sensitising agents or small-molecules with new mechanisms of action to kill these cells is needed. Autophagy is a cellular process responsible for the turnover of misfolded proteins or damaged organelles, and it also recycles nutrients to maintain energy levels for cell survival. In some apoptosis-resistant cancer cells, autophagy can also enhance the efficacy of anti-cancer drugs through autophagy-mediated mechanisms of cell death. Because the modulation of autophagic processes can be therapeutically useful to circumvent chemoresistance and enhance the effects of cancer treatment, the identification of novel autophagic enhancers for use in oncology is highly desirable. Many novel anti-cancer compounds have been isolated from natural products; therefore, we worked to discover natural, anti-cancer small-molecule enhancers of autophagy. Here, we have identified a group of natural alkaloid small-molecules that function as novel autophagic enhancers. These alkaloids, including liensinine, isoliensinine, dauricine and cepharanthine, stimulated AMPK-mTOR dependent induction of autophagy and autophagic cell death in a panel of apoptosis-resistant cells. Taken together, our work provides novel insights into the biological functions, mechanisms and potential therapeutic values of alkaloids for the induction of autophagy. PMID:24981420

  4. Enhanced Dynamics of HIV gp120 Glycoprotein by Small Molecule Binding

    PubMed Central

    Shrivastava, Indira; LaLonde, Judith M.

    2011-01-01

    HIV cell entry and infection are driven by binding events to the CD4 and Chemokine receptors with associated conformational change of the viral glycoprotein, gp120. Scyllatoxin mini-protein CD4 mimetics and a small molecule inhibitor of CD4 binding, NBD-556, also effectively induce gp120 conformational change. In this study we examine the fluctuation profile of gp120 in context of CD4, a mini-protein mimetic and NBD-556 with the aim of understanding the effect of ligand binding on gp120 conformational dynamics. Analysis of Molecular Dynamics trajectories indicate that NBD-556 binding in the Phe 43 cavity enhances the overall mobility of gp120 especially in the outer-domain in comparison to CD4 or mini-protein bound complex. Interactions with the more flexible bridging sheet strengthen upon NBD-556 binding and may contribute to gp120 restructuring. The enhanced mobility of D368, E370 and I371 with NBD-556 bound in the Phe 43 cavity suggests that interactions with α3-helix in the outer-domain are not optimal, providing further insights into gp120-small molecule interactions that may impact small molecule designs. PMID:21488663

  5. Small-molecule enhancers of autophagy modulate cellular disease phenotypes suggested by human genetics

    PubMed Central

    Kuo, Szu-Yu; Castoreno, Adam B.; Aldrich, Leslie N.; Lassen, Kara G.; Goel, Gautam; Dančík, Vlado; Kuballa, Petric; Latorre, Isabel; Conway, Kara L.; Sarkar, Sovan; Maetzel, Dorothea; Jaenisch, Rudolf; Clemons, Paul A.; Schreiber, Stuart L.; Shamji, Alykhan F.; Xavier, Ramnik J.

    2015-01-01

    Studies of human genetics and pathophysiology have implicated the regulation of autophagy in inflammation, neurodegeneration, infection, and autoimmunity. These findings have motivated the use of small-molecule probes to study how modulation of autophagy affects disease-associated phenotypes. Here, we describe the discovery of the small-molecule probe BRD5631 that is derived from diversity-oriented synthesis and enhances autophagy through an mTOR-independent pathway. We demonstrate that BRD5631 affects several cellular disease phenotypes previously linked to autophagy, including protein aggregation, cell survival, bacterial replication, and inflammatory cytokine production. BRD5631 can serve as a valuable tool for studying the role of autophagy in the context of cellular homeostasis and disease. PMID:26195741

  6. Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich Assay for Ultrasensitive Detection of Small Molecules.

    PubMed

    Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi

    2015-08-01

    It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms.

  7. Efficiency enhancement in solution-processed organic small molecule: Fullerene solar cells via solvent vapor annealing

    NASA Astrophysics Data System (ADS)

    Miao, Jingsheng; Chen, Hui; Liu, Feng; Zhao, Baofeng; Hu, Lingyu; He, Zhicai; Wu, Hongbin

    2015-05-01

    We report highly efficient small molecule solar cells (SMSCs) by using dichloromethane solvent vapor annealing method. The resulted devices delivered a power conversion efficiency (PCE) of 8.3%, which is among the highest in SMSCs. Comparing to the control devices, the short circuit current (Jsc), fill factor, and PCE of solvent vapor annealed devices are significantly improved. Summarizing the results of optical absorption, film morphology, and charge carrier transporting properties, we see that the enhanced structure order and reduced size of phase separation are major reasons for the improved device performances, establishing a solid structure-property relationship. The solvent vapor annealing method can thus be a useful method in device fabrication to enhance performances of SMSCs.

  8. Small molecule aptamer assays based on fluorescence anisotropy signal-enhancer oligonucleotides.

    PubMed

    Perrier, Sandrine; Bouilloud, Prisca; De Oliveira Coelho, Gisella; Henry, Mickael; Peyrin, Eric

    2016-08-15

    Herein, we design novel fluorescence anisotropy (FA) aptamer sensing platforms dedicated to small molecule detection. The assay strategy relied on enhanced fluctuations of segmental motion dynamics of the aptamer tracer mediated by an unlabelled, partially complementary oligonucleotide. The signal-enhancer oligonucleotide (SEO) essentially served as a free probe fraction revealer. By targeting specific regions of the signalling functional nucleic acid, the SEO binding to the unbound aptamer triggered perturbations of both the internal DNA flexibility and the localized dye environment upon the free probe to duplex structure transition. This potentiating effect determined increased FA variations between the duplex and target bound states of the aptameric probe. FA assay responses were obtained with both pre-structured (adenosine) and unstructured (tyrosinamide) aptamers and with dyes of different photochemical properties (fluorescein and texas red). The multiplexed analysis ability was further demonstrated through the simultaneous multicolour detection of the two small targets. The FA method appears to be especially simple, sensitive and widely applicable. PMID:27085946

  9. Pharmacology of novel small-molecule tubulin inhibitors in glioblastoma cells with enhanced EGFR signalling.

    PubMed

    Phoa, Athena F; Browne, Stephen; Gurgis, Fadi M S; Åkerfeldt, Mia C; Döbber, Alexander; Renn, Christian; Peifer, Christian; Stringer, Brett W; Day, Bryan W; Wong, Chin; Chircop, Megan; Johns, Terrance G; Kassiou, Michael; Munoz, Lenka

    2015-12-15

    We recently reported that CMPD1, originally developed as an inhibitor of MK2 activation, primarily inhibits tubulin polymerisation and induces apoptosis in glioblastoma cells. In the present study we provide detailed pharmacological investigation of CMPD1 analogues with improved molecular properties. We determined their anti-cancer efficacy in glioblastoma cells with enhanced EGFR signalling, as deregulated EGFR often leads to chemoresistance. Eight analogues of CMPD1 with varying lipophilicity and basicity were synthesised and tested for efficacy in the cell viability assay using established glioblastoma cell lines and patient-derived primary glioblastoma cells. The mechanism of action for the most potent analogue 15 was determined using MK2 activation and tubulin polymerisation assays, together with the immunofluorescence analysis of the mitotic spindle formation. Apoptosis was analysed by Annexin V staining, immunoblotting analysis of bcl-2 proteins and PARP cleavage. The apoptotic activity of CMPD1 and analogue 15 was comparable across glioblastoma cell lines regardless of the EGFR status. Primary glioblastoma cells of the classical subtype that are characterized by enhanced EGFR activity were most sensitive to the treatment with CMPD1 and 15. In summary, we present mechanism of action for a novel small molecule tubulin inhibitor, compound 15 that inhibits tubulin polymerisation and mitotic spindle formation, induces degradation of anti-apoptotic bcl-2 proteins and leads to apoptosis of glioblastoma cells. We also demonstrate that the enhanced EGFR activity does not decrease the efficacy of tubulin inhibitors developed in this study.

  10. An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator

    PubMed Central

    2015-01-01

    Proteins as well as small molecules have demonstrated success as therapeutic agents, but their pharmacologic properties sometimes fall short against particular drug targets. Although the adenosine 2a receptor (A2AR) has been identified as a promising target for immunotherapy, small molecule A2AR agonists have suffered from short pharmacokinetic half-lives and the potential for toxicity by modulating nonimmune pathways. To overcome these limitations, we have tethered the A2AR agonist CGS-21680 to the immunoglobulin Fc domain using expressed protein ligation with Sf9 cell secreted protein. The protein small molecule conjugate Fc-CGS retained potent Fc receptor and A2AR interactions and showed superior properties as a therapeutic for the treatment of a mouse model of autoimmune pneumonitis. This approach may provide a general strategy for optimizing small molecule therapeutics. PMID:24533830

  11. p53 Small Molecule Inhibitor Enhances Temozolomide Cytotoxic Activity against Intracranial Glioblastoma Xenografts

    PubMed Central

    Dinca, Eduard B.; Lu, Kan V.; Sarkaria, Jann N.; Pieper, Russell O.; Prados, Michael D.; Haas-Kogan, Daphne A.; VandenBerg, Scott R.; Berger, Mitchel S.; James, C. David

    2010-01-01

    In this study we investigated corresponding precursor and active forms of a p53 small molecule inhibitor for effect on temozolomide (TMZ) anti-tumor activity against glioblastoma (GBM), using both in vitro and in vivo experimental approaches. Results from in vitro cell viability analysis showed that the cytotoxic activity of TMZ was substantially increased when GBMs with wild-type p53 were co-treated with the active form of p53 inhibitor, and this heightened cytotoxic response was accompanied by increased PARP cleavage as well as elevated cellular phospho-H2AX. Analysis of the same series of GBMs, as intracranial xenografts in athymic mice, and administering corresponding p53 inhibitor precursor, that is converted to the active compound in vivo, yielded results consistent with the in vitro analyses: i.e., TMZ + p53 inhibitor precursor co-treatment, of three distinct wild-type p53 GBM xenografts, resulted in significant enhancement of TMZ anti-tumor effect relative to treatment with TMZ alone, as indicated by serial bioluminescence monitoring as well as survival analysis (p < 0.001 for co-treatment survival benefit in each case). Mice receiving intracranial injection with p53 null GBM showed similar survival benefit from TMZ treatment regardless of the presence or absence of p53 inhibitor precursor. In total, our results indicate that the p53 active and precursor inhibitor pair enhance TMZ cytotoxicity in vitro and in vivo, respectively, and do so in a p53-dependent manner. PMID:19074867

  12. p53 Small-molecule inhibitor enhances temozolomide cytotoxic activity against intracranial glioblastoma xenografts.

    PubMed

    Dinca, Eduard B; Lu, Kan V; Sarkaria, Jann N; Pieper, Russell O; Prados, Michael D; Haas-Kogan, Daphne A; Vandenberg, Scott R; Berger, Mitchel S; James, C David

    2008-12-15

    In this study, we investigated the precursor and active forms of a p53 small-molecule inhibitor for their effects on temozolomide (TMZ) antitumor activity against glioblastoma (GBM), using both in vitro and in vivo experimental approaches. Results from in vitro cell viability analysis showed that the cytotoxic activity of TMZ was substantially increased when p53 wild-type (p53(wt)) GBMs were cotreated with the active form of p53 inhibitor, and this heightened cytotoxic response was accompanied by increased poly(ADP-ribose) polymerase cleavage as well as elevated cellular phospho-H2AX. Analysis of the same series of GBMs, as intracranial xenografts in athymic mice, and administering corresponding p53 inhibitor precursor, which is converted to the active compound in vivo, yielded results consistent with the in vitro analyses: TMZ + p53 inhibitor precursor cotreatment of three distinct p53(wt) GBM xenografts resulted in significant enhancement of TMZ antitumor effect relative to treatment with TMZ alone, as indicated by serial bioluminescence monitoring as well as survival analysis (P < 0.001 for cotreatment survival benefit in each case). Mice receiving intracranial injection with p53(null) GBM showed similar survival benefit from TMZ treatment regardless of the presence or absence of p53 inhibitor precursor. In total, our results indicate that the p53 active and precursor inhibitor pair enhances TMZ cytotoxicity in vitro and in vivo, respectively, and do so in a p53-dependent manner.

  13. Discovery of Novel Small Molecules that Activate Satellite Cell Proliferation and Enhance Repair of Damaged Muscle.

    PubMed

    Billin, Andrew N; Bantscheff, Marcus; Drewes, Gerard; Ghidelli-Disse, Sonja; Holt, Jason A; Kramer, Henning F; McDougal, Alan J; Smalley, Terry L; Wells, Carrow I; Zuercher, William J; Henke, Brad R

    2016-02-19

    Skeletal muscle progenitor stem cells (referred to as satellite cells) represent the primary pool of stem cells in adult skeletal muscle responsible for the generation of new skeletal muscle in response to injury. Satellite cells derived from aged muscle display a significant reduction in regenerative capacity to form functional muscle. This decrease in functional recovery has been attributed to a decrease in proliferative capacity of satellite cells. Hence, agents that enhance the proliferative abilities of satellite cells may hold promise as therapies for a variety of pathological settings, including repair of injured muscle and age- or disease-associated muscle wasting. Through phenotypic screening of isolated murine satellite cells, we identified a series of 2,4-diaminopyrimidines (e.g., 2) that increased satellite cell proliferation. Importantly, compound 2 was effective in accelerating repair of damaged skeletal muscle in an in vivo mouse model of skeletal muscle injury. While these compounds were originally prepared as c-Jun N-terminal kinase 1 (JNK-1) inhibitors, structure-activity analyses indicated JNK-1 inhibition does not correlate with satellite cell activity. Screening against a broad panel of kinases did not result in identification of an obvious molecular target, so we conducted cell-based proteomics experiments in an attempt to identify the molecular target(s) responsible for the potentiation of the satellite cell proliferation. These data provide the foundation for future efforts to design improved small molecules as potential therapeutics for muscle repair and regeneration.

  14. Confined gold nanoparticles enhance the detection of small molecules in label-free impedance aptasensors

    NASA Astrophysics Data System (ADS)

    Peinetti, Ana S.; Ceretti, Helena; Mizrahi, Martín; González, Graciela A.; Ramírez, Silvana A.; Requejo, Felix G.; Montserrat, Javier M.; Battaglini, Fernando

    2015-04-01

    A controlled architecture of nanoelectrodes, of a similar size to small molecule-binding aptamers, is synthesized inside nanoporous alumina. Gold nanoparticles with a controlled size (about 2 nm) are electrogenerated in the alumina cavities, showing a fast electron transfer process toward ferrocyanide. These uncapped nanoparticles are easily modified with a thiol-containing aptamer for label-free detection of adenosine monophosphate by electrochemical impedance spectroscopy. Our results show that the use of a limited electrical conducting surface inside an insulating environment can be very sensitive to conformational changes, introducing a new approach to the detection of small molecules, exemplified here by the direct and selective detection of adenosine monophosphate at the nanomolar scale.A controlled architecture of nanoelectrodes, of a similar size to small molecule-binding aptamers, is synthesized inside nanoporous alumina. Gold nanoparticles with a controlled size (about 2 nm) are electrogenerated in the alumina cavities, showing a fast electron transfer process toward ferrocyanide. These uncapped nanoparticles are easily modified with a thiol-containing aptamer for label-free detection of adenosine monophosphate by electrochemical impedance spectroscopy. Our results show that the use of a limited electrical conducting surface inside an insulating environment can be very sensitive to conformational changes, introducing a new approach to the detection of small molecules, exemplified here by the direct and selective detection of adenosine monophosphate at the nanomolar scale. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01429h

  15. Label-enhanced surface plasmon resonance applied to label-free interaction analysis of small molecules and fragments.

    PubMed

    Eng, Lars; Nygren-Babol, Linnéa; Hanning, Anders

    2016-10-01

    Surface plasmon resonance (SPR) is a well-established method for studying interactions between small molecules and biomolecules. In particular, SPR is being increasingly applied within fragment-based drug discovery; however, within this application area, the limited sensitivity of SPR may constitute a problem. This problem can be circumvented by the use of label-enhanced SPR that shows a 100-fold higher sensitivity as compared with conventional SPR. Truly label-free interaction data for small molecules can be obtained by applying label-enhanced SPR in a surface competition assay format. The enhanced sensitivity is accompanied by an increased specificity and inertness toward disturbances (e.g., bulk refractive index disturbances). Label-enhanced SPR can be used for fragment screening in a competitive assay format; the competitive format has the added advantage of confirming the specificity of the molecular interaction. In addition, label-enhanced SPR extends the accessible kinetic regime of SPR to the analysis of very fast fragment binding kinetics. In this article, we demonstrate the working principles and benchmark the performance of label-enhanced SPR in a model system-the interaction between carbonic anhydrase II and a number of small-molecule sulfonamide-based inhibitors. PMID:27325502

  16. Label-enhanced surface plasmon resonance applied to label-free interaction analysis of small molecules and fragments.

    PubMed

    Eng, Lars; Nygren-Babol, Linnéa; Hanning, Anders

    2016-10-01

    Surface plasmon resonance (SPR) is a well-established method for studying interactions between small molecules and biomolecules. In particular, SPR is being increasingly applied within fragment-based drug discovery; however, within this application area, the limited sensitivity of SPR may constitute a problem. This problem can be circumvented by the use of label-enhanced SPR that shows a 100-fold higher sensitivity as compared with conventional SPR. Truly label-free interaction data for small molecules can be obtained by applying label-enhanced SPR in a surface competition assay format. The enhanced sensitivity is accompanied by an increased specificity and inertness toward disturbances (e.g., bulk refractive index disturbances). Label-enhanced SPR can be used for fragment screening in a competitive assay format; the competitive format has the added advantage of confirming the specificity of the molecular interaction. In addition, label-enhanced SPR extends the accessible kinetic regime of SPR to the analysis of very fast fragment binding kinetics. In this article, we demonstrate the working principles and benchmark the performance of label-enhanced SPR in a model system-the interaction between carbonic anhydrase II and a number of small-molecule sulfonamide-based inhibitors.

  17. Confined gold nanoparticles enhance the detection of small molecules in label-free impedance aptasensors.

    PubMed

    Peinetti, Ana S; Ceretti, Helena; Mizrahi, Martín; González, Graciela A; Ramírez, Silvana A; Requejo, Felix G; Montserrat, Javier M; Battaglini, Fernando

    2015-05-01

    A controlled architecture of nanoelectrodes, of a similar size to small molecule-binding aptamers, is synthesized inside nanoporous alumina. Gold nanoparticles with a controlled size (about 2 nm) are electrogenerated in the alumina cavities, showing a fast electron transfer process toward ferrocyanide. These uncapped nanoparticles are easily modified with a thiol-containing aptamer for label-free detection of adenosine monophosphate by electrochemical impedance spectroscopy. Our results show that the use of a limited electrical conducting surface inside an insulating environment can be very sensitive to conformational changes, introducing a new approach to the detection of small molecules, exemplified here by the direct and selective detection of adenosine monophosphate at the nanomolar scale.

  18. Discovery of small-molecule enhancers of reactive oxygen species that are nontoxic or cause genotype-selective cell death.

    PubMed

    Adams, Drew J; Boskovic, Zarko V; Theriault, Jimmy R; Wang, Alex J; Stern, Andrew M; Wagner, Bridget K; Shamji, Alykhan F; Schreiber, Stuart L

    2013-05-17

    Elevation of reactive oxygen species (ROS) levels has been observed in many cancer cells relative to nontransformed cells, and recent reports have suggested that small-molecule enhancers of ROS may selectively kill cancer cells in various in vitro and in vivo models. We used a high-throughput screening approach to identify several hundred small-molecule enhancers of ROS in a human osteosarcoma cell line. A minority of these compounds diminished the viability of cancer cell lines, indicating that ROS elevation by small molecules is insufficient to induce death of cancer cell lines. Three chemical probes (BRD5459, BRD56491, BRD9092) are highlighted that most strongly elevate markers of oxidative stress without causing cell death and may be of use in a variety of cellular settings. For example, combining nontoxic ROS-enhancing probes with nontoxic doses of L-buthionine sulfoximine, an inhibitor of glutathione synthesis previously studied in cancer patients, led to potent cell death in more than 20 cases, suggesting that even nontoxic ROS-enhancing treatments may warrant exploration in combination strategies. Additionally, a few ROS-enhancing compounds that contain sites of electrophilicity, including piperlongumine, show selective toxicity for transformed cells over nontransformed cells in an engineered cell-line model of tumorigenesis. These studies suggest that cancer cell lines are more resilient to chemically induced increases in ROS levels than previously thought and highlight electrophilicity as a property that may be more closely associated with cancer-selective cell death than ROS elevation.

  19. Cell-based high-throughput screening identifies galactocerebrosidase enhancers as potential small-molecule therapies for Krabbe's disease.

    PubMed

    Jang, Dae Song; Ye, Wenjuan; Guimei, Tian; Solomon, Melani; Southall, Noel; Hu, Xin; Marugan, Juan; Ferrer, Marc; Maegawa, Gustavo H B

    2016-11-01

    Krabbe's disease, also known as globoid cell leukodystrophy (GLD), is a lysosomal storage disease caused by the deficiency of the lysosomal enzyme β-galactocerebrosidase (GALC), resulting in severe neurological manifestations related to demyelination secondary to elevated galactosylsphingosine (psychosine) with its subsequent cytotoxicity. The only available treatment is hematopoietic stem cell transplantation, which delays disease onset but does not prevent long-term neurological manifestations. This article describes the identification of small molecules that enhance mutant GALC activity, identified by quantitative cell-based high-throughput screening (qHTS). Using a specific neurologically relevant murine cell line (145M-Twi) modified to express common human hGALC-G270D mutant, we were able to detect GALC activity in a 1,536-well microplate format. The qHTS of approximately 46,000 compounds identified three small molecules that showed significant enhancements of residual mutant GALC activity in primary cell lines from GLD patients. These compounds were shown to increase the levels of GALC-G270D mutant in the lysosomal compartment. In kinetic assessments, these small molecules failed to disturb the GALC kinetic profile under acidic conditions, which is highly desirable for folding-assisting molecules operating in the endoplasmic reticulum and not affecting GALC catalytic properties in the lysosomal compartment. In addition, these small molecules rescued the decreased GALC activity at neutral pH and partially stabilized GALC under heat-denaturating conditions. These drug-like compounds can be used as the starting point to develop novel small-molecule agents to treat the progressive neurodegenerative course of GLD. © 2016 Wiley Periodicals, Inc. PMID:27638606

  20. Graphene Oxide Enhances Cellular Delivery of Hydrophilic Small Molecules by Co-incubation

    PubMed Central

    2015-01-01

    The delivery of bioactive molecules into cells has broad applications in biology and medicine. Polymer-modified graphene oxide (GO) has recently emerged as a de facto noncovalent vehicle for hydrophobic drugs. Here, we investigate a different approach using native GO to deliver hydrophilic molecules by co-incubation in culture. GO adsorption and delivery were systematically studied with a library of 15 molecules synthesized with Gd(III) labels to enable quantitation. Amines were revealed to be a key chemical group for adsorption, while delivery was shown to be quantitatively predictable by molecular adsorption, GO sedimentation, and GO size. GO co-incubation was shown to enhance delivery by up to 13-fold and allowed for a 100-fold increase in molecular incubation concentration compared to the alternative of nanoconjugation. When tested in the application of Gd(III) cellular MRI, these advantages led to a nearly 10-fold improvement in sensitivity over the state-of-the-art. GO co-incubation is an effective method of cellular delivery that is easily adoptable by researchers across all fields. PMID:25226566

  1. Tetrandrine identified in a small molecule screen to activate mesenchymal stem cells for enhanced immunomodulation.

    PubMed

    Yang, Zijiang; Concannon, John; Ng, Kelvin S; Seyb, Kathleen; Mortensen, Luke J; Ranganath, Sudhir; Gu, Fangqi; Levy, Oren; Tong, Zhixiang; Martyn, Keir; Zhao, Weian; Lin, Charles P; Glicksman, Marcie A; Karp, Jeffrey M

    2016-07-26

    Pre-treatment or priming of mesenchymal stem cells (MSC) prior to transplantation can significantly augment the immunosuppressive effect of MSC-based therapies. In this study, we screened a library of 1402 FDA-approved bioactive compounds to prime MSC. We identified tetrandrine as a potential hit that activates the secretion of prostaglandin E2 (PGE2), a potent immunosuppressive agent, by MSC. Tetrandrine increased MSC PGE2 secretion through the NF-κB/COX-2 signaling pathway. When co-cultured with mouse macrophages (RAW264.7), tetrandrine-primed MSC attenuated the level of TNF-α secreted by RAW264.7. Furthermore, systemic transplantation of primed MSC into a mouse ear skin inflammation model significantly reduced the level of TNF-α in the inflamed ear, compared to unprimed cells. Screening of small molecules to pre-condition cells prior to transplantation represents a promising strategy to boost the therapeutic potential of cell therapy.

  2. Tetrandrine identified in a small molecule screen to activate mesenchymal stem cells for enhanced immunomodulation

    PubMed Central

    Yang, Zijiang; Concannon, John; Ng, Kelvin S.; Seyb, Kathleen; Mortensen, Luke J.; Ranganath, Sudhir; Gu, Fangqi; Levy, Oren; Tong, Zhixiang; Martyn, Keir; Zhao, Weian; Lin, Charles P.; Glicksman, Marcie A.; Karp, Jeffrey M.

    2016-01-01

    Pre-treatment or priming of mesenchymal stem cells (MSC) prior to transplantation can significantly augment the immunosuppressive effect of MSC-based therapies. In this study, we screened a library of 1402 FDA-approved bioactive compounds to prime MSC. We identified tetrandrine as a potential hit that activates the secretion of prostaglandin E2 (PGE2), a potent immunosuppressive agent, by MSC. Tetrandrine increased MSC PGE2 secretion through the NF-κB/COX-2 signaling pathway. When co-cultured with mouse macrophages (RAW264.7), tetrandrine-primed MSC attenuated the level of TNF-α secreted by RAW264.7. Furthermore, systemic transplantation of primed MSC into a mouse ear skin inflammation model significantly reduced the level of TNF-α in the inflamed ear, compared to unprimed cells. Screening of small molecules to pre-condition cells prior to transplantation represents a promising strategy to boost the therapeutic potential of cell therapy. PMID:27457881

  3. Tetrandrine identified in a small molecule screen to activate mesenchymal stem cells for enhanced immunomodulation.

    PubMed

    Yang, Zijiang; Concannon, John; Ng, Kelvin S; Seyb, Kathleen; Mortensen, Luke J; Ranganath, Sudhir; Gu, Fangqi; Levy, Oren; Tong, Zhixiang; Martyn, Keir; Zhao, Weian; Lin, Charles P; Glicksman, Marcie A; Karp, Jeffrey M

    2016-01-01

    Pre-treatment or priming of mesenchymal stem cells (MSC) prior to transplantation can significantly augment the immunosuppressive effect of MSC-based therapies. In this study, we screened a library of 1402 FDA-approved bioactive compounds to prime MSC. We identified tetrandrine as a potential hit that activates the secretion of prostaglandin E2 (PGE2), a potent immunosuppressive agent, by MSC. Tetrandrine increased MSC PGE2 secretion through the NF-κB/COX-2 signaling pathway. When co-cultured with mouse macrophages (RAW264.7), tetrandrine-primed MSC attenuated the level of TNF-α secreted by RAW264.7. Furthermore, systemic transplantation of primed MSC into a mouse ear skin inflammation model significantly reduced the level of TNF-α in the inflamed ear, compared to unprimed cells. Screening of small molecules to pre-condition cells prior to transplantation represents a promising strategy to boost the therapeutic potential of cell therapy. PMID:27457881

  4. Liposomes as carriers of hydrophilic small molecule drugs: strategies to enhance encapsulation and delivery.

    PubMed

    Eloy, Josimar Oliveira; Claro de Souza, Marina; Petrilli, Raquel; Barcellos, Juliana Palma Abriata; Lee, Robert J; Marchetti, Juliana Maldonado

    2014-11-01

    Although hydrophilic small molecule drugs are widely used in the clinic, their rapid clearance, suboptimal biodistribution, low intracellular absorption and toxicity can limit their therapeutic efficacy. These drawbacks can potentially be overcome by loading the drug into delivery systems, particularly liposomes; however, low encapsulation efficiency usually results. Many strategies are available to improve both the drug encapsulation efficiency and delivery to the target site to reduce side effects. For encapsulation, passive and active strategies are available. Passive strategies encompass the proper selection of the composition of the formulation, zeta potential, particle size and preparation method. Moreover, many weak acids and bases, such as doxorubicin, can be actively loaded with high efficiency. It is highly desirable that once the drug is encapsulated, it should be released preferentially at the target site, resulting in an optimal therapeutic effect devoid of side effects. For this purpose, targeted and triggered delivery approaches are available. The rapidly increasing knowledge of the many overexpressed biochemical makers in pathological sites, reviewed herein, has enabled the development of liposomes decorated with ligands for cell-surface receptors and active delivery. Furthermore, many liposomal formulations have been designed to actively release their content in response to specific stimuli, such as a pH decrease, heat, external alternating magnetic field, ultrasound or light. More than half a century after the discovery of liposomes, some hydrophilic small molecule drugs loaded in liposomes with high encapsulation efficiency are available on the market. However, targeted liposomes or formulations able to deliver the drug after a stimulus are not yet a reality in the clinic and are still awaited.

  5. The Small Molecule Nobiletin Targets the Molecular Oscillator to Enhance Circadian Rhythms and Protect against Metabolic Syndrome.

    PubMed

    He, Baokun; Nohara, Kazunari; Park, Noheon; Park, Yong-Sung; Guillory, Bobby; Zhao, Zhaoyang; Garcia, Jose M; Koike, Nobuya; Lee, Cheng Chi; Takahashi, Joseph S; Yoo, Seung-Hee; Chen, Zheng

    2016-04-12

    Dysregulation of circadian rhythms is associated with metabolic dysfunction, yet it is unclear whether enhancing clock function can ameliorate metabolic disorders. In an unbiased chemical screen using fibroblasts expressing PER2::Luc, we identified Nobiletin (NOB), a natural polymethoxylated flavone, as a clock amplitude-enhancing small molecule. When administered to diet-induced obese (DIO) mice, NOB strongly counteracted metabolic syndrome and augmented energy expenditure and locomotor activity in a Clock gene-dependent manner. In db/db mutant mice, the clock is also required for the mitigating effects of NOB on metabolic disorders. In DIO mouse liver, NOB enhanced clock protein levels and elicited pronounced gene expression remodeling. We identified retinoid acid receptor-related orphan receptors as direct targets of NOB, revealing a pharmacological intervention that enhances circadian rhythms to combat metabolic disease via the circadian gene network.

  6. Gold Nanoparticles Surface Plasmon Resonance Enhanced Signal for the Detection of Small Molecules on Split-Aptamer Microarrays (Small Molecules Detection from Split-Aptamers)

    PubMed Central

    Melaine, Feriel; Roupioz, Yoann; Buhot, Arnaud

    2015-01-01

    The detection of small molecules by biosensors remains a challenge for diagnostics in many areas like pharmacology, environment or homeland security. The main difficulty comes from both the low molecular weight and low concentrations of most targets, which generally requires an indirect detection with an amplification or a sandwich procedure. In this study, we combine both strategies as the amplification of Surface Plasmon Resonance imaging (SPRi) signal is obtained by the use of gold nanoparticles and the sequence engineering of split-aptamers, short oligonucleotides strands with strong affinity towards small targets, allows for a sandwich structure. Combining those two strategies, we obtained state-of-the-art results in the limit of detection (LOD = 50 nM) with the model target adenosine. Furthermore, the SPRi detection led on aptamer microarrays paves the way for potential multi-target detections thanks to the multi-probe imaging approach.

  7. Enhancement of Antiviral Immunity by Small Molecule Antagonist of Suppressor of Cytokine Signaling

    PubMed Central

    Ahmed, Chulbul M. I.; Dabelic, Rea; Martin, James P.; Jager, Lindsey D.; Haider, S. Mohammad; Johnson, Howard M.

    2011-01-01

    Suppressors of cytokine signaling (SOCSs) are negative regulators of both innate and adaptive immunity via inhibition of signaling by cytokines such as type I and type II IFNs. We have developed a small peptide antagonist of SOCS-1 that corresponds to the activation loop of JAK2. SOCS-1 inhibits both type I and type II IFN activities by binding to the kinase activation loop via the kinase inhibitory region of the SOCS. The antagonist, pJAK2(1001–1013), inhibited the replication of vaccinia virus and encephalomyocarditis virus in cell culture, suggesting that it possesses broad antiviral activity. In addition, pJAK2(1001–1013) protected mice against lethal vaccinia and encephalomyocarditis virus infection. pJAK2(1001–1013) increased the intracellular level of the constitutive IFN-β, which may play a role in the antagonist antiviral effect at the cellular level. Ab neutralization suggests that constitutive IFN-β may act intracellularly, consistent with recent findings on IFN-γ intracellular signaling. pJAK2(1001–1013) also synergizes with IFNs as per IFN-γ mimetic to exert a multiplicative antiviral effect at the level of transcription, the cell, and protection of mice against lethal viral infection. pJAK2(1001–1013) binds to the kinase inhibitory region of both SOCS-1 and SOCS-3 and blocks their inhibitory effects on the IFN-γ activation site promoter. In addition to a direct antiviral effect and synergism with IFN, the SOCS antagonist also exhibits adjuvant effects on humoral and cellular immunity as well as an enhancement of polyinosinic-polycytidylic acid activation of TLR3. The SOCS antagonist thus presents a novel and effective approach to enhancement of host defense against viruses. PMID:20543109

  8. Small organic molecules detection based on aptamer-modified gold nanoparticles-enhanced quartz crystal microbalance with dissipation biosensor.

    PubMed

    Zheng, Bin; Cheng, Sheng; Liu, Wei; Lam, Michael Hon-Wah; Liang, Haojun

    2013-07-15

    Small molecules are difficult to detect by the conventional quartz crystal microbalance with dissipation (QCM-D) technique directly because the changes in frequency resulting from the binding processes of small biomolecules are often small. In the current study, an aptamer-based gold nanoparticles (AuNPs)-enhanced sensing strategy for detection of small molecules was developed. The QCM crystal was first modified with a layer of thiolated linker DNA, which can be partly base-paired with the detection part containing the adenosine aptamer sequence. In the presence of adenosine, the aptamer bound with adenosine and folded to the complex structure, which precluded the reporter part carrying AuNPs to combine with the random coiled detection part. Therefore, the lower the concentration of adenosine, the more AuNPs combined to the crystal. The resulting aptasensor showed a linear response to the increase of the adenosine concentration in the range of 0-2 μM with a linear correlation of r=0.99148 and a detection limit of 65 nM. Moreover, the aptasensor exhibited several excellent characteristics such as high sensitivity, selectivity, good stability, and reproducibility.

  9. A small molecule inhibitor for ATPase activity of Hsp70 and Hsc70 enhances the immune response to protein antigens

    NASA Astrophysics Data System (ADS)

    Baek, Kyung-Hwa; Zhang, Haiying; Lee, Bo Ryeong; Kwon, Young-Guen; Ha, Sang-Jun; Shin, Injae

    2015-12-01

    The ATPase activities of Hsp70 and Hsc70 are known to be responsible for regulation of various biological processes. However, little is known about the roles of Hsp70 and Hsc70 in modulation of immune responses to antigens. In the present study, we investigated the effect of apoptozole (Az), a small molecule inhibitor of Hsp70 and Hsc70, on immune responses to protein antigens. The results show that mice administered with both protein antigen and Az produce more antibodies than those treated with antigen alone, showing that Az enhances immune responses to administered antigens. Treatment of mice with Az elicits production of antibodies with a high IgG2c/IgG1 ratio and stimulates the release of Th1 and Th2-type cytokines, suggesting that Az activates the Th1 and Th2 immune responses. The observations made in the present study suggest that inhibition of Hsp70 and Hsc70 activities could be a novel strategy designing small molecule-based adjuvants in protein vaccines.

  10. A Bifunctional Dimethylsulfoxide Substitute Enhances the Aqueous Solubility of Small Organic Molecules

    PubMed Central

    Sprachman, Melissa M.

    2012-01-01

    Abstract An oxetane-substituted sulfoxide has demonstrated potential as a dimethylsulfoxide substitute for enhancing the dissolution of organic compounds with poor aqueous solubilities. This sulfoxide may find utility in applications of library storage and biological assays. For the model compounds studied, significant solubility enhancements were observed using the sulfoxide as a cosolvent in aqueous media. Brine shrimp, breast cancer (MDA-MB-231), and liver cell line (HepG2) toxicity data for the new additive are also presented, in addition to comparative IC50 values for a series of PKD1 inhibitors. PMID:22192308

  11. A small molecule norspermidine in combination with silver ion enhances dispersal and disinfection of multi-species wastewater biofilms.

    PubMed

    Wu, Yachuan; Quan, Xiangchun; Si, Xiurong; Wang, Xinrui

    2016-06-01

    Detrimental biofilms have become a great concern in many areas due to their strong resistance and insensitivity to traditional antimicrobial agents. Norspermidine is a potent small molecule for biofilm dispersal. In this study, silver ion, a conventional inorganic biocide, was combined with norspermidine and used for control and removal of multi-species biofilms formed by a mixed culture from wastewater treatment systems. Results showed that silver ion (0.01-1 mg/L) treatment alone failed to remove the existing wastewater biofilms. Norspermidine at the concentrations of 500-1000 μM was capable to disrupt and disperse the existing biofilms with a biofilm reduction of 21-34 % after 24-h exposure. The combined treatment with norspermidine (500 μM) and silver ion (0.01 mg/L) increased biofilm reduction to 48 % (24-h exposure). The combined treatment also enhanced biofilm disinfection ratio (82 %, 2-h exposure) by 2.0- and 2.6-folds compared to norspermidine (27 %) or silver ion (23 %) treatment alone, respectively. Confocal laser scanning microscopic (CLSM) observations found that norspermidine could disrupt biofilm matrix and promote biofilm dispersal via breaking down exopolysaccharides. The combined treatment increased the reduction in biofilm cell density and viability, possibly due to the damage of biofilm matrix, enhanced silver ion diffusion in biofilms, and increased biofilm sensitivity. These findings indicate that the combination of a small molecule norspermidine with a traditional biocide silver ion presents a novel strategy to remove and kill biofilms, which have a potential application in addressing wastewater biofilm-related issues. PMID:26894404

  12. A small molecule screen for enhanced homing of systemically infused cells

    PubMed Central

    Tong, Zhixiang; Perrault, Christelle; Benhamou, Brigitte; Zhang, Jidong; Stratton, Tara; Han, Edward; Safaee, Helia; Musabeyezu, Juliet; Yang, Zijiang; Multon, Marie-Christine; Rothblatt, Jonathan; Deleuze, Jean-Francois; Lin, Charles P.; Karp, Jeffrey M.

    2015-01-01

    SUMMARY Poor homing of systemically infused cells to disease sites may limit the success of exogenous cell-based therapy. In this study, we screened 9,000 signal transduction modulators to identify hits that increase mesenchymal stromal cell (MSC) surface expression of homing ligands that bind to ICAM-1, such as CD11a. Pretreatment of MSCs with Ro-31-8425, an identified hit from this screen, increased MSC firm adhesion to an ICAM-1-coated substrate in-vitro, and enabled targeted delivery of systemically administered MSCs to inflamed sites in-vivo in a CD11a (and other ICAM-1-binding domains)-dependent manner. This resulted in a heightened anti-inflammatory response. This represents a new strategy for engineering cell homing to enhance therapeutic efficacy and validates CD11a/ICAM-1 as potential targets. Altogether, this multi-step screening process may significantly improve clinical outcomes of cell-based therapies. PMID:25732817

  13. Comparison of light out-coupling enhancements in single-layer blue-phosphorescent organic light emitting diodes using small-molecule or polymer hosts

    SciTech Connect

    Chang, Yung-Ting; Liu, Shun-Wei; Yuan, Chih-Hsien; Lee, Chih-Chien; Ho, Yu-Hsuan; Wei, Pei-Kuen; Chen, Kuan-Yu; Lee, Yi-Ting; Wu, Min-Fei; Chen, Chin-Ti E-mail: chihiwu@cc.ee.ntu.edu.tw; Wu, Chih-I E-mail: chihiwu@cc.ee.ntu.edu.tw

    2013-11-07

    Single-layer blue phosphorescence organic light emitting diodes (OLEDs) with either small-molecule or polymer hosts are fabricated using solution process and the performances of devices with different hosts are investigated. The small-molecule device exhibits luminous efficiency of 14.7 cd/A and maximum power efficiency of 8.39 lm/W, which is the highest among blue phosphorescence OLEDs with single-layer solution process and small molecular hosts. Using the same solution process for all devices, comparison of light out-coupling enhancement, with brightness enhancement film (BEF), between small-molecule and polymer based OLEDs is realized. Due to different dipole orientation and anisotropic refractive index, polymer-based OLEDs would trap less light than small molecule-based OLEDs internally, about 37% better based simulation results. In spite of better electrical and spectroscopic characteristics, including ambipolar characteristics, higher carrier mobility, higher photoluminescence quantum yield, and larger triplet state energy, the overall light out-coupling efficiency of small molecule-based devices is worse than that of polymer-based devices without BEF. However, with BEF for light out-coupling enhancement, the improved ratio in luminous flux and luminous efficiency for small molecule based device is 1.64 and 1.57, respectively, which are significantly better than those of PVK (poly-9-vinylcarbazole) devices. In addition to the theoretical optical simulation, the experimental data also confirm the origins of differential light-outcoupling enhancement. The maximum luminous efficiency and power efficiency are enhanced from 14.7 cd/A and 8.39 lm/W to 23 cd/A and 13.2 lm/W, respectively, with laminated BEF, which are both the highest so far for single-layer solution-process blue phosphorescence OLEDs with small molecule hosts.

  14. Solution-grown small-molecule organic semiconductor with enhanced crystal alignment and areal coverage for organic thin film transistors

    DOE PAGES

    Bi, Sheng; He, Zhengran; Chen, Jihua; Li, Dawen

    2015-07-24

    Drop casting of small-molecule organic semiconductors typically forms crystals with random orientation and poor areal coverage, which leads to significant performance variations of organic thin-film transistors (OTFTs). In this study, we utilize the controlled evaporative self-assembly (CESA) method combined with binary solvent system to control the crystal growth. A small-molecule organic semiconductor,2,5-Di-(2-ethylhexyl)-3,6-bis(5"-n-hexyl-2,2',5',2"]terthiophen-5-yl)-pyrrolo[3,4-c]pyrrole-1,4-dione (SMDPPEH), is used as an example to demonstrate the effectiveness of our approach. By optimizing the double solvent ratios, well-aligned SMDPPEH crystals with significantly improved areal coverage were achieved. As a result, the SMDPPEH based OTFTs exhibit a mobility of 1.6 × 10-2 cm2/V s, which is themore » highest mobility from SMDPPEH ever reported.« less

  15. Solution-grown small-molecule organic semiconductor with enhanced crystal alignment and areal coverage for organic thin film transistors

    SciTech Connect

    Bi, Sheng; He, Zhengran; Chen, Jihua; Li, Dawen

    2015-07-24

    Drop casting of small-molecule organic semiconductors typically forms crystals with random orientation and poor areal coverage, which leads to significant performance variations of organic thin-film transistors (OTFTs). In this study, we utilize the controlled evaporative self-assembly (CESA) method combined with binary solvent system to control the crystal growth. A small-molecule organic semiconductor,2,5-Di-(2-ethylhexyl)-3,6-bis(5"-n-hexyl-2,2',5',2"]terthiophen-5-yl)-pyrrolo[3,4-c]pyrrole-1,4-dione (SMDPPEH), is used as an example to demonstrate the effectiveness of our approach. By optimizing the double solvent ratios, well-aligned SMDPPEH crystals with significantly improved areal coverage were achieved. As a result, the SMDPPEH based OTFTs exhibit a mobility of 1.6 × 10-2 cm2/V s, which is the highest mobility from SMDPPEH ever reported.

  16. Incorporation of ionic liquid into porous polymer monoliths to enhance the separation of small molecules in reversed-phase high-performance liquid chromatography.

    PubMed

    Wang, Jiafei; Bai, Ligai; Wei, Zhen; Qin, Junxiao; Ma, Yamin; Liu, Haiyan

    2015-06-01

    An ionic liquid was incorporated into the porous polymer monoliths to afford stationary phases with enhanced chromatographic performance for small molecules in reversed-phase high-performance liquid chromatography. The effect of the ionic liquid in the polymerization mixture on the performance of the monoliths was studied in detail. While monoliths without ionic liquid exhibited poor resolution and low efficiency, the addition of ionic liquid to the polymerization mixture provides highly increased resolution and high efficiency. The chromatographic performances of the monoliths were demonstrated by the separations of various small molecules including aromatic hydrocarbons, isomers, and homologues using a binary polar mobile phase. The present column efficiency reached 27 000 plates/m, which showed that the ionic liquid monoliths are alternative stationary phases in the separation of small molecules by high-performance liquid chromatography.

  17. Positron-attachment to small molecules: Vibrational enhancement of positron affinities with configuration interaction level of multi-component molecular orbital approach

    SciTech Connect

    Tachikawa, Masanori

    2015-12-31

    To theoretically demonstrate the binding of a positron to small polarized molecules, we have calculated the vibrational averaged positron affinity (PA) values along the local vibrational contribution with the configuration interaction level of multi-component molecular orbital method. This method can take the electron-positron correlation contribution into account through single electronic - single positronic excitation configurations. The PA values are enhanced by including the local vibrational contribution from vertical PA values due to the anharmonicity of the potential.

  18. Protein Scaffolding for Small Molecule Catalysts

    SciTech Connect

    Baker, David

    2014-09-14

    We aim to design hybrid catalysts for energy production and storage that combine the high specificity, affinity, and tunability of proteins with the potent chemical reactivities of small organometallic molecules. The widely used Rosetta and RosettaDesign methodologies will be extended to model novel protein / small molecule catalysts in which one or many small molecule active centers are supported and coordinated by protein scaffolding. The promise of such hybrid molecular systems will be demonstrated with the nickel-phosphine hydrogenase of DuBois et. al.We will enhance the hydrogenase activity of the catalyst by designing protein scaffolds that incorporate proton relays and systematically modulate the local environment of the catalyticcenter. In collaboration with DuBois and Shaw, the designs will be experimentally synthesized and characterized.

  19. Small Molecule Immunosensing Using Surface Plasmon Resonance

    PubMed Central

    Mitchell, John

    2010-01-01

    Surface plasmon resonance (SPR) biosensors utilize refractive index changes to sensitively detect mass changes at noble metal sensor surface interfaces. As such, they have been extensively applied to immunoassays of large molecules, where their high mass and use of sandwich immunoassay formats can result in excellent sensitivity. Small molecule immunosensing using SPR is more challenging. It requires antibodies or high-mass or noble metal labels to provide the required signal for ultrasensitive assays. Also, it can suffer from steric hindrance between the small antigen and large antibodies. However, new studies are increasingly meeting these and other challenges to offer highly sensitive small molecule immunosensor technologies through careful consideration of sensor interface design and signal enhancement. This review examines the application of SPR transduction technologies to small molecule immunoassays directed to different classes of small molecule antigens, including the steroid hormones, toxins, drugs and explosives residues. Also considered are the matrix effects resulting from measurement in chemically complex samples, the construction of stable sensor surfaces and the development of multiplexed assays capable of detecting several compounds at once. Assay design approaches are discussed and related to the sensitivities obtained. PMID:22163605

  20. Enhancement of Open-Circuit Voltage by Using the 58-π Silylmethyl Fullerenes in Small-Molecule Organic Solar Cells.

    PubMed

    Jeon, Il; Delacou, Clément; Nakagawa, Takafumi; Matsuo, Yutaka

    2016-04-20

    The application of 58-π-1,4-bis(silylmethyl)[60]fullerenes, C60 (CH2 SiMe2 Ph)(CH2 SiMe2 Ar) (Ar=Ph and 2-methoxylphenyl for SIMEF-1 and SIMEF-2, respectively), in small-molecule organic solar cells with a diketopyrrolopyrrole donor (3,6-bis[5-(benzofuran-2-yl)thiophen-2-yl]-2,5-bis(2-ethylhexyl)pyrrolo[3,4-c]pyrrole-1,4-dione (DPP(TBFu)2 )) is demonstrated. With the 58-π-silylmethyl fullerene acceptor, SIMEF-1, the devices showed the highest efficiency of 4.57 % with an average of 4.10 %. They manifested an improved open-circuit voltage (1.03 V) owing to the high-lying LUMO level of SIMEF-1, while maintaining a high short-circuit density (9.91 mA cm(-2) ) through controlling the crystallinity of DPP by thermal treatment. On the other hand, despite even higher open-circuit voltage (1.05 V), SIMEF-2-based devices showed lower performances of 3.53 %, owing to a low short-circuit current density (8.33 mA cm(-2) ) and fill factor (0.40) arising from the asymmetric structure, which results in a lower mobility and immiscibility.

  1. Enhanced Neurite Outgrowth of Human Model (NT2) Neurons by Small-Molecule Inhibitors of Rho/ROCK Signaling

    PubMed Central

    Roloff, Frank; Scheiblich, Hannah; Dewitz, Carola; Dempewolf, Silke; Stern, Michael; Bicker, Gerd

    2015-01-01

    Axonal injury in the adult human central nervous system often results in loss of sensation and motor functions. Promoting regeneration of severed axons requires the inactivation of growth inhibitory influences from the tissue environment and stimulation of the neuron intrinsic growth potential. Especially glial cell derived factors, such as chondroitin sulfate proteoglycans, Nogo-A, myelin-associated glycoprotein, and myelin in general, prevent axon regeneration. Most of the glial growth inhibiting factors converge onto the Rho/ROCK signaling pathway in neurons. Although conditions in the injured nervous system are clearly different from those during neurite outgrowth in vitro, here we use a chemical approach to manipulate Rho/ROCK signalling with small-molecule agents to encourage neurite outgrowth in cell culture. The development of therapeutic treatments requires drug testing not only on neurons of experimental animals, but also on human neurons. Using human NT2 model neurons, we demonstrate that the pain reliever Ibuprofen decreases RhoA (Ras homolog gene family, member A GTPase) activation and promotes neurite growth. Inhibition of the downstream effector Rho kinase by the drug Y-27632 results in a strong increase in neurite outgrowth. Conversely, activation of the Rho pathway by lysophosphatidic acid results in growth cone collapse and eventually to neurite retraction. Finally, we show that blocking of Rho kinase, but not RhoA results in an increase in neurons bearing neurites. Due to its anti-inflammatory and neurite growth promoting action, the use of a pharmacological treatment of damaged neural tissue with Ibuprofen should be explored. PMID:25714396

  2. Enhancement of Performance and Mechanism Studies of All-Solution Processed Small-Molecule based Solar Cells with an Inverted Structure.

    PubMed

    Long, Guankui; Wu, Bo; Yang, Xuan; Kan, Bin; Zhou, Ye-Cheng; Chen, Li-Chuan; Wan, Xiangjian; Zhang, Hao-Li; Sum, Tze Chien; Chen, Yongsheng

    2015-09-30

    Both solution-processed polymers and small molecule based solar cells have achieved PCEs over 9% with the conventional device structure. However, for the practical applications of photovoltaic technology, further enhancement of both device performance and stability are urgently required, particularly for the inverted structure devices, since this architecture will probably be most promising for the possible coming commercialization. In this work, we have fabricated both conventional and inverted structure devices using the same small molecular donor/acceptor materials and compared the performance of both device structures, and found that the inverted structure based device gave significantly improved performance, the highest PCE so far for inverted structure based device using small molecules as the donor. Furthermore, the inverted device shows a remarkable stability with almost no obvious degradation after three months. Systematic device physics and charge generation dynamics studies, including optical simulation, light-intensity-dependent current-voltage experiments, photocurrent density-effective voltage analyses, transient absorption measurements, and electrical simulations, indicate that the significantly enhanced performance using inverted device is ascribed to the increasing of Jsc compared to the conventional device, which in turn is mainly attributed to the increased absorption of photons in the active layers, rather than the reduced nongeminate recombination.

  3. Small-molecule inhibitors of myosin proteins

    PubMed Central

    Bond, Lisa M; Tumbarello, David A; Kendrick-Jones, John; Buss, Folma

    2014-01-01

    Advances in screening and computational methods have enhanced recent efforts to discover/design small-molecule protein inhibitors. One attractive target for inhibition is the myosin family of motor proteins. Myosins function in a wide variety of cellular processes, from intracellular trafficking to cell motility, and are implicated in several human diseases (e.g., cancer, hypertrophic cardiomyopathy, deafness and many neurological disorders). Potent and selective myosin inhibitors are, therefore, not only a tool for understanding myosin function, but are also a resource for developing treatments for diseases involving myosin dysfunction or overactivity. This review will provide a brief overview of the characteristics and scientific/therapeutic applications of the presently identified small-molecule myosin inhibitors before discussing the future of myosin inhibitor and activator design. PMID:23256812

  4. A Surface-Enhanced Raman Scattering Sensor Integrated with Battery-Controlled Fluidic Device for Capture and Detection of Trace Small Molecules

    PubMed Central

    Zhou, Qitao; Meng, Guowen; Zheng, Peng; Cushing, Scott; Wu, Nianqiang; Huang, Qing; Zhu, Chuhong; Zhang, Zhuo; Wang, Zhiwei

    2015-01-01

    For surface-enhanced Raman scattering (SERS) sensors, one of the important issues is the development of substrates not only with high SERS-activity but also with strong ability to capture analytes. However, it is difficult to achieve the two goals simultaneously especially when detecting small molecules. Herein a compact battery-controlled nanostructure-assembled SERS system has been demonstrated for capture and detection of trace small molecule pollutants in water. In this SERS fluidic system, an electrical heating constantan wire covered with the vertically aligned ZnO nanotapers decorated with Ag-nanoparticles is inserted into a glass capillary. A mixture of thermo-responsive microgels, Au-nanorods colloids and analyte solution is then filled into the remnant space of the capillary. When the system is heated by switching on the battery, the thermo-responsive microgels shrink, which immobilizes the analyte and drives the Au-nanorod close to each other and close to the Ag-ZnO nanotapers. This process has also created high-density “hot spots” due to multi-type plasmonic couplings in three-dimensional space, amplifying the SERS signal. This integrated device has been successfully used to measure methyl parathion in lake water, showing a great potential in detection of aquatic pollutants. PMID:26238799

  5. Small molecule enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2-mediated microRNA processing.

    PubMed

    Melo, Sonia; Villanueva, Alberto; Moutinho, Catia; Davalos, Veronica; Spizzo, Riccardo; Ivan, Cristina; Rossi, Simona; Setien, Fernando; Casanovas, Oriol; Simo-Riudalbas, Laia; Carmona, Javier; Carrere, Jordi; Vidal, August; Aytes, Alvaro; Puertas, Sara; Ropero, Santiago; Kalluri, Raghu; Croce, Carlo M; Calin, George A; Esteller, Manel

    2011-03-15

    MicroRNAs (miRNAs) are small RNA molecules that regulate gene expression at the posttranscriptional level and are critical for many cellular pathways. The disruption of miRNAs and their processing machineries also contributes to the development of human tumors. A common scenario for miRNA expression in carcinogenesis is emerging that shows that impaired miRNA production and/or down-regulation of these transcripts occurs in many neoplasms. Several of these lost miRNAs have tumor-suppressor features, so strategies to restore their expression globally in malignancies would be a welcome addition to the current therapeutic arsenal against cancer. Herein, we show that the small molecule enoxacin, a fluoroquinolone used as an antibacterial compound, enhances the production of miRNAs with tumor suppressor functions by binding to the miRNA biosynthesis protein TAR RNA-binding protein 2 (TRBP). The use of enoxacin in human cell cultures and xenografted, orthotopic, and metastatic mouse models reveals a TRBP-dependent and cancer-specific growth-inhibitory effect of the drug. These results highlight the key role of disrupted miRNA expression patterns in tumorigenesis, and suggest a unique strategy for restoring the distorted microRNAome of cancer cells to a more physiological setting.

  6. Discovery of novel small molecule cell type-specific enhancers of NF-kappaB nuclear translocation.

    PubMed

    Gong, Gangli; Xie, Yuli; Liu, Yidong; Rinderspacher, Alison; Deng, Shi-Xian; Feng, Yan; Zhu, Zhengxiang; Tang, Yufei; Wyler, Michael; Aulner, Nathalie; Toebben, Udo; Smith, Deborah H; Branden, Lars; Chung, Caty; Schürer, Stephan; Vidović, Dusica; Landry, Donald W

    2009-02-15

    An IKKbeta inhibitor reported to block NF-kappaB transcriptional activities in Jurkat T cells, was found to enhance NF-kappaB translocation in HUVEC cells. These studies suggested a noncanonical NF-kappaB signaling pathway independent of IKKbeta in HUVEC cells.

  7. Identification of Small-Molecule Enhancers of Arginine Methylation Catalyzed by Coactivator-Associated Arginine Methyltransferase 1

    PubMed Central

    Castellano, Sabrina; Spannhoff, Astrid; Milite, Ciro; Dal Piaz, Fabrizio; Cheng, Donghang; Tosco, Alessandra; Viviano, Monica; Yamani, Abdellah; Cianciulli, Agostino; Sala, Marina; Cura, Vincent; Cavarelli, Jean; Novellino, Ettore; Mai, Antonello; Bedford, Mark T.; Sbardella, Gianluca

    2012-01-01

    Arginine methylation is a common post-translational modification that is crucial in modulating gene expression at multiple critical levels. The arginine methyltransferases (PRMTs) are envisaged as promising druggable targets but their role in physiological and pathological pathways is far from being clear, due to the limited number of modulators reported to date. In this effort, enzyme activators can be invaluable tools useful as gain-of-function reagents to interrogate the biological roles in cells and in vivo of PRMTs. Yet the identification of such molecules is rarely pursued. Herein we describe a series of aryl ureido acetamido indole carboxylates (dubbed “uracandolates”), able to increase the methylation of histone- (H3) or non-histone (polyadenylate-binding protein 1, PABP1) substrates induced by coactivator-associated arginine methyltransferase 1 (CARM1), both in in vitro and cellular settings. To the best of our knowledge, this is the first report of compounds acting as CARM1 activators. PMID:23095008

  8. Quest for organic polymer-based monolithic columns affording enhanced efficiency in high performance liquid chromatography separations of small molecules in isocratic mode.

    PubMed

    Svec, Frantisek

    2012-03-01

    The separations of small molecules using columns containing porous polymer monoliths invented two decades ago went a long way from the very modest beginnings to the current capillary columns with efficiencies approaching those featured by their silica-based counterparts. This review article presents a variety of techniques that have been used to form capillary formats of monolithic columns with enhanced separation performance in isocratic elutions. The following text first describes the traditional approaches used for the preparation of efficient monoliths comprising variations in polymerization conditions including temperature as well as composition of monomers and porogenic solvents. Encouraging results of these experiments fueled research of completely new preparation methods such as polymerization to an incomplete conversion, use of single crosslinker, hypercrosslinking, and incorporation of carbon nanotubes that are described in the second part of the text. PMID:21816401

  9. Enhance the light-harvesting capability of the ITO-free inverted small molecule solar cell by ZnO nanorods.

    PubMed

    Lin, Ming-Yi; Wu, Shang-Hsuan; Hsiao, Li-Jen; Budiawan, Widhya; Boopathi, Karunakara Moorthy; Tu, Wei-Chen; Chang, Yia-Chung; Chu, Chih-Wei

    2016-08-01

    The ITO-free inverted SMPV1:PC71BM solar cells with an Al doped ZnO (AZO) transparent electrodes are fabricated. The AZO thin film prepared by pulsed laser deposition (PLD) technique exhibits high transmission (>85%) and low sheet resistance (~30 Ω/sq) and the power conversion efficiency (PCE) of devices based on AZO electrode can reach around 4%. To further enhance the light harvesting of the absorption layer of solar cells, ZnO nanorods interlayer is grown on the AZO layer before the deposition the active layer. The absorption spectrums of devices under various conditions are also simulated by RCWA method to identify the optical saturation length of the ZnO nanorods. The PCE of ITO-free inverted small molecule solar cell improved with ZnO nanorods can reach 6.6%. PMID:27505758

  10. Structure-Based Small Molecule Modulation of a Pre-Amyloid State: Pharmacological Enhancement of IAPP Membrane-Binding and Toxicity

    PubMed Central

    Nath, Abhinav; Schlamadinger, Diana E.; Rhoades, Elizabeth; Miranker, Andrew D.

    2015-01-01

    Islet amyloid polypeptide (IAPP) is a peptide hormone whose pathological self-assembly is a hallmark of the progression of type II diabetes. IAPP–membrane interactions catalyze its higher-order self-assembly and also underlie its toxic effects toward cells. While there is great interest in developing small molecule reagents capable of altering the structure and behavior of oligomeric, membrane-bound IAPP, the dynamic and heterogeneous nature of this ensemble makes it recalcitrant to traditional approaches. Here, we build on recent insights into the nature of membrane-bound states and develop a combined computational and experimental strategy to address this problem. The generalized structural approach efficiently identified diverse compounds from large commercial libraries with previously unrecognized activities toward the gain-of-function behaviors of IAPP. The use of appropriate computational prescreening reduced the experimental burden by orders of magnitude relative to unbiased high-throughput screening. We found that rationally targeting experimentally derived models of membrane-bound dimers identified several compounds that demonstrate the remarkable ability to enhance IAPP–membrane binding and one compound that enhances IAPP-mediated cytotoxicity. Taken together, these findings imply that membrane binding per se is insufficient to generate cytotoxicity; instead, enhanced sampling of rare states within the membrane-bound ensemble may potentiate IAPP’s toxic effects. PMID:25966003

  11. Hydrophobic Porous Material Adsorbs Small Organic Molecules

    NASA Technical Reports Server (NTRS)

    Sharma, Pramod K.; Hickey, Gregory S.

    1994-01-01

    Composite molecular-sieve material has pore structure designed specifically for preferential adsorption of organic molecules for sizes ranging from 3 to 6 angstrom. Design based on principle that contaminant molecules become strongly bound to surface of adsorbent when size of contaminant molecules is nearly same as that of pores in adsorbent. Material used to remove small organic contaminant molecules from vacuum systems or from enclosed gaseous environments like closed-loop life-support systems.

  12. The Small Molecule Hyperphyllin Enhances Leaf Formation Rate and Mimics Shoot Meristem Integrity Defects Associated with AMP1 Deficiency.

    PubMed

    Poretska, Olena; Yang, Saiqi; Pitorre, Delphine; Rozhon, Wilfried; Zwerger, Karin; Uribe, Marcos Castellanos; May, Sean; McCourt, Peter; Poppenberger, Brigitte; Sieberer, Tobias

    2016-06-01

    ALTERED MERISTEM PROGRAM1 (AMP1) is a member of the M28 family of carboxypeptidases with a pivotal role in plant development and stress adaptation. Its most prominent mutant defect is a unique hypertrophic shoot phenotype combining a strongly increased organ formation rate with enhanced meristem size and the formation of ectopic meristem poles. However, so far the role of AMP1 in shoot development could not be assigned to a specific molecular pathway nor is its biochemical function resolved. In this work we evaluated the level of functional conservation between AMP1 and its human homolog HsGCPII, a tumor marker of medical interest. We show that HsGCPII cannot substitute AMP1 in planta and that an HsGCPII-specific inhibitor does not evoke amp1-specific phenotypes. We used a chemical genetic approach to identify the drug hyperphyllin (HP), which specifically mimics the shoot defects of amp1, including plastochron reduction and enlargement and multiplication of the shoot meristem. We assessed the structural requirements of HP activity and excluded that it is a cytokinin analog. HP-treated wild-type plants showed amp1-related tissue-specific changes of various marker genes and a significant transcriptomic overlap with the mutant. HP was ineffective in amp1 and elevated the protein levels of PHAVOLUTA, consistent with the postulated role of AMP1 in miRNA-controlled translation, further supporting an AMP1-related mode of action. Our work suggests that plant and animal members of the M28 family of proteases adopted unrelated functions. With HP we provide a tool to characterize the plant-specific functions of this important class of proteins. PMID:27208298

  13. Restoring Mitochondrial Function: A Small Molecule-mediated Approach to Enhance Glucose Stimulated Insulin Secretion in Cholesterol Accumulated Pancreatic beta cells

    PubMed Central

    Asalla, Suman; Girada, Shravan Babu; Kuna, Ramya S.; Chowdhury, Debabrata; Kandagatla, Bhaskar; Oruganti, Srinivas; Bhadra, Utpal; Bhadra, Manika Pal; Kalivendi, Shasi Vardhan; Rao, Swetha Pavani; Row, Anupama; Ibrahim, A; Ghosh, Partha Pratim; Mitra, Prasenjit

    2016-01-01

    Dyslipidemia, particularly the elevated serum cholesterol levels, aggravate the pathophysiology of type 2 diabetes. In the present study we explored the relationship between fasting blood sugar and serum lipid parameters in human volunteers which revealed a significant linear effect of serum cholesterol on fasting blood glucose. Short term feeding of cholesterol enriched diet to rodent model resulted in elevated serum cholesterol levels, cholesterol accumulation in pancreatic islets and hyperinsulinemia with modest increase in plasma glucose level. To explore the mechanism, we treated cultured BRIN-BD11 pancreatic beta cells with soluble cholesterol. Our data shows that cholesterol treatment of cultured pancreatic beta cells enhances total cellular cholesterol. While one hour cholesterol exposure enhances insulin exocytosis, overnight cholesterol accumulation in cultured pancreatic beta cells affects cellular respiration, and inhibits Glucose stimulated insulin secretion. We further report that (E)-4-Chloro-2-(1-(2-(2,4,6-trichlorophenyl) hydrazono) ethyl) phenol (small molecule M1) prevents the cholesterol mediated blunting of cellular respiration and potentiates Glucose stimulated insulin secretion which was abolished in pancreatic beta cells on cholesterol accumulation. PMID:27282931

  14. Cellular reprogramming: a small molecule perspective

    PubMed Central

    Nie, Baoming; Wang, Haixia; Laurent, Timothy; Ding, Sheng

    2013-01-01

    The discovery that somatic cells can be reprogrammed to induced pluripotent stem cells (iPSCs) by the expression of a few transcription factors has attracted enormous interest in biomedical research and the field of regenerative medicine. iPSCs nearly identically resemble embryonic stem cells (ESCs) and can give rise to all cell types in the body, and thus have opened new opportunities for personalized regenerative medicine and new ways of modeling human diseases. Although some studies have raised concerns about genomic stability and epigenetic memory in the resulting cells, better understanding and control of the reprogramming process should enable enhanced efficiency and higher fidelity in reprogramming. Therefore, small molecules regulating reprogramming mechanisms are valuable tools to probe the process of reprogremming and harness cell fate transitions for various applications. PMID:22959962

  15. Auxin biology revealed by small molecules.

    PubMed

    Ma, Qian; Robert, Stéphanie

    2014-05-01

    The plant hormone auxin regulates virtually every aspect of plant growth and development and unraveling its molecular and cellular modes of action is fundamental for plant biology research. Chemical genomics is the use of small molecules to modify protein functions. This approach currently rises as a powerful technology for basic research. Small compounds with auxin-like activities or affecting auxin-mediated biological processes have been widely used in auxin research. They can serve as a tool complementary to genetic and genomic methods, facilitating the identification of an array of components modulating auxin metabolism, transport and signaling. The employment of high-throughput screening technologies combined with informatics-based chemical design and organic chemical synthesis has since yielded many novel small molecules with more instantaneous, precise and specific functionalities. By applying those small molecules, novel molecular targets can be isolated to further understand and dissect auxin-related pathways and networks that otherwise are too complex to be elucidated only by gene-based methods. Here, we will review examples of recently characterized molecules used in auxin research, highlight the strategies of unraveling the mechanisms of these small molecules and discuss future perspectives of small molecule applications in auxin biology. PMID:24252105

  16. “RaMassays”: Synergistic Enhancement of Plasmon-Free Raman Scattering and Mass Spectrometry for Multimodal Analysis of Small Molecules

    NASA Astrophysics Data System (ADS)

    Alessandri, Ivano; Vassalini, Irene; Bertuzzi, Michela; Bontempi, Nicolò; Memo, Maurizio; Gianoncelli, Alessandra

    2016-10-01

    SiO2/TiO2 core/shell (T-rex) beads were exploited as “all-in-one” building-block materials to create analytical assays that combine plasmon-free surface enhanced Raman scattering (SERS) and surface assisted laser desorption/ionization (SALDI) mass spectrometry (RaMassays). Such a multi-modal approach relies on the unique optical properties of T-rex beads, which are able to harvest and manage light in both UV and Vis range, making ionization and Raman scattering more efficient. RaMassays were successfully applied to the detection of small (molecular weight, M.W. <400 Da) molecules with a key relevance in biochemistry and pharmaceutical analysis. Caffeine and cocaine were utilized as molecular probes to test the combined SERS/SALDI response of RaMassays, showing excellent sensitivity and reproducibility. The differentiation between amphetamine/ephedrine and theophylline/theobromine couples demonstrated the synergistic reciprocal reinforcement of SERS and SALDI. Finally, the conversion of L-tyrosine in L-DOPA was utilized to probe RaMassays as analytical tools for characterizing reaction intermediates without introducing any spurious effects. RaMassays exhibit important advantages over plasmonic nanoparticles in terms of reproducibility, absence of interference and potential integration in multiplexed devices.

  17. “RaMassays”: Synergistic Enhancement of Plasmon-Free Raman Scattering and Mass Spectrometry for Multimodal Analysis of Small Molecules

    PubMed Central

    Alessandri, Ivano; Vassalini, Irene; Bertuzzi, Michela; Bontempi, Nicolò; Memo, Maurizio; Gianoncelli, Alessandra

    2016-01-01

    SiO2/TiO2 core/shell (T-rex) beads were exploited as “all-in-one” building-block materials to create analytical assays that combine plasmon-free surface enhanced Raman scattering (SERS) and surface assisted laser desorption/ionization (SALDI) mass spectrometry (RaMassays). Such a multi-modal approach relies on the unique optical properties of T-rex beads, which are able to harvest and manage light in both UV and Vis range, making ionization and Raman scattering more efficient. RaMassays were successfully applied to the detection of small (molecular weight, M.W. <400 Da) molecules with a key relevance in biochemistry and pharmaceutical analysis. Caffeine and cocaine were utilized as molecular probes to test the combined SERS/SALDI response of RaMassays, showing excellent sensitivity and reproducibility. The differentiation between amphetamine/ephedrine and theophylline/theobromine couples demonstrated the synergistic reciprocal reinforcement of SERS and SALDI. Finally, the conversion of L-tyrosine in L-DOPA was utilized to probe RaMassays as analytical tools for characterizing reaction intermediates without introducing any spurious effects. RaMassays exhibit important advantages over plasmonic nanoparticles in terms of reproducibility, absence of interference and potential integration in multiplexed devices. PMID:27698368

  18. Electrocatalytic oxidation of small organic molecules in acid medium: enhancement of activity of noble metal nanoparticles and their alloys by supporting or modifying them with metal oxides

    PubMed Central

    Kulesza, Pawel J.; Pieta, Izabela S.; Rutkowska, Iwona A.; Wadas, Anna; Marks, Diana; Klak, Karolina; Stobinski, Leszek; Cox, James A.

    2013-01-01

    Different approaches to enhancement of electrocatalytic activity of noble metal nanoparticles during oxidation of small organic molecules (namely potential fuels for low-temperature fuel cells such as methanol, ethanol and formic acid) are described. A physical approach to the increase of activity of catalytic nanoparticles (e.g. platinum or palladium) involves nanostructuring to obtain highly dispersed systems of high surface area. Recently, the feasibility of enhancing activity of noble metal systems through the formation of bimetallic (e.g. PtRu, PtSn, and PdAu) or even more complex (e.g. PtRuW, PtRuSn) alloys has been demonstrated. In addition to possible changes in the electronic properties of alloys, specific interactions between metals as well as chemical reactivity of the added components have been postulated. We address and emphasize here the possibility of utilization of noble metal and alloyed nanoparticles supported on robust but reactive high surface area metal oxides (e.g. WO3, MoO3, TiO2, ZrO2, V2O5, and CeO2) in oxidative electrocatalysis. This paper concerns the way in which certain inorganic oxides and oxo species can act effectively as supports for noble metal nanoparticles or their alloys during electrocatalytic oxidation of hydrogen and representative organic fuels. Among important issues are possible changes in the morphology and dispersion, as well as specific interactions leading to the improved chemisorptive and catalytic properties in addition to the feasibility of long time operation of the discussed systems. PMID:24443590

  19. Electrocatalytic oxidation of small organic molecules in acid medium: enhancement of activity of noble metal nanoparticles and their alloys by supporting or modifying them with metal oxides.

    PubMed

    Kulesza, Pawel J; Pieta, Izabela S; Rutkowska, Iwona A; Wadas, Anna; Marks, Diana; Klak, Karolina; Stobinski, Leszek; Cox, James A

    2013-11-01

    Different approaches to enhancement of electrocatalytic activity of noble metal nanoparticles during oxidation of small organic molecules (namely potential fuels for low-temperature fuel cells such as methanol, ethanol and formic acid) are described. A physical approach to the increase of activity of catalytic nanoparticles (e.g. platinum or palladium) involves nanostructuring to obtain highly dispersed systems of high surface area. Recently, the feasibility of enhancing activity of noble metal systems through the formation of bimetallic (e.g. PtRu, PtSn, and PdAu) or even more complex (e.g. PtRuW, PtRuSn) alloys has been demonstrated. In addition to possible changes in the electronic properties of alloys, specific interactions between metals as well as chemical reactivity of the added components have been postulated. We address and emphasize here the possibility of utilization of noble metal and alloyed nanoparticles supported on robust but reactive high surface area metal oxides (e.g. WO3, MoO3, TiO2, ZrO2, V2O5, and CeO2) in oxidative electrocatalysis. This paper concerns the way in which certain inorganic oxides and oxo species can act effectively as supports for noble metal nanoparticles or their alloys during electrocatalytic oxidation of hydrogen and representative organic fuels. Among important issues are possible changes in the morphology and dispersion, as well as specific interactions leading to the improved chemisorptive and catalytic properties in addition to the feasibility of long time operation of the discussed systems.

