Coaxial needle insertion assistant with enhanced force feedback.
De Lorenzo, Danilo; Koseki, Yoshihiko; De Momi, Elena; Chinzei, Kiyoyuki; Okamura, Allison M
2013-02-01
Many medical procedures involving needle insertion into soft tissues, such as anesthesia, biopsy, brachytherapy, and placement of electrodes, are performed without image guidance. In such procedures, haptic detection of changing tissue properties at different depths during needle insertion is important for needle localization and detection of subsurface structures. However, changes in tissue mechanical properties deep inside the tissue are difficult for human operators to sense, because the relatively large friction force between the needle shaft and the surrounding tissue masks the smaller tip forces. A novel robotic coaxial needle insertion assistant, which enhances operator force perception, is presented. This one-degree-of-freedom cable-driven robot provides to the operator a scaled version of the force applied by the needle tip to the tissue, using a novel design and sensors that separate the needle tip force from the shaft friction force. The ability of human operators to use the robot to detect membranes embedded in artificial soft tissue was tested under the conditions of 1) tip force and shaft force feedback, and 2) tip force only feedback. The ratio of successful to unsuccessful membrane detections was significantly higher (up to 50%) when only the needle tip force was provided to the user.
Passman, Rod S; Rogers, John D; Sarkar, Shantanu; Reiland, Jerry; Reisfeld, Erin; Koehler, Jodi; Mittal, Suneet
2017-07-01
Undersensing of premature ventricular beats and low-amplitude R waves are primary causes for inappropriate bradycardia and pause detections in insertable cardiac monitors (ICMs). The purpose of this study was to develop and validate an enhanced algorithm to reduce inappropriately detected bradycardia and pause episodes. Independent data sets to develop and validate the enhanced algorithm were derived from a database of ICM-detected bradycardia and pause episodes in de-identified patients monitored for unexplained syncope. The original algorithm uses an auto-adjusting sensitivity threshold for R-wave sensing to detect tachycardia and avoid T-wave oversensing. In the enhanced algorithm, a second sensing threshold is used with a long blanking and fixed lower sensitivity threshold, looking for evidence of undersensed signals. Data reported includes percent change in appropriate and inappropriate bradycardia and pause detections as well as changes in episode detection sensitivity and positive predictive value with the enhanced algorithm. The validation data set, from 663 consecutive patients, consisted of 4904 (161 patients) bradycardia and 2582 (133 patients) pause episodes, of which 2976 (61%) and 996 (39%) were appropriately detected bradycardia and pause episodes. The enhanced algorithm reduced inappropriate bradycardia and pause episodes by 95% and 47%, respectively, with 1.7% and 0.6% reduction in appropriate episodes, respectively. The average episode positive predictive value improved by 62% (P < .001) for bradycardia detection and by 26% (P < .001) for pause detection, with an average relative sensitivity of 95% (P < .001) and 99% (P = .5), respectively. The enhanced dual sense algorithm for bradycardia and pause detection in ICMs substantially reduced inappropriate episode detection with a minimal reduction in true episode detection. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Varner, Erika L; Leong, Chi Leng; Jaquins-Gerstl, Andrea; Nesbitt, Kathryn M; Boutelle, Martyn G; Michael, Adrian C
2017-08-16
Microdialysis is well established in chemical neuroscience as a mainstay technology for real time intracranial chemical monitoring in both animal models and human patients. Evidence shows that microdialysis can be enhanced by mitigating the penetration injury caused during the insertion of microdialysis probes into brain tissue. Herein, we show that retrodialysis of dexamethasone in the rat cortex enhances the microdialysis detection of K + and glucose transients induced by spreading depolarization. Without dexamethasone, quantification of glucose transients was unreliable by 5 days after probe insertion. With dexamethasone, robust K + and glucose transients were readily quantified at 2 h, 5 days, and 10 days after probe insertion. The amplitudes of the K + transients declined day-to-day following probe insertion, and the amplitudes of the glucose transients exhibited a decreasing trend that did not reach statistical significance. Immunohistochemistry and fluorescence microscopy confirm that dexamethasone is highly effective at preserving a healthy probe-brain interface for at least 10 days even though retrodialysis of dexamethasone ceased after 5 days.
Sultan, Torky; Khedr, Ayman E; Sayed, Mostafa
2013-01-01
NONE DECLARED Defect tracking systems play an important role in the software development organizations as they can store historical information about defects. There are many research in defect tracking models and systems to enhance their capabilities to be more specifically tracking, and were adopted with new technology. Furthermore, there are different studies in classifying bugs in a step by step method to have clear perception and applicable method in detecting such bugs. This paper shows a new proposed defect tracking model for the purpose of classifying the inserted defects reports in a step by step method for more enhancement of the software quality.
Trace detection of analytes using portable raman systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alam, M. Kathleen; Hotchkiss, Peter J.; Martin, Laura E.
Apparatuses and methods for in situ detection of a trace amount of an analyte are disclosed herein. In a general embodiment, the present disclosure provides a surface-enhanced Raman spectroscopy (SERS) insert including a passageway therethrough, where the passageway has a SERS surface positioned therein. The SERS surface is configured to adsorb molecules of an analyte of interest. A concentrated sample is caused to flow over the SERS surface. The SERS insert is then provided to a portable Raman spectroscopy system, where it is analyzed for the analyte of interest.
Pürerfellner, Helmut; Sanders, Prashanthan; Sarkar, Shantanu; Reisfeld, Erin; Reiland, Jerry; Koehler, Jodi; Pokushalov, Evgeny; Urban, Luboš; Dekker, Lukas R C
2017-10-03
Intermittent change in p-wave discernibility during periods of ectopy and sinus arrhythmia is a cause of inappropriate atrial fibrillation (AF) detection in insertable cardiac monitors (ICM). To address this, we developed and validated an enhanced AF detection algorithm. Atrial fibrillation detection in Reveal LINQ ICM uses patterns of incoherence in RR intervals and absence of P-wave evidence over a 2-min period. The enhanced algorithm includes P-wave evidence during RR irregularity as evidence of sinus arrhythmia or ectopy to adaptively optimize sensitivity for AF detection. The algorithm was developed and validated using Holter data from the XPECT and LINQ Usability studies which collected surface electrocardiogram (ECG) and continuous ICM ECG over a 24-48 h period. The algorithm detections were compared with Holter annotations, performed by multiple reviewers, to compute episode and duration detection performance. The validation dataset comprised of 3187 h of valid Holter and LINQ recordings from 138 patients, with true AF in 37 patients yielding 108 true AF episodes ≥2-min and 449 h of AF. The enhanced algorithm reduced inappropriately detected episodes by 49% and duration by 66% with <1% loss in true episodes or duration. The algorithm correctly identified 98.9% of total AF duration and 99.8% of total sinus or non-AF rhythm duration. The algorithm detected 97.2% (99.7% per-patient average) of all AF episodes ≥2-min, and 84.9% (95.3% per-patient average) of detected episodes involved AF. An enhancement that adapts sensitivity for AF detection reduced inappropriately detected episodes and duration with minimal reduction in sensitivity. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Cardiology
Khedr, Ayman E.; Sayed, Mostafa
2013-01-01
CONFLICT OF INTEREST: NONE DECLARED Defect tracking systems play an important role in the software development organizations as they can store historical information about defects. There are many research in defect tracking models and systems to enhance their capabilities to be more specifically tracking, and were adopted with new technology. Furthermore, there are different studies in classifying bugs in a step by step method to have clear perception and applicable method in detecting such bugs. This paper shows a new proposed defect tracking model for the purpose of classifying the inserted defects reports in a step by step method for more enhancement of the software quality. PMID:24039334
NASA Astrophysics Data System (ADS)
Tang, Yubo; Carns, Jennifer; Polydorides, Alexandros D.; Anandasabapathy, Sharmila; Richards-Kortum, Rebecca R.
2016-08-01
A modular video endoscope is developed to enable both white light imaging (WLI) and vital-dye fluorescence imaging (VFI) in a single-endoscopic insertion for the early detection of cancer in Barrett's esophagus (BE). We demonstrate that VFI can be achieved in conjunction with white light endoscopy, where appropriate white balance is used to correct for the presence of the emission filter. In VFI mode, a contrast enhancement feature is implemented in real time to further highlight glandular patterns in BE and related malignancies without introducing artifacts. In a pilot study, we demonstrate accurate correlation of images in two widefield modalities, with representative images showing the disruption and effacement of glandular architecture associated with cancer development in BE. VFI images of these alterations exhibit enhanced contrast when compared to WLI. Results suggest that the usefulness of VFI in the detection of BE-related neoplasia should be further evaluated in future in vivo studies.
Design of a Tool Integrating Force Sensing With Automated Insertion in Cochlear Implantation
Schurzig, Daniel; Labadie, Robert F.; Hussong, Andreas; Rau, Thomas S.; Webster, Robert J.
2012-01-01
The quality of hearing restored to a deaf patient by a cochlear implant in hearing preservation cochlear implant surgery (and possibly also in routine cochlear implant surgery) is believed to depend on preserving delicate cochlear membranes while accurately inserting an electrode array deep into the spiral cochlea. Membrane rupture forces, and possibly, other indicators of suboptimal placement, are below the threshold detectable by human hands, motivating a force sensing insertion tool. Furthermore, recent studies have shown significant variability in manual insertion forces and velocities that may explain some instances of imperfect placement. Toward addressing this, an automated insertion tool was recently developed by Hussong et al. By following the same insertion tool concept, in this paper, we present mechanical enhancements that improve the surgeon’s interface with the device and make it smaller and lighter. We also present electomechanical design of new components enabling integrated force sensing. The tool is designed to be sufficiently compact and light that it can be mounted to a microstereotactic frame for accurate image-guided preinsertion positioning. The new integrated force sensing system is capable of resolving forces as small as 0.005 N, and we provide experimental illustration of using forces to detect errors in electrode insertion. PMID:23482414
Software-implemented fault insertion: An FTMP example
NASA Technical Reports Server (NTRS)
Czeck, Edward W.; Siewiorek, Daniel P.; Segall, Zary Z.
1987-01-01
This report presents a model for fault insertion through software; describes its implementation on a fault-tolerant computer, FTMP; presents a summary of fault detection, identification, and reconfiguration data collected with software-implemented fault insertion; and compares the results to hardware fault insertion data. Experimental results show detection time to be a function of time of insertion and system workload. For the fault detection time, there is no correlation between software-inserted faults and hardware-inserted faults; this is because hardware-inserted faults must manifest as errors before detection, whereas software-inserted faults immediately exercise the error detection mechanisms. In summary, the software-implemented fault insertion is able to be used as an evaluation technique for the fault-handling capabilities of a system in fault detection, identification and recovery. Although the software-inserted faults do not map directly to hardware-inserted faults, experiments show software-implemented fault insertion is capable of emulating hardware fault insertion, with greater ease and automation.
Automated synthesis, insertion and detection of polyps for CT colonography
NASA Astrophysics Data System (ADS)
Sezille, Nicolas; Sadleir, Robert J. T.; Whelan, Paul F.
2003-03-01
CT Colonography (CTC) is a new non-invasive colon imaging technique which has the potential to replace conventional colonoscopy for colorectal cancer screening. A novel system which facilitates automated detection of colorectal polyps at CTC is introduced. As exhaustive testing of such a system using real patient data is not feasible, more complete testing is achieved through synthesis of artificial polyps and insertion into real datasets. The polyp insertion is semi-automatic: candidate points are manually selected using a custom GUI, suitable points are determined automatically from an analysis of the local neighborhood surrounding each of the candidate points. Local density and orientation information are used to generate polyps based on an elliptical model. Anomalies are identified from the modified dataset by analyzing the axial images. Detected anomalies are classified as potential polyps or natural features using 3D morphological techniques. The final results are flagged for review. The system was evaluated using 15 scenarios. The sensitivity of the system was found to be 65% with 34% false positive detections. Automated diagnosis at CTC is possible and thorough testing is facilitated by augmenting real patient data with computer generated polyps. Ultimately, automated diagnosis will enhance standard CTC and increase performance.