  20. Electronic Structure of Small Lanthanide Containing Molecules

    NASA Astrophysics Data System (ADS)

    Kafader, Jared O.; Ray, Manisha; Topolski, Josey E.; Chick Jarrold, Caroline

    2016-06-01

    Lanthanide-based materials have unusual electronic properties because of the high number of electronic degrees of freedom arising from partial occupation of 4f orbitals, which make these materials optimal for their utilization in many applications including electronics and catalysis. Electronic spectroscopy of small lanthanide molecules helps us understand the role of these 4f electrons, which are generally considered core-like because of orbital contraction, but are energetically similar to valence electrons. The spectroscopy of small lanthanide-containing molecules is relatively unexplored and to broaden this understanding we have completed the characterization of small cerium, praseodymium, and europium molecules using photoelectron spectroscopy coupled with DFT calculations. The characterization of PrO, EuH, EuO/EuOH, and CexOy molecules have allowed for the determination of their electron affinity, the assignment of numerous anion to neutral state transitions, modeling of anion/neutral structures and electron orbital occupation.

  1. Engineering vascularized tissues using natural and synthetic small molecules

    PubMed Central

    Sefcik, Lauren S; Petrie Aronin, Caren E

    2008-01-01

    Vascular growth and remodeling are complex processes that depend on the proper spatial and temporal regulation of many different signaling molecules to form functional vascular networks. The ability to understand and regulate these signals is an important clinical need with the potential to treat a wide variety of disease pathologies. Current approaches have focused largely on the delivery of proteins to promote neovascularization of ischemic tissues, most notably VEGF and FGF. Although great progress has been made in this area, results from clinical trials are disappointing and safer and more effective approaches are required. To this end, biological agents used for therapeutic neovascularization must be explored beyond the current well-investigated classes. This review focuses on potential pathways for novel drug discovery, utilizing small molecule approaches to induce and enhance neovascularization. Specifically, four classes of new and existing molecules are discussed, including transcriptional activators, receptor selective agonists and antagonists, natural product-derived small molecules, and novel synthetic small molecules. PMID:19337401

  2. Profiling protein function with small molecule microarrays

    PubMed Central

    Winssinger, Nicolas; Ficarro, Scott; Schultz, Peter G.; Harris, Jennifer L.

    2002-01-01

    The regulation of protein function through posttranslational modification, local environment, and protein–protein interaction is critical to cellular function. The ability to analyze on a genome-wide scale protein functional activity rather than changes in protein abundance or structure would provide important new insights into complex biological processes. Herein, we report the application of a spatially addressable small molecule microarray to an activity-based profile of proteases in crude cell lysates. The potential of this small molecule-based profiling technology is demonstrated by the detection of caspase activation upon induction of apoptosis, characterization of the activated caspase, and inhibition of the caspase-executed apoptotic phenotype using the small molecule inhibitor identified in the microarray-based profile. PMID:12167675

  3. Metastable States of small-molecule solutions.

    PubMed

    He, Guangwen; Tan, Reginald B H; Kenis, Paul J A; Zukoski, Charles F

    2007-12-27

    Metastable states such as gels and glasses that are commonly seen in nanoparticle suspensions have found application in a wide range of products including toothpaste, hand cream, paints, and car tires. The equilibrium and metastable state behavior of nanoparticle suspensions are often described by simple fluid models where particles are treated as having hard cores and interacting with short-range attractions. Here we explore similar models to describe the presence of metastable states of small-molecule solutions. We have recently shown that the equilibrium solubilities of small hydrogen-bonding molecules and nanoparticles fall onto a corresponding-states solubility curve suggesting that with similar average strengths of attraction these molecules have similar solubilities. This observation implies that metastable states in small-molecule solutions may be found under conditions similar to those where metastable states are observed in nanoparticle and colloidal suspensions. Here we seek confirmation of this concept by exploring the existence of metastable states in solutions of small molecules.

  4. Small Molecules from the Human Microbiota

    PubMed Central

    Donia, Mohamed S.; Fischbach, Michael A.

    2015-01-01

    Developments in the use of genomics to guide natural product discovery and a recent emphasis on understanding the molecular mechanisms of microbiota-host interactions have converged on the discovery of natural products from the human microbiome. Here, we review what is known about small molecules produced by the human microbiota. Numerous molecules representing each of the major metabolite classes have been found that have a variety of biological activities, including immune modulation and antibiosis. We discuss technologies that will affect how microbiota-derived molecules are discovered in the future, and consider the challenges inherent in finding specific molecules that are critical for driving microbe-host and microbe-microbe interactions and their biological relevance. PMID:26206939

  5. Uranium-mediated activation of small molecules.

    PubMed

    Arnold, Polly L

    2011-08-28

    Molecular complexes of uranium are capable of activating a range of industrially and economically important small molecules such as CO, CO(2), and N(2); new and often unexpected reactions provide insight into an element that needs to be well-understood if future clean-energy solutions are to involve nuclear power.

  6. Small molecule control of bacterial biofilms

    PubMed Central

    Worthington, Roberta J.; Richards, Justin J.

    2012-01-01

    Bacterial biofilms are defined as a surface attached community of bacteria embedded in a matrix of extracellular polymeric substances that they have produced. When in the biofilm state, bacteria are more resistant to antibiotics and the host immune response than are their planktonic counterparts. Biofilms are increasingly recognized as being significant in human disease, accounting for 80% of bacterial infections in the body and diseases associated with bacterial biofilms include: lung infections of cystic fibrosis, colitis, urethritis, conjunctivitis, otitis, endocarditis and periodontitis. Additionally, biofilm infections of indwelling medical devices are of particular concern, as once the device is colonized infection is virtually impossible to eradicate. Given the prominence of biofilms in infectious diseases, there has been an increased effort toward the development of small molecules that will modulate bacterial biofilm development and maintenance. In this review, we highlight the development of small molecules that inhibit and/or disperse bacterial biofilms through non-microbicidal mechanisms. The review discuses the numerous approaches that have been applied to the discovery of lead small molecules that mediate biofilm development. These approaches are grouped into: 1) the identification and development of small molecules that target one of the bacterial signaling pathways involved in biofilm regulation, 2) chemical library screening for compounds with anti-biofilm activity, and 3) the identification of natural products that possess anti-biofilm activity, and the chemical manipulation of these natural products to obtain analogues with increased activity. PMID:22733439

  7. Small molecule control of bacterial biofilms.

    PubMed

    Worthington, Roberta J; Richards, Justin J; Melander, Christian

    2012-10-01

    Bacterial biofilms are defined as a surface attached community of bacteria embedded in a matrix of extracellular polymeric substances that they have produced. When in the biofilm state, bacteria are more resistant to antibiotics and the host immune response than are their planktonic counterparts. Biofilms are increasingly recognized as being significant in human disease, accounting for 80% of bacterial infections in the body and diseases associated with bacterial biofilms include: lung infections of cystic fibrosis patients, colitis, urethritis, conjunctivitis, otitis, endocarditis and periodontitis. Additionally, biofilm infections of indwelling medical devices are of particular concern, as once the device is colonized infection is virtually impossible to eradicate. Given the prominence of biofilms in infectious diseases, there has been an increased effort toward the development of small molecules that will modulate bacterial biofilm development and maintenance. In this review, we highlight the development of small molecules that inhibit and/or disperse bacterial biofilms through non-microbicidal mechanisms. The review discuses the numerous approaches that have been applied to the discovery of lead small molecules that mediate biofilm development. These approaches are grouped into: (1) the identification and development of small molecules that target one of the bacterial signaling pathways involved in biofilm regulation, (2) chemical library screening for compounds with anti-biofilm activity, and (3) the identification of natural products that possess anti-biofilm activity, and the chemical manipulation of these natural products to obtain analogues with increased activity. PMID:22733439

  8. SMPDB: The Small Molecule Pathway Database.

    PubMed

    Frolkis, Alex; Knox, Craig; Lim, Emilia; Jewison, Timothy; Law, Vivian; Hau, David D; Liu, Phillip; Gautam, Bijaya; Ly, Son; Guo, An Chi; Xia, Jianguo; Liang, Yongjie; Shrivastava, Savita; Wishart, David S

    2010-01-01

    The Small Molecule Pathway Database (SMPDB) is an interactive, visual database containing more than 350 small-molecule pathways found in humans. More than 2/3 of these pathways (>280) are not found in any other pathway database. SMPDB is designed specifically to support pathway elucidation and pathway discovery in clinical metabolomics, transcriptomics, proteomics and systems biology. SMPDB provides exquisitely detailed, hyperlinked diagrams of human metabolic pathways, metabolic disease pathways, metabolite signaling pathways and drug-action pathways. All SMPDB pathways include information on the relevant organs, organelles, subcellular compartments, protein cofactors, protein locations, metabolite locations, chemical structures and protein quaternary structures. Each small molecule is hyperlinked to detailed descriptions contained in the Human Metabolome Database (HMDB) or DrugBank and each protein or enzyme complex is hyperlinked to UniProt. All SMPDB pathways are accompanied with detailed descriptions, providing an overview of the pathway, condition or processes depicted in each diagram. The database is easily browsed and supports full text searching. Users may query SMPDB with lists of metabolite names, drug names, genes/protein names, SwissProt IDs, GenBank IDs, Affymetrix IDs or Agilent microarray IDs. These queries will produce lists of matching pathways and highlight the matching molecules on each of the pathway diagrams. Gene, metabolite and protein concentration data can also be visualized through SMPDB's mapping interface. All of SMPDB's images, image maps, descriptions and tables are downloadable. SMPDB is available at: http://www.smpdb.ca. PMID:19948758

  9. Computational mass spectrometry for small molecules

    PubMed Central

    2013-01-01

    The identification of small molecules from mass spectrometry (MS) data remains a major challenge in the interpretation of MS data. This review covers the computational aspects of identifying small molecules, from the identification of a compound searching a reference spectral library, to the structural elucidation of unknowns. In detail, we describe the basic principles and pitfalls of searching mass spectral reference libraries. Determining the molecular formula of the compound can serve as a basis for subsequent structural elucidation; consequently, we cover different methods for molecular formula identification, focussing on isotope pattern analysis. We then discuss automated methods to deal with mass spectra of compounds that are not present in spectral libraries, and provide an insight into de novo analysis of fragmentation spectra using fragmentation trees. In addition, this review shortly covers the reconstruction of metabolic networks using MS data. Finally, we list available software for different steps of the analysis pipeline. PMID:23453222

  10. Organic Optoelectronic Devices Employing Small Molecules

    NASA Astrophysics Data System (ADS)

    Fleetham, Tyler Blain

    Organic optoelectronic devices have remained a research topic of great interest over the past two decades, particularly in the development of efficient organic photovoltaics (OPV) and organic light emitting diodes (OLED). In order to improve the efficiency, stability, and materials variety for organic optoelectronic devices a number of emitting materials, absorbing materials, and charge transport materials were developed and employed in a device setting. Optical, electrical, and photophysical studies of the organic materials and their corresponding devices were thoroughly carried out. Two major approaches were taken to enhance the efficiency of small molecule based OPVs: developing material with higher open circuit voltages or improved device structures which increased short circuit current. To explore the factors affecting the open circuit voltage (VOC) in OPVs, molecular structures were modified to bring VOC closer to the effective bandgap, DeltaE DA, which allowed the achievement of 1V VOC for a heterojunction of a select Ir complex with estimated exciton energy of only 1.55eV. Furthermore, the development of anode interfacial layer for exciton blocking and molecular templating provide a general approach for enhancing the short circuit current. Ultimately, a 5.8% PCE was achieved in a single heterojunction of C60 and a ZnPc material prepared in a simple, one step, solvent free, synthesis. OLEDs employing newly developed deep blue emitters based on cyclometalated complexes were demonstrated. Ultimately, a peak EQE of 24.8% and nearly perfect blue emission of (0.148,0.079) was achieved from PtON7dtb, which approaches the maximum attainable performance from a blue OLED. Furthermore, utilizing the excimer formation properties of square-planar Pt complexes, highly efficient and stable white devices employing a single emissive material were demonstrated. A peak EQE of over 20% for pure white color (0.33,0.33) and 80 CRI was achieved with the tridentate Pt complex, Pt

  11. Small-molecule inhibitors targeting INK4 protein p18INK4C enhance ex vivo expansion of haematopoietic stem cells

    PubMed Central

    Gao, Yingdai; Yang, Peng; Shen, Hongmei; Yu, Hui; Song, Xianmin; Zhang, Liyan; Zhang, Peng; Cheng, Haizi; Xie, Zhaojun; Hao, Sha; Dong, Fang; Ma, Shihui; Ji, Qing; Bartlow, Patrick; Ding, Yahui; Wang, Lirong; Liu, Haibin; Li, Yanxin; Cheng, Hui; Miao, Weimin; Yuan, Weiping; Yuan, Youzhong; Cheng, Tao; Xie, Xiang-Qun

    2015-01-01

    Among cyclin-dependent kinase inhibitors that control the G1 phase in cell cycle, only p18 and p27 can negatively regulate haematopoietic stem cell (HSC) self-renewal. In this manuscript, we demonstrate that p18 protein is a more potent inhibitor of HSC self-renewal than p27 in mouse models and its deficiency promoted HSC expansion in long-term culture. Single-cell analysis indicated that deleting p18 gene favoured self-renewing division of HSC in vitro. Based on the structure of p18 protein and in-silico screening, we further identified novel small-molecule inhibitors that can specifically block the activity of p18 protein. Our selected lead compounds were able to expand functional HSCs in a short-term culture. Thus, these putative small-molecule inhibitors for p18 protein are valuable for further dissecting the signalling pathways of stem cell self-renewal and may help develop more effective chemical agents for therapeutic expansion of HSC. PMID:25692908

  12. Fluorescence Polarization Assays in Small Molecule Screening

    PubMed Central

    Lea, Wendy A.; Simeonov, Anton

    2011-01-01

    Importance of the field Fluorescence polarization (FP) is a homogeneous method that allows rapid and quantitative analysis of diverse molecular interactions and enzyme activities. This technique has been widely utilized in clinical and biomedical settings, including the diagnosis of certain diseases and monitoring therapeutic drug levels in body fluids. Recent developments in the field has been symbolized by the facile adoption of FP in high-throughput screening (HTS) and small molecule drug discovery of an increasing range of target classes. Areas covered in this review The article provides a brief overview on the theoretical foundation of FP, followed by updates on recent advancements in its application for various drug target classes, including G-protein coupled receptors (GPCRs), enzymes and protein-protein interactions (PPIs). The strengths and weaknesses of this method, practical considerations in assay design, novel applications, and future directions are also discussed. What the reader will gain The reader will be informed of the most recent advancements and future directions of FP application to small molecule screening. Take home message In addition to its continued utilization in high-throughput screening, FP has expanded into new disease and target areas and has been marked by increased use of labeled small molecule ligands for receptor binding studies. PMID:22328899

  13. Evaluating enzymatic synthesis of small molecule drugs.

    PubMed

    Moura, Matthew; Finkle, Justin; Stainbrook, Sarah; Greene, Jennifer; Broadbelt, Linda J; Tyo, Keith E J

    2016-01-01

    There have been many achievements in applying biochemical synthetic routes to the synthesis of commodity chemicals. However, most of these endeavors have focused on optimizing and increasing the yields of naturally existing pathways. We sought to evaluate the potential for biosynthesis beyond the limits of known biochemistry towards the production of small molecule drugs that do not exist in nature. Because of the potential for improved yields compared to total synthesis, and therefore lower manufacturing costs, we focused on drugs for diseases endemic to many resource poor regions, like tuberculosis and HIV. Using generalized biochemical reaction rules, we were able to design biochemical pathways for the production of eight small molecule drugs or drug precursors and identify potential enzyme-substrate pairs for nearly every predicted reaction. All pathways begin from native metabolites, abrogating the need for specialized precursors. The simulated pathways showed several trends with the sequential ordering of reactions as well as the types of chemistries used. For some compounds, the main obstacles to finding feasible biochemical pathways were the lack of appropriate, natural starting compounds and a low diversity of biochemical coupling reactions necessary to synthesize molecules with larger molecular size.

  14. Small Molecule Agonists of Cell Adhesion Molecule L1 Mimic L1 Functions In Vivo.

    PubMed

    Kataria, Hardeep; Lutz, David; Chaudhary, Harshita; Schachner, Melitta; Loers, Gabriele

    2016-09-01

    Lack of permissive mechanisms and abundance of inhibitory molecules in the lesioned central nervous system of adult mammals contribute to the failure of functional recovery after injury, leading to severe disabilities in motor functions and pain. Peripheral nerve injury impairs motor, sensory, and autonomic functions, particularly in cases where nerve gaps are large and chronic nerve injury ensues. Previous studies have indicated that the neural cell adhesion molecule L1 constitutes a viable target to promote regeneration after acute injury. We screened libraries of known drugs for small molecule agonists of L1 and evaluated the effect of hit compounds in cell-based assays in vitro and in mice after femoral nerve and spinal cord injuries in vivo. We identified eight small molecule L1 agonists and showed in cell-based assays that they stimulate neuronal survival, neuronal migration, and neurite outgrowth and enhance Schwann cell proliferation and migration and myelination of neurons in an L1-dependent manner. In a femoral nerve injury mouse model, enhanced functional regeneration and remyelination after application of the L1 agonists were observed. In a spinal cord injury mouse model, L1 agonists improved recovery of motor functions, being paralleled by enhanced remyelination, neuronal survival, and monoaminergic innervation, reduced astrogliosis, and activation of microglia. Together, these findings suggest that application of small organic compounds that bind to L1 and stimulate the beneficial homophilic L1 functions may prove to be a valuable addition to treatments of nervous system injuries. PMID:26253722

  15. Carbon nanotubes for delivery of small molecule drugs.

    PubMed

    Wong, Bin Sheng; Yoong, Sia Lee; Jagusiak, Anna; Panczyk, Tomasz; Ho, Han Kiat; Ang, Wee Han; Pastorin, Giorgia

    2013-12-01

    In the realm of drug delivery, carbon nanotubes (CNTs) have gained tremendous attention as promising nanocarriers, owing to their distinct characteristics, such as high surface area, enhanced cellular uptake and the possibility to be easily conjugated with many therapeutics, including both small molecules and biologics, displaying superior efficacy, enhanced specificity and diminished side effects. While most CNT-based drug delivery system (DDS) had been engineered to combat cancers, there are also emerging reports that employ CNTs as either the main carrier or adjunct material for the delivery of various non-anticancer drugs. In this review, the delivery of small molecule drugs is expounded, with special attention paid to the current progress of in vitro and in vivo research involving CNT-based DDSs, before finally concluding with some consideration on inevitable complications that hamper successful disease intervention with CNTs. PMID:23954402

  16. Carbon nanotubes for delivery of small molecule drugs.

    PubMed

    Wong, Bin Sheng; Yoong, Sia Lee; Jagusiak, Anna; Panczyk, Tomasz; Ho, Han Kiat; Ang, Wee Han; Pastorin, Giorgia

    2013-12-01

    In the realm of drug delivery, carbon nanotubes (CNTs) have gained tremendous attention as promising nanocarriers, owing to their distinct characteristics, such as high surface area, enhanced cellular uptake and the possibility to be easily conjugated with many therapeutics, including both small molecules and biologics, displaying superior efficacy, enhanced specificity and diminished side effects. While most CNT-based drug delivery system (DDS) had been engineered to combat cancers, there are also emerging reports that employ CNTs as either the main carrier or adjunct material for the delivery of various non-anticancer drugs. In this review, the delivery of small molecule drugs is expounded, with special attention paid to the current progress of in vitro and in vivo research involving CNT-based DDSs, before finally concluding with some consideration on inevitable complications that hamper successful disease intervention with CNTs.

  17. Activation of small molecules by phosphorus biradicaloids.

    PubMed

    Hinz, Alexander; Kuzora, Rene; Rosenthal, Uwe; Schulz, Axel; Villinger, Alexander

    2014-11-01

    The reactivity of biradicaloid [P(μ-NTer)]2 was employed to activate small molecules bearing single, double, and triple bonds. Addition of chalcogens (O2 , S8 , Sex and Tex ) led to the formation of dichalcogen-bridged P2 N2 heterocycles, except from the reaction with molecular oxygen, which gave a P2 N2 ring featuring a dicoordinated P(III) and a four-coordinated P(V) center. In formal [2πe+2πe] addition reactions, small unsaturated compounds such as ethylene, acetylene, acetone, acetonitrile, tolane, diphenylcarbodiimide, and bis(trimethylsilyl)sulfurdiimide are readily added to the P2 N2 heterocycle of the biradicaloid [P(μ-NTer)]2 , yielding novel heteroatom cage compounds. The synthesis, reactivity, and bonding of the biradicaloid [P(μ-NTer)]2 were studied in detail as well as the synthesis, properties, and structural features of all addition products. PMID:25266101

  18. Small Molecule Bax Agonists for Cancer Therapy

    PubMed Central

    Xin, Meiguo; Li, Rui; Xie, Maohua; Park, Dongkyoo; Owonikoko, Taofeek K.; Sica, Gabriel L.; Corsino, Patrick E.; Zhou, Jia; Ding, Chunyong; White, Mark A.; Magis, Andrew T.; Ramalingam, Suresh S.; Curran, Walter J.; Khuri, Fadlo R.; Deng, Xingming

    2014-01-01

    Bax, a central death regulator, is required at the decisional stage of apoptosis. We recently identified serine 184 (S184) of Bax as a critical functional switch controlling its proapoptotic activity. Here, we employed the structural pocket around S184 as a docking site to screen the NCI library of small molecules using the UCSF-DOCK program suite. Three compounds, small molecule Bax agonists SMBA1, SMBA2 and SMBA3, induce conformational changes in Bax by blocking S184 phosphorylation, facilitating Bax insertion into mitochondrial membranes and forming Bax oligomers. The latter leads to cytochrome c release and apoptosis in human lung cancer cells, which occurs in a Bax- but not Bak-dependent fashion. SMBA1 potently suppresses lung tumor growth via apoptosis by selectively activating Bax in vivo without significant normal tissue toxicity. Development of Bax agonists as a new class of anti-cancer drugs offers a strategy for the treatment of lung cancer and other Bax-expressing malignancies. PMID:25230299

  19. Small molecule phagocytosis inhibitors for immune cytopenias.

    PubMed

    Neschadim, Anton; Kotra, Lakshmi P; Branch, Donald R

    2016-08-01

    Immune cytopenias are conditions characterized by low blood cell counts, such as platelets in immune thrombocytopenia (ITP) and red blood cells in autoimmune hemolytic anemia (AIHA). Chronic ITP affects approximately 4 in 100,000 adults annually while AIHA is much less common. Extravascular phagocytosis and massive destruction of autoantibody-opsonized blood cells by macrophages in the spleen and liver are the hallmark of these conditions. Current treatment modalities for ITP and AIHA include the first-line use of corticosteroids; whereas, IVIg shows efficacy in ITP but not AIHA. One main mechanism of action by which IVIg treatment leads to the reduction in platelet destruction rates in ITP is thought to involve Fcγ receptor (FcγR) blockade, ultimately leading to the inhibition of extravascular platelet phagocytosis. IVIg, which is manufactured from the human plasma of thousands of donors, is a limited resource, and alternative treatments, particularly those based on bioavailable small molecules, are needed. In this review, we overview the pathophysiology of ITP, the role of Fcγ receptors, and the mechanisms of action of IVIg in treating ITP, and outline the efforts and progress towards developing novel, first-in-class inhibitors of phagocytosis as synthetic, small molecule substitutes for IVIg in ITP and other conditions where the pathobiology of the disease involves phagocytosis.

  20. Enhancement of Radiation Sensitivity in Lung Cancer Cells by a Novel Small Molecule Inhibitor That Targets the β-Catenin/Tcf4 Interaction

    PubMed Central

    Luo, Guifen; Han, Xiaofeng; Bao, Wenjing; Cheng, Yanyan; Tian, Wang; Yan, Maocai; Yang, Guanlin; An, Jing

    2016-01-01

    Radiation therapy is an important treatment choice for unresectable advanced human lung cancers, and a critical adjuvant treatment for surgery. However, radiation as a lung cancer treatment remains far from satisfactory due to problems associated with radiation resistance in cancer cells and severe cytotoxicity to non-cancer cells, which arise at doses typically administered to patients. We have recently identified a promising novel inhibitor of β-catenin/Tcf4 interaction, named BC-23 (C21H14ClN3O4S), which acts as a potent cell death enhancer when used in combination with radiation. Sequential exposure of human p53-null non-small cell lung cancer (NSCLC) H1299 cells to low doses of x-ray radiation, followed 1 hour later by administration of minimally cytotoxic concentrations of BC-23, resulted in a highly synergistic induction of clonogenic cell death (combination index <1.0). Co-treatment with BC-23 at low concentrations effectively inhibits Wnt/β-catenin signaling and down-regulates c-Myc and cyclin D1 expression. S phase arrest and ROS generation are also involved in the enhancement of radiation effectiveness mediated by BC-23. BC-23 therefore represents a promising new class of radiation enhancer. PMID:27014877

  1. Enhancement of Radiation Sensitivity in Lung Cancer Cells by a Novel Small Molecule Inhibitor That Targets the β-Catenin/Tcf4 Interaction.

    PubMed

    Zhang, Qinghao; Gao, Mei; Luo, Guifen; Han, Xiaofeng; Bao, Wenjing; Cheng, Yanyan; Tian, Wang; Yan, Maocai; Yang, Guanlin; An, Jing

    2016-01-01

    Radiation therapy is an important treatment choice for unresectable advanced human lung cancers, and a critical adjuvant treatment for surgery. However, radiation as a lung cancer treatment remains far from satisfactory due to problems associated with radiation resistance in cancer cells and severe cytotoxicity to non-cancer cells, which arise at doses typically administered to patients. We have recently identified a promising novel inhibitor of β-catenin/Tcf4 interaction, named BC-23 (C21H14ClN3O4S), which acts as a potent cell death enhancer when used in combination with radiation. Sequential exposure of human p53-null non-small cell lung cancer (NSCLC) H1299 cells to low doses of x-ray radiation, followed 1 hour later by administration of minimally cytotoxic concentrations of BC-23, resulted in a highly synergistic induction of clonogenic cell death (combination index <1.0). Co-treatment with BC-23 at low concentrations effectively inhibits Wnt/β-catenin signaling and down-regulates c-Myc and cyclin D1 expression. S phase arrest and ROS generation are also involved in the enhancement of radiation effectiveness mediated by BC-23. BC-23 therefore represents a promising new class of radiation enhancer.

  2. Enhancement of Radiation Sensitivity in Lung Cancer Cells by a Novel Small Molecule Inhibitor That Targets the β-Catenin/Tcf4 Interaction.

    PubMed

    Zhang, Qinghao; Gao, Mei; Luo, Guifen; Han, Xiaofeng; Bao, Wenjing; Cheng, Yanyan; Tian, Wang; Yan, Maocai; Yang, Guanlin; An, Jing

    2016-01-01

    Radiation therapy is an important treatment choice for unresectable advanced human lung cancers, and a critical adjuvant treatment for surgery. However, radiation as a lung cancer treatment remains far from satisfactory due to problems associated with radiation resistance in cancer cells and severe cytotoxicity to non-cancer cells, which arise at doses typically administered to patients. We have recently identified a promising novel inhibitor of β-catenin/Tcf4 interaction, named BC-23 (C21H14ClN3O4S), which acts as a potent cell death enhancer when used in combination with radiation. Sequential exposure of human p53-null non-small cell lung cancer (NSCLC) H1299 cells to low doses of x-ray radiation, followed 1 hour later by administration of minimally cytotoxic concentrations of BC-23, resulted in a highly synergistic induction of clonogenic cell death (combination index <1.0). Co-treatment with BC-23 at low concentrations effectively inhibits Wnt/β-catenin signaling and down-regulates c-Myc and cyclin D1 expression. S phase arrest and ROS generation are also involved in the enhancement of radiation effectiveness mediated by BC-23. BC-23 therefore represents a promising new class of radiation enhancer. PMID:27014877

  3. Development of novel small molecules for imaging and drug release

    NASA Astrophysics Data System (ADS)

    Cao, Yanting

    last part, a new photo-initiated fluorescent anticancer prodrug for DNA alkylating agent mechlorethamine releasing and monitoring has been developed. The theranostic prodrug consists a photolabile NPE group, an inactive form of mechlorethamine and a nonfluorescent coumarin in one small molecule. It is demonstrated that the prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, while the original parent drug mechlorethamine can be photocontrol-released and induces effective DNA cross-linking activity. Importantly, the drug release progress can be conveniently monitored by the 'off-on' fluorescence enhancement in cells. Moreover, the selective prodrug is not only cell permeable but also nuclear permeable. Therefore, the prodrug serves as a promising drug delivery system for spatiotemporal control release and monitoring of an anticancer drug to obtain the optimal treatment efficacy.

  4. Aggregated silver nanoparticles based surface-enhanced Raman scattering enzyme-linked immunosorbent assay for ultrasensitive detection of protein biomarkers and small molecules.

    PubMed

    Liang, Jiajie; Liu, Hongwu; Huang, Caihong; Yao, Cuize; Fu, Qiangqiang; Li, Xiuqing; Cao, Donglin; Luo, Zhi; Tang, Yong

    2015-06-01

    Lowering the detection limit is critical to the design of bioassays required for medical diagnostics, environmental monitoring, and food safety regulations. The current sensitivity of standard color-based analyte detection limits the further use of enzyme-linked immunosorbent assays (ELISAs) in research and clinical diagnoses. Here, we demonstrate a novel method that uses the Raman signal as the signal-generating system of an ELISA and combines surface-enhanced Raman scattering (SERS) with silver nanoparticles aggregation for ultrasensitive analyte detection. The enzyme label of the ELISA controls the dissolution of Raman reporter-labeled silver nanoparticles through hydrogen peroxide and generates a strong Raman signal when the analyte is present. Using this assay, prostate-specific antigen (PSA) and the adrenal stimulant ractopamine (Rac) were detected in whole serum and urine at the ultralow concentrations of 10(-9) and 10(-6) ng/mL, respectively. The methodology proposed here could potentially be applied to other molecules detection as well as PSA and Rac.

  5. Small-Molecule Inhibitors of Urea Transporters

    PubMed Central

    Verkman, Alan S.; Esteva-Font, Cristina; Cil, Onur; Anderson, Marc O.; Li, Fei; Li, Min; Lei, Tianluo; Ren, Huiwen; Yang, Baoxue

    2015-01-01

    Urea transporter (UT) proteins, which include isoforms of UT-A in kidney tubule epithelia and UT-B in vasa recta endothelia and erythrocytes, facilitate urinary concentrating function. Inhibitors of urea transporter function have potential clinical applications as sodium-sparing diuretics, or ‘urearetics,’ in edema from different etiologies, such as congestive heart failure and cirrhosis, as well as in syndrome of inappropriate antidiuretic hormone (SIADH). High-throughput screening of drug-like small molecules has identified UT-A and UT-B inhibitors with nanomolar potency. Inhibitors have been identified with different UT-A versus UT-B selectivity profiles and putative binding sites on UT proteins. Studies in rodent models support the utility of UT inhibitors in reducing urinary concentration, though testing in clinically relevant animal models of edema has not yet been done. PMID:25298345

  6. Programmable DNA-binding Small Molecules

    PubMed Central

    Blackledge, Meghan S.; Melander, Christian

    2013-01-01

    Aberrant gene expression is responsible for a myriad of human diseases from infectious diseases to cancer. Precise regulation of these genes via specific interactions with the DNA double helix could pave the way for novel therapeutics. Pyrrole-imidazole polyamides are small molecules capable of binding to pre-determined DNA sequences up to 16 base pairs with affinity and specificity comparable to natural transcription factors. In the three decades since their development, great strides have been made relating to synthetic accessibility and improved sequence specificity and binding affinity. This perspective presents a brief history of early seminal developments in the field and highlights recent reports of the utility of polyamides as both genetic modulators and molecular probes. PMID:23665141

  7. Two-Photon Small Molecule Enzymatic Probes.

    PubMed

    Qian, Linghui; Li, Lin; Yao, Shao Q

    2016-04-19

    Enzymes are essential for life, especially in the development of disease and on drug effects, but as we cannot yet directly observe the inside interactions and only partially observe biochemical outcomes, tools "translating" these processes into readable information are essential for better understanding of enzymes as well as for developing effective tools to fight against diseases. Therefore, sensitive small molecule probes suitable for direct in vivo monitoring of enzyme activities are ultimately desirable. For fulfilling this desire, two-photon small molecule enzymatic probes (TSMEPs) producing amplified fluorescent signals based on enzymatic conversion with better photophysical properties and deeper penetration in intact tissues and whole animals have been developed and demonstrated to be powerful in addressing the issues described above. Nonetheless, currently available TSMEPs only cover a small portion of enzymes despite the distinct advantages of two-photon fluorescence microscopy. In this Account, we would like to share design principles for TSMEPs as potential indicators of certain pathology-related biomarkers together with their applications in disease models to inspire more elegant work to be done in this area. Highlights will be addressed on how to equip two-photon fluorescent probes with features amenable for direct assessment of enzyme activities in complex pathological environments. We give three recent examples from our laboratory and collaborations in which TSMEPs are applied to visualize the distribution and activity of enzymes at cellular and organism levels. The first example shows that we could distinguish endogenous phosphatase activity in different organelles; the second illustrates that TSMEP is suitable for specific and sensitive detection of a potential Parkinson's disease marker (monoamine oxidase B) in a variety of biological systems from cells to patient samples, and the third identifies that TSMEPs can be applied to other enzyme

  8. Simulation Studies of Protein and Small Molecule Interactions and Reaction.

    PubMed

    Yang, L; Zhang, J; Che, X; Gao, Y Q

    2016-01-01

    Computational studies of protein and small molecule (protein-ligand/enzyme-substrate) interactions become more and more important in biological science and drug discovery. Computer modeling can provide molecular details of the processes such as conformational change, binding, and transportation of small molecules/proteins, which are not easily to be captured in experiments. In this chapter, we discussed simulation studies of both protein and small molecules from three aspects: conformation sampling, transportations of small molecules in enzymes, and enzymatic reactions involving small molecules. Both methodology developments and examples of simulation studies in this field were presented.

  9. Simulation Studies of Protein and Small Molecule Interactions and Reaction.

    PubMed

    Yang, L; Zhang, J; Che, X; Gao, Y Q

    2016-01-01

    Computational studies of protein and small molecule (protein-ligand/enzyme-substrate) interactions become more and more important in biological science and drug discovery. Computer modeling can provide molecular details of the processes such as conformational change, binding, and transportation of small molecules/proteins, which are not easily to be captured in experiments. In this chapter, we discussed simulation studies of both protein and small molecules from three aspects: conformation sampling, transportations of small molecules in enzymes, and enzymatic reactions involving small molecules. Both methodology developments and examples of simulation studies in this field were presented. PMID:27497167

  10. First-in-class small molecule potentiators of cancer virotherapy

    PubMed Central

    Dornan, Mark H.; Krishnan, Ramya; Macklin, Andrew M.; Selman, Mohammed; El Sayes, Nader; Son, Hwan Hee; Davis, Colin; Chen, Andrew; Keillor, Kerkeslin; Le, Penny J.; Moi, Christina; Ou, Paula; Pardin, Christophe; Canez, Carlos R.; Le Boeuf, Fabrice; Bell, John C.; Smith, Jeffrey C.; Diallo, Jean-Simon; Boddy, Christopher N.

    2016-01-01

    The use of engineered viral strains such as gene therapy vectors and oncolytic viruses (OV) to selectively destroy cancer cells is poised to make a major impact in the clinic and revolutionize cancer therapy. In particular, several studies have shown that OV therapy is safe and well tolerated in humans and can infect a broad range of cancers. Yet in clinical studies OV therapy has highly variable response rates. The heterogeneous nature of tumors is widely accepted to be a major obstacle for OV therapeutics and highlights a need for strategies to improve viral replication efficacy. Here, we describe the development of a new class of small molecules for selectively enhancing OV replication in cancer tissue. Medicinal chemistry studies led to the identification of compounds that enhance multiple OVs and gene therapy vectors. Lead compounds increase OV growth up to 2000-fold in vitro and demonstrate remarkable selectivity for cancer cells over normal tissue ex vivo and in vivo. These small molecules also demonstrate enhanced stability with reduced electrophilicity and are highly tolerated in animals. This pharmacoviral approach expands the scope of OVs to include resistant tumors, further potentiating this transformative therapy. It is easily foreseeable that this approach can be applied to therapeutically enhance other attenuated viral vectors. PMID:27226390

  11. Small Molecule Inhibitor of AICAR Transformylase Homodimerization

    PubMed Central

    Spurr, Ian B.; Birts, Charles N.; Cuda, Francesco; Benkovic, Stephen J; Blaydes, Jeremy P.; Tavassoli, Ali

    2012-01-01

    Aminoimidazole carboxamide ribonucleotide transformylase/inosine monophosphate cyclohydrolase (ATIC) is a bifunctional homodimeric enzyme that catalyses the last two steps of de novo purine biosynthesis. Homodimerization of ATIC, a protein-protein interaction with an interface of over 5000 Å2, is required for its aminoimidazole carboxamide ribonucleotide (AICAR) transformylase activity, with the active sites forming at the interface of the interacting proteins. Here, we report the development of a small-molecule inhibitor of AICAR transformylase that functions by preventing the homodimerization of ATIC. The compound is derived from a previously reported cyclic hexa-peptide inhibitor of AICAR transformylase (with a Ki of 17 μM), identified by high-throughput screening. The active motif of the cyclic peptide is identified as an arginine-tyrosine dipeptide, a capped analogue of which inhibits AICAR transformylase with a Ki of 84 μM. A library of non-natural analogues of this dipeptide was designed, synthesized, and assayed. The most potent compound inhibits AICAR transformylase with a Ki of 685 nM, a 25-fold improvement in activity from the parent cyclic peptide. The potential for this AICAR transformylase inhibitor in cancer therapy is assessed by studying its effect on the proliferation of a model breast cancer cell line. Using a non-radioactive proliferation assay and live cell imaging, a dose-dependent reduction in cell numbers and cell division rates was observed in cells treated with our ATIC dimerization inhibitor. PMID:22764122

  12. Finding small molecules for the ‘next Ebola’

    PubMed Central

    Ekins, Sean; Southan, Christopher; Coffee, Megan

    2015-01-01

    The current Ebola virus epidemic may provide some suggestions of how we can better prepare for the next pathogen outbreak. We propose several cost effective steps that could be taken that would impact the discovery and use of small molecule therapeutics including: 1. text mine the literature, 2. patent assignees and/or inventors should openly declare their relevant filings, 3. reagents and assays could be commoditized, 4. using manual curation to enhance database links, 5. engage database and curation teams, 6. consider open science approaches, 7. adapt the “box” model for shareable reference compounds, and 8. involve the physician’s perspective. PMID:25949804

  13. Structure of small clusters of parahydrogen molecules

    SciTech Connect

    Guardiola, Rafael; Navarro, Jesus

    2006-08-15

    The ground state energies and the one-body densities of parahydrogen clusters have been systematically calculated by the diffusion Monte Carlo technique in steps of one molecule from 3 to 50 molecules. These calculations show that parahydrogen clusters exhibit a clear geometrical order which excludes any liquidlike structure. A definite confirmation of the magic size for the cluster with 13 molecules is also obtained.

  14. Id proteins: small molecules, mighty regulators.

    PubMed

    Ling, Flora; Kang, Bin; Sun, Xiao-Hong

    2014-01-01

    The family of inhibitor of differentiation (Id) proteins is a group of evolutionarily conserved molecules, which play important regulatory roles in organisms ranging from Drosophila to humans. Id proteins are small polypeptides harboring a helix-loop-helix (HLH) motif, which are best known to mediate dimerization with other basic HLH proteins, primarily E proteins. Because Id proteins do not possess the basic amino acids adjacent to the HLH motif necessary for DNA binding, Id proteins inhibit the function of E protein homodimers, as well as heterodimers between E proteins and tissue-specific bHLH proteins. However, Id proteins have also been shown to have E protein-independent functions. The Id genes are broadly but differentially expressed in a variety of cell types. Transcription of the Id genes is controlled by transcription factors such as C/EBPβ and Egr as well as by signaling pathways triggered by different stimuli, which include bone morphogenic proteins, cytokines, and ligands of T cell receptors. In general, Id proteins are capable of inhibiting the differentiation of progenitors of different cell types, promoting cell-cycle progression, delaying cellular senescence, and facilitating cell migration. These properties of Id proteins enable them to play significant roles in stem cell maintenance, vasculogenesis, tumorigenesis and metastasis, the development of the immune system, and energy metabolism. In this review, we intend to highlight the current understanding of the function of Id proteins and discuss gaps in our knowledge about the mechanisms whereby Id proteins exert their diverse effects in multiple cellular processes.

  15. Small molecule delivery through nanofibrous scaffolds for musculoskeletal regenerative engineering

    PubMed Central

    Carbone, Erica J.; Jiang, Tao; Nelson, Clarke; Henry, Nicole; Lo, Kevin W.-H.

    2014-01-01

    Musculoskeletal regenerative engineering approach using small bioactive molecules in conjunction with advanced materials has emerged as a highly promising strategy for musculoskeletal repair and regeneration. Advanced biomaterials technologies have revealed nanofiber-based scaffolds for musculoskeletal tissue engineering as vehicles for the controlled delivery of small molecule drugs. This review article highlights recent advances in nanofiber-based delivery of small molecules for musculoskeletal regenerative engineering. The article concludes with perspectives on the challenges and future directions. PMID:24907464

  16. TSH Receptor Signaling Abrogation by a Novel Small Molecule

    PubMed Central

    Latif, Rauf; Realubit, Ronald B.; Karan, Charles; Mezei, Mihaly; Davies, Terry F.

    2016-01-01

    Pathological activation of the thyroid-stimulating hormone receptor (TSHR) is caused by thyroid-stimulating antibodies in patients with Graves’ disease (GD) or by somatic and rare genomic mutations that enhance constitutive activation of the receptor influencing both G protein and non-G protein signaling. Potential selective small molecule antagonists represent novel therapeutic compounds for abrogation of such abnormal TSHR signaling. In this study, we describe the identification and in vitro characterization of a novel small molecule antagonist by high-throughput screening (HTS). The identification of the TSHR antagonist was performed using a transcription-based TSH-inhibition bioassay. TSHR-expressing CHO cells, which also expressed a luciferase-tagged CRE response element, were optimized using bovine TSH as the activator, in a 384 well plate format, which had a Z score of 0.3–0.6. Using this HTS assay, we screened a diverse library of ~80,000 compounds at a final concentration of 16.7 μM. The selection criteria for a positive hit were based on a mean signal threshold of ≥50% inhibition of control TSH stimulation. The screening resulted in 450 positive hits giving a hit ratio of 0.56%. A secondary confirmation screen against TSH and forskolin – a post receptor activator of adenylyl cyclase – confirmed one TSHR-specific candidate antagonist molecule (named VA-K-14). This lead molecule had an IC50 of 12.3 μM and a unique chemical structure. A parallel analysis for cell viability indicated that the lead inhibitor was non-cytotoxic at its effective concentrations. In silico docking studies performed using a TSHR transmembrane model showed the hydrophobic contact locations and the possible mode of inhibition of TSHR signaling. Furthermore, this molecule was capable of inhibiting TSHR stimulation by GD patient sera and monoclonal-stimulating TSHR antibodies. In conclusion, we report the identification of a novel small molecule TSHR inhibitor, which has

  17. Adsorption of small organic molecules on graphene.

    PubMed

    Lazar, Petr; Karlický, František; Jurečka, Petr; Kocman, Mikuláš; Otyepková, Eva; Šafářová, Klára; Otyepka, Michal

    2013-04-24

    We present a combined experimental and theoretical quantification of the adsorption enthalpies of seven organic molecules (acetone, acetonitrile, dichloromethane, ethanol, ethyl acetate, hexane, and toluene) on graphene. Adsorption enthalpies were measured by inverse gas chromatography and ranged from -5.9 kcal/mol for dichloromethane to -13.5 kcal/mol for toluene. The strength of interaction between graphene and the organic molecules was estimated by density functional theory (PBE, B97D, M06-2X, and optB88-vdW), wave function theory (MP2, SCS(MI)-MP2, MP2.5, MP2.X, and CCSD(T)), and empirical calculations (OPLS-AA) using two graphene models: coronene and infinite graphene. Symmetry-adapted perturbation theory calculations indicated that the interactions were governed by London dispersive forces (amounting to ∼60% of attractive interactions), even for the polar molecules. The results also showed that the adsorption enthalpies were largely controlled by the interaction energy. Adsorption enthalpies obtained from ab initio molecular dynamics employing non-local optB88-vdW functional were in excellent agreement with the experimental data, indicating that the functional can cover physical phenomena behind adsorption of organic molecules on graphene sufficiently well.

  18. X-ray characterization of solid small molecule organic materials

    DOEpatents

    Billinge, Simon; Shankland, Kenneth; Shankland, Norman; Florence, Alastair

    2014-06-10

    The present invention provides, inter alia, methods of characterizing a small molecule organic material, e.g., a drug or a drug product. This method includes subjecting the solid small molecule organic material to x-ray total scattering analysis at a short wavelength, collecting data generated thereby, and mathematically transforming the data to provide a refined set of data.

  19. Enhancement of the Fill Factor through an Increase of the Crystallinity in Fullerene-Based Small-Molecule Organic Photovoltaic Cells.

    PubMed

    Choi, Min-Soo; Kim, Tae-Min; Shim, Hyun-Sub; Kim, Beom-Soo; Kim, Hyo Jung; Kim, Jang-Joo

    2015-05-01

    We report that the crystallinity of C70 is improved significantly if CuI is used as a templating layer, leading to remarkable enhancement of hole mobilities from 8.32 × 10(-6) to 3.26 × 10(-5) cm(2)/(V s). As a result, the use of the templating layer in C70-based solar cells with low donor concentration resulted in significant improvement of the fill factor from 0.51 to 0.57 and the power conversion efficiency from 5.56% to 6.23% under simulated AM 1.5G, 1 sun irradiation. This result demonstrates that the CuI templating layer is effective at improving the crystallinity of the fullerene derivatives as well as the donor materials.

  20. Advancing Biological Understanding and Therapeutics Discovery with Small Molecule Probes

    PubMed Central

    Schreiber, Stuart L.; Kotz, Joanne D.; Li, Min; Aubé, Jeffrey; Austin, Christopher P.; Reed, John C.; Rosen, Hugh; White, E. Lucile; Sklar, Larry A.; Lindsley, Craig W.; Alexander, Benjamin R.; Bittker, Joshua A.; Clemons, Paul A.; de Souza, Andrea; Foley, Michael A.; Palmer, Michelle; Shamji, Alykhan F.; Wawer, Mathias J.; McManus, Owen; Wu, Meng; Zou, Beiyan; Yu, Haibo; Golden, Jennifer E.; Schoenen, Frank J.; Simeonov, Anton; Jadhav, Ajit; Jackson, Michael R.; Pinkerton, Anthony B.; Chung, Thomas D.Y.; Griffin, Patrick R.; Cravatt, Benjamin F.; Hodder, Peter S.; Roush, William R.; Roberts, Edward; Chung, Dong-Hoon; Jonsson, Colleen B.; Noah, James W.; Severson, William E.; Ananthan, Subramaniam; Edwards, Bruce; Oprea, Tudor I.; Conn, P. Jeffrey; Hopkins, Corey R.; Wood, Michael R.; Stauffer, Shaun R.; Emmitte, Kyle A.

    2015-01-01

    Small-molecule probes can illuminate biological processes and aid in the assessment of emerging therapeutic targets by perturbing biological systems in a manner distinct from other experimental approaches. Despite the tremendous promise of chemical tools for investigating biology and disease, small-molecule probes were unavailable for most targets and pathways as recently as a decade ago. In 2005, the U.S. National Institutes of Health launched the decade-long Molecular Libraries Program with the intent of innovating in and broadening access to small-molecule science. This Perspective describes how novel small-molecule probes identified through the program are enabling the exploration of biological pathways and therapeutic hypotheses not otherwise testable. These experiences illustrate how small-molecule probes can help bridge the chasm between biological research and the development of medicines, but also highlight the need to innovate the science of therapeutic discovery. PMID:26046436

  1. Antibody-enabled small-molecule drug discovery.

    PubMed

    Lawson, Alastair D G

    2012-06-29

    Although antibody-based therapeutics have become firmly established as medicines for serious diseases, the value of antibodies as tools in the early stages of small-molecule drug discovery is only beginning to be realized. In particular, antibodies may provide information to reduce risk in small-molecule drug discovery by enabling the validation of targets and by providing insights into the design of small-molecule screening assays. Moreover, antibodies can act as guides in the quest for small molecules that have the ability to modulate protein-protein interactions, which have traditionally only been considered to be tractable targets for biological drugs. The development of small molecules that have similar therapeutic effects to current biologics has the potential to benefit a broader range of patients at earlier stages of disease.

  2. Small Talk: Children's Everyday `Molecule' Ideas

    NASA Astrophysics Data System (ADS)

    Jakab, Cheryl

    2013-08-01

    This paper reports on 6-11-year-old children's `sayings and doings' (Harré 2002) as they explore molecule artefacts in dialectical-interactive teaching interviews (Fleer, Cultural Studies of Science Education 3:781-786, 2008; Hedegaard et al. 2008). This sociocultural study was designed to explore children's everyday awareness of and meaning-making with cultural molecular artefacts. Our everyday world is populated with an ever increasing range of molecular or nanoworld words, symbols, images, and games. What do children today say about these artefacts that are used to represent molecular world entities? What are the material and social resources that can influence a child's everyday and developing scientific ideas about `molecules'? How do children interact with these cognitive tools when given expert assistance? What meaning-making is afforded when children are socially and materially assisted in using molecular tools in early chemical and nanoworld thinking? Tool-dependent discursive studies show that provision of cultural artefacts can assist and direct developmental thinking across many domains of science (Schoultz et al., Human Development 44:103-118, 2001; Siegal 2008). Young children's use of molecular artefacts as cognitive tools has not received much attention to date (Jakab 2009a, b). This study shows 6-11-year-old children expressing everyday ideas of molecular artefacts and raising their own questions about the artefacts. They are seen beginning to domesticate (Erneling 2010) the words, symbols, and images to their own purposes when given the opportunity to interact with such artefacts in supported activity. Discursive analysis supports the notion that using `molecules' as cultural tools can help young children to begin `putting on molecular spectacles' (Kind 2004). Playing with an interactive game (ICT) is shown to be particularly helpful in assisting children's early meaning-making with representations of molecules, atoms, and their chemical symbols.

  3. Small-molecule suppressors of Candida albicans biofilm formation synergistically enhance the antifungal activity of amphotericin B against clinical Candida isolates.

    PubMed

    You, Jianlan; Du, Lin; King, Jarrod B; Hall, Brian E; Cichewicz, Robert H

    2013-04-19

    A new class of fungal biofilm inhibitors represented by shearinines D (3) and E (4) were obtained from a Penicillium sp. isolate. The inhibitory activities of 3 and 4 were characterized using a new imaging flow-cytometer technique, which enabled the rapid phenotypic analysis of Candida albicans cell types (budding yeast cells, germ tube cells, pseudohyphae, and hyphae) in biofilm populations. The results were confirmed by experimental data obtained from three-dimensional confocal laser scanning microscopy and 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assays. These data indicate that 3 and 4 inhibited C. albicans biofilm formation by blocking the outgrowth of hyphae at a relatively late stage of biofilm development (IC50 = 8.5 and 7.6 μM, respectively). However, 3 and 4 demonstrated comparatively weak activity at disrupting existing biofilms. Compounds 3 and 4 also exhibited synergistic activities with amphotericin B against C. albicans and other clinical Candida isolates by enhancing the potency of amphotericin B up to 8-fold against cells in both developing and established biofilms. These data suggest that the Candida biofilm disruption and amphotericin B potentiating effects of 3 and 4 could be mediated through multiple biological targets. The shearinines are good tools for testing the potential advantages of using adjunctive therapies in combination with antifungals.

  4. The Small Molecule Hyperphyllin Enhances Leaf Formation Rate and Mimics Shoot Meristem Integrity Defects Associated with AMP1 Deficiency1[OPEN

    PubMed Central

    Poretska, Olena; Yang, Saiqi; Rozhon, Wilfried; Zwerger, Karin; Uribe, Marcos Castellanos; May, Sean; McCourt, Peter

    2016-01-01

    ALTERED MERISTEM PROGRAM1 (AMP1) is a member of the M28 family of carboxypeptidases with a pivotal role in plant development and stress adaptation. Its most prominent mutant defect is a unique hypertrophic shoot phenotype combining a strongly increased organ formation rate with enhanced meristem size and the formation of ectopic meristem poles. However, so far the role of AMP1 in shoot development could not be assigned to a specific molecular pathway nor is its biochemical function resolved. In this work we evaluated the level of functional conservation between AMP1 and its human homolog HsGCPII, a tumor marker of medical interest. We show that HsGCPII cannot substitute AMP1 in planta and that an HsGCPII-specific inhibitor does not evoke amp1-specific phenotypes. We used a chemical genetic approach to identify the drug hyperphyllin (HP), which specifically mimics the shoot defects of amp1, including plastochron reduction and enlargement and multiplication of the shoot meristem. We assessed the structural requirements of HP activity and excluded that it is a cytokinin analog. HP-treated wild-type plants showed amp1-related tissue-specific changes of various marker genes and a significant transcriptomic overlap with the mutant. HP was ineffective in amp1 and elevated the protein levels of PHAVOLUTA, consistent with the postulated role of AMP1 in miRNA-controlled translation, further supporting an AMP1-related mode of action. Our work suggests that plant and animal members of the M28 family of proteases adopted unrelated functions. With HP we provide a tool to characterize the plant-specific functions of this important class of proteins. PMID:27208298

  5. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    NASA Astrophysics Data System (ADS)

    Ruscito, Annamaria; DeRosa, Maria

    2016-05-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  6. The Bichromatic Force on Small Molecules

    NASA Astrophysics Data System (ADS)

    Aldridge, Leland M.; Galica, Scott E.; Sheets, Donal; Eyler, Edward E.

    2016-06-01

    The bichromatic force is a coherent optical force that has been demonstrated to exceed the saturated radiative force from a monochromatic cw laser by orders of magnitude in atomic systems. By stimulating photon emission between two states, the bichromatic force allows us to increase the photon scattering rate beyond the spontaneous emission rate while also suppressing decays into dark states. We present studies of the efficacy of the bichromatic force on molecular systems using the test cases of B-X (0,0), P11(1.5)/^PQ12(0.5) in CaF and tilde{A}(000)-tilde{X}(000), P11(1.5)/^PQ12(0.5) in the linear triatomic molecule SrOH. Computational results from detailed multilevel models indicate that both of these molecular systems are suitable for the use of the bichromatic force, with neither repumping nor magnetic destabilization of dark states interrupting the coherent cycling at the heart of the force. We comment on the applicability of the bichromatic force to arbitrary polyatomic molecules, and present our experimental progress in demonstrating the bichromatic force on CaF and possibly on SrOH. Supported by the National Science Foundation.

  7. Molecular Responses to Small Regulating Molecules against Huanglongbing Disease.

    PubMed

    Martinelli, Federico; Dolan, David; Fileccia, Veronica; Reagan, Russell L; Phu, My; Spann, Timothy M; McCollum, Thomas G; Dandekar, Abhaya M

    2016-01-01

    Huanglongbing (HLB; citrus greening) is the most devastating disease of citrus worldwide. No cure is yet available for this disease and infected trees generally decline after several months. Disease management depends on early detection of symptoms and chemical control of insect vectors. In this work, different combinations of organic compounds were tested for the ability to modulate citrus molecular responses to HLB disease beneficially. Three small-molecule regulating compounds were tested: 1) L-arginine, 2) 6-benzyl-adenine combined with gibberellins, and 3) sucrose combined with atrazine. Each treatment contained K-phite mineral solution and was tested at two different concentrations. Two trials were conducted: one in the greenhouse and the other in the orchard. In the greenhouse study, responses of 42 key genes involved in sugar and starch metabolism, hormone-related pathways, biotic stress responses, and secondary metabolism in treated and untreated mature leaves were analyzed. TGA5 was significantly induced by arginine. Benzyladenine and gibberellins enhanced two important genes involved in biotic stress responses: WRKY54 and WRKY59. Sucrose combined with atrazine mainly upregulated key genes involved in carbohydrate metabolism such as sucrose-phosphate synthase, sucrose synthase, starch synthase, and α-amylase. Atrazine also affected expression of some key genes involved in systemic acquired resistance such as EDS1, TGA6, WRKY33, and MYC2. Several treatments upregulated HSP82, which might help protect protein folding and integrity. A subset of key genes was chosen as biomarkers for molecular responses to treatments under field conditions. GPT2 was downregulated by all small-molecule treatments. Arginine-induced genes involved in systemic acquired resistance included PR1, WRKY70, and EDS1. These molecular data encourage long-term application of treatments that combine these regulating molecules in field trials.

  8. Molecular Responses to Small Regulating Molecules against Huanglongbing Disease

    PubMed Central

    Martinelli, Federico; Dolan, David; Fileccia, Veronica; Reagan, Russell L.; Phu, My; Spann, Timothy M.; McCollum, Thomas G.; Dandekar, Abhaya M.

    2016-01-01

    Huanglongbing (HLB; citrus greening) is the most devastating disease of citrus worldwide. No cure is yet available for this disease and infected trees generally decline after several months. Disease management depends on early detection of symptoms and chemical control of insect vectors. In this work, different combinations of organic compounds were tested for the ability to modulate citrus molecular responses to HLB disease beneficially. Three small-molecule regulating compounds were tested: 1) L-arginine, 2) 6-benzyl-adenine combined with gibberellins, and 3) sucrose combined with atrazine. Each treatment contained K-phite mineral solution and was tested at two different concentrations. Two trials were conducted: one in the greenhouse and the other in the orchard. In the greenhouse study, responses of 42 key genes involved in sugar and starch metabolism, hormone-related pathways, biotic stress responses, and secondary metabolism in treated and untreated mature leaves were analyzed. TGA5 was significantly induced by arginine. Benzyladenine and gibberellins enhanced two important genes involved in biotic stress responses: WRKY54 and WRKY59. Sucrose combined with atrazine mainly upregulated key genes involved in carbohydrate metabolism such as sucrose-phosphate synthase, sucrose synthase, starch synthase, and α-amylase. Atrazine also affected expression of some key genes involved in systemic acquired resistance such as EDS1, TGA6, WRKY33, and MYC2. Several treatments upregulated HSP82, which might help protect protein folding and integrity. A subset of key genes was chosen as biomarkers for molecular responses to treatments under field conditions. GPT2 was downregulated by all small-molecule treatments. Arginine-induced genes involved in systemic acquired resistance included PR1, WRKY70, and EDS1. These molecular data encourage long-term application of treatments that combine these regulating molecules in field trials. PMID:27459099

  9. Molecular Responses to Small Regulating Molecules against Huanglongbing Disease.

    PubMed

    Martinelli, Federico; Dolan, David; Fileccia, Veronica; Reagan, Russell L; Phu, My; Spann, Timothy M; McCollum, Thomas G; Dandekar, Abhaya M

    2016-01-01

    Huanglongbing (HLB; citrus greening) is the most devastating disease of citrus worldwide. No cure is yet available for this disease and infected trees generally decline after several months. Disease management depends on early detection of symptoms and chemical control of insect vectors. In this work, different combinations of organic compounds were tested for the ability to modulate citrus molecular responses to HLB disease beneficially. Three small-molecule regulating compounds were tested: 1) L-arginine, 2) 6-benzyl-adenine combined with gibberellins, and 3) sucrose combined with atrazine. Each treatment contained K-phite mineral solution and was tested at two different concentrations. Two trials were conducted: one in the greenhouse and the other in the orchard. In the greenhouse study, responses of 42 key genes involved in sugar and starch metabolism, hormone-related pathways, biotic stress responses, and secondary metabolism in treated and untreated mature leaves were analyzed. TGA5 was significantly induced by arginine. Benzyladenine and gibberellins enhanced two important genes involved in biotic stress responses: WRKY54 and WRKY59. Sucrose combined with atrazine mainly upregulated key genes involved in carbohydrate metabolism such as sucrose-phosphate synthase, sucrose synthase, starch synthase, and α-amylase. Atrazine also affected expression of some key genes involved in systemic acquired resistance such as EDS1, TGA6, WRKY33, and MYC2. Several treatments upregulated HSP82, which might help protect protein folding and integrity. A subset of key genes was chosen as biomarkers for molecular responses to treatments under field conditions. GPT2 was downregulated by all small-molecule treatments. Arginine-induced genes involved in systemic acquired resistance included PR1, WRKY70, and EDS1. These molecular data encourage long-term application of treatments that combine these regulating molecules in field trials. PMID:27459099

  10. Coacervate delivery systems for proteins and small molecule drugs

    PubMed Central

    Johnson, Noah R; Wang, Yadong

    2015-01-01

    Coacervates represent an exciting new class of drug delivery vehicles, developed in the past decade as carriers of small molecule drugs and proteins. This review summarizes several well-described coacervate systems, including Elastin-like peptides for delivery of anti-cancer therapeutics,Heparin-based coacervates with synthetic polycations for controlled growth factor delivery,Carboxymethyl chitosan aggregates for oral drug delivery,Mussel adhesive protein and hyaluronic acid coacervates. Coacervates present advantages in their simple assembly and easy incorporation into tissue engineering scaffolds or as adjuncts to cell therapies. They are also amenable to functionalization such as for targeting or for enhancing the bioactivity of their cargo. These new drug carriers are anticipated to have broad applications and noteworthy impact in the near future. PMID:25138695

  11. Coacervate delivery systems for proteins and small molecule drugs.

    PubMed

    Johnson, Noah R; Wang, Yadong

    2014-12-01

    Coacervates represent an exciting new class of drug delivery vehicles, developed in the past decade as carriers of small molecule drugs and proteins. This review summarizes several well-described coacervate systems, including: i) elastin-like peptides for delivery of anticancer therapeutics; ii) heparin-based coacervates with synthetic polycations for controlled growth factor delivery; iii) carboxymethyl chitosan aggregates for oral drug delivery; iv) Mussel adhesive protein and hyaluronic acid coacervates. Coacervates present advantages in their simple assembly and easy incorporation into tissue engineering scaffolds or as adjuncts to cell therapies. They are also amenable to functionalization such as for targeting or for enhancing the bioactivity of their cargo. These new drug carriers are anticipated to have broad applications and noteworthy impact in the near future.

  12. Selection and Biosensor Application of Aptamers for Small Molecules

    PubMed Central

    Pfeiffer, Franziska; Mayer, Günter

    2016-01-01

    Small molecules play a major role in the human body and as drugs, toxins, and chemicals. Tools to detect and quantify them are therefore in high demand. This review will give an overview about aptamers interacting with small molecules and their selection. We discuss the current state of the field, including advantages as well as problems associated with their use and possible solutions to tackle these. We then discuss different kinds of small molecule aptamer-based sensors described in literature and their applications, ranging from detecting drinking water contaminations to RNA imaging. PMID:27379229

  13. Small molecule perimeter defense in entomopathogenic bacteria.

    PubMed

    Crawford, Jason M; Portmann, Cyril; Zhang, Xu; Roeffaers, Maarten B J; Clardy, Jon

    2012-07-01

    Two gram-negative insect pathogens, Xenorhabdus nematophila and Photorhabdus luminescens, produce rhabduscin, an amidoglycosyl- and vinyl-isonitrile-functionalized tyrosine derivative. Heterologous expression of the rhabduscin pathway in Escherichia coli, precursor-directed biosynthesis of rhabduscin analogs, biochemical assays, and visualization using both stimulated Raman scattering and confocal fluorescence microscopy established rhabduscin's role as a potent nanomolar-level inhibitor of phenoloxidase, a key component of the insect's innate immune system, as well as rhabduscin's localization at the bacterial cell surface. Stimulated Raman scattering microscopy visualized rhabduscin at the periphery of wild-type X. nematophila cells and E. coli cells heterologously expressing the rhabduscin pathway. Precursor-directed biosynthesis created rhabduscin mimics in X. nematophila pathway mutants that could be accessed at the bacterial cell surface by an extracellular bioorthogonal probe, as judged by confocal fluorescence microscopy. Biochemical assays using both wild-type and mutant X. nematophila cells showed that rhabduscin was necessary and sufficient for potent inhibition (low nM) of phenoloxidases, the enzymes responsible for producing melanin (the hard black polymer insects generate to seal off microbial pathogens). These observations suggest a model in which rhabduscin's physical association at the bacterial cell surface provides a highly effective inhibitor concentration directly at the site of phenoloxidase contact. This class of molecules is not limited to insect pathogens, as the human pathogen Vibrio cholerae also encodes rhabduscin's aglycone, and bacterial cell-coated immunosuppressants could be a general strategy to combat host defenses. PMID:22711807

  14. Small Molecule Inhibitors of Anthrax Lethal Factor Toxin

    PubMed Central

    Williams, John D.; Khan, Atiyya R.; Cardinale, Steven C.; Butler, Michelle M.; Bowlin, Terry L.; Peet, Norton P.

    2014-01-01

    This manuscript describes the preparation of new small molecule inhibitors of Bacillus anthracis lethal factor. Our starting point was the symmetrical, bis-quinolinyl compound 1 (NSC 12155). Optimization of one half of this molecule led to new LF inhibitors that were desymmetrized to afford more drug-like compounds. PMID:24290062

  15. A Prospective Method to Guide Small Molecule Drug Design

    ERIC Educational Resources Information Center

    Johnson, Alan T.

    2015-01-01

    At present, small molecule drug design follows a retrospective path when considering what analogs are to be made around a current hit or lead molecule with the focus often on identifying a compound with higher intrinsic potency. What this approach overlooks is the simultaneous need to also improve the physicochemical (PC) and pharmacokinetic (PK)…

  16. Small-molecule microarrays as tools in ligand discovery

    PubMed Central

    Vegas, Arturo J.; Fuller, Jason H.; Koehler, Angela N.

    2009-01-01

    Small molecules that bind and modulate specific protein targets are increasingly used as tools to decipher protein function in a cellular context. Identifying specific small-molecule probes for each protein in the proteome will require miniaturized assays that permit screening large collections of compounds against large numbers of proteins in a highly parallel fashion. Simple and general binding assays involving small-molecule microarrays can be used to identify probes for nearly any protein in the proteome. The assay may be used to identify ligands for proteins in the absence of knowledge about structure or function. In this tutorial review, we introduce small-molecule microarrays (SMMs) as tools for ligand discovery; discuss methods for manufacturing SMMs, including both non-covalent and covalent attachment strategies; and provide examples of ligand discovery involving SMMs. PMID:18568164

  17. Small molecule perimeter defense in entomopathogenic bacteria

    PubMed Central

    Crawford, Jason M.; Portmann, Cyril; Zhang, Xu; Roeffaers, Maarten B. J.; Clardy, Jon

    2012-01-01

    Two Gram-negative insect pathogens, Xenorhabdus nematophila and Photorhabdus luminescens, produce rhabduscin, an amidoglycosyl- and vinyl-isonitrile-functionalized tyrosine derivative. Heterologous expression of the rhabduscin pathway in Escherichia coli, precursor-directed biosynthesis of rhabduscin analogs, biochemical assays, and visualization using both stimulated Raman scattering and confocal fluorescence microscopy established rhabduscin’s role as a potent nanomolar-level inhibitor of phenoloxidase, a key component of the insect’s innate immune system, as well as rhabduscin’s localization at the bacterial cell surface. Stimulated Raman scattering microscopy visualized rhabduscin at the periphery of wild-type X. nematophila cells and E. coli cells heterologously expressing the rhabduscin pathway. Precursor-directed biosynthesis created rhabduscin mimics in X. nematophila pathway mutants that could be accessed at the bacterial cell surface by an extracellular bioorthogonal probe, as judged by confocal fluorescence microscopy. Biochemical assays using both wild-type and mutant X. nematophila cells showed that rhabduscin was necessary and sufficient for potent inhibition (low nM) of phenoloxidases, the enzymes responsible for producing melanin (the hard black polymer insects generate to seal off microbial pathogens). These observations suggest a model in which rhabduscin’s physical association at the bacterial cell surface provides a highly effective inhibitor concentration directly at the site of phenoloxidase contact. This class of molecules is not limited to insect pathogens, as the human pathogen Vibrio cholerae also encodes rhabduscin’s aglycone, and bacterial cell-coated immunosuppressants could be a general strategy to combat host defenses. PMID:22711807

  18. Small molecules intercept Notch signaling and the early secretory pathway.

    PubMed

    Krämer, Andreas; Mentrup, Torben; Kleizen, Bertrand; Rivera-Milla, Eric; Reichenbach, Daniela; Enzensperger, Christoph; Nohl, Richard; Täuscher, Eric; Görls, Helmar; Ploubidou, Aspasia; Englert, Christoph; Werz, Oliver; Arndt, Hans-Dieter; Kaether, Christoph

    2013-11-01

    Notch signaling has a pivotal role in numerous cell-fate decisions, and its aberrant activity leads to developmental disorders and cancer. To identify molecules that influence Notch signaling, we screened nearly 17,000 compounds using automated microscopy to monitor the trafficking and processing of a ligand-independent Notch-enhanced GFP (eGFP) reporter. Characterization of hits in vitro by biochemical and cellular assays and in vivo using zebrafish led to five validated compounds, four of which induced accumulation of the reporter at the plasma membrane by inhibiting γ-secretase. One compound, the dihydropyridine FLI-06, disrupted the Golgi apparatus in a manner distinct from that of brefeldin A and golgicide A. FLI-06 inhibited general secretion at a step before exit from the endoplasmic reticulum (ER), which was accompanied by a tubule-to-sheet morphological transition of the ER, rendering FLI-06 the first small molecule acting at such an early stage in secretory traffic. These data highlight the power of phenotypic screening to enable investigations of central cellular signaling pathways. PMID:24077179

  19. Nanolaboratories: physics and chemistry of small-molecule endofullerenes

    PubMed Central

    Levitt, Malcolm H.; Horsewill, Anthony J.

    2013-01-01

    This Theo Murphy Meeting Issue contains papers presented at a Discussion Meeting held at the Kavli Centre of the Royal Society in March 2012. The meeting brought together a wide variety of scientists working on different aspects of small-molecule endofullerenes—those intriguing chemical systems in which small molecules such as H2 or H2O are encapsulated in tiny carbon cages. PMID:23918720

  20. Small molecule annotation for the Protein Data Bank.

    PubMed

    Sen, Sanchayita; Young, Jasmine; Berrisford, John M; Chen, Minyu; Conroy, Matthew J; Dutta, Shuchismita; Di Costanzo, Luigi; Gao, Guanghua; Ghosh, Sutapa; Hudson, Brian P; Igarashi, Reiko; Kengaku, Yumiko; Liang, Yuhe; Peisach, Ezra; Persikova, Irina; Mukhopadhyay, Abhik; Narayanan, Buvaneswari Coimbatore; Sahni, Gaurav; Sato, Junko; Sekharan, Monica; Shao, Chenghua; Tan, Lihua; Zhuravleva, Marina A

    2014-01-01

    The Protein Data Bank (PDB) is the single global repository for three-dimensional structures of biological macromolecules and their complexes, and its more than 100,000 structures contain more than 20,000 distinct ligands or small molecules bound to proteins and nucleic acids. Information about these small molecules and their interactions with proteins and nucleic acids is crucial for our understanding of biochemical processes and vital for structure-based drug design. Small molecules present in a deposited structure may be attached to a polymer or may occur as a separate, non-covalently linked ligand. During curation of a newly deposited structure by wwPDB annotation staff, each molecule is cross-referenced to the PDB Chemical Component Dictionary (CCD). If the molecule is new to the PDB, a dictionary description is created for it. The information about all small molecule components found in the PDB is distributed via the ftp archive as an external reference file. Small molecule annotation in the PDB also includes information about ligand-binding sites and about covalent and other linkages between ligands and macromolecules. During the remediation of the peptide-like antibiotics and inhibitors present in the PDB archive in 2011, it became clear that additional annotation was required for consistent representation of these molecules, which are quite often composed of several sequential subcomponents including modified amino acids and other chemical groups. The connectivity information of the modified amino acids is necessary for correct representation of these biologically interesting molecules. The combined information is made available via a new resource called the Biologically Interesting molecules Reference Dictionary, which is complementary to the CCD and is now routinely used for annotation of peptide-like antibiotics and inhibitors.

  1. Small molecule annotation for the Protein Data Bank.

    PubMed

    Sen, Sanchayita; Young, Jasmine; Berrisford, John M; Chen, Minyu; Conroy, Matthew J; Dutta, Shuchismita; Di Costanzo, Luigi; Gao, Guanghua; Ghosh, Sutapa; Hudson, Brian P; Igarashi, Reiko; Kengaku, Yumiko; Liang, Yuhe; Peisach, Ezra; Persikova, Irina; Mukhopadhyay, Abhik; Narayanan, Buvaneswari Coimbatore; Sahni, Gaurav; Sato, Junko; Sekharan, Monica; Shao, Chenghua; Tan, Lihua; Zhuravleva, Marina A

    2014-01-01

    The Protein Data Bank (PDB) is the single global repository for three-dimensional structures of biological macromolecules and their complexes, and its more than 100,000 structures contain more than 20,000 distinct ligands or small molecules bound to proteins and nucleic acids. Information about these small molecules and their interactions with proteins and nucleic acids is crucial for our understanding of biochemical processes and vital for structure-based drug design. Small molecules present in a deposited structure may be attached to a polymer or may occur as a separate, non-covalently linked ligand. During curation of a newly deposited structure by wwPDB annotation staff, each molecule is cross-referenced to the PDB Chemical Component Dictionary (CCD). If the molecule is new to the PDB, a dictionary description is created for it. The information about all small molecule components found in the PDB is distributed via the ftp archive as an external reference file. Small molecule annotation in the PDB also includes information about ligand-binding sites and about covalent and other linkages between ligands and macromolecules. During the remediation of the peptide-like antibiotics and inhibitors present in the PDB archive in 2011, it became clear that additional annotation was required for consistent representation of these molecules, which are quite often composed of several sequential subcomponents including modified amino acids and other chemical groups. The connectivity information of the modified amino acids is necessary for correct representation of these biologically interesting molecules. The combined information is made available via a new resource called the Biologically Interesting molecules Reference Dictionary, which is complementary to the CCD and is now routinely used for annotation of peptide-like antibiotics and inhibitors. PMID:25425036

  2. TMAO: A small molecule of great expectations.

    PubMed

    Ufnal, Marcin; Zadlo, Anna; Ostaszewski, Ryszard

    2015-01-01

    Trimethylamine N-oxide (TMAO) is a small organic compound whose concentration in blood increases after ingesting dietary l-carnitine and phosphatidylcholine. Recent clinical studies show a positive correlation between elevated plasma levels of TMAO and an increased risk for major adverse cardiovascular events defined as death, myocardial infarction, or stroke. Several experimental studies suggest a possible contribution of TMAO to the etiology of cardiovascular diseases by affecting lipid and hormonal homeostasis. On the other hand, TMAO-rich seafood, which is an important source of protein and vitamins in the Mediterranean diet, has been considered beneficial for the circulatory system. Although in humans TMAO is known mainly as a waste product of choline metabolism, a number of studies suggest an involvement of TMAO in important biological functions in numerous organisms, ranging from bacteria to mammals. For example, cells use TMAO to maintain cell volume under conditions of osmotic and hydrostatic pressure stresses. In this article, we reviewed well-established chemical and biological properties of TMAO and dietary sources of TMAO, as well as looked at the studies suggesting possible involvement of TMAO in the etiology of cardiovascular and other diseases, such as kidney failure, diabetes, and cancer.

  3. TMAO: A small molecule of great expectations.

    PubMed

    Ufnal, Marcin; Zadlo, Anna; Ostaszewski, Ryszard

    2015-01-01

    Trimethylamine N-oxide (TMAO) is a small organic compound whose concentration in blood increases after ingesting dietary l-carnitine and phosphatidylcholine. Recent clinical studies show a positive correlation between elevated plasma levels of TMAO and an increased risk for major adverse cardiovascular events defined as death, myocardial infarction, or stroke. Several experimental studies suggest a possible contribution of TMAO to the etiology of cardiovascular diseases by affecting lipid and hormonal homeostasis. On the other hand, TMAO-rich seafood, which is an important source of protein and vitamins in the Mediterranean diet, has been considered beneficial for the circulatory system. Although in humans TMAO is known mainly as a waste product of choline metabolism, a number of studies suggest an involvement of TMAO in important biological functions in numerous organisms, ranging from bacteria to mammals. For example, cells use TMAO to maintain cell volume under conditions of osmotic and hydrostatic pressure stresses. In this article, we reviewed well-established chemical and biological properties of TMAO and dietary sources of TMAO, as well as looked at the studies suggesting possible involvement of TMAO in the etiology of cardiovascular and other diseases, such as kidney failure, diabetes, and cancer. PMID:26283574

  4. Molecules Great and Small: The Complement System

    PubMed Central

    Mathern, Douglas R.

    2015-01-01

    The complement cascade, traditionally considered an effector arm of innate immunity required for host defense against pathogens, is now recognized as a crucial pathogenic mediator of various kidney diseases. Complement components produced by the liver and circulating in the plasma undergo activation through the classical and/or mannose-binding lectin pathways to mediate anti-HLA antibody-initiated kidney transplant rejection and autoantibody-initiated GN, the latter including membranous glomerulopathy, antiglomerular basement membrane disease, and lupus nephritis. Inherited and/or acquired abnormalities of complement regulators, which requisitely limit restraint on alternative pathway complement activation, contribute to the pathogenesis of the C3 nephropathies and atypical hemolytic uremic syndrome. Increasing evidence links complement produced by endothelial cells and/or tubular cells to the pathogenesis of kidney ischemia-reperfusion injury and progressive kidney fibrosis. Data emerging since the mid-2000s additionally show that immune cells, including T cells and antigen-presenting cells, produce alternative pathway complement components during cognate interactions. The subsequent local complement activation yields production of the anaphylatoxins C3a and C5a, which bind to their respective receptors (C3aR and C5aR) on both partners to augment effector T-cell proliferation and survival, while simultaneously inhibiting regulatory T-cell induction and function. This immune cell–derived complement enhances pathogenic alloreactive T-cell immunity that results in transplant rejection and likely contributes to the pathogenesis of other T cell–mediated kidney diseases. C5a/C5aR ligations on neutrophils have additionally been shown to contribute to vascular inflammation in models of ANCA-mediated renal vasculitis. New translational immunology efforts along with the development of pharmacologic agents that block human complement components and receptors now permit

  5. Molecules Great and Small: The Complement System.

    PubMed

    Mathern, Douglas R; Heeger, Peter S

    2015-09-01

    The complement cascade, traditionally considered an effector arm of innate immunity required for host defense against pathogens, is now recognized as a crucial pathogenic mediator of various kidney diseases. Complement components produced by the liver and circulating in the plasma undergo activation through the classical and/or mannose-binding lectin pathways to mediate anti-HLA antibody-initiated kidney transplant rejection and autoantibody-initiated GN, the latter including membranous glomerulopathy, antiglomerular basement membrane disease, and lupus nephritis. Inherited and/or acquired abnormalities of complement regulators, which requisitely limit restraint on alternative pathway complement activation, contribute to the pathogenesis of the C3 nephropathies and atypical hemolytic uremic syndrome. Increasing evidence links complement produced by endothelial cells and/or tubular cells to the pathogenesis of kidney ischemia-reperfusion injury and progressive kidney fibrosis. Data emerging since the mid-2000s additionally show that immune cells, including T cells and antigen-presenting cells, produce alternative pathway complement components during cognate interactions. The subsequent local complement activation yields production of the anaphylatoxins C3a and C5a, which bind to their respective receptors (C3aR and C5aR) on both partners to augment effector T-cell proliferation and survival, while simultaneously inhibiting regulatory T-cell induction and function. This immune cell-derived complement enhances pathogenic alloreactive T-cell immunity that results in transplant rejection and likely contributes to the pathogenesis of other T cell-mediated kidney diseases. C5a/C5aR ligations on neutrophils have additionally been shown to contribute to vascular inflammation in models of ANCA-mediated renal vasculitis. New translational immunology efforts along with the development of pharmacologic agents that block human complement components and receptors now permit

  6. FDA-approved small-molecule kinase inhibitors.

    PubMed

    Wu, Peng; Nielsen, Thomas E; Clausen, Mads H

    2015-07-01

    Kinases have emerged as one of the most intensively pursued targets in current pharmacological research, especially for cancer, due to their critical roles in cellular signaling. To date, the US FDA has approved 28 small-molecule kinase inhibitors, half of which were approved in the past 3 years. While the clinical data of these approved molecules are widely presented and structure-activity relationship (SAR) has been reported for individual molecules, an updated review that analyzes all approved molecules and summarizes current achievements and trends in the field has yet to be found. Here we present all approved small-molecule kinase inhibitors with an emphasis on binding mechanism and structural features, summarize current challenges, and discuss future directions in this field.

  7. Discovery of small molecule cancer drugs: Successes, challenges and opportunities

    PubMed Central

    Hoelder, Swen; Clarke, Paul A.; Workman, Paul

    2012-01-01

    The discovery and development of small molecule cancer drugs has been revolutionised over the last decade. Most notably, we have moved from a one-size-fits-all approach that emphasized cytotoxic chemotherapy to a personalised medicine strategy that focuses on the discovery and development of molecularly targeted drugs that exploit the particular genetic addictions, dependencies and vulnerabilities of cancer cells. These exploitable characteristics are increasingly being revealed by our expanding understanding of the abnormal biology and genetics of cancer cells, accelerated by cancer genome sequencing and other high-throughput genome-wide campaigns, including functional screens using RNA interference. In this review we provide an overview of contemporary approaches to the discovery of small molecule cancer drugs, highlighting successes, current challenges and future opportunities. We focus in particular on four key steps: Target validation and selection; chemical hit and lead generation; lead optimization to identify a clinical drug candidate; and finally hypothesis-driven, biomarker-led clinical trials. Although all of these steps are critical, we view target validation and selection and the conduct of biology-directed clinical trials as especially important areas upon which to focus to speed progress from gene to drug and to reduce the unacceptably high attrition rate during clinical development. Other challenges include expanding the envelope of druggability for less tractable targets, understanding and overcoming drug resistance, and designing intelligent and effective drug combinations. We discuss not only scientific and technical challenges, but also the assessment and mitigation of risks as well as organizational, cultural and funding problems for cancer drug discovery and development, together with solutions to overcome the ‘Valley of Death’ between basic research and approved medicines. We envisage a future in which addressing these challenges will

  8. Differentiating Alzheimer disease-associated aggregates with small molecules.

    PubMed

    Honson, Nicolette S; Johnson, Ronald L; Huang, Wenwei; Inglese, James; Austin, Christopher P; Kuret, Jeff

    2007-12-01

    Alzheimer disease is diagnosed postmortem by the density and spatial distribution of beta-amyloid plaques and tau-bearing neurofibrillary tangles. The major protein component of each lesion adopts cross-beta-sheet conformation capable of binding small molecules with submicromolar affinity. In many cases, however, Alzheimer pathology overlaps with Lewy body disease, characterized by the accumulation of a third cross-beta-sheet forming protein, alpha-synuclein. To determine the feasibility of distinguishing tau aggregates from beta-amyloid and alpha-synuclein aggregates with small molecule probes, a library containing 72,455 small molecules was screened for antagonists of tau-aggregate-mediated changes in Thioflavin S fluorescence, followed by secondary screens to distinguish the relative affinity for each substrate protein. Results showed that >10-fold binding selectivity among substrates could be achieved, with molecules selective for tau aggregates containing at least three aromatic or rigid moieties connected by two rotatable bonds.

  9. Differentiating Alzheimer Disease-Associated Aggregates with Small Molecules

    PubMed Central

    Honson, Nicolette S.; Johnson, Ronald L.; Huang, Wenwei; Inglese, James; Austin, Christopher P.; Kuret, Jeff

    2008-01-01

    Alzheimer disease is diagnosed postmortem by the density and spatial distribution of β-amyloid plaques and tau-bearing neurofibrillary tangles. The major protein component of each lesion adopts cross-β-sheet conformation capable of binding small molecules with submicromolar affinity. In many cases, however, Alzheimer pathology overlaps with Lewy body disease, characterized by the accumulation of a third cross-β-sheet forming protein, α-synuclein. To determine the feasibility of distinguishing tau aggregates from β-amyloid and α-synuclein aggregates with small molecule probes, a library containing 71,975 small molecules was screened for antagonists of tau-aggregate mediated changes in Thioflavin S fluorescence, followed by secondary screens to distinguish the relative affinity for each substrate protein. Results showed that >10-fold binding selectivity among substrates could be achieved, with molecules selective for tau aggregates containing at least three aromatic or rigid moieties connected by two rotatable bonds. PMID:17761424

  10. Small molecules for immunomodulation in cancer: a review.

    PubMed

    Iyer, Vidhya V

    2015-01-01

    Small-molecule cytotoxic agents are already in use for cancer immunotherapy in the form of antibody conjugates containing these molecules linked covalently to antibodies or their fragments with the goal of targeting specific surface components of tumor cells. However, there are also reports of small molecules that act as antagonists to surface enzyme-linked receptors and receptors that interact with the tumor microenvironment, or that even inhibit metabolic enzymes. Such molecules have been shown to directly inhibit the signaling initiated by the respective ligands binding to their receptors, to recruit antibodies and other immunomodulatory molecules, or to promote or inhibit the proliferation of different immune cells to target specific types of cancer cells. This review will discuss immune response modifiers such as imiquimod, antibody-recruiting molecules that target prostate cancer, integrin receptor antagonists, indoleamine-2,3-dioxygenase inhibitors, emodin, RORɣt antagonists, ephrin receptor antagonists, membrane-bound carbonic anhydrase IX (CAIX) inhibitors, and selected protein kinase inhibitors. These small molecules can open up new ways to treat many types of cancers and possibly even other diseases that arise from immune dysregulation. Finally, the review will briefly discuss some additional targets that are being pursued to modify immune system responses in the tumor microenvironment.

  11. Strategy to discover diverse optimal molecules in the small molecule universe.

    PubMed

    Rupakheti, Chetan; Virshup, Aaron; Yang, Weitao; Beratan, David N

    2015-03-23

    The small molecule universe (SMU) is defined as a set of over 10(60) synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework ( Virshup et al. J. Am. Chem. Soc. 2013 , 135 , 7296 - 7303 ) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 10(5) molecules.

  12. Strategy To Discover Diverse Optimal Molecules in the Small Molecule Universe

    PubMed Central

    2015-01-01

    The small molecule universe (SMU) is defined as a set of over 1060 synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework (Virshup et al. J. Am. Chem. Soc.2013, 135, 7296–730323548177) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 105 molecules. PMID:25594586

  13. Thermal Degradation of Small Molecules: A Global Metabolomic Investigation

    PubMed Central

    2015-01-01

    Thermal processes are widely used in small molecule chemical analysis and metabolomics for derivatization, vaporization, chromatography, and ionization, especially in gas chromatography mass spectrometry (GC/MS). In this study the effect of heating was examined on a set of 64 small molecule standards and, separately, on human plasma metabolite extracts. The samples, either derivatized or underivatized, were heated at three different temperatures (60, 100, and 250 °C) at different exposure times (30 s, 60 s, and 300 s). All the samples were analyzed by liquid chromatography coupled to electrospray ionization mass spectrometry (LC/MS) and the data processed by XCMS Online (xcmsonline.scripps.edu). The results showed that heating at an elevated temperature of 100 °C had an appreciable effect on both the underivatized and derivatized molecules, and heating at 250 °C created substantial changes in the profile. For example, over 40% of the molecular peaks were altered in the plasma metabolite analysis after heating (250 °C, 300s) with a significant formation of degradation and transformation products. The analysis of 64 small molecule standards validated the temperature-induced changes observed on the plasma metabolites, where most of the small molecules degraded at elevated temperatures even after minimal exposure times (30 s). For example, tri- and diorganophosphates (e.g., adenosine triphosphate and adenosine diphosphate) were readily degraded into a mono-organophosphate (e.g., adenosine monophosphate) during heating. Nucleosides and nucleotides (e.g., inosine and inosine monophosphate) were also found to be transformed into purine derivatives (e.g., hypoxanthine). A newly formed transformation product, oleoyl ethyl amide, was identified in both the underivatized and derivatized forms of the plasma extracts and small molecule standard mixture, and was likely generated from oleic acid. Overall these analyses show that small molecules and metabolites undergo

  14. Small-Molecule Regulators of MicroRNAs in Biomedicine.

    PubMed

    Xia, Tingting; Li, Jinbo; Cheng, Hao; Zhang, Chenyu; Zhang, Yan

    2015-11-01

    Preclinical Research MicroRNAs (miRNAs) can regulate gene expression at the post-transcriptional level and have been implicated in the development of various human diseases, including cancer. The regulatory networks of miRNAs play a vital role not only in normal physiology but also in pathology and may represent novel targets for drug discovery. Regulation of miRNAs and the elucidation of miRNA networks will advance miRNA-targeted research but are challenging due to a shortage of appropriate tools. Using different assay systems, diverse small molecules with unique miRNA regulatory activity have been identified. These bioactive small molecules not only showed regulation on different miRNAs but revealed previously unknown miRNA networks. Treatment of cancer both in vitro and in vivo with small-molecule regulators of miRNAs has demonstrated their therapeutic potential. In this review, we discuss assay systems for the identification of small-molecule regulators of miRNAs and reported small molecules, and discuss their applications as probes and candidate drug leads.

  15. Single molecule surface enhanced resonance Raman scattering (SERRS) of the enhanced green fluorescent protein (EGFP)

    NASA Astrophysics Data System (ADS)

    Hofkens, Johan; De Schryver, Frans C.; Cotlet, Mircea; Habuchi, Satoshi

    2004-06-01

    One of the most intriguing findings in single molecule spectroscopy (SMS) is the observation of Raman spectra of individual molecules, despite the small cross section of the transitions involved. The observation of the spectra can be explained by the surface enhanced Raman scattering (SERRS) effect. At the single-molecule level, the SERRS-spectra recorded as a function of time reveal inhomogeneous behaviour such as on/off blinking, spectral diffusion, intensity fluctuations of vibrational line, and even splitting of some lines within the spectrum of one molecule. Single-molecule SERRS (SM-SERRS) spectroscopy opens up exciting opportunities in the field of biophysics and biomedical spectroscopy. The first example of single protein SERRS was performed on hemoglobin. However, the possibility of extracting the heme group by silver sols can not be excluded. Here we report on SM-SERRS spectra of enhanced green fluorescent protein (EGFP) in which the chromophore is kept in the protein. The time series of SM-SERRS spectra suggest the conversion of the EGFP chromophore between the deprotonated and the protonated form. Autocorrelation analysis of SM-SERRS trajectory reveals the presence of fast dynamics taking place in the protein. Our findings show the potential of the technique to study structural dynamics of protein molecules.

  16. SPLINTS: small-molecule protein ligand interface stabilizers.

    PubMed

    Fischer, Eric S; Park, Eunyoung; Eck, Michael J; Thomä, Nicolas H

    2016-04-01

    Regulatory protein-protein interactions are ubiquitous in biology, and small molecule protein-protein interaction inhibitors are an important focus in drug discovery. Remarkably little attention has been given to the opposite strategy-stabilization of protein-protein interactions, despite the fact that several well-known therapeutics act through this mechanism. From a structural perspective, we consider representative examples of small molecules that induce or stabilize the association of protein domains to inhibit, or alter, signaling for nuclear hormone, GTPase, kinase, phosphatase, and ubiquitin ligase pathways. These SPLINTS (small-molecule protein ligand interface stabilizers) drive interactions that are in some cases physiologically relevant, and in others entirely adventitious. The diverse structural mechanisms employed suggest approaches for a broader and systematic search for such compounds in drug discovery. PMID:26829757

  17. Cancer Immunotherapy: Selected Targets and Small-Molecule Modulators.

    PubMed

    Weinmann, Hilmar

    2016-03-01

    There is a significant amount of excitement in the scientific community around cancer immunotherapy, as this approach has renewed hope for many cancer patients owing to some recent successes in the clinic. Currently available immuno-oncology therapeutics under clinical development and on the market are mostly biologics (antibodies, proteins, engineered cells, and oncolytic viruses). However, modulation of the immune system with small molecules offers several advantages that may be complementary and potentially synergistic to the use of large biologicals. Therefore, the discovery and development of novel small-molecule modulators is a rapidly growing research area for medicinal chemists working in cancer immunotherapy. This review provides a brief introduction into recent trends related to selected targets and pathways for cancer immunotherapy and their small-molecule pharmacological modulators.

  18. Small-molecule discovery from DNA-encoded chemical libraries.

    PubMed

    Kleiner, Ralph E; Dumelin, Christoph E; Liu, David R

    2011-12-01

    Researchers seeking to improve the efficiency and cost effectiveness of the bioactive small-molecule discovery process have recently embraced selection-based approaches, which in principle offer much higher throughput and simpler infrastructure requirements compared with traditional small-molecule screening methods. Since selection methods benefit greatly from an information-encoding molecule that can be readily amplified and decoded, several academic and industrial groups have turned to DNA as the basis for library encoding and, in some cases, library synthesis. The resulting DNA-encoded synthetic small-molecule libraries, integrated with the high sensitivity of PCR and the recent development of ultra high-throughput DNA sequencing technology, can be evaluated very rapidly for binding or bond formation with a target of interest while consuming minimal quantities of material and requiring only modest investments of time and equipment. In this tutorial review we describe the development of two classes of approaches for encoding chemical structures and reactivity with DNA: DNA-recorded library synthesis, in which encoding and library synthesis take place separately, and DNA-directed library synthesis, in which DNA both encodes and templates library synthesis. We also describe in vitro selection methods used to evaluate DNA-encoded libraries and summarize successful applications of these approaches to the discovery of bioactive small molecules and novel chemical reactivity.

  19. Increased Hydrogel Swelling Induced by Absorption of Small Molecules.

    PubMed

    Nam, Changwoo; Zimudzi, Tawanda J; Geise, Geoffrey M; Hickner, Michael A

    2016-06-01

    The water and small molecule uptake behavior of amphiphilic diacrylate terminated poly(dimethylsiloxane) (PDMSDA)/poly(ethylene glycol diacrylate) (PEGDA) cross-linked hydrogels were studied using attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectroscopy. These hydrogel networks absorbed more water as the PEGDA content of the network increased. In contrast to typical osmotic deswelling behavior that occurs when liquid water equilibrated hydrogels are immersed in small molecule solutions with water activities less than unity, water-swollen gels immersed in 2-acrylamido-2-methylpropanesulfonic acid (AMPS-H) solutions rapidly regained their water content within 4 min following an initial deswelling response. In situ ATR-FTIR analysis of the hydrogel film during the dynamic swelling experiment indicated that small molecule absorption into the gel played an important role in inducing gel reswelling in low water activity solutions. This aspect of polymer gel water uptake and interaction with small molecules is important for optimizing hydrogel coatings and hydrophilic polymer applications where there is an interaction between the internal chemical structure of the gel and electrolytes or other molecules in solution. PMID:27159118

  20. Design of Catalytically Amplified Sensors for Small Molecules

    PubMed Central

    Makhlynets, Olga V.; Korendovych, Ivan V.

    2014-01-01

    Catalytically amplified sensors link an allosteric analyte binding site with a reactive site to catalytically convert substrate into colored or fluorescent product that can be easily measured. Such an arrangement greatly improves a sensor’s detection limit as illustrated by successful application of ELISA-based approaches. The ability to engineer synthetic catalytic sites into non-enzymatic proteins expands the repertoire of analytes as well as readout reactions. Here we review recent examples of small molecule sensors based on allosterically controlled enzymes and organometallic catalysts. The focus of this paper is on biocompatible, switchable enzymes regulated by small molecules to track analytes both in vivo and in the environment. PMID:24970222

  1. Recent Advances in Developing Small Molecules Targeting Nucleic Acid

    PubMed Central

    Wang, Maolin; Yu, Yuanyuan; Liang, Chao; Lu, Aiping; Zhang, Ge

    2016-01-01

    Nucleic acids participate in a large number of biological processes. However, current approaches for small molecules targeting protein are incompatible with nucleic acids. On the other hand, the lack of crystallization of nucleic acid is the limiting factor for nucleic acid drug design. Because of the improvements in crystallization in recent years, a great many structures of nucleic acids have been reported, providing basic information for nucleic acid drug discovery. This review focuses on the discovery and development of small molecules targeting nucleic acids. PMID:27248995

  2. A Small Molecule Inhibitor of Monoubiquitinated Proliferating Cell Nuclear Antigen (PCNA) Inhibits Repair of Interstrand DNA Cross-link, Enhances DNA Double Strand Break, and Sensitizes Cancer Cells to Cisplatin*

    PubMed Central

    Inoue, Akira; Kikuchi, Sotaro; Hishiki, Asami; Shao, Youming; Heath, Richard; Evison, Benjamin J.; Actis, Marcelo; Canman, Christine E.; Hashimoto, Hiroshi; Fujii, Naoaki

    2014-01-01

    Small molecule inhibitors of proliferating cell nuclear antigen (PCNA)/PCNA interacting protein box (PIP-Box) interactions, including T2 amino alcohol (T2AA), inhibit translesion DNA synthesis. The crystal structure of PCNA in complex with T2AA revealed that T2AA bound to the surface adjacent to the subunit interface of the homotrimer of PCNA in addition to the PIP-box binding cavity. Because this site is close to Lys-164, which is monoubiquitinated by RAD18, we postulated that T2AA would affect monoubiquitinated PCNA interactions. Binding of monoubiquitinated PCNA and a purified pol η fragment containing the UBZ and PIP-box was inhibited by T2AA in vitro. T2AA decreased PCNA/pol η and PCNA/REV1 chromatin colocalization but did not inhibit PCNA monoubiquitination, suggesting that T2AA hinders interactions of pol η and REV1 with monoubiquitinated PCNA. Interstrand DNA cross-links (ICLs) are repaired by mechanisms using translesion DNA synthesis that is regulated by monoubiquitinated PCNA. T2AA significantly delayed reactivation of a reporter plasmid containing an ICL. Neutral comet analysis of cells receiving T2AA in addition to cisplatin revealed that T2AA significantly enhanced formation of DNA double strand breaks (DSBs) by cisplatin. T2AA promoted colocalized foci formation of phospho-ATM and 53BP1 and up-regulated phospho-BRCA1 in cisplatin-treated cells, suggesting that T2AA increases DSBs. When cells were treated by cisplatin and T2AA, their clonogenic survival was significantly less than that of those treated by cisplatin only. These findings show that the inhibitors of monoubiquitinated PCNA chemosensitize cells by inhibiting repair of ICLs and DSBs. PMID:24474685

  3. Targeting Mycobacterium tuberculosis topoisomerase I by small-molecule inhibitors.

    PubMed

    Godbole, Adwait Anand; Ahmed, Wareed; Bhat, Rajeshwari Subray; Bradley, Erin K; Ekins, Sean; Nagaraja, Valakunja

    2015-03-01

    We describe inhibition of Mycobacterium tuberculosis topoisomerase I (MttopoI), an essential mycobacterial enzyme, by two related compounds, imipramine and norclomipramine, of which imipramine is clinically used as an antidepressant. These molecules showed growth inhibition of both Mycobacterium smegmatis and M. tuberculosis cells. The mechanism of action of these two molecules was investigated by analyzing the individual steps of the topoisomerase I (topoI) reaction cycle. The compounds stimulated cleavage, thereby perturbing the cleavage-religation equilibrium. Consequently, these molecules inhibited the growth of the cells overexpressing topoI at a low MIC. Docking of the molecules on the MttopoI model suggested that they bind near the metal binding site of the enzyme. The DNA relaxation activity of the metal binding mutants harboring mutations in the DxDxE motif was differentially affected by the molecules, suggesting that the metal coordinating residues contribute to the interaction of the enzyme with the drug. Taken together, the results highlight the potential of these small molecules, which poison the M. tuberculosis and M. smegmatis topoisomerase I, as leads for the development of improved molecules to combat mycobacterial infections. Moreover, targeting metal coordination in topoisomerases might be a general strategy to develop new lead molecules.

  4. Autophagonizer, a novel synthetic small molecule, induces autophagic cell death

    SciTech Connect

    Choi, In-Kwon; Cho, Yoon Sun; Jung, Hye Jin; Kwon, Ho Jeong

    2010-03-19

    Autophagy is an apoptosis-independent mechanism of cell death that protects the cell from environmental imbalances and infection by pathogens. We identified a novel small molecule, 2-(3-Benzyl-4-oxo-3,4,5,6,7,8-hexahydro-benzo[4,5]thieno[2,3-d] pyrimidin-2-ylsulfanylmethyl)-oxazole-4-carboxylic acid (2-pyrrolidin-1-yl-ethyl)-amide (referred as autophagonizer), using high-content cell-based screening and the autophagosome marker EGFP-LC3. Autophagonizer inhibited growth and induced cell death in the human tumor cell lines MCF7, HeLa, HCT116, A549, AGS, and HT1080 via a caspase-independent pathway. Conversion of cytosolic LC3-I to autophagosome-associated LC3-II was greatly enhanced by autophagonizer treatment. Transmission electron microscopy and acridine orange staining revealed increased autophagy in the cytoplasm of autophagonizer-treated cells. In conclusion, autophagonizer is a novel autophagy inducer with unique structure, which induces autophagic cell death in the human tumor cell lines.

  5. Design, synthesis, and evaluation of bioactive small molecules.

    PubMed

    Hua, Duy H

    2013-02-01

    Collaborative research projects between chemists, biologists, and medical scientists have inevitably produced many useful drugs, biosensors, and medical instrumentation. Organic chemistry lies at the heart of drug discovery and development. The current range of organic synthetic methodologies allows for the construction of unlimited libraries of small organic molecules for drug screening. In translational research projects, we have focused on the discovery of lead compounds for three major diseases: Alzheimer's disease (AD), breast cancer, and viral infections. In the AD project, we have taken a rational-design approach and synthesized a new class of tricyclic pyrone (TP) compounds that preserve memory and motor functions in amyloid precursor protein (APP)/presenilin-1 (PS1) mice. TPs could protect neuronal death through several possible mechanisms, including their ability to inhibit the formation of both intraneuronal and extracellular amyloid β (Aβ) aggregates, to increase cholesterol efflux, to restore axonal trafficking, and to enhance long-term potentiation (LTP) and restored LTP following treatment with Aβ oligomers. We have also synthesized a new class of gap-junction enhancers, based on substituted quinolines, that possess potent inhibitory activities against breast-cancer cells in vitro and in vivo. Although various antiviral drugs are available, the emergence of viral resistance to existing antiviral drugs and various understudied viral infections, such as norovirus and rotavirus, emphasizes the demand for the development of new antiviral agents against such infections and others. Our laboratories have undertaken these projects for the discovery of new antiviral inhibitors. The discussion of these aforementioned projects may shed light on the future development of drug candidates in the fields of AD, cancer, and viral infections. PMID:23280957

  6. Mechanistic understanding and significance of small peptides interaction with MHC class II molecules for therapeutic applications.

    PubMed

    Afridi, Saifullah; Hoessli, Daniel C; Hameed, Muhammad Waqar

    2016-07-01

    Major histocompatibility complex (MHC) class II molecules are expressed by antigen-presenting cells and stimulate CD4(+) T cells, which initiate humoral immune responses. Over the past decade, interest has developed to therapeutically impact the peptides to be exposed to CD4(+) T cells. Structurally diverse small molecules have been discovered that act on the endogenous peptide exchanger HLA-DM by different mechanisms. Exogenously delivered peptides are highly susceptible to proteolytic cleavage in vivo; however, it is only when successfully incorporated into stable MHC II-peptide complexes that these peptides can induce an immune response. Many of the small molecules so far discovered have highlighted the molecular interactions mediating the formation of MHC II-peptide complexes. As potential drugs, these small molecules open new therapeutic approaches to modulate MHC II antigen presentation pathways and influence the quality and specificity of immune responses. This review briefly introduces how CD4(+) T cells recognize antigen when displayed by MHC class II molecules, as well as MHC class II-peptide-loading pathways, structural basis of peptide binding and stabilization of the peptide-MHC complexes. We discuss the concept of MHC-loading enhancers, how they could modulate immune responses and how these molecules have been identified. Finally, we suggest mechanisms whereby MHC-loading enhancers could act upon MHC class II molecules.

  7. Conformational analysis of small molecules: NMR and quantum mechanics calculations.

    PubMed

    Tormena, Cláudio F

    2016-08-01

    This review deals with conformational analysis in small organic molecules, and describes the stereoelectronic interactions responsible for conformational stability. Conformational analysis is usually performed using NMR spectroscopy through measurement of coupling constants at room or low temperature in different solvents to determine the populations of conformers in solution. Quantum mechanical calculations are used to address the interactions responsible for conformer stability. The conformational analysis of a large number of small molecules is described, using coupling constant measurements in different solvents and at low temperature, as well as recent applications of through-space and through-hydrogen bond coupling constants JFH as tools for the conformational analysis of fluorinated molecules. Besides NMR parameters, stereoelectronic interactions such as conjugative, hyperconjugative, steric and intramolecular hydrogen bond interactions involved in conformational preferences are discussed.

  8. Engineered kinesin motor proteins amenable to small-molecule inhibition.

    PubMed

    Engelke, Martin F; Winding, Michael; Yue, Yang; Shastry, Shankar; Teloni, Federico; Reddy, Sanjay; Blasius, T Lynne; Soppina, Pushpanjali; Hancock, William O; Gelfand, Vladimir I; Verhey, Kristen J

    2016-01-01

    The human genome encodes 45 kinesin motor proteins that drive cell division, cell motility, intracellular trafficking and ciliary function. Determining the cellular function of each kinesin would benefit from specific small-molecule inhibitors. However, screens have yielded only a few specific inhibitors. Here we present a novel chemical-genetic approach to engineer kinesin motors that can carry out the function of the wild-type motor yet can also be efficiently inhibited by small, cell-permeable molecules. Using kinesin-1 as a prototype, we develop two independent strategies to generate inhibitable motors, and characterize the resulting inhibition in single-molecule assays and in cells. We further apply these two strategies to create analogously inhibitable kinesin-3 motors. These inhibitable motors will be of great utility to study the functions of specific kinesins in a dynamic manner in cells and animals. Furthermore, these strategies can be used to generate inhibitable versions of any motor protein of interest. PMID:27045608

  9. Engineered kinesin motor proteins amenable to small-molecule inhibition

    PubMed Central

    Engelke, Martin F.; Winding, Michael; Yue, Yang; Shastry, Shankar; Teloni, Federico; Reddy, Sanjay; Blasius, T. Lynne; Soppina, Pushpanjali; Hancock, William O.; Gelfand, Vladimir I.; Verhey, Kristen J.

    2016-01-01

    The human genome encodes 45 kinesin motor proteins that drive cell division, cell motility, intracellular trafficking and ciliary function. Determining the cellular function of each kinesin would benefit from specific small-molecule inhibitors. However, screens have yielded only a few specific inhibitors. Here we present a novel chemical-genetic approach to engineer kinesin motors that can carry out the function of the wild-type motor yet can also be efficiently inhibited by small, cell-permeable molecules. Using kinesin-1 as a prototype, we develop two independent strategies to generate inhibitable motors, and characterize the resulting inhibition in single-molecule assays and in cells. We further apply these two strategies to create analogously inhibitable kinesin-3 motors. These inhibitable motors will be of great utility to study the functions of specific kinesins in a dynamic manner in cells and animals. Furthermore, these strategies can be used to generate inhibitable versions of any motor protein of interest. PMID:27045608

  10. Conformational analysis of small molecules: NMR and quantum mechanics calculations.

    PubMed

    Tormena, Cláudio F

    2016-08-01

    This review deals with conformational analysis in small organic molecules, and describes the stereoelectronic interactions responsible for conformational stability. Conformational analysis is usually performed using NMR spectroscopy through measurement of coupling constants at room or low temperature in different solvents to determine the populations of conformers in solution. Quantum mechanical calculations are used to address the interactions responsible for conformer stability. The conformational analysis of a large number of small molecules is described, using coupling constant measurements in different solvents and at low temperature, as well as recent applications of through-space and through-hydrogen bond coupling constants JFH as tools for the conformational analysis of fluorinated molecules. Besides NMR parameters, stereoelectronic interactions such as conjugative, hyperconjugative, steric and intramolecular hydrogen bond interactions involved in conformational preferences are discussed. PMID:27573182

  11. Rotation of methane molecules in dimers and small clusters.

    PubMed

    Hoshina, Hiromichi; Skvortsov, Dmitri; Slipchenko, Mikhail N; Sartakov, Boris G; Vilesov, Andrey F

    2015-08-28

    This work reports on the study of the internal rotation of methane molecules in small clusters containing up to about five molecules. The clusters were assembled in helium droplets at T = 0.38 K by successive capture of single methane molecules and studied by infrared laser spectroscopy of the fundamental CH4 ν3 vibration around 3030 cm(-1). The spectra demonstrate well resolved structure due to internal rotation of the constituent molecules in the clusters. The most resolved spectrum for the dimers shows characteristic splitting of the lines due to anisotropic intermolecular interaction. The magnitude of the splitting is found to be in a good quantitative agreement with the recent theoretical anisotropic intermolecular potentials. PMID:26328841

  12. Caenorhabditis elegans chemical biology: lessons from small molecules

    Technology Transfer Automated Retrieval System (TEKTRAN)

    How can we complement Caenorhabditis elegans genomics and proteomics with a comprehensive structural and functional annotation of its metabolome? Several lines of evidence indicate that small molecules of largely undetermined structure play important roles in C. elegans biology, including key pathw...

  13. Design of a small molecule against an oncogenic noncoding RNA.

    PubMed

    Velagapudi, Sai Pradeep; Cameron, Michael D; Haga, Christopher L; Rosenberg, Laura H; Lafitte, Marie; Duckett, Derek R; Phinney, Donald G; Disney, Matthew D

    2016-05-24

    The design of precision, preclinical therapeutics from sequence is difficult, but advances in this area, particularly those focused on rational design, could quickly transform the sequence of disease-causing gene products into lead modalities. Herein, we describe the use of Inforna, a computational approach that enables the rational design of small molecules targeting RNA to quickly provide a potent modulator of oncogenic microRNA-96 (miR-96). We mined the secondary structure of primary microRNA-96 (pri-miR-96) hairpin precursor against a database of RNA motif-small molecule interactions, which identified modules that bound RNA motifs nearby and in the Drosha processing site. Precise linking of these modules together provided Targaprimir-96 (3), which selectively modulates miR-96 production in cancer cells and triggers apoptosis. Importantly, the compound is ineffective on healthy breast cells, and exogenous overexpression of pri-miR-96 reduced compound potency in breast cancer cells. Chemical Cross-Linking and Isolation by Pull-Down (Chem-CLIP), a small-molecule RNA target validation approach, shows that 3 directly engages pri-miR-96 in breast cancer cells. In vivo, 3 has a favorable pharmacokinetic profile and decreases tumor burden in a mouse model of triple-negative breast cancer. Thus, rational design can quickly produce precision, in vivo bioactive lead small molecules against hard-to-treat cancers by targeting oncogenic noncoding RNAs, advancing a disease-to-gene-to-drug paradigm.

  14. Small Molecules Take A Big Step Against Clostridium difficile.

    PubMed

    Beilhartz, Greg L; Tam, John; Melnyk, Roman A

    2015-12-01

    Effective treatment of Clostridium difficile infections demands a shift away from antibiotics towards toxin-neutralizing agents. Work by Bender et al., using a drug that attenuates toxin action in vivo without affecting bacterial survival, demonstrates the exciting potential of small molecules as a new modality in the fight against C. difficile. PMID:26547239

  15. A novel small-molecule inhibitor of 3-phosphoglycerate dehydrogenase.

    PubMed

    Mullarky, Edouard; Lairson, Luke L; Cantley, Lewis C; Lyssiotis, Costas A

    2016-07-01

    Serine metabolism is likely to play a critical role in cancer cell growth. A recent study reports the identification of a novel small-molecule inhibitor of serine synthesis that targets 3-phosphoglycerate dehydrogenase (PHGDH), the first enzyme of the serine synthesis pathway, and selectively abrogates the proliferation of PHGDH overexpressing breast cancer cells. PMID:27652319

  16. Integration of small-molecule discovery in academic biomedical research.

    PubMed

    Ohlmeyer, Michael; Zhou, Ming-Ming

    2010-01-01

    Rapid advances in biomedical sciences in recent years have drastically accelerated the discovery of the molecular basis of human diseases. The great challenge is how to translate the newly acquired knowledge into new medicine for disease prevention and treatment. Drug discovery is a long and expensive process, and the pharmaceutical industry has not been very successful at it, despite its enormous resources and spending on the process. It is increasingly realized that academic biomedical research institutions ought to be engaged in early-stage drug discovery, especially when it can be coupled to their basic research. To leverage the productivity of new-drug development, a substantial acceleration in validation of new therapeutic targets is required, which would require small molecules that can precisely control target functions in complex biological systems in a temporal and dose-dependent manner. In this review, we describe a process of integration of small-molecule discovery and chemistry in academic biomedical research that will ideally bring together the elements of innovative approaches to new molecular targets, existing basic and clinical research, screening infrastructure, and synthetic and medicinal chemistry to follow up on small-molecule hits. Such integration of multidisciplinary resources and expertise will enable academic investigators to discover novel small molecules that are expected to facilitate their efforts in both mechanistic research and new-drug target validation. More broadly academic drug discovery should contribute new entities to therapy for intractable human diseases, especially for orphan diseases, and hopefully stimulate and synergize with the commercial sector.

  17. Single-molecule surface- and tip-enhanced raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Pettinger, Bruno

    2010-08-01

    A review is given on single-molecule surface- and tip-enhanced Raman spectroscopy (SERS and TERS). It sketches the historical development along different routes toward huge near-field enhancements, the basis of single-molecule enhanced Raman spectroscopy; from SNOM to apertureless SNOM to tip-enhanced Raman spectroscopy (TERS) and microscopy; from SERS to single-molecule SERS to single-molecule TERS. The claim of extremely high enhancement factors of 1014 in single-molecule SERS is critically discussed, in particular in the view of recent experimental and theoretical results that limits the electromagnetic enhancement to ⩽ 1011. In the field of TERS only very few reports on single-molecule TERS exist: single-molecule TERS on dyes and on a protein (cytochrome c). In the latter case, TERS 'sees' even subunits of this protein, either amino-acids or the heme, depending on the orientation of the protein relative to the tip. The former case concerns the dye brilliant cresyl blue adsorbed either on a Au surface under ambient conditions or on a Au(111) surface in ultra high vacuum. These results indicate that significant progress is to be expected for TERS in general and for single-molecule TERS in particular.

  18. Unraveling plant hormone signaling through the use of small molecules

    PubMed Central

    Rigal, Adeline; Ma, Qian; Robert, Stéphanie

    2014-01-01

    Plants have acquired the capacity to grow continuously and adjust their morphology in response to endogenous and external signals, leading to a high architectural plasticity. The dynamic and differential distribution of phytohormones is an essential factor in these developmental changes. Phytohormone perception is a fast but complex process modulating specific developmental reprogramming. In recent years, chemical genomics or the use of small molecules to modulate target protein function has emerged as a powerful strategy to study complex biological processes in plants such as hormone signaling. Small molecules can be applied in a conditional, dose-dependent and reversible manner, with the advantage of circumventing the limitations of lethality and functional redundancy inherent to traditional mutant screens. High-throughput screening of diverse chemical libraries has led to the identification of bioactive molecules able to induce plant hormone-related phenotypes. Characterization of the cognate targets and pathways of those molecules has allowed the identification of novel regulatory components, providing new insights into the molecular mechanisms of plant hormone signaling. An extensive structure-activity relationship (SAR) analysis of the natural phytohormones, their designed synthetic analogs and newly identified bioactive molecules has led to the determination of the structural requirements essential for their bioactivity. In this review, we will summarize the so far identified small molecules and their structural variants targeting specific phytohormone signaling pathways. We will highlight how the SAR analyses have enabled better interrogation of the molecular mechanisms of phytohormone responses. Finally, we will discuss how labeled/tagged hormone analogs can be exploited, as compelling tools to better understand hormone signaling and transport mechanisms. PMID:25126092

  19. Small Molecule Approach to Study the Function of Mitotic Kinesins.

    PubMed

    Al-Obaidi, Naowras; Kastl, Johanna; Mayer, Thomas U

    2016-01-01

    Mitotic motor proteins of the kinesin superfamily are critical for the faithful segregation of chromosomes and the formation of the two daughter cells during meiotic and mitotic M-phase. Of the 45 human kinesins, roughly a dozen are involved in the assembly of the bipolar spindle, alignment of chromosomes at the spindle equator, chromosome segregation, and cytokinesis. The functions of kinesins in these processes are highly diverse and include the transport of cargo molecules, sliding and bundling of microtubules, and regulation of microtubule dynamics. In light of this multitude of diverse functions and the complex functional interplay of different kinesins during M-phase, it is not surprising that one of the greatest challenges in cell biology is the functional dissection of individual motor proteins. Reversible and fast acting small molecules are powerful tools to accomplish this challenge. However, the validity of conclusions drawn from small molecule studies strictly depends on compound specificity. In this chapter, we present methods for the identification of small molecule inhibitors of a motor protein of interest. In particular, we focus on a protein-based large throughput screen to identify inhibitors of the ATPase activity of kinesins. Furthermore, we provide protocols and guidelines for secondary screens to validate hits and select for specific inhibitors. PMID:27193856

  20. Intercalation of small hydrophobic molecules in lipid bilayers containing cholesterol

    SciTech Connect

    Worcester, D.L.; Hamacher, K.; Kaiser, H.; Kulasekere, R.; Torbet, J.

    1994-12-31

    Partitioning of small hydrophobic molecules into lipid bilayers containing cholesterol has been studied using the 2XC diffractometer at the University of Missouri Research Reactor. Locations of the compounds were determined by Fourier difference methods with data from both deuterated and undeuterated compounds introduced into the bilayers from the vapor phase. Data fitting procedures were developed for determining how well the compounds were localized. The compounds were found to be localized in a narrow region at the center of the hydrophobic layer, between the two halves of the bilayer. The structures are therefore intercalated structures with the long axis of the molecules in the plane of the bilayer.

  1. Validating and understanding ring conformations using small molecule crystallographic data.

    PubMed

    Cottrell, Simon J; Olsson, Tjelvar S G; Taylor, Robin; Cole, Jason C; Liebeschuetz, John W

    2012-04-23

    Understanding the conformational preferences of ring structures is fundamental to structure-based drug design. Although the Cambridge Structural Database (CSD) provides information on the preferred conformations of small molecules, analyzing this data can be very time-consuming. In order to overcome this hurdle, tools have been developed for quickly extracting geometrical preferences from the CSD. Here we describe how the program Mogul has been extended to analyze and compare ring conformations, using a library derived from over 900 000 ring fragments in the CSD. We illustrate how these can be used to understand the conformational preferences of molecules in a crystal lattice and bound to proteins. PMID:22372622

  2. Small and Large Molecules in the Diffuse Interstellar Medium

    NASA Astrophysics Data System (ADS)

    Oka, Takeshi; Huang, Jane

    2014-06-01

    Although molecules with a wide range of sizes exist in dense clouds (e.g. H(C≡C)_nC≡N with n = 0 - 5), molecules identified in diffuse clouds are all small ones. Since the initial discovery of CH, CN, and CH^+, all molecules detected in the optical region are diatomics except for H_3^+ in the infrared and C_3 in the visible. Radio observations have been limited up to triatomic molecules except for H_2CO and the ubiquitous C_3H_2. The column densities of all molecules are less than 1014 cm-2 with the two exceptions of CO and H_3^+ as well as CH and C_2 in a few special sightlines. Larger molecules with many carbon atoms have been searched for but have not been detected. On the other hand, the observations of a great many diffuse interstellar bands (380 toward HD 204827 and 414 toward HD 183143) with equivalent widths from 1 to 5700 m Å indicate high column densities of many heavy molecules. If an electronic transition dipole moment of 1 Debye is assumed, the observed equivalent widths translate to column densities from 5 × 1011 cm-2 to 3 × 1015 cm-2. It seems impossible that these large molecules are formed from chemical reactions in space from small molecules. It is more likely that they are fragments of aggregates, perhaps mixed aromatic/aliphatic organic nanoparticles (MAONS). MAONS and their large fragment molecules are stable against photodissociation in the diffuse ISM because the energy of absorbed photons is divided into statistical distributions of vibrational energy and emitted in the infrared rather than breaking a chemical bond. We use a simple Rice-Ramsperger-Kassel-Marcus theory to estimate the molecular size required for the stabilization. Snow, T. P. & McCall, B. J. 2006, ARA&A, 44 367 Hobbs, L. M., York, D. G., Snow, T. P., Oka, T., Thorburn, J. A., et al. 2008, ApJ, 680 1256 Hobbs, L. M., York, D. G., Thorburn, J. A., Snow, T. P., Bishof, M., et al. 2009, ApJ, 705 32 Kwok, S. & Zhang, S. 2013, ApJ, 771 5 Freed, K. F., Oka, T., & Suzuki, H

  3. Getting across the cell membrane: an overview for small molecules, peptides, and proteins.

    PubMed

    Yang, Nicole J; Hinner, Marlon J

    2015-01-01

    The ability to efficiently access cytosolic proteins is desired in both biological research and medicine. However, targeting intracellular proteins is often challenging, because to reach the cytosol, exogenous molecules must first traverse the cell membrane. This review provides a broad overview of how certain molecules are thought to cross this barrier, and what kinds of approaches are being made to enhance the intracellular delivery of those that are impermeable. We first discuss rules that govern the passive permeability of small molecules across the lipid membrane, and mechanisms of membrane transport that have evolved in nature for certain metabolites, peptides, and proteins. Then, we introduce design strategies that have emerged in the development of small molecules and peptides with improved permeability. Finally, intracellular delivery systems that have been engineered for protein payloads are surveyed. Viewpoints from varying disciplines have been brought together to provide a cohesive overview of how the membrane barrier is being overcome.

  4. Getting Across the Cell Membrane: An Overview for Small Molecules, Peptides, and Proteins

    PubMed Central

    Yang, Nicole J.; Hinner, Marlon J.

    2016-01-01

    The ability to efficiently access cytosolic proteins is desired in both biological research and medicine. However, targeting intracellular proteins is often challenging, because to reach the cytosol, exogenous molecules must first traverse the cell membrane. This review provides a broad overview of how certain molecules are thought to cross this barrier, and what kinds of approaches are being made to enhance the intracellular delivery of those that are impermeable. We first discuss rules that govern the passive permeability of small molecules across the lipid membrane, and mechanisms of membrane transport that have evolved in nature for certain metabolites, peptides, and proteins. Then, we introduce design strategies that have emerged in the development of small molecules and peptides with improved permeability. Finally, intracellular delivery systems that have been engineered for protein payloads are surveyed. Viewpoints from varying disciplines have been brought together to provide a cohesive overview of how the membrane barrier is being overcome. PMID:25560066

  5. Computational insight into small molecule inhibition of cyclophilins.

    PubMed

    Sambasivarao, Somisetti V; Acevedo, Orlando

    2011-02-28

    Cyclophilins (Cyp) are a family of cellular enzymes possessing peptidyl-prolyl isomerase activity, which catalyze the cis-trans interconversion of proline-containing peptide bonds. The two most abundant family members, CypA and CypB, have been identified as valid drug targets for a wide range of diseases, including HCV, HIV, and multiple cancers. However, the development of small molecule inhibitors that possess nM potency and high specificity for a particular Cyp is difficult given the complete conservation of all active site residues between the enzymes. Monte Carlo statistical sampling coupled to free energy perturbation theory (MC/FEP) calculations have been carried out to elucidate the origin of the experimentally observed nM inhibition of CypA by acylurea-based derivatives and the >200-fold in vitro selectivity between CypA and CypB from aryl 1-indanylketone-based μM inhibitors. The computed free-energies of binding were in close accord with those derived from experiments. Binding affinity values for the inhibitors were determined to be dependent upon the stabilization strength of the nonbonded interactions provided toward two catalytic residues: Arg55 and Asn102 in CypA and the analogous Arg63 and Asn110 residues in CypB. Fine-tuning of the hydrophobic interactions allowed for enhanced potency among derivatives. The aryl 1-indanylketones are predicted to differentiate between the cyclophilins by using distinct binding motifs that exploit subtle differences in the active site arrangements. Ideas for the development of new selective compounds with the potential for advancement to low-nanomolar inhibition are presented. PMID:21194235

  6. A general strategy to construct small molecule biosensors in eukaryotes.

    PubMed

    Feng, Justin; Jester, Benjamin W; Tinberg, Christine E; Mandell, Daniel J; Antunes, Mauricio S; Chari, Raj; Morey, Kevin J; Rios, Xavier; Medford, June I; Church, George M; Fields, Stanley; Baker, David

    2015-12-29

    Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activates transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes.

  7. A general strategy to construct small molecule biosensors in eukaryotes

    DOE PAGES

    Feng, Justin; Jester, Benjamin W.; Tinberg, Christine E.; Mandell, Daniel J.; Antunes, Mauricio S.; Chari, Raj; Morey, Kevin J.; Rios, Xavier; Medford, June I.; Church, George M.; et al

    2015-12-29

    Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activatesmore » transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes.« less

  8. Enhancing the efficiency of direct reprogramming of human mesenchymal stem cells into mature neuronal-like cells with the combination of small molecule modulators of chromatin modifying enzymes, SMAD signaling and cyclic adenosine monophosphate levels.

    PubMed

    Alexanian, Arshak R; Liu, Qing-song; Zhang, Zhiying

    2013-08-01

    Advances in cell reprogramming technologies to generate patient-specific cells of a desired type will revolutionize the field of regenerative medicine. While several cell reprogramming methods have been developed over the last decades, the majority of these technologies require the exposure of cell nuclei to reprogramming large molecules via transfection, transduction, cell fusion or nuclear transfer. This raises several technical, safety and ethical issues. Chemical genetics is an alternative approach for cell reprogramming that uses small, cell membrane penetrable substances to regulate multiple cellular processes including cell plasticity. Recently, using the combination of small molecules that are involved in the regulation chromatin structure and function and agents that favor neural differentiation we have been able to generate neural-like cells from human mesenchymal stem cells. In this study, to improve the efficiency of neuronal differentiation and maturation, two specific inhibitors of SMAD signaling (SMAD1/3 and SMAD3/5/8) that play an important role in neuronal differentiation of embryonic stem cells, were added to our previous neural induction recipe. Results demonstrated that human mesenchymal stem cells grown in this culture conditions exhibited higher expression of several mature neuronal genes, formed synapse-like structures and exerted electrophysiological properties of differentiating neural stem cells. Thus, an efficient method for production of mature neuronal-like cells from human adult bone marrow derived mesenchymal stem cells has been developed. We concluded that specific combinations of small molecules that target specific cell signaling pathways and chromatin modifying enzymes could be a promising approach for manipulation of adult stem cell plasticity.

  9. Systems-based discovery of tomatidine as a natural small molecule inhibitor of skeletal muscle atrophy.

    PubMed

    Dyle, Michael C; Ebert, Scott M; Cook, Daniel P; Kunkel, Steven D; Fox, Daniel K; Bongers, Kale S; Bullard, Steven A; Dierdorff, Jason M; Adams, Christopher M

    2014-05-23

    Skeletal muscle atrophy is a common and debilitating condition that lacks an effective therapy. To address this problem, we used a systems-based discovery strategy to search for a small molecule whose mRNA expression signature negatively correlates to mRNA expression signatures of human skeletal muscle atrophy. This strategy identified a natural small molecule from tomato plants, tomatidine. Using cultured skeletal myotubes from both humans and mice, we found that tomatidine stimulated mTORC1 signaling and anabolism, leading to accumulation of protein and mitochondria, and ultimately, cell growth. Furthermore, in mice, tomatidine increased skeletal muscle mTORC1 signaling, reduced skeletal muscle atrophy, enhanced recovery from skeletal muscle atrophy, stimulated skeletal muscle hypertrophy, and increased strength and exercise capacity. Collectively, these results identify tomatidine as a novel small molecule inhibitor of muscle atrophy. Tomatidine may have utility as a therapeutic agent or lead compound for skeletal muscle atrophy. PMID:24719321

  10. Small molecules inhibitors of plasminogen activator inhibitor-1 - an overview.

    PubMed

    Rouch, Anne; Vanucci-Bacqué, Corinne; Bedos-Belval, Florence; Baltas, Michel

    2015-03-01

    PAI-1, a glycoprotein from the serpin family and the main inhibitor of tPA and uPA, plays an essential role in the regulation of intra and extravascular fibrinolysis by inhibiting the formation of plasmin from plasminogen. PAI-1 is also involved in pathological processes such as thromboembolic diseases, atherosclerosis, fibrosis and cancer. The inhibition of PAI-1 activity by small organic molecules has been observed in vitro and with some in vivo models. Based on these findings, PAI-1 appears as a potential therapeutic target for several pathological conditions. Over the past decades, many efforts have therefore been devoted to developing PAI-1 inhibitors. This article provides an overview of the publishing activity on small organic molecules used as PAI-1 inhibitors. The chemical synthesis of the most potent inhibitors as well as their biological and biochemical evaluations is also presented.

  11. Improved abiotic stress tolerance of bermudagrass by exogenous small molecules.

    PubMed

    Chan, Zhulong; Shi, Haitao

    2015-01-01

    As a widely used warm-season turfgrass in landscapes and golf courses, bermudagrass encounters multiple abiotic stresses during the growth and development. Physiology analysis indicated that abiotic stresses induced the accumulation of ROS and decline of photosynthesis, resulting in increased cell damage and inhibited growth. Proteomic and metabolomic approaches showed that antioxidant enzymes and osmoprotectant contents (sugar, sucrose, dehydrin, proline) were extensively changed under abiotic stress conditions. Exogenous application of small molecules, such as ABA, NO, CaCl2, H2S, polyamine and melatonin, could effectively alleviate damages caused by multiple abiotic stresses, including drought, salt, heat and cold. Based on high through-put RNA seq analysis, genes involved in ROS, transcription factors, hormones, and carbohydrate metabolisms were largely enriched. The data indicated that small molecules induced the accumulation of osmoprotectants and antioxidants, kept cell membrane integrity, increased photosynthesis and kept ion homeostasis, which protected bermudagrass from damages caused by abiotic stresses. PMID:25757363

  12. Electronic conduction in nematic phase of small molecules

    NASA Astrophysics Data System (ADS)

    Tokunaga, Keiji; Takayashiki, Yukiko; Iino, Hiroaki; Hanna, Jun-Ichi

    2009-01-01

    We investigated charge-carrier transport in the nematic phase of small molecules such as 2-phenylbenzothiazoles by time-of-flight experiments, in which the conduction mechanism has been considered to be ionic. As a result, we established the hole and electron transports in the nematic phase of highly purified samples: we found that there were two transits, namely, fast and slow transits, in less pure samples; the slow transit was attributed to ionic conduction originating from trace amounts of impurities and the fast transit was attributed to electronic conduction whose attribution was elucidated by mobility changes in the diluted samples with a hydrocarbon of n -tetradecane (n-C14H30) . From these results, we conclude that the intrinsic conduction mechanism in the nematic phase of small molecules is ambipolar and electronic, irrespective of the size of the π -conjugate system of the core moiety. Thus, they provide a new insight into the conduction mechanism in fluidic materials.

  13. Polymer and small molecule based hybrid light source

    DOEpatents

    Choong, Vi-En; Choulis, Stelios; Krummacher, Benjamin Claus; Mathai, Mathew; So, Franky

    2010-03-16

    An organic electroluminescent device, includes: a substrate; a hole-injecting electrode (anode) coated over the substrate; a hole injection layer coated over the anode; a hole transporting layer coated over the hole injection layer; a polymer based light emitting layer, coated over the hole transporting layer; a small molecule based light emitting layer, thermally evaporated over the polymer based light emitting layer; and an electron-injecting electrode (cathode) deposited over the electroluminescent polymer layer.

  14. Light-assisted small molecule screening against protein kinases

    PubMed Central

    Inglés-Prieto, Álvaro; Reichhart, Eva; Muellner, Markus K.; Nowak, Matthias; Nijman, Sebastian M.; Grusch, Michael; Janovjak, Harald

    2015-01-01

    High-throughput live-cell screens are intricate elements of systems biology studies and drug discovery pipelines. Here, we demonstrate an optogenetics-assisted method that obviates the addition of chemical activators and reporters, reduces the number of operational steps and increases information content in a cell-based small molecule screen against human protein kinases including an orphan receptor tyrosine kinase. This blueprint for all-optical screening can be adapted to many drug targets and cellular processes. PMID:26457372

  15. Allosteric Small-Molecule Inhibitors of the AKT Kinase

    NASA Astrophysics Data System (ADS)

    Dalafave, D. S.

    This research addresses computational design of small druglike molecules for possible anticancer applications. AKT and SGK are kinases that control important cellular functions. They are highly homologous, having similar activators and targets. Cancers with increased SGK activity may develop resistance to AKT-specific inhibitors. Our goal was to design new molecules that would bind both AKT and SGK, thus preventing the development of drug resistance. Most kinase inhibitors target the kinase ATP-binding site. However, the high similarity in this site among kinases makes it difficult to target specifically. Furthermore, mutations in this site can cause resistance to ATP-competitive kinase inhibitors. We used existing AKT inhibitors as initial templates to design molecules that could potentially bind the allosteric sites of both AKT and SGK. Molecules with no implicit toxicities and optimal drug-like properties were used for docking studies. Binding energies of the stable complexes that the designed molecules formed with AKT and SGK were calculated. Possible applications of the designed putative inhibitors against cancers with overexpressed AKT/SGK is discussed.

  16. Turning on caspases with genetics and small molecules.

    PubMed

    Morgan, Charles W; Julien, Olivier; Unger, Elizabeth K; Shah, Nirao M; Wells, James A

    2014-01-01

    Caspases, aspartate-specific cysteine proteases, have fate-determining roles in many cellular processes including apoptosis, differentiation, neuronal remodeling, and inflammation (for review, see Yuan & Kroemer, 2010). There are a dozen caspases in humans alone, yet their individual contributions toward these phenotypes are not well understood. Thus, there has been considerable interest in activating individual caspases or using their activity to drive these processes in cells and animals. We envision that such experimental control of caspase activity can not only afford novel insights into fundamental biological problems but may also enable new models for disease and suggest possible routes to therapeutic intervention. In particular, localized, genetic, and small-molecule-controlled caspase activation has the potential to target the desired cell type in a tissue. Suppression of caspase activation is one of the hallmarks of cancer and thus there has been significant enthusiasm for generating selective small-molecule activators that could bypass upstream mutational events that prevent apoptosis. Here, we provide a practical guide that investigators have devised, using genetics or small molecules, to activate specific caspases in cells or animals. Additionally, we show genetically controlled activation of an executioner caspase to target the function of a defined group of neurons in the adult mammalian brain.

  17. Examining small molecule: HIV RNA interactions using arrayed imaging reflectometry

    NASA Astrophysics Data System (ADS)

    Chaimayo, Wanaruk; Miller, Benjamin L.

    2014-03-01

    Human Immunodeficiency Virus (HIV) has been the subject of intense research for more than three decades as it causes an uncurable disease: Acquired Immunodeficiency Syndrome, AIDS. In the pursuit of a medical treatment, RNAtargeted small molecules are emerging as promising targets. In order to understand the binding kinetics of small molecules and HIV RNA, association (ka) and dissociation (kd) kinetic constants must be obtained, ideally for a large number of sequences to assess selectivity. We have developed Aqueous Array Imaged Reflectometry (Aq-AIR) to address this challenge. Using a simple light interference phenomenon, Aq-AIR provides real-time high-throughput multiplex capabilities to detect binding of targets to surface-immobilized probes in a label-free microarray format. The second generation of Aq-AIR consisting of high-sensitivity CCD camera and 12-μL flow cell was fabricated. The system performance was assessed by real-time detection of MBNL1-(CUG)10 and neomycin B - HIV RNA bindings. The results establish this second-generation Aq-AIR to be able to examine small molecules binding to RNA sequences specific to HIV.

  18. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications.

    PubMed

    Ruscito, Annamaria; DeRosa, Maria C

    2016-01-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then used in various applications. These applications range from therapeutic uses to biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is needed for the protection and wellbeing of humans and animals. However, the small molecular weights of these targets, including the drastic size difference between the target and the oligonucleotides, make it challenging to select, characterize, and apply aptamers for their detection. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed. PMID:27242994

  19. Multimonth controlled small molecule release from biodegradable thin films

    PubMed Central

    Hsu, Bryan B.; Park, Myoung-Hwan; Hagerman, Samantha R.; Hammond, Paula T.

    2014-01-01

    Long-term, localized delivery of small molecules from a biodegradable thin film is challenging owing to their low molecular weight and poor charge density. Accomplishing highly extended controlled release can facilitate high therapeutic levels in specific regions of the body while significantly reducing the toxicity to vital organs typically caused by systemic administration and decreasing the need for medical intervention because of its long-lasting release. Also important is the ability to achieve high drug loadings in thin film coatings to allow incorporation of significant drug amounts on implant surfaces. Here we report a sustained release formulation for small molecules based on a soluble charged polymer–drug conjugate that is immobilized into nanoscale, conformal, layer-by-layer assembled films applicable to a variety of substrate surfaces. We measured a highly predictable sustained drug release from a polymer thin film coating of 0.5–2.7 μm that continued for more than 14 mo with physiologically relevant drug concentrations, providing an important drug delivery advance. We demonstrated this effect with a potent small molecule nonsteroidal anti-inflammatory drug, diclofenac, because this drug can be used to address chronic pain, osteoarthritis, and a range of other critical medical issues. PMID:25092310

  20. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    PubMed Central

    Ruscito, Annamaria; DeRosa, Maria C.

    2016-01-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then used in various applications. These applications range from therapeutic uses to biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is needed for the protection and wellbeing of humans and animals. However, the small molecular weights of these targets, including the drastic size difference between the target and the oligonucleotides, make it challenging to select, characterize, and apply aptamers for their detection. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed. PMID:27242994

  1. Small molecules that target phosphorylation dependent protein-protein interaction.

    PubMed

    Watanabe, Nobumoto; Osada, Hiroyuki

    2016-08-01

    Protein-protein interaction is one of the key events in the signal transduction pathway. The interaction changes the conformations, activities, localization and stabilities of the proteins, and transduces the signal to the next step. Frequently, this interaction occurs upon the protein phosphorylation. When upstream signals are stimulated, protein kinase(s) is/are activated and phosphorylate(s) their substrates, and induce the phosphorylation dependent protein-protein interaction. For this interaction, several domains in proteins are known to specifically recognize the phosphorylated residues of target proteins. These specific domains for interaction are important in the progression of the diseases caused by disordered signal transduction such as cancer. Thus small molecules that modulate this interaction are attractive lead compounds for the treatment of such diseases. In this review, we focused on three examples of phosphorylation dependent protein-protein interaction modules (14-3-3, polo box domain of Plk1 and F-box proteins in SCF ubiquitin ligases) and summarize small molecules that modulate their interaction. We also introduce our original screening system to identify such small molecules.

  2. Organic synthesis toward small-molecule probes and drugs

    PubMed Central

    Schreiber, Stuart L.

    2011-01-01

    “Organic synthesis” is a compound-creating activity often focused on biologically active small molecules. This special issue of PNAS explores innovations and trends in the field that are enabling the synthesis of new types of small-molecule probes and drugs. This perspective article frames the research described in the special issue but also explores how these modern capabilities can both foster a new and more extensive view of basic research in the academy and promote the linkage of life-science research to the discovery of novel types of small-molecule therapeutics [Schreiber SL (2009) Chem Bio Chem 10:26–29]. This new view of basic research aims to bridge the chasm between basic scientific discoveries in life sciences and new drugs that treat the root cause of human disease—recently referred to as the “valley of death” for drug discovery. This perspective article describes new roles that modern organic chemistry will need to play in overcoming this challenge. PMID:21464328

  3. Urea transporter proteins as targets for small-molecule diuretics

    PubMed Central

    Esteva-Font, Cristina; Anderson, Marc O.; Verkman, Alan S.

    2016-01-01

    Conventional diuretics such as furosemide and thiazides target salt transporters in kidney tubules, but urea transporters (UTs) have emerged as alternative targets. UTs are a family of transmembrane channels expressed in a variety of mammalian tissues, in particular the kidney. UT knockout mice and humans with UT mutations exhibit reduced maximal urinary osmolality, demonstrating that UTs are necessary for the concentration of urine. Small-molecule screening has identified potent and selective inhibitors of UT-A, the UT protein expressed in renal tubule epithelial cells, and UT-B, the UT protein expressed in vasa recta endothelial cells. Data from UT knockout mice and from rodents administered UT inhibitors support the diuretic action of UT inhibition. The kidney-specific expression of UT-A1, together with high selectivity of the small-molecule inhibitors, means that off-target effects of such small-molecule drugs should be minimal. This Review summarizes the structure, expression and function of UTs, and looks at the evidence supporting the validity of UTs as targets for the development of salt-sparing diuretics with a unique mechanism of action. UT-targeted inhibitors may be useful alone or in combination with conventional diuretics for therapy of various oedemas and hyponatraemias, potentially including those refractory to treatment with current diuretics. PMID:25488859

  4. Enhancing molecule fluorescence with asymmetrical plasmonic antennas.

    PubMed

    Lu, Guowei; Liu, Jie; Zhang, Tianyue; Shen, Hongming; Perriat, Pascal; Martini, Matteo; Tillement, Olivier; Gu, Ying; He, Yingbo; Wang, Yuwei; Gong, Qihuang

    2013-07-21

    We propose and justify by the finite-difference time-domain method an efficient strategy to enhance the spontaneous emission of a fluorophore with a multi-resonance plasmonic antenna. The custom-designed asymmetrical antenna consists of two plasmonic nanoparticles with different sizes and is able to couple efficiently to free space light through multiple localized surface plasmon resonances. This design simultaneously permits a large near-field excitation near the antenna as well as a high quantum efficiency, which results in an unusual and significant enhancement of the fluorescence of a single emitter. Such an asymmetrical antenna presents intrinsic advantages over single particle or dimer based antennas made using two identical nanostructures. This promising concept can be exploited in the large domain of light-matter interaction processes involving multiple frequencies.

  5. Enhanced Raman scattering of biological molecules

    NASA Astrophysics Data System (ADS)

    Montoya, Joseph R.

    The results presented in this thesis, originate from the aspiration to develop an identification algorithm for Salmonella enterica Serovar Enteritidis (S. enterica), Escherichia coli (E. coli), Bacillus globigii ( B. globigii), and Bacillus megaterium ( B. megaterium) using "enhanced" Raman scattering. We realized our goal, with a method utilizing an immunoassay process in a spectroscopic technique, and the direct use of the enhanced spectral response due to bacterial surface elements. The enhanced Raman signal originates from Surface Enhanced Raman Scattering (SERS) and/or Morphological Dependent Resonances (MDR's). We utilized a modified Lee-Meisel colloidal production method to produce a SERS active substrate, which was applied to a SERS application for the amino acid Glycine. The comparison indicates that the SERS/FRACTAL/MDR process can produce an increase of 107 times more signal than the bulk Raman signal from Glycine. In the extension of the Glycine results, we studied the use of SERS related to S. enterica, where we have shown that the aromatic amino acid contribution from Phenylalanine, Tyrosine, and Tryptophan produces a SERS response that can be used to identify the associated SERS vibrational modes of a S. enterica one or two antibody complexes. The "fingerprint" associated with the spectral signature in conjunction with an enhanced Raman signal allows conclusions to be made: (1) about the orientation of the secondary structure on the metal; (2) whether bound/unbound antibody can be neglected; (3) whether we can lower the detection limit. We have lowered the detection limit of S. enterica to 106 bacteria/ml. We also show a profound difference between S. enterica and E. coli SERS spectra even when there exists non-specific binding on E. coli indicating a protein conformation change induced by the addition of the antigen S. enterica. We confirm TEM imagery data, indicating that the source of the aromatic amino acid SERS response is originating from

  6. Effects of small halocarbon molecules on reverse osmosis membrane performance

    SciTech Connect

    Cheng, R.C.; Glater, J.; Neethling, J.B. )

    1990-01-01

    The reverse osmosis (RO) membrane industry has long been concerned with problems of performance decline due to fouling. Colloidal and biological fouling have been discussed to some extent in the literature but little is known about the effect of small organic molecules on membrane performance. The work reported in this paper involved controlled laboratory experiments with three small halocarbons and three different types of commercial RO membranes. The compounds used were CHCl{sub 3}, CHBr{sub 3} and CCl{sub 4}. The first two represent typical small and large THM's. Carbon tetrachloride was selected as a non-polar model compound. Membranes representing three different polymer systems were provided by E. I. du Pont Inc.

  7. Saccharide sensing molecules having enhanced fluorescent properties

    DOEpatents

    Satcher Jr., Joe H.; Lane, Stephen M.; Darrow, Christopher B.; Cary, Douglas R.; Tran, Joe Anh

    2004-01-06

    The present invention provides formulae for fluorescent compounds that have a number of properties which make them uniquely suited for use in sensors of analytes such as saccharides. The advantageous fluorescent properties include favorable excitation wavelengths, emission wavelengths, fluorescence lifetimes, and photostability. Additional advantageous properties include enhanced aqueous solubility, as well as temperature and pH sensitivity. The compound comprises an aryl or a substituted phenyl botonic acid that acts as a substrate recognition component, a fluorescence switch component, and a fluorophore. Fluorescent compounds are described that are excited at wavelengths greater than 400 nm and emit at wavelengths greater than 450 nm, which is advantageous for optical transmission through skin. The fluorophore is typically selected from transition metal-ligand complexes and thiazine, oxazine, oxazone, or oxazine-one as well as anthracene compounds. The fluorescent compound can be immobilized in a glucose permeable biocompatible polymer matrix that is implantable below the skin.

  8. Translocation of Small Interfering RNA and Cholesterol Molecules in Biomembranes

    NASA Astrophysics Data System (ADS)

    Kalia, Rajiv

    2013-03-01

    This presentation will focus on all-atom molecular dynamics (MD) simulation studies of (1) structural and mechanical barriers to translocation of small interfering RNA (siRNA) across a phospholipid bilayer, and (2) flip-flop dynamics of cholesterol (CHOL) molecules across a phospholipid bilayer. In the first case, we find that the siRNA induces a liquid-to-gel phase transformation. In the gel phase we find large compressive lateral stresses in the hydrocarbon chains of lipid molecules, which present a considerable barrier to siRNA passage across the bilayer. In the second case, we study spontaneous CHOL inter-leaflet transport (flip-flop), the effect of this process on mechanical stresses across the bilayer, and the role of CHOL in inducing molecular order in bilayer leaflets. The simulation was run for 15 microseconds and we found 24 CHOL flip-flop events over that duration. On average, a CHOL molecule migrates across the lipid bilayer in about 73 ns after a flip-flop event is triggered. We have calculated diffusion maps and determined free energy surfaces and flip-flop mechanisms for CHOL molecules. Work supported by NSF-OCI-0749360 and NSF-IOS-125317.