Transposon mediated transgenesis in a marine invertebrate chordate: Ciona intestinalis
Sasakura, Yasunori; Oogai, Yuichi; Matsuoka, Terumi; Satoh, Nori; Awazu, Satoko
2007-01-01
Achievement of transposon mediated germline transgenesis in a basal chordate, Ciona intestinalis, is discussed. A Tc1/mariner superfamily transposon, Minos, has excision and transposition activities in Ciona. Minos enables the creation of stable transgenic lines, enhancer detection, and insertional mutagenesis. PMID:18047695
Automated detection of a prostate Ni-Ti stent in electronic portal images.
Carl, Jesper; Nielsen, Henning; Nielsen, Jane; Lund, Bente; Larsen, Erik Hoejkjaer
2006-12-01
Planning target volumes (PTV) in fractionated radiotherapy still have to be outlined with wide margins to the clinical target volume due to uncertainties arising from daily shift of the prostate position. A recently proposed new method of visualization of the prostate is based on insertion of a thermo-expandable Ni-Ti stent. The current study proposes a new detection algorithm for automated detection of the Ni-Ti stent in electronic portal images. The algorithm is based on the Ni-Ti stent having a cylindrical shape with a fixed diameter, which was used as the basis for an automated detection algorithm. The automated method uses enhancement of lines combined with a grayscale morphology operation that looks for enhanced pixels separated with a distance similar to the diameter of the stent. The images in this study are all from prostate cancer patients treated with radiotherapy in a previous study. Images of a stent inserted in a humanoid phantom demonstrated a localization accuracy of 0.4-0.7 mm which equals the pixel size in the image. The automated detection of the stent was compared to manual detection in 71 pairs of orthogonal images taken in nine patients. The algorithm was successful in 67 of 71 pairs of images. The method is fast, has a high success rate, good accuracy, and has a potential for unsupervised localization of the prostate before radiotherapy, which would enable automated repositioning before treatment and allow for the use of very tight PTV margins.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Yufei, E-mail: mayufei@hit.edu.cn; Post-doctoral Mobile Station of Power Engineering and Engineering Thermophysics, Harbin Institute of Technology, Harbin 150001; He, Ying
An ultra compact all-fiber quartz-enhanced photoacoustic spectroscopy (QEPAS) sensor using quartz tuning fork (QTF) with a low resonance frequency of 30.72 kHz was demonstrated. Such a sensor architecture has the advantages of easier optical alignment, lower insertion loss, lower cost, and more compact compared with a conventional QEPAS sensor using discrete optical components for laser delivery and coupling to the QTF. A fiber beam splitter and three QTFs were employed to perform multi-point detection and demonstrated the potential of spatially resolved measurements.
L1 Retrotransposon Heterogeneity in Ovarian Tumor Cell Evolution.
Nguyen, Thu H M; Carreira, Patricia E; Sanchez-Luque, Francisco J; Schauer, Stephanie N; Fagg, Allister C; Richardson, Sandra R; Davies, Claire M; Jesuadian, J Samuel; Kempen, Marie-Jeanne H C; Troskie, Robin-Lee; James, Cini; Beaven, Elizabeth A; Wallis, Tristan P; Coward, Jermaine I G; Chetty, Naven P; Crandon, Alexander J; Venter, Deon J; Armes, Jane E; Perrin, Lewis C; Hooper, John D; Ewing, Adam D; Upton, Kyle R; Faulkner, Geoffrey J
2018-06-26
LINE-1 (L1) retrotransposons are a source of insertional mutagenesis in tumor cells. However, the clinical significance of L1 mobilization during tumorigenesis remains unclear. Here, we applied retrotransposon capture sequencing (RC-seq) to multiple single-cell clones isolated from five ovarian cancer cell lines and HeLa cells and detected endogenous L1 retrotransposition in vitro. We then applied RC-seq to ovarian tumor and matched blood samples from 19 patients and identified 88 tumor-specific L1 insertions. In one tumor, an intronic de novo L1 insertion supplied a novel cis-enhancer to the putative chemoresistance gene STC1. Notably, the tumor subclone carrying the STC1 L1 mutation increased in prevalence after chemotherapy, further increasing STC1 expression. We also identified hypomethylated donor L1s responsible for new L1 insertions in tumors and cultivated cancer cells. These congruent in vitro and in vivo results highlight L1 insertional mutagenesis as a common component of ovarian tumorigenesis and cancer genome heterogeneity. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Ney, Michael; Abdulhalim, Ibrahim
2015-12-01
Mueller matrix imaging sensitivity, to delicate water content changes in tissue associated with early stages of skin cancer, is demonstrated by numerical modeling to be enhanced by localized surface plasmon resonance (LSPR) effects at the terahertz (THz) range when InN nanoparticles (NPs) coated with Parylene-C are introduced into the skin. A skin tissue model tailored for THz wavelengths is established for a Monte Carlo simulation of polarized light propagation and scattering, and a comparative study based on simulated Mueller matrices is presented considering different NPs' parameters and insertion into the skin methods. The insertion of NPs presenting LSPR in the THz is demonstrated to enable the application of polarization-based sample characterization techniques adopted from the scattering dominated visible wavelengths domain for the, otherwise, relatively low scattering THz domain, where such approach is irrelevant without the NPs. Through these Mueller polarimetry techniques, the detection of water content variations in the tissue is made possible and with high sensitivity. This study yields a limit of detection down to 0.0018% for relative changes in the water content based on linear degree of polarization-an improvement of an order of magnitude relative to the limit of detection without NPs calculated in a previous ellipsometric study.
Ney, Michael; Abdulhalim, Ibrahim
2015-01-01
Mueller matrix imaging sensitivity, to delicate water content changes in tissue associated with early stages of skin cancer, is demonstrated by numerical modeling to be enhanced by localized surface plasmon resonance (LSPR) effects at the terahertz (THz) range when InN nanoparticles (NPs) coated with Parylene-C are introduced into the skin. A skin tissue model tailored for THz wavelengths is established for a Monte Carlo simulation of polarized light propagation and scattering, and a comparative study based on simulated Mueller matrices is presented considering different NPs’ parameters and insertion into the skin methods. The insertion of NPs presenting LSPR in the THz is demonstrated to enable the application of polarization-based sample characterization techniques adopted from the scattering dominated visible wavelengths domain for the, otherwise, relatively low scattering THz domain, where such approach is irrelevant without the NPs. Through these Mueller polarimetry techniques, the detection of water content variations in the tissue is made possible and with high sensitivity. This study yields a limit of detection down to 0.0018% for relative changes in the water content based on linear degree of polarization--an improvement of an order of magnitude relative to the limit of detection without NPs calculated in a previous ellipsometric study.
Gain-assisted broadband ring cavity enhanced spectroscopy
NASA Astrophysics Data System (ADS)
Selim, Mahmoud A.; Adib, George A.; Sabry, Yasser M.; Khalil, Diaa
2017-02-01
Incoherent broadband cavity enhanced spectroscopy can significantly increase the effective path length of light-matter interaction to detect weak absorption lines over broad spectral range, for instance to detect gases in confined environments. Broadband cavity enhancement can be based on the decay time or the intensity drop technique. Decay time measurement is based on using tunable laser source that is expensive and suffers from long scan time. Intensity dependent measurement is usually reported based on broadband source using Fabry-Perot cavity, enabling short measurement time but suffers from the alignment tolerance of the cavity and the cavity insertion loss. In this work we overcome these challenges by using an alignment-free ring cavity made of an optical fiber loop and a directional coupler, while having a gain medium pumped below the lasing threshold to improve the finesse and reduce the insertion loss. Acetylene (C2H2) gas absorption is measured around 1535 nm wavelength using a semiconductor optical amplifier (SOA) gain medium. The system is analyzed for different ring resonator forward coupling coefficient and loses, including the 3-cm long gas cell insertion loss and fiber connector losses used in the experimental verification. The experimental results are obtained for a coupler ratio of 90/10 and a fiber length of 4 m. The broadband source is the amplified spontaneous emission of another SOA and the output is measured using a 70pm-resolution optical spectrum analyzer. The absorption depth and the effective interaction length are improved about an order of magnitude compared to the direct absorption of the gas cell. The presented technique provides an engineering method to improve the finesse and, consequently the effective length, while relaxing the technological constraints on the high reflectivity mirrors and free-space cavity alignment.
Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd
2017-01-01
SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
Spectrotemporal processing drives fast access to memory traces for spoken words.
Tavano, A; Grimm, S; Costa-Faidella, J; Slabu, L; Schröger, E; Escera, C
2012-05-01
The Mismatch Negativity (MMN) component of the event-related potentials is generated when a detectable spectrotemporal feature of the incoming sound does not match the sensory model set up by preceding repeated stimuli. MMN is enhanced at frontocentral scalp sites for deviant words when compared to acoustically similar deviant pseudowords, suggesting that automatic access to long-term memory traces for spoken words contributes to MMN generation. Does spectrotemporal feature matching also drive automatic lexical access? To test this, we recorded human auditory event-related potentials (ERPs) to disyllabic spoken words and pseudowords within a passive oddball paradigm. We first aimed at replicating the word-related MMN enhancement effect for Spanish, thereby adding to the available cross-linguistic evidence (e.g., Finnish, English). We then probed its resilience to spectrotemporal perturbation by inserting short (20 ms) and long (120 ms) silent gaps between first and second syllables of deviant and standard stimuli. A significantly enhanced, frontocentrally distributed MMN to deviant words was found for stimuli with no gap. The long gap yielded no deviant word MMN, showing that prior expectations of word form limits in a given language influence deviance detection processes. Crucially, the insertion of a short gap suppressed deviant word MMN enhancement at frontocentral sites. We propose that spectrotemporal point-wise matching constitutes a core mechanism for fast serial computations in audition and language, bridging sensory and long-term memory systems. Copyright © 2012 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Rauh, R. David (Inventor)
1990-01-01
A sensor for detecting a chemical substance includes an insertion element having a structure which enables insertion of the chemical substance with a resulting change in the bulk electrical characteristics of the insertion element under conditions sufficient to permit effective insertion; the change in the bulk electrical characteristics of the insertion element is detected as an indication of the presence of the chemical substance.
USDA-ARS?s Scientific Manuscript database
Shiga toxin producing Escherichia coli (STEC) represent a continuing threat to the Nation’s food supply and public health. Shiga toxin genes (stx) are encoded in lambda-like bacteriophages whose genome is inserted into the bacterial DNA. Environmental stress can trigger bacteriophage replication a...
Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R
2014-07-01
Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.
NASA Astrophysics Data System (ADS)
Bismuth, Vincent; Vancamberg, Laurence; Gorges, Sébastien
2009-02-01
During interventional radiology procedures, guide-wires are usually inserted into the patients vascular tree for diagnosis or healing purpose. These procedures are monitored with an Xray interventional system providing images of the interventional devices navigating through the patient's body. The automatic detection of such tools by image processing means has gained maturity over the past years and enables applications ranging from image enhancement to multimodal image fusion. Sophisticated detection methods are emerging, which rely on a variety of device enhancement techniques. In this article we reviewed and classified these techniques into three families. We chose a state of the art approach in each of them and built a rigorous framework to compare their detection capability and their computational complexity. Through simulations and the intensive use of ROC curves we demonstrated that the Hessian based methods are the most robust to strong curvature of the devices and that the family of rotated filters technique is the most suited for detecting low CNR and low curvature devices. The steerable filter approach demonstrated less interesting detection capabilities and appears to be the most expensive one to compute. Finally we demonstrated the interest of automatic guide-wire detection on a clinical topic: the compensation of respiratory motion in multimodal image fusion.
The association between cecal insertion time and colorectal neoplasm detection
2013-01-01
Background Information on the impact of cecal insertion time on colorectal neoplasm detection is limited. Our objective was to determine the association between cecal insertion time and colorectal neoplasm detection rate in colonoscopy screening. Methods We performed a cross-sectional study of 12,679 consecutive subjects aged 40–79 years undergoing screening colonoscopy in routine health check-ups at the Center for Health Promotion of the Samsung Medical Center from December 2007 to June 2009. Fixed effects logistic regression conditioning on colonoscopist was used to eliminate confounding due to differences in technical ability and other characteristics across colonoscopists. Results The mean cecal insertion time was 5.9 (SD, 4.4 minutes). We identified 4,249 (33.5%) participants with colorectal neoplasms, of whom 1,956 had small single adenomas (<5 mm), 595 had medium single adenomas (5–9 mm), and 1,699 had multiple adenomas or advanced colorectal neoplasms. The overall rates of colorectal neoplasm detection by quartiles of cecal insertion time were 36.8%, 33.4%, 32.7%, and 31.0%, respectively (p trend <0.001).The odds for small single colorectal adenoma detection was 16% lower (adjusted OR 0.84; 95% CI 0.71 to 0.99) in the fourth compared to the first quartile of insertion time (p trend 0.005). Insertion time was not associated with the detection rate of single adenomas ≥5 mm, multiple adenomas or advanced colorectal neoplasms. Conclusion Shorter insertion times were associated with increased rates of detection of small colorectal adenomas <5 mm. Cecal insertion time may be clinically relevant as missed small colorectal adenomas may progress to more advanced lesions. PMID:23915303
Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan
2008-01-01
Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541
NASA Astrophysics Data System (ADS)
Verma, Aditya; Kumar, Manoj; Patil, Anil Kumar
2018-04-01
The application of compact heat exchangers in any thermal system improves overall performance with a considerable reduction in size and weight. Inserts of different geometrical features have been used as turbulence promoting devices to increase the heat transfer rates. The present study deals with the experimental investigation of heat transfer and fluid flow characteristics of a tubular heat exchanger fitted with modified helical coiled inserts. Experiments have been carried out for a smooth tube without insert, tube fitted with helical coiled inserts, and modified helical coiled inserts. The helical coiled inserts are tested by varying the pitch ratio and wire diameter ratio from 0.5-1.5, and 0.063-0.125, respectively for the Reynolds number range of 1400 to 11,000. Experimental data have also been collected for the modified helical coiled inserts with gradually increasing pitch (GIP) and gradually decreasing pitch (GDP) configurations. The Nusselt number and friction factor values for helical coiled inserts are enhanced in the range of 1.42-2.62, 3.4-27.4, relative to smooth tube, respectively. The modified helical coiled insert showed enhancements in Nusselt number and friction factor values in the range of 1.49-3.14, 11.2-19.9, relative to smooth tube, respectively. The helical coiled and modified helical coiled inserts have thermo-hydraulic performance factor in the range of 0.59-1.29, 0.6-1.39, respectively. The empirical correlations of Nusselt number and friction factor for helical coiled inserts are proposed.
Zhu, Sha; Zhang, Xiaoli; Cui, Jingcheng; Shi, Yu-E; Jiang, Xiaohong; Liu, Zhen; Zhan, Jinhua
2015-04-21
Perchlorate, which causes health concerns because of its effects on the thyroid function, is highly soluble and mobile in the environment. In this study, diethyldithiocarbamate (DDTC)-modified silver nanoplates were fabricated on a copper wire to perform the on-site microextraction and detection of perchlorate. This fiber could be inserted into water or soil to extract perchlorate through electrostatic interaction and then can be detected by a portable Raman spectrometer, owing to its surface-enhanced Raman (SERS) activity. A relatively stable vibrational mode (δ(HCH)(CH3), (CH2)) of DDTC at 1273 cm(-1) was used as an internal standard, which was negligibly influenced by the absorption of ClO4(-). The DDTC-modified Ag/Cu fiber showed high uniformity, good reusability and temporal stability under continuous laser radiation each with an RSD lower than 10%. The qualitative and quantitative detection of perchlorate were also realized. A log-log plot of the normalized SERS intensity against perchlorate concentration showed a good linear relationship. The fiber could be also directly inserted into the perchlorate-polluted soil, and the perchlorate could thereby be detected on site. The detection limit in soil reached 0.081 ppm, which was much lower than the EPA-published safety standard. The recovery of the detection was 105% and comparable with the ion chromatography. This hyphenated method of microextraction with direct SERS detection may find potential application for direct pollutant detection free from complex sample pretreatment.
Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth
2016-04-16
Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p<0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434 (inlB), lmo0263 (inlH), lmo0543, lmo0057 (EsaA), lmo2563, lmo0453), caused enhanced biofilm formation in the bacterium at 15 °C. The remaining mutants harbored interruptions in 10 genetic loci previously associated with biofilm formation at higher temperatures, indicating some temperature driven differences in the formation of biofilm by L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
Enhancement of surface definition and gridding in the EAGLE code
NASA Technical Reports Server (NTRS)
Thompson, Joe F.
1991-01-01
Algorithms for smoothing of curves and surfaces for the EAGLE grid generation program are presented. The method uses an existing automated technique which detects undesirable geometric characteristics by using a local fairness criterion. The geometry entity is then smoothed by repeated removal and insertion of spline knots in the vicinity of the geometric irregularity. The smoothing algorithm is formulated for use with curves in Beta spline form and tensor product B-spline surfaces.
Etgen, Thorleif; Hochreiter, Manfred; Mundel, Markus; Freudenberger, Thomas
2013-07-01
Atrial fibrillation (AF) is the most frequent risk factor in ischemic stroke but often remains undetected. We analyzed the value of insertable cardiac event recorder in detection of AF in a 1-year cohort of patients with cryptogenic ischemic stroke. All patients with cryptogenic stroke and eligibility for oral anticoagulation were offered the insertion of a cardiac event recorder. Regular follow-up for 1 year recorded the incidence of AF. Of the 393 patients with ischemic stroke, 65 (16.5%) had a cryptogenic stroke, and in 22 eligible patients, an event recorder was inserted. After 1 year, in 6 of 22 patients (27.3%), AF was detected. These preliminary data show that insertion of cardiac event recorder was eligible in approximately one third of patients with cryptogenic stroke and detected in approximately one quarter of these patients new AF.
NASA Astrophysics Data System (ADS)
Sato, Shoichi; Nakane, Ryosho; Hada, Takato; Tanaka, Masaaki
2017-12-01
We demonstrate that the spin injection/extraction efficiency is enhanced by an ultrathin Mg insertion layer (⩽2 nm) in Fe /Mg /MgO /n+-Si tunnel junctions. In diode-type vertical three-terminal devices fabricated on a Si substrate, we observe the narrower three-terminal Hanle (N-3TH) signals indicating true spin injection into Si and estimate the spin polarization in Si to be 16% when the thickness of the Mg insertion layer is 1 nm, whereas no N-3TH signal is observed without the Mg insertion. This means that the spin injection/extraction efficiency is enhanced by suppressing the formation of a magnetically dead layer at the Fe/MgO interface. We also observe clear spin transport signals, such as nonlocal Hanle signals and spin-valve signals, in a lateral four-terminal device with the same Fe /Mg /MgO /n+-Si tunnel junctions fabricated on a Si-on-insulator substrate. It is found that both the intensity and linewidth of the spin signals are affected by the geometrical effects (device geometry and size). We have derived analytical functions taking into account the device structures, including channel thickness and electrode size, and estimated important parameters: spin lifetime and spin polarization. Our analytical functions explain the experimental results very well. Our study shows the importance of suppressing a magnetically dead layer and provides a unified understanding of spin injection/detection signals in different device geometries.
Svečko, Rajko; Kusić, Dragan; Kek, Tomaž; Sarjaš, Andrej; Hančič, Aleš; Grum, Janez
2013-05-14
This paper presents an improved monitoring system for the failure detection of engraving tool steel inserts during the injection molding cycle. This system uses acoustic emission PZT sensors mounted through acoustic waveguides on the engraving insert. We were thus able to clearly distinguish the defect through measured AE signals. Two engraving tool steel inserts were tested during the production of standard test specimens, each under the same processing conditions. By closely comparing the captured AE signals on both engraving inserts during the filling and packing stages, we were able to detect the presence of macro-cracks on one engraving insert. Gabor wavelet analysis was used for closer examination of the captured AE signals' peak amplitudes during the filling and packing stages. The obtained results revealed that such a system could be used successfully as an improved tool for monitoring the integrity of an injection molding process.
Svečko, Rajko; Kusić, Dragan; Kek, Tomaž; Sarjaš, Andrej; Hančič, Aleš; Grum, Janez
2013-01-01
This paper presents an improved monitoring system for the failure detection of engraving tool steel inserts during the injection molding cycle. This system uses acoustic emission PZT sensors mounted through acoustic waveguides on the engraving insert. We were thus able to clearly distinguish the defect through measured AE signals. Two engraving tool steel inserts were tested during the production of standard test specimens, each under the same processing conditions. By closely comparing the captured AE signals on both engraving inserts during the filling and packing stages, we were able to detect the presence of macro-cracks on one engraving insert. Gabor wavelet analysis was used for closer examination of the captured AE signals' peak amplitudes during the filling and packing stages. The obtained results revealed that such a system could be used successfully as an improved tool for monitoring the integrity of an injection molding process. PMID:23673677
Cholesterol blocks spontaneous insertion of membrane proteins into liposomes of phosphatidylcholine.
Nakamura, Shota; Suzuki, Sonomi; Saito, Hiroaki; Nishiyama, Ken-Ichi
2018-04-01
Spontaneous insertion of membrane proteins into liposomes formed from Escherichia coli polar phospholipids is blocked by diacylglycerol (DAG) at a physiological level. We found that cholesterol also blocks this spontaneous insertion, although a much larger amount is necessary for sufficient blockage. Reversely, sphingomyelin enhanced the spontaneous insertion. DAG at a physiological level was found not to block spontaneous insertion into liposomes formed from phosphatidylcholine (PC), while non-physiologically high concentrations of DAG reduced it. On the other hand, cholesterol blocked the spontaneous insertion into PC liposomes at a physiological level, explaining that both PC and cholesterol are absent in E. coli. While sphingomyelin did not enhance spontaneous insertion into PC liposomes, the effect of cholesterol on blockage of spontaneous insertion was dominant over that of sphingomyelin, suggesting that cholesterol functions as a blocker of disordered spontaneous insertion in eukaryotic cells. Lower amount of cholesterol was necessary to block spontaneous insertion into ER-mimic liposomes, explaining that ER membranes contain less amount of cholesterol. These results also explain that cholesterol, but not DAG, is involved in blockage of spontaneous insertion in eukaryotic cells, since DAG plays an important role as a second messenger in signal transduction.
Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G
2011-04-01
Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.
Noise-Enhanced Human Balance Control
NASA Astrophysics Data System (ADS)
Priplata, Attila; Niemi, James; Salen, Martin; Harry, Jason; Lipsitz, Lewis A.; Collins, J. J.
2002-11-01
Noise can enhance the detection and transmission of weak signals in certain nonlinear systems, via a mechanism known as stochastic resonance. Here we show that input noise can be used to improve motor control in humans. Specifically, we show that the postural sway of both young and elderly individuals during quiet standing can be significantly reduced by applying subsensory mechanical noise to the feet. We further demonstrate with input noise a trend towards the reduction of postural sway in elderly subjects to the level of young subjects. These results suggest that noise-based devices, such as randomly vibrating shoe inserts, may enable people to overcome functional difficulties due to age-related sensory loss.