  9. A new class of pluripotent stem cell cytotoxic small molecules.

    PubMed

    Richards, Mark; Phoon, Chee Wee; Goh, Gwendoline Tze Wei; Seng, Eng Khuan; Guo, Xu Ming; Tan, Cherine Mei Fong; Chan, Woon-Khiong; Lee, Joel Mun Kin

    2014-01-01

    A major concern in Pluripotent Stem Cell (PSC)-derived cell replacement therapy is the risk of teratoma formation from contaminating undifferentiated cells. Removal of undifferentiated cells from differentiated cultures is an essential step before PSC-based cell therapies can be safely deployed in a clinical setting. We report a group of novel small molecules that are cytotoxic to PSCs. Our data indicates that these molecules are specific and potent in their activity allowing rapid eradication of undifferentiated cells. Experiments utilizing mixed PSC and primary human neuronal and cardiomyocyte cultures demonstrate that up to a 6-fold enrichment for specialized cells can be obtained without adversely affecting cell viability and function. Several structural variants were synthesized to identify key functional groups and to improve specificity and efficacy. Comparative microarray analysis and ensuing RNA knockdown studies revealed involvement of the PERK/ATF4/DDIT3 ER stress pathway. Surprisingly, cell death following ER stress induction was associated with a concomitant decrease in endogenous ROS levels in PSCs. Undifferentiated cells treated with these molecules preceding transplantation fail to form teratomas in SCID mice. Furthermore, these molecules remain non-toxic and non-teratogenic to zebrafish embryos suggesting that they may be safely used in vivo. PMID:24647085

  10. Composite microsphere-functionalized scaffold for the controlled release of small molecules in tissue engineering

    PubMed Central

    Pandolfi, Laura; Minardi, Silvia; Taraballi, Francesca; Liu, Xeuwu; Ferrari, Mauro; Tasciotti, Ennio

    2016-01-01

    Current tissue engineering strategies focus on restoring damaged tissue architectures using biologically active scaffolds. The ideal scaffold would mimic the extracellular matrix of any tissue of interest, promoting cell proliferation and de novo extracellular matrix deposition. A plethora of techniques have been evaluated to engineer scaffolds for the controlled and targeted release of bioactive molecules to provide a functional structure for tissue growth and remodeling, as well as enhance recruitment and proliferation of autologous cells within the implant. Recently, novel approaches using small molecules, instead of growth factors, have been exploited to regulate tissue regeneration. The use of small synthetic molecules could be very advantageous because of their stability, tunability, and low cost. Herein, we propose a chitosan–gelatin scaffold functionalized with composite microspheres consisting of mesoporous silicon microparticles and poly(dl-lactic-co-glycolic acid) for the controlled release of sphingosine-1-phospate, a small molecule of interest. We characterized the platform with scanning electron microscopy, Fourier transform infrared spectroscopy, and confocal microscopy. Finally, the biocompatibility of this multiscale system was analyzed by culturing human mesenchymal stem cells onto the scaffold. The presented strategy establishes the basis of a versatile scaffold for the controlled release of small molecules and for culturing mesenchymal stem cells for regenerative medicine applications. PMID:26977286

  11. Demonstration of sub-femtomole sensitivity for small molecules with microsphere ring resonator sensors

    NASA Astrophysics Data System (ADS)

    White, Ian M.; Oveys, Hesam; Fan, Xudong

    2006-02-01

    Optical microsphere resonators can function as highly sensitive bio/chemical sensors due to the large Q-factor, which leads to high light-matter interaction. The whispering gallery modes (WGM) arise at the surface of the microsphere, creating a highly enhanced optical field that interacts with matter on or near the microsphere surface. As a result, the spectral position of the WGM is extremely sensitive to refractive index changes near the surface, such as when bio/chemical molecules bind to the sphere. We show the potential feasibility of a microsphere ring resonator as a sensor for small molecules by demonstrating detection of sub-femtomole changes in SiO II molecules at the surface of the microsphere. In this experiment, the silica molecules act as an excellent model for small molecule analytes because of their 60 Dalton molecular weight, and because we know nearly the exact quantity of molecules at the surface, which enables a sensitivity characterization. We measure the spectral shifts in the WGMs when low concentrations of hydrofluoric acid (HF) are added to a solution that is being probed by the microsphere. As the HF molecules break apart the SiO II molecules at the sphere surface, the WGMs shift due to the sub-nano-scale decrease in the size of the microsphere. These calculations show that the sensitivity of this microsphere resonator is on the order of 500 attomoles. Our results will lead to the utilization of optical microspheres for detection of trace quantities of small molecules for such applications as drug discovery, environmental monitoring, and enzyme detection using peptide cleavage.

  12. The Dynamics of Dissociative Electron Attachment to Small Polyatomic Molecules

    NASA Astrophysics Data System (ADS)

    Rescigno, Thomas

    2013-09-01

    Dissociative electron attachment (DEA) is a resonant process in which an electron attaches to a molecule to form an unstable anion which subsequently fragments into stable products. DEA to small polyatomic molecules is often governed by complex electronic and nuclear dynamics that is intrinsically multi-dimensional. One-dimensional treatments of the dissociation dynamics based on resonance scattering theory, while often successful in modeling the energy dependence of total cross sections, can mask the complexity of post-attachment dynamics which is revealed by the observed angular dependence of the reaction products. The dissociation evolves on transient anion potential energy surfaces and often involves conical intersections which can result in a complete breakdown of the axial recoil approximation. I will use the examples of DEA to water, carbon dioxide and methanol to illustrate the discussion. Work performed under auspices of USDOE by LBNL under contract DE-AC02-05CH11231 and supported by OBES, Division of Chemical Sciences.

  13. Controlling conformations of conjugated polymers and small molecules: the role of nonbonding interactions.

    PubMed

    Jackson, Nicholas E; Savoie, Brett M; Kohlstedt, Kevin L; Olvera de la Cruz, Monica; Schatz, George C; Chen, Lin X; Ratner, Mark A

    2013-07-17

    The chemical variety present in the organic electronics literature has motivated us to investigate potential nonbonding interactions often incorporated into conformational "locking" schemes. We examine a variety of potential interactions, including oxygen-sulfur, nitrogen-sulfur, and fluorine-sulfur, using accurate quantum-chemical wave function methods and noncovalent interaction (NCI) analysis on a selection of high-performing conjugated polymers and small molecules found in the literature. In addition, we evaluate a set of nonbonding interactions occurring between various heterocyclic and pendant atoms taken from a group of representative π-conjugated molecules. Together with our survey and set of interactions, it is determined that while many nonbonding interactions possess weak binding capabilities, nontraditional hydrogen-bonding interactions, oxygen-hydrogen (CH···O) and nitrogen-hydrogen (CH···N), are alone in inducing conformational control and enhanced planarity along a polymer or small molecule backbone at room temperature.

  14. An autonomous chemically fuelled small-molecule motor

    NASA Astrophysics Data System (ADS)

    Wilson, Miriam R.; Solà, Jordi; Carlone, Armando; Goldup, Stephen M.; Lebrasseur, Nathalie; Leigh, David A.

    2016-06-01

    Molecular machines are among the most complex of all functional molecules and lie at the heart of nearly every biological process. A number of synthetic small-molecule machines have been developed, including molecular muscles, synthesizers, pumps, walkers, transporters and light-driven and electrically driven rotary motors. However, although biological molecular motors are powered by chemical gradients or the hydrolysis of adenosine triphosphate (ATP), so far there are no synthetic small-molecule motors that can operate autonomously using chemical energy (that is, the components move with net directionality as long as a chemical fuel is present). Here we describe a system in which a small molecular ring (macrocycle) is continuously transported directionally around a cyclic molecular track when powered by irreversible reactions of a chemical fuel, 9-fluorenylmethoxycarbonyl chloride. Key to the design is that the rate of reaction of this fuel with reactive sites on the cyclic track is faster when the macrocycle is far from the reactive site than when it is near to it. We find that a bulky pyridine-based catalyst promotes carbonate-forming reactions that ratchet the displacement of the macrocycle away from the reactive sites on the track. Under reaction conditions where both attachment and cleavage of the 9-fluorenylmethoxycarbonyl groups occur through different processes, and the cleavage reaction occurs at a rate independent of macrocycle location, net directional rotation of the molecular motor continues for as long as unreacted fuel remains. We anticipate that autonomous chemically fuelled molecular motors will find application as engines in molecular nanotechnology.

  15. Biophysical screening for the discovery of small-molecule ligands.

    PubMed

    Ciulli, Alessio

    2013-01-01

    Discovering small-molecule chemical probes of protein function has great potential to elucidate biological pathways and to provide early-stage proof-of-concept for target validation. Discovery of such probes therefore underpins many of the chemical biology and drug discovery efforts in both academia and the pharmaceutical industry. The process generally begins with screening small molecules to identify bona fide "hits" that bind non-covalently to a target protein. This chapter is concerned with the application of biophysical and structural techniques to small-molecule ligand screening, and with the validation of hits from both structural (binding mode) and energetic (binding affinity) stand-points. The methods discussed include differential scanning fluorimetry (thermal shift), fluorescence polarization (FP), surface plasmon resonance, ligand-observed NMR spectroscopy, isothermal titration calorimetry, and protein X-ray crystallography. The principles of these techniques and the fundamental nature of the observables used to detect macromolecule-ligand binding are briefly outlined. The practicalities, advantages, and disadvantages of each technique are described, particularly in the context of detecting weak affinities, as relevant to fragment screening. Fluorescence-based methods, which offer an attractive combination of high throughput and low cost are discussed in detail. It is argued that applying a combination of different methods provides the most robust and effective way to identify high-quality starting points for follow-up medicinal chemistry and to build structure-activity relationships that better inform effective development of high-quality, cell-active chemical probes by structure-based drug design.

  16. Development of Small-Molecule Antivirals for Ebola.

    PubMed

    Janeba, Zlatko

    2015-11-01

    Ebola hemorrhagic fever is a deadly disease caused by infection with one of the Ebola virus species. Although a significant progress has recently been made in understanding of Ebola virus biology and pathogenesis, development of effective anti-Ebola treatments has not been very productive, compared to other areas of antiviral research (e.g., HIV and HCV infections). No approved vaccine or medicine is available for Ebola but several are currently under development. This review summarises attempts in identification, evaluation, and development of small-molecule candidates for treatment of Ebola viral disease, including the most promising experimental drugs brincidofovir (CMX001), BCX4430, and favipiravir (T-705).

  17. A new small molecule inhibitor of soluble guanylate cyclase

    PubMed Central

    Mota, Filipa; Gane, Paul; Hampden-Smith, Kathryn; Allerston, Charles K.; Garthwaite, John; Selwood, David L.

    2015-01-01

    Soluble guanylate cyclase (sGC) is a haem containing enzyme that regulates cardiovascular homeostasis and multiple mechanisms in the central and peripheral nervous system. Commonly used inhibitors of sGC activity act through oxidation of the haem moiety, however they also bind haemoglobin and this limits their bioavailability for in vivo studies. We have discovered a new class of small molecule inhibitors of sGC and have characterised a compound designated D12 (compound 10) which binds to the catalytic domain of the enzyme with a KD of 11 μM in a SPR assay. PMID:26264842

  18. Spectroscopic and dynamical studies of highly energized small polyatomic molecules

    SciTech Connect

    Field, R.W.; Silbey, R.J.

    1993-12-01

    The authors have initiated a program to perform spectroscopic and dynamic studies of small molecules. Large amplitude motions in excited acetylene were discussed along with plans to record the dispersed fluorescence (DF) and the stimulated emission pumping (SEP) spectra. SEP spectra were reported for the formyl radical. A Fourier transform spectrometer was discussed with respect to its ability to probe the structure of radicals. This instrument is capable of performing studies using various techniques such as magnetic rotation spectroscopy and sub-Doppler sideband-OODR Zeman (SOODRZ) spectroscopy.

  19. Discovery of small molecule antagonists of TRPV1.

    PubMed

    Rami, Harshad K; Thompson, Mervyn; Wyman, Paul; Jerman, Jeffrey C; Egerton, Julie; Brough, Stephen; Stevens, Alexander J; Randall, Andrew D; Smart, Darren; Gunthorpe, Martin J; Davis, John B

    2004-07-16

    Small molecule antagonists of the vanilloid receptor 1 (TRPV1, also known as VR1) are disclosed. Ureas such as 5 (SB-452533) were used to explore the structure activity relationship with several potent analogues identified. Pharmacological studies using electrophysiological and FLIPR Ca(2+) based assays showed compound 5 was an antagonist versus capsaicin, noxious heat and acid mediated activation of TRPV1. Study of a quaternary salt of 5 supports a mode of action in which compounds from this series cause inhibition via an extracellularly accessible binding site on the TRPV1 receptor. PMID:15203132

  20. Single dish gradient screening of small molecule localization.

    PubMed

    Beuzer, Paolo; Axelrod, Joshua; Trzoss, Lynnie; Fenical, Willam; Dasari, Ramesh; Evidente, Antonio; Kornienko, Alexander; Cang, Hu; La Clair, James J

    2016-09-21

    Understanding trafficking in cells and tissues is one of the most critical steps in exploring the mechanisms and modes of action (MOAs) of a small molecule. Typically, deciphering the role of concentration presents one of the most difficult challenges associated with this task. Herein, we present a practical solution to this problem by developing concentration gradients within single dishes of cells. We demonstrate the method by evaluating fluorescently-labelled probes developed from two classes of natural products that have been identified as potential anti-cancer leads by STORM super-resolution microscopy. PMID:27530345

  1. Anti-Ebola Activity of Diazachrysene Small Molecules.

    PubMed

    Selaković, Života; Soloveva, Veronica; Gharaibeh, Dima N; Wells, Jay; Šegan, Sandra; Panchal, Rekha G; Šolaja, Bogdan A

    2015-06-12

    Herein we report on a diazachrysene class of small molecules that exhibit potent antiviral activity against the Ebola (EBOV) virus. The antiviral compounds are easily synthesized, and the most active compounds have excellent in vitro activity (0.34-0.70 μM) and are significantly less lipophilic than their predecessors. The three most potent diazachrysene antivirals do not exhibit any toxicity in vivo and protected 70-90% of the mice at 10 mg/kg following EBOV challenge. Together, these studies suggest that diazachrysenes are a promising class of compounds for hit to lead optimization and as potential Ebola therapeutics. PMID:27622742

  2. Computer Simulations of Small Molecules in Membranes: Insights from Computer Simulations into the Interactions of Small Molecules with Lipid Bilayers

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew; New, Michael H.; Schweighofer, Karl; Wilson, Michael A.; DeVincenzi, Donald L. (Technical Monitor)

    2000-01-01

    Two of Ernest Overton's lasting contributions to biology are the Meyer-Overton relationship between the potency of an anesthetic and its solubility in oil, and the Overton rule which relates the permeability of a membrane to the oil-water partition coefficient of the permeating molecule. A growing body of experimental evidence, however, cannot be reconciled with these theories. In particular, the molecular nature of membranes, unknown to Overton, needs to be included in any description of these phenomena. Computer simulations are ideally suited for providing atomic-level information about the behavior of small molecules in membranes. The authors discuss simulation studies relevant to Overton's ideas. Through simulations it was found that anesthetics tend to concentrate at interfaces and their anesthetic potency correlates better with solubility at the water-membrane interface than with solubility in oil. Simulation studies of membrane permeation revealed the anisotropic nature of the membranes, as evidenced, for example, by the highly nonuniform distribution of free volume in the bilayer. This, in turn, influences the diffusion rates of solutes, which increase with the depth in the membrane. Small solutes tend to move by hopping between voids in the bilayer, and this hopping motion may be responsible for the deviation from the Overton rule of the permeation rates of these molecules.

  3. Engineered Protein Polymer-Gold Nanoparticle Hybrid Materials for Small Molecule Delivery

    PubMed Central

    Dai, Min; Frezzo, JA; Sharma, E; Chen, R; Singh, N; Yuvienco, C; Caglar, E; Xiao, S; Saxena, A; Montclare, JK

    2016-01-01

    We have fabricated protein polymer-gold nanoparticle (P-GNP) nanocomposites that exhibit enhanced binding and delivery properties of the small hydrophobic molecule drug, curcumin, to the model breast cancer cell line, MCF-7. These hybrid biomaterials are constructed via in situ GNP templated-synthesis with genetically engineered histidine tags. The P-GNP nanocomposites exhibit enhanced small molecule loading, sustained release and increased uptake by MCF-7 cells. When compared to the proteins polymers alone, the P-GNPs demonstrate a greater than 7-fold increase in curcumin binding, a nearly 50% slower release profile and more than 2-fold increase in cellular uptake of curcumin. These results suggest that P-GNP nanocomposites serve as promising candidates for drug delivery vehicles. PMID:27081576

  4. A "roller-wheel" Pt-containing small molecule that outperforms its polymer analogs in organic solar cells

    DOE PAGES

    He, Wenhan; Wu, Qin; Livshits, Maksim Y.; Dickie, Diane A.; Yang, Jianzhong; Quinnett, Rachel; Rack, Jeffrey R.; Qin, Yang

    2016-05-23

    A novel Pt-bisacetylide small molecule (Pt-SM) featuring “roller-wheel” geometry was synthesized and characterized. When compared with conventional Pt-containing polymers and small molecules having “dumbbell” shaped structures, Pt-SM displays enhanced crystallinity and intermolecular π–π interactions, as well as favorable panchromatic absorption behaviors. Furthermore, organic solar cells (OSCs) employing Pt-SM achieve power conversion efficiencies (PCEs) up to 5.9%, the highest reported so far for Pt-containing polymers and small molecules.

  5. Enhancement of Ultracold Molecule Formation Using Shaped Nanosecond Frequency Chirps

    NASA Astrophysics Data System (ADS)

    Carini, J. L.; Kallush, S.; Kosloff, R.; Gould, P. L.

    2015-10-01

    We demonstrate that judicious shaping of a nanosecond-time-scale frequency chirp can dramatically enhance the formation rate of ultracold 87Rb2 molecules. Starting with ultracold Rb 87 atoms, we apply pulses of frequency-chirped light to first photoassociate the atoms into excited molecules and then, later in the chirp, deexcite these molecules into a high vibrational level of the lowest triplet state a Σ3 u + . The enhancing chirp shape passes through the absorption and stimulated emission transitions relatively slowly, thus increasing their adiabaticity, but jumps quickly between them to minimize the effects of spontaneous emission. Comparisons with quantum simulations for various chirp shapes support this enhancement mechanism.

  6. Enhancement of Ultracold Molecule Formation Using Shaped Nanosecond Frequency Chirps

    NASA Astrophysics Data System (ADS)

    Carini, Jennifer; Kallush, Shimshon; Kosloff, Ronnie; Gould, Phillip

    2016-05-01

    We demonstrate that judicious shaping of a nanosecond-time-scale frequency chirp can dramatically enhance the formation rate of ultracold molecules. Starting with ultracold 87 Rb atoms, we apply pulses of frequency-chirped light to first photoassociate the atoms into excited molecules and then, later in the chirp, de-excite these molecules into a high vibrational level of the lowest triplet state. The enhancing chirp shape passes through the absorption and stimulated emission transitions relatively slowly, thus increasing their adiabaticity, but jumps quickly between them to minimize the effects of spontaneous emission. Comparisons with quantum simulations for various chirp shapes support this enhancement mechanism. Schemes for further improvements of the formation rate will also be presented. This work is supported by DOE and BSF.

  7. A general strategy to construct small molecule biosensors in eukaryotes

    PubMed Central

    Feng, Justin; Jester, Benjamin W; Tinberg, Christine E; Mandell, Daniel J; Antunes, Mauricio S; Chari, Raj; Morey, Kevin J; Rios, Xavier; Medford, June I; Church, George M; Fields, Stanley; Baker, David

    2015-01-01

    Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activates transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.10606.001 PMID:26714111

  8. Mechanism of cellular response to nanoscale aggregates of small molecules

    NASA Astrophysics Data System (ADS)

    Kuang, Yi

    This dissertation research focused on the illustration of the molecular mechanism of cellular response to nanoscale aggregates formed by small molecules. There are five chapters in this dissertation. Chapter 1 summarizes the current research on the evaluation of cell response (i.e., biocompatibility/cytotoxicity) to small molecular hydrogelators. Chapter 2 describes an interesting phenomenon that supramolecular hydrogelators consisting of N-terminated dipeptides, which exhibit selective inhibitory effects against cancer cells. This study calls for the development of a new approach for identification of protein targets of the hydrogelators. Chapter 3 describes the evaluation of interactions between cytosol proteins of a mammalian cell line and morphologically different nanoscale molecular aggregates formed by small peptidic molecules. Chapter 4 describes the research on the mechanism of a type of molecular aggregates, which cluster short microtubules to prevent the growth of microtubule. This unprecedented mechanism of "self-assembly to interfere with self-organization " contributes to inhibiting growth of cancer cells in several mammalian cell based assays and a xenograft tumor mice model. At the end, Chapter 5 reports a novel supramolecular hydrogelator, which consists of fluorene and the pentapeptide epitope (TIGYG) of potassium ion (K+) channels, to self-assemble in water to form the tunable, hierarchical nanostructures dictated by the concentration of K+. In conclusion, this dissertation research demonstrates a new approach for investigating cellular target and molecular mechanism of self-assembled aggregates formed by small peptide derivatives based hydrogelators, which will make contribution to the development of supramolecular hydrogelators as biomaterials. Moreover, the differential cytotoxicity of molecular aggregates illustrated in this research promises a new direction for developing anti-cancer drug based on interactions between molecular aggregates and

  9. Rational design of small molecules as vaccine adjuvants.

    PubMed

    Wu, Tom Y-H; Singh, Manmohan; Miller, Andrew T; De Gregorio, Ennio; Doro, Francesco; D'Oro, Ugo; Skibinski, David A G; Mbow, M Lamine; Bufali, Simone; Herman, Ann E; Cortez, Alex; Li, Yongkai; Nayak, Bishnu P; Tritto, Elaine; Filippi, Christophe M; Otten, Gillis R; Brito, Luis A; Monaci, Elisabetta; Li, Chun; Aprea, Susanna; Valentini, Sara; Calabrό, Samuele; Laera, Donatello; Brunelli, Brunella; Caproni, Elena; Malyala, Padma; Panchal, Rekha G; Warren, Travis K; Bavari, Sina; O'Hagan, Derek T; Cooke, Michael P; Valiante, Nicholas M

    2014-11-19

    Adjuvants increase vaccine potency largely by activating innate immunity and promoting inflammation. Limiting the side effects of this inflammation is a major hurdle for adjuvant use in vaccines for humans. It has been difficult to improve on adjuvant safety because of a poor understanding of adjuvant mechanism and the empirical nature of adjuvant discovery and development historically. We describe new principles for the rational optimization of small-molecule immune potentiators (SMIPs) targeting Toll-like receptor 7 as adjuvants with a predicted increase in their therapeutic indices. Unlike traditional drugs, SMIP-based adjuvants need to have limited bioavailability and remain localized for optimal efficacy. These features also lead to temporally and spatially restricted inflammation that should decrease side effects. Through medicinal and formulation chemistry and extensive immunopharmacology, we show that in vivo potency can be increased with little to no systemic exposure, localized innate immune activation and short in vivo residence times of SMIP-based adjuvants. This work provides a systematic and generalizable approach to engineering small molecules for use as vaccine adjuvants.

  10. Moving atoms and small molecules out of open containers.

    PubMed

    McKee, Michael L

    2013-03-21

    Density functional theory with the M05-2X exchange/correlation functional is used to study the barriers for expulsion of atoms and small molecules (N2, CO, H2, Ar, Kr, Xe, H2O) out of open fullerenes (I20) and related molecular containers (C40H20, [5]beltene, cucurbit[5]uril). The reactions are examples where dispersion plays a critical role in determining the barrier heights. Calculations are compared with experimental kinetic data for N2@I20, CO@I20, and Xe@cucurbit[5]uril (Xe@CB[5]). Comparing the four molecular containers, the activation barriers for escape of an atom or small molecule correlate with the binding energies. A new open-fullerene model container C40H20 (C40) was constructed from C60 with a constriction at both ends formed by five methylene groups around the rim. The activation barriers for escape of N2 and CO from the model container are similar to those from the I20 open-cage fullerene. In the case of H2O@C40, charge analysis reveals an interesting charge transfer at the transition state as the escaping guest is "squeezed" out of the host container.

  11. Small molecules reveal an alternative mechanism of Bax activation

    PubMed Central

    Brahmbhatt, Hetal; Uehling, David; Al-awar, Rima; Leber, Brian; Andrews, David

    2016-01-01

    The pro-apoptotic protein Bax commits a cell to death by permeabilizing the mitochondrial outer membrane (MOM). To obtain small-molecule probes for elucidating the molecular mechanism(s) of Bax activation, we screened for compounds that induced Bax-mediated liposome permeabilization. We identified five structurally different small molecules that promoted both Bax targeting to and oligomerization at membranes. All five compounds initiated Bax oligomerization in the absence of membranes by a mechanism unlike Bax activation by Bcl-2 homology 3 domain (BH3) proteins. Some of the compounds induced Bax/Bak-dependent apoptosis in cells. Activation of Bax by the most active compound was poorly inhibited by the anti-apoptotic protein Bcl-XL and requires a cysteine residue at position 126 of Bax that is not required for activation by BH3 proteins. Our results reveal a novel pathway for Bax activation independent of pro-apoptotic BH3 proteins that may have important implications for the regulation of Bax activity in cells. PMID:26916338

  12. Reprogramming the assembly of unmodified DNA with a small molecule.

    PubMed

    Avakyan, Nicole; Greschner, Andrea A; Aldaye, Faisal; Serpell, Christopher J; Toader, Violeta; Petitjean, Anne; Sleiman, Hanadi F

    2016-04-01

    The ability of DNA to store and encode information arises from base pairing of the four-letter nucleobase code to form a double helix. Expanding this DNA 'alphabet' by synthetic incorporation of new bases can introduce new functionalities and enable the formation of novel nucleic acid structures. However, reprogramming the self-assembly of existing nucleobases presents an alternative route to expand the structural space and functionality of nucleic acids. Here we report the discovery that a small molecule, cyanuric acid, with three thymine-like faces, reprogrammes the assembly of unmodified poly(adenine) (poly(A)) into stable, long and abundant fibres with a unique internal structure. Poly(A) DNA, RNA and peptide nucleic acid (PNA) all form these assemblies. Our studies are consistent with the association of adenine and cyanuric acid units into a hexameric rosette, which brings together poly(A) triplexes with a subsequent cooperative polymerization. Fundamentally, this study shows that small hydrogen-bonding molecules can be used to induce the assembly of nucleic acids in water, which leads to new structures from inexpensive and readily available materials. PMID:27001733

  13. Reprogramming the assembly of unmodified DNA with a small molecule

    NASA Astrophysics Data System (ADS)

    Avakyan, Nicole; Greschner, Andrea A.; Aldaye, Faisal; Serpell, Christopher J.; Toader, Violeta; Petitjean, Anne; Sleiman, Hanadi F.

    2016-04-01

    The ability of DNA to store and encode information arises from base pairing of the four-letter nucleobase code to form a double helix. Expanding this DNA ‘alphabet’ by synthetic incorporation of new bases can introduce new functionalities and enable the formation of novel nucleic acid structures. However, reprogramming the self-assembly of existing nucleobases presents an alternative route to expand the structural space and functionality of nucleic acids. Here we report the discovery that a small molecule, cyanuric acid, with three thymine-like faces, reprogrammes the assembly of unmodified poly(adenine) (poly(A)) into stable, long and abundant fibres with a unique internal structure. Poly(A) DNA, RNA and peptide nucleic acid (PNA) all form these assemblies. Our studies are consistent with the association of adenine and cyanuric acid units into a hexameric rosette, which brings together poly(A) triplexes with a subsequent cooperative polymerization. Fundamentally, this study shows that small hydrogen-bonding molecules can be used to induce the assembly of nucleic acids in water, which leads to new structures from inexpensive and readily available materials.

  14. Orthopedic tissue regeneration: cells, scaffolds, and small molecules.

    PubMed

    Jeon, Ok Hee; Elisseeff, Jennifer

    2016-04-01

    Orthopedic tissue regeneration would benefit the aging population or patients with degenerative bone and cartilage diseases, especially osteoporosis and osteoarthritis. Despite progress in surgical and pharmacological interventions, new regenerative approaches are needed to meet the challenge of creating bone and articular cartilage tissues that are not only structurally sound but also functional, primarily to maintain mechanical integrity in their high load-bearing environments. In this review, we discuss new advances made in exploiting the three classes of materials in bone and cartilage regenerative medicine--cells, biomaterial-based scaffolds, and small molecules--and their successes and challenges reported in the clinic. In particular, the focus will be on the development of tissue-engineered bone and cartilage ex vivo by combining stem cells with biomaterials, providing appropriate structural, compositional, and mechanical cues to restore damaged tissue function. In addition, using small molecules to locally promote regeneration will be discussed, with potential approaches that combine bone and cartilage targeted therapeutics for the orthopedic-related disease, especially osteoporosis and osteoarthritis.

  15. Discovery and Development of Small Molecule SHIP Phosphatase Modulators

    PubMed Central

    Viernes, Dennis R.; Choi, Lydia B.

    2016-01-01

    Inositol phospholipids play an important role in the transfer of signaling information across the cell membrane in eukaryotes. These signals are often governed by the phosphorylation patterns on the inositols, which are mediated by a number of inositol kinases and phosphatases. The src homology 2 (SH2) – containing inositol 5-phosphatase (SHIP) plays a central role in these processes, influencing signals delivered through the PI3K/Akt/mTOR pathway. SHIP modulation by small molecules has been implicated as a treatment in a number of human disease states, including cancer, inflammatory diseases, diabetes, atherosclerosis, and Alzheimer's disease. In addition, alteration of SHIP phosphatase activity may provide a means to facilitate bone marrow transplantation and increase blood cell production. This review discusses the cellular signaling pathways and protein-protein interactions that provide the molecular basis for targeting the SHIP enzyme in these disease states. In addition, a comprehensive survey of small molecule modulators of SHIP1 and SHIP2 is provided, with a focus on the structure, potency, selectivity and solubility properties of these compounds. PMID:24302498

  16. Stability of lyophilized human platelets loaded with small molecule carbohydrates.

    PubMed

    Wang, J X; Yang, C; Wan, W; Liu, M X; Ren, S P; Quan, G B; Han, Y

    2011-01-01

    Long-term preservation of platelets is a great challenge for blood transfusion centers, due to the required narrow storage temperature arange (22 ± 2 degree C). Short shelf life and potential bacterial growth often lead to the shortage of high-quality platelets. Freeze-dried preservation is thus believed to be a potential solution for long-term platelet storage without losing the hemostasis function. Here we report a new platelet preservation method, which uses small molecule carbohydrates to extend storage time and to maintain platelet function. The activities of lyophilized platelets that were stabilized with small molecule carbohydrate (e.g., cell viability, mean platelet volume, activation characteristics, and aggregation kinetics) were maintained after storage of 30, 60, and 90 days at room temperature, 4 degree C, and -20 degree C. The recovery of freeze-dried platelets was 87 percent in comparison to fresh platelets. The mean platelet volume of rehydrated platelets increased (from 6.8 fl to 8.0 fl). About 40 percent of rehydrated platelets was in the early-activated stage (PCA-1 positive) and 30 percent was in the terminal-activated stage (CD62P positive). The cell viability was about 60 percent as measured with CMFDA vital probes. The aggregation rate of rehydrated platelets after 90-day storage was similar to fresh platelets stored at 22 degree C ± 2 degree C.

  17. Structural basis of AMPK regulation by small molecule activators

    NASA Astrophysics Data System (ADS)

    Xiao, Bing; Sanders, Matthew J.; Carmena, David; Bright, Nicola J.; Haire, Lesley F.; Underwood, Elizabeth; Patel, Bhakti R.; Heath, Richard B.; Walker, Philip A.; Hallen, Stefan; Giordanetto, Fabrizio; Martin, Stephen R.; Carling, David; Gamblin, Steven J.

    2013-12-01

    AMP-activated protein kinase (AMPK) plays a major role in regulating cellular energy balance by sensing and responding to increases in AMP/ADP concentration relative to ATP. Binding of AMP causes allosteric activation of the enzyme and binding of either AMP or ADP promotes and maintains the phosphorylation of threonine 172 within the activation loop of the kinase. AMPK has attracted widespread interest as a potential therapeutic target for metabolic diseases including type 2 diabetes and, more recently, cancer. A number of direct AMPK activators have been reported as having beneficial effects in treating metabolic diseases, but there has been no structural basis for activator binding to AMPK. Here we present the crystal structure of human AMPK in complex with a small molecule activator that binds at a site between the kinase domain and the carbohydrate-binding module, stabilising the interaction between these two components. The nature of the activator-binding pocket suggests the involvement of an additional, as yet unidentified, metabolite in the physiological regulation of AMPK. Importantly, the structure offers new opportunities for the design of small molecule activators of AMPK for treatment of metabolic disorders.

  18. Unique small molecule entry inhibitors of hemorrhagic fever arenaviruses.

    PubMed

    Lee, Andrew M; Rojek, Jillian M; Spiropoulou, Christina F; Gundersen, Anette T; Jin, Wei; Shaginian, Alex; York, Joanne; Nunberg, Jack H; Boger, Dale L; Oldstone, Michael B A; Kunz, Stefan

    2008-07-01

    Viral hemorrhagic fevers caused by the arenaviruses Lassa virus in Africa and Machupo, Guanarito, Junin, and Sabia virus in South America are among the most devastating emerging human diseases with fatality rates of 15-35% and a limited antiviral therapeutic repertoire available. Here we used high throughput screening of synthetic combinatorial small molecule libraries to identify inhibitors of arenavirus infection using pseudotyped virion particles bearing the glycoproteins (GPs) of highly pathogenic arenaviruses. Our screening efforts resulted in the discovery of a series of novel small molecule inhibitors of viral entry that are highly active against both Old World and New World hemorrhagic arenaviruses. We observed potent inhibition of infection of human and primate cells with live hemorrhagic arenaviruses (IC(50)=500-800 nm). Investigations of the mechanism of action revealed that the candidate compounds efficiently block pH-dependent fusion by the arenavirus GPs (IC(50) of 200-350 nm). Although our lead compounds were potent against phylogenetically distant arenaviruses, they did not show activity against other enveloped viruses with class I viral fusion proteins, indicating specificity for arenavirus GP-mediated membrane fusion.

  19. Oral small molecule therapy for lysosomal storage diseases.

    PubMed

    Weinreb, Neal J

    2013-11-01

    For more than 20 years, "enzyme replacement therapy" (ERT) has been the prevalent treatment approach for lysosomal storage disorders (LSDs). Unfortunately, ERT, as currently administered, is ineffective for primary neuronopathic LSDs. For LSDs whose major disease burden is non-neurological, ERT efficacy is limited by uneven tissue distribution and penetration, immunological intolerance, and disturbed intracellular homeostasis associated with persistent mutant enzymes that are not "replaced" by ERT. Many of these limitations might be circumvented by oral, low molecular weight pharmaceuticals that address relevant LSD pathophysiology and distribute widely in steady state concentrations in all cells and body tissues including the CNS. Two oral small molecule drugs (miglustat and cysteamine) are currently approved for clinical use and two (eliglustat and migalastat) are in advanced stage clinical trials. Several others are in early stages of clinical or pre-clinical investigation. This article reviews current knowledge of small molecule treatment for LSDs including approaches such as substrate synthesis inhibition, pharmacological chaperones, and proteostasis modification. PMID:24380126

  20. Dielectric behavior of some small ketones as ideal polar molecules.

    PubMed

    Shikata, Toshiyuki; Yoshida, Nao

    2012-05-17

    The dielectric behaviors of some small symmetric ketone molecules, including acetone, 3-pentanone, cyclopentanone, 4-heptanone, and cyclohexanone, were investigated as a function of temperature (T) over a wide frequency range from 50 MHz (3.14 × 10(8) s(-1), in angular frequency) to 3 THz (1.88 × 10(13) s(-1)). The temperature dependencies of the rotational diffusion times (τ(r)) determined using (17)O NMR spin-lattice relaxation time (T(1)) measurements and viscosities of the ketones were also examined. The obtained temperature dependencies of the parameters for the ketones were compared with those of ideal polar molecules, which obey the Stokes-Einstein-Debye (SED) relationship without the formation of intermolecular dimeric associations and without orientational correlations between dipoles (molecular axes), that is, free rotation. Kirkwood correlation factors (g(K)) of only acetone and 3-pentanone were close to unity over a wide temperature range, whereas those of other ketones were obviously less than unity. These results revealed that no correlations exist between the rotational motions of dipoles in acetone and 3-pentanone, as expected in ideal polar molecules. However, other ketones exhibited orientational correlations in their dipoles because of dipole-dipole interactions via antiparallel configurations. Furthermore, because acetone and 3-pentanone satisfied the SED relationship and because their microscopic dielectric relaxation times (τ(μ)), which were calculated from the determined dielectric relaxation times (τ(D)) via the relationship τ(μ) = τ(D)g(K)(-1), were identical to 3τ(r) and were proportional to Vη(k(B)T)(-1) over the wide temperature range examined, where V, k(B), and η represent the effective molecular volume, Boltzmann's constant, and the viscosity of the liquid molecules, respectively, these two ketone molecules behave as ideal polar molecules. In addition, other ketones not significantly larger than acetone and 3-pentanone in

  1. Molecular overlap in the regulation of SK channels by small molecules and phosphoinositides

    PubMed Central

    Zhang, Miao; Meng, Xuan-Yu; Zhang, Ji-fang; Cui, Meng; Logothetis, Diomedes E.

    2015-01-01

    Phosphatidylinositol 4,5-bisphosphate (PIP2) directly interacts with the small-conductance Ca2+-activated K+ 2-a (SK2-a) channel/calmodulin complex, serving as a critical element in the regulation of channel activity. We report that changes of protein conformation in close proximity to the PIP2 binding site induced by a small-molecule SK channel modulator, NS309, can effectively enhance the interaction between the protein and PIP2 to potentiate channel activity. This novel modulation of PIP2 sensitivity by small-molecule drugs is likely not to be limited in its application to SK channels, representing an intriguing strategy to develop drugs controlling the activity of the large number of PIP2-dependent proteins. PMID:26366439

  2. Structure Based Discovery of Small Molecules to Regulate the Activity of Human Insulin Degrading Enzyme

    PubMed Central

    Çakir, Bilal; Dağliyan, Onur; Dağyildiz, Ezgi; Bariş, İbrahim; Kavakli, Ibrahim Halil; Kizilel, Seda; Türkay, Metin

    2012-01-01

    Background Insulin-degrading enzyme (IDE) is an allosteric Zn+2 metalloprotease involved in the degradation of many peptides including amyloid-β, and insulin that play key roles in Alzheimer's disease (AD) and type 2 diabetes mellitus (T2DM), respectively. Therefore, the use of therapeutic agents that regulate the activity of IDE would be a viable approach towards generating pharmaceutical treatments for these diseases. Crystal structure of IDE revealed that N-terminal has an exosite which is ∼30 Å away from the catalytic region and serves as a regulation site by orientation of the substrates of IDE to the catalytic site. It is possible to find small molecules that bind to the exosite of IDE and enhance its proteolytic activity towards different substrates. Methodology/Principal Findings In this study, we applied structure based drug design method combined with experimental methods to discover four novel molecules that enhance the activity of human IDE. The novel compounds, designated as D3, D4, D6, and D10 enhanced IDE mediated proteolysis of substrate V, insulin and amyloid-β, while enhanced degradation profiles were obtained towards substrate V and insulin in the presence of D10 only. Conclusion/Significance This paper describes the first examples of a computer-aided discovery of IDE regulators, showing that in vitro and in vivo activation of this important enzyme with small molecules is possible. PMID:22355395

  3. Optimized metal-organic-framework nanospheres for drug delivery: evaluation of small-molecule encapsulation.

    PubMed

    Zhuang, Jia; Kuo, Chun-Hong; Chou, Lien-Yang; Liu, De-Yu; Weerapana, Eranthie; Tsung, Chia-Kuang

    2014-03-25

    We have developed a general synthetic route to encapsulate small molecules in monodisperse zeolitic imid-azolate framework-8 (ZIF-8) nanospheres for drug delivery. Electron microscopy, powder X-ray diffraction, and elemental analysis show that the small-molecule-encapsulated ZIF-8 nanospheres are uniform 70 nm particles with single-crystalline structure. Several small molecules, including fluorescein and the anticancer drug camptothecin, were encapsulated inside of the ZIF-8 framework. Evaluation of fluorescein-encapsulated ZIF-8 nanospheres in the MCF-7 breast cancer cell line demonstrated cell internalization and minimal cytotoxicity. The 70 nm particle size facilitates cellular uptake, and the pH-responsive dissociation of the ZIF-8 framework likely results in endosomal release of the small-molecule cargo, thereby rendering the ZIF-8 scaffold an ideal drug delivery vehicle. To confirm this, we demonstrate that camptothecin encapsulated ZIF-8 particles show enhanced cell death, indicative of internalization and intracellular release of the drug. To demonstrate the versatility of this ZIF-8 system, iron oxide nanoparticles were also encapsulated into the ZIF-8 nanospheres, thereby endowing magnetic features to these nanospheres.

  4. OPLS3: A Force Field Providing Broad Coverage of Drug-like Small Molecules and Proteins.

    PubMed

    Harder, Edward; Damm, Wolfgang; Maple, Jon; Wu, Chuanjie; Reboul, Mark; Xiang, Jin Yu; Wang, Lingle; Lupyan, Dmitry; Dahlgren, Markus K; Knight, Jennifer L; Kaus, Joseph W; Cerutti, David S; Krilov, Goran; Jorgensen, William L; Abel, Robert; Friesner, Richard A

    2016-01-12

    The parametrization and validation of the OPLS3 force field for small molecules and proteins are reported. Enhancements with respect to the previous version (OPLS2.1) include the addition of off-atom charge sites to represent halogen bonding and aryl nitrogen lone pairs as well as a complete refit of peptide dihedral parameters to better model the native structure of proteins. To adequately cover medicinal chemical space, OPLS3 employs over an order of magnitude more reference data and associated parameter types relative to other commonly used small molecule force fields (e.g., MMFF and OPLS_2005). As a consequence, OPLS3 achieves a high level of accuracy across performance benchmarks that assess small molecule conformational propensities and solvation. The newly fitted peptide dihedrals lead to significant improvements in the representation of secondary structure elements in simulated peptides and native structure stability over a number of proteins. Together, the improvements made to both the small molecule and protein force field lead to a high level of accuracy in predicting protein-ligand binding measured over a wide range of targets and ligands (less than 1 kcal/mol RMS error) representing a 30% improvement over earlier variants of the OPLS force field. PMID:26584231

  5. OPLS3: A Force Field Providing Broad Coverage of Drug-like Small Molecules and Proteins.

    PubMed

    Harder, Edward; Damm, Wolfgang; Maple, Jon; Wu, Chuanjie; Reboul, Mark; Xiang, Jin Yu; Wang, Lingle; Lupyan, Dmitry; Dahlgren, Markus K; Knight, Jennifer L; Kaus, Joseph W; Cerutti, David S; Krilov, Goran; Jorgensen, William L; Abel, Robert; Friesner, Richard A

    2016-01-12

    The parametrization and validation of the OPLS3 force field for small molecules and proteins are reported. Enhancements with respect to the previous version (OPLS2.1) include the addition of off-atom charge sites to represent halogen bonding and aryl nitrogen lone pairs as well as a complete refit of peptide dihedral parameters to better model the native structure of proteins. To adequately cover medicinal chemical space, OPLS3 employs over an order of magnitude more reference data and associated parameter types relative to other commonly used small molecule force fields (e.g., MMFF and OPLS_2005). As a consequence, OPLS3 achieves a high level of accuracy across performance benchmarks that assess small molecule conformational propensities and solvation. The newly fitted peptide dihedrals lead to significant improvements in the representation of secondary structure elements in simulated peptides and native structure stability over a number of proteins. Together, the improvements made to both the small molecule and protein force field lead to a high level of accuracy in predicting protein-ligand binding measured over a wide range of targets and ligands (less than 1 kcal/mol RMS error) representing a 30% improvement over earlier variants of the OPLS force field.

  6. Mobility of Small Molecules and Polymer Chains in CO2-Swollen Polymer Matrices

    NASA Astrophysics Data System (ADS)

    Gupta, Ravi; Russell, Thomas; Watkins, James

    2003-03-01

    Compressible and supercritical fluids such as CO2 are gaining increasing importance as a medium for polymer synthesis and processing. For example, CO2 can be used to facilitate ordering in high molecular weight block copolymers for use in photonic applications that cannot be ordered by thermal means alone. In addition, infusion and condensation of metal alkoxides within CO2 - dilated copolymer templates offers an attractive route to mesoporous materials. To fully exploit CO2 as a processing medium, it is necessary to characterize mass transport in CO2-swollen polymers. We have studied the mobility of small molecules and polymer chains in CO2-swollen polymers in situ. Specifically, the mobility of small organic molecules including decacyclene and perylene were measured in a CO2 -swollen polystyrene matrix using high-pressure fluorescence NRET techniques. Polystyrene chain diffusivity was measured in CO2-swollen polystyrene using high-pressure neutron reflectivity. Both the studies were conducted in real time and reveal substantial enhancements in small molecule and chain mobility as the polystyrene matrix was swollen with moderate amounts of CO2 (5-12 wt%). The size and shape of the small molecule, polymer chain length, temperature and CO2 concentration in polystyrene films were each considered. The experimental data for all systems were modeled using the Vrentas-Duda free volume theory using a consistent set of parameters.

  7. Direct-reversible binding of small molecules to G protein βγ subunits

    PubMed Central

    Seneviratne, AMPB; Burroughs, Michael; Giralt, Ernest; Smrcka, Alan V.

    2011-01-01

    Heterotrimeric guanine nucleotide-binding proteins (G proteins) composed of three subunits α, β, γ mediate activation of multiple intracellular signaling cascades initiated by G protein-coupled receptors (GPCRs). Previously our laboratory identified small molecules that bind to Gβγ and interfere with or enhance binding of select effectors with Gβγ. To understand the molecular mechanisms of selectivity and assess binding of compounds to Gβγ, we used biophysical and biochemical approaches to directly monitor small molecule binding to Gβγ. Surface plasmon resonance (SPR) analysis indicated that multiple compounds bound directly to Gβγ with affinities in the high nanomolar to low micromolar range but with surprisingly slow on and off rate kinetics. While the koff was slow for most of the compounds in physiological buffers, they could be removed from Gβγ with mild chaotropic salts or mildly dissociating collision energy in a mass-spectrometer indicating that compound-Gβγ interactions were non-covalent. Finally, at concentrations used to observe maximal biological effects the stoichiometry of binding was 1:1. The results from this study show that small molecule modulation of Gβγ-effector interactions is by specific direct non-covalent and reversible binding of small molecules to Gβγ. This is highly relevant to development of Gβγ targeting as a therapeutic approach since reversible, direct binding is a prerequisite for drug development and important for specificity. PMID:21621014

  8. Synthetic Small-Molecule Prohormone Convertase 2 Inhibitors

    PubMed Central

    Kowalska, Dorota; Liu, Jin; Appel, Jon R.; Ozawa, Akihiko; Nefzi, Adel; Mackin, Robert B.; Houghten, Richard A.; Lindberg, Iris

    2009-01-01

    The proprotein convertases are believed to be responsible for the proteolytic maturation of a large number of peptide hormone precursors. Although potent furin inhibitors have been identified, thus far, no small-molecule prohormone convertase 1/3 or prohormone convertase 2 (PC2) inhibitors have been described. After screening 38 small-molecule positional scanning libraries against recombinant mouse PC2, two promising chemical scaffolds were identified: bicyclic guanidines, and pyrrolidine bis-piperazines. A set of individual compounds was designed from each library and tested against PC2. Pyrrolidine bis-piperazines were irreversible, time-dependent inhibitors of PC2, exhibiting noncompetitive inhibition kinetics; the most potent inhibitor exhibited a Ki value for PC2 of 0.54 μM. In contrast, the most potent bicyclic guanidine inhibitor exhibited a Ki value of 3.3 μM. Cross-reactivity with other convertases was limited: pyrrolidine bis-piperazines exhibited Ki values greater than 25 μM for PC1/3 or furin, whereas the Ki values of bicyclic guanidines for these other convertases were more than 15 μM. We conclude that pyrrolidine bis-piperazines and bicyclic guanidines represent promising initial leads for the optimization of therapeutically active PC2 inhibitors. PC2-specific inhibitors may be useful in the pharmacological blockade of PC2-dependent cleavage events, such as glucagon production in the pancreas and ectopic peptide production in small-cell carcinoma, and to study PC2-dependent proteolytic events, such as opioid peptide production. PMID:19074544

  9. Enhanced Raman scattering by molecules adsorbed at the surface of colloidal spheroids

    NASA Astrophysics Data System (ADS)

    Wang, D.-S.; Kerker, M.

    1981-08-01

    Equations are derived and calculations are presented for the electrodynamic mechanism of enhanced Raman scattering by molecules at the surface of prolate and oblate spheroids in the small-particle limit. The molecules may be arbitrarily distributed; the particles may be arbitrarily oriented. Calculations are presented for a monolayer distributed over randomly oriented spheroids. The effects of particle shape are considered for Ag, Au, and Cu hydrosols. The peak enhancement moves to longer wavelengths, and in the case of Au and Cu the magnitude of the enhancement increases strikingly as the eccentricity increases. The relation between the dependence of the Raman enhancement upon excitation wavelength and the extinction spectra is discussed, including the precariousness of extrapolating such relations beyond the small-particle limit.

  10. Mechanisms of small molecule-DNA interactions probed by single-molecule force spectroscopy.

    PubMed

    Almaqwashi, Ali A; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C

    2016-05-19

    There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA-ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

  11. Small molecule semiconductors for high-efficiency organic photovoltaics.

    PubMed

    Lin, Yuze; Li, Yongfang; Zhan, Xiaowei

    2012-06-01

    Organic photovoltaic cells (OPVs) are a promising cost-effective alternative to silicon-based solar cells, and possess light-weight, low-cost, and flexibility advantages. Significant progress has been achieved in the development of novel photovoltaic materials and device structures in the last decade. Nowadays small molecular semiconductors for OPVs have attracted considerable attention, due to their advantages over their polymer counterparts, including well-defined molecular structure, definite molecular weight, and high purity without batch to batch variations. The highest power conversion efficiencies of OPVs based on small molecular donor/fullerene acceptors or polymeric donor/fullerene acceptors are up to 6.7% and 8.3%, respectively, and meanwhile nonfullerene acceptors have also exhibited some promising results. In this review we summarize the developments in small molecular donors, acceptors (fullerene derivatives and nonfullerene molecules), and donor-acceptor dyad systems for high-performance multilayer, bulk heterojunction, and single-component OPVs. We focus on correlations of molecular chemical structures with properties, such as absorption, energy levels, charge mobilities, and photovoltaic performances. This structure-property relationship analysis may guide rational structural design and evaluation of photovoltaic materials (253 references).

  12. Influence of Lithium Additives in Small Molecule Light-Emitting Electrochemical Cells.

    PubMed

    Lin, Kuo-Yao; Bastatas, Lyndon D; Suhr, Kristin J; Moore, Matthew D; Holliday, Bradley J; Minary-Jolandan, Majid; Slinker, Jason D

    2016-07-01

    Light-emitting electrochemical cells (LEECs) utilizing small molecule emitters such as iridium complexes have great potential as low-cost emissive devices. In these devices, ions rearrange during operation to facilitate carrier injection, bringing about efficient operation from simple, single layer devices. Recent work has shown that the luminance, efficiency, and responsiveness of iridium-based LEECs are greatly enhanced by the inclusion of small amounts of lithium salts (≤0.5%/wt) into the active layer. However, the origin of this enhancement has yet to be demonstrated experimentally. Furthermore, although iridium-based devices have been the longstanding leader among small molecule LEECs, fundamental understanding of the ionic distribution in these devices under operation is lacking. Herein, we use scanning Kelvin probe microscopy to measure the in situ potential profiles and electric field distributions of planar iridium-based LEECs and clarify the role of ionic lithium additives. In pristine devices, it is found that ions do not pack densely at the cathode, and ionic redistribution is slow. Inclusion of small amounts of Li[PF6] greatly increases ionic space charge near the cathode that doubles the peak electric fields and enhances electronic injection relative to pristine devices. This study confirms and clarifies a number of longstanding hypotheses regarding iridium LEECs and recent postulates concerning optimization of their operation. PMID:27299981

  13. Influence of Lithium Additives in Small Molecule Light-Emitting Electrochemical Cells.

    PubMed

    Lin, Kuo-Yao; Bastatas, Lyndon D; Suhr, Kristin J; Moore, Matthew D; Holliday, Bradley J; Minary-Jolandan, Majid; Slinker, Jason D

    2016-07-01

    Light-emitting electrochemical cells (LEECs) utilizing small molecule emitters such as iridium complexes have great potential as low-cost emissive devices. In these devices, ions rearrange during operation to facilitate carrier injection, bringing about efficient operation from simple, single layer devices. Recent work has shown that the luminance, efficiency, and responsiveness of iridium-based LEECs are greatly enhanced by the inclusion of small amounts of lithium salts (≤0.5%/wt) into the active layer. However, the origin of this enhancement has yet to be demonstrated experimentally. Furthermore, although iridium-based devices have been the longstanding leader among small molecule LEECs, fundamental understanding of the ionic distribution in these devices under operation is lacking. Herein, we use scanning Kelvin probe microscopy to measure the in situ potential profiles and electric field distributions of planar iridium-based LEECs and clarify the role of ionic lithium additives. In pristine devices, it is found that ions do not pack densely at the cathode, and ionic redistribution is slow. Inclusion of small amounts of Li[PF6] greatly increases ionic space charge near the cathode that doubles the peak electric fields and enhances electronic injection relative to pristine devices. This study confirms and clarifies a number of longstanding hypotheses regarding iridium LEECs and recent postulates concerning optimization of their operation.

  14. Evidence that small molecule enhancement of β-hexosaminidase activity corrects the behavioral phenotype in Dutch APP(E693Q) mice through reduction of ganglioside-bound Aβ.

    PubMed

    Knight, E M; Williams, H N; Stevens, A C; Kim, S H; Kottwitz, J C; Morant, A D; Steele, J W; Klein, W L; Yanagisawa, K; Boyd, R E; Lockhart, D J; Sjoberg, E R; Ehrlich, M E; Wustman, B A; Gandy, S

    2015-02-01

    Certain mutant Alzheimer's amyloid-β (Aβ) peptides (that is, Dutch mutant APP(E693Q)) form complexes with gangliosides (GAβ). These mutant Aβ peptides may also undergo accelerated aggregation and accumulation upon exposure to GM2 and GM3. We hypothesized that increasing β-hexosaminidase (β-hex) activity would lead to a reduction in GM2 levels, which in turn, would cause a reduction in Aβ aggregation and accumulation. The small molecule OT1001 is a β-hex-targeted pharmacological chaperone with good bioavailability, blood-brain barrier penetration, high selectivity for β-hex and low cytotoxicity. Dutch APP(E693Q) transgenic mice accumulate oligomeric Aβ as they age, as well as Aβ oligomer-dose-dependent anxiety and impaired novel object recognition (NOR). Treatment of Dutch APP(E693Q) mice with OT1001 caused a dose-dependent increase in brain β-hex levels up to threefold over those observed at baseline. OT1001 treatment was associated with reduced anxiety, improved learning behavior in the NOR task and dramatically reduced GAβ accumulation in the subiculum and perirhinal cortex, both of which are brain regions required for normal NOR. Pharmacological chaperones that increase β-hex activity may be useful in reducing accumulation of certain mutant species of Aβ and in preventing the associated behavioral pathology. PMID:25349165

  15. Laser-initiated Coulomb explosion imaging of small molecules

    NASA Astrophysics Data System (ADS)

    Brichta, Jean-Paul

    Momentum vectors of fragment ions produced by the Coulomb explosion of COz+2 (z = 3 - 6) and CSz+2 (z = 3 - 13) in an intense laser field (˜50 fs, 1 x 1015 W/cm2) are determined by the triple coincidence imaging technique. The molecular structure from symmetric and asymmetric explosion channels is reconstructed from the measured momentum vectors using a novel simplex algorithm that can be extended to study larger molecules. Physical parameters such as bend angle and bond lengths are extracted from the data and are qualitatively described using an enhanced ionization model that predicts the laser intensity required for ionization as a function of bond length using classical, over the barrier arguments. As a way of going beyond the classical model, molecular ionization is examined using a quantum-mechanical, wave function modified ADK method. The ADK model is used to calculate the ionization rates of H2, N 2 and CO2 as a function of initial vibrational level of the molecules. A strong increase in the ionization rate, with vibrational level, is found for H2, while N2 and CO2 show a lesser increase. The prospects for using ionization rates as a diagnostic for vibrational level population are assessed.

  16. Small Molecule Anticonvulsant Agents with Potent In Vitro Neuroprotection

    PubMed Central

    Smith, Garry R.; Zhang, Yan; Du, Yanming; Kondaveeti, Sandeep K.; Zdilla, Michael J.; Reitz, Allen B.

    2012-01-01

    Severe seizure activity is associated with recurring cycles of excitotoxicity and oxidative stress that result in progressive neuronal damage and death. Intervention to halt these pathological processes is a compelling disease-modifying strategy for the treatment of seizure disorders. In the present study, a core small molecule with anticonvulsant activity has been structurally optimized for neuroprotection. Phenotypic screening of rat hippocampal cultures with nutrient medium depleted of antioxidants was utilized as a disease model. Increased cell death and decreased neuronal viability produced by acute treatment with glutamate or hydrogen peroxide were prevented by our novel molecules. The neuroprotection associated with this chemical series has marked structure activity relationships that focus on modification of the benzylic position of a 2-phenyl-2-hydroxyethyl sulfamide core structure. Complete separation between anticonvulsant activity and neuroprotective action was dependent on substitution at the benzylic carbon. Chiral selectivity was evident in that the S-enantiomer of the benzylic hydroxy group had neither neuroprotective nor anticonvulsant activity, while the R-enantiomer of the lead compound had full neuroprotective action at ≤40 nM and antiseizure activity in three animal models. These studies indicate that potent, multifunctional neuroprotective anticonvulsants are feasible within a single molecular entity. PMID:22535312

  17. Catalytic in vivo protein knockdown by small-molecule PROTACs

    PubMed Central

    Bondeson, Daniel P; Mares, Alina; Smith, Ian E D; Ko, Eunhwa; Campos, Sebastien; Miah, Afjal H; Mulholland, Katie E; Routly, Natasha; Buckley, Dennis L; Gustafson, Jeffrey L; Zinn, Nico; Grandi, Paola; Shimamura, Satoko; Bergamini, Giovanna; Faelth-Savitski, Maria; Bantscheff, Marcus; Cox, Carly; Gordon, Deborah A; Willard, Ryan R; Flanagan, John J; Casillas, Linda N; Votta, Bartholomew J; den Besten, Willem; Famm, Kristoffer; Kruidenier, Laurens; Carter, Paul S; Harling, John D; Churcher, Ian; Crews, Craig M

    2015-01-01

    The current predominant theapeutic paradigm is based on maximizing drug-receptor occupancy to achieve clinical benefit. This strategy, however, generally requires excessive drug concentrations to ensure sufficient occupancy, often leading to adverse side effects. Here, we describe major improvements to the proteolysis targeting chimeras (PROTACs) method, a chemical knockdown strategy in which a heterobifunctional molecule recruits a specific protein target to an E3 ubiquitin ligase, resulting in the target’s ubiquitination and degradation. These compounds behave catalytically in their ability to induce the ubiquitination of super-stoichiometric quantities of proteins, providing efficacy that is not limited by equilibrium occupancy. We present two PROTACs that are capable of specifically reducing protein levels by >90% at nanomolar concentrations. In addition, mouse studies indicate that they provide broad tissue distribution and knockdown of the targeted protein in tumor xenografts. Together, these data demonstrate a protein knockdown system combining many of the favorable properties of small-molecule agents with the potent protein knockdown of RNAi and CRISPR. PMID:26075522

  18. Construction of DNA Hemicatenanes from Two Small Circular DNA Molecules

    PubMed Central

    Gaillard, Claire; Strauss, François

    2015-01-01

    DNA hemicatenanes, one of the simplest possible junctions between two double stranded DNA molecules, have frequently been mentioned in the literature for their possible function in DNA replication, recombination, repair, and organization in chromosomes. They have been little studied experimentally, however, due to the lack of an appropriate method for their preparation. Here we have designed a method to build hemicatenanes from two small circular DNA molecules. The method involves, first, the assembly of two linear single strands and their circularization to form a catenane of two single stranded circles, and, second, the addition and base-pairing of the two single stranded circles complementary to the first ones, followed by their annealing using DNA topoisomerase I. The product was purified by gel electrophoresis and characterized. The arrangement of strands was as expected for a hemicatenane and clearly distinct from a full catenane. In addition, each circle was unwound by an average of half a double helical turn, also in excellent agreement with the structure of a hemicatenane. It was also observed that hemicatenanes are quickly destabilized by a single cut on either of the two strands passing inside the junction, strongly suggesting that DNA strands are able to slide easily inside the hemicatenane. This method should make it possible to study the biochemical properties of hemicatenanes and to test some of the hypotheses that have been proposed about their function, including a possible role for this structure in the organization of complex genomes in loops and chromosomal domains. PMID:25799010

  19. Small molecule inhibitors of HCV replication from pomegranate.

    PubMed

    Reddy, B Uma; Mullick, Ranajoy; Kumar, Anuj; Sudha, Govindarajan; Srinivasan, Narayanaswamy; Das, Saumitra

    2014-01-01

    Hepatitis C virus (HCV) is the causative agent of end-stage liver disease. Recent advances in the last decade in anti HCV treatment strategies have dramatically increased the viral clearance rate. However, several limitations are still associated, which warrant a great need of novel, safe and selective drugs against HCV infection. Towards this objective, we explored highly potent and selective small molecule inhibitors, the ellagitannins, from the crude extract of Pomegranate (Punica granatum) fruit peel. The pure compounds, punicalagin, punicalin, and ellagic acid isolated from the extract specifically blocked the HCV NS3/4A protease activity in vitro. Structural analysis using computational approach also showed that ligand molecules interact with the catalytic and substrate binding residues of NS3/4A protease, leading to inhibition of the enzyme activity. Further, punicalagin and punicalin significantly reduced the HCV replication in cell culture system. More importantly, these compounds are well tolerated ex vivo and'no observed adverse effect level' (NOAEL) was established upto an acute dose of 5000 mg/kg in BALB/c mice. Additionally, pharmacokinetics study showed that the compounds are bioavailable. Taken together, our study provides a proof-of-concept approach for the potential use of antiviral and non-toxic principle ellagitannins from pomegranate in prevention and control of HCV induced complications. PMID:24958333

  20. Small molecule inhibitors of HCV replication from Pomegranate

    NASA Astrophysics Data System (ADS)

    Reddy, B. Uma; Mullick, Ranajoy; Kumar, Anuj; Sudha, Govindarajan; Srinivasan, Narayanaswamy; Das, Saumitra

    2014-06-01

    Hepatitis C virus (HCV) is the causative agent of end-stage liver disease. Recent advances in the last decade in anti HCV treatment strategies have dramatically increased the viral clearance rate. However, several limitations are still associated, which warrant a great need of novel, safe and selective drugs against HCV infection. Towards this objective, we explored highly potent and selective small molecule inhibitors, the ellagitannins, from the crude extract of Pomegranate (Punica granatum) fruit peel. The pure compounds, punicalagin, punicalin, and ellagic acid isolated from the extract specifically blocked the HCV NS3/4A protease activity in vitro. Structural analysis using computational approach also showed that ligand molecules interact with the catalytic and substrate binding residues of NS3/4A protease, leading to inhibition of the enzyme activity. Further, punicalagin and punicalin significantly reduced the HCV replication in cell culture system. More importantly, these compounds are well tolerated ex vivo and`no observed adverse effect level' (NOAEL) was established upto an acute dose of 5000 mg/kg in BALB/c mice. Additionally, pharmacokinetics study showed that the compounds are bioavailable. Taken together, our study provides a proof-of-concept approach for the potential use of antiviral and non-toxic principle ellagitannins from pomegranate in prevention and control of HCV induced complications.

  1. Allosteric control of the ribosome by small-molecule antibiotics

    PubMed Central

    Wang, Leyi; Pulk, Arto; Wasserman, Michael R; Feldman, Michael B; Altman, Roger B; Cate, Jamie H. Doudna; Blanchard, Scott C

    2013-01-01

    Protein synthesis is targeted by numerous, chemically distinct antibiotics that bind and inhibit key functional centers of the ribosome. Using single-molecule imaging and X-ray crystallography, we show that the aminoglycoside neomycin blocks aminoacyl–transfer RNA (aa-tRNA) selection and translocation as well as ribosome recycling by binding to helix 69 (H69) of 23S ribosomal RNA within the large subunit of the Escherichia coli ribosome. There, neomycin prevents the remodeling of intersubunit bridges that normally accompanies the process of subunit rotation to stabilize a partially rotated ribosome configuration in which peptidyl (P)-site tRNA is constrained in a previously unidentified hybrid position. Direct measurements show that this neomycin-stabilized intermediate is incompatible with the translation factor binding that is required for distinct protein synthesis reactions. These findings reveal the functional importance of reversible intersubunit rotation to the translation mechanism and shed new light on the allosteric control of ribosome functions by small-molecule antibiotics. PMID:22902368

  2. Dissecting fibrosis: therapeutic insights from the small-molecule toolbox.

    PubMed

    Nanthakumar, Carmel B; Hatley, Richard J D; Lemma, Seble; Gauldie, Jack; Marshall, Richard P; Macdonald, Simon J F

    2015-10-01

    Fibrosis, which leads to progressive loss of tissue function and eventual organ failure, has been estimated to contribute to ~45% of deaths in the developed world, and so new therapeutics to modulate fibrosis are urgently needed. Major advances in our understanding of the mechanisms underlying pathological fibrosis are supporting the search for such therapeutics, and the recent approval of two anti-fibrotic drugs for idiopathic pulmonary fibrosis has demonstrated the tractability of this area for drug discovery. This Review examines the pharmacology and structural information for small molecules being evaluated for lung, liver, kidney and skin fibrosis. In particular, we discuss the insights gained from the use of these pharmacological tools, and how these entities can inform, and probe, emerging insights into disease mechanisms, including the potential for future drug combinations.

  3. Small Molecule Inhibitors Targeting Activator Protein 1 (AP-1)

    PubMed Central

    2015-01-01

    Activator protein 1 (AP-1) is a pivotal transcription factor that regulates a wide range of cellular processes including proliferation, apoptosis, differentiation, survival, cell migration, and transformation. Accumulating evidence supports that AP-1 plays an important role in several severe disorders including cancer, fibrosis, and organ injury, as well as inflammatory disorders such as asthma, psoriasis, and rheumatoid arthritis. AP-1 has emerged as an actively pursued drug discovery target over the past decade. Excitingly, a selective AP-1 inhibitor T-5224 (51) has been investigated in phase II human clinical trials. Nevertheless, no effective AP-1 inhibitors have yet been approved for clinical use. Despite significant advances achieved in understanding AP-1 biology and function, as well as the identification of small molecules modulating AP-1 associated signaling pathways, medicinal chemistry efforts remain an urgent need to yield selective and efficacious AP-1 inhibitors as a viable therapeutic strategy for human diseases. PMID:24831826

  4. Detection of small molecules with a flow immunosensor

    NASA Technical Reports Server (NTRS)

    Kusterbeck, Anne W.; Ligler, Frances S.

    1991-01-01

    We describe the development of an easy-to-use sensor with widespread applications for detecting small molecules. The flow immunosensor can analyze discrete samples in under one minute or continuously monitor a flowing stream for the presence of specific analytes. This detection system is extremely specific, and achieves a level of sensitivity which meets or exceeds the detection limits reported for rival assays. Because the system is also compact, transportable, and automated, it has the potential to impact diverse areas. For example, the flow immunosensor has successfully detected drugs of abuse and explosives, and may well address many of the needs of the environmental community with respect to continuous monitoring for pollutants. Efforts are underway to engineer a portable device in the field.

  5. Regulatory aspects of small molecule drugs for heart regeneration.

    PubMed

    Rodgers, Kathleen; Papinska, Anna; Mordwinkin, Nicholas

    2016-01-15

    Even though recent discoveries prove the existence of cardiac progenitor cells, internal regenerative capacity of the heart is minimal. As cardiovascular disease is the leading cause of deaths in the United States, a number of approaches are being used to develop treatments for heart repair and regeneration. Small molecule drugs are of particular interest as they are suited for oral administration and can be chemically synthesized. However, the regulatory process for the development of new treatment modalities is protracted, complex and expensive. One of the hurdles to development of appropriate therapies is the need for predictive preclinical models. The use of patient-derived cardiomyocytes from iPSC cells represents a novel tool for this purpose. Among other concepts for induction of heart regeneration, the most advanced is the combination of DPP-IV inhibitors with stem cell mobilizers. This review will focus on regulatory aspects as well as preclinical hurdles of development of new treatments for heart regeneration.

  6. Probing the Probes: Fitness Factors For Small Molecule Tools

    PubMed Central

    Workman, Paul; Collins, Ian

    2010-01-01

    Chemical probes for interrogating biological processes are of considerable current interest. Cell permeable small molecule tools have a major role in facilitating the functional annotation of the human genome, understanding both physiological and pathological processes, and validating new molecular targets. To be valuable, chemical tools must satisfy necessary criteria and recent publications have suggested objective guidelines for what makes a useful chemical probe. Although recognizing that such guidelines may be valuable, we caution against overly restrictive rules that may stifle innovation in favor of a “fit-for-purpose” approach. Reviewing the literature and providing examples from the cancer field, we recommend a series of “fitness factors” to be considered when assessing chemical probes. We hope this will encourage innovative chemical biology research while minimizing the generation of poor quality and misleading biological data, thus increasing understanding of the particular biological area, to the benefit of basic research and drug discovery. PMID:20609406

  7. Infectious Complications Associated with Monoclonal Antibodies and Related Small Molecules

    PubMed Central

    Salvana, Edsel Maurice T.; Salata, Robert A.

    2009-01-01

    Summary: Biologics are increasingly becoming part of routine disease management. As more agents are developed, the challenge of keeping track of indications and side effects is growing. While biologics represent a milestone in targeted and specific therapy, they are not without drawbacks, and the judicious use of these “magic bullets” is essential if their full potential is to be realized. Infectious complications in particular are not an uncommon side effect of therapy, whether as a direct consequence of the agent or because of the underlying disease process. With this in mind, we have reviewed and summarized the risks of infection and the infectious disease-related complications for all FDA-approved monoclonal antibodies and some related small molecules, and we discuss the probable mechanisms involved in immunosuppression as well as recommendations for prophylaxis and treatment of specific disease entities. PMID:19366915

  8. Targeting RSV with Vaccines and Small Molecule Drugs

    PubMed Central

    Costello, Heather M.; Ray, William C.; Chaiwatpongsakorn, Supranee; Peeples, Mark E.

    2012-01-01

    Respiratory syncytial virus (RSV) is the most significant cause of pediatric respiratory infections. Palivizumab (Synagis®), a humanized monoclonal antibody, has been used successfully for a number of years to prevent severe RSV disease in at-risk infants. However, despite intense efforts, there is no approved vaccine or small molecule drug for RSV. As an enveloped virus, RSV must fuse its envelope with the host cell membrane, which is accomplished through the actions of the fusion (F) glycoprotein, with attachment help from the G glycoprotein. Because of their integral role in initiation of infection and their accessibility outside the lipid bilayer, these proteins have been popular targets in the discovery and development of antiviral compounds and vaccines against RSV. This review examines advances in the development of antiviral compounds and vaccine candidates. PMID:22335496

  9. Branched terthiophenes in organic electronics: from small molecules to polymers.

    PubMed

    Scheuble, Martin; Goll, Miriam; Ludwigs, Sabine

    2015-01-01

    A zoo of chemical structures is accessible when the branched unit 2,2':3',2″-terthiophene (3T) is included both in structurally well-defined small molecules and polymer-like architectures. The first part of this review article highlights literature on all-thiophene based branched oligomers including dendrimers as well as combinations of 3T-units with functional moieties for light-harvesting systems. Motivated by the perfectly branched macromolecular dendrimers both electropolymerization as well as chemical approaches are presented as methods for the preparation of branched polythiophenes with different branching densities. Structure-function relationships between the molecular architecture and optical and electronic properties are discussed throughout the article.

  10. Toward reprogramming bacteria with small molecules and RNA.

    PubMed

    Gallivan, Justin P

    2007-12-01

    A major goal of synthetic biology is to reprogram bacteria to carry out complex tasks, such as synthesizing and delivering drugs, and seeking and destroying environmental pollutants. Advances in molecular biology and bacterial genetics have made it straightforward to modify, insert, or delete genes in many bacterial strains, and advances in gene synthesis have opened the door to replacing entire genomes. However, rewriting the underlying genetic code is only part of the challenge of reprogramming cellular behavior. A remaining challenge is to control how and when the modified genes are expressed. Several recent studies have highlighted how synthetic riboswitches, which are RNA sequences that undergo a ligand-induced conformational change to alter gene expression, can be used to reprogram how bacteria respond to small molecules. PMID:17967431

  11. Elucidating the germination transcriptional program using small molecules.

    PubMed

    Bassel, George W; Fung, Pauline; Chow, Tsz-fung Freeman; Foong, Justin A; Provart, Nicholas J; Cutler, Sean R

    2008-05-01

    The transition from seed to seedling is mediated by germination, a complex process that starts with imbibition and completes with radicle emergence. To gain insight into the transcriptional program mediating germination, previous studies have compared the transcript profiles of dry, dormant, and germinating after-ripened Arabidopsis (Arabidopsis thaliana) seeds. While informative, these approaches did not distinguish the transcriptional responses due to imbibition, shifts in metabolism, or breaking of dormancy from those triggered by the initiation of germination. In this study, three mechanistically distinct small molecules that inhibit Arabidopsis seed germination (methotrexate, 2, 4-dinitrophenol, and cycloheximide) were identified using a small-molecule screen and used to probe the germination transcriptome. Germination-responsive transcripts were defined as those with significantly altered transcript abundance across all inhibitory treatments with respect to control germinating seeds, using data from ATH1 microarrays. This analysis identified numerous germination regulators as germination responsive, including the DELLA proteins GAI, RGA, and RGL3, the abscisic acid-insensitive proteins ABI4, ABI5, ABI8, and FRY1, and the gibberellin receptor GID1A. To help visualize these and other publicly available seed microarray data, we designed a seed mRNA expression browser using the electronic Fluorescent Pictograph platform. An overall decrease in gene expression and a 5-fold greater number of transcripts identified as statistically down-regulated in drug-inhibited seeds point to a role for mRNA degradation or turnover during seed germination. The genes identified in our study as responsive to germination define potential uncharacterized regulators of this process and provide a refined transcriptional signature for germinating Arabidopsis seeds.

  12. Advances in structure elucidation of small molecules using mass spectrometry

    PubMed Central

    Fiehn, Oliver

    2010-01-01

    The structural elucidation of small molecules using mass spectrometry plays an important role in modern life sciences and bioanalytical approaches. This review covers different soft and hard ionization techniques and figures of merit for modern mass spectrometers, such as mass resolving power, mass accuracy, isotopic abundance accuracy, accurate mass multiple-stage MS(n) capability, as well as hybrid mass spectrometric and orthogonal chromatographic approaches. The latter part discusses mass spectral data handling strategies, which includes background and noise subtraction, adduct formation and detection, charge state determination, accurate mass measurements, elemental composition determinations, and complex data-dependent setups with ion maps and ion trees. The importance of mass spectral library search algorithms for tandem mass spectra and multiple-stage MS(n) mass spectra as well as mass spectral tree libraries that combine multiple-stage mass spectra are outlined. The successive chapter discusses mass spectral fragmentation pathways, biotransformation reactions and drug metabolism studies, the mass spectral simulation and generation of in silico mass spectra, expert systems for mass spectral interpretation, and the use of computational chemistry to explain gas-phase phenomena. A single chapter discusses data handling for hyphenated approaches including mass spectral deconvolution for clean mass spectra, cheminformatics approaches and structure retention relationships, and retention index predictions for gas and liquid chromatography. The last section reviews the current state of electronic data sharing of mass spectra and discusses the importance of software development for the advancement of structure elucidation of small molecules. Electronic supplementary material The online version of this article (doi:10.1007/s12566-010-0015-9) contains supplementary material, which is available to authorized users. PMID:21289855

  13. Targeting Th17 Cells with Small Molecules and Small Interference RNA

    PubMed Central

    Lin, Hui; Song, Pingfang; Zhao, Yi; Xue, Li-Jia; Liu, Yi; Chu, Cong-Qiu

    2015-01-01

    T helper 17 (Th17) cells play a central role in inflammatory and autoimmune diseases via the production of proinflammatory cytokines interleukin- (IL-) 17, IL-17F, and IL-22. Anti-IL-17 monoclonal antibodies show potent efficacy in psoriasis but poor effect in rheumatoid arthritis (RA) and Crohn's disease. Alternative agents targeting Th17 cells may be a better way to inhibit the development and function of Th17 cells than antibodies of blocking a single effector cytokine. Retinoic acid-related orphan receptor gamma t (RORγt) which acts as the master transcription factor of Th17 differentiation has been an attractive pharmacologic target for the treatment of Th17-mediated autoimmune disease. Recent progress in technology of chemical screen and engineering nucleic acid enable two new classes of therapeutics targeting RORγt. Chemical screen technology identified several small molecule specific inhibitors of RORγt from a small molecule library. Systematic evolution of ligands by exponential enrichment (SELEX) technology enabled target specific aptamers to be isolated from a random sequence oligonucleotide library. In this review, we highlight the development and therapeutic potential of small molecules inhibiting Th17 cells by targeting RORγt and aptamer mediated CD4+ T cell specific delivery of small interference RNA against RORγt gene expression to inhibit pathogenic effector functions of Th17 lineage. PMID:26792955

  14. Targeting Th17 Cells with Small Molecules and Small Interference RNA.

    PubMed

    Lin, Hui; Song, Pingfang; Zhao, Yi; Xue, Li-Jia; Liu, Yi; Chu, Cong-Qiu

    2015-01-01

    T helper 17 (Th17) cells play a central role in inflammatory and autoimmune diseases via the production of proinflammatory cytokines interleukin- (IL-) 17, IL-17F, and IL-22. Anti-IL-17 monoclonal antibodies show potent efficacy in psoriasis but poor effect in rheumatoid arthritis (RA) and Crohn's disease. Alternative agents targeting Th17 cells may be a better way to inhibit the development and function of Th17 cells than antibodies of blocking a single effector cytokine. Retinoic acid-related orphan receptor gamma t (RORγt) which acts as the master transcription factor of Th17 differentiation has been an attractive pharmacologic target for the treatment of Th17-mediated autoimmune disease. Recent progress in technology of chemical screen and engineering nucleic acid enable two new classes of therapeutics targeting RORγt. Chemical screen technology identified several small molecule specific inhibitors of RORγt from a small molecule library. Systematic evolution of ligands by exponential enrichment (SELEX) technology enabled target specific aptamers to be isolated from a random sequence oligonucleotide library. In this review, we highlight the development and therapeutic potential of small molecules inhibiting Th17 cells by targeting RORγt and aptamer mediated CD4(+) T cell specific delivery of small interference RNA against RORγt gene expression to inhibit pathogenic effector functions of Th17 lineage. PMID:26792955

  15. TIPS-DBC small molecule O-FETs fabricated by evaporation and solution processing

    NASA Astrophysics Data System (ADS)

    Gruszecki, Daniel; Singh, Birendra; Bown, Mark; Lewis, David

    2012-02-01

    The performance of organic field effect transistors using the small molecule, tri-isopropyl- silane-di-benzo chrysene (TIPS-DBC) is reported. The field effect mobility μFE is found to depend on the deposition conditions, which affect the morphology of the film. A mobility in the range of 1.5 × 10-6 to 2.4 × 10-4 cm2 V-1 s-1 is obtained from the evaporated films depending on the substrate treatment and deposition temperature, while films deposited by solution-processing techniques yield mobilities in the range of 0.7 × 10-3 to 1.5 × 10-3 cm2 V-1 s-1. The enhanced performance in polycrystalline solution-processed coatings and its relationship to crystallite size is an important parameter in the design of high-performance devices based on small molecules.

  16. Identification of small molecules for human hepatocyte expansion and iPS differentiation

    PubMed Central

    Shan, Jing; Schwartz, Robert E.; Ross, Nathan T.; Logan, David J.; Thomas, David; Duncan, Stephen A.; North, Trista E.; Goessling, Wolfram; Carpenter, Anne E.; Bhatia, Sangeeta N.

    2013-01-01

    Cell-based therapies hold the potential to alleviate the growing burden of liver diseases. Such therapies require human hepatocytes, which, within the stromal context of the liver, are capable of many rounds of replication. However, this ability is lost ex vivo and human hepatocyte sourcing has been limiting many fields of research for decades. Here, we developed a high-throughput screening platform for primary human hepatocytes to identify small molecules in two different classes that can be used to generate renewable sources of functional human hepatocytes. One class induced functional proliferation of primary human hepatocytes in vitro. The second class enhanced hepatocyte functions and promoted differentiation of iPS-derived hepatocytes, toward a phenotype more mature than what was previously obtainable. The identification of these small molecules can help to address a major challenge impacting many facets of liver research and may lead to the development of novel therapeutics for liver diseases. PMID:23728495

  17. Nanochemical equilibrium involving a small number of molecules: a prediction of a distinct confinement effect.

    PubMed

    Polak, Micha; Rubinovich, Leonid

    2008-10-01

    The equilibrium state of a reaction mixture comprised of a small number of molecules is modeled for three different nanoconfined systems. The issue is relevant to several advanced routes for the synthesis of encapsulated organic molecules, metallic or inorganic nanoclusters, and other nanoscale structures. Canonical-ensemble based formulations and computations predict for the equilibrated closed small systems significant deviations from the (macroscopic) thermodynamic limit. The effects include the enhancement/suppression of the equilibrium extent of the exothermic/endothermic model reactions, associated mainly with reduced numbers of mixed reactant-product microstates in the closed system. Fluctuations in the nanochemical reaction extent, which are found to be closely related to the stoichiometric coefficients, become more dominant for smaller systems and modify considerably the temperature dependence of the equilibrium constant.

  18. Perspective: Accurate ro-vibrational calculations on small molecules

    NASA Astrophysics Data System (ADS)

    Tennyson, Jonathan

    2016-09-01

    In what has been described as the fourth age of quantum chemistry, variational nuclear motion programs are now routinely being used to obtain the vibration-rotation levels and corresponding wavefunctions of small molecules to the sort of high accuracy demanded by comparison with spectroscopy. In this perspective, I will discuss the current state-of-the-art which, for example, shows that these calculations are increasingly competitive with measurements or, indeed, replacing them and thus becoming the primary source of data on key processes. To achieve this accuracy ab initio requires consideration of small effects, routinely ignored in standard calculations, such as those due to quantum electrodynamics. Variational calculations are being used to generate huge lists of transitions which provide the input for models of radiative transport through hot atmospheres and to fill in or even replace measured transition intensities. Future prospects such as the study of molecular states near dissociation, which can provide a link with low-energy chemical reactions, are discussed.

  19. Small molecule screening in context: Lipid-catalyzed amyloid formation

    PubMed Central

    Hebda, James A; Magzoub, Mazin; Miranker, Andrew D

    2014-01-01

    Islet Amyloid Polypeptide (IAPP) is a 37-residue hormone cosecreted with insulin by the β-cells of the pancreas. Amyloid fiber aggregation of IAPP has been correlated with the dysfunction and death of these cells in type II diabetics. The likely mechanisms by which IAPP gains toxic function include energy independent cell membrane penetration and induction of membrane depolarization. These processes have been correlated with solution biophysical observations of lipid bilayer catalyzed acceleration of amyloid formation. Although the relationship between amyloid formation and toxicity is poorly understood, the fact that conditions promoting one also favor the other suggests related membrane active structural states. Here, a novel high throughput screening protocol is described that capitalizes on this correlation to identify compounds that target membrane active species. Applied to a small library of 960 known bioactive compounds, we are able to report identification of 37 compounds of which 36 were not previously reported as active toward IAPP fiber formation. Several compounds tested in secondary cell viability assays also demonstrate cytoprotective effects. It is a general observation that peptide induced toxicity in several amyloid diseases (such as Alzhiemer’s and Parkinson’s) involves a membrane bound, preamyloid oligomeric species. Our data here suggest that a screening protocol based on lipid-catalyzed assembly will find mechanistically informative small molecule hits in this subclass of amyloid diseases. PMID:25043951

  20. Zirconium silicate assisted removal of residual proteins after organic solvent deproteinization of human plasma, enhancing the stability of the LC-ESI-MS response for the bioanalysis of small molecules.

    PubMed

    Hussain, Shah; Pezzei, Cornelia; Güzel, Yüksel; Rainer, Matthias; Huck, Christian W; Bonn, Günther K

    2014-12-10

    An efficient blood plasma clean-up method was developed, where methanol protein precipitation was applied, followed by zirconium silicate assisted exclusion of residual proteins. A strong binding of zirconium (IV) silicate to the proteins enabled the elimination of remaining proteins after solvent deproteinization through a rapid solid-phase extraction (SPE) procedure. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI/TOF MS) was used for monitoring the proteins during clean-up practice applied to human plasma samples. The proteins were quantified by colorimetric detection using the bicinchoninic acid (BCA) assay. The presented analytical strategy resulted in the depletion of >99.6% proteins from human plasma samples. Furthermore, high-performance liquid chromatography hyphenated to diode-array and electrospray ionization mass spectrometric detection (HPLC-DAD/ESI MS) was applied for qualitative and quantitative analysis of the caffeoylquinic acids (CQAs) and their metabolites in human plasma. The procedure demonstrated high recoveries for the standard compounds spiked at different concentrations. Cynarin and chlorogenic acid were recovered in the range of 81-86% and 78-83%, respectively. Caffeic acid was extracted in the excess of 89-92%, while ferulic acid and dihydroxyhydrocinnamic acid showed a recovery of 87-91% and 92-95%, respectively. The method was partially validated in accordance with FDA-Industry Guidelines for Bioanalytical Method Validation (2001). The presented scheme improves the clean-up efficacy of the methanol deproteinization, significantly reduces the matrix effects and provides a great analytical tool for the isolation of small molecules from human plasma.

  1. Targeting Innate Immunity for Antiviral Therapy through Small Molecule Agonists of the RLR Pathway

    PubMed Central

    Pattabhi, Sowmya; Wilkins, Courtney R.; Dong, Ran; Knoll, Megan L.; Posakony, Jeffrey; Kaiser, Shari; Mire, Chad E.; Wang, Myra L.; Ireton, Renee C.; Geisbert, Thomas W.; Bedard, Kristin M.; Iadonato, Shawn P.

    2015-01-01

    selectively activate IRF3 for the purpose of identifying drug-like molecules that can be developed for the treatment of viral infections. Here, we report the discovery of a hydroxyquinoline family of small molecules that can activate IRF3 to promote cellular antiviral responses. These molecules can prophylactically or therapeutically control infection in cell culture by pathogenic RNA viruses, including West Nile virus, dengue virus, hepatitis C virus, influenza A virus, respiratory syncytial virus, Nipah virus, Lassa virus, and Ebola virus. Our study thus identifies a class of small molecules with a novel mechanism to enhance host immune responses for antiviral activity against a variety of RNA viruses that pose a significant health care burden and/or that are known to cause infections with high case fatality rates. PMID:26676770

  2. Learning and Training: Enhancing Small Business Success.

    ERIC Educational Resources Information Center

    Kilpatrick, Sue; Crowley, Suzanne

    Owners or managers of 181 Australian businesses employing fewer than 20 people in the construction, manufacturing, property and business services, and retail industries in 3 metropolitan and 3 nonmetropolitan locations were interviewed by telephone to identify how they used training to enhance their small business's success. Of those surveyed,…

  3. Conductance and Surface-Enhanced Raman Scattering of Single Molecules Utilizing Dimers of Nanoparticles

    NASA Astrophysics Data System (ADS)

    Dadosh, Tali

    conductance at certain voltage values. The position of peaks in the spectrum was affected by the electrostatic environment, resulting in random gating. In view of the above developments, my thesis focuses on surface-enhanced Raman scattering (SERS) measurement of single molecules. Single-molecule spectroscopy is an emerging field that provides detailed information on molecular response, which is unavailable in measurements performed on an assembly of molecules. The obvious problem, however, in implementing most spectroscopic techniques, such as Raman scattering, is the very weak signal obtained from a single molecule. Interestingly, the Raman signal from a molecule has been shown to increase dramatically when the molecule is adsorbed to metal particles of certain types having sub-wavelength dimensions [1, 2]. This enhancement technique, known as surface-enhanced Raman scattering, can increase the Raman signal by as much as 14--15 orders of magnitude, which has been shown to be sufficient for performing single-molecule spectroscopy successfully. Dimer structures are not only attractive for conductance measurements on single-molecule devices; they could also serve as an efficient antenna system that greatly enhances the electromagnetic field at the center of the dimer, where the molecule resides. Dimers provide a basic experimental model for studying the fundamentals of the SERS enhancement, which are not well understood. Dimers have the advantage of possessing a small gap (on the order of a nanometer) that is beyond the limit of today's sophisticated lithography techniques. By utilizing the dimer structures that contain a Rhodamine 123 molecule, we were able to resolve some fundamental questions regarding the SERS enhancement mechanism. The issue of how the nanoparticles' surface plasmon properties affects the SERS enhancement was addressed both experimentally and by calculations. Moreover, it was predicted by our calculations that when the dimers consist of large

  4. High performance photovoltaic applications using solution-processed small molecules.

    PubMed

    Chen, Yongsheng; Wan, Xiangjian; Long, Guankui

    2013-11-19

    Energy remains a critical issue for the survival and prosperity of humancivilization. Many experts believe that the eventual solution for sustainable energy is the use of direct solar energy as the main energy source. Among the options for renewable energy, photovoltaic technologies that harness solar energy offer a way to harness an unlimited resource and minimum environment impact in contrast with other alternatives such as water, nuclear, and wind energy. Currently, almost all commercial photovoltaic technologies use Si-based technology, which has a number of disadvantages including high cost, lack of flexibility, and the serious environmental impact of the Si industry. Other technologies, such as organic photovoltaic (OPV) cells, can overcome some of these issues. Today, polymer-based OPV (P-OPV) devices have achieved power conversion efficiencies (PCEs) that exceed 9%. Compared with P-OPV, small molecules based OPV (SM-OPV) offers further advantages, including a defined structure for more reproducible performance, higher mobility and open circuit voltage, and easier synthetic control that leads to more diversified structures. Therefore, while largely undeveloped, SM-OPV is an important emerging technology with performance comparable to P-OPV. In this Account, we summarize our recent results on solution-processed SM-OPV. We believe that solution processing is essential for taking full advantage of OPV technologies. Our work started with the synthesis of oligothiophene derivatives with an acceptor-donor-acceptor (A-D-A) structure. Both the backbone conjugation length and electron withdrawing terminal groups play an important role in the light absorption, energy levels and performance of the devices. Among those molecules, devices using a 7-thiophene-unit backbone and a 3-ethylrhodanine (RD) terminal unit produced a 6.1% PCE. With the optimized conjugation length and terminal unit, we borrowed from the results with P-OPV devices to optimize the backbone. Thus we

  5. High performance photovoltaic applications using solution-processed small molecules.

    PubMed

    Chen, Yongsheng; Wan, Xiangjian; Long, Guankui

    2013-11-19

    Energy remains a critical issue for the survival and prosperity of humancivilization. Many experts believe that the eventual solution for sustainable energy is the use of direct solar energy as the main energy source. Among the options for renewable energy, photovoltaic technologies that harness solar energy offer a way to harness an unlimited resource and minimum environment impact in contrast with other alternatives such as water, nuclear, and wind energy. Currently, almost all commercial photovoltaic technologies use Si-based technology, which has a number of disadvantages including high cost, lack of flexibility, and the serious environmental impact of the Si industry. Other technologies, such as organic photovoltaic (OPV) cells, can overcome some of these issues. Today, polymer-based OPV (P-OPV) devices have achieved power conversion efficiencies (PCEs) that exceed 9%. Compared with P-OPV, small molecules based OPV (SM-OPV) offers further advantages, including a defined structure for more reproducible performance, higher mobility and open circuit voltage, and easier synthetic control that leads to more diversified structures. Therefore, while largely undeveloped, SM-OPV is an important emerging technology with performance comparable to P-OPV. In this Account, we summarize our recent results on solution-processed SM-OPV. We believe that solution processing is essential for taking full advantage of OPV technologies. Our work started with the synthesis of oligothiophene derivatives with an acceptor-donor-acceptor (A-D-A) structure. Both the backbone conjugation length and electron withdrawing terminal groups play an important role in the light absorption, energy levels and performance of the devices. Among those molecules, devices using a 7-thiophene-unit backbone and a 3-ethylrhodanine (RD) terminal unit produced a 6.1% PCE. With the optimized conjugation length and terminal unit, we borrowed from the results with P-OPV devices to optimize the backbone. Thus we

  6. Small-molecule PSMA ligands. Current state, SAR and perspectives.

    PubMed

    Machulkin, Alexey E; Ivanenkov, Yan A; Aladinskaya, Anastasia V; Veselov, Mark S; Aladinskiy, Vladimir A; Beloglazkina, Elena K; Koteliansky, Victor E; Shakhbazyan, Artem G; Sandulenko, Yuri B; Majouga, Alexander G

    2016-09-01

    Prostate cancer (PC) is the prevalent malignancy widespread among men in the Western World. Prostate specific membrane antigen (PSMA) is an established PC marker and has been considered as a promising biological target for anti-PC drug delivery and diagnostics. The protein was found to be overexpressed in PC cells, including metastatic, and the neovasculature of solid tumors. These properties make PSMA-based approach quite appropriate for effective PC imaging and specific drug therapy. Through the past decade, a variety of PSMA-targeted agents has been systematically evaluated. Small-molecule compounds have several advantages over other classes, such as improved pharmacokinetics and rapid blood clearance. These low-weight ligands have similar structure and can be divided into three basic categories in accordance with the type of their zinc-binding core-head. Several PSMA binders are currently undergoing clinical trials generally for PC imaging. The main goal of the present review is to describe the recent progress achieved within the title field and structure activity relationships (SAR) disclosed for different PSMA ligands. Recent in vitro and in vivo studies for each type of the compounds described have also been briefly summarized. PMID:26887438

  7. Screen for small molecules increasing the mitochondrial membrane potential.

    PubMed

    Montague, Christine R; Fitzmaurice, Aileen; Hover, Bradley M; Salazar, Noe A; Fey, Julien P

    2014-03-01

    The identification of small molecules that positively modulate the mitochondrial respiratory function has broad applications in fundamental research, therapeutic target validation, and drug discovery. We present an approach in which primary screens for mitochondrial function in yeast are used to efficiently identify a subset of high-value compounds that can in turn be rapidly tested against a broad range of mammalian cell lines. The ability of the yeast assay to successfully identify in a high-throughput format hit compounds that increase the mitochondrial membrane potential and adenosine triphosphate (ATP) levels by as little as 15% was demonstrated. In this study, 14 hits were identified from a collection of 13,680 compounds. Secondary testing with myotubes, fibroblasts, and PC-12 and HepG2 cells identified two compounds increasing ATP levels in hepatocytes and two other compounds increasing ATP in fibroblasts. The effect on hepatocytes was further studied using genomic and mitochondrial proteomic tools to characterize the changes induced by the two compounds. Changes in the accumulation of a series of factors involved in early gene response or apoptosis or linked to metabolic functions (i.e., β-Klotho, RORα, PGC-1α, G6PC, IGFBP1, FTL) were discovered.

  8. Progress in Small Molecule and Biologic Therapeutics Targeting Ghrelin Signaling.

    PubMed

    McGovern, Kayleigh R; Darling, Joseph E; Hougland, James L

    2016-01-01

    Ghrelin is a circulating peptide hormone involved in regulation of a wide array of physiological processes. As an endogenous ligand for growth hormone secretagogue receptor (GHSR1a), ghrelin is responsible for signaling involved in energy homeostasis, including appetite stimulation, glucose metabolism, insulin signaling, and adiposity. Ghrelin has also been implicated in modulation of several neurological processes. Dysregulation of ghrelin signaling is implicated in diseases related to these pathways, including obesity, type II diabetes, and regulation of appetite and body weight in patients with Prader-Willi syndrome. Multiple steps in the ghrelin signaling pathway are available for targeting in the development of therapeutics for these diseases. Agonists and antagonists of GHS-R1a have been widely studied and have shown varying levels of effectiveness within ghrelin-related physiological pathways. Agents targeting ghrelin directly, either through depletion of ghrelin levels in circulation or inhibitors of ghrelin O-acyltransferase whose action is required for ghrelin to become biologically active, are receiving increasing attention as potential therapeutic options. We discuss the approaches utilized to target ghrelin signaling and highlight the current challenges toward developing small-molecule agents as potential therapeutics for ghrelin-related diseases. PMID:26202202

  9. Small-Molecule Inhibitors of the Myc Oncoprotein

    PubMed Central

    Fletcher, Steven; Prochownik, Edward V.

    2014-01-01

    The c-Myc (Myc) oncoprotein is among the most attractive of cancer targets given that is deregulated in the majority of tumors and that its inhibition profoundly affects their growth and/or survival. However, its role as a seldom-mutated transcription factor, its lack of enzymatic activity for which suitable pharmaceutical inhibitors could be crafted and its expression by normal cells have largely been responsible for its being viewed as “undruggable”. Work over the past several years, however, has begun to reverse this idea by allowing us to view Myc within the larger context of global gene regulatory control. Thus, Myc and its obligate heterodimeric partner, Max, are integral to the coordinated recruitment and post-translational modification of components of the core transcriptional machinery. Moreover, Myc over-expression re-programs numerous critical cellular functions and alters the cell’s susceptibility to their inhibition. This new knowledge has therefore served as a framework upon which to develop new pharmaceutical approaches. These include the continuing development of small molecules which act directly to inhibit the critical Myc-Max interaction, those which act indirectly to prevent Myc-directed post-translational modifications necessary to initiate productive transcription and those which inhibit vital pathways upon which the Myc-transformed cell is particularly reliant. PMID:24657798

  10. Beta-alanine as a small molecule neurotransmitter.

    PubMed

    Tiedje, K E; Stevens, K; Barnes, S; Weaver, D F

    2010-10-01

    This review discusses the role of beta-alanine as a neurotransmitter. Beta-alanine is structurally intermediate between alpha-amino acid (glycine, glutamate) and gamma-amino acid (GABA) neurotransmitters. In general, beta-alanine satisfies a number of the prerequisite classical criteria for being a neurotransmitter: beta-alanine occurs naturally in the CNS, is released by electrical stimulation through a Ca(2+) dependent process, has binding sites, and inhibits neuronal excitability. beta-Alanine has 5 recognized receptor sites: glycine co-agonist site on the NMDA complex (strychnine-insensitive); glycine receptor site (strychnine sensitive); GABA-A receptor; GABA-C receptor; and blockade of GAT protein-mediated glial GABA uptake. Although beta-alanine binding has been identified throughout the hippocampus, limbic structures, and neocortex, unique beta-alaninergic neurons with no GABAergic properties remain unidentified, and it is impossible to discriminate between beta-alaninergic and GABAergic properties in the CNS. Nevertheless, a variety of data suggest that beta-alanine should be considered as a small molecule neurotransmitter and should join the ranks of the other amino acid neurotransmitters. These realizations open the door for a more comprehensive evaluation of beta-alanine's neurochemistry and for its exploitation as a platform for drug design.

  11. Small-Molecule Inhibition of BRDT for Male Contraception

    PubMed Central

    Matzuk, Martin M.; McKeown, Michael R.; Filippakopoulos, Panagis; Li, Qinglei; Ma, Lang; Agno, Julio E.; Lemieux, Madeleine E.; Picaud, Sarah; Yu, Richard N.; Qi, Jun; Knapp, Stefan; Bradner, James E.

    2012-01-01

    Summary A pharmacologic approach to male contraception remains a longstanding challenge in medicine. Toward this objective, we explored the spermatogenic effects of a selective small-molecule inhibitor (JQ1) of the bromodomain and extraterminal (BET) subfamily of epigenetic reader proteins. Here, we report potent inhibition of the testis-specific member BRDT, which is essential for chromatin remodeling during spermatogenesis. Biochemical and crystallographic studies confirm that occupancy of the BRDT acetyl-lysine binding pocket by JQ1 prevents recognition of acetylated histone H4. Treatment of mice with JQ1 reduced seminiferous tubule area, testis size, and spermatozoa number and motility without affecting hormone levels. Although JQ1-treated males mate normally, inhibitory effects of JQ1 evident at the spermatocyte and round spermatid stages cause a complete and reversible contraceptive effect. These data establish a new contraceptive that can cross the blood:testis boundary and inhibit bromodomain activity during spermatogenesis, providing a lead compound targeting the male germ cell for contraception. PaperClip PMID:22901802

  12. Electrocatalytic recycling of CO2 and small organic molecules.

    PubMed

    Lee, Jaeyoung; Kwon, Youngkook; Machunda, Revocatus L; Lee, Hye Jin

    2009-10-01

    As global warming directly affects the ecosystems and humankind in the 21st century, attention and efforts are continuously being made to reduce the emission of greenhouse gases, especially carbon dioxide (CO2). In addition, there have been numerous efforts to electrochemically convert CO2 gas to small organic molecules (SOMs) and vice versa. Herein, we highlight recent advances made in the electrocatalytic recycling of CO2 and SOMs including (i) the overall trend of research activities made in this area, (ii) the relations between reduction conditions and products in the aqueous phase, (iii) the challenges in the use of gas diffusion electrodes for the continuous gas phase CO2 reduction, as well as (iv) the development of state of the art hybrid techniques for industrial applications. Perspectives geared to fully exploit the potential of zero-gap cells for CO2 reduction in the gaseous phase and the high applicability on a large scale are also presented. We envision that the hybrid system for CO2 reduction supported by sustainable solar, wind, and geothermal energies and waste heat will provide a long term reduction of greenhouse gas emissions and will allow for continued use of the abundant fossil fuels by industries and/or power plants but with zero emissions.

  13. Progress in Small Molecule Therapeutics for the Treatment of Retinoblastoma.

    PubMed

    Pritchard, Eleanor M; Dyer, Michael A; Guy, R Kiplin

    2016-01-01

    While mortality is low for intraocular retinoblastoma patients in the developed world who receive aggressive multimodal therapy, partial or full loss of vision occurs in approximately 50% of patients with advanced bilateral retinoblastoma. Therapies that preserve vision and reduce late effects are needed. Because clinical trials for retinoblastoma are difficult due to the young age of the patient population and relative rarity of the disease, robust preclinical testing of new therapies is critical. The last decade has seen advances towards identifying new therapies including the development of animal models of retinoblastoma for preclinical testing, progress in local drug delivery to reach intraocular targets, and improved understanding of the underlying biological mechanisms that give rise to retinoblastoma. This review discusses advances in these areas, with a focus on discovery and development of small molecules for the treatment of retinoblastoma, including novel targeted therapeutics such as inhibitors of the MDMX-p53 interaction (nutlin-3a), histone deacetylase (HDAC) inhibitors, and spleen tyrosine kinase (SYK) inhibitors. PMID:26202204

  14. Antiobesity Effect of a Small Molecule Repressor of RORγ.

    PubMed

    Chang, Mi Ra; He, Yuanjun; Khan, Tanya M; Kuruvilla, Dana S; Garcia-Ordonez, Ruben; Corzo, Cesar A; Unger, Thaddeus J; White, David W; Khan, Susan; Lin, Li; Cameron, Michael D; Kamenecka, Theodore M; Griffin, Patrick R

    2015-07-01

    The orphan nuclear receptor RORγ is a key regulator for T helper 17 (TH17) cell differentiation, which regulates metabolic and circadian rhythm genes in peripheral tissues. Previously, it was shown that the small molecule inverse agonist of RORγ SR1555 [1-(4-((4'-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1'-biphenyl]-4-yl)methyl)piperazin-1-yl) ethanone] suppressed TH17 differentiation and stimulated induced T regulatory (iTreg) cells. Here, we show that treatment of cultured pre-adipocyctes with SR1555 represses the expression of RORγ while leading to increased expression of FGF21 and adipoQ. Chronic administration of SR1555 to obese diabetic mice resulted in a modest reduction in food intake accompanied with significant reduction in fat mass, resulting in reduced body weight and improved insulin sensitivity. Analysis ex vivo of treated mice demonstrates that SR1555 induced expression of the thermogenic gene program in fat depots. Further studies in cultured cells showed that SR1555 inhibited activation of hormone-sensitive lipase and increased fatty acid oxidation. Combined, these results suggest that pharmacological repression of RORγ may represent a strategy for treatment of obesity by increasing thermogenesis and fatty acid oxidation, while inhibition of hormone-sensitive lipase activity results in a reduction of serum free fatty acids, leading to improved peripheral insulin sensitivity.

  15. Antiobesity Effect of a Small Molecule Repressor of RORγ

    PubMed Central

    Chang, Mi Ra; He, Yuanjun; Khan, Tanya M.; Kuruvilla, Dana S.; Garcia-Ordonez, Ruben; Corzo, Cesar A.; Unger, Thaddeus J.; White, David W.; Khan, Susan; Lin, Li; Cameron, Michael D.; Kamenecka, Theodore M.

    2015-01-01

    The orphan nuclear receptor RORγ is a key regulator for T helper 17 (TH17) cell differentiation, which regulates metabolic and circadian rhythm genes in peripheral tissues. Previously, it was shown that the small molecule inverse agonist of RORγ SR1555 [1-(4-((4′-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)-[1,1′-biphenyl]-4-yl)methyl)piperazin-1-yl) ethanone] suppressed TH17 differentiation and stimulated induced T regulatory (iTreg) cells. Here, we show that treatment of cultured pre-adipocyctes with SR1555 represses the expression of RORγ while leading to increased expression of FGF21 and adipoQ. Chronic administration of SR1555 to obese diabetic mice resulted in a modest reduction in food intake accompanied with significant reduction in fat mass, resulting in reduced body weight and improved insulin sensitivity. Analysis ex vivo of treated mice demonstrates that SR1555 induced expression of the thermogenic gene program in fat depots. Further studies in cultured cells showed that SR1555 inhibited activation of hormone-sensitive lipase and increased fatty acid oxidation. Combined, these results suggest that pharmacological repression of RORγ may represent a strategy for treatment of obesity by increasing thermogenesis and fatty acid oxidation, while inhibition of hormone-sensitive lipase activity results in a reduction of serum free fatty acids, leading to improved peripheral insulin sensitivity. PMID:25904554

  16. Small molecule glutaminase inhibitors block glutamate release from stimulated microglia.

    PubMed

    Thomas, Ajit G; O'Driscoll, Cliona M; Bressler, Joseph; Kaufmann, Walter; Rojas, Camilo J; Slusher, Barbara S

    2014-01-01

    Glutaminase plays a critical role in the generation of glutamate, a key excitatory neurotransmitter in the CNS. Excess glutamate release from activated macrophages and microglia correlates with upregulated glutaminase suggesting a pathogenic role for glutaminase. Both glutaminase siRNA and small molecule inhibitors have been shown to decrease excess glutamate and provide neuroprotection in multiple models of disease, including HIV-associated dementia (HAD), multiple sclerosis and ischemia. Consequently, inhibition of glutaminase could be of interest for treatment of these diseases. Bis-2-(5-phenylacetimido-1,2,4-thiadiazol-2-yl)ethyl sulfide (BPTES) and 6-diazo-5-oxo-l-norleucine (DON), two most commonly used glutaminase inhibitors, are either poorly soluble or non-specific. Recently, several new BPTES analogs with improved physicochemical properties were reported. To evaluate these new inhibitors, we established a cell-based microglial activation assay measuring glutamate release. Microglia-mediated glutamate levels were significantly augmented by tumor necrosis factor (TNF)-α, phorbol 12-myristate 13-acetate (PMA) and Toll-like receptor (TLR) ligands coincident with increased glutaminase activity. While several potent glutaminase inhibitors abrogated the increase in glutamate, a structurally related analog devoid of glutaminase activity was unable to block the increase. In the absence of glutamine, glutamate levels were significantly attenuated. These data suggest that the in vitro microglia assay may be a useful tool in developing glutaminase inhibitors of therapeutic interest. PMID:24269238

  17. Progress in Small Molecule Therapeutics for the Treatment of Retinoblastoma.

    PubMed

    Pritchard, Eleanor M; Dyer, Michael A; Guy, R Kiplin

    2016-01-01

    While mortality is low for intraocular retinoblastoma patients in the developed world who receive aggressive multimodal therapy, partial or full loss of vision occurs in approximately 50% of patients with advanced bilateral retinoblastoma. Therapies that preserve vision and reduce late effects are needed. Because clinical trials for retinoblastoma are difficult due to the young age of the patient population and relative rarity of the disease, robust preclinical testing of new therapies is critical. The last decade has seen advances towards identifying new therapies including the development of animal models of retinoblastoma for preclinical testing, progress in local drug delivery to reach intraocular targets, and improved understanding of the underlying biological mechanisms that give rise to retinoblastoma. This review discusses advances in these areas, with a focus on discovery and development of small molecules for the treatment of retinoblastoma, including novel targeted therapeutics such as inhibitors of the MDMX-p53 interaction (nutlin-3a), histone deacetylase (HDAC) inhibitors, and spleen tyrosine kinase (SYK) inhibitors.

  18. Discovery of a small molecule that inhibits bacterial ribosome biogenesis

    PubMed Central

    Stokes, Jonathan M; Davis, Joseph H; Mangat, Chand S; Williamson, James R; Brown, Eric D

    2014-01-01

    While small molecule inhibitors of the bacterial ribosome have been instrumental in understanding protein translation, no such probes exist to study ribosome biogenesis. We screened a diverse chemical collection that included previously approved drugs for compounds that induced cold sensitive growth inhibition in the model bacterium Escherichia coli. Among the most cold sensitive was lamotrigine, an anticonvulsant drug. Lamotrigine treatment resulted in the rapid accumulation of immature 30S and 50S ribosomal subunits at 15°C. Importantly, this was not the result of translation inhibition, as lamotrigine was incapable of perturbing protein synthesis in vivo or in vitro. Spontaneous suppressor mutations blocking lamotrigine activity mapped solely to the poorly characterized domain II of translation initiation factor IF2 and prevented the binding of lamotrigine to IF2 in vitro. This work establishes lamotrigine as a widely available chemical probe of bacterial ribosome biogenesis and suggests a role for E. coli IF2 in ribosome assembly. DOI: http://dx.doi.org/10.7554/eLife.03574.001 PMID:25233066

  19. Modulated iontophoretic delivery of small and large molecules through microchannels.

    PubMed

    Kumar, Vijay; Banga, Ajay K

    2012-09-15

    The objective of this work was to modulate transdermal drug delivery by iontophoresis though skin microchannels created by microneedles. Calcein and human growth hormone were used as a model small and large molecule, respectively. In vitro permeation studies were performed on porcine ear skin under three different settings: (a) modulated iontophoresis alone, (b) pretreatment with microneedles and (c) combination of microneedles pretreatment and modulated iontophoresis. For modulated iontophoresis, 0.5 mA/cm(2) current was applied for 1h each at 2nd and 6th hour of the study. Methylene blue staining, calcein imaging and pore permeability index suggested maltose microneedles created uniform microchannels in skin. Application of iontophoresis provided two peaks in flux of 1.04 μg/(cm(2)h) at 4th hour and 2.09 μg/(cm(2)h) at 8th hour of study for calcein. These peaks in flux were significant higher when skin was pretreated with microneedles (p<0.05). Similarly, for human growth hormone, modulation in transdermal flux was achieved with combination of microneedles and iontophoresis. This combination also provided significant increase in cumulative amount of calcein and human growth hormone delivered as compared to microneedles or iontophoresis alone (p<0.05). Therefore, iontophoresis can be used to modulate drug delivery across skin microchannels created by microneedles.

  20. JAKpot! New small molecules in autoimmune and inflammatory diseases

    PubMed Central

    Ghoreschi, Kamran; Gadina, Massimo

    2013-01-01

    Cytokines are key mediators of the development and homeostasis of hematopoietic cells, critical for host defense, but also for the development of autoimmune and inflammatory diseases like psoriasis or rheumatoid arthritis (RA). Blocking cytokines activity by interfering with the ligand-receptor association has been successfully employed to treat several immune disorders. A subgroup of cytokines signals through receptors requiring the association with a family of cytoplasmic protein tyrosine kinases known as Janus kinases (Jaks). Jaks have recently gained significant attention as therapeutic targets in inflammation and autoimmunity and several Jak inhibitory small molecules have been developed. The first two Jak inhibitors, tofacitinib and ruxolitinib, have been approved for the treatment of RA and primary myelofibrosis, respectively. Efficacy and safety data suggest that some of these oral Jak inhibitors as well as their topical formulations may soon enter the daily clinical practice for treating patients with psoriasis, lupus erythematosus or other inflammatory skin diseases. While biologics typically target one single cytokine, these new immunomodulators can inhibit signals from multiple cytokines intracellularly and therefore could be useful when other therapies are ineffective. Thus, Jak inhibitors may replace some traditional immunosuppressive agents and help patients not responding to previous therapies. PMID:24131352

  1. Novel Small Molecule Entry Inhibitors of Ebola Virus

    PubMed Central

    Basu, Arnab; Mills, Debra M.; Mitchell, Daniel; Ndungo, Esther; Williams, John D.; Herbert, Andrew S.; Dye, John M.; Moir, Donald T.; Chandran, Kartik; Patterson, Jean L.; Rong, Lijun; Bowlin, Terry L.

    2015-01-01

    Background. The current Ebola virus (EBOV) outbreak has highlighted the troubling absence of available antivirals or vaccines to treat infected patients and stop the spread of EBOV. The EBOV glycoprotein (GP) plays critical roles in the early stage of virus infection, including receptor binding and membrane fusion, making it a potential target for the development of anti-EBOV drugs. We report the identification of 2 novel EBOV inhibitors targeting viral entry. Methods. To identify small molecule inhibitors of EBOV entry, we carried out a cell-based high-throughput screening using human immunodeficiency virus–based pseudotyped viruses expressing EBOV-GP. Two compounds were identified, and mechanism-of-action studies were performed using immunoflourescence, AlphaLISA, and enzymatic assays for cathepsin B inhibition. Results. We report the identification of 2 novel entry inhibitors. These inhibitors (1) inhibit EBOV infection (50% inhibitory concentration, approximately 0.28 and approximately 10 µmol/L) at a late stage of entry, (2) induce Niemann-Pick C phenotype, and (3) inhibit GP–Niemann-Pick C1 (NPC1) protein interaction. Conclusions. We have identified 2 novel EBOV inhibitors, MBX2254 and MBX2270, that can serve as starting points for the development of an anti-EBOV therapeutic agent. Our findings also highlight the importance of NPC1-GP interaction in EBOV entry and the attractiveness of NPC1 as an antifiloviral therapeutic target. PMID:26206510

  2. Ion Momentum Imaging of Dissociative Electron Attachment to Small Molecules

    NASA Astrophysics Data System (ADS)

    Fogle, Michael

    2015-09-01

    In recent years, low energy dissociative electron attachment (DEA) interactions have been of interest to varying biological and technological applications. To study the dynamics resulting from DEA, we used an ion-momentum imaging apparatus based on the Cold Target Recoil Ion Momentum Spectroscopy (COLTRIMS) technique in which a molecular beam is crossed by a pulsed electron beam. The beam interaction takes place in a 4 π pulsed electrostatic spectrometer that collects the anion fragments resulting from DEA. The molecular beam is formed by a supersonic expansion which results in a well-localized and cold target. Using this apparatus we have investigated the DEA dynamics for several small molecules: CO2 at the 4 eV shape resonance and the 8 eV Feshbach resonance; N2O at the 2.3 eV shape resonance; HCCH at the 3 eV shape resonance; and CF4 near the 7 eV resonance. An overview of these experimental ion-momentum results will be compared to ab initio electronic structure and fixed-nuclei scattering calculations to gauge the resulting dynamics driven by DEA. In many cases, conical intersections play a pivotal role in driving the dynamics. Some of these systems exhibit non-axial recoil conditions indicative of a bending dynamics in the transitory negative ion state while others exhibit a direct axial recoil dissociation without any bending. This work is supported by the National Science Foundation under Contract NSF-PHYS1404366.

  3. A Chemical Screen Identifies Small Molecules that Regulate Hepcidin Expression

    PubMed Central

    Gaun, Vera; Patchen, Bonnie; Volovetz, Josephine; Zhen, Aileen W.; Andreev, Aleksandr; Pollastri, Michael P.; Fraenkel, Paula G.

    2014-01-01

    Hepcidin, a peptide hormone produced in the liver, decreases intestinal iron absorption and macrophage iron release via effects on ferroportin. Bone morphogenic protein and Stat3 signaling regulate Hepcidin's transcription. Hepcidin is a potential drug target for patients with iron overload syndromes because its levels are inappropriately low in these individuals. To generate a tool for identifying small molecules that modulate Hepcidin expression, we stably transfected human hepatocytes (HepG2) cells with a reporter construct containing 2.7 kilobases of the human Hepcidin promoter upstream of a firefly reporter gene. We used high throughput methods to screen 10,169 chemicals in duplicate for their effect on Hepcidin expression and cell viability. Regulators were identified as chemicals that caused a change >3 standard deviations above or >1.5 standard deviations below the mean of the other chemicals (z-score >3 or <-1.5), while not adversely affecting cell viability, quantified by fluorescence assay. Following validation assays, we identified 16 chemicals in a broad range of functional classes that promote Hepcidin expression. All of the chemicals identified increased expression of bone morphogenic protein-dependent and/or Stat3-dependent genes, however none of them strongly increased phosphorylation of Smad1,5,8 or Stat3. PMID:24998898

  4. A small-molecule photoactivatable optical sensor of transmembrane potential

    PubMed Central

    Grenier, Vincent; Walker, Alison S.; Miller, Evan W.

    2015-01-01

    This paper discloses the design, synthesis, and imaging applications of the first member of a new class of SPOTs, small-molecule photoactivatable optical sensors of transmembrane potential. SPOT2.1.Cl features an established voltage-sensitive dye, VoltageFluor2.1.Cl—or—VF capped with a dimethoxy-o-nitrobenzyl (DMNB) caging group to effectively eliminate fluorescence of the VF dye prior to uncaging. SPOT2.1.Cl localizes to cell membranes and displays weak fluorescence until photoactivated. Illumination generates the parent VF dye which then optically reports on changes in the membrane voltage. After photoactivation with spatially restricted light, SPOT2.1.Cl-loaded cells display bright, voltage-sensitive fluorescence associated with the plasma membrane, while neighboring cells remain dark. Activated SPOT reports on action potentials in single trials. SPOT can be activated in neuron cell bodies or uncaged in dendrites to enable structural tracing via “backfilling” of the dye to the soma, followed by functional imaging in the labeled cell. The combination of cellular specificity achieved through spatially-defined patterns of illumination, coupled with the fast, sensitive, and non-capacitive voltage sensing characteristics of VF dyes makes SPOT2.1.Cl a useful tool for interrogating both structure and function of neuronal systems. PMID:26247778

  5. Application of Optical Biosensors in Small-Molecule Screening Activities

    PubMed Central

    Geschwindner, Stefan; Carlsson, Johan F.; Knecht, Wolfgang

    2012-01-01

    The last two decades have seen remarkable progress and improvements in optical biosensor systems such that those are currently seen as an important and value-adding component of modern drug screening activities. In particular the introduction of microplate-based biosensor systems holds the promise to match the required throughput without compromising on data quality thus representing a sought-after complement to traditional fluidic systems. This article aims to highlight the application of the two most prominent optical biosensor technologies, namely surface plasmon resonance (SPR) and optical waveguide grating (OWG), in small-molecule screening and will present, review and discuss the advantages and disadvantages of different assay formats on these platforms. A particular focus will be on the specific advantages of the inhibition in solution assay (ISA) format in contrast to traditional direct binding assays (DBA). Furthermore we will discuss different application areas for both fluidic as well as plate-based biosensor systems by considering the individual strength of the platforms. PMID:22666031

  6. Molecular locks and keys: the role of small molecules in phytohormone research

    PubMed Central

    Fonseca, Sandra; Rosado, Abel; Vaughan-Hirsch, John; Bishopp, Anthony; Chini, Andrea

    2014-01-01

    Plant adaptation, growth and development rely on the integration of many environmental and endogenous signals that collectively determine the overall plant phenotypic plasticity. Plant signaling molecules, also known as phytohormones, are fundamental to this process. These molecules act at low concentrations and regulate multiple aspects of plant fitness and development via complex signaling networks. By its nature, phytohormone research lies at the interface between chemistry and biology. Classically, the scientific community has always used synthetic phytohormones and analogs to study hormone functions and responses. However, recent advances in synthetic and combinational chemistry, have allowed a new field, plant chemical biology, to emerge and this has provided a powerful tool with which to study phytohormone function. Plant chemical biology is helping to address some of the most enduring questions in phytohormone research such as: Are there still undiscovered plant hormones? How can we identify novel signaling molecules? How can plants activate specific hormone responses in a tissue-specific manner? How can we modulate hormone responses in one developmental context without inducing detrimental effects on other processes? The chemical genomics approaches rely on the identification of small molecules modulating different biological processes and have recently identified active forms of plant hormones and molecules regulating many aspects of hormone synthesis, transport and response. We envision that the field of chemical genomics will continue to provide novel molecules able to elucidate specific aspects of hormone-mediated mechanisms. In addition, compounds blocking specific responses could uncover how complex biological responses are regulated. As we gain information about such compounds we can design small alterations to the chemical structure to further alter specificity, enhance affinity or modulate the activity of these compounds. PMID:25566283

  7. Molecular locks and keys: the role of small molecules in phytohormone research.

    PubMed

    Fonseca, Sandra; Rosado, Abel; Vaughan-Hirsch, John; Bishopp, Anthony; Chini, Andrea

    2014-01-01

    Plant adaptation, growth and development rely on the integration of many environmental and endogenous signals that collectively determine the overall plant phenotypic plasticity. Plant signaling molecules, also known as phytohormones, are fundamental to this process. These molecules act at low concentrations and regulate multiple aspects of plant fitness and development via complex signaling networks. By its nature, phytohormone research lies at the interface between chemistry and biology. Classically, the scientific community has always used synthetic phytohormones and analogs to study hormone functions and responses. However, recent advances in synthetic and combinational chemistry, have allowed a new field, plant chemical biology, to emerge and this has provided a powerful tool with which to study phytohormone function. Plant chemical biology is helping to address some of the most enduring questions in phytohormone research such as: Are there still undiscovered plant hormones? How can we identify novel signaling molecules? How can plants activate specific hormone responses in a tissue-specific manner? How can we modulate hormone responses in one developmental context without inducing detrimental effects on other processes? The chemical genomics approaches rely on the identification of small molecules modulating different biological processes and have recently identified active forms of plant hormones and molecules regulating many aspects of hormone synthesis, transport and response. We envision that the field of chemical genomics will continue to provide novel molecules able to elucidate specific aspects of hormone-mediated mechanisms. In addition, compounds blocking specific responses could uncover how complex biological responses are regulated. As we gain information about such compounds we can design small alterations to the chemical structure to further alter specificity, enhance affinity or modulate the activity of these compounds.

  8. Modulation of neurogenesis by targeting epigenetic enzymes using small molecules: an overview.

    PubMed

    Swaminathan, Amrutha; Kumar, Manoj; Halder Sinha, Sarmistha; Schneider-Anthony, Anne; Boutillier, Anne-Laurence; Kundu, Tapas K

    2014-12-17

    Neurogenesis consists of a plethora of complex cellular processes including neural stem cell (NSC) proliferation, migration, maturation or differentiation to neurons, and finally integration into the pre-existing neural circuits in the brain, which are temporally regulated and coordinated sequentially. Mammalian neurogenesis begins during embryonic development and continues in postnatal brain (adult neurogenesis). It is now evident that adult neurogenesis is driven by extracellular and intracellular signaling pathways, where epigenetic modifications like reversible histone acetylation, methylation, as well as DNA methylation play a vital role. Epigenetic regulation of gene expression during neural development is governed mainly by histone acetyltransferases (HATs), histone methyltransferase (HMTs), DNA methyltransferases (DNMTs), and also the enzymes for reversal, like histone deacetylases (HDACs), and many of these have also been shown to be involved in the regulation of adult neurogenesis. The contribution of these epigenetic marks to neurogenesis is increasingly being recognized, through knockout studies and small molecule modulator based studies. These small molecules are directly involved in regeneration and repair of neurons, and not only have applications from a therapeutic point of view, but also provide a tool to study the process of neurogenesis itself. In the present Review, we will focus on small molecules that act predominantly on epigenetic enzymes to enhance neurogenesis and neuroprotection and discuss the mechanism and recent advancements in their synthesis, targeting, and biology.

  9. Anti-vascular endothelial growth factor treatment normalizes tuberculosis granuloma vasculature and improves small molecule delivery.

    PubMed

    Datta, Meenal; Via, Laura E; Kamoun, Walid S; Liu, Chong; Chen, Wei; Seano, Giorgio; Weiner, Danielle M; Schimel, Daniel; England, Kathleen; Martin, John D; Gao, Xing; Xu, Lei; Barry, Clifton E; Jain, Rakesh K

    2015-02-10

    Tuberculosis (TB) causes almost 2 million deaths annually, and an increasing number of patients are resistant to existing therapies. Patients who have TB require lengthy chemotherapy, possibly because of poor penetration of antibiotics into granulomas where the bacilli reside. Granulomas are morphologically similar to solid cancerous tumors in that they contain hypoxic microenvironments and can be highly fibrotic. Here, we show that TB-infected rabbits have impaired small molecule distribution into these disease sites due to a functionally abnormal vasculature, with a low-molecular-weight tracer accumulating only in peripheral regions of granulomatous lesions. Granuloma-associated vessels are morphologically and spatially heterogeneous, with poor vessel pericyte coverage in both human and experimental rabbit TB granulomas. Moreover, we found enhanced VEGF expression in both species. In tumors, antiangiogenic, specifically anti-VEGF, treatments can "normalize" their vasculature, reducing hypoxia and creating a window of opportunity for concurrent chemotherapy; thus, we investigated vessel normalization in rabbit TB granulomas. Treatment of TB-infected rabbits with the anti-VEGF antibody bevacizumab significantly decreased the total number of vessels while normalizing those vessels that remained. As a result, hypoxic fractions of these granulomas were reduced and small molecule tracer delivery was increased. These findings demonstrate that bevacizumab treatment promotes vascular normalization, improves small molecule delivery, and decreases hypoxia in TB granulomas, thereby providing a potential avenue to improve delivery and efficacy of current treatment regimens.

  10. Small-molecule G-quadruplex interactions: Systematic exploration of conformational space using multiple molecular dynamics.

    PubMed

    Husby, Jarmila; Todd, Alan K; Platts, James A; Neidle, Stephen

    2013-12-01

    G-quadruplexes are higher-order four-stranded structures formed from repetitive guanine-containing tracts in nucleic acids. They comprise a core of stacked guanine-quartets linked by loops of length and sequence that vary with the context in which the quadruplex sequence occurs. Such sequences can be found in a number of genomic environments; at the telomeric ends of eukaryotic chromosomes, in promoter regions, in untranslated sequences and in open reading frames. Quadruplex formation can inhibit telomere maintenance, transcription and translation, especially when enhanced by quadruplex-binding small molecules, and quadruplex targeting is currently of considerable interest. The available experimental structural data shows that quadruplexes can have high conformational flexibility, especially in loop regions, which has hampered attempts to use high-throughput docking to find quadruplex-binding small-molecules with new scaffolds or to optimize existing ones with structure-based design methods. An approach to overcome the challenge of quadruplex conformational flexibility is presented here, which uses a combined multiple molecular dynamics and sampling approach. Two test small molecules have been used, RHPS4 and pyridostatin, which themselves have contrasting degrees of conformational flexibility.

  11. Phosphate binding energy and catalysis by small and large molecules.

    PubMed

    Morrow, Janet R; Amyes, Tina L; Richard, John P

    2008-04-01

    Catalysis is an important process in chemistry and enzymology. The rate acceleration for any catalyzed reaction is the difference between the activation barriers for the uncatalyzed (Delta G(HO)(#)) and catalyzed (Delta G(Me)(#)) reactions, which corresponds to the binding energy (Delta G(S)(#) = Delta G(Me)(#)-Delta G(HO)(#)) for transfer of the reaction transition state from solution to the catalyst. This transition state binding energy is a fundamental descriptor of catalyzed reactions, and its evaluation is necessary for an understanding of any and all catalytic processes. We have evaluated the transition state binding energies obtained from interactions between low molecular weight metal ion complexes or high molecular weight protein catalysts and the phosphate group of bound substrate. Work on catalysis by small molecules is exemplified by studies on the mechanism of action of Zn2(1)(H2O). A binding energy of Delta G(S)(#) = -9.6 kcal/mol was determined for Zn2(1)(H2O)-catalyzed cleavage of the RNA analogue HpPNP. The pH-rate profile for this cleavage reaction showed that there is optimal catalytic activity at high pH, where the catalyst is in the basic form [Zn2(1)(HO-)]. However, it was also shown that the active form of the catalyst is Zn2(1)(H2O) and that this recognizes the C2-oxygen-ionized substrate in the cleavage reaction. The active catalyst Zn2(1)(H2O) shows a high affinity for oxyphosphorane transition state dianions and a stable methyl phosphate transition state analogue, compared with the affinity for phosphate monoanion substrates. The transition state binding energies, Delta G(S)(#), for cleavage of HpPNP catalyzed by a variety of Zn2+ and Eu3+ metal ion complexes reflect the increase in the catalytic activity with increasing total positive charge at the catalyst. These values of Delta G(S)(#) are affected by interactions between the metal ion and its ligands, but these effects are small in comparison with Delta G(S)(#) observed for catalysis

  12. Small-molecule trkB agonists promote axon regeneration in cut peripheral nerves

    PubMed Central

    English, Arthur W.; Liu, Kevin; Nicolini, Jennifer M.; Mulligan, Amanda M.; Ye, Keqiang

    2013-01-01

    Treatments with two-small molecule tropomyosin receptor kinase B (trkB) ligands, 7,8 dihydroxyflavone (7,8 DHF) and deoxygedunin, were evaluated for their ability to promote the regeneration of cut axons in injured peripheral nerves in mice in which sensory and motor axons are marked by YFP. Peripheral nerves were cut and repaired with grafts from strain-matched, nonfluorescent donors and secured in place with fibrin glue. Lengths of profiles of regenerating YFP+ axons were measured 2 wk later from confocal images. Axon regeneration was enhanced when the fibrin glue contained dilutions of 500-nM solution of either small-molecule trkB agonist. In mice in which the neurotrophin receptor trkB is knocked out selectively in neurons, axon regeneration is very weak, and topical treatment with 7,8 DHF had no effect on axon regeneration. Similar treatments with deoxygedunin had only a modest effect. In conditional BDNF knockout mice, topical treatments with either 7,8 DHF or deoxygedunin resulted in a reversal of the poor regeneration found in controls and produced significant enhancement of regeneration. In WT mice treated with 2 wk of daily i.p. injections of either 7,8 DHF or deoxygedunin (5 mg/kg), regenerating axon profiles were nearly twice as long as in controls. Restoration of direct muscle responses evoked by sciatic nerve stimulation to pretransection levels over an 8-wk survival period was found only in the treated mice. Treatments with either small-molecule trkB agonist enhanced axon regeneration and muscle reinnervation after peripheral nerve injuries. PMID:24043773

  13. Small-molecule trkB agonists promote axon regeneration in cut peripheral nerves.

    PubMed

    English, Arthur W; Liu, Kevin; Nicolini, Jennifer M; Mulligan, Amanda M; Ye, Keqiang

    2013-10-01

    Treatments with two-small molecule tropomyosin receptor kinase B (trkB) ligands, 7,8 dihydroxyflavone (7,8 DHF) and deoxygedunin, were evaluated for their ability to promote the regeneration of cut axons in injured peripheral nerves in mice in which sensory and motor axons are marked by YFP. Peripheral nerves were cut and repaired with grafts from strain-matched, nonfluorescent donors and secured in place with fibrin glue. Lengths of profiles of regenerating YFP(+) axons were measured 2 wk later from confocal images. Axon regeneration was enhanced when the fibrin glue contained dilutions of 500-nM solution of either small-molecule trkB agonist. In mice in which the neurotrophin receptor trkB is knocked out selectively in neurons, axon regeneration is very weak, and topical treatment with 7,8 DHF had no effect on axon regeneration. Similar treatments with deoxygedunin had only a modest effect. In conditional BDNF knockout mice, topical treatments with either 7,8 DHF or deoxygedunin resulted in a reversal of the poor regeneration found in controls and produced significant enhancement of regeneration. In WT mice treated with 2 wk of daily i.p. injections of either 7,8 DHF or deoxygedunin (5 mg/kg), regenerating axon profiles were nearly twice as long as in controls. Restoration of direct muscle responses evoked by sciatic nerve stimulation to pretransection levels over an 8-wk survival period was found only in the treated mice. Treatments with either small-molecule trkB agonist enhanced axon regeneration and muscle reinnervation after peripheral nerve injuries. PMID:24043773

  14. Induction of sensory neurons from neuroepithelial stem cells by the ISX9 small molecule.

    PubMed

    Ali, Rouknuddin Qasim; Blomberg, Evelina; Falk, Anna; Ährlund-Richter, Lars; Ulfendahl, Mats

    2016-01-01

    Hearing impairment most often involves loss of sensory hair cells and auditory neurons. As this loss is permanent in humans, a cell therapy approach has been suggested to replace damaged cells. It is thus of interest to generate lineage restricted progenitor cells appropriate for cell based therapies. Human long-term self-renewing neuroepithelial stem (lt-NES) cell lines exhibit in vitro a developmental potency to differentiate into CNS neural lineages, and importantly lack this potency in vivo, i.e do not form teratomas. Small-molecules-driven differentiation is today an established route obtain specific cell derivatives from stem cells. In this study, we have investigated the effects of three small molecules SB431542, ISX9 and Metformin to direct differentiation of lt-NES cells into sensory neurons. Exposure of lt-NES cells to Metformin or SB431542 did not induce any marked induction of markers for sensory neurons. However, a four days exposure to the ISX9 small molecule resulted in reduced expression of NeuroD1 mRNA as well as enhanced mRNA levels of GATA3, a marker and important player in auditory neuron specification and development. Subsequent culture in the presence of the neurotrophic factors BDNF and NT3 for another seven days yielded a further increase of mRNA expression for GATA3. This regimen resulted in a frequency of up to 25-30% of cells staining positive for Brn3a/Tuj1. We conclude that an approach with ISX9 small molecule induction of lt-NES cells into auditory like neurons may thus be an attractive route for obtaining safe cell replacement therapy of sensorineural hearing loss. PMID:27335699

  15. Identification of small molecule binding sites within proteins using phage display technology.

    SciTech Connect

    Rodi, D. J.; Agoston, G. E.; Manon, R.; Lapcevich, R.; Green, S. J.; Makowski, L.; Biosciences Division; EntreMed Inc.; Florida State Univ.

    2001-11-01

    Affinity selection of peptides displayed on phage particles was used as the basis for mapping molecular contacts between small molecule ligands and their protein targets. Analysis of the crystal structures of complexes between proteins and small molecule ligands revealed that virtually all ligands of molecular weight 300 Da or greater have a continuous binding epitope of 5 residues or more. This observation led to the development of a technique for binding site identification which involves statistical analysis of an affinity-selected set of peptides obtained by screening of libraries of random, phage-displayed peptides against small molecules attached to solid surfaces. A random sample of the selected peptides is sequenced and used as input for a similarity scanning program which calculates cumulative similarity scores along the length of the putative receptor. Regions of the protein sequence exhibiting the highest similarity with the selected peptides proved to have a high probability of being involved in ligand binding. This technique has been employed successfully to map the contact residues in multiple known targets of the anticancer drugs paclitaxel (Taxol), docetaxel (Taxotere) and 2-methoxyestradiol and the glycosaminoglycan hyaluronan, and to identify a novel paclitaxel receptor [1]. These data corroborate the observation that the binding properties of peptides displayed on the surface of phage particles can mimic the binding properties of peptides in naturally occurring proteins. It follows directly that structural context is relatively unimportant for determining the binding properties of these disordered peptides. This technique represents a novel, rapid, high resolution method for identifying potential ligand binding sites in the absence of three-dimensional information and has the potential to greatly enhance the speed of development of novel small molecule pharmaceuticals.

  16. A Remote Arene-Binding Site on Prostate Specific Membrane Antigen Revealed by Antibody-Recruiting Small Molecules

    SciTech Connect

    Zhang, Andrew X.; Murelli, Ryan P.; Barinka, Cyril; Michel, Julien; Cocleaza, Alexandra; Jorgensen, William L.; Lubkowski, Jacek; Spiegel, David A.

    2010-09-27

    Prostate specific membrane antigen (PSMA) is a membrane-bound glutamate carboxypeptidase overexpressed in many forms of prostate cancer. Our laboratory has recently disclosed a class of small molecules, called ARM-Ps (antibody-recruiting molecule targeting prostate cancer) that are capable of enhancing antibody-mediated immune recognition of prostate cancer cells. Interestingly, during the course of these studies, we found ARM-Ps to exhibit extraordinarily high potencies toward PSMA, compared to previously reported inhibitors. Here, we report in-depth biochemical, crystallographic, and computational investigations which elucidate the origin of the observed affinity enhancement. These studies reveal a previously unreported arene-binding site on PSMA, which we believe participates in an aromatic stacking interaction with ARMs. Although this site is composed of only a few amino acid residues, it drastically enhances small molecule binding affinity. These results provide critical insights into the design of PSMA-targeted small molecules for prostate cancer diagnosis and treatment; more broadly, the presence of similar arene-binding sites throughout the proteome could prove widely enabling in the optimization of small molecule-protein interactions.

  17. Small molecule inhibitors of IRES-mediated translation

    PubMed Central

    Vaklavas, Christos; Meng, Zheng; Choi, Hyoungsoo; Grizzle, William E; Zinn, Kurt R; Blume, Scott W

    2015-01-01

    Many genes controlling cell proliferation and survival (those most important to cancer biology) are now known to be regulated specifically at the translational (RNA to protein) level. The internal ribosome entry site (IRES) provides a mechanism by which the translational efficiency of an individual or group of mRNAs can be regulated independently of the global controls on general protein synthesis. IRES-mediated translation has been implicated as a significant contributor to the malignant phenotype and chemoresistance, however there has been no effective means by which to interfere with this specialized mode of protein synthesis. A cell-based empirical high-throughput screen was performed in attempt to identify compounds capable of selectively inhibiting translation mediated through the IGF1R IRES. Results obtained using the bicistronic reporter system demonstrate selective inhibition of second cistron translation (IRES-dependent). The lead compound and its structural analogs completely block de novo IGF1R protein synthesis in genetically-unmodified cells, confirming activity against the endogenous IRES. Spectrum of activity extends beyond IGF1R to include the c-myc IRES. The small molecule IRES inhibitor differentially modulates synthesis of the oncogenic (p64) and growth-inhibitory (p67) isoforms of Myc, suggesting that the IRES controls not only translational efficiency, but also choice of initiation codon. Sustained IRES inhibition has profound, detrimental effects on human tumor cells, inducing massive (>99%) cell death and complete loss of clonogenic survival in models of triple-negative breast cancer. The results begin to reveal new insights into the inherent complexity of gene-specific translational regulation, and the importance of IRES-mediated translation to tumor cell biology. PMID:26177060

  18. Spectroscopy and dynamics of small molecules with large amplitude motion

    NASA Astrophysics Data System (ADS)

    Dawadi, Mahesh B.

    This dissertation addresses the effect of large amplitude vibrations (LAV or LAVs) on the other small amplitude vibrations (SAVs) for investigating the vibrational dynamics on the molecular systems ranging from G6 to G12 symmetry, including methanol, methylamine, nitromethane, 2-methylmalonaldehyde (2-MMA) and 5-methyltropolone (5-MT). The study of the high-resolution infrared spectrum of methylamine (CH 3NH2) in the nu11 asymmetric CH stretch region (2965-3005 cm1) under sub-Doppler slit-jet conditions reveals that the torsion-inversion tunneling patterns are heavily impacted by perturbations and hence different both from the ground state and from the theoretical predictions. Two torsion-inversion tunneling models are reported for studying the high-barrier tunneling behavior in the methyl CH stretch vibrationally excited states of the molecules with G12 symmetry. These models predict the inverted tunneling pattern of the four tunneling states (A, B, E 1 and E2 symmetries) in the asymmetric CH stretch excited states relative to the ground state. The trends in the patterns relative to tunneling rates and coupling parameters are presented and comparisons are made to the available experimental data. Additionally, a remarkable result that follows from the approximate adiabatic separation of the fast and slow vibrations in methanol is the existence of vibrational conical intersections (CIs) where the surfaces representing the two asymmetric CH stretches meet like the points of two cones touching point-to-point. The CIs occur in the slow coordinates space consisting of the torsion and the COH bend. Finally, the analysis of the high-resolution synchrotron based Fourier transform infrared (FTIR) spectrum for NO2 in-plane rock, nu 7, band of nitromethane reveals that the rotational energy pattern in the lowest torsional state (m' = 0) of the upper vibrational state is similar relative to the vibrational ground state.

  19. Antidiabetic effects of glucokinase regulatory protein small-molecule disruptors

    NASA Astrophysics Data System (ADS)

    Lloyd, David J.; St Jean, David J.; Kurzeja, Robert J. M.; Wahl, Robert C.; Michelsen, Klaus; Cupples, Rod; Chen, Michelle; Wu, John; Sivits, Glenn; Helmering, Joan; Komorowski, Renée; Ashton, Kate S.; Pennington, Lewis D.; Fotsch, Christopher; Vazir, Mukta; Chen, Kui; Chmait, Samer; Zhang, Jiandong; Liu, Longbin; Norman, Mark H.; Andrews, Kristin L.; Bartberger, Michael D.; van, Gwyneth; Galbreath, Elizabeth J.; Vonderfecht, Steven L.; Wang, Minghan; Jordan, Steven R.; Véniant, Murielle M.; Hale, Clarence

    2013-12-01

    Glucose homeostasis is a vital and complex process, and its disruption can cause hyperglycaemia and type II diabetes mellitus. Glucokinase (GK), a key enzyme that regulates glucose homeostasis, converts glucose to glucose-6-phosphate in pancreatic β-cells, liver hepatocytes, specific hypothalamic neurons, and gut enterocytes. In hepatocytes, GK regulates glucose uptake and glycogen synthesis, suppresses glucose production, and is subject to the endogenous inhibitor GK regulatory protein (GKRP). During fasting, GKRP binds, inactivates and sequesters GK in the nucleus, which removes GK from the gluconeogenic process and prevents a futile cycle of glucose phosphorylation. Compounds that directly hyperactivate GK (GK activators) lower blood glucose levels and are being evaluated clinically as potential therapeutics for the treatment of type II diabetes mellitus. However, initial reports indicate that an increased risk of hypoglycaemia is associated with some GK activators. To mitigate the risk of hypoglycaemia, we sought to increase GK activity by blocking GKRP. Here we describe the identification of two potent small-molecule GK-GKRP disruptors (AMG-1694 and AMG-3969) that normalized blood glucose levels in several rodent models of diabetes. These compounds potently reversed the inhibitory effect of GKRP on GK activity and promoted GK translocation both in vitro (isolated hepatocytes) and in vivo (liver). A co-crystal structure of full-length human GKRP in complex with AMG-1694 revealed a previously unknown binding pocket in GKRP distinct from that of the phosphofructose-binding site. Furthermore, with AMG-1694 and AMG-3969 (but not GK activators), blood glucose lowering was restricted to diabetic and not normoglycaemic animals. These findings exploit a new cellular mechanism for lowering blood glucose levels with reduced potential for hypoglycaemic risk in patients with type II diabetes mellitus.

  20. Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products.

    PubMed

    Cui, Xiaojie; Lin, Sen; Yuan, Gu

    2012-05-01

    The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene. PMID:22405847

  1. Theoretical studies of photodissociation of small molecules of astrophysical importance

    NASA Technical Reports Server (NTRS)

    Saxon, R. P.

    1983-01-01

    The radicals and ions observed in comets result from photodissociation and photoionization of molecules. According to current models, a comet is composed chiefly of a large, solid nucelus of frozen gases (parent molecules) such as H2O, HCN, and NH3. It is believed comets were formed at the same time and in the same region of space as the major planets and that their chemical composition is the same as that of the early solar system. As the comet nears the Sun, the surface heats up, liberating the frozen gases as well as dust particles. Solar radiation photodissociates the parent molecules into fragments that are observed by resonance fluorescence. Both polyatomic molecules, present in the interstellar medium, and cometary radicals were observed. Using laboratory photo-dissociation data and computer models, astronomers are attempting to identify the parent molecules that account for all observed radicals and ions.

  2. The small-voxel tracking algorithm for simulating chemical reactions among diffusing molecules

    SciTech Connect

    Gillespie, Daniel T. Gillespie, Carol A.; Seitaridou, Effrosyni

    2014-12-21

    Simulating the evolution of a chemically reacting system using the bimolecular propensity function, as is done by the stochastic simulation algorithm and its reaction-diffusion extension, entails making statistically inspired guesses as to where the reactant molecules are at any given time. Those guesses will be physically justified if the system is dilute and well-mixed in the reactant molecules. Otherwise, an accurate simulation will require the extra effort and expense of keeping track of the positions of the reactant molecules as the system evolves. One molecule-tracking algorithm that pays careful attention to the physics of molecular diffusion is the enhanced Green's function reaction dynamics (eGFRD) of Takahashi, Tănase-Nicola, and ten Wolde [Proc. Natl. Acad. Sci. U.S.A. 107, 2473 (2010)]. We introduce here a molecule-tracking algorithm that has the same theoretical underpinnings and strategic aims as eGFRD, but a different implementation procedure. Called the small-voxel tracking algorithm (SVTA), it combines the well known voxel-hopping method for simulating molecular diffusion with a novel procedure for rectifying the unphysical predictions of the diffusion equation on the small spatiotemporal scale of molecular collisions. Indications are that the SVTA might be more computationally efficient than eGFRD for the problematic class of non-dilute systems. A widely applicable, user-friendly software implementation of the SVTA has yet to be developed, but we exhibit some simple examples which show that the algorithm is computationally feasible and gives plausible results.

  3. Harnessing Connectivity in a Large-Scale Small-Molecule Sensitivity Dataset | Office of Cancer Genomics

    Cancer.gov

    Identifying genetic alterations that prime a cancer cell to respond to a particular therapeutic agent can facilitate the development of precision cancer medicines. Cancer cell-line (CCL) profiling of small-molecule sensitivity has emerged as an unbiased method to assess the relationships between genetic or cellular features of CCLs and small-molecule response. Here, we developed annotated cluster multidimensional enrichment analysis to explore the associations between groups of small molecules and groups of CCLs in a new, quantitative sensitivity dataset.

  4. Functional and mechanistic exploration of an adult neurogenesis-promoting small molecule

    PubMed Central

    Petrik, David; Jiang, Yindi; Birnbaum, Shari G.; Powell, Craig M.; Kim, Mi-Sung; Hsieh, Jenny; Eisch, Amelia J.

    2012-01-01

    Adult neurogenesis occurs throughout life in the mammalian hippocampus and is essential for memory and mood control. There is significant interest in identifying ways to promote neurogenesis and ensure maintenance of these hippocampal functions. Previous work with a synthetic small molecule, isoxazole 9 (Isx-9), highlighted its neuronal-differentiating properties in vitro. However, the ability of Isx-9 to drive neurogenesis in vivo or improve hippocampal function was unknown. Here we show that Isx-9 promotes neurogenesis in vivo, enhancing the proliferation and differentiation of hippocampal subgranular zone (SGZ) neuroblasts, and the dendritic arborization of adult-generated dentate gyrus neurons. Isx-9 also improves hippocampal function, enhancing memory in the Morris water maze. Notably, Isx-9 enhances neurogenesis and memory without detectable increases in cellular or animal activity or vascularization. Molecular exploration of Isx-9-induced regulation of neurogenesis (via FACS and microarray of SGZ stem and progenitor cells) suggested the involvement of the myocyte-enhancer family of proteins (Mef2). Indeed, transgenic-mediated inducible knockout of all brain-enriched Mef2 isoforms (Mef2a/c/d) specifically from neural stem cells and their progeny confirmed Mef2's requirement for Isx-9-induced increase in hippocampal neurogenesis. Thus, Isx-9 enhances hippocampal neurogenesis and memory in vivo, and its effects are reliant on Mef2, revealing a novel cell-intrinsic molecular pathway regulating adult neurogenesis.—Petrik, D., Jiang, Y., Birnbaum, S. G., Powell, C. M., Kim, M.-S., Hsieh, J., Eisch, A. J. Functional and mechanistic exploration of an adult neurogenesis-promoting small molecule. PMID:22542682

  5. Late intervention with the small molecule BB3 mitigates postischemic kidney injury.

    PubMed

    Narayan, Prakash; Duan, Bin; Jiang, Kai; Li, Jingsong; Paka, Latha; Yamin, Michael A; Friedman, Scott L; Weir, Matthew R; Goldberg, Itzhak D

    2016-08-01

    Ischemia-reperfusion-mediated acute kidney injury can necessitate renal replacement therapy and is a major cause of morbidity and mortality. We have identified BB3, a small molecule, which when first administered at 24 h after renal ischemia in rats, improved survival, augmented urine output, and reduced the increase in serum creatinine and blood urea nitrogen. Compared with control kidneys, the kidneys of BB3-treated animals exhibited reduced levels of kidney injury molecule-1, neutrophil gelatinase-associated lipocalin, and reduced tubular apoptosis and acute tubular necrosis but enhanced tubular regeneration. Consistent with its hepatocyte growth factor-like mode of action, BB3 treatment promoted phosphorylation of renal cMet and Akt and upregulated renal expression of the survival protein Bcl-2. These data suggest that the kidney is amenable to pharmacotherapy even 24 h after ischemia-reperfusion and that activation of the hepatocyte growth factor signaling pathway with the small molecule BB3 confers interventional benefits late into ischemia-reperfusion injury. These data formed, in part, the basis for the use of BB3 in a clinical trial in kidney recipients presenting with delayed graft function.