Hefny, Ashraf F; Kunhivalappil, Fathima T; Matev, Nikolay; Avila, Norman A; Bashir, Masoud O; Abu-Zidan, Fikri M
2018-01-01
INTRODUCTION Diagnoses of pneumothorax, especially occult pneumothorax, have increased as the use of computed tomography (CT) for imaging trauma patients becomes near-routine. However, the need for chest tube insertion remains controversial. We aimed to study the management of pneumothorax detected on CT among patients with blunt trauma, including the decision for tube thoracostomy, in a community-based hospital. METHODS Chest CT scans of patients with blunt trauma treated at Al Rahba Hospital, Abu Dhabi, United Arab Emirates, from October 2010 to October 2014 were retrospectively studied. Variables studied included demography, mechanism of injury, endotracheal intubation, pneumothorax volume, chest tube insertion, Injury Severity Score, hospital length of stay and mortality. RESULTS CT was performed in 703 patients with blunt trauma. Overall, pneumothorax was detected on CT for 74 (10.5%) patients. Among the 65 patients for whom pneumothorax was detected before chest tube insertion, 25 (38.5%) needed chest tube insertion, while 40 (61.5%) did not. Backward stepwise likelihood regression showed that independent factors that significantly predicted chest tube insertion were endotracheal intubation (p = 0.01), non-United Arab Emirates nationality (p = 0.01) and pneumothorax volume (p = 0.03). The receiver operating characteristic curve showed that the best pneumothorax volume that predicted chest tube insertion was 30 mL. CONCLUSION Chest tube was inserted in less than half of the patients with blunt trauma for whom pneumothorax was detected on CT. Pneumothorax volume should be considered in decision-making regarding chest tube insertion. Conservative treatment may be sufficient for pneumothorax of volume < 30 mL. PMID:28741012
Hefny, Ashraf F; Kunhivalappil, Fathima T; Matev, Nikolay; Avila, Norman A; Bashir, Masoud O; Abu-Zidan, Fikri M
2018-03-01
Diagnoses of pneumothorax, especially occult pneumothorax, have increased as the use of computed tomography (CT) for imaging trauma patients becomes near-routine. However, the need for chest tube insertion remains controversial. We aimed to study the management of pneumothorax detected on CT among patients with blunt trauma, including the decision for tube thoracostomy, in a community-based hospital. Chest CT scans of patients with blunt trauma treated at Al Rahba Hospital, Abu Dhabi, United Arab Emirates, from October 2010 to October 2014 were retrospectively studied. Variables studied included demography, mechanism of injury, endotracheal intubation, pneumothorax volume, chest tube insertion, Injury Severity Score, hospital length of stay and mortality. CT was performed in 703 patients with blunt trauma. Overall, pneumothorax was detected on CT for 74 (10.5%) patients. Among the 65 patients for whom pneumothorax was detected before chest tube insertion, 25 (38.5%) needed chest tube insertion, while 40 (61.5%) did not. Backward stepwise likelihood regression showed that independent factors that significantly predicted chest tube insertion were endotracheal intubation (p = 0.01), non-United Arab Emirates nationality (p = 0.01) and pneumothorax volume (p = 0.03). The receiver operating characteristic curve showed that the best pneumothorax volume that predicted chest tube insertion was 30 mL. Chest tube was inserted in less than half of the patients with blunt trauma for whom pneumothorax was detected on CT. Pneumothorax volume should be considered in decision-making regarding chest tube insertion. Conservative treatment may be sufficient for pneumothorax of volume < 30 mL. Copyright: © Singapore Medical Association.
Gene and enhancer trap tagging of vascular-expressed genes in poplar trees
Andrew Groover; Joseph R. Fontana; Gayle Dupper; Caiping Ma; Robert Martienssen; Steven Strauss; Richard Meilan
2004-01-01
We report a gene discovery system for poplar trees based on gene and enhancer traps. Gene and enhancer trap vectors carrying the β-glucuronidase (GUS) reporter gene were inserted into the poplar genome via Agrobacterium tumefaciens transformation, where they reveal the expression pattern of genes at or near the insertion sites. Because GUS...
NASA Astrophysics Data System (ADS)
Peng, Nan; Huang, Feng; Chu, Sheng; Chen, Hao
2016-12-01
The solar-blind-ultraviolet (SBUV) detection industry demands high sensitivity as well as easy processability for its semiconductor devices. Photoconductive detectors have the simplest structure. However, the electrodes covering the illuminated side cause optical shielding losses, resulting in a relatively low sensitivity of such devices. Through finite-difference time-domain (FDTD) simulation, we demonstrated that surface-plasmon-based enhanced SBUV transmission is achievable for Al interdigital electrodes (IDEs) with a period ⩽200 nm and an interval ⩾140 nm. Under this parameter setting, a larger interval and smaller period leads to further enhancement of SBUV transmission. Particularly, we have found that different possible dielectric environments, such as Ni insertion, Al oxidization, and MgF2 anti-oxidation, would not exert fatal effects on this enhancement. Besides, such an enhancement is maintained under the angle of incidence within 10°, which is large enough for practical SBUV detection. Our research reveals the feasibility of high sensitivity by a simple photoconductive device, showing profound significance for an applicable SBUV detector.
Elastic all-optical multi-hop interconnection in data centers with adaptive spectrum allocation
NASA Astrophysics Data System (ADS)
Hong, Yuanyuan; Hong, Xuezhi; Chen, Jiajia; He, Sailing
2017-01-01
In this paper, a novel flex-grid all-optical interconnect scheme that supports transparent multi-hop connections in data centers is proposed. An inter-rack all-optical multi-hop connection is realized with an optical loop employed at flex-grid wavelength selective switches (WSSs) in an intermediate rack rather than by relaying through optical-electric-optical (O-E-O) conversions. Compared with the conventional O-E-O based approach, the proposed all-optical scheme is able to off-load the traffic at intermediate racks, leading to a reduction of the power consumption and cost. The transmission performance of the proposed flex-grid multi-hop all-optical interconnect scheme with various modulation formats, including both coherently detected and directly detected approaches, are investigated by Monte-Carlo simulations. To enhance the spectrum efficiency (SE), number-of-hop adaptive bandwidth allocation is introduced. Numerical results show that the SE can be improved by up to 33.3% at 40 Gbps, and by up to 25% at 100 Gbps. The impact of parameters, such as targeted bit error rate (BER) level and insertion loss of components, on the transmission performance of the proposed approach are also explored. The results show that the maximum SE improvement of the adaptive approach over the non-adaptive one is enhanced with the decrease of the targeted BER levels and the component insertion loss.
Penile Lengthening, Girth, and Size Preservation at the Time of Penile Prosthesis Insertion.
Tran, Henry; Goldfarb, Robert; Ackerman, Anika; Valenzuela, Robert J
2017-07-01
Penile prosthetic devices are the gold standard treatment of medication-refractory erectile dysfunction. Inflatable penile prosthetic (IPP) devices have been available and used for more than four decades. Oftentimes, medical conditions causing erectile dysfunction also cause penile shortening, causing decreased patient quality of life. To identify and review all available penile lengthening procedures that can be performed at time of IPP insertion. An extensive, systematic literature review was performed using PubMed searching for key terms penile lengthening, inflatable penile prosthesis, penile girth, corporoplasty, glans augmentation, and penile enhancement; all articles with subjective and/or objective penile length outcomes were reviewed. A review of various techniques for penile length and girth preservation and enhancement during penile prosthesis insertion. Several advanced and novel techniques were found for penile length preservation and enhancement at time of IPP insertion, including the sub-coronal IPP insertion technique, and adjuvant maneuvers during insertion, such as the sliding technique, modified sliding technique, multiple slice technique, and circumferential incision and grafting. Other adjuvant techniques that can enhance perception of increased length include ventral phalloplasty, suprapubic lipectomy, and suspensory ligament release. Further enhancement can be obtained using augmentation corporoplasty and glans augmentation with hyaluronic acid and other fillers. The different techniques vary in complexity and could require specialized training and experience. Maximum length gain appears to be limited by the length of the neurovascular bundles. Overall, surgical penile lengthening procedures at time of IPP insertion appear safe and effective for treatment of patients with penile shortening and severe erectile dysfunction. These therapies can significantly improve patient self-esteem and quality of life in properly selected patients. Tran H, Goldfarb R, Ackerman A, Valenxuela RJ. Penile Lengthening, Girth and Size Preservation at the Time of Penile Prosthesis Insertion. Sex Med Rev 2017;5:403-412. Copyright © 2017 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.
Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio
2017-03-01
Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.
van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T
2012-07-01
Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Dmitriyeva, Olga; Hamm, Steven C.; Knies, David L.; Cantwell, Richard; McConnell, Matt
2018-05-01
Our previous work experimentally demonstrated the enhancement of electrochemical hydrogen insertion into palladium by modifying the chemical composition of the cathode surface with Pb, Pt and Bi, referred to as surface promoters. The experiment demonstrated that an optimal combination of the surface promoters led to an increase in hydrogen fugacity of more than three orders of magnitude, while maintaining the same current density. This manuscript discusses the application of Density Functional Theory (DFT) to elucidate the thermodynamics and kinetics of observed enhancement of electrochemical hydrogen insertion into palladium. We present theoretical simulations that: (1) establish the elevation of hydrogen's chemical potential on Pb and Bi surfaces to enhance hydrogen insertion, (2) confirm the increase of a Tafel activation barrier that results in a decrease of the reaction rate at the given hydrogen overpotential, and (3) explain why the surface promoter's coverage needs to be non-uniform, namely to allow hydrogen insertion into palladium bulk while simultaneously locking hydrogen below the surface (the corking effect). The discussed DFT-based method can be used for efficient scanning of different material configurations to design a highly effective hydrogen storage system.
Zeng, Xianchun; Barbic, Mladen; Chen, Liangliang; Qian, Chunqi
2017-11-01
To improve the imaging quality of vessel walls with an endoesophageal Wireless Amplified NMR Detector (WAND). A cylindrically shaped double-frequency resonator has been constructed with a single metal wire that is self-connected by a pair of nonlinear capacitors. The double-frequency resonator can convert wirelessly provided pumping power into amplified MR signals. This compact design makes the detector easily insertable into a rodent esophagus. The detector has good longitudinal and axial symmetry. Compared to an external surface coil, the WAND can enhance detection sensitivity by at least 5 times, even when the distance separation between the region of interest and the detector's cylindrical surface is twice the detector's own radius. Such detection capability enables us to observe vessel walls near the aortic arch and carotid bifurcation with elevated sensitivity. A cylindrical MRI detector integrated with a wireless-powered amplifier has been developed as an endoesophageal detector to enhance detection sensitivity of vessel walls. This detector can greatly improve the imaging quality for vessel regions that are susceptible to atherosclerotic lesions. Magn Reson Med 78:2048-2054, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.
Chan Chung, Kim C.; Zamble, Deborah B.
2011-01-01
Nickel delivery during maturation of Escherichia coli [NiFe] hydrogenase 3 includes the accessory proteins HypA, HypB, and SlyD. Although the isolated proteins have been characterized, little is known about how they interact with each other and the hydrogenase 3 large subunit, HycE. In this study the complexes of HypA and HycE were investigated after modification with the Strep-tag II. Multiprotein complexes containing HypA, HypB, SlyD, and HycE were observed, consistent with the assembly of a single nickel insertion cluster. An interaction between HypA and HycE did not require the other nickel insertion proteins, but HypB was not found with the large subunit in the absence of HypA. The HypA-HycE complex was not detected in the absence of the HypC or HypD proteins, involved in the preceding iron insertion step, and this interaction is enhanced by nickel brought into the cell by the NikABCDE membrane transporter. Furthermore, without the hydrogenase 1, 2, and 3 large subunits, complexes between HypA, HypB, and SlyD were observed. These results support the hypothesis that HypA acts as a scaffold for assembly of the nickel insertion proteins with the hydrogenase precursor protein after delivery of the iron center. At different stages of the hydrogenase maturation process, HypA was observed at or near the cell membrane by using fluorescence confocal microscopy, as was HycE, suggesting membrane localization of the nickel insertion event. PMID:22016389
Burkowitz, Jörg; Merzenich, Carina; Grassme, Kathrin; Brüggenjürgen, Bernd
2016-08-01
Insertable or implantable cardiac monitors (ICMs) continuously monitor the heart rhythm and record irregularities over 3 years, enabling the diagnosis of infrequent rhythm abnormalities associated with syncope and stroke. The enhanced recognition capabilities of recent ICM models are able to accurately detect atrial fibrillation (AF) and have led to new applications of ICMs for the detection and monitoring of AF. Based on a systematic literature search, two indications were identified for ICMs for which considerable evidence, including randomized studies, exists: diagnosing the underlying cardiac cause of unexplained recurrent syncope and detecting AF in patients after cryptogenic stroke (CS). Three randomized controlled trials (RCTs) were identified that compared the effectiveness of ICMs in diagnosing patients with unexplained syncope (n = 556) to standard of care. A meta-analysis was conducted in order to generate an overall effect size and confidence interval of the diagnostic yield of ICMs versus conventional monitoring. In the indication CS, one RCT and five observational studies were included in order to assess the performance of ICMs in diagnosing patients with AF (n = 1129). Based on these studies, there is strong evidence that ICMs provide a higher diagnostic yield for detecting arrhythmias in patients with unexplained syncope and for detection of AF in patients after CS compared to conventional monitoring. Prolonged monitoring with ICMs is an effective tool for diagnosing the underlying cardiac cause of unexplained syncope and for detecting AF in patients with CS. In all RCTs, ICMs have a superior diagnostic yield compared to conventional monitoring. © The European Society of Cardiology 2016.
Yoo, Joanne Y; Cai, Jenny; Chen, Antonia F; Austin, Matthew S; Sharkey, Peter F
2016-05-01
Some manufacturers have introduced polyethylene (PE) inserts in 1-mm increment thickness options to allow for finer adjustments in total knee arthroplasty kinematics. Two surgeons with extensive experience performed 88 total knee arthroplasties using implants with 1-mm PE inserts. After trial components were inserted and the optimal PE thickness was selected, the insert was removed and a trial insert size was randomly chosen from opaque envelopes (1-mm smaller, same size, and 1-mm larger). The knee was re-examined and the surgeon determined which size PE had been placed. Surgeons reliably determined insert thicknesses in 62.5% (55 of 88; P = .050) of trials. Surgeons were not able to accurately detect 1-mm incremental changes of trial PE implants on a consistent basis. The potential clinical usefulness of this concept should be further evaluated. Copyright © 2016 Elsevier Inc. All rights reserved.
Gallus, Susanne; Janke, Axel
2017-01-01
Abstract Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. PMID:28985298
Direct detection of RNAs in living cells using peptide-inserted Renilla luciferase.
Andou, Takashi; Endoh, Tamaki; Mie, Masayasu; Kobatake, Eiry
2011-06-21
In this study, non-engineered RNAs were detected in living cells using bioluminescence. Two types of probe were utilized: a peptide inserted RLuc (PI-RLuc) probe and a split-RNA probe. Incorporation of the PI-RLuc and split-RNA probes enabled the direct detection of RNA introduced into living cells.
Otsuka, Sachio; Saiki, Jun
2016-02-01
Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.
Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J
2016-01-01
Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.
Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A
2017-10-01
Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stromberg, Loreen R.; Hengartner, Nicolas W.; Swingle, Kirstie L.
Shiga toxin-producing Escherichia coli is an important cause of foodborne illness, with cases attributable to beef, fresh produce and other sources. Many serotypes of the pathogen cause disease, and differentiating one serotype from another requires specific identification of the O antigen located on the lipopolysaccharide (LPS) molecule. The amphiphilic structure of LPS poses a challenge when using classical detection methods, which do not take into account its lipoglycan biochemistry. Typically, detection of LPS requires heat or chemical treatment of samples and relies on bioactivity assays for the conserved lipid A portion of the molecule. Our goal was to develop assaysmore » to facilitate the direct and discriminative detection of the entire LPS molecule and its O antigen in complex matrices using minimal sample processing. To perform serogroup identification of LPS, we used a method called membrane insertion on a waveguide biosensor, and tested three serogroups of LPS. The membrane insertion technique allows for the hydrophobic association of LPS with a lipid bilayer, where the exposed O antigen can be targeted for specific detection. Samples of beef lysate were spiked with LPS to perform O antigen specific detection of LPS from E. coli O157. To validate assay performance, we evaluated the biophysical interactions of LPS with lipid bilayers both in- and outside of a flow cell using fluorescence microscopy and fluorescently doped lipids. Our results indicate that membrane insertion allows for the qualitative and reliable identification of amphiphilic LPS in complex samples like beef homogenates. In addition, we also demonstrated that LPS-induced hole formation does not occur under the conditions of the membrane insertion assays. Together, these findings describe for the first time the serogroup-specific detection of amphiphilic LPS in complex samples using a membrane insertion assay, and highlight the importance of LPS molecular conformations in detection architectures.« less
Stromberg, Loreen R.; Hengartner, Nicolas W.; Swingle, Kirstie L.; ...
2016-05-26
Shiga toxin-producing Escherichia coli is an important cause of foodborne illness, with cases attributable to beef, fresh produce and other sources. Many serotypes of the pathogen cause disease, and differentiating one serotype from another requires specific identification of the O antigen located on the lipopolysaccharide (LPS) molecule. The amphiphilic structure of LPS poses a challenge when using classical detection methods, which do not take into account its lipoglycan biochemistry. Typically, detection of LPS requires heat or chemical treatment of samples and relies on bioactivity assays for the conserved lipid A portion of the molecule. Our goal was to develop assaysmore » to facilitate the direct and discriminative detection of the entire LPS molecule and its O antigen in complex matrices using minimal sample processing. To perform serogroup identification of LPS, we used a method called membrane insertion on a waveguide biosensor, and tested three serogroups of LPS. The membrane insertion technique allows for the hydrophobic association of LPS with a lipid bilayer, where the exposed O antigen can be targeted for specific detection. Samples of beef lysate were spiked with LPS to perform O antigen specific detection of LPS from E. coli O157. To validate assay performance, we evaluated the biophysical interactions of LPS with lipid bilayers both in- and outside of a flow cell using fluorescence microscopy and fluorescently doped lipids. Our results indicate that membrane insertion allows for the qualitative and reliable identification of amphiphilic LPS in complex samples like beef homogenates. In addition, we also demonstrated that LPS-induced hole formation does not occur under the conditions of the membrane insertion assays. Together, these findings describe for the first time the serogroup-specific detection of amphiphilic LPS in complex samples using a membrane insertion assay, and highlight the importance of LPS molecular conformations in detection architectures.« less
Common-path conoscopic interferometry for enhanced picosecond ultrasound detection
NASA Astrophysics Data System (ADS)
Liu, Liwang; Guillet, Yannick; Audoin, Bertrand
2018-05-01
We report on a common-path implementation of conoscopic interferometry in picosecond pump-probe reflectometry for simple and efficient detection of picosecond ultrasounds. The interferometric configuration proposed here is greatly simplified, involving only the insertion of a birefringent crystal in a standard reflectometry setup. Our approach is demonstrated by the optical detection of coherent acoustic phonons propagating through thin metal films under two representative geometries, one a particular case where the crystal slab is part of a sample as substrate of a metal film, and the other a more general case where the crystal slab is independent of the sample as part of the detection system. We first illustrate the former with a 300 nm thin film of polycrystalline titanium, deposited by physical vapor deposition on top of a 1 mm-thick uniaxial (0001) sapphire crystal. A signal-to-noise ratio (SNR) enhancement of more than 15 dB is achieved compared to conventional reflectometry. Next, the general case is demonstrated with a 900 nm-tungsten film sputtered on a silicon wafer substrate. More echoes can be discriminated by using the reported approach compared to standard reflectometry, which confirms the improvement in SNR and suggests broad applications for the reported method.
USDA-ARS?s Scientific Manuscript database
Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...
Natural mutagenesis of human genomes by endogenous retrotransposons.
Iskow, Rebecca C; McCabe, Michael T; Mills, Ryan E; Torene, Spencer; Pittard, W Stephen; Neuwald, Andrew F; Van Meir, Erwin G; Vertino, Paula M; Devine, Scott E
2010-06-25
Two abundant classes of mobile elements, namely Alu and L1 elements, continue to generate new retrotransposon insertions in human genomes. Estimates suggest that these elements have generated millions of new germline insertions in individual human genomes worldwide. Unfortunately, current technologies are not capable of detecting most of these young insertions, and the true extent of germline mutagenesis by endogenous human retrotransposons has been difficult to examine. Here, we describe technologies for detecting these young retrotransposon insertions and demonstrate that such insertions indeed are abundant in human populations. We also found that new somatic L1 insertions occur at high frequencies in human lung cancer genomes. Genome-wide analysis suggests that altered DNA methylation may be responsible for the high levels of L1 mobilization observed in these tumors. Our data indicate that transposon-mediated mutagenesis is extensive in human genomes and is likely to have a major impact on human biology and diseases.
Takenouchi, Toshiki; Kuchikata, Tomu; Yoshihashi, Hiroshi; Fujiwara, Mineko; Uehara, Tomoko; Miyama, Sahoko; Yamada, Shiro; Kosaki, Kenjiro
2017-05-01
Among more than 5,000 human monogenic disorders with known causative genes, transposable element insertion of a Long Interspersed Nuclear Element 1 (LINE1, L1) is known as the mechanistic basis in only 13 genetic conditions. Meckel-Gruber syndrome is a rare ciliopathy characterized by occipital encephalocele and cystic kidney disease. Here, we document a boy with occipital encephalocele, post-axial polydactyly, and multicystic renal disease. A medical exome analysis detected a heterozygous frameshift mutation, c.4582_4583delCG p.(Arg1528Serfs*17) in CC2D2A in the maternally derived allele. The further use of a dedicated bioinformatics algorithm for detecting retrotransposon insertions led to the detection of an L1 insertion affecting exon 7 in the paternally derived allele. The complete sequencing and sequence homology analysis of the inserted L1 element showed that the L1 element was classified as L1HS (L1 human specific) and that the element had intact open reading frames in the two L1-encoded proteins. This observation ranks Meckel-Gruber syndrome as only the 14th disorder to be caused by an L1 insertion among more than 5,000 known human genetic disorders. Although a transposable element detection algorithm is not included in the current best-practice next-generation sequencing analysis, the present observation illustrates the utility of such an algorithm, which would require modest computational time and resources. Whether the seemingly infrequent recognition of L1 insertion in the pathogenesis of human genetic diseases might simply reflect a lack of appropriate detection methods remains to be seen. © 2017 Wiley Periodicals, Inc.
Yu, Qichao; Zhang, Wei; Zhang, Xiaolong; Zeng, Yongli; Wang, Yeming; Wang, Yanhui; Xu, Liqin; Huang, Xiaoyun; Li, Nannan; Zhou, Xinlan; Lu, Jie; Guo, Xiaosen; Li, Guibo; Hou, Yong; Liu, Shiping; Li, Bo
2017-09-01
Active retrotransposons play important roles during evolution and continue to shape our genomes today, especially in genetic polymorphisms underlying a diverse set of diseases. However, studies of human retrotransposon insertion polymorphisms (RIPs) based on whole-genome deep sequencing at the population level have not been sufficiently undertaken, despite the obvious need for a thorough characterization of RIPs in the general population. Herein, we present a novel and efficient computational tool called Specific Insertions Detector (SID) for the detection of non-reference RIPs. We demonstrate that SID is suitable for high-depth whole-genome sequencing data using paired-end reads obtained from simulated and real datasets. We construct a comprehensive RIP database using a large population of 90 Han Chinese individuals with a mean ×68 depth per individual. In total, we identify 9342 recent RIPs, and 8433 of these RIPs are novel compared with dbRIP, including 5826 Alu, 2169 long interspersed nuclear element 1 (L1), 383 SVA, and 55 long terminal repeats. Among the 9342 RIPs, 4828 were located in gene regions and 5 were located in protein-coding regions. We demonstrate that RIPs can, in principle, be an informative resource to perform population evolution and phylogenetic analyses. Taking the demographic effects into account, we identify a weak negative selection on SVA and L1 but an approximately neutral selection for Alu elements based on the frequency spectrum of RIPs. SID is a powerful open-source program for the detection of non-reference RIPs. We built a non-reference RIP dataset that greatly enhanced the diversity of RIPs detected in the general population, and it should be invaluable to researchers interested in many aspects of human evolution, genetics, and disease. As a proof of concept, we demonstrate that the RIPs can be used as biomarkers in a similar way as single nucleotide polymorphisms. © The Authors 2017. Published by Oxford University Press.
RNA detection using peptide-inserted Renilla luciferase.