  6. Enantioselective silyl protection of alcohols catalysed by an amino-acid-based small molecule.

    PubMed

    Zhao, Yu; Rodrigo, Jason; Hoveyda, Amir H; Snapper, Marc L

    2006-09-01

    Reliable, selective and environmentally friendly chemical transformations are crucial to the development of new therapeutics and the design of novel materials. Chiral catalysts that can be easily prepared and used to obtain organic molecules of high enantiomeric purity are critical to modern chemical synthesis. The development of protecting groups that shield reactive functionalities has also proved indispensable in the preparation of complex biologically active molecules. Here we present a chiral catalyst that promotes the enantioselective protection of a secondary alcohol as one of the most commonly used protected forms of an alcohol: a silyl ether. The catalyst is a small, simple molecule that can be prepared in three steps from commercial materials without the need for rigorously controlled conditions. Enantioselective silylations are performed with commercial silyl chlorides and produce yields of up to 96 per cent at an enantiomeric ratio of up to 98:2. Chiral catalysts for selective formation of commonly used protecting groups such as silyl ethers should significantly enhance the ability of chemical synthesis to deliver, in a more practical and efficient manner, important organic molecules.

  7. Characteristics of product recalls of biopharmaceuticals and small-molecule drugs in the USA.

    PubMed

    Ebbers, Hans C; de Tienda, Nina Fuentes; Hoefnagel, Marcel C; Nibbeling, Ria; Mantel-Teeuwisse, Aukje K

    2016-04-01

    Compared with chemically synthesized small-molecule drugs, the manufacturing process of biopharmaceuticals is more complex. Unexpected changes to product characteristics following manufacturing changes have given rise to calls for robust systems to monitor the postauthorization safety of biopharmaceuticals. We compared quality-related product recalls in the USA of biopharmaceuticals and of small molecules. Although the reasons for recalls for biopharmaceuticals differed from those for small molecules, adverse events were rarely reported. The relative contribution of recalls that could cause serious adverse health consequences was not greater for biopharmaceuticals than for small molecules. Therefore, these data do not give rise to concerns that biopharmaceuticals are more frequently associated with unexpected safety concerns.

  8. Tailoring the interface using thiophene small molecules in TiO2/P3HT hybrid solar cells.

    PubMed

    Freitas, Flavio S; Clifford, John N; Palomares, Emilio; Nogueira, Ana F

    2012-09-14

    In this paper we focus on the effect of carboxylated thiophene small molecules as interface modifiers in TiO(2)/P3HT hybrid solar cells. Our results show that small differences in the chemical structure of these molecules, for example, the presence of the -CH(2)- group in the 2-thiopheneacetic acid (TAA), can greatly increase the TiO(2) surface wettability, improving the TiO(2)/polymer contact. This effect is important to enhance exciton splitting and charge separation. PMID:22842849

  9. Enhancing the low frequency THz resonances (< 1 THz) of organic molecules via electronegative atom substitution

    NASA Astrophysics Data System (ADS)

    Dash, Jyotirmayee; Ray, Shaumik; Pesala, Bala

    2015-03-01

    Terahertz (THz) technology is an active area of research with various applications in non-intrusive imaging and spectroscopy. Very few organic molecules have significant resonances below 1 THz. Understanding the origin of low frequency THz modes in these molecules and their absence in other molecules could be extremely important in design and engineering molecules with low frequency THz resonances. These engineered molecules can be used as THz tags for anti-counterfeiting applications. Studies show that low frequency THz resonances are commonly observed in molecules having higher molecular mass and weak intermolecular hydrogen bonds. In this paper, we have explored the possibility of enhancing the strength of THz resonances below 1 THz through electronegative atom substitution. Adding an electronegative atom helps in achieving higher hydrogen bond strength to enhance the resonances below 1 THz. Here acetanilide has been used as a model system. THz-Time Domain Spectroscopy (THz-TDS) results show that acetanilide has a small peak observed below 1 THz. Acetanilide can be converted to 2-fluoroacetanilide by adding an electronegative atom, fluorine, which doesn't have any prominent peak below 1 THz. However, by optimally choosing the position of the electronegative atom as in 4-fluoroacetanilide, a significant THz resonance at 0.86 THz is observed. The origin of low frequency resonances can be understood by carrying out Density Functional Theory (DFT) simulations of full crystal structure. These studies show that adding an electronegative atom to the organic molecules at an optimized position can result in significantly enhanced resonances below 1 THz.

  10. Efficient polymer solar cells employing a non-conjugated small-molecule electrolyte

    NASA Astrophysics Data System (ADS)

    Ouyang, Xinhua; Peng, Ruixiang; Ai, Ling; Zhang, Xingye; Ge, Ziyi

    2015-08-01

    Polymer solar cells have drawn a great deal of attention due to the attractiveness of their use in renewable energy sources that are potentially lightweight and low in cost. Recently, numerous significant research efforts have resulted in polymer solar cells with power conversion efficiencies in excess of 9% (ref. 1). Nevertheless, further improvements in performance are sought for commercial applications. Here, we report polymer solar cells with a power conversion efficiency of 10.02% that employ a non-conjugated small-molecule electrolyte as an interlayer. The material offers good contact for photogenerated charge carrier collection and allows optimum photon harvesting in the device. Furthermore, the enhanced performance is attributed to improved electron mobility, enhanced active-layer absorption and properly active-layer microstructures with optimal horizontal phase separation and vertical phase gradation. Our discovery opens a new avenue for single-junction devices by fully exploiting the potential of various material systems with efficiency over 10%.

  11. Small molecule inhibitor of the bone morphogenetic protein pathway DMH1 reduces ovarian cancer cell growth.

    PubMed

    Hover, Laura D; Young, Christian D; Bhola, Neil E; Wilson, Andrew J; Khabele, Dineo; Hong, Charles C; Moses, Harold L; Owens, Philip

    2015-11-01

    The bone morphogenetic protein (BMP) pathway belonging to the Transforming Growth Factor beta (TGFβ) family of secreted cytokines/growth factors is an important regulator of cancer. BMP ligands have been shown to play both tumor suppressive and promoting roles in human cancers. We have found that BMP ligands are amplified in human ovarian cancers and that BMP receptor expression correlates with poor progression-free-survival (PFS). Furthermore, active BMP signaling has been observed in human ovarian cancer tissue. We also determined that ovarian cancer cell lines have active BMP signaling in a cell autonomous fashion. Inhibition of BMP signaling with a small molecule receptor kinase antagonist is effective at reducing ovarian tumor sphere growth. Furthermore, BMP inhibition can enhance sensitivity to Cisplatin treatment and regulates gene expression involved in platinum resistance in ovarian cancer. Overall, these studies suggest targeting the BMP pathway as a novel source to enhance chemo-sensitivity in ovarian cancer.

  12. Maskless RGB color patterning of vacuum-deposited small molecule OLED displays by diffusion of luminescent dopant molecules.

    PubMed

    Kajiyama, Yoshitaka; Kajiyama, Koichi; Aziz, Hany

    2015-06-29

    A maskless RGB color patterning technique based on diffusion of luminescent dopant molecules is proposed here for vacuum-deposited small molecule OLED displays. The proposed maskless color patterning technique enables us to overcome challenging issues in OLED display manufacturing arising from shadow mask limitations. This approach utilizes selective diffusion of luminescent dopant molecules from a donor substrate to an acceptor substrate. Results show that sufficiently high doping levels can be achieved through this technique and that devices with performance similar to those produced by standard co-deposition can be easily produced. Red, green and blue OLEDs are successfully fabricated side by side on one substrate using this technique.

  13. Signalling to the nucleus under the control of light and small molecules.

    PubMed

    Juillot, Samuel; Beyer, Hannes M; Madl, Josef; Weber, Wilfried; Zurbriggen, Matias D; Römer, Winfried

    2016-02-01

    One major regulatory mechanism in cell signalling is the spatio-temporal control of the localization of signalling molecules. We synthetically designed an entire cell signalling pathway, which allows controlling the transport of signalling molecules from the plasma membrane to the nucleus, by using light and small molecules.

  14. Metal-organic frameworks with functional pores for recognition of small molecules.

    PubMed

    Chen, Banglin; Xiang, Shengchang; Qian, Guodong

    2010-08-17

    strong interactions between open metal sites within porous MOFs and gas molecules such as hydrogen and acetylene, we have developed several MOF materials with extraordinary acetylene storage capacity at room temperature. We have also immobilized Lewis acidic and basic sites into luminescent porous MOFs to recognize and sense neutral and ionic species. Using the strategy to systematically immobilize different open metal sites within porous MOFs from the metalloligand precursors, we have developed the first microporous mixed-metal-organic framework (M'MOF) with enhanced affinity for hydrogen molecules, which successfully separated D(2) from H(2) using kinetic isotope quantum molecular sieving. Because we can functionalize the pores to direct their specific recognition of small molecules, the emerging porous MOFs serve as novel functional materials for gas storage, separation, heterogeneous catalysis, and sensing.

  15. Confined optical modes in small photonic molecules with semiconductor nanocrystals

    NASA Astrophysics Data System (ADS)

    Rakovich, Yu. P.; Gerlach, M.; Bradley, A. L.; Donegan, J. F.; Connolly, T. M.; Boland, J. J.; Przyjalgowski, M. A.; Ryder, A.; Gaponik, N.; Rogach, A. L.

    2004-12-01

    We report on the coherent coupling of whispering gallery modes (WGMs) in a photonic molecule formed from two melamine-formaldehyde spherical microcavities coated with a thin shell of light-emitting CdTe nanocrystals (NCs). Utilizing different excitation conditions, the splitting of the WGM resonances originating from bonding and antibonding branches of the photonic states is observed, and fine structure consisting of very sharp peaks resulting from lifting of the WGM degeneracy has been detected. Time-resolved measurements showed a slight increase in the spontaneous emission rate of NCs in a photonic molecule when compared to the spontaneous emission rate for NCs coating a single microsphere.

  16. Metamaterial-enhanced vibrational absorption spectroscopy for the detection of protein molecules

    NASA Astrophysics Data System (ADS)

    Bui, Tung S.; Dao, Thang D.; Dang, Luu H.; Vu, Lam D.; Ohi, Akihiko; Nabatame, Toshihide; Lee, Youngpak; Nagao, Tadaaki; Hoang, Chung V.

    2016-08-01

    From visible to mid-infrared frequencies, molecular sensing has been a major successful application of plasmonics because of the enormous enhancement of the surface electromagnetic nearfield associated with the induced collective motion of surface free carriers excited by the probe light. However, in the lower-energy terahertz (THz) region, sensing by detecting molecular vibrations is still challenging because of low sensitivity, complicated spectral features, and relatively little accumulated knowledge of molecules. Here, we report the use of a micron-scale thin-slab metamaterial (MM) architecture, which functions as an amplifier for enhancing the absorption signal of the THz vibration of an ultrathin adsorbed layer of large organic molecules. We examined bovine serum albumin (BSA) as a prototype large protein molecule and Rhodamine 6G (Rh6G) and 3,3‧-diethylthiatricarbocyanine iodide (DTTCI) as examples of small molecules. Among them, our MM significantly magnified only the signal strength of bulky BSA. On the other hand, DTTCI and Rh6G are inactive, as they lack low-frequency vibrational modes in this frequency region. The results obtained here clearly demonstrate the promise of MM-enhanced absorption spectroscopy in the THz region for detection and structural monitoring of large biomolecules such as proteins or pathogenic enzymes.

  17. Metamaterial-enhanced vibrational absorption spectroscopy for the detection of protein molecules.

    PubMed

    Bui, Tung S; Dao, Thang D; Dang, Luu H; Vu, Lam D; Ohi, Akihiko; Nabatame, Toshihide; Lee, YoungPak; Nagao, Tadaaki; Hoang, Chung V

    2016-01-01

    From visible to mid-infrared frequencies, molecular sensing has been a major successful application of plasmonics because of the enormous enhancement of the surface electromagnetic nearfield associated with the induced collective motion of surface free carriers excited by the probe light. However, in the lower-energy terahertz (THz) region, sensing by detecting molecular vibrations is still challenging because of low sensitivity, complicated spectral features, and relatively little accumulated knowledge of molecules. Here, we report the use of a micron-scale thin-slab metamaterial (MM) architecture, which functions as an amplifier for enhancing the absorption signal of the THz vibration of an ultrathin adsorbed layer of large organic molecules. We examined bovine serum albumin (BSA) as a prototype large protein molecule and Rhodamine 6G (Rh6G) and 3,3'-diethylthiatricarbocyanine iodide (DTTCI) as examples of small molecules. Among them, our MM significantly magnified only the signal strength of bulky BSA. On the other hand, DTTCI and Rh6G are inactive, as they lack low-frequency vibrational modes in this frequency region. The results obtained here clearly demonstrate the promise of MM-enhanced absorption spectroscopy in the THz region for detection and structural monitoring of large biomolecules such as proteins or pathogenic enzymes. PMID:27555217

  18. Metamaterial-enhanced vibrational absorption spectroscopy for the detection of protein molecules

    PubMed Central

    Bui, Tung S.; Dao, Thang D.; Dang, Luu H.; Vu, Lam D.; Ohi, Akihiko; Nabatame, Toshihide; Lee, YoungPak; Nagao, Tadaaki; Hoang, Chung V.

    2016-01-01

    From visible to mid-infrared frequencies, molecular sensing has been a major successful application of plasmonics because of the enormous enhancement of the surface electromagnetic nearfield associated with the induced collective motion of surface free carriers excited by the probe light. However, in the lower-energy terahertz (THz) region, sensing by detecting molecular vibrations is still challenging because of low sensitivity, complicated spectral features, and relatively little accumulated knowledge of molecules. Here, we report the use of a micron-scale thin-slab metamaterial (MM) architecture, which functions as an amplifier for enhancing the absorption signal of the THz vibration of an ultrathin adsorbed layer of large organic molecules. We examined bovine serum albumin (BSA) as a prototype large protein molecule and Rhodamine 6G (Rh6G) and 3,3′-diethylthiatricarbocyanine iodide (DTTCI) as examples of small molecules. Among them, our MM significantly magnified only the signal strength of bulky BSA. On the other hand, DTTCI and Rh6G are inactive, as they lack low-frequency vibrational modes in this frequency region. The results obtained here clearly demonstrate the promise of MM-enhanced absorption spectroscopy in the THz region for detection and structural monitoring of large biomolecules such as proteins or pathogenic enzymes. PMID:27555217

  19. Hide and seek: Identification and confirmation of small molecule protein targets.

    PubMed

    Ursu, Andrei; Waldmann, Herbert

    2015-08-15

    Target identification and confirmation for small molecules is often the rate limiting step in drug discovery. A robust method to identify proteins addressed by small molecules is affinity chromatography using chemical probes. These usually consist of the compound of interest equipped with a linker molecule and a proper tag. Recently, methods emerged that allow the identification of protein targets without prior functionalization of the small molecule of interest. The digest offers an update on the newest developments in the area of target identification with special focus on confirmation techniques. PMID:26115575

  20. Small Talk: Children's Everyday "Molecule" Ideas

    ERIC Educational Resources Information Center

    Jakab, Cheryl

    2013-01-01

    This paper reports on 6-11-year-old children's "sayings and doings" (Harré 2002) as they explore molecule artefacts in dialectical-interactive teaching interviews (Fleer, "Cultural Studies of Science Education" 3:781-786, 2008; Hedegaard et al. 2008). This sociocultural study was designed to explore children's…

  1. Group specific internal standard technology (GSIST) for simultaneous identification and quantification of small molecules

    DOEpatents

    Adamec, Jiri; Yang, Wen-Chu; Regnier, Fred E

    2014-01-14

    Reagents and methods are provided that permit simultaneous analysis of multiple diverse small molecule analytes present in a complex mixture. Samples are labeled with chemically identical but isotopically distince forms of the labeling reagent, and analyzed using mass spectrometry. A single reagent simultaneously derivatizes multiple small molecule analytes having different reactive functional groups.

  2. What are preferred water-aromatic interactions in proteins and crystal structures of small molecules?

    PubMed

    Janjić, Goran V; Malkov, Saša N; Zivković, Miodrag V; Zarić, Snežana D

    2014-11-21

    The distribution of water molecules around aromatic rings in the protein structures and crystal structures of small molecules shows quite a small number of the strongest OH-π interactions, a larger number of parallel interactions, and the largest number of the weakest CH-O interactions.

  3. Evaluation of Small Molecules as Front Cell Donor Materials for High-Efficiency Tandem Solar Cells.

    PubMed

    Zhang, Qian; Wan, Xiangjian; Liu, Feng; Kan, Bin; Li, Miaomiao; Feng, Huanran; Zhang, Hongtao; Russell, Thomas P; Chen, Yongsheng

    2016-08-01

    Three small molecules as front cell donors for tandem cells are thoroughly evaluated and a high power conversion efficiency of 11.47% is achieved, which demonstrates that the oligomer-like small molecules offer a good choice for high-performance tandem solar cells.

  4. Evaluation of Small Molecules as Front Cell Donor Materials for High-Efficiency Tandem Solar Cells.

    PubMed

    Zhang, Qian; Wan, Xiangjian; Liu, Feng; Kan, Bin; Li, Miaomiao; Feng, Huanran; Zhang, Hongtao; Russell, Thomas P; Chen, Yongsheng

    2016-08-01

    Three small molecules as front cell donors for tandem cells are thoroughly evaluated and a high power conversion efficiency of 11.47% is achieved, which demonstrates that the oligomer-like small molecules offer a good choice for high-performance tandem solar cells. PMID:27214707

  5. Nucleic acid molecules conferring enhanced ethanol tolerance and microorganisms having enhanced tolerance to ethanol

    SciTech Connect

    Brown, Steven; Guss, Adam; Yang, Shihui; Karpinets, Tatiana; Lynd, Lee; Shao, Xiongjun

    2014-01-14

    The present invention provides isolated nucleic acid molecules which encode a mutant acetaldehyde-CoA/alcohol dehydrogenase or mutant alcohol dehydrogenase and confer enhanced tolerance to ethanol. The invention also provides related expression vectors, genetically engineered microorganisms having enhanced tolerance to ethanol, as well as methods of making and using such genetically modified microorganisms for production of biofuels based on fermentation of biomass materials.

  6. A clinical commentary on the article "N-acetylglucosamine conjugated to nanoparticles enhances myocyte uptake and improves delivery of a small molecule p38 inhibitor for post-infarct healing" : N-acetylglucosamine conjugated nanoparticles: translational opportunities and barriers.

    PubMed

    Levit, Rebecca D; Taylor, W Robert

    2011-10-01

    Targeting drugs and nanoparticles to cardiomyocytes has been an elusive challenge. Cardiomyocytes are inherently non-phagocytic and their environment is subjected to contractile forces which tend to expel injected and catheter-delivered drugs. In this issue, a novel-targeting strategy, N-acetyl-glucosamine (GlcNAc) coating, is shown to enhance cardiomyocyte nanoparticle uptake both in vitro and in vivo. Many effective and proven therapies for myocardial infarction are in clinical use thus raising the bar for the translation of new technologies. Nevertheless, GlcNAc targeting represents a promising approach for improved targeting of drug therapies to cardiomyocytes.

  7. Imaging Self-assembly Dependent Spatial Distribution of Small Molecules in Cellular Environment

    PubMed Central

    Gao, Yuan; Kuang, Yi; Du, Xuewen; Zhou, Jie; Chandran, Preethi; Horkay, Ferenc; Xu, Bing

    2014-01-01

    Self-assembly of small molecules, as a more common phenomenon than one previously thought, can be either beneficial or detrimental to cells. Despite its profound biological implications, how the self-assembly of small molecules behave in cellular environment is largely unknown and barely explored. This work studies four fluorescent molecules that consist of the same peptidic backbone (e.g., Phe-Phe-Lys) and enzyme trigger (e.g., a phosphotyrosine residue), but bear different fluorophores on the side chain of the lysine residue of the peptidic motif. These molecules, however, exhibit different ability of self-assembly before and after enzymatic transformation (e.g., dephosphorylation). Fluorescent imaging reveals that self-assembly directly affects the distribution of these small molecules in cellular environment. Moreover, cell viability tests suggest that the states and the location of the molecular assemblies in the cellular environment control the phenotypes of the cells. For example, the molecular nanofibers of one of the small molecules apparently stabilize actin filaments and alleviate the insult of an F-actin toxin (e.g., latrunculin A). Combining fluorescent imaging and enzyme-instructed self-assembly of small peptidic molecules, this work not only demonstrates that self-assembly as a key factor for dictating the spatial distribution of small molecules in cellular environment. In addition, it illustrates a useful approach, based on enzyme-instructed self-assembly of small molecules, to modulate spatiotemporal profiles of small molecules in cellular environment, which allows the use of the emergent properties of small molecules to control the fate of cells. PMID:24266765

  8. Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal

    PubMed Central

    Stoszko, Mateusz; De Crignis, Elisa; Rokx, Casper; Khalid, Mir Mubashir; Lungu, Cynthia; Palstra, Robert-Jan; Kan, Tsung Wai; Boucher, Charles; Verbon, Annelies; Dykhuizen, Emily C.; Mahmoudi, Tokameh

    2015-01-01

    Persistence of latently infected cells in presence of Anti-Retroviral Therapy presents the main obstacle to HIV-1 eradication. Much effort is thus placed on identification of compounds capable of HIV-1 latency reversal in order to render infected cells susceptible to viral cytopathic effects and immune clearance. We identified the BAF chromatin remodeling complex as a key player required for maintenance of HIV-1 latency, highlighting its potential as a molecular target for inhibition in latency reversal. Here, we screened a recently identified panel of small molecule inhibitors of BAF (BAFi's) for potential to activate latent HIV-1. Latency reversal was strongly induced by BAFi's Caffeic Acid Phenethyl Ester and Pyrimethamine, two molecules previously characterized for clinical application. BAFi's reversed HIV-1 latency in cell line based latency models, in two ex vivo infected primary cell models of latency, as well as in HIV-1 infected patient's CD4 + T cells, without inducing T cell proliferation or activation. BAFi-induced HIV-1 latency reversal was synergistically enhanced upon PKC pathway activation and HDAC-inhibition. Therefore BAFi's constitute a promising family of molecules for inclusion in therapeutic combinatorial HIV-1 latency reversal. PMID:26870822

  9. Small Molecule Inhibitors of BAF; A Promising Family of Compounds in HIV-1 Latency Reversal.

    PubMed

    Stoszko, Mateusz; De Crignis, Elisa; Rokx, Casper; Khalid, Mir Mubashir; Lungu, Cynthia; Palstra, Robert-Jan; Kan, Tsung Wai; Boucher, Charles; Verbon, Annelies; Dykhuizen, Emily C; Mahmoudi, Tokameh

    2016-01-01

    Persistence of latently infected cells in presence of Anti-Retroviral Therapy presents the main obstacle to HIV-1 eradication. Much effort is thus placed on identification of compounds capable of HIV-1 latency reversal in order to render infected cells susceptible to viral cytopathic effects and immune clearance. We identified the BAF chromatin remodeling complex as a key player required for maintenance of HIV-1 latency, highlighting its potential as a molecular target for inhibition in latency reversal. Here, we screened a recently identified panel of small molecule inhibitors of BAF (BAFi's) for potential to activate latent HIV-1. Latency reversal was strongly induced by BAFi's Caffeic Acid Phenethyl Ester and Pyrimethamine, two molecules previously characterized for clinical application. BAFi's reversed HIV-1 latency in cell line based latency models, in two ex vivo infected primary cell models of latency, as well as in HIV-1 infected patient's CD4 + T cells, without inducing T cell proliferation or activation. BAFi-induced HIV-1 latency reversal was synergistically enhanced upon PKC pathway activation and HDAC-inhibition. Therefore BAFi's constitute a promising family of molecules for inclusion in therapeutic combinatorial HIV-1 latency reversal. PMID:26870822

  10. Proteasome Activation is a Mechanism for Pyrazolone Small Molecules Displaying Therapeutic Potential in Amyotrophic Lateral Sclerosis

    PubMed Central

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive and ultimately fatal neurodegenerative disease. Pyrazolone containing small molecules have shown significant disease attenuating efficacy in cellular and murine models of ALS. Pyrazolone based affinity probes were synthesized to identify high affinity binding partners and ascertain a potential biological mode of action. Probes were confirmed to be neuroprotective in PC12-SOD1G93A cells. PC12-SOD1G93A cell lysates were used for protein pull-down, affinity purification, and subsequent proteomic analysis using LC-MS/MS. Proteomics identified the 26S proteasome regulatory subunit 4 (PSMC1), 26S proteasome regulatory subunit 6B (PSMC4), and T-complex protein 1 (TCP-1) as putative protein targets. Coincubation with appropriate competitors confirmed the authenticity of the proteomics results. Activation of the proteasome by pyrazolones was demonstrated in the absence of exogenous proteasome inhibitor and by restoration of cellular protein degradation of a fluorogenic proteasome substrate in PC12-SOD1G93A cells. Importantly, supplementary studies indicated that these molecules do not induce a heat shock response. We propose that pyrazolones represent a rare class of molecules that enhance proteasomal activation in the absence of a heat shock response and may have therapeutic potential in ALS. PMID:25001311

  11. Chasing the structures of small molecules in arbuscular mycorrhizal signaling.

    PubMed

    Bucher, Marcel; Wegmüller, Sarah; Drissner, David

    2009-08-01

    The arbuscular mycorrhiza (AM) is a symbiosis between most terrestrial plants and fungi of the ancient phylum Glomeromycota. AM improves the uptake of water and mineral nutrients, such as phosphorus (P) and nitrogen (N), of the host plant in exchange for photosynthetically fixed carbon. Successful colonization and a functional interaction between host plant and mycobiont are based upon exchange of signaling molecules at different stages of symbiosis development. Strigolactones, a novel class of plant hormones, are secreted by plant roots stimulating presymbiotic growth of AM fungi. Fungi release soluble signaling molecules, the enigmatic 'Myc factors', that activate early symbiotic root responses. Lysophosphatidylcholine is a lipophilic intraradical mycorrhizal signal triggering plant phosphate transporter gene expression late in AM development through a P-controlled transcriptional mechanism. This enables uptake of orthophosphate released from the AM fungus.

  12. Enhancing Single Molecule Imaging in Optofluidics and Microfluidics

    PubMed Central

    Vasdekis, Andreas E.; Laporte, Gregoire P.J.

    2011-01-01

    Microfluidics and optofluidics have revolutionized high-throughput analysis and chemical synthesis over the past decade. Single molecule imaging has witnessed similar growth, due to its capacity to reveal heterogeneities at high spatial and temporal resolutions. However, both resolution types are dependent on the signal to noise ratio (SNR) of the image. In this paper, we review how the SNR can be enhanced in optofluidics and microfluidics. Starting with optofluidics, we outline integrated photonic structures that increase the signal emitted by single chromophores and minimize the excitation volume. Turning then to microfluidics, we review the compatible functionalization strategies that reduce noise stemming from non-specific interactions and architectures that minimize bleaching and blinking. PMID:21954349

  13. Enhancing single molecule imaging in optofluidics and microfluidics.

    PubMed

    Vasdekis, Andreas E; Laporte, Gregoire P J

    2011-01-01

    Microfluidics and optofluidics have revolutionized high-throughput analysis and chemical synthesis over the past decade. Single molecule imaging has witnessed similar growth, due to its capacity to reveal heterogeneities at high spatial and temporal resolutions. However, both resolution types are dependent on the signal to noise ratio (SNR) of the image. In this paper, we review how the SNR can be enhanced in optofluidics and microfluidics. Starting with optofluidics, we outline integrated photonic structures that increase the signal emitted by single chromophores and minimize the excitation volume. Turning then to microfluidics, we review the compatible functionalization strategies that reduce noise stemming from non-specific interactions and architectures that minimize bleaching and blinking.

  14. Intraepithelial lymphocytes express junctional molecules in murine small intestine

    SciTech Connect

    Inagaki-Ohara, Kyoko . E-mail: INAGAKI@med.miyazaki-u.ac.jp; Sawaguchi, Akira; Suganuma, Tatsuo; Matsuzaki, Goro; Nawa, Yukifumi

    2005-06-17

    Intestinal intraepithelial lymphocytes (IEL) that reside at basolateral site regulate the proliferation and differentiation of epithelial cells (EC) for providing a first line of host defense in intestine. However, it remains unknown how IEL interact and communicate with EC. Here, we show that IEL express junctional molecules like EC. We identified mRNA expression of the junctional molecules in IEL such as zonula occludens (ZO)-1, occludin and junctional adhesion molecule (JAM) (tight junction), {beta}-catenin and E-cadherin (adherens junction), and connexin26 (gap junction). IEL constitutively expressed occludin and E-cadherin at protein level, while other T cells in the thymus, spleen, liver, mesenteric lymph node, and Peyer's patches did not. {gamma}{delta} IEL showed higher level of these expressions than {alpha}{beta} IEL. The expression of occludin was augmented by anti-CD3 Ab stimulation. These results suggest the possibility of a novel role of IEL concerning epithelial barrier and communication between IEL and EC.

  15. Conjugated Polymer-Small Molecule Alloy Leads to High Efficient Ternary Organic Solar Cells.

    PubMed

    Zhang, Jianqi; Zhang, Yajie; Fang, Jin; Lu, Kun; Wang, Zaiyu; Ma, Wei; Wei, Zhixiang

    2015-07-01

    Ternary organic solar cells are promising candidates for bulk heterojunction solar cells; however, improving the power conversion efficiency (PCE) is quite challenging because the ternary system is complicated on phase separation behavior. In this study, a ternary organic solar cell (OSC) with two donors, including one polymer (PTB7-Th), one small molecule (p-DTS(FBTTH2)2), and one acceptor (PC71BM), is fabricated. We propose the two donors in the ternary blend forms an alloy. A notable averaged PCE of 10.5% for ternary OSC is obtained due to the improvement of the fill factor (FF) and the short-circuit current density (J(sc)), and the open-circuit voltage (V(oc)) does not pin to the smaller V(oc) of the corresponding binary blends. A highly ordered face-on orientation of polymer molecules is obtained due to the formation of an alloy structure, which facilitates the enhancement of charge separation and transport and the reduction of charge recombination. This work indicates that a high crystallinity and the face-on orientation of polymers could be obtained by forming alloy with two miscible donors, thus paving a way to largely enhance the PCE of OSCs by using the ternary blend strategy.

  16. Peptides and small molecules of the plant-pathogen apoplastic arena

    PubMed Central

    Mott, G. Adam; Middleton, Maggie A.; Desveaux, Darrell; Guttman, David S.

    2014-01-01

    Plants reside within an environment rich in potential pathogens. Survival in the presence of such threats requires both effective perception of, and appropriate responses to, pathogenic attack. While plants lack an adaptive immune system, they have a highly developed and responsive innate immune system able to detect and inhibit the growth of the vast majority of potential pathogens. Many of the critical interactions that characterize the relationship between plants and pathogens are played out in the intercellular apoplastic space. The initial perception of pathogen invasion is often achieved through specific plant receptor-like kinases that recognize conserved molecular patterns presented by the pathogen or respond to the molecular debris caused by cellular damage. The perception of either microbial or damage signals by these receptors initiates a response that includes the production of peptides and small molecules to enhance cellular integrity and inhibit pathogen growth. In this review, we discuss the roles of apoplastic peptides and small molecules in modulating plant-pathogen interactions. PMID:25506352

  17. Histone deacetylase inhibitor givinostat: the small-molecule with promising activity against therapeutically challenging haematological malignancies.

    PubMed

    Ganai, Shabir Ahmad

    2016-08-01

    Histone acetyl transferases and histone deacetylases (HDACs) are counteracting epigenetic enzymes regulating the turnover of histone acetylation thereby regulating transcriptional events in a precise manner. Deregulation of histone acetylation caused by aberrant expression of HDACs plays a key role in tumour onset and progression making these enzymes as candidate targets for anticancer drugs and therapy. Small-molecules namely histone deacetylase inhibitors (HDACi) modulating the biological function of HDACs have shown multiple biological effects including differentiation, cell cycle arrest and apoptosis in tumour models. HDACi in general have been described in plethora of reviews with respect to various cancers. However, no review article is available describing thoroughly the role of inhibitor givinostat (ITF2357 or [6-(diethylaminomethyl) naphthalen-2-yl] methyl N-[4-(hydroxycarbamoyl) phenyl] carbamate) in haematological malignancies. Thus, the present review explores the intricate role of novel inhibitor givinostat in the defined malignancies including multiple myeloma, acute myelogenous leukaemia, Hodgkin's and non-Hodgkin's lymphoma apart from myeloproliferative neoplasms. The distinct molecular mechanisms triggered by this small-molecule inhibitor in these cancers to exert cytotoxic effect have also been dealt with. The article also highlights the combination strategy that can be used for enhancing the therapeutic efficiency of this inhibitor in the upcoming future. PMID:27121910

  18. Therapeutic targeting and rapid mobilization of endosteal HSC using a small molecule integrin antagonist.

    PubMed

    Cao, Benjamin; Zhang, Zhen; Grassinger, Jochen; Williams, Brenda; Heazlewood, Chad K; Churches, Quentin I; James, Simon A; Li, Songhui; Papayannopoulou, Thalia; Nilsson, Susan K

    2016-01-01

    The inherent disadvantages of using granulocyte colony-stimulating factor (G-CSF) for hematopoietic stem cell (HSC) mobilization have driven efforts to identify alternate strategies based on single doses of small molecules. Here, we show targeting α9β1/α4β1 integrins with a single dose of a small molecule antagonist (BOP (N-(benzenesulfonyl)-L-prolyl-L-O-(1-pyrrolidinylcarbonyl)tyrosine)) rapidly mobilizes long-term multi-lineage reconstituting HSC. Synergistic engraftment augmentation is observed when BOP is co-administered with AMD3100. Impressively, HSC in equal volumes of peripheral blood (PB) mobilized with this combination effectively out-competes PB mobilized with G-CSF. The enhanced mobilization observed using BOP and AMD3100 is recapitulated in a humanized NODSCIDIL2Rγ(-/-) model, demonstrated by a significant increase in PB CD34(+) cells. Using a related fluorescent analogue of BOP (R-BC154), we show that this class of antagonists preferentially bind human and mouse HSC and progenitors via endogenously primed/activated α9β1/α4β1 within the endosteal niche. These results support using dual α9β1/α4β1 inhibitors as effective, rapid and transient mobilization agents with promising clinical applications. PMID:26975966

  19. Towards Development of Small Molecule Lipid II Inhibitors as Novel Antibiotics

    PubMed Central

    Chauhan, Jamal; Cardinale, Steven; Fang, Lei; Huang, Jing; Kwasny, Steven M.; Pennington, M. Ross; Basi, Kelly; diTargiani, Robert; Capacio, Benedict R.; MacKerell, Alexander D.; Opperman, Timothy J.; Fletcher, Steven; de Leeuw, Erik P. H.

    2016-01-01

    Recently we described a novel di-benzene-pyrylium-indolene (BAS00127538) inhibitor of Lipid II. BAS00127538 (1-Methyl-2,4-diphenyl-6-((1E,3E)-3-(1,3,3-trimethylindolin-2-ylidene)prop-1-en-1-yl)pyryl-1-ium) tetrafluoroborate is the first small molecule Lipid II inhibitor and is structurally distinct from natural agents that bind Lipid II, such as vancomycin. Here, we describe the synthesis and biological evaluation of 50 new analogs of BAS00127538 designed to explore the structure-activity relationships of the scaffold. The results of this study indicate an activity map of the scaffold, identifying regions that are critical to cytotoxicity, Lipid II binding and range of anti-bacterial action. One compound, 6jc48-1, showed significantly enhanced drug-like properties compared to BAS00127538. 6jc48-1 has reduced cytotoxicity, while retaining specific Lipid II binding and activity against Enterococcus spp. in vitro and in vivo. Further, this compound showed a markedly improved pharmacokinetic profile with a half-life of over 13 hours upon intravenous and oral administration and was stable in plasma. These results suggest that scaffolds like that of 6jc48-1 can be developed into small molecule antibiotic drugs that target Lipid II. PMID:27776124

  20. Targeted Intracellular Delivery of Antisense Oligonucleotides Via Conjugation With Small Molecule Ligands

    PubMed Central

    Nakagawa, Osamu; Ming, Xin; Huang, Leaf; Juliano, Rudolph L.

    2010-01-01

    Selective delivery of antisense or siRNA oligonucleotides to cells and tissues via receptor-mediated endocytosis is becoming an important approach for oligonucleotide-based pharmacology. In most cases receptor targeting has been attained using antibodies or peptide-type ligands. Thus there are few examples of delivering oligonucleotides using the plethora of small-molecule receptor-specific ligands that currently exist. In this report we describe a facile approach to the generation of mono- and multi-valent conjugates of oligonucleotides with small molecule ligands. Using the sigma receptor ligand anisamide as an example, we describe conversion of the ligand to a phosphoramidite and direct incorporation of this moiety into the oligonucleotide by solid phase DNA synthesis. We generated mono- and tri-valent conjugates of anisamide with a splice switching antisense oligonucleotide (SSO) and tested their ability to modify splicing of a reporter gene (luciferase) in tumor cells in culture. The tri-valent anisamide-SSO conjugate displayed enhanced cellular uptake and was markedly more effective than an unconjugated SSO or the mono-valent conjugate in modifying splicing of the reporter. Significant biological effects were attained in the sub-100 nM concentration range. PMID:20550198

  1. Therapeutic targeting and rapid mobilization of endosteal HSC using a small molecule integrin antagonist

    PubMed Central

    Cao, Benjamin; Zhang, Zhen; Grassinger, Jochen; Williams, Brenda; Heazlewood, Chad K.; Churches, Quentin I.; James, Simon A.; Li, Songhui; Papayannopoulou, Thalia; Nilsson, Susan K.

    2016-01-01

    The inherent disadvantages of using granulocyte colony-stimulating factor (G-CSF) for hematopoietic stem cell (HSC) mobilization have driven efforts to identify alternate strategies based on single doses of small molecules. Here, we show targeting α9β1/α4β1 integrins with a single dose of a small molecule antagonist (BOP (N-(benzenesulfonyl)-L-prolyl-L-O-(1-pyrrolidinylcarbonyl)tyrosine)) rapidly mobilizes long-term multi-lineage reconstituting HSC. Synergistic engraftment augmentation is observed when BOP is co-administered with AMD3100. Impressively, HSC in equal volumes of peripheral blood (PB) mobilized with this combination effectively out-competes PB mobilized with G-CSF. The enhanced mobilization observed using BOP and AMD3100 is recapitulated in a humanized NODSCIDIL2Rγ−/− model, demonstrated by a significant increase in PB CD34+ cells. Using a related fluorescent analogue of BOP (R-BC154), we show that this class of antagonists preferentially bind human and mouse HSC and progenitors via endogenously primed/activated α9β1/α4β1 within the endosteal niche. These results support using dual α9β1/α4β1 inhibitors as effective, rapid and transient mobilization agents with promising clinical applications. PMID:26975966

  2. Discovery of a novel small molecule agonist scaffold for the APJ receptor.

    PubMed

    Narayanan, Sanju; Maitra, Rangan; Deschamps, Jeffery R; Bortoff, Katherine; Thomas, James B; Zhang, Yanyan; Warner, Keith; Vasukuttan, Vineetha; Decker, Ann; Runyon, Scott P

    2016-08-15

    The apelinergic system includes a series of endogenous peptides apelin, ELABELA/TODDLER and their 7-transmembrane G-protein coupled apelin receptor (APJ, AGTRL-1, APLNR). The APJ receptor is an attractive therapeutic target because of its involvement in cardiovascular diseases and potentially other disorders including liver fibrosis, obesity, diabetes, and neuroprotection. To date, pharmacological characterization of the APJ receptor has been limited due to the lack of small molecule functional agonists or antagonists. Through focused screening we identified a drug-like small molecule agonist hit 1 with a functional EC50 value of 21.5±5μM and binding affinity (Ki) of 5.2±0.5μM. Initial structure-activity studies afforded compound 22 having a 27-fold enhancement in potency and the first sub-micromolar full agonist with an EC50 value of 800±0.1nM and Ki of 1.3±0.3μM. Preliminary SAR, synthetic methodology, and in vitro pharmacological characterization indicate this scaffold will serve as a favorable starting point for further refinement of APJ potency and selectivity. PMID:27369451

  3. Targeted delivery as key for the success of small osteoinductive molecules.

    PubMed

    Balmayor, Elizabeth R

    2015-11-01

    Molecules such as growth factors, peptides and small molecules can guide cellular behavior and are thus important for tissue engineering. They are rapidly emerging as promising compounds for the regeneration of tissues of the musculoskeletal system. Growth factors have disadvantages such as high cost, short half-life, supraphysiological amounts needed, etc. Therefore, small molecules may be an alternative. These molecules have been discovered using high throughput screening. Small osteoinductive molecules exhibit several advantages over growth factors owing to their small sizes, such as high stability and non-immunogenicity. These molecules may stimulate directly signaling pathways that are important for osteogenesis. However, systemic application doesn't induce osteogenesis in most cases. Therefore, local administration is needed. This may be achieved by using a bone graft material providing additional osteoconductive properties. These graft materials can also act by themselves as a delivery matrix for targeted and local delivery. Furthermore, vascularization is necessary in the process of osteogenesis. Many of the small molecules are also capable of promoting vascularization of the tissue to be regenerated. Thus, in this review, special attention is given to molecules that are capable of inducing both angiogenesis and osteogenesis simultaneously. Finally, more recent preclinical and clinical uses in bone regeneration of those molecules are described, highlighting the needs for the clinical translation of these promising compounds.

  4. Small-Molecule Procaspase-3 Activation Sensitizes Cancer to Treatment with Diverse Chemotherapeutics

    PubMed Central

    2016-01-01

    Conventional chemotherapeutics remain essential treatments for most cancers, but their combination with other anticancer drugs (including targeted therapeutics) is often complicated by unpredictable synergies and multiplicative toxicities. As cytotoxic anticancer chemotherapeutics generally function through induction of apoptosis, we hypothesized that a molecularly targeted small molecule capable of facilitating a central and defining step in the apoptotic cascade, the activation of procaspase-3 to caspase-3, would broadly and predictably enhance activity of cytotoxic drugs. Here we show that procaspase-activating compound 1 (PAC-1) enhances cancer cell death induced by 15 different FDA-approved chemotherapeutics, across many cancer types and chemotherapeutic targets. In particular, the promising combination of PAC-1 and doxorubicin induces a synergistic reduction in tumor burden and enhances survival in murine tumor models of osteosarcoma and lymphoma. This PAC-1/doxorubicin combination was evaluated in 10 pet dogs with naturally occurring metastatic osteosarcoma or lymphoma, eliciting a biologic response in 3 of 6 osteosarcoma patients and 4 of 4 lymphoma patients. Importantly, in both mice and dogs, coadministration of PAC-1 with doxorubicin resulted in no additional toxicity. On the basis of the mode of action of PAC-1 and the high expression of procaspase-3 in many cancers, these results suggest the combination of PAC-1 with cytotoxic anticancer drugs as a potent and general strategy to enhance therapeutic response.

  5. Small-Molecule Procaspase-3 Activation Sensitizes Cancer to Treatment with Diverse Chemotherapeutics

    PubMed Central

    2016-01-01

    Conventional chemotherapeutics remain essential treatments for most cancers, but their combination with other anticancer drugs (including targeted therapeutics) is often complicated by unpredictable synergies and multiplicative toxicities. As cytotoxic anticancer chemotherapeutics generally function through induction of apoptosis, we hypothesized that a molecularly targeted small molecule capable of facilitating a central and defining step in the apoptotic cascade, the activation of procaspase-3 to caspase-3, would broadly and predictably enhance activity of cytotoxic drugs. Here we show that procaspase-activating compound 1 (PAC-1) enhances cancer cell death induced by 15 different FDA-approved chemotherapeutics, across many cancer types and chemotherapeutic targets. In particular, the promising combination of PAC-1 and doxorubicin induces a synergistic reduction in tumor burden and enhances survival in murine tumor models of osteosarcoma and lymphoma. This PAC-1/doxorubicin combination was evaluated in 10 pet dogs with naturally occurring metastatic osteosarcoma or lymphoma, eliciting a biologic response in 3 of 6 osteosarcoma patients and 4 of 4 lymphoma patients. Importantly, in both mice and dogs, coadministration of PAC-1 with doxorubicin resulted in no additional toxicity. On the basis of the mode of action of PAC-1 and the high expression of procaspase-3 in many cancers, these results suggest the combination of PAC-1 with cytotoxic anticancer drugs as a potent and general strategy to enhance therapeutic response. PMID:27610416

  6. Small-Molecule Procaspase-3 Activation Sensitizes Cancer to Treatment with Diverse Chemotherapeutics.

    PubMed

    Botham, Rachel C; Roth, Howard S; Book, Alison P; Roady, Patrick J; Fan, Timothy M; Hergenrother, Paul J

    2016-08-24

    Conventional chemotherapeutics remain essential treatments for most cancers, but their combination with other anticancer drugs (including targeted therapeutics) is often complicated by unpredictable synergies and multiplicative toxicities. As cytotoxic anticancer chemotherapeutics generally function through induction of apoptosis, we hypothesized that a molecularly targeted small molecule capable of facilitating a central and defining step in the apoptotic cascade, the activation of procaspase-3 to caspase-3, would broadly and predictably enhance activity of cytotoxic drugs. Here we show that procaspase-activating compound 1 (PAC-1) enhances cancer cell death induced by 15 different FDA-approved chemotherapeutics, across many cancer types and chemotherapeutic targets. In particular, the promising combination of PAC-1 and doxorubicin induces a synergistic reduction in tumor burden and enhances survival in murine tumor models of osteosarcoma and lymphoma. This PAC-1/doxorubicin combination was evaluated in 10 pet dogs with naturally occurring metastatic osteosarcoma or lymphoma, eliciting a biologic response in 3 of 6 osteosarcoma patients and 4 of 4 lymphoma patients. Importantly, in both mice and dogs, coadministration of PAC-1 with doxorubicin resulted in no additional toxicity. On the basis of the mode of action of PAC-1 and the high expression of procaspase-3 in many cancers, these results suggest the combination of PAC-1 with cytotoxic anticancer drugs as a potent and general strategy to enhance therapeutic response. PMID:27610416

  7. Transferable Atomic Multipole Machine Learning Models for Small Organic Molecules.

    PubMed

    Bereau, Tristan; Andrienko, Denis; von Lilienfeld, O Anatole

    2015-07-14

    Accurate representation of the molecular electrostatic potential, which is often expanded in distributed multipole moments, is crucial for an efficient evaluation of intermolecular interactions. Here we introduce a machine learning model for multipole coefficients of atom types H, C, O, N, S, F, and Cl in any molecular conformation. The model is trained on quantum-chemical results for atoms in varying chemical environments drawn from thousands of organic molecules. Multipoles in systems with neutral, cationic, and anionic molecular charge states are treated with individual models. The models' predictive accuracy and applicability are illustrated by evaluating intermolecular interaction energies of nearly 1,000 dimers and the cohesive energy of the benzene crystal.

  8. Hydration properties of small hydrophobic molecules by Brillouin light scattering

    NASA Astrophysics Data System (ADS)

    Comez, L.; Lupi, L.; Paolantoni, M.; Picchiò, F.; Fioretto, D.

    2012-09-01

    We study the relaxation of water molecules next to hydrophobic solutes with different functional groups by Brillouin light scattering. Evidence is given for (i) water activation energy in trimethylamine-N-oxide, proline and t-butyl alcohol diluted solutions which is comparable to that of neat water, almost independent from solute mole fraction and (ii) moderate slowdown of relaxation time of proximal water compared to the bulk, which is consistent with excluded volume models. Assuming that the main contribution to viscosity comes from bulk and hydration water, a rationale is given of the phenomenological Arrhenius' laws for the viscosity of diluted aqueous solutions.

  9. Connecting synthetic chemistry decisions to cell and genome biology using small-molecule phenotypic profiling

    PubMed Central

    Wagner, Bridget K.; Clemons, Paul A.

    2009-01-01

    Discovering small-molecule modulators for thousands of gene products requires multiple stages of biological testing, specificity evaluation, and chemical optimization. Many cellular profiling methods, including cellular sensitivity, gene-expression, and cellular imaging, have emerged as methods to assess the functional consequences of biological perturbations. Cellular profiling methods applied to small-molecule science provide opportunities to use complex phenotypic information to prioritize and optimize small-molecule structures simultaneously against multiple biological endpoints. As throughput increases and cost decreases for such technologies, we see an emerging paradigm of using more information earlier in probe- and drug-discovery efforts. Moreover, increasing access to public datasets makes possible the construction of “virtual” profiles of small-molecule performance, even when multiplexed measurements were not performed or when multidimensional profiling was not the original intent. We review some key conceptual advances in small-molecule phenotypic profiling, emphasizing connections to other information, such as protein-binding measurements, genetic perturbations, and cell states. We argue that to maximally leverage these measurements in probe and drug discovery requires a fundamental connection to synthetic chemistry, allowing the consequences of synthetic decisions to be described in terms of changes in small-molecule profiles. Mining such data in the context of chemical structure and synthesis strategies can inform decisions about chemistry procurement and library development, leading to optimal small-molecule screening collections. PMID:19825513

  10. Antithrombotic and antiplatelet activities of small-molecule alkaloids from Scolopendra subspinipes mutilans

    PubMed Central

    Lee, Wonhwa; Lee, JungIn; Kulkarni, Roshan; Kim, Mi-Ae; Hwang, Jae Sam; Na, MinKyun; Bae, Jong-Sup

    2016-01-01

    The aim of this study was to discover small-molecule anticoagulants from Scolopendra subspinipes mutilans (SSM). A new acylated polyamine (1) and a new sulfated quinoline alkaloid (2) were isolated from SSM. Treatment with the new alkaloids 1, 2, and indole acetic acid 4 prolonged the activated partial thromboplastin time and prothrombin time and inhibited the activity and production of thrombin and activated factor X. Furthermore, compounds 1, 2, and 4 inhibited thrombin-catalyzed fibrin polymerization and platelet aggregation. In accordance with these potential in vitro antiplatelet activities, compounds 1, 2, and 4 showed enhanced antithrombotic effects in an in vivo pulmonary embolism and arterial thrombosis model. Compounds 1, 2, and 4 also elicited anticoagulant effects in mice. Collectively, this study may serve as the groundwork for commercializing SSM or compounds 1, 2, and 4 as functional food components for the prevention and treatment of pathogenic conditions and serve as new scaffolds for the development of anticoagulants. PMID:26905699

  11. A small-molecule inhibitor of sarcomere contractility suppresses hypertrophic cardiomyopathy in mice

    PubMed Central

    Green, Eric M.; Wakimoto, Hiroko; Anderson, Robert L.; Evanchik, Marc J.; Gorham, Joshua M.; Harrison, Brooke C.; Henze, Marcus; Kawas, Raja; Oslob, Johan D.; Rodriguez, Hector M.; Song, Yonghong; Wan, William; Leinwand, Leslie A.; Spudich, James A.; McDowell, Robert S.; Seidman, J. G.; Seidman, Christine E.

    2016-01-01

    Hypertrophic cardiomyopathy (HCM) is an inherited disease of heart muscle that can be caused by mutations in sarcomere proteins. Clinical diagnosis depends on an abnormal thickening of the heart, but the earliest signs of disease are hyperdynamic contraction and impaired relaxation. Whereas some in vitro studies of power generation by mutant and wild-type sarcomere proteins are consistent with mutant sarcomeres exhibiting enhanced contractile power, others are not. We identified a small molecule, MYK-461, that reduces contractility by decreasing the adenosine triphosphatase activity of the cardiac myosin heavy chain. Here we demonstrate that early, chronic administration of MYK-461 suppresses the development of ventricular hypertrophy, cardiomyocyte disarray, and myocardial fibrosis and attenuates hypertrophic and profibrotic gene expression in mice harboring heterozygous human mutations in the myosin heavy chain. These data indicate that hyperdynamic contraction is essential for HCM pathobiology and that inhibitors of sarcomere contraction may be a valuable therapeutic approach for HCM. PMID:26912705

  12. Osteogenic Activity of Locally Applied Small Molecule Drugs in a Rat Femur Defect Model

    PubMed Central

    Cottrell, Jessica A.; Vales, Francis M.; Schachter, Deborah; Wadsworth, Scott; Gundlapalli, Rama; Kapadia, Rasesh; O'Connor, J. Patrick

    2010-01-01

    The long-term success of arthroplastic joints is dependent on the stabilization of the implant within the skeletal site. Movement of the arthroplastic implant within the bone can stimulate osteolysis, and therefore methods which promote rigid fixation or bone growth are expected to enhance implant stability and the long-term success of joint arthroplasty. In the present study, we used a simple bilateral bone defect model to analyze the osteogenic activity of three small-molecule drug implants via microcomputerized tomography (micro-CT) and histomorphometry. In this study, we show that local delivery of alendronate, but not lovastatin or omeprazole, led to significant new bone formation at the defect site. Since alendronate impedes osteoclast-development, it is theorized that alendronate treatment results in a net increase in bone formation by preventing osteoclast mediated remodeling of the newly formed bone and upregulating osteoblasts. PMID:20625499

  13. Lyotropic liquid crystal engineering-ordered nanostructured small molecule amphiphile self-assembly materials by design.

    PubMed

    Fong, Celesta; Le, Tu; Drummond, Calum J

    2012-02-01

    Future nanoscale soft matter design will be guided to a large extent by the teachings of amphiphile (lipid or surfactant) self-assembly. Ordered nanostructured lyotropic liquid crystalline mesophases may form in select mixtures of amphiphile and solvent. To reproducibly engineer the low energy amphiphile self-assembly of materials for the future, we must first learn the design principles. In this critical review we discuss the evolution of these design rules and in particular discuss recent key findings regarding (i) what drives amphiphile self-assembly, (ii) what governs the self-assembly structures that are formed, and (iii) how can amphiphile self-assembly materials be used to enhance product formulations, including drug delivery vehicles, medical imaging contrast agents, and integral membrane protein crystallisation media. We focus upon the generation of 'dilutable' lyotropic liquid crystal phases with two- and three-dimensional geometries from amphiphilic small molecules (225 references).

  14. Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization

    SciTech Connect

    Kim, Sun Young; Song, Kyung-A; Kieff, Elliott; Kang, Myung-Soo

    2012-07-27

    Highlights: Black-Right-Pointing-Pointer Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. Black-Right-Pointing-Pointer A small molecule and a peptide as EBNA1 dimerization inhibitors identified. Black-Right-Pointing-Pointer Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. Black-Right-Pointing-Pointer Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)'s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation. In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459-607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-J{kappa} binding to the J{kappa} site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560-574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated with

  15. Stereoselective Modulation of P-Glycoprotein by Chiral Small Molecules.

    PubMed

    Carocci, Alessia; Catalano, Alessia; Turi, Francesco; Lovece, Angelo; Cavalluzzi, Maria M; Bruno, Claudio; Colabufo, Nicola A; Contino, Marialessandra; Perrone, Maria G; Franchini, Carlo; Lentini, Giovanni

    2016-01-01

    Inhibition of drug efflux pumps such as P-glycoprotein (P-gp) is an approach toward combating multidrug resistance, which is a significant hurdle in current cancer treatments. To address this, N-substituted aryloxymethyl pyrrolidines were designed and synthesized in their homochiral forms in order to investigate the stereochemical requirements for the binding site of P-gp. Our study provides evidence that the chiral property of molecules could be a strategy for improving the capacity for interacting with P-gp, as the most active compounds of the series stereoselectively modulated this efflux pump. The naphthalene-1-yl analogue (R)-2-[(2,3-dichlorophenoxy)methyl]-1-(naphthalen-1-ylmethyl)pyrrolidine) [(R)-7 a] emerged foremost for its potency and stereoselectivity toward P-gp, with the S enantiomer being nearly inactive. The modulation of P-gp by (R)-7 a involved consumption of ATP, thus demonstrating that the compound behaves as a P-gp substrate.

  16. [Progress in sample preparation and analytical methods for trace polar small molecules in complex samples].

    PubMed

    Zhang, Qianchun; Luo, Xialin; Li, Gongke; Xiao, Xiaohua

    2015-09-01

    Small polar molecules such as nucleosides, amines, amino acids are important analytes in biological, food, environmental, and other fields. It is necessary to develop efficient sample preparation and sensitive analytical methods for rapid analysis of these polar small molecules in complex matrices. Some typical materials in sample preparation, including silica, polymer, carbon, boric acid and so on, are introduced in this paper. Meanwhile, the applications and developments of analytical methods of polar small molecules, such as reversed-phase liquid chromatography, hydrophilic interaction chromatography, etc., are also reviewed. PMID:26753274

  17. Fluorescence Polarization Screening Assays for Small Molecule Allosteric Modulators of ABL Kinase Function

    PubMed Central

    Grover, Prerna; Shi, Haibin; Baumgartner, Matthew; Camacho, Carlos J.; Smithgall, Thomas E.

    2015-01-01

    The ABL protein-tyrosine kinase regulates intracellular signaling pathways controlling diverse cellular processes and contributes to several forms of cancer. The kinase activity of ABL is repressed by intramolecular interactions involving its regulatory Ncap, SH3 and SH2 domains. Small molecules that allosterically regulate ABL kinase activity through its non-catalytic domains may represent selective probes of ABL function. Here we report a screening assay for chemical modulators of ABL kinase activity that target the regulatory interaction of the SH3 domain with the SH2-kinase linker. This fluorescence polarization (FP) assay is based on a purified recombinant ABL protein consisting of the N-cap, SH3 and SH2 domains plus the SH2-kinase linker (N32L protein) and a short fluorescein-labeled probe peptide that binds to the SH3 domain. In assay development experiments, we found that the probe peptide binds to the recombinant ABL N32L protein in vitro, producing a robust FP signal that can be competed with an excess of unlabeled peptide. The FP signal is not observed with control N32L proteins bearing either an inactivating mutation in the SH3 domain or enhanced SH3:linker interaction. A pilot screen of 1200 FDA-approved drugs identified four compounds that specifically reduced the FP signal by at least three standard deviations from the untreated controls. Secondary assays showed that one of these hit compounds, the antithrombotic drug dipyridamole, enhances ABL kinase activity in vitro to a greater extent than the previously described ABL agonist, DPH. Docking studies predicted that this compound binds to a pocket formed at the interface of the SH3 domain and the linker, suggesting that it activates ABL by disrupting this regulatory interaction. These results show that screening assays based on the non-catalytic domains of ABL can identify allosteric small molecule regulators of kinase function, providing a new approach to selective drug discovery for this important

  18. Enhanced one-photon double ionization of atoms and molecules in an environment of different species.

    PubMed

    Stumpf, V; Kryzhevoi, N V; Gokhberg, K; Cederbaum, L S

    2014-05-16

    The correlated nature of electronic states in atoms and molecules is manifested in the simultaneous emission of two electrons after absorption of a single photon close to the respective threshold. Numerous observations in atoms and small molecules demonstrate that the double ionization efficiency close to threshold is rather small. In this Letter we show that this efficiency can be dramatically enhanced in the environment. To be specific, we concentrate on the case where the species in question has one or several He atoms as neighbors. The enhancement is achieved by an indirect process, where a He atom of the environment absorbs a photon and the resulting He(+) cation is neutralized fast by a process known as electron transfer mediated decay, producing thereby doubly ionized species. The enhancement of the double ionization is demonstrated in detail for the example of the Mg · He cluster. We show that the double ionization cross section of Mg becomes 3 orders of magnitude larger than the respective cross section of the isolated Mg atom. The impact of more neighbors is discussed and the extension to other species and environments is addressed.

  19. Sustained Small Molecule Delivery from Injectable Hyaluronic Acid Hydrogels through Host-Guest Mediated Retention

    PubMed Central

    Mealy, Joshua E.; Rodell, Christopher B.; Burdick, Jason A.

    2015-01-01

    Self-assembled and injectable hydrogels have many beneficial properties for the local delivery of therapeutics; however, challenges still exist in the sustained release of small molecules from these highly hydrated networks. Host-guest chemistry between cyclodextrin and adamantane has been used to create supramolecular hydrogels from modified polymers. Beyond assembly, this chemistry may also provide increased drug retention and sustained release through the formation of inclusion complexes between drugs and cyclodextrin. Here, we engineered a two-component system from adamantane-modified and β-cyclodextrin (CD)-modified hyaluronic acid (HA), a natural component of the extracellular matrix, to produce hydrogels that are both injectable and able to sustain the release of small molecules. The conjugation of cyclodextrin to HA dramatically altered its affinity for hydrophobic small molecules, such as tryptophan. This interaction led to lower molecule diffusivity and the release of small molecules for up to 21 days with release profiles dependent on CD concentration and drug-CD affinity. There was significant attenuation of release from the supramolecular hydrogels (~20% release in 24h) when compared to hydrogels without CD (~90% release in 24h). The loading of small molecules also had no effect on hydrogel mechanics or self-assembly properties. Finally, to illustrate this controlled delivery approach with clinically used small molecule pharmaceuticals, we sustained the release of two widely used drugs (i.e., doxycycline and doxorubicin) from these hydrogels. PMID:26693019

  20. Chemical and electrochemical oxidation of small organic molecules

    NASA Astrophysics Data System (ADS)

    Smart, Marshall C.

    Direct oxidation fuel cells using proton-exchange membrane electrolytes have long been recognized as being an attractive mode of power generation. The current work addresses the electro-oxidation characteristics of a number of potential fuels on Pt-based electrodes which can be used in direct oxidation fuel cells, including hydrocarbons and oxygenated molecules, such as alcohols, formates, ethers, and acetals. Promising alternative fuels which were identified, such as trimethoxymethane and dimethoxymethane, were then investigated in liquid-feed PEM-based fuel cells. In addition to investigating the nature of the anodic electro-oxidation of organic fuels, effort was also devoted to developing novel polymer electrolyte membranes which have low permeability to organic molecules, such as methanol. This research was initiated with the expectation of reducing the extent of fuel crossover from the anode to the cathode in the liquid-feed design fuel cell which results in lower fuel efficiency and performance. Other work involving efforts to improve the performance of direct oxidation fuel cell includes research focused upon improving the kinetics of oxygen reduction. There is continued interest in the identification of new, safe, non-toxic, and inexpensive reagents which can be used in the oxidation of organic compounds. Urea-hydrogen peroxide (UHP), a hydrogen bonded adduct, has been shown to serve as a valuable source of hydrogen peroxide in a range of reactions. UHP has been shown to be ideal for the monohydroxylation of aromatics, including toluene, ethylbenzene, p-xylene, m-xylene, and mesitylene, as well as benzene, in the presence of trifluoromethanesulfonic acid. It was also found that aniline was converted to a mixture containing primarily azobenzene, azoxybenzene and nitrobenzene when reacted with UHP in glacial acetic acid. A number of aniline derivatives have been investigated and it was observed that the corresponding azoxybenzene derivatives could be

  1. Fragmentation of Small Molecules by Photo-Double Ionization

    NASA Astrophysics Data System (ADS)

    Osipov, Timur

    2008-05-01

    Molecular structure, formation, breakup pathways and recombination formed the subject of many theoretical and experimental studies. Among molecular species like H2, CO, N2, O2 recently great attention has been paid to the dynamics of the fragmentations and rearrangements of C2H2 molecule. Nature's smallest stable hydrocarbon, the symmetric linear acetylene molecule, C2H2, is an important polyatomic system for the study of photo initiated processes. Important features of the intramolecular dynamics in neutral acetylene have been revealed over many years through numerous spectroscopic studies. More recently, the availability of synchrotron radiation and intense laser sources has lead to intriguing studies of the ionization, isomerization and breakup dynamics of acetylene ions. Of particular interest are the yields into the symmetric (CH^+/CH^+), deprotonation (HCC^+/H^+) and quasi-symmetric (HHC^+/C^+) channels, the latter involving isomerization from the neutral acetylene structure into the vinylidene configuration prior to breakup. One expects that the products of dissociation, their kinetic energy releases (KER) and the isomerization times will depend on the particular initial electronic states of the dication involved, but such detailed information has heretofore not been available. We will present the results of the experiment where the dication of acetylene is prepared by Auger decay following core-level X-ray photoionization. Cold Target Recoil Ion Momentum Spectroscopy technique was used to measure the corresponding 3d momentum vectors of Auger electrons and recoil ions in coincidence. We will show that this experimental approach, in combination with ab initio quantum mechanical calculations, can yield a comprehensive map of the two-body dissociation pathways including transition through different electronic energy surfaces, barriers to direct dissociation and the associated rearrangement channels. Work done in collaboration with T. Rescigno, T. Weber, S

  2. Small molecules with ambipolar transporting properties for efficient OLEDs

    NASA Astrophysics Data System (ADS)

    Duan, Lian; Wei, Peng; Qiu, Yong

    2007-11-01

    For stable and efficienct organic light-emitting diodes, it is essential to find molecules with high photoluminescent efficiency, little self-quenching and balanced charge transporting properties. Recently, we've designed and synthesized some highly emissive naphtho[2,3-c][1,2,5]thiadiazole (NTD) derivatives and naphtho[2,3-c][1,2,5]selenadiazole (NSeD) derivatives with unusual ambipolar transporting properties. The ambipolar transporting properties of the NTDs were explained by Marcus theory with carrier reorganization energies and charge-transfer integrals. We obtained high quality single crystals of 4,9-di(biphenyl-4-yl)-naphtho[2,3-c][1,2,5]thiadiazole (NTD02) and 4,9-bis(4-(2,2-diphenylvinyl)phenyl)-naphtho[2,3-c][1,2,5]thiadiazole (NTD05). They have disordered NTD rings' orientation with the opposite directions in the center of the molecule because of NTD's planar configuration and the single-bond connection with the phenyl substituents. The packing structure of NTD02 shows the planar arrangement of NTD rings, forming a "charge transporting channel". Quantum calculation also confirms that the π-π stacking interaction in NTD derivatives benefits the charge transporting via intermolecular hopping on NTD rings. The hole and electron mobilities of NTD05 are 7.16×10 -4 cm2/VÂ.s and 6.19×10 -4 cm2/V•s at an electronic field E = 2.0×10 5 V/cm, respectively. The hole mobility of NTD05 is close to that of N,N'-diphenyl-N,N'-bis(1-naphthyl)(1,1'-biphenyl)-4,4'-diamine (NPB) and the electron mobility of NTD05 is two orders-of-magnitude higher than that of tris(8-hydroxyquinoline) aluminum (Alq 3). For the NTD derivatives, NTD05 also shows the best performance in non-doped OLEDs. CIE coordinates of (0.65, 0.35) and a peak efficiency of 2.4% are achieved for a double layer OLED with NPB as the hole transporting layer and NTD05 as the emitting layer. Moreover, we get ultimate red emission with CIE coordinates of (0.71, 0.29) for some of the NSeD based non

  3. Developing an Efficient and General Strategy for Immobilization of Small Molecules onto Microarrays Using Isocyanate Chemistry.

    PubMed

    Zhu, Chenggang; Zhu, Xiangdong; Landry, James P; Cui, Zhaomeng; Li, Quanfu; Dang, Yongjun; Mi, Lan; Zheng, Fengyun; Fei, Yiyan

    2016-01-01

    Small-molecule microarray (SMM) is an effective platform for identifying lead compounds from large collections of small molecules in drug discovery, and efficient immobilization of molecular compounds is a pre-requisite for the success of such a platform. On an isocyanate functionalized surface, we studied the dependence of immobilization efficiency on chemical residues on molecular compounds, terminal residues on isocyanate functionalized surface, lengths of spacer molecules, and post-printing treatment conditions, and we identified a set of optimized conditions that enable us to immobilize small molecules with significantly improved efficiencies, particularly for those molecules with carboxylic acid residues that are known to have low isocyanate reactivity. We fabricated microarrays of 3375 bioactive compounds on isocyanate functionalized glass slides under these optimized conditions and confirmed that immobilization percentage is over 73%. PMID:26999137

  4. Developing an Efficient and General Strategy for Immobilization of Small Molecules onto Microarrays Using Isocyanate Chemistry

    PubMed Central

    Zhu, Chenggang; Zhu, Xiangdong; Landry, James P.; Cui, Zhaomeng; Li, Quanfu; Dang, Yongjun; Mi, Lan; Zheng, Fengyun; Fei, Yiyan

    2016-01-01

    Small-molecule microarray (SMM) is an effective platform for identifying lead compounds from large collections of small molecules in drug discovery, and efficient immobilization of molecular compounds is a pre-requisite for the success of such a platform. On an isocyanate functionalized surface, we studied the dependence of immobilization efficiency on chemical residues on molecular compounds, terminal residues on isocyanate functionalized surface, lengths of spacer molecules, and post-printing treatment conditions, and we identified a set of optimized conditions that enable us to immobilize small molecules with significantly improved efficiencies, particularly for those molecules with carboxylic acid residues that are known to have low isocyanate reactivity. We fabricated microarrays of 3375 bioactive compounds on isocyanate functionalized glass slides under these optimized conditions and confirmed that immobilization percentage is over 73%. PMID:26999137

  5. Developing an Efficient and General Strategy for Immobilization of Small Molecules onto Microarrays Using Isocyanate Chemistry.

    PubMed

    Zhu, Chenggang; Zhu, Xiangdong; Landry, James P; Cui, Zhaomeng; Li, Quanfu; Dang, Yongjun; Mi, Lan; Zheng, Fengyun; Fei, Yiyan

    2016-03-16

    Small-molecule microarray (SMM) is an effective platform for identifying lead compounds from large collections of small molecules in drug discovery, and efficient immobilization of molecular compounds is a pre-requisite for the success of such a platform. On an isocyanate functionalized surface, we studied the dependence of immobilization efficiency on chemical residues on molecular compounds, terminal residues on isocyanate functionalized surface, lengths of spacer molecules, and post-printing treatment conditions, and we identified a set of optimized conditions that enable us to immobilize small molecules with significantly improved efficiencies, particularly for those molecules with carboxylic acid residues that are known to have low isocyanate reactivity. We fabricated microarrays of 3375 bioactive compounds on isocyanate functionalized glass slides under these optimized conditions and confirmed that immobilization percentage is over 73%.

  6. Wnt/beta-Catenin Signaling and Small Molecule Inhibitors

    PubMed Central

    Voronkov, Andrey; Krauss, Stefan

    2012-01-01

    Wnt/β-catenin signaling is a branch of a functional network that dates back to the first metazoans and it is involved in a broad range of biological systems including stem cells, embryonic development and adult organs. Deregulation of components involved in Wnt/β-catenin signaling has been implicated in a wide spectrum of diseases including a number of cancers and degenerative diseases. The key mediator of Wnt signaling, β-catenin, serves several cellular functions. It functions in a dynamic mode at multiple cellular locations, including the plasma membrane, where β-catenin contributes to the stabilization of intercellular adhesive complexes, the cytoplasm where β-catenin levels are regulated and the nucleus where β-catenin is involved in transcriptional regulation and chromatin interactions. Central effectors of β-catenin levels are a family of cysteine-rich secreted glycoproteins, known as Wnt morphogens. Through the LRP5/6-Frizzled receptor complex, Wnts regulate the location and activity of the destruction complex and consequently intracellular β- catenin levels. However, β-catenin levels and their effects on transcriptional programs are also influenced by multiple other factors including hypoxia, inflammation, hepatocyte growth factor-mediated signaling, and the cell adhesion molecule E-cadherin. The broad implications of Wnt/β-catenin signaling in development, in the adult body and in disease render the pathway a prime target for pharmacological research and development. The intricate regulation of β-catenin at its various locations provides alternative points for therapeutic interventions. PMID:23016862

  7. Design, Synthesis and Evaluation of Small Molecule Hsp90 Probes

    PubMed Central

    Taldone, Tony; Zatorska, Danuta; Patel, Pallav D.; Zong, Hongliang; Rodina, Anna; Ahn, James H.; Moulick, Kamalika; Guzman, Monica L.

    2011-01-01

    A number of compounds from different chemical classes are known to bind competitively to the ATP-pocket of Hsp90 and inhibit its chaperone function. The natural product geldanamycin was the first reported inhibitor of Hsp90 and since then synthetic inhibitors from purine, isoxazole and indazol-4-one chemical classes have been discovered and are currently or soon to be in clinical trials for the treatment of cancer. In spite of a similar binding mode to Hsp90, distinct biological profiles were demonstrated amongst these molecules, both in vitro and in vivo. To better understand the molecular basis for these dissimilarities, we report here the synthesis of chemical tools for three Hsp90 inhibitor classes. These agents will be useful for probing tumor-by-tumor the Hsp90 complexes isolated by specific inhibitors. Such information will lead to better understanding of tumor specific molecular markers to aid in their clinical development. It will also help to elucidate the molecular basis for the biological differences observed among Hsp90 inhibitors. PMID:21459002

  8. Novel Apigenin Based Small Molecule that Targets Snake Venom Metalloproteases

    PubMed Central

    Anusha, Sebastian; Hemshekhar, Mahadevappa; Chandra Nayaka, Siddaiah; Kemparaju, Kempaiah; Basappa; Girish, Kesturu S.; Rangappa, Kanchugarakoppal S.