Andou, Takashi; Endoh, Tamaki; Mie, Masayasu; Kobatake, Eiry
2009-01-01
A novel complementation system with short peptide-inserted-Renilla luciferase (PI-Rluc) and split-RNA probes was constructed for noninvasive RNA detection. The RNA binding peptides HIV-1 Rev and BIV Tat were used as inserted peptides. They display induced fit conformational changes upon binding to specific RNAs and trigger complementation or discomplementation of Rluc. Split-RNA probes were designed to reform the peptide binding site upon hybridization with arbitrarily selected target RNA. This set of recombinant protein and split-RNA probes enabled a high degree of sensitivity in RNA detection. In this study, we show that the Rluc system is comparable to Fluc, but that its detection limit for arbitrarily selected RNA (at least 100 pM) exceeds that of Fluc by approximately two orders of magnitude.
Fiber optic SERS-based plasmonics nanobiosensing in single living cells
NASA Astrophysics Data System (ADS)
Scaffidi, Jonathan P.; Gregas, Molly K.; Seewaldt, Victoria; Vo-Dinh, Tuan
2009-05-01
We describe the development of small molecule-sensitive plasmonics-active fiber-optic nanoprobes suitable for intracellular bioanalysis in single living human cells using surface-enhanced Raman scattering (SERS) detection. The practical utility of SERS-based fiber-optic nanoprobes is illustrated by measurements of intracellular pH in HMEC- 15/hTERT immortalized "normal" human mammary epithelial cells and PC-3 human prostate cancer cells. The results indicate that fiber-optic nanoprobe insertion and interrogation provide a sensitive and selective means to monitor biologically-relevant small molecules at the single cell level.
Caffarel-Salvador, Ester; Brady, Aaron J.; Eltayib, Eyman; Meng, Teng; Alonso-Vicente, Ana; Gonzalez-Vazquez, Patricia; Torrisi, Barbara M.; Vicente-Perez, Eva Maria; Mooney, Karen; Jones, David S.; Bell, Steven E. J.; McCoy, Colin P.; McCarthy, Helen O.; McElnay, James C.; Donnelly, Ryan F.
2015-01-01
We describe, for the first time the use of hydrogel-forming microneedle (MN) arrays for minimally-invasive extraction and quantification of drug substances and glucose from skin in vitro and in vivo. MN prepared from aqueous blends of hydrolysed poly(methyl-vinylether-co-maleic anhydride) (11.1% w/w) and poly(ethyleneglycol) 10,000 daltons (5.6% w/w) and crosslinked by esterification swelled upon skin insertion by uptake of fluid. Post-removal, theophylline and caffeine were extracted from MN and determined using HPLC, with glucose quantified using a proprietary kit. In vitro studies using excised neonatal porcine skin bathed on the underside by physiologically-relevant analyte concentrations showed rapid (5 min) analyte uptake. For example, mean concentrations of 0.16 μg/mL and 0.85 μg/mL, respectively, were detected for the lowest (5 μg/mL) and highest (35 μg/mL) Franz cell concentrations of theophylline after 5 min insertion. A mean concentration of 0.10 μg/mL was obtained by extraction of MN inserted for 5 min into skin bathed with 5 μg/mL caffeine, while the mean concentration obtained by extraction of MN inserted into skin bathed with 15 μg/mL caffeine was 0.33 μg/mL. The mean detected glucose concentration after 5 min insertion into skin bathed with 4 mmol/L was 19.46 nmol/L. The highest theophylline concentration detected following extraction from a hydrogel-forming MN inserted for 1 h into the skin of a rat dosed orally with 10 mg/kg was of 0.363 μg/mL, whilst a maximum concentration of 0.063 μg/mL was detected following extraction from a MN inserted for 1 h into the skin of a rat dosed with 5 mg/kg theophylline. In human volunteers, the highest mean concentration of caffeine detected using MN was 91.31 μg/mL over the period from 1 to 2 h post-consumption of 100 mg Proplus® tablets. The highest mean blood glucose level was 7.89 nmol/L detected 1 h following ingestion of 75 g of glucose, while the highest mean glucose concentration extracted from MN was 4.29 nmol/L, detected after 3 hours skin insertion in human volunteers. Whilst not directly correlated, concentrations extracted from MN were clearly indicative of trends in blood in both rats and human volunteers. This work strongly illustrates the potential of hydrogel-forming MN in minimally-invasive patient monitoring and diagnosis. Further studies are now ongoing to reduce clinical insertion times and develop mathematical algorithms enabling determination of blood levels directly from MN measurements. PMID:26717198
Image reconstruction and system modeling techniques for virtual-pinhole PET insert systems
Keesing, Daniel B; Mathews, Aswin; Komarov, Sergey; Wu, Heyu; Song, Tae Yong; O'Sullivan, Joseph A; Tai, Yuan-Chuan
2012-01-01
Virtual-pinhole PET (VP-PET) imaging is a new technology in which one or more high-resolution detector modules are integrated into a conventional PET scanner with lower-resolution detectors. It can locally enhance the spatial resolution and contrast recovery near the add-on detectors, and depending on the configuration, may also increase the sensitivity of the system. This novel scanner geometry makes the reconstruction problem more challenging compared to the reconstruction of data from a standalone PET scanner, as new techniques are needed to model and account for the non-standard acquisition. In this paper, we present a general framework for fully 3D modeling of an arbitrary VP-PET insert system. The model components are incorporated into a statistical reconstruction algorithm to estimate an image from the multi-resolution data. For validation, we apply the proposed model and reconstruction approach to one of our custom-built VP-PET systems – a half-ring insert device integrated into a clinical PET/CT scanner. Details regarding the most important implementation issues are provided. We show that the proposed data model is consistent with the measured data, and that our approach can lead to reconstructions with improved spatial resolution and lesion detectability. PMID:22490983
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiebe, David J.; Carlson, Andrew; Stoker, Kyle C.
A transition duct system for routing a gas flow in a combustion turbine engine is provided. The transition duct system includes one or more converging flow joint inserts forming a trailing edge at an intersection between adjacent transition ducts. The converging flow joint insert may be contained within a converging flow joint insert receiver and may be disconnected from the transition duct bodies by which the converging flow joint insert is positioned. Being disconnected eliminates stress formation within the converging flow joint insert, thereby enhancing the life of the insert. The converging flow joint insert may be removable such thatmore » the insert can be replaced once worn beyond design limits.« less
NASA Astrophysics Data System (ADS)
Wang, Xing-Fu; Tong, Jin-Hui; Zhao, Bi-Jun; Chen, Xin; Ren, Zhi-Wei; Li, Dan-Wei; Zhuo, Xiang-Jing; Zhang, Jun; Yi, Han-Xiang; Li, Shu-Ti
2013-09-01
The advantages of a blue InGaN-based light-emitting diode with a p-InGaN layer inserted in the GaN barriers is studied. The carrier concentration in the quantum well, radiative recombination rate in the active region, output power, and internal quantum efficiency are investigated. The simulation results show that the InGaN-based light-emitting diode with a p-InGaN layer inserted in the barriers has better performance over its conventional counterpart and the light emitting diode with p-GaN inserted in the barriers. The improvement is due to enhanced Mg acceptor activation and enhanced hole injection into the quantum wells.
Pappas, Eleftherios P; Seimenis, Ioannis; Dellios, Dimitrios; Kollias, Georgios; Lampropoulos, Kostas I; Karaiskos, Pantelis
2018-06-25
This work focuses on MR-related sequence dependent geometric distortions, which are associated with B 0 inhomogeneity and patient-induced distortion (susceptibility differences and chemical shift effects), in MR images used in stereotactic radiosurgery (SRS) applications. Emphasis is put on characterizing distortion at target brain areas identified by gadolinium diethylenetriamine pentaacetic acid (Gd-DTPA) paramagnetic contrast agent uptake. A custom-made phantom for distortion detection was modified to accommodate two small cylindrical inserts, simulating small brain targets. The inserts were filled with Gd-DTPA solutions of various concentrations (0-20 mM). The phantom was scanned at 1.5 T unit using both the reversed read gradient polarity (to determine the overall distortion as reflected by the inserts centroid offset) and the field mapping (to determine B 0 inhomogeneity related distortion in the vicinity of the inserts) techniques. Post-Gd patient images involving a total of 10 brain metastases/targets were also studied using a similar methodology. For the specific imaging conditions, contrast agent presence was found to evidently affect phantom insert position, with centroid offset extending up to 0.068 mm mM -1 (0.208 ppm mM -1 ). The Gd-DTPA induced distortion in patient images was of the order of 0.5 mm for the MRI protocol used, in agreement with the phantom results. Total localization uncertainty of metastases-targets in patient images ranged from 0.35 mm to 0.87 mm, depending on target location, with an average value of 0.54 mm (2.24 ppm). This relative wide range of target localization uncertainty results from the fact that the B 0 inhomogeneity distortion vector in a specific location may add to or partly counterbalance Gd-DTPA induced distortion, thus increasing or decreasing, respectively, the total sequence dependent distortion. Although relatively small, the sequence dependent distortion in Gd-DTPA enhanced brain images can be easily taken into account for SRS treatment planning and target definition purposes by carefully inspecting both the forward and reversed polarity series.
Yu, Tae Jun; Hong, Kyung-Han; Choi, Hyun-Gyug; Sung, Jae Hee; Choi, Il Woo; Ko, Do-Kyeong; Lee, Jongmin; Kim, Junwon; Kim, Dong Eon; Nam, Chang Hee
2007-06-25
We demonstrate a long-term operation with reduced phase noise in the carrier-envelope-phase (CEP) stabilization process by employing a double feedback loop and an improved signal detection in the direct locking technique [Opt. Express 13, 2969 (2005)]. A homodyne balanced detection method is employed for efficiently suppressing the dc noise in the f-2f beat signal, which is converted into the CEP noise in the direct locking loop working at around zero carrier-envelope offset frequency (f(ceo)). In order to enhance the long-term stability, we have used the double feedback scheme that modulates both the oscillator pump power for a fast control and the intracavity-prism insertion depth for a slow and high-dynamic-range control. As a result, the in-loop phase jitter is reduced from 50 mrad of the previous result to 29 mrad, corresponding to 13 as in time scale, and the long-term stable operation is achieved for more than 12 hours.
Characterization of GM events by insert knowledge adapted re-sequencing approaches
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-01-01
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events. PMID:24088728
Characterization of GM events by insert knowledge adapted re-sequencing approaches.
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-10-03
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events.
Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio
2014-03-14
Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.
Nano-oxide-layer insertion and specular effects in spin valves: Experiment and theory
NASA Astrophysics Data System (ADS)
Wang, L.; Qiu, J. J.; McMahon, W. J.; Li, K. B.; Wu, Y. H.
2004-06-01
We report a systematic study of NOL (nano-oxide-layer) insertion and specular effects on the giant magnetoresistance (GMR) of single, synthetic, and dual spin valves, using a semiclassical Boltzmann theory. It is confirmed that the GMR ratio is enhanced by NOL insertion inside the pinned layer or after the free layer. The enhancements are primarily due to the contribution of the majority carriers. The NOL insertions inside the inactive layers of spin valves such as the seed, under, and capping layers reduce the GMR ratio. Though introducing a NOL before or after the Cu spacer would, in principle, significantly suppress the GMR ratio due to the blocking effect or the average effect of different spin channels, large positive or negative (inverse) GMR is found by assuming spin-dependent NOL specular reflections. We have also demonstrated that specular reflection, even beyond a capping layer, may result in reduction of GMR. Upon appropriate NOL insertion, the amplitude of curve of GMR versus thickness of individual layer of spin valves may be generally enhanced, but the shape may change, depending on whether the distance of the NOL to the layer is small or large (distance effect). Finally, it is found that most results obtained for the single realistic spin valves are applicable to synthetic and dual spin valves.
Influence of wire-coil inserts on the thermo-hydraulic performance of a flat-plate solar collector
NASA Astrophysics Data System (ADS)
Herrero Martín, R.; García, A.; Pérez-García, J.