    2014-01-01

    The classical antivenom therapy has appreciably reduced snakebite mortality rate and thus is the only savior drug available. Unfortunately, it considerably fails to shield the viper bite complications like hemorrhage, local tissue degradation and necrosis responsible for severe morbidity. Moreover, the therapy is also tagged with limitations including anaphylaxis, serum sickness and poor availability. Over the last decade, snake venom metalloproteases (SVMPs) are reported to be the primary component responsible for hemorrhage and tissue degradation at bitten site. Thus, antivenom inability to offset viper venom-induced local toxicity has been a basis for an insistent search for SVMP inhibitors. Here we report the inhibitory effect of compound 5d, an apigenin based molecule against SVMPs both in silico and in vivo. Several apigenin analogues are synthesized using multicomponent Ugi reactions. Among them, compound 5d effectively abrogated Echis carinatus (EC) venom-induced local hemorrhage, tissue necrosis and myotoxicity in a dose dependant fashion. The histopathological study further conferred effective inhibition of basement membrane degradation, and accumulation of inflammatory leucocytes at the site of EC venom inoculation. The compound also protected EC venom-induced fibrin and fibrinogen degradation. The molecular docking of compound 5d and bothropasin demonstrated the direct interaction of hydroxyl group of compound with Glu146 present in hydrophobic pocket of active site and does not chelate Zn2+. Hence, it is concluded that compound 5d could be a potent agent in viper bite management. PMID:25184206

  9. A small-molecule dye for NIR-II imaging

    NASA Astrophysics Data System (ADS)

    Antaris, Alexander L.; Chen, Hao; Cheng, Kai; Sun, Yao; Hong, Guosong; Qu, Chunrong; Diao, Shuo; Deng, Zixin; Hu, Xianming; Zhang, Bo; Zhang, Xiaodong; Yaghi, Omar K.; Alamparambil, Zita R.; Hong, Xuechuan; Cheng, Zhen; Dai, Hongjie

    2016-02-01

    Fluorescent imaging of biological systems in the second near-infrared window (NIR-II) can probe tissue at centimetre depths and achieve micrometre-scale resolution at depths of millimetres. Unfortunately, all current NIR-II fluorophores are excreted slowly and are largely retained within the reticuloendothelial system, making clinical translation nearly impossible. Here, we report a rapidly excreted NIR-II fluorophore (~90% excreted through the kidneys within 24 h) based on a synthetic 970-Da organic molecule (CH1055). The fluorophore outperformed indocyanine green (ICG)--a clinically approved NIR-I dye--in resolving mouse lymphatic vasculature and sentinel lymphatic mapping near a tumour. High levels of uptake of PEGylated-CH1055 dye were observed in brain tumours in mice, suggesting that the dye was detected at a depth of ~4 mm. The CH1055 dye also allowed targeted molecular imaging of tumours in vivo when conjugated with anti-EGFR Affibody. Moreover, a superior tumour-to-background signal ratio allowed precise image-guided tumour-removal surgery.

  10. A small-molecule dye for NIR-II imaging.

    PubMed

    Antaris, Alexander L; Chen, Hao; Cheng, Kai; Sun, Yao; Hong, Guosong; Qu, Chunrong; Diao, Shuo; Deng, Zixin; Hu, Xianming; Zhang, Bo; Zhang, Xiaodong; Yaghi, Omar K; Alamparambil, Zita R; Hong, Xuechuan; Cheng, Zhen; Dai, Hongjie

    2016-02-01

    Fluorescent imaging of biological systems in the second near-infrared window (NIR-II) can probe tissue at centimetre depths and achieve micrometre-scale resolution at depths of millimetres. Unfortunately, all current NIR-II fluorophores are excreted slowly and are largely retained within the reticuloendothelial system, making clinical translation nearly impossible. Here, we report a rapidly excreted NIR-II fluorophore (∼90% excreted through the kidneys within 24 h) based on a synthetic 970-Da organic molecule (CH1055). The fluorophore outperformed indocyanine green (ICG)-a clinically approved NIR-I dye-in resolving mouse lymphatic vasculature and sentinel lymphatic mapping near a tumour. High levels of uptake of PEGylated-CH1055 dye were observed in brain tumours in mice, suggesting that the dye was detected at a depth of ∼4 mm. The CH1055 dye also allowed targeted molecular imaging of tumours in vivo when conjugated with anti-EGFR Affibody. Moreover, a superior tumour-to-background signal ratio allowed precise image-guided tumour-removal surgery. PMID:26595119

  11. β-phenylethylamine, a small molecule with a large impact

    PubMed Central

    Irsfeld, Meredith; Spadafore, Matthew; Prüß, Birgit M.

    2013-01-01

    During a screen of bacterial nutrients as inhibitors of Escherichia coli O157:H7 biofilm, the Prüß research team made an intriguing observation: among 95 carbon and 95 nitrogen sources tested, β-phenylethylamine (PEA) performed best at reducing bacterial cell counts and biofilm amounts, when supplemented to liquid beef broth medium. This review article summarizes what is known about PEA. After some starting information on the chemistry of the molecule, we focus on PEA as a neurotransmitter and then move on to its role in food processing. PEA is a trace amine whose molecular mechanism of action differs from biogenic amines, such as serotonin or dopamine. Especially low or high concentrations of PEA may be associated with specific psychological disorders. For those disorders that are characterized by low PEA levels (e.g. attention deficit hyperactivity disorder), PEA has been suggested as a ‘safe’ alternative to drugs, such as amphetamine or methylphenidate, which are accompanied by many undesirable side effects. On the food processing end, PEA can be detected in food either as a result of microbial metabolism or thermal processing. PEA's presence in food can be used as an indicator of bacterial contamination. PMID:24482732

  12. Ethylene and Metal Stress: Small Molecule, Big Impact

    PubMed Central

    Keunen, Els; Schellingen, Kerim; Vangronsveld, Jaco; Cuypers, Ann

    2016-01-01

    The phytohormone ethylene is known to mediate a diverse array of signaling processes during abiotic stress in plants. Whereas many reports have demonstrated enhanced ethylene production in metal-exposed plants, the underlying molecular mechanisms are only recently investigated. Increasing evidence supports a role for ethylene in the regulation of plant metal stress responses. Moreover, crosstalk appears to exist between ethylene and the cellular redox balance, nutrients and other phytohormones. This review highlights our current understanding of the key role ethylene plays during responses to metal exposure. Moreover, particular attention is paid to the integration of ethylene within the broad network of plant responses to metal stress. PMID:26870052

  13. Matrix Infrared Spectroscopic and Computational Investigations of Novel Small Uranium Containing Molecules - Final Technical Report

    SciTech Connect

    Andrews, Lester

    2014-10-17

    Direct reactions of f-element uranium, thorium and lanthanide metal atoms were investigated with small molecules. These metal atoms were generated by laser ablation and mixed with the reagent molecules then condensed with noble gases at 4K. The products were analyzed by absorption of infrared light to measure vibrational frequencies which were confirmed by quantum chemical calculations. We have learned more about the reactivity of uranium atoms with common molecules, which will aid in the develolpment of further applications of uranium.

  14. Carbohydrate Recognition by Boronolectins, Small Molecules, and Lectins

    PubMed Central

    Jin, Shan; Cheng, Yunfeng; Reid, Suazette; Li, Minyong; Wang, Binghe

    2009-01-01

    Carbohydrates are known to mediate a large number of biological and pathological events. Small and macromolecules capable of carbohydrate recognition have great potentials as research tools, diagnostics, vectors for targeted delivery of therapeutic and imaging agents, and therapeutic agents. However, this potential is far from being realized. One key issue is the difficulty in the development of “binders” capable of specific recognition of carbohydrates of biological relevance. This review discusses systematically the general approaches that are available in developing carbohydrate sensors and “binders/receptors,” and their applications. The focus is on discoveries during the last five years. PMID:19291708

  15. Development and utilization of non-coding RNA-small molecule interactions.

    PubMed

    Georgianna, Wesleigh E; Young, Douglas D

    2011-12-01

    RNA plays a crucial role in cellular biology as a carrier of genetic information. However, beyond this passive role, RNA has been shown to regulate various cellular processes in a form that is not translated into protein. Non-coding RNA (ncRNA) has been shown to be important in gene regulation, and its aberrant activity has been associated with several disease states. As such, ncRNAs represent a novel target for small molecule regulation and recently, significant advances have been made towards elucidating small molecule regulators of ncRNAs. Herein, we provide an overview of miRNA, siRNA, RNA aptamers, riboswitches, and ribozymes, within the context of recent findings regarding the exogenous regulation of these ncRNAs by small molecules. The development of these small molecule tools has far-reaching applications in the advancement of molecular therapeutics.

  16. Target deconvolution of bioactive small molecules: the heart of chemical biology and drug discovery.

    PubMed

    Jung, Hye Jin; Kwon, Ho Jeong

    2015-09-01

    Identification of the target proteins of bioactive small molecules isolated from phenotypic screens plays an important role in chemical biology and drug discovery. However, discovering the targets of small molecules is often the most challenging and time-consuming step for chemical biology researchers. To overcome the bottlenecks in target identification, many new approaches based on genomics, proteomics, and bioinformatics technologies have been developed. Here, we provide an overview of the current major methodologies for target deconvolution of bioactive small molecules. To obtain an integrated view of the mechanisms of action of small molecules, we propose a systematic approach that involves the combination of multi-omics-based target identification and validation and preclinical target validation.

  17. Advancing small-molecule-based chemical biology with next-generation sequencing technologies.

    PubMed

    Anandhakumar, Chandran; Kizaki, Seiichiro; Bando, Toshikazu; Pandian, Ganesh N; Sugiyama, Hiroshi

    2015-01-01

    Next-generation-sequencing (NGS) technologies enable us to obtain extensive information by deciphering millions of individual DNA sequencing reactions simultaneously. The new DNA-sequencing strategies exceed their precursors in output by many orders of magnitude, resulting in a quantitative increase in valuable sequence information that could be harnessed for qualitative analysis. Sequencing on this scale has facilitated significant advances in diverse disciplines, ranging from the discovery, design, and evaluation of many small molecules and relevant biological mechanisms to maturation of personalized therapies. NGS technologies that have recently become affordable allow us to gain in-depth insight into small-molecule-triggered biological phenomena and empower researchers to develop advanced versions of small molecules. In this review we focus on the overlooked implications of NGS technologies in chemical biology, with a special emphasis on small-molecule development and screening.

  18. Sensors and Biosensors for the Determination of Small Molecule Biological Toxins

    PubMed Central

    Wang, Xiang-Hong; Wang, Shuo

    2008-01-01

    The following review of sensors and biosensors focuses on the determination of commonly studied small molecule biological toxins, including mycotoxins and small molecule neurotoxins. Because of the high toxicity of small molecule toxins, an effective analysis technique for determining their toxicity is indispensable. Sensors and biosensors have emerged as sensitive and rapid techniques for toxicity analysis in the past decade. Several different sensors for the determination of mycotoxins and other small molecule neurotoxins have been reported in the literature, and many of these sensors such as tissue biosensors, enzyme sensors, optical immunosensors, electrochemical sensors, quartz crystal sensors, and surface plasmon resonance biosensors are reviewed in this paper. Sensors are a practical and convenient monitoring tool in the area of routine analysis, and their specificity, sensitivity, reproducibility and analysis stability should all be improved in future work. In addition, accuracy field portable sensing devices and multiplexing analysis devices will be important requirement for the future.

  19. Large Scale Nanoparticle Screening for Small Molecule Analysis in Laser Desorption Ionization Mass Spectrometry.

    PubMed

    Yagnik, Gargey B; Hansen, Rebecca L; Korte, Andrew R; Reichert, Malinda D; Vela, Javier; Lee, Young Jin

    2016-09-20

    Nanoparticles (NPs) have been suggested as efficient matrixes for small molecule profiling and imaging by laser-desorption ionization mass spectrometry (LDI-MS), but so far there has been no systematic study comparing different NPs in the analysis of various classes of small molecules. Here, we present a large scale screening of 13 NPs for the analysis of two dozen small metabolite molecules. Many NPs showed much higher LDI efficiency than organic matrixes in positive mode and some NPs showed comparable efficiencies for selected analytes in negative mode. Our results suggest that a thermally driven desorption process is a key factor for metal oxide NPs, but chemical interactions are also very important, especially for other NPs. The screening results provide a useful guideline for the selection of NPs in the LDI-MS analysis of small molecules. PMID:27573492

  20. Small Molecule Control of Intracellular Protein Levels Through Modulation of the Ubiquitin Proteasome System

    PubMed Central

    Buckley, Dennis L.

    2015-01-01

    Traditionally, biological probes and drugs have targeted the activities of proteins (such as enzymes and receptors) that can be easily controlled by small molecules. The remaining majority of the proteome has been deemed “undruggable”. By using small molecule modulators of the ubiquitin proteasome, protein levels, rather than protein activities can be targeted instead, increasing the number of druggable targets. While targeting the proteasome itself can lead to a global increase in protein levels, targeting other components of the UPS (e.g., the hundreds of E3 ubiquitin ligases) can lead to an increase in protein levels in a more targeted fashion. Alternatively, multiple strategies for inducing protein degradation with small molecule probes are emerging. With the ability to induce and inhibit the degradation of targeted proteins, small molecule modulators of the UPS have the potential to significantly expand the druggable portion of the proteome beyond traditional targets such as enzymes and receptors. PMID:24459094

  1. Synthesis of many different types of organic small molecules using one automated process.

    PubMed

    Li, Junqi; Ballmer, Steven G; Gillis, Eric P; Fujii, Seiko; Schmidt, Michael J; Palazzolo, Andrea M E; Lehmann, Jonathan W; Morehouse, Greg F; Burke, Martin D

    2015-03-13

    Small-molecule synthesis usually relies on procedures that are highly customized for each target. A broadly applicable automated process could greatly increase the accessibility of this class of compounds to enable investigations of their practical potential. Here we report the synthesis of 14 distinct classes of small molecules using the same fully automated process. This was achieved by strategically expanding the scope of a building block-based synthesis platform to include even C(sp3)-rich polycyclic natural product frameworks and discovering a catch-and-release chromatographic purification protocol applicable to all of the corresponding intermediates. With thousands of compatible building blocks already commercially available, many small molecules are now accessible with this platform. More broadly, these findings illuminate an actionable roadmap to a more general and automated approach for small-molecule synthesis. PMID:25766227

  2. Synthesis of many different types of organic small molecules using one automated process.

    PubMed

    Li, Junqi; Ballmer, Steven G; Gillis, Eric P; Fujii, Seiko; Schmidt, Michael J; Palazzolo, Andrea M E; Lehmann, Jonathan W; Morehouse, Greg F; Burke, Martin D

    2015-03-13

    Small-molecule synthesis usually relies on procedures that are highly customized for each target. A broadly applicable automated process could greatly increase the accessibility of this class of compounds to enable investigations of their practical potential. Here we report the synthesis of 14 distinct classes of small molecules using the same fully automated process. This was achieved by strategically expanding the scope of a building block-based synthesis platform to include even C(sp3)-rich polycyclic natural product frameworks and discovering a catch-and-release chromatographic purification protocol applicable to all of the corresponding intermediates. With thousands of compatible building blocks already commercially available, many small molecules are now accessible with this platform. More broadly, these findings illuminate an actionable roadmap to a more general and automated approach for small-molecule synthesis.

  3. Synthesis of many different types of organic small molecules using one automated process

    PubMed Central

    Li, Junqi; Ballmer, Steven G.; Gillis, Eric P.; Fujii, Seiko; Schmidt, Michael J.; Palazzolo, Andrea M. E.; Lehmann, Jonathan W.; Morehouse, Greg F.; Burke, Martin D.

    2015-01-01

    Small molecule synthesis usually relies on procedures highly customized for each target. A broadly applicable automated process could greatly increase the accessibility of this class of compounds to enable investigations of their practical potential. Here we report the synthesis of 14 distinct classes of small molecules using the same fully automated process. This was achieved by strategically expanding the scope of a building block-based synthesis platform to include even Csp3-rich polycyclic natural product frameworks and discovering a catch-and-release chromatographic purification protocol applicable to all of the corresponding intermediates. With thousands of compatible building blocks already commercially available, many small molecules are now accessible with this platform. More broadly, these findings illuminate an actionable roadmap to a more general and automated approach for small molecule synthesis. PMID:25766227

  4. Small molecules enable cardiac reprogramming of mouse fibroblasts with a single factor, Oct4.

    PubMed

    Wang, Haixia; Cao, Nan; Spencer, C Ian; Nie, Baoming; Ma, Tianhua; Xu, Tao; Zhang, Yu; Wang, Xiaojing; Srivastava, Deepak; Ding, Sheng

    2014-03-13

    It was recently shown that mouse fibroblasts could be reprogrammed into cells of a cardiac fate by forced expression of multiple transcription factors and microRNAs. For ultimate application of such a reprogramming strategy for cell-based therapy or in vivo cardiac regeneration, reducing or eliminating the genetic manipulations by small molecules would be highly desirable. Here, we report the identification of a defined small-molecule cocktail that enables the highly efficient conversion of mouse fibroblasts into cardiac cells with only one transcription factor, Oct4, without any evidence of entrance into the pluripotent state. Small-molecule-induced cardiomyocytes spontaneously contract and exhibit a ventricular phenotype. Furthermore, these induced cardiomyocytes pass through a cardiac progenitor stage. This study lays the foundation for future pharmacological reprogramming approaches and provides a small-molecule condition for investigation of the mechanisms underlying the cardiac reprogramming process. PMID:24561253

  5. Restored physiology in protein-deficient yeast by a small molecule channel

    PubMed Central

    Cioffi, Alexander G.; Hou, Jennifer; Grillo, Anthony S.; Diaz, Katrina A.; Burke, Martin D.

    2015-01-01

    Deficiencies of protein ion channels underlie many currently incurable human diseases. Robust networks of pumps and channels are usually responsible for the directional movement of specific ions in organisms ranging from microbes to humans. We thus questioned whether minimally selective small molecule mimics of missing protein channels might be capable of collaborating with the corresponding protein ion pumps to restore physiology. Here we report vigorous and sustainable restoration of yeast cell growth by replacing missing protein ion channels with imperfect small molecule mimics. We further provide evidence that this tolerance for imperfect mimicry is attributable to collaboration between the channel-forming small molecule and protein ion pumps. These results illuminate a mechanistic framework for pursuing small molecule replacements for deficient protein ion channels that underlie a range of challenging human diseases. PMID:26230309

  6. Probing model interstellar grain surfaces with small molecules

    NASA Astrophysics Data System (ADS)

    Collings, M. P.; Frankland, V. L.; Lasne, J.; Marchione, D.; Rosu-Finsen, A.; McCoustra, M. R. S.

    2015-05-01

    Temperature-programmed desorption and reflection-absorption infrared spectroscopy have been used to explore the interaction of oxygen (O2), nitrogen (N2), carbon monoxide (CO) and water (H2O) with an amorphous silica film as a demonstration of the detailed characterization of the silicate surfaces that might be present in the interstellar medium. The simple diatomic adsorbates are found to wet the silica surface and exhibit first-order desorption kinetics in the regime up to monolayer coverage. Beyond that, they exhibit zero-order kinetics as might be expected for sublimation of bulk solids. Water, in contrast, does not wet the silica surface and exhibits zero-order desorption kinetics at all coverages consistent with the formation of an islanded structure. Kinetic parameters for use in astrophysical modelling were obtained by inversion of the experimental data at sub-monolayer coverages and by comparison with models in the multilayer regime. Spectroscopic studies in the sub-monolayer regime show that the C-O stretching mode is at around 2137 cm-1 (5.43 μm), a position consistent with a linear surface-CO interaction, and is inhomogenously broadened as resulting from the heterogeneity of the surface. These studies also reveal, for the first time, direct evidence for the thermal activation of diffusion, and hence de-wetting, of H2O on the silica surface. Astrophysical implications of these findings could account for a part of the missing oxygen budget in dense interstellar clouds, and suggest that studies of the sub-monolayer adsorption of these simple molecules might be a useful probe of surface chemistry on more complex silicate materials.

  7. Laser desorption/ionization mass spectrometry for direct profiling and imaging of small molecules from raw biological materials

    SciTech Connect

    Cha, Sangwon

    2008-01-01

    Matrix-assisted laser desorption/ionization(MALDI) mass spectrometry(MS) has been widely used for analysis of biological molecules, especially macromolecules such as proteins. However, MALDI MS has a problem in small molecule (less than 1 kDa) analysis because of the signal saturation by organic matrixes in the low mass region. In imaging MS (IMS), inhomogeneous surface formation due to the co-crystallization process by organic MALDI matrixes limits the spatial resolution of the mass spectral image. Therefore, to make laser desorption/ionization (LDI) MS more suitable for mass spectral profiling and imaging of small molecules directly from raw biological tissues, LDI MS protocols with various alternative assisting materials were developed and applied to many biological systems of interest. Colloidal graphite was used as a matrix for IMS of small molecules for the first time and methodologies for analyses of small metabolites in rat brain tissues, fruits, and plant tissues were developed. With rat brain tissues, the signal enhancement for cerebroside species by colloidal graphite was observed and images of cerebrosides were successfully generated by IMS. In addition, separation of isobaric lipid ions was performed by imaging tandem MS. Directly from Arabidopsis flowers, flavonoids were successfully profiled and heterogeneous distribution of flavonoids in petals was observed for the first time by graphite-assisted LDI(GALDI) IMS.

  8. Small Molecule Radiopharmaceuticals – A Review of Current Approaches

    PubMed Central

    Chaturvedi, Shubhra; Mishra, Anil K.

    2016-01-01

    Radiopharmaceuticals are an integral component of nuclear medicine and are widely applied in diagnostics and therapy. Though widely applied, the development of an “ideal” radiopharmaceutical can be challenging. Issues such as specificity, selectivity, sensitivity, and feasible chemistry challenge the design and synthesis of radiopharmaceuticals. Over time, strategies to address the issues have evolved by making use of new technological advances in the fields of biology and chemistry. This review presents the application of few advances in design and synthesis of radiopharmaceuticals. The topics covered are bivalent ligand approach and lipidization as part of design modifications for enhanced selectivity and sensitivity and novel synthetic strategies for optimized chemistry and radiolabeling of radiopharmaceuticals. PMID:26942181

  9. Design of organic ternary blends and small-molecule bulk heterojunctions: photophysical considerations

    NASA Astrophysics Data System (ADS)

    Rajesh, Kallarakkal Ramakrishnan; Paudel, Keshab; Johnson, Brian; Hallani, Rawad; Anthony, John; Ostroverkhova, Oksana

    2015-01-01

    We explored relationships between photophysical processes and solar cell characteristics in solution-processable bulk heterojunctions (BHJs), in particular: (1) polymer donor:fullerene acceptor:small-molecule (SM) nonfullerene acceptor, (2) polymer donor:SM donor:SM nonfullerene acceptor, and (3) SM donor:SM nonfullerene or fullerene acceptor. Addition of a nonfullerene SM acceptor to "efficient" polymer:fullerene BHJs led to a reduction in power conversion efficiency (PCE), mostly due to decreased charge photogeneration efficiency and increased disorder. By contrast, addition of an SM donor to "inefficient" polymer:SM nonfullerene acceptor BHJs led to a factor of two to three improvement in the PCE, due to improved charge photogeneration efficiency and transport. In most blends, exciplex formation was observed and correlated with a reduced short-circuit current (Jsc) without negatively impacting the open-circuit voltage (Voc). A factor of ˜5 higher PCE was observed in SM donor:fullerene acceptor BHJs as compared to SMBHJs with the same SM donor but nonfullerene acceptor, due to enhanced charge carrier photogeneration in the blend with fullerene. Our study revealed that the HOMO and LUMO energies of molecules comprising a blend are not reliable parameters for predicting Voc of the blend, and an understanding of the photophysics is necessary for interpreting solar cell characteristics and improving the molecular design of BHJs.

  10. Tuning dissociation using isoelectronically doped graphene and hexagonal boron nitride: Water and other small molecules

    NASA Astrophysics Data System (ADS)

    Al-Hamdani, Yasmine S.; Alfè, Dario; von Lilienfeld, O. Anatole; Michaelides, Angelos

    2016-04-01

    Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN doped graphene and C doped h-BN. We find that doped surfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed.

  11. Tuning dissociation using isoelectronically doped graphene and hexagonal boron nitride: Water and other small molecules.

    PubMed

    Al-Hamdani, Yasmine S; Alfè, Dario; von Lilienfeld, O Anatole; Michaelides, Angelos

    2016-04-21

    Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN dopedgraphene and C doped h-BN. We find that dopedsurfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed. PMID:27389233

  12. Patterning small-molecule biocapture surfaces: microcontact insertion printing vs. photolithography.

    PubMed

    Shuster, M J; Vaish, A; Cao, H H; Guttentag, A I; McManigle, J E; Gibb, A L; Martinez-Rivera, M; Martinez, M M; Nezarati, R M; Hinds, J M; Liao, W-S; Weiss, P S; Andrews, A M

    2011-10-14

    Chemical patterns prepared by self-assembly, combined with soft lithography or photolithography, are directly compared. Pattern fidelity can be controlled in both cases but patterning at the low densities necessary for small-molecule probe capture of large biomolecule targets is better accomplished using microcontact insertion printing (μCIP). Surfaces patterned by μCIP are used to capture biomolecule binding partners for the small molecules dopamine and biotin.

  13. A-D-A small molecules for solution-processed organic photovoltaic cells.

    PubMed

    Ni, Wang; Wan, Xiangjian; Li, Miaomiao; Wang, Yunchuang; Chen, Yongsheng

    2015-03-25

    A-D-A small molecules have drawn more and more attention in solution-processed organic solar cells due to the advantages of a diversity of structures, easy control of energy levels, etc. Recently, a power conversion efficiency of nearly 10% has been achieved through careful material design and device optimization. This feature article reviews recent representative progress in the design and application of A-D-A small molecules in organic photovoltaic cells.

  14. Prdm4 induction by the small molecule butein promotes white adipose tissue browning.

    PubMed

    Song, No-Joon; Choi, Seri; Rajbhandari, Prashant; Chang, Seo-Hyuk; Kim, Suji; Vergnes, Laurent; Kwon, So-Mi; Yoon, Jung-Hoon; Lee, Sukchan; Ku, Jin-Mo; Lee, Jeong-Soo; Reue, Karen; Koo, Seung-Hoi; Tontonoz, Peter; Park, Kye Won

    2016-07-01

    Increasing the thermogenic activity of adipocytes holds promise as an approach to combating human obesity and related metabolic diseases. We identified induction of mouse PR domain containing 4 (Prdm4) by the small molecule butein as a means to induce expression of uncoupling protein 1 (Ucp1), increase energy expenditure, and stimulate the generation of thermogenic adipocytes. This study highlights a Prdm4-dependent pathway, modulated by small molecules, that stimulates browning of white adipose tissue.

  15. Elasticity Dominated Surface Segregation of Small Molecules in Polymer Mixtures

    NASA Astrophysics Data System (ADS)

    Krawczyk, Jarosław; Croce, Salvatore; McLeish, T. C. B.; Chakrabarti, Buddhapriya

    2016-05-01

    We study the phenomenon of migration of the small molecular weight component of a binary polymer mixture to the free surface using mean field and self-consistent field theories. By proposing a free energy functional that incorporates polymer-matrix elasticity explicitly, we compute the migrant volume fraction and show that it decreases significantly as the sample rigidity is increased. A wetting transition, observed for high values of the miscibility parameter can be prevented by increasing the matrix rigidity. Estimated values of the bulk modulus suggest that the effect should be observable experimentally for rubberlike materials. This provides a simple way of controlling surface migration in polymer mixtures and can play an important role in industrial formulations, where surface migration often leads to decreased product functionality.

  16. Small molecules as tracers in atmospheric secondary organic aerosol

    NASA Astrophysics Data System (ADS)

    Yu, Ge

    Secondary organic aerosol (SOA), formed from in-air oxidation of volatile organic compounds, greatly affects human health and climate. Although substantial research has been devoted to SOA formation and evolution, the modeled and lab-generated SOA are still low in mass and degree of oxidation compared to ambient measurements. In order to compensate for these discrepancies, the aqueous processing pathway has been brought to attention. The atmospheric waters serve as aqueous reaction media for dissolved organics to undergo further oxidation, oligomerization, or other functionalization reactions, which decreases the vapor pressure while increasing the oxidation state of carbon atoms. Field evidence for aqueous processing requires the identification of tracer products such as organosulfates. We synthesized the standards for two organosulfates, glycolic acid sulfate and lactic acid sulfate, in order to measure their aerosol-state concentration from five distinct locations via filter samples. The water-extracted filter samples were analyzed by LC-MS. Lactic acid sulfate and glycolic acid sulfate were detected in urban locations in the United States, Mexico City, and Pakistan with varied concentrations, indicating their potential as tracers. We studied the aqueous processing reaction between glyoxal and nitrogen-containing species such as ammonium and amines exclusively by NMR spectrometry. The reaction products formic acid and several imidazoles along with the quantified kinetics were reported. The brown carbon generated from these reactions were quantified optically by UV-Vis spectroscopy. The organic-phase reaction between oxygen molecule and alkenes photosensitized by alpha-dicarbonyls were studied in the same manner. We observed the fast kinetics transferring alkenes to epoxides under simulated sunlight. Statistical estimations indicate a very effective conversion of aerosol-phase alkenes to epoxides, potentially forming organosulfates in a deliquescence event and

  17. X-ray crystallography: Assessment and validation of protein-small molecule complexes for drug discovery

    PubMed Central

    Cooper, David R.; Porebski, Przemyslaw J.; Chruszcz, Maksymilian; Minor, Wladek

    2011-01-01

    Introduction Crystallography is the key initial component for structure-based and fragment-based drug design and can often generate leads that can be developed into high potency drugs. Therefore, huge sums of money are committed based on the outcome of crystallography experiments and their interpretation. Areas covered This review discusses how to evaluate the correctness of an X-ray structure, focusing on the validation of small molecule-protein complexes. Various types of inaccuracies found within the PDB are identified and the ramifications of these errors are discussed. The reader will gain an understanding of the key parameters that need to be inspected before a structure can be used in drug discovery efforts, as well as an appreciation of the difficulties of correctly interpreting electron density for small molecules. The reader will also be introduced to methods for validating small molecules within the context of a macromolecular structure. Expert opinion One of the reasons that ligand identification and positioning, within a macromolecular crystal structure, is so difficult is that the quality of small molecules widely varies in the PDB. For this reason, the PDB can not always be considered a reliable repository of structural information pertaining to small molecules, and this makes the derivation of general principles that govern small molecule-protein interactions more difficult. PMID:21779303

  18. Mass spectrometry for small molecule pharmaceutical product development: a review.

    PubMed

    Gillespie, Todd A; Winger, Brian E

    2011-01-01

    Developing a pharmaceutical product has become increasingly difficult and expensive. With an emphasis on developing project knowledge at an earlier stage in development, the use of information-rich technologies (particularly MS) has continued to expand throughout product development. Continued improvements in LC/MS technology have widened the scope of utilizing MS methods for performing both qualitative and quantitative applications within product development. This review describes a multi-tiered MS strategy designed to enhance and accelerate the identification and profiling of both process- and degradation-related impurities in either the active pharmaceutical ingredient (API) or formulated product. Such impurities can be formed either during chemical synthesis, formulation, or during storage. This review provides an overview of a variety of orthogonal-mass spectrometric methodologies, namely GC/MS, LC/MS, and ICP-MS, in support of product development. This review is not meant to be all inclusive; however, it has been written to highlight the increasing use of hyphenated MS techniques within the pharmaceutical development area.

  19. Integration of β-carotene molecules in small liposomes

    NASA Astrophysics Data System (ADS)

    Andreeva, Atanaska; Popova, Antoaneta

    2010-11-01

    The most typical feature of carotenoids is the long polyene chain with conjugated double bonds suggesting that they can serve as conductors of electrons, acting as ''molecular wires'', important elements in the molecular electronic devices. Carotenoids are essential components of photosynthetic systems, performing different functions as light harvesting, photoprotection and electron transfer. They act also as natural antioxidants. In addition they perform structural role stabilizing the three-dimensional organization of photosynthetic membranes. Carotenoids contribute to the stability of the lipid phase, preserving the membrane integrity under potentially harmful environmental conditions. Carotenoids can be easily integrated into model membranes, facilitating the investigation of their functional roles. In carotenoid-egg phosphatidylcholine (EPC) liposomes ß-carotene is randomly distributed in the hydrocarbon interior of the bilayer, without any preferred, well defined orientation and retains a substantial degree of mobility. Here we investigate the degree of integration of ß-carotene in small unilamellar EPC liposomes and the changes in ß-carotene absorption and Raman spectra due to the lipid-pigment interaction. All observed changes in ß-carotene absorption and Raman spectra may be regarded as a result of the lipid-pigment interactions leading to the polyene geometry distortion and increasing of the environment heterogenety in the liposomes as compared to the solutions.

  20. Identification of novel small molecules that elevate Klotho expression.

    PubMed

    King, Gwendalyn D; Chen, CiDi; Huang, Mickey M; Zeldich, Ella; Brazee, Patricia L; Schuman, Eli R; Robin, Maxime; Cuny, Gregory D; Glicksman, Marcie A; Abraham, Carmela R

    2012-01-01

    The absence of Klotho (KL) from mice causes the development of disorders associated with human aging and decreased longevity, whereas increased expression prolongs lifespan. With age, KL protein levels decrease, and keeping levels consistent may promote healthier aging and be disease-modifying. Using the KL promoter to drive expression of luciferase, we conducted a high-throughput screen to identify compounds that activate KL transcription. Hits were identified as compounds that elevated luciferase expression at least 30%. Following validation for dose-dependent activation and lack of cytotoxicity, hit compounds were evaluated further in vitro by incubation with opossum kidney and Z310 rat choroid plexus cells, which express KL endogenously. All compounds elevated KL protein compared with control. To determine whether increased protein resulted in an in vitro functional change, we assayed FGF23 (fibroblast growth factor 23) signalling. Compounds G-I augmented ERK (extracellular-signal-regulated kinase) phosphorylation in FGFR (fibroblast growth factor receptor)-transfected cells, whereas co-transfection with KL siRNA (small interfering RNA) blocked the effect. These compounds will be useful tools to allow insight into the mechanisms of KL regulation. Further optimization will provide pharmacological tools for in vivo studies of KL. PMID:21939436

  1. Combinatorics of feedback in cellular uptake and metabolism of small molecules.

    PubMed

    Krishna, Sandeep; Semsey, Szabolcs; Sneppen, Kim

    2007-12-26

    We analyze the connection between structure and function for regulatory motifs associated with cellular uptake and usage of small molecules. Based on the boolean logic of the feedback we suggest four classes: the socialist, consumer, fashion, and collector motifs. We find that the socialist motif is good for homeostasis of a useful but potentially poisonous molecule, whereas the consumer motif is optimal for nutrition molecules. Accordingly, examples of these motifs are found in, respectively, the iron homeostasis system in various organisms and in the uptake of sugar molecules in bacteria. The remaining two motifs have no obvious analogs in small molecule regulation, but we illustrate their behavior using analogies to fashion and obesity. These extreme motifs could inspire construction of synthetic systems that exhibit bistable, history-dependent states, and homeostasis of flux (rather than concentration).

  2. Free energy of binding of a small molecule to an amorphous polymer in a solvent.

    PubMed

    Chunsrivirot, Surasak; Trout, Bernhardt L

    2011-06-01

    Crystallization is a commonly used purification process in industrial practice. It usually begins with heterogeneous nucleation on a foreign surface. The complicated mechanism of heterogeneous nucleation is not well understood, but we hypothesize that a possible correlation between binding affinity to a surface and nucleation enhancement might exist. Amorphous polymers have been used in controlling crystallization. However, to our knowledge, no attempt has been made to calculate the free energy of binding of a small molecule to an amorphous polymer in a solvent, and to characterize the binding sites/conformations of this system at a molecular level. We developed a two-step approach, first using Adsorption Locator to identify probable binding sites and molecular dynamics to screen for the best binding sites and then using the Blue-Moon Ensemble method to compute the free energy of binding. A system of ethylene glycol, polyvinyl alcohol (PVA), and heavy water (D(2)O) was used for validation, since experimental data exists on a related system. Looking at four independently constructed surfaces, we found that ethylene glycol binds to an indentation on the surface or in a hole beneath the surface. We focused on the indentation binding sites because they are easily accessible and do not have large free energy barriers. The closest system for which experimental data on binding energetics exists is ethylene glycol on PVA in aqueous solutions/gels, and the magnitudes of the free energy of binding to the three best indentation binding sites are close to the experimental value, 0.4-3.7 kcal/mol higher. Our approach offers a way to compute the free energy of binding and characterize the binding sites/conformations, and is general enough to apply to other small molecule/amorphous polymer/solvent systems.

  3. Quantifying the Influence of the Crowded Cytoplasm on Small Molecule Diffusion.

    PubMed

    Kekenes-Huskey, Peter M; Scott, Caitlin E; Atalay, Selcuk

    2016-08-25

    Cytosolic crowding can influence the thermodynamics and kinetics of in vivo chemical reactions. Most significantly, proteins and nucleic acid crowders reduce the accessible volume fraction, ϕ, available to a diffusing substrate, thereby reducing its effective diffusion rate, Deff, relative to its rate in bulk solution. However, Deff can be further hindered or even enhanced, when long-range crowder/diffuser interactions are significant. To probe these effects, we numerically estimated Deff values for small, charged molecules in representative, cytosolic protein lattices up to 0.1 × 0.1 × 0.1 μm(3) in volume via the homogenized Smoluchowski electro-diffusion equation. We further validated our predictions against Deff estimates from ϕ-dependent analytical relationships, such as the Maxwell-Garnett (MG) bound, as well as explicit solutions of the time-dependent electro-diffusion equation. We find that in typical, moderately crowded cell cytoplasm (ϕ ≈ 0.8), Deff is primarily determined by ϕ; in other words, diverse protein shapes and heterogeneous distributions only modestly impact Deff. However, electrostatic interactions between diffusers and crowders, particularly at low electrolyte ionic strengths, can substantially modulate Deff. These findings help delineate the extent that cytoplasmic crowders influence small molecule diffusion, which ultimately may shape the efficiency and timing of intracellular signaling pathways. More generally, the quantitative agreement between computationally expensive solutions of the time-dependent electro-diffusion equation and its comparatively cheaper homogenized form suggest that the latter is a broadly effective model for diffusion in wide-ranging, crowded biological media. PMID:27327486

  4. Label-Free Detection of G Protein–SNARE Interactions and Screening for Small Molecule Modulators

    PubMed Central

    2011-01-01

    Gi/o-coupled presynaptic GPCRs are major targets in neuropsychiatric diseases. For example, presynaptic auto- or heteroreceptors include the D2 dopamine receptor, H3 histamine receptor, 5HT1 serotonin receptors, M4 acetylcholine receptors, GABAB receptors, Class II and III metabotropic glutamate receptors, opioid receptors, as well as many other receptors. These GPCRs exert their influence by decreasing exocytosis of synaptic vesicles. One mechanism by which they act is through direct interaction of the Gβγ subunit with members of the SNARE complex downstream of voltage-dependent calcium channels, and specifically with the C-terminus of SNAP25 and the H3 domain of syntaxin1A. (Gerachshenko, T., Blackmer, T., Yoon, E. J., Bartleson, C., Hamm, H. E., and Alford, S. (2005) Gβγ acts at the C terminus of SNAP-25 to mediate presynaptic inhibition, Nat. Neurosci.8, 597–605; Yoon, E. J., Gerachshenko, T., Spiegelberg, B. D., Alford, S., and Hamm, H. E. (2007) Gβγ interferes with Ca2+-dependent binding of synaptotagmin to the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complex, Mol. Pharmacol.72, 1210–1219; Blackmer, T., Larsen, E. C., Bartleson, C., Kowalchyk, J. A., Yoon, E. J., Preininger, A. M., Alford, S., Hamm, H. E., and Martin, T. F. (2005) G protein βγ directly regulates SNARE protein fusion machinery for secretory granule exocytosis, Nat. Neurosci.8, 421–425).1−3 Small molecule inhibitors of the Gβγ–SNARE interaction would allow the study of the relative importance of this mechanism in more detail. We have utilized novel, label-free technology to detect this protein–protein interaction and screen for several small molecule compounds that perturb the interaction, demonstrating the viability of this approach. Interestingly, the screen also produced enhancers of the Gβγ–SNARE interaction. PMID:22368765

  5. Recent advances in inorganic materials for LDI-MS analysis of small molecules.

    PubMed

    Shi, C Y; Deng, C H

    2016-05-10

    In this review, various inorganic materials were summarized for the analysis of small molecules by laser desorption/ionization mass spectrometry (LDI-MS). Due to its tremendous advantages, such as simplicity, high speed, high throughput, small analyte volumes and tolerance towards salts, LDI-MS has been widely used in various analytes. During the ionization process, a suitable agent is required to assist the ionization, such as an appropriate matrix for matrix assisted laser desorption/ionization mass spectrometry (MALDI-MS). However, it is normally difficult to analyze small molecules with the MALDI technique because conventional organic matrices may produce matrix-related peaks in the low molecular-weight region, which limits the detection of small molecules (m/z < 700 Da). Therefore, more and more inorganic materials, including carbon-based materials, silicon-based materials and metal-based materials, have been developed to assist the ionization of small molecules. These inorganic materials can transfer energy and improve the ionization efficiency of analytes. In addition, functionalized inorganic materials can act as both an adsorbent and an agent in the enrichment and ionization of small molecules. In this review, we mainly focus on present advances in inorganic materials for the LDI-MS analysis of small molecules in the last five years, which contains the synthetic protocols of novel inorganic materials and the detailed results achieved by inorganic materials. On the other hand, this review also summarizes the application of inorganic materials as adsorbents in the selective enrichment of small molecules, which provides a new field for the application of inorganic materials.

  6. Target identification for biologically active small molecules using chemical biology approaches.

    PubMed

    Lee, Heesu; Lee, Jae Wook

    2016-09-01

    The identification and validation of the targets of biologically active molecules is an important step in the field of chemical biology. While recent advances in proteomic and genomic technology have accelerated this identification process, the discovery of small molecule targets remains the most challenging step. A general method for the identification of these small molecule targets has not yet been established. To overcome the difficulty in target identification, new technology derived from the fields of genomics, proteomics, and bioinformatics has been developed. To date, pull-down methods using small molecules immobilized on a solid support followed by mass spectrometry have been the most successful approach. Here, we discuss current procedures for target identification. We also review the most recent target identification approaches and present several examples that illustrate advanced target identification technology.

  7. Comparative metabolomics and structural characterizations illuminate colibactin pathway-dependent small molecules.

    PubMed

    Vizcaino, Maria I; Engel, Philipp; Trautman, Eric; Crawford, Jason M

    2014-07-01

    The gene cluster responsible for synthesis of the unknown molecule "colibactin" has been identified in mutualistic and pathogenic Escherichia coli. The pathway endows its producer with a long-term persistence phenotype in the human bowel, a probiotic activity used in the treatment of ulcerative colitis, and a carcinogenic activity under host inflammatory conditions. To date, functional small molecules from this pathway have not been reported. Here we implemented a comparative metabolomics and targeted structural network analyses approach to identify a catalog of small molecules dependent on the colibactin pathway from the meningitis isolate E. coli IHE3034 and the probiotic E. coli Nissle 1917. The structures of 10 pathway-dependent small molecules are proposed based on structural characterizations and network relationships. The network will provide a roadmap for the structural and functional elucidation of a variety of other small molecules encoded by the pathway. From the characterized small molecule set, in vitro bacterial growth inhibitory and mammalian CNS receptor antagonist activities are presented. PMID:24932672

  8. Solution processable organic polymers and small molecules for bulk-heterojunction solar cells: A review

    SciTech Connect

    Sharma, G. D.

    2011-10-20

    Solution processed bulk heterojunction (BHJ) organic solar cells (OSCs) have gained wide interest in past few years and are established as one of the leading next generation photovoltaic technologies for low cost power production. Power conversion efficiencies up to 6% and 6.5% have been reported in the literature for single layer and tandem solar cells, respectively using conjugated polymers. A recent record efficiency about 8.13% with active area of 1.13 cm{sup 2} has been reported. However Solution processable small molecules have been widely applied for photovoltaic (PV) devices in recent years because they show strong absorption properties, and they can be easily purified and deposited onto flexible substrates at low cost. Introducing different donor and acceptor groups to construct donor--acceptor (D--A) structure small molecules has proved to be an efficient way to improve the properties of organic solar cells (OSCs). The power conversion efficiency about 4.4 % has been reported for OSCs based on the small molecules. This review deals with the recent progress of solution processable D--A structure small molecules and discusses the key factors affecting the properties of OSCs based on D--A structure small molecules: sunlight absorption, charge transport and the energy level of the molecules.

  9. Small-molecule inhibition of MLL activity by disruption of its interaction with WDR5.

    PubMed

    Senisterra, Guillermo; Wu, Hong; Allali-Hassani, Abdellah; Wasney, Gregory A; Barsyte-Lovejoy, Dalia; Dombrovski, Ludmila; Dong, Aiping; Nguyen, Kong T; Smil, David; Bolshan, Yuri; Hajian, Taraneh; He, Hao; Seitova, Alma; Chau, Irene; Li, Fengling; Poda, Gennadiy; Couture, Jean-François; Brown, Peter J; Al-Awar, Rima; Schapira, Matthieu; Arrowsmith, Cheryl H; Vedadi, Masoud

    2013-01-01

    WDR5 (WD40 repeat protein 5) is an essential component of the human trithorax-like family of SET1 [Su(var)3-9 enhancer-of-zeste trithorax 1] methyltransferase complexes that carry out trimethylation of histone 3 Lys4 (H3K4me3), play key roles in development and are abnormally expressed in many cancers. In the present study, we show that the interaction between WDR5 and peptides from the catalytic domain of MLL (mixed-lineage leukaemia protein) (KMT2) can be antagonized with a small molecule. Structural and biophysical analysis show that this antagonist binds in the WDR5 peptide-binding pocket with a Kd of 450 nM and inhibits the catalytic activity of the MLL core complex in vitro. The degree of inhibition was enhanced at lower protein concentrations consistent with a role for WDR5 in directly stabilizing the MLL multiprotein complex. Our data demonstrate inhibition of an important protein-protein interaction and form the basis for further development of inhibitors of WDR5-dependent enzymes implicated in MLL-rearranged leukaemias or other cancers.

  10. Small-molecule inhibition of MLL activity by disruption of its interaction with WDR5

    PubMed Central

    Senisterra, Guillermo; Wu, Hong; Allali-Hassani, Abdellah; Wasney, Gregory A.; Barsyte-Lovejoy, Dalia; Dombrovski, Ludmila; Dong, Aiping; Nguyen, Kong T.; Smil, David; Bolshan, Yuri; Hajian, Taraneh; He, Hao; Seitova, Alma; Chau, Irene; Li, Fengling; Poda, Gennadiy; Couture, Jean-François; Brown, Peter J.; Al-Awar, Rima; Schapira, Matthieu; Arrowsmith, Cheryl H.; Vedadi, Masoud

    2012-01-01

    WDR5 (WD40 repeat protein 5) is an essential component of the human trithorax-like family of SET1 [Su(var)3–9 enhancer-of-zeste trithorax 1] methyltransferase complexes that carry out trimethylation of histone 3 Lys4 (H3K4me3), play key roles in development and are abnormally expressed in many cancers. In the present study, we show that the interaction between WDR5 and peptides from the catalytic domain of MLL (mixed-lineage leukaemia protein) (KMT2) can be antagonized with a small molecule. Structural and biophysical analysis show that this antagonist binds in the WDR5 peptide-binding pocket with a Kd of 450 nM and inhibits the catalytic activity of the MLL core complex in vitro. The degree of inhibition was enhanced at lower protein concentrations consistent with a role for WDR5 in directly stabilizing the MLL multiprotein complex. Our data demonstrate inhibition of an important protein–protein interaction and form the basis for further development of inhibitors of WDR5-dependent enzymes implicated in MLL-rearranged leukaemias or other cancers. PMID:22989411

  11. Nanoplasmonic chitosan nanofibers as effective SERS substrate for detection of small molecules.

    PubMed

    Severyukhina, Alexandra N; Parakhonskiy, Bogdan V; Prikhozhdenko, Ekaterina S; Gorin, Dmitry A; Sukhorukov, Gleb B; Möhwald, Helmuth; Yashchenok, Alexey M

    2015-07-22

    The use of surface enhanced Raman spectroscopy (SERS) is limited by low reproducibility and uniformity of the response. Solving these problems can turn the laboratory use of SERS into real-world application. In this regard, soft SERS-active substrates can enable portable instrumentation and reduce costs in the fabrication of SERS-based sensors. Here, plasmonic free-standing films made of biocompatible chitosan nanofibers and gold nanoparticles are engineered by a simple protocol varying the concentration of chloroauric acid. The concentration and distribution of gold nanoparticles in films are controlled in a predictable way, and SERS spectra for the standard 2-naphthalenethiol with concentration less than 10(-15) M are acquired in a reproducible way. The statistical analysis reveals a relatively high and locally uniform performance of SERS with an enhancement factor of 2 × 10(5) for 86% of the points on the imaged area of the SERS substrate. Potential SERS detection of small molecules, both Rhodamine 6G and d-Glucose, in the micromolar range is demonstrated. PMID:26126080

  12. Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression

    PubMed Central

    2015-01-01

    The transcription factor MYC plays a pivotal role in cancer initiation, progression, and maintenance. However, it has proven difficult to develop small molecule inhibitors of MYC. One attractive route to pharmacological inhibition of MYC has been the prevention of its expression through small molecule-mediated stabilization of the G-quadruplex (G4) present in its promoter. Although molecules that bind globally to quadruplex DNA and influence gene expression are well-known, the identification of new chemical scaffolds that selectively modulate G4-driven genes remains a challenge. Here, we report an approach for the identification of G4-binding small molecules using small molecule microarrays (SMMs). We use the SMM screening platform to identify a novel G4-binding small molecule that inhibits MYC expression in cell models, with minimal impact on the expression of other G4-associated genes. Surface plasmon resonance (SPR) and thermal melt assays demonstrated that this molecule binds reversibly to the MYC G4 with single digit micromolar affinity, and with weaker or no measurable binding to other G4s. Biochemical and cell-based assays demonstrated that the compound effectively silenced MYC transcription and translation via a G4-dependent mechanism of action. The compound induced G1 arrest and was selectively toxic to MYC-driven cancer cell lines containing the G4 in the promoter but had minimal effects in peripheral blood mononucleocytes or a cell line lacking the G4 in its MYC promoter. As a measure of selectivity, gene expression analysis and qPCR experiments demonstrated that MYC and several MYC target genes were downregulated upon treatment with this compound, while the expression of several other G4-driven genes was not affected. In addition to providing a novel chemical scaffold that modulates MYC expression through G4 binding, this work suggests that the SMM screening approach may be broadly useful as an approach for the identification of new G4-binding small

  13. Small molecule-mediated refolding and activation of myosin motor function

    PubMed Central

    Radke, Michael B; Taft, Manuel H; Stapel, Britta; Hilfiker-Kleiner, Denise; Preller, Matthias; Manstein, Dietmar J

    2014-01-01

    The small molecule EMD 57033 has been shown to stimulate the actomyosin ATPase activity and contractility of myofilaments. Here, we show that EMD 57033 binds to an allosteric pocket in the myosin motor domain. EMD 57033-binding protects myosin against heat stress and thermal denaturation. In the presence of EMD 57033, ATP hydrolysis, coupling between actin and nucleotide binding sites, and actin affinity in the presence of ATP are increased more than 10-fold. Addition of EMD 57033 to heat-inactivated β-cardiac myosin is followed by refolding and reactivation of ATPase and motile activities. In heat-stressed cardiomyocytes expression of the stress-marker atrial natriuretic peptide is suppressed by EMD 57033. Thus, EMD 57033 displays a much wider spectrum of activities than those previously associated with small, drug-like compounds. Allosteric effectors that mediate refolding and enhance enzymatic function have the potential to improve the treatment of heart failure, myopathies, and protein misfolding diseases. DOI: http://dx.doi.org/10.7554/eLife.01603.001 PMID:24520162

  14. Systematic selection of small molecules to promote differentiation of embryonic stem cells and experimental validation for generating cardiomyocytes

    PubMed Central

    KalantarMotamedi, Y; Peymani, M; Baharvand, H; Nasr-Esfahani, M H; Bender, A

    2016-01-01

    Small molecules are being increasingly used for inducing the targeted differentiation of stem cells to different cell types. However, until now no systematic method for selecting suitable small molecules for this purpose has been presented. In this work, we propose an integrated and general bioinformatics- and cheminformatics-based approach for selecting small molecules which direct cellular differentiation in the desired way. The approach was successfully experimentally validated for differentiating stem cells into cardiomyocytes. All predicted compounds enhanced expression of cardiac progenitor (Gata4, Nkx2-5 and Mef2c) and mature cardiac markers (Actc1, myh6) significantly during and post-cardiac progenitor formation. The best-performing compound, Famotidine, increased the percentage of Myh6-positive cells from 33 to 56%, and enhanced the expression of Nkx2.5 and Tnnt2 cardiac progenitor and cardiac markers in protein level. The approach employed in the study is applicable to all other stem cell differentiation settings where gene expression data are available. PMID:27551501

  15. Systematic selection of small molecules to promote differentiation of embryonic stem cells and experimental validation for generating cardiomyocytes.

    PubMed

    KalantarMotamedi, Y; Peymani, M; Baharvand, H; Nasr-Esfahani, M H; Bender, A

    2016-01-01

    Small molecules are being increasingly used for inducing the targeted differentiation of stem cells to different cell types. However, until now no systematic method for selecting suitable small molecules for this purpose has been presented. In this work, we propose an integrated and general bioinformatics- and cheminformatics-based approach for selecting small molecules which direct cellular differentiation in the desired way. The approach was successfully experimentally validated for differentiating stem cells into cardiomyocytes. All predicted compounds enhanced expression of cardiac progenitor (Gata4, Nkx2-5 and Mef2c) and mature cardiac markers (Actc1, myh6) significantly during and post-cardiac progenitor formation. The best-performing compound, Famotidine, increased the percentage of Myh6-positive cells from 33 to 56%, and enhanced the expression of Nkx2.5 and Tnnt2 cardiac progenitor and cardiac markers in protein level. The approach employed in the study is applicable to all other stem cell differentiation settings where gene expression data are available. PMID:27551501

  16. Screening for Small-Molecule Modulators of Long Noncoding RNA-Protein Interactions Using AlphaScreen

    PubMed Central

    Pedram Fatemi, Roya; Salah-Uddin, Sultan; Modarresi, Farzaneh; Khoury, Nathalie; Wahlestedt, Claes

    2015-01-01

    Long non–protein coding RNAs (lncRNAs) are an important class of molecules that help orchestrate key cellular events. Although their functional roles in cells are not well understood, thousands of lncRNAs and a number of possible mechanisms by which they act have been reported. LncRNAs can exert their regulatory function in cells by interacting with epigenetic enzymes. In this study, we developed a tool to study lncRNA-protein interactions for high-throughput screening of small-molecule modulators using AlphaScreen technology. We tested the interaction of two lncRNAs: brain-derived neurotrophic factor antisense (BDNF-AS) and Hox transcript antisense RNA (HOTAIR), with Enhancer of zeste homolog 2 (EZH2), a histone methyltransferase against a phytochemical library, to look for small-molecule inhibitors that can alter the expression of downstream target genes. We identified ellipticine, a compound that up-regulates BDNF transcription. Our study shows the feasibility of using high-throughput screening to identify modulators of lncRNA-protein interactions and paves the road for targeting lncRNAs that are dysregulated in human disorders using small-molecule therapies. PMID:26173710

  17. Efficient new ribozyme mimics: direct mapping of molecular design principles from small molecules to macromolecular, biomimetic catalysts.

    PubMed

    Putnam, W C; Daniher, A T; Trawick, B N; Bashkin, J K

    2001-05-15

    Dramatic improvements in ribozyme mimics have been achieved by employing the principles of small molecule catalysis to the design of macromolecular, biomimetic reagents. Ribozyme mimics derived from the ligand 2,9-dimethylphenanthroline (neocuproine) show at least 30-fold improvements in efficiency at sequence-specific RNA cleavage when compared with analogous o-phenanthroline- and terpyridine-derived reagents. The suppression of hydroxide-bridged dimers and the greater activation of coordinated water by Cu(II) neocuproine (compared with the o-phenanthroline and terpyridine complexes) better allow Cu(II) to reach its catalytic potential as a biomimetic RNA cleavage agent. This work demonstrates the direct mapping of molecular design principles from small-molecule cleavage to macromolecular cleavage events, generating enhanced biomimetic, sequence-specific RNA cleavage agents.

  18. Impact of the electron-transport layer on the performance of solution-processed small-molecule organic solar cells.

    PubMed

    Long, Guankui; Wan, Xiangjian; Kan, Bin; Hu, Zhicheng; Yang, Xuan; Zhang, Yi; Zhang, Mingtao; Wu, Hongbing; Huang, Fei; Su, Shijian; Cao, Yong; Chen, Yongsheng

    2014-08-01

    Although the performance of polymer solar cells has been improved significantly recently through careful optimization with different interlayers for the same materials, more improvement is needed in this respect for small-molecule-based solar cells, particularly for the electron-transport layers (ETLs). In this work, three different solution-processed ETLs, PFN, ZnO nanoparticles, and LiF, were investigated and compared in the performance of small-molecule-based devices, and power conversion efficiencies (PCEs) of 8.32, 7.30, and 7.38% were achieved, respectively. The mechanism for the ETL-induced enhancement has been studied, and different ETLs have a significantly different impact on the device performance. The clearly improved performance of PFN is attributed to the combination of reduced bimolecular recombination and increased effective photon absorption in the active layer.

  19. Impact of the electron-transport layer on the performance of solution-processed small-molecule organic solar cells.

    PubMed

    Long, Guankui; Wan, Xiangjian; Kan, Bin; Hu, Zhicheng; Yang, Xuan; Zhang, Yi; Zhang, Mingtao; Wu, Hongbing; Huang, Fei; Su, Shijian; Cao, Yong; Chen, Yongsheng

    2014-08-01

    Although the performance of polymer solar cells has been improved significantly recently through careful optimization with different interlayers for the same materials, more improvement is needed in this respect for small-molecule-based solar cells, particularly for the electron-transport layers (ETLs). In this work, three different solution-processed ETLs, PFN, ZnO nanoparticles, and LiF, were investigated and compared in the performance of small-molecule-based devices, and power conversion efficiencies (PCEs) of 8.32, 7.30, and 7.38% were achieved, respectively. The mechanism for the ETL-induced enhancement has been studied, and different ETLs have a significantly different impact on the device performance. The clearly improved performance of PFN is attributed to the combination of reduced bimolecular recombination and increased effective photon absorption in the active layer. PMID:24984949

  20. Adsorption of small molecules on helical gold nanorods: a relativistic density functional study.

    PubMed

    Liu, Xiao-Jing; Hamilton, Ian

    2014-10-15

    We study the adsorption of a variety of small molecules on helical gold nanorods using relativistic density functional theory. We focus on Au40 which consists of a central linear strand of five gold atoms with seven helical strands of five gold atoms on a coaxial tube. All molecules preferentially adsorb at a single low-coordinated gold atom on the coaxial tube at an end of Au40. In most cases, there is significant charge transfer (CT) between Au40 and the adsorbate, for CO and NO2, there is CT from the Au40 to adsorbate while for all other molecules there is CT from the adsorbate to Au40. Thus, Au40-adsorbate can be described as a donor-accepter complex and we use charge decomposition analysis to better understand the adsorption process. We determine the adsorption energy order to be C5H5N >NO2  > CO > NH3  > CH2=CH2  > CH2=CH-CHO > NO > HC≡CH > H2S > SO2  > HCN > CH3OH > H2C=O > O2  > H2O > CH4  > N2. We find that the Au-C, Au-N, Au-S, and Au-O bonds are surprisingly strong, with clear implications for reactivity enhancement of the adsorbate. The Au-H bond is relatively weak but, for interactions via an H atom that is bonded to a carbon atom (e.g., CH4), we find that there is large charge polarization of the Au-H-C moiety and partial activation of the inert C-H bond. Although the Au-S and Au-O bonds are generally weaker than the Au-C and Au-N bonds, we find that adsorption of H2S or H2O causes greater distortion of Au40 in the binding region. However, the degree of distortion is small and the helical structure is retained, demonstrating the stability of the helical Au40 nanorod under perturbations.

  1. Efficient Isothermal Titration Calorimetry Technique Identifies Direct Interaction of Small Molecule Inhibitors with the Target Protein.

    PubMed

    Gal, Maayan; Bloch, Itai; Shechter, Nelia; Romanenko, Olga; Shir, Ofer M

    2016-01-01

    Protein-protein interactions (PPI) play a critical role in regulating many cellular processes. Finding novel PPI inhibitors that interfere with specific binding of two proteins is considered a great challenge, mainly due to the complexity involved in characterizing multi-molecular systems and limited understanding of the physical principles governing PPIs. Here we show that the combination of virtual screening techniques, which are capable of filtering a large library of potential small molecule inhibitors, and a unique secondary screening by isothermal titration calorimetry, a label-free method capable of observing direct interactions, is an efficient tool for finding such an inhibitor. In this study we applied this strategy in a search for a small molecule capable of interfering with the interaction of the tumor-suppressor p53 and the E3-ligase MDM2. We virtually screened a library of 15 million small molecules that were filtered to a final set of 80 virtual hits. Our in vitro experimental assay, designed to validate the activity of mixtures of compounds by isothermal titration calorimetry, was used to identify an active molecule against MDM2. At the end of the process the small molecule (4S,7R)-4-(4-chlorophenyl)-5-hydroxy-2,7-dimethyl-N-(6-methylpyridin-2-yl)-4,6,7,8 tetrahydrIoquinoline-3-carboxamide was found to bind MDM2 with a dissociation constant of ~2 µM. Following the identification of this single bioactive compound, spectroscopic measurements were used to further characterize the interaction of the small molecule with the target protein. 2D NMR spectroscopy was used to map the binding region of the small molecule, and fluorescence polarization measurement confirmed that it indeed competes with p53.

  2. Identification of a small molecule that turns ON the pluripotency gene circuitry in human fibroblasts.

    PubMed

    Pandian, Ganesh N; Sato, Shinsuke; Anandhakumar, Chandran; Taniguchi, Junichi; Takashima, Kazuhiro; Syed, Junetha; Han, Le; Saha, Abhijit; Bando, Toshikazu; Nagase, Hiroki; Sugiyama, Hiroshi

    2014-12-19

    A nontransgenic approach to reprogram mouse somatic cells into induced pluripotent stem cells using only small molecules got achieved to propose a potential clinical-friendly cellular reprogramming strategy. Consequently, the screening and identification of small molecules capable of inducing pluripotency genes in human cells are increasingly a focus of research. Because cellular reprogramming is multifactorial in nature, there is a need for versatile small molecules capable of modulating the complicated gene networks associated with pluripotency. We have developed a targeting small molecule called SAHA-PIP comprising the histone deacetylase inhibitor SAHA and the sequence-specific DNA binding pyrrole-imidazole polyamides for modulating distinct gene networks. Here, we report the identification of a SAHA-PIP termed Ì that could trigger genome-wide epigenetic reprogramming and turn ON the typically conserved core pluripotency gene network. Through independent lines of evidence, we report for the first time a synthetic small molecule inducer that target and activate the OCT-3/4 regulated pluripotency genes in human dermal fibroblasts.

  3. Harnessing Connectivity in a Large-Scale Small-Molecule Sensitivity Dataset

    PubMed Central

    Seashore-Ludlow, Brinton; Rees, Matthew G.; Cheah, Jaime H.; Cokol, Murat; Price, Edmund V.; Coletti, Matthew E.; Jones, Victor; Bodycombe, Nicole E.; Soule, Christian K.; Gould, Joshua; Alexander, Benjamin; Li, Ava; Montgomery, Philip; Wawer, Mathias J.; Kuru, Nurdan; Kotz, Joanne D.; Hon, C. Suk-Yee; Munoz, Benito; Liefeld, Ted; Dančík, Vlado; Bittker, Joshua A.; Palmer, Michelle; Bradner, James E.; Shamji, Alykhan F.; Clemons, Paul A.; Schreiber, Stuart L.

    2015-01-01

    Identifying genetic alterations that prime a cancer cell to respond to a particular therapeutic agent can facilitate the development of precision cancer medicines. Cancer cell-line (CCL) profiling of small-molecule sensitivity has emerged as an unbiased method to assess the relationships between genetic or cellular features of CCLs and small-molecule response. Here, we developed annotated cluster multidimensional enrichment analysis to explore the associations between groups of small molecules and groups of CCLs in a new, quantitative sensitivity dataset. This analysis reveals insights into small-molecule mechanisms of action, and genomic features that associate with CCL response to small-molecule treatment. We are able to recapitulate known relationships between FDA-approved therapies and cancer dependencies and to uncover new relationships, including for KRAS-mutant cancers and neuroblastoma. To enable the cancer community to explore these data, and to generate novel hypotheses, we created an updated version of the Cancer Therapeutic Response Portal (CTRP v2). PMID:26482930

  4. Predicting metabolic pathways of small molecules and enzymes based on interaction information of chemicals and proteins.

    PubMed

    Gao, Yu-Fei; Chen, Lei; Cai, Yu-Dong; Feng, Kai-Yan; Huang, Tao; Jiang, Yang

    2012-01-01

    Metabolic pathway analysis, one of the most important fields in biochemistry, is pivotal to understanding the maintenance and modulation of the functions of an organism. Good comprehension of metabolic pathways is critical to understanding the mechanisms of some fundamental biological processes. Given a small molecule or an enzyme, how may one identify the metabolic pathways in which it may participate? Answering such a question is a first important step in understanding a metabolic pathway system. By utilizing the information provided by chemical-chemical interactions, chemical-protein interactions, and protein-protein interactions, a novel method was proposed by which to allocate small molecules and enzymes to 11 major classes of metabolic pathways. A benchmark dataset consisting of 3,348 small molecules and 654 enzymes of yeast was constructed to test the method. It was observed that the first order prediction accuracy evaluated by the jackknife test was 79.56% in identifying the small molecules and enzymes in a benchmark dataset. Our method may become a useful vehicle in predicting the metabolic pathways of small molecules and enzymes, providing a basis for some further analysis of the pathway systems.

  5. Identification and biological activities of a new antiangiogenic small molecule that suppresses mitochondrial reactive oxygen species

    SciTech Connect

    Kim, Ki Hyun; Park, Ju Yeol; Jung, Hye Jin; Kwon, Ho Jeong

    2011-01-07

    Research highlights: {yields} YCG063 was screened as a new angiogenesis inhibitor which suppresses mitochondrial ROS generation in a phenotypic cell-based screening of a small molecule-focused library. {yields} The compound inhibited in vitro and in vivo angiogenesis in a dose-dependent manner. {yields} This new small molecule tool will provide a basis for a better understanding of angiogenesis driven under hypoxic conditions. -- Abstract: Mitochondrial reactive oxygen species (ROS) are associated with multiple cellular functions such as cell proliferation, differentiation, and apoptosis. In particular, high levels of mitochondrial ROS in hypoxic cells regulate many angiogenesis-related diseases, including cancer and ischemic disorders. Here we report a new angiogenesis inhibitor, YCG063, which suppressed mitochondrial ROS generation in a phenotypic cell-based screening of a small molecule-focused library with an ArrayScan HCS reader. YCG063 suppressed mitochondrial ROS generation under a hypoxic condition in a dose-dependent manner, leading to the inhibition of in vitro angiogenic tube formation and chemoinvasion as well as in vivo angiogenesis of the chorioallantoic membrane (CAM) at non-toxic doses. In addition, YCG063 decreased the expression levels of HIF-1{alpha} and its target gene, VEGF. Collectively, a new antiangiogenic small molecule that suppresses mitochondrial ROS was identified. This new small molecule tool will provide a basis for a better understanding of angiogenesis driven under hypoxic conditions.

  6. Exploiting a global regulator for small molecule discovery in Photorhabdus luminescens.

    PubMed

    Kontnik, Renee; Crawford, Jason M; Clardy, Jon

    2010-07-16

    Bacterially produced small molecules demonstrate a remarkable range of structural and functional diversity and include some of our most useful biological probes and therapeutic agents. Annotations of bacterial genomes reveal a large gap between the number of known small molecules and the number of biosynthetic genes/loci that could produce such small molecules, a gap that most likely originates from tight regulatory control by the producing organism. This study coupled a global transcriptional regulator, HexA, to secondary metabolite production in Photorhabdus luminescens, a member of the Gammaproteobacteria that participates in a complex symbiosis with nematode worms and insect larvae. HexA is a LysR-type transcriptional repressor, and knocking it out to create a P. luminescens DeltahexA mutant led to dramatic upregulation of biosynthesized small molecules. Use of this mutant expanded a family of stilbene-derived small molecules, which were known to play important roles in the symbiosis, from three members to at least nine members. PMID:20524642

  7. Small molecules targeting microRNA for cancer therapy: Promises and obstacles.

    PubMed

    Wen, Di; Danquah, Michael; Chaudhary, Amit Kumar; Mahato, Ram I

    2015-12-10

    Aberrant expression of miRNAs is critically implicated in cancer initiation and progression. Therapeutic approaches focused on regulating miRNAs are therefore a promising approach for treating cancer. Antisense oligonucleotides, miRNA sponges, and CRISPR/Cas9 genome editing systems are being investigated as tools for regulating miRNAs. Despite the accruing insights in the use of these tools, delivery concerns have mitigated clinical application of such systems. In contrast, little attention has been given to the potential of small molecules to modulate miRNA expression for cancer therapy. In these years, many researches proved that small molecules targeting cancer-related miRNAs might have greater potential for cancer treatment. Small molecules targeting cancer related miRNAs showed significantly promising results in different cancer models. However, there are still several obstacles hindering the progress and clinical application in this area. This review discusses the development, mechanisms and application of small molecules for modulating oncogenic miRNAs (oncomiRs). Attention has also been given to screening technologies and perspectives aimed to facilitate clinical translation for small molecule-based miRNA therapeutics.

  8. Stem cells and small molecule screening: haploid embryonic stem cells as a new tool.

    PubMed

    Wu, Bi; Li, Wei; Wang, Liu; Liu, Zhong-hua; Zhao, Xiao-yang

    2013-06-01

    Stem cells can both self-renew and differentiate into various cell types under certain conditions, which makes them a good model for development and disease studies. Recently, chemical approaches have been widely applied in stem cell biology by promoting stem cell self-renewal, proliferation, differentiation and somatic cell reprogramming using specific small molecules. Conversely, stem cells and their derivatives also provide an efficient and robust platform for small molecule and drug screening. Here, we review the current research and applications of small molecules that modulate stem cell self-renewal and differentiation and improve reprogramming, as well as the applications that use stem cells as a tool for small molecule screening. Moreover, we introduce the recent advance in haploid embryonic stem cells research. Haploid embryonic stem cells maintain haploidy and stable growth over extensive passages, possess the ability to differentiate into all three germ layers in vitro and in vivo, and contribute to the germlines of chimeras when injected into blastocysts. Androgenetic haploid stem cells can also be used in place of sperm to produce fertile progeny after intracytoplasmic injection into mature oocytes. Such characteristics demonstrate that haploid stem cells are a new approach for genetic studies at both the cellular and animal levels and that they are a valuable platform for future small molecule screening.

  9. [Ultrastructural and functional assessment on platelets loaded with small molecule carbohydrates].

    PubMed

    Yang, Chao; Wang, Jie-Xi; Han, Ying; Wang, Yan; Quan, Guo-Bo; Liu, Min-Xia; Gao, Feng; Liu, An

    2008-06-01

    The aim of this study was to investigate the effect of loading some small molecule carbohydrates into human platelets on ultrastucture and function. The ultrastructure of platelets were observed by transmission electron microscope (TEM); the platelet counts and mean platelet volume (MPV) were measured by hemocytometer, the maximal platelet aggregation rate was measured optically in an aggregometer; the surface marker of platelet membranes CD62p and phosphatidyl serine were analyzed by flow cytometry. The results showed that no significant changes of the ultrastructure of platelets loaded with small molecule carbohydrates were seen. The aggregation responsiveness of platelets loaded with small molecule carbohydrates reached to 60% of the fresh control platelets. The values of platelet counts and MPV showed no significant differences. The expression level of CD62p and the binding rate with Annexin V before and after loading small molecule carbohydrates into platelets were no different. It is concluded that the platelets after loading with small molecule carbohydrates remained fine ultrastructure and function.

  10. Identification of a small molecule that turns ON the pluripotency gene circuitry in human fibroblasts.

    PubMed

    Pandian, Ganesh N; Sato, Shinsuke; Anandhakumar, Chandran; Taniguchi, Junichi; Takashima, Kazuhiro; Syed, Junetha; Han, Le; Saha, Abhijit; Bando, Toshikazu; Nagase, Hiroki; Sugiyama, Hiroshi

    2014-12-19

    A nontransgenic approach to reprogram mouse somatic cells into induced pluripotent stem cells using only small molecules got achieved to propose a potential clinical-friendly cellular reprogramming strategy. Consequently, the screening and identification of small molecules capable of inducing pluripotency genes in human cells are increasingly a focus of research. Because cellular reprogramming is multifactorial in nature, there is a need for versatile small molecules capable of modulating the complicated gene networks associated with pluripotency. We have developed a targeting small molecule called SAHA-PIP comprising the histone deacetylase inhibitor SAHA and the sequence-specific DNA binding pyrrole-imidazole polyamides for modulating distinct gene networks. Here, we report the identification of a SAHA-PIP termed Ì that could trigger genome-wide epigenetic reprogramming and turn ON the typically conserved core pluripotency gene network. Through independent lines of evidence, we report for the first time a synthetic small molecule inducer that target and activate the OCT-3/4 regulated pluripotency genes in human dermal fibroblasts. PMID:25366962

  11. Peering into Cells One Molecule at a Time: Single-molecule and plasmon-enhanced fluorescence super-resolution imaging

    NASA Astrophysics Data System (ADS)

    Biteen, Julie

    2013-03-01

    Single-molecule fluorescence brings the resolution of optical microscopy down to the nanometer scale, allowing us to unlock the mysteries of how biomolecules work together to achieve the complexity that is a cell. This high-resolution, non-destructive method for examining subcellular events has opened up an exciting new frontier: the study of macromolecular localization and dynamics in living cells. We have developed methods for single-molecule investigations of live bacterial cells, and have used these techniques to investigate thee important prokaryotic systems: membrane-bound transcription activation in Vibrio cholerae, carbohydrate catabolism in Bacteroides thetaiotaomicron, and DNA mismatch repair in Bacillus subtilis. Each system presents unique challenges, and we will discuss the important methods developed for each system. Furthermore, we use the plasmon modes of bio-compatible metal nanoparticles to enhance the emissivity of single-molecule fluorophores. The resolution of single-molecule imaging in cells is generally limited to 20-40 nm, far worse than the 1.5-nm localization accuracies which have been attained in vitro. We use plasmonics to improve the brightness and stability of single-molecule probes, and in particular fluorescent proteins, which are widely used for bio-imaging. We find that gold-coupled fluorophores demonstrate brighter, longer-lived emission, yielding an overall enhancement in total photons detected. Ultimately, this results in increased localization accuracy for single-molecule imaging. Furthermore, since fluorescence intensity is proportional to local electromagnetic field intensity, these changes in decay intensity and rate serve as a nm-scale read-out of the field intensity. Our work indicates that plasmonic substrates are uniquely advantageous for super-resolution imaging, and that plasmon-enhanced imaging is a promising technique for improving live cell single-molecule microscopy.