2012-11-01
Enhancement techniques can be applied to flat-plate liquid solar collectors towards more compact and efficient designs. For the typical operating mass flow rates in flat-plate solar collectors, the most suitable technique is inserted devices. Based on previous studies from the authors, wire coils were selected for enhancing heat transfer. This type of inserted device provides better results in laminar, transitional and low turbulence fluid flow regimes. To test the enhanced solar collector and compare with a standard one, an experimental side-by-side solar collector test bed was designed and constructed. The testing set up was fully designed following the requirements of EN12975-2 and allow us to accomplish performance tests under the same operating conditions (mass flow rate, inlet fluid temperature and weather conditions). This work presents the thermal efficiency curves of a commercial and an enhanced solar collector, for the standardized mass flow rate per unit of absorber area of 0.02 kg/sm2 (in useful engineering units 144 kg/h for water as working fluid and 2 m2 flat-plate solar collector of absorber area). The enhanced collector was modified inserting spiral wire coils of dimensionless pitch p/D = 1 and wire-diameter e/D = 0.0717. The friction factor per tube has been computed from the overall pressure drop tests across the solar collectors. The thermal efficiency curves of both solar collectors, a standard and an enhanced collector, are presented. The enhanced solar collector increases the thermal efficiency by 15%. To account for the overall enhancement a modified performance evaluation criterion (R3m) is proposed. The maximum value encountered reaches 1.105 which represents an increase in useful power of 10.5% for the same pumping power consumption.
Lamb, G C; Dahlen, C R; Larson, J E; Marquezini, G; Stevenson, J S
2010-04-01
Early estrus-synchronization protocols focused on regressing the corpus luteum (CL) with an injection of PGF(2alpha) followed by detection of estrus or involved the use of exogenous progestins that prevent estrus from occurring. Later, protocols combining the use of PGF(2alpha) and exogenous progestins were developed. Gonadotropin-releasing hormone was utilized to control follicular waves, synchronize ovulation, or to luteinize large dominant follicles. Our research aimed to develop reliable protocols that 1) relied solely on fixed-timed AI (TAI); 2) required a maximum of 3 animal handlings, and 3) were successful in estrous-cycling and noncycling females. In cows, insertion of an intravaginal progesterone insert during the 7-d interval between the initial GnRH and PGF(2alpha) injections enhanced pregnancy rates by 9 to 10%. In a multi-location study, a TAI protocol yielded pregnancy rates similar to a protocol involving detection of estrus plus a fixed-time clean-up AI for females not detected in estrus (54 vs. 58%, respectively, for cows and 53 vs. 57%, respectively, for heifers). Initiation of estrous cycles in noncycling cows is likely the primary manner in which beef producers may improve fertility in response to estrus synchronization and TAI protocols. Treatment of noncycling females with progesterone and GnRH increases the percentage of cycling females and improves fertility to a TAI, but inducing cyclicity with hCG failed to enhance fertility in TAI protocols. Supplementing progesterone after TAI failed to increase pregnancy rates in beef cattle. In contrast, administration of hCG 7 d after TAI induced an accessory CL, increased progesterone, and tended to enhance pregnancy rates. Development of TAI protocols that reduce the hassle factors associated with ovulation synchronization and AI provide cattle producers efficient and effective tools for capturing selective genetic traits of economic consequences. Location variables, however, which may include differences in pasture and diet, breed composition, body condition, postpartum interval, climate, and geographic location, affect the success of TAI protocols.
NASA Astrophysics Data System (ADS)
Waghole, D. R.
2018-06-01
Investigation on heat transfer by generating turbulence in the fluid stream inside the circular tube is an innovative area of research for researchers. Hence, many techniques are been investigated and adopted for enhancement of heat transfer rate to reduce the size and the cost of the heat exchanger/circular tube. In the present study the effect of differential solid ring inserts /turbulators on heat transfer, friction factor of heat exchanger/circular tube was evaluated through experimentally and numerically. The experiments were conducted in range of 3000 ≤Re≤ 6500 and annular blockages 0 ≤ɸ≤50 %. The heat transfer rate was higher for differential combination of inserts as compared to tube fitted with uniform inserts. The maximum heat transfer was obtained by the use of differential metal circular ring inserts/blockages. From this study, Nusselt number, friction factor and enhancement factor are found as 2.5-3.5 times, 12% - 50.5% and 155% - 195%, respectively with water. Finally new possible correlations for predicting heat transfer and friction factor in the flow of water through the circular tube with differential blockages/inserts are proposed.
NASA Astrophysics Data System (ADS)
Khosla, Deepak; Huber, David J.; Martin, Kevin
2017-05-01
This paper† describes a technique in which we improve upon the prior performance of the Rapid Serial Visual Presentation (RSVP) EEG paradigm for image classification though the insertion of visual attention distracters and overall sequence reordering based upon the expected ratio of rare to common "events" in the environment and operational context. Inserting distracter images maintains the ratio of common events to rare events at an ideal level, maximizing the rare event detection via P300 EEG response to the RSVP stimuli. The method has two steps: first, we compute the optimal number of distracters needed for an RSVP stimuli based on the desired sequence length and expected number of targets and insert the distracters into the RSVP sequence, and then we reorder the RSVP sequence to maximize P300 detection. We show that by reducing the ratio of target events to nontarget events using this method, we can allow RSVP sequences with more targets without sacrificing area under the ROC curve (azimuth).
Zhu, Desong; Wang, Lei; Xu, Xiaowen; Jiang, Wei
2016-01-15
Transcription factors (TFs) play pivotal roles in the regulation of a variety of essential cellular processes and some of them have been recognized as potential diagnostic markers and therapeutic targets of some diseases. Sensitive and accurate detection of TFs is of great importance to better understanding their roles in gene regulation and evaluation of disease state. Here, we developed a simple, label-free and enzyme-free new fluorescent strategy for the detection of TFs by graphene oxide (GO) fluorescence switch-based multifunctional G-quadruplex-hairpin probe (MGHP). The MGHP possessed of three functions simultaneously, adsorbing onto GO with the loop part, binding to target with the stem part and serving as signal carrier with the terminal G-quadruplex. First, the MGHP was adsorbed quickly to GO. Next, the TF bound to the stem part of MGHP to form a huge target-MGHP complex, which led to desorption of the complex from GO. Finally, NMM was inserted into G-quadruplex in the complex to yield an enhanced fluorescence response. The GO used here, as a fluorescence switch, could quickly and efficiently quench the fluorescence of NMM inserted into the MGHP absorbed on the GO, guaranteeing a high signal-to-noise ratio. Sensitive detection of purified NF-κB p50 and HeLa cell nuclear extracts were achieved with detection limits of 0.2nM and 7.8ng/µL, respectively. Moreover, this proposed strategy could be used to screen inhibitors of NF-κB p50 activity. The strategy proposed here might offer a new potential approach for reliable quantification of TFs in clinical diagnostics and treatment research of some diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Mitochondrial DNA transfer to the nucleus generates extensive insertion site variation in maize.
Lough, Ashley N; Roark, Leah M; Kato, Akio; Ream, Thomas S; Lamb, Jonathan C; Birchler, James A; Newton, Kathleen J
2008-01-01
Mitochondrial DNA (mtDNA) insertions into nuclear chromosomes have been documented in a number of eukaryotes. We used fluorescence in situ hybridization (FISH) to examine the variation of mtDNA insertions in maize. Twenty overlapping cosmids, representing the 570-kb maize mitochondrial genome, were individually labeled and hybridized to root tip metaphase chromosomes from the B73 inbred line. A minimum of 15 mtDNA insertion sites on nine chromosomes were detectable using this method. One site near the centromere on chromosome arm 9L was identified by a majority of the cosmids. To examine variation in nuclear mitochondrial DNA sequences (NUMTs), a mixture of labeled cosmids was applied to chromosome spreads of ten diverse inbred lines: A188, A632, B37, B73, BMS, KYS, Mo17, Oh43, W22, and W23. The number of detectable NUMTs varied dramatically among the lines. None of the tested inbred lines other than B73 showed the strong hybridization signal on 9L, suggesting that there is a recent mtDNA insertion at this site in B73. Different sources of B73 and W23 were examined for NUMT variation within inbred lines. Differences were detectable, suggesting either that mtDNA is being incorporated or lost from the maize nuclear genome continuously. The results indicate that mtDNA insertions represent a major source of nuclear chromosomal variation.
Kolanko, C J; Pyle, M D; Nath, J; Prasanna, P G; Loats, H; Blakely, W F
2000-03-01
We report a low cost and efficient method for synthesizing a human pancentromeric DNA probe by the polymerase chain reaction (PRC) and an optimized protocol for in situ detection using color pigment immunostaining. The DNA template used in the PCR was a 2.4 kb insert containing human alphoid repeated sequences of pancentromeric DNA subcloned into pUC9 (Miller et al. 1988) and the primers hybridized to internal sequences of the 172 bp consensus tandem repeat associated with human centromeres. PCR was performed in the presence of biotin-11-dUTP, and the product was used for in situ hybridization to detect the pancentromeric region of human chromosomes in metaphase spreads. Detection of pancentromeric probe was achieved by immunoenzymatic color pigment painting to yield a permanent image detected at high resolution by bright field microscopy. The ability to synthesize the centromeric probe rapidly and to detect it with color pigment immunostaining will lead to enhanced identification and eventually to automation of various chromosome aberration assays.
Water molecule-enhanced CO{sub 2} insertion in lanthanide coordination polymers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luo Liushan; Huang Xiaoyuan; Wang Ning
2009-08-15
Two new lanthanide coordination polymers H{sub 2}N(CH{sub 3}){sub 2}.[Eu{sup III}{sub 2}(L{sub 1}){sub 3}(L{sub 2})] (1, L{sub 1}=isophthalic acid dianion, L{sub 2}=formic acid anion) and [La{sup III}(2,5-PDC)(L{sub 2})](2, 2,5-PDC=2,5-pyridinedicarboxylate dianion) were synthesized under solvothermal conditions. It is of interest that the formic ligand (L{sub 2}) is not contained in the stating materials, but arises from the water molecule-enhanced CO{sub 2} insertion during the solvothermal process. Both of the two compounds exhibit complicated three dimensional sandwich-like frameworks. - Graphical abstract: Two new lanthanide coordination polymers involving water molecule-enhanced CO{sub 2} insertion resulting in the formation of formic anion and dimethylammonium cation weremore » synthesized under solvothermal conditions.« less
The carnegie protein trap library: a versatile tool for Drosophila developmental studies.
Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C
2007-03-01
Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.
Automated model-based quantitative analysis of phantoms with spherical inserts in FDG PET scans.
Ulrich, Ethan J; Sunderland, John J; Smith, Brian J; Mohiuddin, Imran; Parkhurst, Jessica; Plichta, Kristin A; Buatti, John M; Beichel, Reinhard R
2018-01-01
Quality control plays an increasingly important role in quantitative PET imaging and is typically performed using phantoms. The purpose of this work was to develop and validate a fully automated analysis method for two common PET/CT quality assurance phantoms: the NEMA NU-2 IQ and SNMMI/CTN oncology phantom. The algorithm was designed to only utilize the PET scan to enable the analysis of phantoms with thin-walled inserts. We introduce a model-based method for automated analysis of phantoms with spherical inserts. Models are first constructed for each type of phantom to be analyzed. A robust insert detection algorithm uses the model to locate all inserts inside the phantom. First, candidates for inserts are detected using a scale-space detection approach. Second, candidates are given an initial label using a score-based optimization algorithm. Third, a robust model fitting step aligns the phantom model to the initial labeling and fixes incorrect labels. Finally, the detected insert locations are refined and measurements are taken for each insert and several background regions. In addition, an approach for automated selection of NEMA and CTN phantom models is presented. The method was evaluated on a diverse set of 15 NEMA and 20 CTN phantom PET/CT scans. NEMA phantoms were filled with radioactive tracer solution at 9.7:1 activity ratio over background, and CTN phantoms were filled with 4:1 and 2:1 activity ratio over background. For quantitative evaluation, an independent reference standard was generated by two experts using PET/CT scans of the phantoms. In addition, the automated approach was compared against manual analysis, which represents the current clinical standard approach, of the PET phantom scans by four experts. The automated analysis method successfully detected and measured all inserts in all test phantom scans. It is a deterministic algorithm (zero variability), and the insert detection RMS error (i.e., bias) was 0.97, 1.12, and 1.48 mm for phantom activity ratios 9.7:1, 4:1, and 2:1, respectively. For all phantoms and at all contrast ratios, the average RMS error was found to be significantly lower for the proposed automated method compared to the manual analysis of the phantom scans. The uptake measurements produced by the automated method showed high correlation with the independent reference standard (R 2 ≥ 0.9987). In addition, the average computing time for the automated method was 30.6 s and was found to be significantly lower (P ≪ 0.001) compared to manual analysis (mean: 247.8 s). The proposed automated approach was found to have less error when measured against the independent reference than the manual approach. It can be easily adapted to other phantoms with spherical inserts. In addition, it eliminates inter- and intraoperator variability in PET phantom analysis and is significantly more time efficient, and therefore, represents a promising approach to facilitate and simplify PET standardization and harmonization efforts. © 2017 American Association of Physicists in Medicine.