  12. Next Generation of Targeted Molecules for Non-Hodgkin Lymphomas: Small-Molecule Inhibitors of Intracellular Targets and Signaling Pathways.

    PubMed

    Choe, Hannah; Ruan, Jia

    2016-09-15

    Advances in our understanding of the molecular pathogenesis of B-cell lymphoma have guided the development of targeted therapies that disrupt aberrant signaling pathways important for communication within lymphoma cells and for their interactions with the tumor microenvironment. This has led to unprecedented therapeutic progress, with biologic agents that have begun to transform the care of patients with lymphoma and chronic lymphocytic leukemia. This review discusses the mechanisms of action, clinical development, and emerging applications of small-molecule inhibitors that target B-cell receptor signaling pathways, B-cell lymphoma-2 inhibitors, selective inhibitors of nuclear export, and epigenetic modifiers. PMID:27633417

  13. Small molecules preventing GAPDH aggregation are therapeutically applicable in cell and rat models of oxidative stress.

    PubMed

    Lazarev, Vladimir F; Nikotina, Alina D; Semenyuk, Pavel I; Evstafyeva, Diana B; Mikhaylova, Elena R; Muronetz, Vladimir I; Shevtsov, Maxim A; Tolkacheva, Anastasia V; Dobrodumov, Anatoly V; Shavarda, Alexey L; Guzhova, Irina V; Margulis, Boris A

    2016-03-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is one of the most abundant targets of the oxidative stress. Oxidation of the enzyme causes its inactivation and the formation of intermolecular disulfide bonds, and leads to the accumulation of GAPDH aggregates and ultimately to cell death. The aim of this work was to reveal the ability of chemicals to break the described above pathologic linkage by inhibiting GAPDH aggregation. Using the model of oxidative stress based on SK-N-SH human neuroblastoma cells treated with hydrogen peroxide, we found that lentivirus-mediated down- or up-regulation of GAPDH content caused inhibition or enhancement of the protein aggregation and respectively reduced or increased the level of cell death. To reveal substances that are able to inhibit GAPDH aggregation, we developed a special assay based on dot ultrafiltration using the collection of small molecules of plant origin. In the first round of screening, five compounds were found to possess anti-aggregation activity as established by ultrafiltration and dynamic light scattering; some of the substances efficiently inhibited GAPDH aggregation in nanomolar concentrations. The ability of the compounds to bind GAPDH molecules was proved by the drug affinity responsive target stability assay, molecular docking and differential scanning calorimetry. Results of experiments with SK-N-SH human neuroblastoma treated with hydrogen peroxide show that two substances, RX409 and RX426, lowered the degree of GAPDH aggregation and reduced cell death by 30%. Oxidative injury was emulated in vivo by injecting of malonic acid into the rat brain, and we showed that the treatment with RX409 or RX426 inhibited GAPDH-mediated aggregation in the brain, reduced areas of the injury as proved by magnetic resonance imaging, and augmented the behavioral status of the rats as established by the "beam walking" test. In conclusion, the data show that two GAPDH binders could be therapeutically relevant in the

  14. Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.

    PubMed

    Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten

    2006-07-01

    bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.

  15. Working with small molecules: rules-of-thumb of "drug likeness".

    PubMed

    Zhang, Ming-Qiang

    2012-01-01

    Based on analyses of existing small organic drug molecules, a set of "rules-of-thumb" have been devised to assess the likeness of a small molecule under study to those existing drugs in terms of physicochemical and topological properties. These rules can be used to estimate the likelihood of a small molecule to possess the desired efficacy, pharmacokinetic/pharmacodynamic properties, and toxicity profiles to eventually become a drug, and therefore, whether it justifies further experimental work and development. These rules are particularly useful when selecting a chemical starting point for a given project or choosing a chemical series to focus when multiple series are available. Caution should be paid, however, not to overly rely on these rules for decision-making, since these rules are restricted by knowledge of existing drugs. Novel chemotypes and/or targets may be exceptions. PMID:22065233

  16. Synthetic Small Molecule Inhibitors of Hh Signaling As Anti-Cancer Chemotherapeutics

    PubMed Central

    Maschinot, C.A.; Pace, J.R.; Hadden, M.K.

    2016-01-01

    The hedgehog (Hh) pathway is a developmental signaling pathway that is essential to the proper embryonic development of many vertebrate systems. Dysregulation of Hh signaling has been implicated as a causative factor in the development and progression of several forms of human cancer. As such, the development of small molecule inhibitors of Hh signaling as potential anti-cancer chemotherapeutics has been a major area of research interest in both academics and industry over the past ten years. Through these efforts, synthetic small molecules that target multiple components of the Hh pathway have been identified and advanced to preclinical or clinical development. The goal of this review is to provide an update on the current status of several synthetic small molecule Hh pathway inhibitors and explore the potential of several recently disclosed inhibitory scaffolds. PMID:26310919

  17. Structure of a Small-Molecule Inhibitor of a DNA Polymerase Sliding Clamp

    SciTech Connect

    Georgescu, R.; Yurieva, O; Kim, S; Kuriyan, J; Kong, X; O'Donnell, M

    2008-01-01

    DNA polymerases attach to the DNA sliding clamp through a common overlapping binding site. We identify a small-molecule compound that binds the protein-binding site in the Escherichia coli ?-clamp and differentially affects the activity of DNA polymerases II, III, and IV. To understand the molecular basis of this discrimination, the cocrystal structure of the chemical inhibitor is solved in complex with ? and is compared with the structures of Pol II, Pol III, and Pol IV peptides bound to ?. The analysis reveals that the small molecule localizes in a region of the clamp to which the DNA polymerases attach in different ways. The results suggest that the small molecule may be useful in the future to probe polymerase function with ?, and that the ?-clamp may represent an antibiotic target.

  18. Delivery of small molecules for bone regenerative engineering: preclinical studies and potential clinical applications

    PubMed Central

    Laurencin, Cato T.; Ashe, Keshia M.; Henry, Nicole; Kan, Ho Man; Lo, Kevin W-H.

    2014-01-01

    Stimulation of bone regeneration using growth factors is a promising approach for musculoskeletal regenerative engineering. Common limitations with protein growth factors are high manufacturing costs, protein instability, contamination issues, and unwanted immunogenic responses of the host. New strategies for bone regeneration that obviate these problems can have a significant impact on the treatment of skeletal injury and diseases. Over the past decade, a large number of small molecules with the potential of regenerating skeletal tissue have been reported in the literature. Here, we review this literature, paying specific attention to the prospects for small molecule-based bone-regenerative engineering. We also review the preclinical study of small molecules associated with bone regeneration. PMID:24508820

  19. Schematic Studies on the Structural Properties and Device Physics of All Small Molecule Ternary Photovoltaic Cells.

    PubMed

    Kim, Yu Jin; Hong, Jisu; Park, Chan Eon

    2015-09-30

    Although the field of ternary organic solar cells has seen much progress in terms of device performance in the past few years, limited understanding has restricted further development. For example, studies of the crystalline packing structure of ternary blends have rarely been reported in the solar cell field. Consequently, we chose two ternary blends of small molecules, two fullerene derivatives (small-molecule:PC71BM:PC61BM or small-molecule:PC71BM:ICBA), to investigate crystallization behavior and interactions among the three components. The crystalline structure of the ternary active blends was characterized using various techniques such as 2D-GIWAXS and AFM, and the relationship of the observed morphologies to device performance is discussed. Furthermore, the device physics associated with the charge generation, transport, and recombination dynamics of these ternary blend systems were investigated.

  20. Working with small molecules: rules-of-thumb of "drug likeness".

    PubMed

    Zhang, Ming-Qiang

    2012-01-01

    Based on analyses of existing small organic drug molecules, a set of "rules-of-thumb" have been devised to assess the likeness of a small molecule under study to those existing drugs in terms of physicochemical and topological properties. These rules can be used to estimate the likelihood of a small molecule to possess the desired efficacy, pharmacokinetic/pharmacodynamic properties, and toxicity profiles to eventually become a drug, and therefore, whether it justifies further experimental work and development. These rules are particularly useful when selecting a chemical starting point for a given project or choosing a chemical series to focus when multiple series are available. Caution should be paid, however, not to overly rely on these rules for decision-making, since these rules are restricted by knowledge of existing drugs. Novel chemotypes and/or targets may be exceptions.

  1. Mapping the Cellular Response to Small Molecules Using Chemogenomic Fitness Signatures

    PubMed Central

    Lee, Anna Y.; St.Onge, Robert P.; Proctor, Michael J.; Wallace, Iain M.; Nile, Aaron H.; Spagnuolo, Paul A.; Jitkova, Yulia; Gronda, Marcela; Wu, Yan; Kim, Moshe K.; Cheung-Ong, Kahlin; Torres, Nikko P.; Spear, Eric D.; Han, Mitchell K. L.; Schlecht, Ulrich; Suresh, Sundari; Duby, Geoffrey; Heisler, Lawrence E.; Surendra, Anuradha; Fung, Eula; Urbanus, Malene L.; Gebbia, Marinella; Lissina, Elena; Miranda, Molly; Chiang, Jennifer H.; Aparicio, Ana Maria; Zeghouf, Mahel; Davis, Ronald W.; Cherfils, Jacqueline; Boutry, Marc; Kaiser, Chris A.; Cummins, Carolyn L.; Trimble, William S.; Brown, Grant W.; Schimmer, Aaron D.; Bankaitis, Vytas A.; Nislow, Corey; Bader, Gary D.; Giaever, Guri

    2014-01-01

    Genome-wide characterization of the in vivo cellular response to perturbation is fundamental to understanding how cells survive stress. Identifying the proteins and pathways perturbed by small molecules affects biology and medicine by revealing the mechanisms of drug action. We used a yeast chemogenomics platform that quantifies the requirement for each gene for resistance to a compound in vivo to profile 3250 small molecules in a systematic and unbiased manner. We identified 317 compounds that specifically perturb the function of 121 genes and characterized the mechanism of specific compounds. Global analysis revealed that the cellular response to small molecules is limited and described by a network of 45 major chemogenomic signatures. Our results provide a resource for the discovery of functional interactions among genes, chemicals, and biological processes. PMID:24723613

  2. Analysis of small-molecule interactions using Biacore S51 technology.

    PubMed

    Myszka, David G

    2004-06-15

    Biacore S51 is a new surface plasmon resonance-based biosensor developed by Biacore AB (Uppsala, Sweden). The instrument was engineered specifically to support small-molecule drug discovery and development. The platform includes increased sensitivity, larger sample handling capabilities, and automated data processing to improve throughput. Compared to previously released Biacore instruments, the most significant design change relates to the introduction of the hydrodynamic-addressing flow cell. This design allows two reaction surfaces and a reference surface to be placed within the same flow cell, thereby improving data quality and extending the kinetic range of the instrument. Using a set of small-molecule inhibitors of the enzyme carbonic anhydrase II, we tested the reproducibility, sensitivity, and dynamic range of the biosensor. Given the S51's performance capabilities, it should play an active role in secondary screening by providing high-resolution information for small-molecule/target interactions.

  3. A Unified Sensor Architecture for Isothermal Detection of Double-Stranded DNA, Oligonucleotides, and Small Molecules

    PubMed Central

    Brown, Carl W.; Lakin, Matthew R.; Fabry-Wood, Aurora; Horwitz, Eli K.; Baker, Nicholas A.; Stefanovic, Darko; Graves, Steven W.

    2015-01-01

    Pathogen detection is an important problem in many areas of medicine and agriculture, which may involve genomic or transcriptomic signatures, or small molecule metabolites. We report a unified, DNA-based sensor architecture capable of isothermal detection of double-stranded DNA targets, single-stranded oligonucleotides, and small molecules. Each sensor contains independent target detection and reporter modules, enabling rapid design. We detected gene variants on plasmids via a straightforward isothermal denaturation protocol. The sensors were highly specific, even with a randomized DNA background. We achieved a limit of detection of ~15 pM for single-stranded targets and ~5 nM for targets on denatured plasmids. By incorporating a blocked aptamer sequence, we also detected small molecules using the same sensor architecture. This work provides a starting point for multiplexed detection of multi-strain pathogens, and disease states caused by genetic variants (e.g., sickle cell anemia). PMID:25663617

  4. Stochastic electrotransport selectively enhances the transport of highly electromobile molecules

    PubMed Central

    Kim, Sung-Yon; Cho, Jae Hun; Murray, Evan; Bakh, Naveed; Choi, Heejin; Ohn, Kimberly; Ruelas, Luzdary; Hubbert, Austin; McCue, Meg; Vassallo, Sara L.; Keller, Philipp J.; Chung, Kwanghun

    2015-01-01

    Nondestructive chemical processing of porous samples such as fixed biological tissues typically relies on molecular diffusion. Diffusion into a porous structure is a slow process that significantly delays completion of chemical processing. Here, we present a novel electrokinetic method termed stochastic electrotransport for rapid nondestructive processing of porous samples. This method uses a rotational electric field to selectively disperse highly electromobile molecules throughout a porous sample without displacing the low-electromobility molecules that constitute the sample. Using computational models, we show that stochastic electrotransport can rapidly disperse electromobile molecules in a porous medium. We apply this method to completely clear mouse organs within 1–3 days and to stain them with nuclear dyes, proteins, and antibodies within 1 day. Our results demonstrate the potential of stochastic electrotransport to process large and dense tissue samples that were previously infeasible in time when relying on diffusion. PMID:26578787

  5. Utilizing Yeast Surface Human Proteome Display Libraries to Identify Small Molecule-Protein Interactions.

    PubMed

    Bidlingmaier, Scott; Liu, Bin

    2015-01-01

    The identification of proteins that interact with small bioactive molecules is a critical but often difficult and time-consuming step in understanding cellular signaling pathways or molecular mechanisms of drug action. Numerous methods for identifying small molecule-interacting proteins have been developed and utilized, including affinity-based purification followed by mass spectrometry analysis, protein microarrays, phage display, and three-hybrid approaches. Although all these methods have been used successfully, there remains a need for additional techniques for analyzing small molecule-protein interactions. A promising method for identifying small molecule-protein interactions is affinity-based selection of yeast surface-displayed human proteome libraries. Large and diverse libraries displaying human protein fragments on the surface of yeast cells have been constructed and subjected to FACS-based enrichment followed by comprehensive exon microarray-based output analysis to identify protein fragments with affinity for small molecule ligands. In a recent example, a proteome-wide search has been successfully carried out to identify cellular proteins binding to the signaling lipids PtdIns(4,5)P2 and PtdIns(3,4,5)P3. Known phosphatidylinositide-binding proteins such as pleckstrin homology domains were identified, as well as many novel interactions. Intriguingly, many novel nuclear phosphatidylinositide-binding proteins were discovered. Although the existence of an independent pool of nuclear phosphatidylinositides has been known about for some time, their functions and mechanism of action remain obscure. Thus, the identification and subsequent study of nuclear phosphatidylinositide-binding proteins is expected to bring new insights to this important biological question. Based on the success with phosphatidylinositides, it is expected that the screening of yeast surface-displayed human proteome libraries will be of general use for the discovery of novel small

  6. Concentration-related response potentiometric titrations to study the interaction of small molecules with large biomolecules.

    PubMed

    Hamidi-Asl, Ezat; Daems, Devin; De Wael, Karolien; Van Camp, Guy; Nagels, Luc J

    2014-12-16

    In the present paper, the utility of a special potentiometric titration approach for recognition and calculation of biomolecule/small-molecule interactions is reported. This approach is fast, sensitive, reproducible, and inexpensive in comparison to the other methods for the determination of the association constant values (Ka) and the interaction energies (ΔG). The potentiometric titration measurement is based on the use of a classical polymeric membrane indicator electrode in a solution of the small-molecule ligand. The biomolecule is used as a titrant. The potential is measured versus a reference electrode and transformed into a concentration-related signal over the entire concentration interval, also at low concentrations, where the millivolt (y-axis) versus log canalyte (x-axis) potentiometric calibration curve is not linear. In the procedure, Ka is calculated for the interaction of cocaine with a cocaine binding aptamer and with an anticocaine antibody. To study the selectivity and cross-reactivity, other oligonucleotides and aptamers are tested, as well as other small ligand molecules such as tetrakis(4-chlorophenyl)borate, metergoline, lidocaine, and bromhexine. The calculated Ka compared favorably to the value reported in the literature using surface plasmon resonance. The potentiometric titration approach called "concentration-related response potentiometry" is used to study molecular interaction for seven macromolecular target molecules and four small-molecule ligands.

  7. Discovery of Small Molecules that Inhibit the Disordered Protein, p27Kip1

    SciTech Connect

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; Ramanathan, Arvind; Zhang, Weixing; Shelat, Anang A.; Zuo, Jian; Kriwacki, Richard W.

    2015-10-28

    In disordered proteins we see that they are highly prevalent in biological systems. They control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27Kip1 (p27). Moreover, two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groups of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule: disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of- principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A).

  8. Discovery of Small Molecules that Inhibit the Disordered Protein, p27Kip1

    DOE PAGES

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; Ramanathan, Arvind; Zhang, Weixing; Shelat, Anang A.; Zuo, Jian; Kriwacki, Richard W.

    2015-10-28

    In disordered proteins we see that they are highly prevalent in biological systems. They control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27Kip1 (p27). Moreover, two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groups ofmore » small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule: disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of- principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A).« less

  9. Veterans Small Business Enhancement Act of 2014

    THOMAS, 113th Congress

    Sen. Durbin, Richard [D-IL

    2014-09-11

    09/11/2014 Read twice and referred to the Committee on Small Business and Entrepreneurship. (text of measure as introduced: CR S5565) (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

  10. Small-Molecule High-Throughput Screening Utilizing Xenopus Egg Extract

    PubMed Central

    Broadus, Matthew R.; Yew, P. Renee; Hann, Stephen R.; Lee, Ethan

    2015-01-01

    Screens for small-molecule modulators of biological pathways typically utilize cultured cell lines, purified proteins, or, recently, model organisms (e.g., zebrafish, Drosophila, C. elegans). Herein, we describe a method for using Xenopus laevis egg extract, a biologically active and highly tractable cell-free system that recapitulates a legion of complex chemical reactions found in intact cells. Specifically, we focus on the use of a luciferase-based fusion system to identify small-molecule modulators that affect protein turnover. PMID:25618336

  11. Small-molecule library screening by docking with PyRx.

    PubMed

    Dallakyan, Sargis; Olson, Arthur J

    2015-01-01

    Virtual molecular screening is used to dock small-molecule libraries to a macromolecule in order to find lead compounds with desired biological function. This in silico method is well known for its application in computer-aided drug design. This chapter describes how to perform small-molecule virtual screening by docking with PyRx, which is open-source software with an intuitive user interface that runs on all major operating systems (Linux, Windows, and Mac OS). Specific steps for using PyRx, as well as considerations for data preparation, docking, and data analysis, are also described. PMID:25618350

  12. High-resolution electrohydrodynamic jet printing of small-molecule organic light-emitting diodes.

    PubMed

    Kim, Kukjoo; Kim, Gyeomuk; Lee, Bo Ram; Ji, Sangyoon; Kim, So-Yun; An, Byeong Wan; Song, Myoung Hoon; Park, Jang-Ung

    2015-08-28

    The development of alternative organic light-emitting diode (OLED) fabrication technologies for high-definition and low-cost displays is an important research topic as conventional fine metal mask-assisted vacuum evaporation has reached its limit to reduce pixel sizes and manufacturing costs. Here, we report an electrohydrodynamic jet (e-jet) printing method to fabricate small-molecule OLED pixels with high resolution (pixel width of 5 μm), which significantly exceeds the resolutions of conventional inkjet or commercial OLED display pixels. In addition, we print small-molecule emitting materials which provide a significant advantage in terms of device efficiency and lifetime compared to those with polymers.

  13. Following the nanostructural molecular orientation guidelines for sulfur versus thiophene units in small molecule photovoltaic cells

    NASA Astrophysics Data System (ADS)

    Kim, Yu Jin; Park, Chan Eon

    2016-03-01

    In bulk heterojunction (BHJ) organic photovoltaics, particularly those using small molecules, electron donor and/or electron acceptor materials form a distributed network in the photoactive layer where critical photo-physical processes occur. Extensive research has recently focused on the importance of sulfur atoms in the small molecules. Little is known about the three-dimensional orientation of these sulfur atom-containing molecules. Herein, we report on our research concerning the heterojunction textures of the crystalline molecular orientation of small compounds having sulfur-containing units in the side chains, specifically, compounds known as DR3TSBDT that contain the alkylthio group and DR3TBDTT that does not. The improved performance of the DR3TBDTT-based devices, particularly in the photocurrent and the fill factor, was attributed to the large population of donor compound crystallites with a favorable face-on orientation along the perpendicular direction. This orientation resulted in efficient charge transport and a reduction in charge recombination. These findings underscore the great potential of small-molecule solar cells and suggest that even higher efficiencies can be achieved through materials development and molecular orientation control.In bulk heterojunction (BHJ) organic photovoltaics, particularly those using small molecules, electron donor and/or electron acceptor materials form a distributed network in the photoactive layer where critical photo-physical processes occur. Extensive research has recently focused on the importance of sulfur atoms in the small molecules. Little is known about the three-dimensional orientation of these sulfur atom-containing molecules. Herein, we report on our research concerning the heterojunction textures of the crystalline molecular orientation of small compounds having sulfur-containing units in the side chains, specifically, compounds known as DR3TSBDT that contain the alkylthio group and DR3TBDTT that does not

  14. Small molecules that promote regenerative repair for pancreatic and cardiovascular health.

    PubMed

    Menhaji-Klotz, Elnaz; Price, David A

    2015-12-01

    Regenerative medicine for repair of organ injury is an emerging area of research. The use of embryonic stem cells and induced pluripotent cells in combination with endogenously expressed growth factors has provided methods to generate differentiated cells for cell-based therapy and for screening purposes. As cell-based therapies continue to be investigated in the clinical setting, small molecules for in situ tissue repair are being reported. In this review, we focus on the reports applicable to the field of cardiovascular and metabolic disease by discussing small molecules that target β-cells, cardiomyocytes and endothelial cells.

  15. Small-molecule control of cytokine function: new opportunities for treating immune disorders

    PubMed Central

    Sundberg, Thomas B.; Xavier, Ramnik J.; Schreiber, Stuart L.; Shamji, Alykhan F.

    2016-01-01

    Manipulating cytokine function with protein-based drugs has proven effective for treating a wide variety of autoimmune and auto-inflammatory disorders. However, the limited ability of protein-based drugs to modulate intracellular targets, including many implicated by studies of the genetics and physiology of these diseases, and to coordinately neutralize redundant inflammatory cytokines, suggest an important and complementary role for small molecules in immunomodulatory drug development. The recent clinical approval of Janus kinase and phosphodiesterase inhibitors, along with emerging evidence from other compound classes, firmly establish small molecules as effective tools for modulating therapeutically relevant proteins that give rise to aberrant cytokine signaling or mediate its downstream consequences. PMID:25222143

  16. Small Molecule Inhibitors in Acute Myeloid Leukemia: From the Bench to the Clinic

    PubMed Central

    Al-Hussaini, Muneera; DiPersio, John F.

    2014-01-01

    Many patients with acute myeloid leukemia (AML) will eventually develop refractory or relapsed disease. In the absence of standard therapy for this population, there is currently an urgent unmet need for novel therapeutic agents. Targeted therapy with small molecule inhibitors (SMIs) represents a new therapeutic intervention that has been successful for the treatment of multiple tumors (e.g., gastrointestinal stromal tumors, chronic myelogenous leukemia). Hence, there has been great interest in generating selective small molecule inhibitors targeting critical pathways of proliferation and survival in AML. This review highlights a selective group of intriguing therapeutic agents and their presumed targets in both preclinical models and in early human clinical trials. PMID:25025370

  17. The Connectivity Map: using gene-expression signatures to connect small molecules, genes, and disease.

    PubMed

    Lamb, Justin; Crawford, Emily D; Peck, David; Modell, Joshua W; Blat, Irene C; Wrobel, Matthew J; Lerner, Jim; Brunet, Jean-Philippe; Subramanian, Aravind; Ross, Kenneth N; Reich, Michael; Hieronymus, Haley; Wei, Guo; Armstrong, Scott A; Haggarty, Stephen J; Clemons, Paul A; Wei, Ru; Carr, Steven A; Lander, Eric S; Golub, Todd R

    2006-09-29

    To pursue a systematic approach to the discovery of functional connections among diseases, genetic perturbation, and drug action, we have created the first installment of a reference collection of gene-expression profiles from cultured human cells treated with bioactive small molecules, together with pattern-matching software to mine these data. We demonstrate that this "Connectivity Map" resource can be used to find connections among small molecules sharing a mechanism of action, chemicals and physiological processes, and diseases and drugs. These results indicate the feasibility of the approach and suggest the value of a large-scale community Connectivity Map project. PMID:17008526

  18. A complex task? Direct modulation of transcription factors with small molecules

    PubMed Central

    Koehler, Angela N.

    2010-01-01

    Transcription factors with aberrant activity in disease are promising yet untested targets for therapeutic development, particularly in oncology. Directly inhibiting or activating the function of a transcription factor requires specific disruption or recruitment of protein-protein or protein-DNA interactions. The discovery or design of small molecules that specifically modulate these interactions has thus far proven to be a significant challenge and the protein class is often perceived to be ‘undruggable.’ This review will summarize recent progress in the development of small-molecule probes of transcription factors and provide evidence to challenge the notion that this important protein class is chemically intractable. PMID:20395165

  19. Rational Design of Diketopyrrolopyrrole-Based Small Molecules as Donating Materials for Organic Solar Cells

    PubMed Central

    Jin, Ruifa; Wang, Kai

    2015-01-01

    A series of diketopyrrolopyrrole-based small molecules have been designed to explore their optical, electronic, and charge transport properties as organic solar cell (OSCs) materials. The calculation results showed that the designed molecules can lower the band gap and extend the absorption spectrum towards longer wavelengths. The designed molecules own the large longest wavelength of absorption spectra, the oscillator strength, and absorption region values. The optical, electronic, and charge transport properties of the designed molecules are affected by the introduction of different π-bridges and end groups. We have also predicted the mobility of the designed molecule with the lowest total energies. Our results reveal that the designed molecules are expected to be promising candidates for OSC materials. Additionally, the designed molecules are expected to be promising candidates for electron and/or hole transport materials. On the basis of our results, we suggest that molecules under investigation are suitable donors for [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) and its derivatives as acceptors of OSCs. PMID:26343640

  20. Cardioprotective Potentials of Plant-Derived Small Molecules against Doxorubicin Associated Cardiotoxicity

    PubMed Central

    Ojha, Shreesh; Al Taee, Hasan; Goyal, Sameer; Mahajan, Umesh B.; Patil, Chandrgouda R.; Arya, D. S.; Rajesh, Mohanraj

    2016-01-01

    Doxorubicin (DOX) is a potent and widely used anthracycline antibiotic for the treatment of several malignancies. Unfortunately, the clinical utility of DOX is often restricted due to the elicitation of organ toxicity. Particularly, the increased risk for the development of dilated cardiomyopathy by DOX among the cancer survivors warrants major attention from the physicians as well as researchers to develop adjuvant agents to neutralize the noxious effects of DOX on the healthy myocardium. Despite these pitfalls, the use of traditional cytotoxic drugs continues to be the mainstay treatment for several types of cancer. Recently, phytochemicals have gained attention for their anticancer, chemopreventive, and cardioprotective activities. The ideal cardioprotective agents should not compromise the clinical efficacy of DOX and should be devoid of cumulative or irreversible toxicity on the naïve tissues. Furthermore, adjuvants possessing synergistic anticancer activity and quelling of chemoresistance would significantly enhance the clinical utility in combating DOX-induced cardiotoxicity. The present review renders an overview of cardioprotective effects of plant-derived small molecules and their purported mechanisms against DOX-induced cardiotoxicity. Phytochemicals serve as the reservoirs of pharmacophore which can be utilized as templates for developing safe and potential novel cardioprotective agents in combating DOX-induced cardiotoxicity. PMID:27313831

  1. Dissecting allosteric effects of activator-coactivator complexes using a covalent small molecule ligand.

    PubMed

    Wang, Ningkun; Lodge, Jean M; Fierke, Carol A; Mapp, Anna K

    2014-08-19

    Allosteric binding events play a critical role in the formation and stability of transcriptional activator-coactivator complexes, perhaps in part due to the often intrinsically disordered nature of one or more of the constituent partners. The kinase-inducible domain interacting (KIX) domain of the master coactivator CREB binding protein/p300 is a conformationally dynamic domain that complexes with transcriptional activators at two discrete binding sites in allosteric communication. The complexation of KIX with the transcriptional activation domain of mixed-lineage leukemia protein leads to an enhancement of binding by the activation domain of CREB (phosphorylated kinase-inducible domain of CREB) to the second site. A transient kinetic analysis of the ternary complex formation aided by small molecule ligands that induce positive or negative cooperative binding reveals that positive cooperativity is largely governed by stabilization of the bound complex as indicated by a decrease in koff. Thus, this suggests the increased binding affinity for the second ligand is not due to an allosteric creation of a more favorable binding interface by the first ligand. This is consistent with data from us and from others indicating that the on rates of conformationally dynamic proteins approach the limits of diffusion. In contrast, negative cooperativity is manifested by alterations in both kon and koff, suggesting stabilization of the binary complex.

  2. A small-molecule inducer of PDX1 expression identified by high-throughput screening

    PubMed Central

    Yuan, Yuan; Hartland, Kate; Boskovic, Zarko; Wang, Yikai; Walpita, Deepika; Lysy, Philippe A.; Zhong, Cheng; Young, Damian W.; Kim, Young-kwon; Tolliday, Nicola J; Sokal, Etienne M.; Schreiber, Stuart L.; Wagner, Bridget K.

    2014-01-01

    SUMMARY Pancreatic and duodenal homeobox 1 (PDX1), a member of the homedomain-containing transcription factor family, is a key transcription factor important for both pancreas development and mature beta-cell function. The ectopic overexpression of Pdx1, Neurog3, and MafA in mice reprograms acinar cells to insulin-producing cells. We developed a qPCR-based gene-expression assay to screen >60,000 compounds for expression of each of these genes in the human PANC-1 ductal carcinoma cell line. We identified BRD7552, which up-regulated PDX expression in both primary human islets and ductal cells, and induced epigenetic changes in the PDX1 promoter consistent with transcriptional activation. Prolonged compound treatment induced insulin mRNA and protein, and enhanced insulin expression induced by the three-gene combination. These results provide a proof of principle for identifying small molecules that induce expression of transcription factors to control cellular reprogramming. PMID:24290880

  3. Sensitive bifunctional aptamer-based electrochemical biosensor for small molecules and protein.

    PubMed

    Deng, Chunyan; Chen, Jinhua; Nie, Lihua; Nie, Zhou; Yao, Shouzhuo

    2009-12-15

    In this paper, a bifunctional electrochemical biosensor for highly sensitive detection of small molecule (adenosine) or protein (lysozyme) was developed. Two aptamer units for adenosine and lysozyme were immobilized on the gold electrode by the formation of DNA/DNA duplex. The detection of adenosine or lysozyme could be carried out by virtue of switching structures of aptamers from DNA/DNA duplex to DNA/target complex. The change of the interfacial feature of the electrode was characterized by cyclic voltammertic (CV) response of surface-bound [Ru(NH(3))(6)](3+). On the other hand, DNA functionalized Au nanoparticles (DNA-AuNPs) were used to enhance the sensitivity of the aptasensor because DNA-AuNPs modified interface could load more [Ru(NH(3))(6)](3+) cations. Thus, the assembly of two aptamer-contained DNA strands integrated with the DNA-AuNPs amplification not only improves the sensitivity of the electrochemical aptasensor but also presents a simple and general model for bifunctional aptasensor. The proposed aptasensor has low detection limit (0.02 nM for adenosine and 0.01 microg mL(-1) for lysozyme) and exhibits several advantages such as high sensitivity and bifunctional recognition.

  4. Human Sarcoma Growth Is Sensitive to Small-Molecule Mediated AXIN Stabilization

    PubMed Central

    Rossi, Marco; Valensin, Silvia; Tunici, Patrizia; Mori, Elisa; Caradonna, Nicola; Varrone, Maurizio; Salerno, Massimiliano

    2014-01-01

    Sarcomas are mesenchymal tumors showing high molecular heterogeneity, reflected at the histological level by the existence of more than fifty different subtypes. Genetic and epigenetic evidences link aberrant activation of the Wnt signaling to growth and progression of human sarcomas. This phenomenon, mainly accomplished by autocrine loop activity, is sustained by gene amplification, over-expression of Wnt ligands and co-receptors or epigenetic silencing of endogenous Wnt antagonists. We previously showed that pharmacological inhibition of Wnt signaling mediated by Axin stabilization produced in vitro and in vivo antitumor activity in glioblastoma tumors. Here, we report that targeting different sarcoma cell lines with the Wnt inhibitor/Axin stabilizer SEN461 produces a less transformed phenotype, as supported by modulation of anchorage-independent growth in vitro. At the molecular level, SEN461 treatment enhanced the stability of the scaffold protein Axin1, a key negative regulator of the Wnt signaling with tumor suppressor function, resulting in downstream effects coherent with inhibition of canonical Wnt signaling. Genetic phenocopy of small molecule Axin stabilization, through Axin1 over-expression, coherently resulted in strong impairment of soft-agar growth. Importantly, sarcoma growth inhibition through pharmacological Axin stabilization was also observed in a xenograft model in vivo in female CD-1 nude mice. Our findings suggest the usefulness of Wnt inhibitors with Axin stabilization activity as a potentialyl clinical relevant strategy for certain types of sarcomas. PMID:24842792

  5. Human Sarcoma growth is sensitive to small-molecule mediated AXIN stabilization.

    PubMed

    De Robertis, Alessandra; Mennillo, Federica; Rossi, Marco; Valensin, Silvia; Tunici, Patrizia; Mori, Elisa; Caradonna, Nicola; Varrone, Maurizio; Salerno, Massimiliano

    2014-01-01

    Sarcomas are mesenchymal tumors showing high molecular heterogeneity, reflected at the histological level by the existence of more than fifty different subtypes. Genetic and epigenetic evidences link aberrant activation of the Wnt signaling to growth and progression of human sarcomas. This phenomenon, mainly accomplished by autocrine loop activity, is sustained by gene amplification, over-expression of Wnt ligands and co-receptors or epigenetic silencing of endogenous Wnt antagonists. We previously showed that pharmacological inhibition of Wnt signaling mediated by Axin stabilization produced in vitro and in vivo antitumor activity in glioblastoma tumors. Here, we report that targeting different sarcoma cell lines with the Wnt inhibitor/Axin stabilizer SEN461 produces a less transformed phenotype, as supported by modulation of anchorage-independent growth in vitro. At the molecular level, SEN461 treatment enhanced the stability of the scaffold protein Axin1, a key negative regulator of the Wnt signaling with tumor suppressor function, resulting in downstream effects coherent with inhibition of canonical Wnt signaling. Genetic phenocopy of small molecule Axin stabilization, through Axin1 over-expression, coherently resulted in strong impairment of soft-agar growth. Importantly, sarcoma growth inhibition through pharmacological Axin stabilization was also observed in a xenograft model in vivo in female CD-1 nude mice. Our findings suggest the usefulness of Wnt inhibitors with Axin stabilization activity as a potentialyl clinical relevant strategy for certain types of sarcomas. PMID:24842792

  6. Dextran hydrogel coated surface plasmon resonance imaging (SPRi) sensor for sensitive and label-free detection of small molecule drugs

    NASA Astrophysics Data System (ADS)

    Li, Shaopeng; Yang, Mo; Zhou, Wenfei; Johnston, Trevor G.; Wang, Rui; Zhu, Jinsong

    2015-11-01

    The label-free and sensitive detection of small molecule drugs on SPRi is still a challenging task, mainly due to the limited surface immobilization capacity of the sensor. In this research, a dextran hydrogel-coated gold sensor chip for SPRi was successfully fabricated via photo-cross-linking for enhanced surface immobilization capacity. The density of the dextran hydrogel was optimized for protein immobilization and sensitive small molecule detection. The protein immobilization capacity of the hydrogel was 10 times greater than a bare gold surface, and 20 times greater than an 11-mercaptoundecanoic acid (MUA) surface. Such a drastic improvement in immobilization capacity allowed the SPRi sensor to detect adequate response signals when probing small molecule binding events. The binding signal of 4 nM liquid-phase biotin to streptavidin immobilized on the dextran surface reached 435 RU, while no response was observed on bare gold or MUA surfaces. The dextran hydrogel-coated SPRi sensor was also applied in a kinetic study of the binding between an immunosuppressive drug (FK506) and its target protein (FKBP12) in a high-throughput microarray format. The measured binding affinity was shown to be consistent with reported literature values, and a detection limit of 0.5 nM was achieved.

  7. Discovery and Development of Small Molecule Allosteric Modulators of Glycoprotein Hormone Receptors

    PubMed Central

    Nataraja, Selvaraj G.; Yu, Henry N.; Palmer, Stephen S.

    2015-01-01

    Glycoprotein hormones, follicle-stimulating hormone (FSH), luteinizing hormone (LH), and thyroid-stimulating hormone (TSH) are heterodimeric proteins with a common α-subunit and hormone-specific β-subunit. These hormones are dominant regulators of reproduction and metabolic processes. Receptors for the glycoprotein hormones belong to the family of G protein-coupled receptors. FSH receptor (FSHR) and LH receptor are primarily expressed in somatic cells in ovary and testis to promote egg and sperm production in women and men, respectively. TSH receptor is expressed in thyroid cells and regulates the secretion of T3 and T4. Glycoprotein hormones bind to the large extracellular domain of the receptor and cause a conformational change in the receptor that leads to activation of more than one intracellular signaling pathway. Several small molecules have been described to activate/inhibit glycoprotein hormone receptors through allosteric sites of the receptor. Small molecule allosteric modulators have the potential to be administered orally to patients, thus improving the convenience of treatment. It has been a challenge to develop a small molecule allosteric agonist for glycoprotein hormones that can mimic the agonistic effects of the large natural ligand to activate similar signaling pathways. However, in the past few years, there have been several promising reports describing distinct chemical series with improved potency in preclinical models. In parallel, proposal of new structural model for FSHR and in silico docking studies of small molecule ligands to glycoprotein hormone receptors provide a giant leap on the understanding of the mechanism of action of the natural ligands and new chemical entities on the receptors. This review will focus on the current status of small molecule allosteric modulators of glycoprotein hormone receptors, their effects on common signaling pathways in cells, their utility for clinical application as demonstrated in preclinical models

  8. Fluorescence Enhancement of Molecules Inside a Gold Nanomatryoshka

    PubMed Central

    2015-01-01

    Metallic nanoparticles exhibiting plasmonic Fano resonances can provide large enhancements of their internal electric near field. Here we show that nanomatryoshkas, nanoparticles consisting of an Au core, an interstitial nanoscale SiO2 layer, and an Au shell layer, can selectively provide either a strong enhancement or a quenching of the spontaneous emission of fluorophores dispersed within their internal dielectric layer. This behavior can be understood by taking into account the near-field enhancement induced by the Fano resonance of the nanomatryoshka, which is responsible for enhanced absorption of the fluorophores incorporated into the nanocomplex. The combination of compact size and enhanced light emission with internal encapsulation of the fluorophores for increased biocompatibility suggests outstanding potential for this type of nanoparticle complex in biomedical applications. PMID:24738706

  9. Kinetics of small molecule interactions with membrane proteins in single cells measured with mechanical amplification

    PubMed Central

    Guan, Yan; Shan, Xiaonan; Zhang, Fenni; Wang, Shaopeng; Chen, Hong-Yuan; Tao, Nongjian

    2015-01-01

    Measuring small molecule interactions with membrane proteins in single cells is critical for understanding many cellular processes and for screening drugs. However, developing such a capability has been a difficult challenge. We show that molecular interactions with membrane proteins induce a mechanical deformation in the cellular membrane, and real-time monitoring of the deformation with subnanometer resolution allows quantitative analysis of small molecule–membrane protein interaction kinetics in single cells. This new strategy provides mechanical amplification of small binding signals, making it possible to detect small molecule interactions with membrane proteins. This capability, together with spatial resolution, also allows the study of the heterogeneous nature of cells by analyzing the interaction kinetics variability between different cells and between different regions of a single cell. PMID:26601298

  10. The artificial control of enhanced optical processes in fluorescent molecules on high-emittance metasurfaces

    NASA Astrophysics Data System (ADS)

    Iwanaga, Masanobu; Choi, Bongseok; Miyazaki, Hideki T.; Sugimoto, Yoshimasa

    2016-05-01

    Plasmon-enhanced optical processes in molecules have been extensively but individually explored for Raman scattering, fluorescence, and infrared light absorption. In contrast to recent progress in the interfacial control of hot electrons in plasmon-semiconductor hybrid systems, plasmon-molecule hybrid systems have remained to be a conventional scheme, mainly assuming electric-field enhancement. This was because it was difficult to control the plasmon-molecule interface in a well-controlled manner. We here experimentally substantiate an obvious change in artificially enhanced optical processes of fluorescence/Raman scattering in fluorescent molecules on high-emittance plasmo-photonic metasurfaces with/without a self-assembled monolayer of sub-nm thickness. These results indicate that the enhanced optical processes were successfully selected under artificial configurations without any additional chemical treatment that modifies the molecules themselves. Although Raman-scattering efficiency is generally weak in high-fluorescence-yield molecules, it was found that Raman scattering becomes prominent around the molecular fingerprint range on the metasurfaces, being enhanced by more than 2000 fold at the maximum for reference signals. In addition, the highly and uniformly enhancing metasurfaces are able to serve as two-way functional, reproducible, and wavelength-tunable platforms to detect molecules at very low densities, being distinct from other platforms reported so far. The change in the enhanced signals suggests that energy diagrams in fluorescent molecules are changed in the configuration that includes the metal-molecule interface, meaning that plasmon-molecule hybrid systems are rich in the phenomena beyond the conventional scheme.Plasmon-enhanced optical processes in molecules have been extensively but individually explored for Raman scattering, fluorescence, and infrared light absorption. In contrast to recent progress in the interfacial control of hot electrons

  11. Small molecule inhibitor screen identifies synergistic activity of the bromodomain inhibitor CPI203 and bortezomib in drug resistant myeloma

    PubMed Central

    Siegel, Matthew B.; Liu, Selina Qiuying; Davare, Monika A.; Spurgeon, Stephen E.; Loriaux, Marc M.; Druker, Brian J.

    2015-01-01

    Purpose Despite significant therapeutic progress in multiple myeloma, drug resistance is uniformly inevitable and new treatments are needed. Our aim was to identify novel, efficacious small-molecule combinations for use in drug resistant multiple myeloma. Experimental Design A panel of 116 small molecule inhibitors was used to screen resistant myeloma cell lines for potential therapeutic targets. Agents found to have enhanced activity in the bortezomib or melphalan resistant myeloma cell lines were investigated further in combination. Synergistic combinations of interest were evaluated in primary patient cells. Results The overall single-agent drug sensitivity profiles were dramatically different between melphalan and bortezomib resistant cells, however, the bromodomain inhibitor, CPI203, was observed to have enhanced activity in both the bortezomib and melphalan resistant lines compared to their wild-type counterparts. The combination of bortezomib and CPI203 was found to be synergistic in both the bortezomib and melphalan resistant cell lines as well as in a primary multiple myeloma sample from a patient refractory to recent proteasome inhibitor treatment. The CPI203-bortezomib combination led to enhanced apoptosis and anti-proliferative effects. Finally, in contrast to prior reports of synergy between bortezomib and other epigenetic modifying agents, which implicated MYC downregulation or NOXA induction, our analyses suggest that CPI203-bortezomib synergy is independent of these events. Conclusion Our preclinical data supports a role for the clinical investigation of the bromodomain inhibitor CPI203 combined with bortezomib or alkylating agents in resistant multiple myeloma. PMID:26254279

  12. Identification of small molecules inhibiting diguanylate cyclases to control bacterial biofilm development.

    PubMed

    Sambanthamoorthy, Karthik; Luo, Chunyuan; Pattabiraman, Nagarajan; Feng, Xiarong; Koestler, Benjamin; Waters, Christopher M; Palys, Thomas J

    2014-01-01

    Biofilm formation by pathogenic bacteria is an important virulence factor in the development of numerous chronic infections, thereby causing a severe health burden. Many of these infections cannot be resolved, as bacteria in biofilms are resistant to the host's immune defenses and antibiotic therapy. An urgent need for new strategies to treat biofilm-based infections is critically needed. Cyclic di-GMP (c-di-GMP) is a widely conserved second-messenger signal essential for biofilm formation. The absence of this signalling system in higher eukaryotes makes it an attractive target for the development of new anti-biofilm agents. In this study, the results of an in silico pharmacophore-based screen to identify small-molecule inhibitors of diguanylate cyclase (DGC) enzymes that synthesize c-di-GMP are described. Four small molecules, LP 3134, LP 3145, LP 4010 and LP 1062 that antagonize these enzymes and inhibit biofilm formation by Pseudomonas aeruginosa and Acinetobacter baumannii in a continuous-flow system are reported. All four molecules dispersed P. aeruginosa biofilms and inhibited biofilm development on urinary catheters. One molecule dispersed A. baumannii biofilms. Two molecules displayed no toxic effects on eukaryotic cells. These molecules represent the first compounds identified from an in silico screen that are able to inhibit DGC activity to prevent biofilm formation. PMID:24117391

  13. Identification of small molecules inhibiting diguanylate cyclases to control bacterial biofilm development.

    PubMed

    Sambanthamoorthy, Karthik; Luo, Chunyuan; Pattabiraman, Nagarajan; Feng, Xiarong; Koestler, Benjamin; Waters, Christopher M; Palys, Thomas J

    2014-01-01

    Biofilm formation by pathogenic bacteria is an important virulence factor in the development of numerous chronic infections, thereby causing a severe health burden. Many of these infections cannot be resolved, as bacteria in biofilms are resistant to the host's immune defenses and antibiotic therapy. An urgent need for new strategies to treat biofilm-based infections is critically needed. Cyclic di-GMP (c-di-GMP) is a widely conserved second-messenger signal essential for biofilm formation. The absence of this signalling system in higher eukaryotes makes it an attractive target for the development of new anti-biofilm agents. In this study, the results of an in silico pharmacophore-based screen to identify small-molecule inhibitors of diguanylate cyclase (DGC) enzymes that synthesize c-di-GMP are described. Four small molecules, LP 3134, LP 3145, LP 4010 and LP 1062 that antagonize these enzymes and inhibit biofilm formation by Pseudomonas aeruginosa and Acinetobacter baumannii in a continuous-flow system are reported. All four molecules dispersed P. aeruginosa biofilms and inhibited biofilm development on urinary catheters. One molecule dispersed A. baumannii biofilms. Two molecules displayed no toxic effects on eukaryotic cells. These molecules represent the first compounds identified from an in silico screen that are able to inhibit DGC activity to prevent biofilm formation.

  14. The artificial control of enhanced optical processes in fluorescent molecules on high-emittance metasurfaces.

    PubMed

    Iwanaga, Masanobu; Choi, Bongseok; Miyazaki, Hideki T; Sugimoto, Yoshimasa

    2016-06-01

    Plasmon-enhanced optical processes in molecules have been extensively but individually explored for Raman scattering, fluorescence, and infrared light absorption. In contrast to recent progress in the interfacial control of hot electrons in plasmon-semiconductor hybrid systems, plasmon-molecule hybrid systems have remained to be a conventional scheme, mainly assuming electric-field enhancement. This was because it was difficult to control the plasmon-molecule interface in a well-controlled manner. We here experimentally substantiate an obvious change in artificially enhanced optical processes of fluorescence/Raman scattering in fluorescent molecules on high-emittance plasmo-photonic metasurfaces with/without a self-assembled monolayer of sub-nm thickness. These results indicate that the enhanced optical processes were successfully selected under artificial configurations without any additional chemical treatment that modifies the molecules themselves. Although Raman-scattering efficiency is generally weak in high-fluorescence-yield molecules, it was found that Raman scattering becomes prominent around the molecular fingerprint range on the metasurfaces, being enhanced by more than 2000 fold at the maximum for reference signals. In addition, the highly and uniformly enhancing metasurfaces are able to serve as two-way functional, reproducible, and wavelength-tunable platforms to detect molecules at very low densities, being distinct from other platforms reported so far. The change in the enhanced signals suggests that energy diagrams in fluorescent molecules are changed in the configuration that includes the metal-molecule interface, meaning that plasmon-molecule hybrid systems are rich in the phenomena beyond the conventional scheme. PMID:27227964

  15. UV and VUV spectroscopy and photochemistry of small molecules in a supersonic jet

    NASA Technical Reports Server (NTRS)

    Ruehl, E.; Vaida, V.

    1990-01-01

    UV and VUV absorption and emission spectroscopy is used to probe jet cooled molecules, free radicals, and clusters in the gas phase. Due to efficient cooling inhomogeneous effects on spectral line widths are eliminated. Therefore from these spectra, both structural and dynamical information is obtained. The photoproducts of these reactions are probed by resonance enhanced multiphoton ionization.

  16. Diffusion dynamics of small molecules from mesoporous silicon films by real-time optical interferometry

    SciTech Connect

    Mares, Jeremy W.; Weiss, Sharon M.

    2011-09-20

    Time-dependent laser reflectometry measurements are presented as a means to rigorously characterize analyte diffusion dynamics of small molecules from mesoporous silicon (PSi) films for drug delivery and membrane physics applications. Calculations based on inclusion of a spatially and temporally dependent solute concentration profile in a one-dimensional Fickian diffusion flow model are performed to determine the diffusion coefficients for the selected prototypical polar species, sucrose (340 Da), exiting from PSi films. The diffusion properties of the molecules depend on both PSi pore size and film thickness. For films with average pore diameters between 10-30 nm and film thicknesses between 300-900 nm, the sucrose diffusion coefficient can be tuned between approximately 100 and 550 {mu}m{sup 2}/s. Extensions of the real-time measurement and modeling approach for determining the diffusivity of small molecules that strongly interact with and corrode the internal surfaces of PSi films are also discussed.

  17. Involvement of secondary messengers and small organic molecules in auxin perception and signaling.

    PubMed

    Di, Dong-Wei; Zhang, Caiguo; Guo, Guang-Qin

    2015-06-01

    Auxin is a major phytohormone involved in most aspects of plant growth and development. Generally, auxin is perceived by three distinct receptors: TRANSPORT INHIBITOR RESISTANT1-Auxin/INDOLE ACETIC ACID, S-Phase Kinase-Associated Protein 2A and AUXIN-BINDING PROTEIN1. The auxin perception is regulated by a variety of secondary messenger molecules, including nitric oxide, reactive oxygen species, calcium, cyclic GMP, cyclic AMP, inositol triphosphate, diacylglycerol and by physiological pH. In addition, some small organic molecules, including inositol hexakisphosphate, yokonolide B, p-chlorophenoxyisobutyric acid, toyocamycin and terfestatin A, are involved in auxin signaling. In this review, we summarize and discuss the recent progress in understanding the functions of these secondary messengers and small organic molecules, which are now thoroughly demonstrated to be pervasive and important in auxin perception and signal transduction. PMID:25693494

  18. Self-assembled nanoparticle of common food constituents that carries a sparingly soluble small molecule.

    PubMed

    Bhopatkar, Deepak; Feng, Tao; Chen, Feng; Zhang, Genyi; Carignano, Marcelo; Park, Sung Hyun; Zhuang, Haining; Campanella, Osvaldo H; Hamaker, Bruce R

    2015-05-01

    A previously reported nanoparticle formed through the self-assembly of common food constituents (amylose, protein, and fatty acids) was shown to have the capacity to carry a sparingly soluble small molecule (1-naphthol) in a dispersed system. Potentiometric titration showed that 1-naphthol locates in the lumen of the amylose helix of the nanoparticle. This finding was further supported by calorimetric measurements, showing higher enthalpies of dissociation and reassociation in the presence of 1-naphthol. Visually, the 1-naphthol-loaded nanoparticle appeared to be well-dispersed in aqueous solution. Molecular dynamics simulation showed that the self-assembly was favorable, and at 500 ns, the 1-naphthol molecule resided in the helix of the amylose lumen in proximity to the hydrophobic tail of the fatty acid. Thus, sparingly soluble small molecules, such as some nutraceuticals or drugs, could be incorporated and delivered by this soft nanoparticle carrier.

  19. Involvement of secondary messengers and small organic molecules in auxin perception and signaling.

    PubMed

    Di, Dong-Wei; Zhang, Caiguo; Guo, Guang-Qin

    2015-06-01

    Auxin is a major phytohormone involved in most aspects of plant growth and development. Generally, auxin is perceived by three distinct receptors: TRANSPORT INHIBITOR RESISTANT1-Auxin/INDOLE ACETIC ACID, S-Phase Kinase-Associated Protein 2A and AUXIN-BINDING PROTEIN1. The auxin perception is regulated by a variety of secondary messenger molecules, including nitric oxide, reactive oxygen species, calcium, cyclic GMP, cyclic AMP, inositol triphosphate, diacylglycerol and by physiological pH. In addition, some small organic molecules, including inositol hexakisphosphate, yokonolide B, p-chlorophenoxyisobutyric acid, toyocamycin and terfestatin A, are involved in auxin signaling. In this review, we summarize and discuss the recent progress in understanding the functions of these secondary messengers and small organic molecules, which are now thoroughly demonstrated to be pervasive and important in auxin perception and signal transduction.

  20. Construction of logic gates with the fluorene-based small molecule/DNA probes.

    PubMed

    Guo, Jing; Wang, Ting; Yang, Renqiang

    2012-09-01

    Fluorene-based small molecules (FSMs) have optical properties and can interact with DNA. In this paper, the integrated "INH" and "AND" gates operating in parallel are developed with the fluorene-based small molecule (FSM)/DNA probe. They are activated by taking advantage of the two-step fluorescence resonance energy transfer (FRET) process and the sequence-recognition mechanism of DNA. Then, a "NOT" gate is obtained with a molecular beacon-like probe (FSM-MB) by using the FSM as the fluorophore. Moreover, the "NOT" gate based on the FSM-MB probe can be used as a biosensor and has potential applications in label-free detection of target molecules.

  1. Self-assembled nanoparticle of common food constituents that carries a sparingly soluble small molecule.

    PubMed

    Bhopatkar, Deepak; Feng, Tao; Chen, Feng; Zhang, Genyi; Carignano, Marcelo; Park, Sung Hyun; Zhuang, Haining; Campanella, Osvaldo H; Hamaker, Bruce R

    2015-05-01

    A previously reported nanoparticle formed through the self-assembly of common food constituents (amylose, protein, and fatty acids) was shown to have the capacity to carry a sparingly soluble small molecule (1-naphthol) in a dispersed system. Potentiometric titration showed that 1-naphthol locates in the lumen of the amylose helix of the nanoparticle. This finding was further supported by calorimetric measurements, showing higher enthalpies of dissociation and reassociation in the presence of 1-naphthol. Visually, the 1-naphthol-loaded nanoparticle appeared to be well-dispersed in aqueous solution. Molecular dynamics simulation showed that the self-assembly was favorable, and at 500 ns, the 1-naphthol molecule resided in the helix of the amylose lumen in proximity to the hydrophobic tail of the fatty acid. Thus, sparingly soluble small molecules, such as some nutraceuticals or drugs, could be incorporated and delivered by this soft nanoparticle carrier. PMID:25880884

  2. Whispering gallery microresonators for second harmonic light generation from a low number of small molecules.

    PubMed

    Dominguez-Juarez, J L; Kozyreff, G; Martorell, Jordi

    2011-01-01

    Unmarked sensitive detection of molecules is needed in environmental pollution monitoring, disease diagnosis, security screening systems and in many other situations in which a substance must be identified. When molecules are attached or adsorbed onto an interface, detecting their presence is possible using second harmonic light generation, because at interfaces the inversion symmetry is broken. However, such light generation usually requires either dense matter or a large number of molecules combined with high-power laser sources. Here we show that using high-Q spherical microresonators and low average power, between 50 and 100 small non-fluorescent molecules deposited on the outer surface of the microresonator can generate a detectable change in the second harmonic light. This generation requires phase matching in the whispering gallery modes, which we achieved using a new procedure to periodically pattern, with nanometric precision, a molecular surface monolayer. PMID:21448153

  3. Small molecule-assisted fabrication of black phosphorus quantum dots with a broadband nonlinear optical response.

    PubMed

    Gao, Lin-Feng; Xu, Jing-Yin; Zhu, Zhi-Yuan; Hu, Chen-Xia; Zhang, Lei; Wang, Qiang; Zhang, Hao-Li

    2016-08-18

    Ultrathin BP QDs with a uniform size of ∼3.4 nm were prepared via small molecule-assisted liquid phase exfoliation and they exhibited superior broadband nonlinear saturable absorption promising for nonlinear optical applications. Laser photolysis measurement implied that the nonlinear response origin was related to the long-lived electron-hole pairs delocalized within the BP QDs. PMID:27491959

  4. Design of a bioactive small molecule that targets r(AUUCU) repeats in spinocerebellar ataxia 10.

    PubMed

    Yang, Wang-Yong; Gao, Rui; Southern, Mark; Sarkar, Partha S; Disney, Matthew D

    2016-01-01

    RNA is an important target for chemical probes of function and lead therapeutics; however, it is difficult to target with small molecules. One approach to tackle this problem is to identify compounds that target RNA structures and utilize them to multivalently target RNA. Here we show that small molecules can be identified to selectively bind RNA base pairs by probing a library of RNA-focused small molecules. A small molecule that selectively binds AU base pairs informed design of a dimeric compound (2AU-2) that targets the pathogenic RNA, expanded r(AUUCU) repeats, that causes spinocerebellar ataxia type 10 (SCA10) in patient-derived cells. Indeed, 2AU-2 (50 nM) ameliorates various aspects of SCA10 pathology including improvement of mitochondrial dysfunction, reduced activation of caspase 3, and reduction of nuclear foci. These studies provide a first-in-class chemical probe to study SCA10 RNA toxicity and potentially define broadly applicable compounds targeting RNA AU base pairs in cells. PMID:27248057

  5. Small-Molecule-Directed Hepatocyte-Like Cell Differentiation of Human Pluripotent Stem Cells.

    PubMed

    Mathapati, Santosh; Siller, Richard; Impellizzeri, Agata A R; Lycke, Max; Vegheim, Karianne; Almaas, Runar; Sullivan, Gareth J

    2016-01-01

    Hepatocyte-like cells (HLCs) generated in vitro from human pluripotent stem cells (hPSCs) provide an invaluable resource for basic research, regenerative medicine, drug screening, toxicology, and modeling of liver disease and development. This unit describes a small-molecule-driven protocol for in vitro differentiation of hPSCs into HLCs without the use of growth factors. hPSCs are coaxed through a developmentally relevant route via the primitive streak to definitive endoderm (DE) using the small molecule CHIR99021 (a Wnt agonist), replacing the conventional growth factors Wnt3A and activin A. The small-molecule-derived DE is then differentiated to hepatoblast-like cells in the presence of dimethyl sulfoxide. The resulting hepatoblasts are then differentiated to HLCs with N-hexanoic-Tyr, Ile-6 aminohexanoic amide (Dihexa, a hepatocyte growth factor agonist) and dexamethasone. The protocol provides an efficient and reproducible procedure for differentiation of hPSCs into HLCs utilizing small molecules. © 2016 by John Wiley & Sons, Inc. PMID:27532814

  6. Small molecule inhibition of microbial natural product biosynthesis – An emerging antibiotic strategy

    PubMed Central

    Cisar, Justin S.; Tan, Derek S.

    2008-01-01

    A variety of natural products modulate critical biological processes in the microorganisms that produce them. Thus, inhibition of the corresponding natural product biosynthesis pathways represents a promising avenue to develop novel antibiotics. In this tutorial review, we describe several recent examples of designed small molecule inhibitors of microbial natural product biosynthesis and their use in evaluating this emerging antibiotic strategy. PMID:18568158

  7. Cellular reprogramming for pancreatic β-cell regeneration: clinical potential of small molecule control.

    PubMed

    Pandian, Ganesh N; Taniguchi, Junichi; Sugiyama, Hiroshi

    2014-03-27

    Recent scientific breakthroughs in stem cell biology suggest that a sustainable treatment approach to cure diabetes mellitus (DM) can be achieved in the near future. However, the transplantation complexities and the difficulty in obtaining the stem cells from adult cells of pancreas, liver, bone morrow and other cells is a major concern. The epoch-making strategy of transcription-factor based cellular reprogramming suggest that these barriers could be overcome, and it is possible to reprogram any cells into functional β cells. Contemporary biological and analytical techniques help us to predict the key transcription factors needed for β-cell regeneration. These β cell-specific transcription factors could be modulated with diverse reprogramming protocols. Among cellular reprogramming strategies, small molecule approach gets proclaimed to have better clinical prospects because it does not involve genetic manipulation. Several small molecules targeting certain epigenetic enzymes and/or signaling pathways have been successful in helping to induce pancreatic β-cell specification. Recently, a synthetic DNA-based small molecule triggered targeted transcriptional activation of pancreas-related genes to suggest the possibility of achieving desired cellular phenotype in a precise mode. Here, we give a brief overview of treating DM by regenerating pancreatic β-cells from various cell sources. Through a comprehensive overview of the available transcription factors, small molecules and reprogramming strategies available for pancreatic β-cell regeneration, this review compiles the current progress made towards the generation of clinically relevant insulin-producing β-cells.

  8. Small Molecule-Assisted Exfoliation of Layered Zirconium Phosphate Nanoplatelets by Ionic Liquids.

    PubMed

    Xia, Fangqing; Yong, Huaisong; Han, Xiao; Sun, Dazhi

    2016-12-01

    Exfoliation of layered inorganic nanomaterials into single-layered sheets has been widely interested in materials chemistry and composite fabrication. Here, we report the exfoliation of layered zirconium phosphate nanoplatelets by using small molecule intercalating agents in ionic liquids, which opens a new platform for fabricating single-layered inorganic materials from synthetic layered compounds. PMID:27460596

  9. A Direct, Competitive Enzyme-Linked Immunosorbent Assay (ELISA) as a Quantitative Technique for Small Molecules

    ERIC Educational Resources Information Center

    Powers, Jennifer L.; Rippe, Karen Duda; Imarhia, Kelly; Swift, Aileen; Scholten, Melanie; Islam, Naina

    2012-01-01

    ELISA (enzyme-linked immunosorbent assay) is a widely used technique with applications in disease diagnosis, detection of contaminated foods, and screening for drugs of abuse or environmental contaminants. However, published protocols with a focus on quantitative detection of small molecules designed for teaching laboratories are limited. A…

  10. Identification of a small molecule [beta]-secretase inhibitor that binds without catalytic aspartate engagement

    SciTech Connect

    Steele, Thomas G.; Hills, Ivory D.; Nomland, Ashley A.; de León, Pablo; Allison, Timothy; McGaughey, Georgia; Colussi, Dennis; Tugusheva, Katherine; Haugabook, Sharie J.; Espeseth, Amy S.; Zuck, Paul; Graham, Samuel L.; Stachel, Shawn J.

    2010-09-02

    A small molecule inhibitor of beta-secretase with a unique binding mode has been developed. Crystallographic determination of the enzyme-inhibitor complex shows the catalytic aspartate residues in the active site are not engaged in inhibitor binding. This unprecedented binding mode in the field of aspartyl protease inhibition is described.

  11. TNF Superfamily Protein–Protein Interactions: Feasibility of Small-Molecule Modulation

    PubMed Central

    Song, Yun; Buchwald, Peter

    2015-01-01

    The tumor necrosis factor (TNF) superfamily (TNFSF) contains about thirty structurally related receptors (TNFSFRs) and about twenty protein ligands that bind to one or more of these receptors. Almost all of these cell surface protein-protein interactions (PPIs) represent high-value therapeutic targets for inflammatory or immune modulation in autoimmune diseases, transplant recipients, or cancers, and there are several biologics including antibodies and fusion proteins targeting them that are in various phases of clinical development. Small-molecule inhibitors or activators could represent possible alternatives if the difficulties related to the targeting of protein-protein interactions by small molecules can be addressed. Compounds proving the feasibility of such approaches have been identified through different drug discovery approaches for a number of these TNFSFR-TNFSF type PPIs including CD40-CD40L, BAFFR-BAFF, TRAIL-DR5, and OX40-OX40L. Corresponding structural, signaling, and medicinal chemistry aspects are briefly reviewed here. While none of these small-molecule modulators identified so far seems promising enough to be pursued for clinical development, they provide proof-of-principle evidence that these interactions are susceptible to small-molecule modulation and can serve as starting points toward the identification of more potent and selective candidates. PMID:25706111

  12. Efficient small-molecule photovoltaic cells using a crystalline diindenoperylene film as a nanostructured template.

    PubMed

    Zhou, Ying; Taima, Tetsuya; Kuwabara, Takayuki; Takahashi, Kohshin

    2013-11-13

    A cascade-type small-molecule organic photovoltaic cell using a crystalline diindenoperylene film as a nanostructured template is demonstrated. This cell architecture simultaneously realizes organic nanostructure and cascade energy concepts, which significantly improves the photocurrent generation and fill factor, leading to a power conversion efficiency of 5.2±0.3%.

  13. Following the nanostructural molecular orientation guidelines for sulfur versus thiophene units in small molecule photovoltaic cells.

    PubMed

    Kim, Yu Jin; Park, Chan Eon

    2016-04-14

    In bulk heterojunction (BHJ) organic photovoltaics, particularly those using small molecules, electron donor and/or electron acceptor materials form a distributed network in the photoactive layer where critical photo-physical processes occur. Extensive research has recently focused on the importance of sulfur atoms in the small molecules. Little is known about the three-dimensional orientation of these sulfur atom-containing molecules. Herein, we report on our research concerning the heterojunction textures of the crystalline molecular orientation of small compounds having sulfur-containing units in the side chains, specifically, compounds known as DR3TSBDT that contain the alkylthio group and DR3TBDTT that does not. The improved performance of the DR3TBDTT-based devices, particularly in the photocurrent and the fill factor, was attributed to the large population of donor compound crystallites with a favorable face-on orientation along the perpendicular direction. This orientation resulted in efficient charge transport and a reduction in charge recombination. These findings underscore the great potential of small-molecule solar cells and suggest that even higher efficiencies can be achieved through materials development and molecular orientation control.

  14. Small-molecule suppressors of cytokine-induced beta-cell apoptosis

    PubMed Central

    Chou, Danny Hung-Chieh; Bodycombe, Nicole E.; Carrinski, Hyman A.; Lewis, Timothy A.; Clemons, Paul A.; Schreiber, Stuart L.; Wagner, Bridget K.

    2010-01-01

    Pancreatic beta-cell apoptosis is a critical event during the development of type-1 diabetes. The identification of small molecules capable of preventing cytokine-induced apoptosis could lead to avenues for therapeutic intervention. We developed a set of phenotypic cell-based assays designed to identify such small-molecule suppressors. Rat INS-1E cells were simultaneously treated with a cocktail of inflammatory cytokines and a collection of 2,240 diverse small molecules, and screened using an assay for cellular ATP levels. Forty-nine top-scoring compounds included glucocorticoids, several pyrazole derivatives, and known inhibitors of glycogen synthase kinase-3β. Two compounds were able to increase cellular ATP levels, reduce caspase-3 activity and nitrite production, and increase glucose-stimulated insulin secretion in the presence of cytokines. These results indicate that small molecules identified by this screening approach may protect beta cells from autoimmune attack, and may be good candidates for therapeutic intervention in early stages of type-1 diabetes. PMID:20550176

  15. High-resolution electrohydrodynamic jet printing of small-molecule organic light-emitting diodes

    NASA Astrophysics Data System (ADS)

    Kim, Kukjoo; Kim, Gyeomuk; Lee, Bo Ram; Ji, Sangyoon; Kim, So-Yun; An, Byeong Wan; Song, Myoung Hoon; Park, Jang-Ung

    2015-08-01

    The development of alternative organic light-emitting diode (OLED) fabrication technologies for high-definition and low-cost displays is an important research topic as conventional fine metal mask-assisted vacuum evaporation has reached its limit to reduce pixel sizes and manufacturing costs. Here, we report an electrohydrodynamic jet (e-jet) printing method to fabricate small-molecule OLED pixels with high resolution (pixel width of 5 μm), which significantly exceeds the resolutions of conventional inkjet or commercial OLED display pixels. In addition, we print small-molecule emitting materials which provide a significant advantage in terms of device efficiency and lifetime compared to those with polymers.The development of alternative organic light-emitting diode (OLED) fabrication technologies for high-definition and low-cost displays is an important research topic as conventional fine metal mask-assisted vacuum evaporation has reached its limit to reduce pixel sizes and manufacturing costs. Here, we report an electrohydrodynamic jet (e-jet) printing method to fabricate small-molecule OLED pixels with high resolution (pixel width of 5 μm), which significantly exceeds the resolutions of conventional inkjet or commercial OLED display pixels. In addition, we print small-molecule emitting materials which provide a significant advantage in terms of device efficiency and lifetime compared to those with polymers. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr03034j

  16. Selecting, Acquiring, and Using Small Molecule Libraries for High-Throughput Screening

    PubMed Central

    Dandapani, Sivaraman; Rosse, Gerard; Southall, Noel; Salvino, Joseph M.; Thomas, Craig J.

    2015-01-01

    The selection, acquisition and use of high quality small molecule libraries for screening is an essential aspect of drug discovery and chemical biology programs. Screening libraries continue to evolve as researchers gain a greater appreciation of the suitability of small molecules for specific biological targets, processes and environments. The decisions surrounding the make-up of any given small molecule library is informed by a multitude of variables and opinions vary on best-practices. The fitness of any collection relies upon upfront filtering to avoiding problematic compounds, assess appropriate physicochemical properties, install the ideal level of structural uniqueness and determine the desired extent of molecular complexity. These criteria are under constant evaluation and revision as academic and industrial organizations seek out collections that yield ever improving results from their screening portfolios. Practical questions including cost, compound management, screening sophistication and assay objective also play a significant role in the choice of library composition. This overview attempts to offer advice to all organizations engaged in small molecule screening based upon current best practices and theoretical considerations in library selection and acquisition. PMID:26705509

  17. A semantic web ontology for small molecules and their biological targets.

    PubMed

    Choi, Jooyoung; Davis, Melissa J; Newman, Andrew F; Ragan, Mark A

    2010-05-24

    A wide range of data on sequences, structures, pathways, and networks of genes and gene products is available for hypothesis testing and discovery in biological and biomedical research. However, data describing the physical, chemical, and biological properties of small molecules have not been well-integrated with these resources. Semantically rich representations of chemical data, combined with Semantic Web technologies, have the potential to enable the integration of small molecule and biomolecular data resources, expanding the scope and power of biomedical and pharmacological research. We employed the Semantic Web technologies Resource Description Framework (RDF) and Web Ontology Language (OWL) to generate a Small Molecule Ontology (SMO) that represents concepts and provides unique identifiers for biologically relevant properties of small molecules and their interactions with biomolecules, such as proteins. We instanced SMO using data from three public data sources, i.e., DrugBank, PubChem and UniProt, and converted to RDF triples. Evaluation of SMO by use of predetermined competency questions implemented as SPARQL queries demonstrated that data from chemical and biomolecular data sources were effectively represented and that useful knowledge can be extracted. These results illustrate the potential of Semantic Web technologies in chemical, biological, and pharmacological research and in drug discovery.

  18. Rhodanine dye-based small molecule acceptors for organic photovoltaic cells.

    PubMed

    Kim, Yujeong; Song, Chang Eun; Moon, Sang-Jin; Lim, Eunhee

    2014-08-01

    The solution-processable small molecules based on carbazole or fluorene containing rhodanine dyes at both ends were synthesized and introduced as acceptors in organic photovoltaic cells. The high energy levels of their lowest unoccupied molecular orbitals resulted in a power conversion efficiency of 3.08% and an open circuit voltage of up to 1.03 V.

  19. A blend of small molecules regulates both mating and development in Caenorhabditis elegans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In many organisms, population density sensing and sexual attraction rely on small molecule-based signaling systems. In the nematode Caenorhabditis elegans, population density is monitored via specific glycosides of the dideoxysugar ascarylose that promote entry into an alternate larval stage, the no...

  20. Design of a bioactive small molecule that targets r(AUUCU) repeats in spinocerebellar ataxia 10

    PubMed Central

    Yang, Wang-Yong; Gao, Rui; Southern, Mark; Sarkar, Partha S.; Disney, Matthew D.

    2016-01-01

    RNA is an important target for chemical probes of function and lead therapeutics; however, it is difficult to target with small molecules. One approach to tackle this problem is to identify compounds that target RNA structures and utilize them to multivalently target RNA. Here we show that small molecules can be identified to selectively bind RNA base pairs by probing a library of RNA-focused small molecules. A small molecule that selectively binds AU base pairs informed design of a dimeric compound (2AU-2) that targets the pathogenic RNA, expanded r(AUUCU) repeats, that causes spinocerebellar ataxia type 10 (SCA10) in patient-derived cells. Indeed, 2AU-2 (50 nM) ameliorates various aspects of SCA10 pathology including improvement of mitochondrial dysfunction, reduced activation of caspase 3, and reduction of nuclear foci. These studies provide a first-in-class chemical probe to study SCA10 RNA toxicity and potentially define broadly applicable compounds targeting RNA AU base pairs in cells. PMID:27248057