Technical Note: Computer-Manufactured Inserts for Prosthetic Sockets
Sanders, Joan E.; McLean, Jake B.; Cagle, John C.; Gardner, David W.; Allyn, Katheryn J.
2016-01-01
The objective of this research was to use computer-aided design software and a tabletop 3-D additive manufacturing system to design and fabricate custom plastic inserts for trans-tibial prosthesis users. Shape quality of inserts was tested right after they were inserted into participant’s test sockets and again after four weeks of wear. Inserts remained properly positioned and intact throughout testing. Right after insertion the inserts caused the socket to be slightly under-sized, by a mean of 0.11 mm, approximately 55% of the thickness of a nylon sheath. After four weeks of wear the under-sizing was less, averaging 0.03 mm, approximately 15% of the thickness of a nylon sheath. Thus the inserts settled into the sockets over time. If existing prosthetic design software packages were enhanced to conduct insert design and to automatically generate fabrication files for manufacturing, then computer manufactured inserts may offer advantages over traditional methods in terms of speed of fabrication, ease of design, modification, and record keeping. PMID:27212209
NASA Astrophysics Data System (ADS)
Korotkov, E. V.; Korotkova, M. A.
2017-01-01
The purpose of this study was to detect latent periodicity in the presence of deletions or insertions in the analyzed data, when the points of deletions or insertions are unknown. A mathematical method was developed to search for periodicity in the numerical series, using dynamic programming and random matrices. The developed method was applied to search for periodicity in the Euro/Dollar (Eu/) exchange rate, since 2001. The presence of periodicity within the period length equal to 24 h in the analyzed financial series was shown. Periodicity can be detected only with insertions and deletions. The results of this study show that periodicity phase shifts, depend on the observation time. The reasons for the existence of the periodicity in the financial ranks are discussed.
Wang, Li; Eggenberger, Alan; Hill, John; Bogdanove, Adam J
2006-03-01
Soybean mosaic virus (SMV) was adapted for transgene expression in soybean and used to examine the function of avirulence genes avrB and avrPto of Pseudomonas syringae pvs. glycinea and tomato, respectively. A cloning site was introduced between the P1 and HC-Pro genes in 35S-driven infectious cDNAs of strains SMV-N and SMV-G7. Insertion of the uidA gene or the green fluorescent protein gene into either modified cDNA and bombardment into primary leaves resulted in systemic expression that reflected the pattern of viral movement into uninoculated leaves. Insertion of avrB blocked symptom development and detectable viral movement in cv. Harosoy, which carries the Rpg1-b resistance gene corresponding to avrB, but not in cvs. Keburi or Hurrelbrink, which lack Rpg1-b. In Keburi and Hurrelbrink, symptoms caused by SMV carrying avrB appeared more quickly and were more severe than those caused by the virus without avrB. Insertion of avrPto enhanced symptoms in Harosoy, Hurrelbrink, and Keburi. This result was unexpected because avrPto was reported to confer avirulence on P. syringae pv. glycinea inoculated to Harosoy. We inoculated Harosoy with P syringae pv. glycinea expressing avrPto, but observed no hypersensitive reaction, avrPto-dependent induction of pathogenesis-related protein la, or limitation of bacterial population growth. In Hurrelbrink, avrPto enhanced bacterial multiplication and exacerbated symptoms. Our results establish SMV as an expression vector for soybean. They demonstrate that resistance triggered by avrB is effective against SMV, and that avrB and avrPto have general virulence effects in soybean. The results also led to a reevaluation of the reported avirulence activity of avrPto in this plant.
NASA Astrophysics Data System (ADS)
Anbu, S.; Venkatachalapathy, S.; Suresh, S.
2018-05-01
An experimental study on the convective heat transfer and friction factor characteristics of TiO2/DI water nanofluids in uniformly heated plain and helically corrugated tubes (HCT) with and without spiraled rod inserts (SRI) under laminar flow regime is presented in this paper. TiO2 nanoparticles with an average size of 32 nm are dispersed in deionized (DI) water to form stable suspensions containing 0.1, 0.15, 0.2, and 0.25% volume concentrations of nanoparticles. It is found that the inclusion of nanoparticles to DI water ameliorated Nusselt number which increased with nanoparticles concentration upto 0.2%. Two spiraled rod inserts made of copper with different pitches (pi = 50 mm and 30 mm) are inserted in both plain and corrugated tubes and it is found that the addition of these inserts increased the Nusselt number substantially. For Helically corrugated tube with lower pitch and maximum height of corrugation (pc = 8 mm, hc = 1 mm) with 0.2% volume concentration of nanoparticles, a maximum enhancement of 15% in Nusselt number is found without insert and with insert having lower pitch (pi = 30 mm) the enhancement is 34% when compared to DI water in plain tube. The results on friction factor show a maximum penalty of about 53.56% for the above HCT.
Heat Transport Enhancement of Turbulent Thermal Convection by Inserted Channels
NASA Astrophysics Data System (ADS)
Xia, Ke-Qing; Zhang, Lu
2017-11-01
We report an experimental study on the heat transport properties of turbulent Rayleigh Benard Convection (RBC) in a rectangular cell with two types of 3D-printed structures inserted inside. The first one splits the original rectangular cell into 60 identical sub cells whose aspect ratio is 1:1:10 (length, width, height). The second one splits the cell into 30 sub cells, each with a 1:2:10 aspect ratio and a baffle in the center. We find that for large Rayleigh numbers (Ra), the Nusselt numbers (Nu) of both structures increase compared with that of the empty rectangular cell. An enhancement in Nu as much as 20% is found for the second type of insertion at Rayleigh number 2 ×109 . Moreover, the Nu-Ra scaling shows a transition with both geometries. The particle image velocimetry (PIV) measurement within a single sub unit indicates that the transition may be related to the laminar to turbulent transition in flow field. Direct numerical simulations (DNS) confirm the experimental results. Our results demonstrate the potential in using insertions to enhance passive heat transfer. This work was supported by the Research Grants Council (RGC) of HKSAR (Nos. CUHK404513 and CUHK14301115).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Xi; Wang, Shouguo, E-mail: sgwang@ustb.edu.cn; Han, Gang
2015-09-15
The Blocking temperature (T{sub B}) of Pt/NiFe/IrMn/MgO/Pt multilayers was greatly enhanced from far below room temperature (RT) to above RT by inserting 1 nm thick Mg layer at IrMn/MgO interface. Furthermore, the exchange bias field (H{sub eb}) was increased as well by the control of interfacial structures. The evidence for a significant fraction of Mn-O bonding at IrMn/MgO interface without Mg insertion layer was provided by X-ray photoelectron spectroscopy. The bonding between Mn and O can decrease the antiferromagnetism of IrMn film, leading to lower value of T{sub B} in Pt/NiFe/IrMn/MgO/Pt multilayers. Ultrathin Mg film inserted at IrMn/MgO interface actingmore » as an oxygen sinking layer can suppress the oxidation reactions between Mn and O and reduce the formation of Mn-O bonding greatly. The oxidation suppression results in the recovery of the antiferromagnetism of IrMn film, which can enhance T{sub B} and H{sub eb}. Furthermore, the high resolution transmission electron microscopy demonstrates that the Mg insertion layer can efficiently promote a high-quality MgO (200) texture. This study will enhance the understanding of physics in antiferromagnet-based spintronic devices.« less
[Damping inserts have no load reducing effect in the fatigued state].
Melnyk, M; Gollhofer, A
2008-09-01
Overload injuries to the lower limbs may be attributed to repetitive, non-physiological load stimuli. However, these impact loads acting on the musculoskeletal can be reduced by wearing damping inserts. To date, however, there is only little evidence as to whether this positive effect can be assigned to the damping insert and, furthermore, whether this effect is detectable in states of muscle fatigue. Therefore, the influence of muscle fatigue in combination with the wearing of damping inserts was investigated in 13 subjects. The parameters examined in this study were ground reaction forces during walking and the muscular activation profile of the lower limb in the phase of initial ground contact. The results showed that neither in comparisons with and without damping inserts nor in states of muscular fatigue could significant differences were found in the ground reaction forces. Wereas, no significant differences could be detected in the investigated muscles, with and without damping inserts, preactivation in the peroneal and biceps femoris muscles were significantly earlier, in states of muscular fatigue with damping inserts, while no changes could be found in the anterior tibial, soleus, vastus lateralis and gastrocnemius muscles. The present results demonstrate that wearing damping inserts does not lead to a positive effect with regard to a reduction of the ground reaction forces. The earlier preactivation in the case of muscle fatigue with a damping insert is indicative of an increased energy expenditure which may be possibly associated with increased knee and ankle joint control. The high satisfaction concerning the comfort of wearing such inserts revealed by a questionnaire did not correlate with a reduction in loading condition. On the basis of the present results we cannot recommend the wearing of damping soft sole inserts in the context of a reduction in load condition.
Bashir, Ali; Bansal, Vikas; Bafna, Vineet
2010-06-18
Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.
Absorbance enhancement in microplate wells for improved-sensitivity biosensors.
Suárez, Guillaume; Santschi, Christian; Plateel, Gregory; Martin, Olivier J F; Riediker, Michael
2014-06-15
A generic optical biosensing strategy was developed that relies on the absorbance enhancement phenomenon occurring in a multiple scattering matrix. Experimentally, inserts made of glass fiber membrane were placed into microplate wells in order to significantly lengthen the trajectory of the incident light through the sample and therefore increase the corresponding absorbance. Enhancement factor was calculated by comparing the absorbance values measured for a given amount of dye with and without the absorbance-enhancing inserts in the wells. Moreover, the dilution of dye in solutions with different refractive indices (RI) clearly revealed that the enhancement factor increased with the ΔRI between the membrane and the surrounding medium, reaching a maximum value (EF>25) when the membranes were dried. On this basis, two H2O2-biosensing systems were developed based on the biofunctionalization of the glass fiber inserts either with cytochrome c or horseradish peroxidase (HRP) and the analytical performances were systematically compared with the corresponding bioassay in solution. The efficiency of the absorbance-enhancement approach was particularly clear in the case of the cytochrome c-based biosensor with a sensitivity gain of 40 folds and wider dynamic range. Therefore, the developed strategy represents a promising way to convert standard colorimetric bioassays into optical biosensors with improved sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.
Kristiniak, Susan; Harpel, Jean; Breckenridge, Diane M; Buckle, Jane
2012-11-01
To evaluate the effect of topically applied black pepper essential oil on easing intravenous catheter insertion (IVC) in patients with no palpable or visible veins compared to a control group (standard nursing practice). Randomized, controlled study. One hundred twenty hospitalized patients, who were referred to a hospital vascular team because of difficulty in accessing veins for IVC insertion. Topical application of 20% essential oil of black pepper in aloe vera gel or standard nursing care (hot packs with or without vigorous tactile stimulation). Pre- and post-test vein visibility and/or palpability and number of attempts at IVC insertion. A higher percentage of patients achieved optimal scoring (vein score=2) or improved scoring (vein score of 1 or 2) to black pepper intervention than standard nursing care. The black pepper group also reduced the number of patients whose veins were still not visible or palpable after the intervention to nearly half that of the control group (p<0.05). The number of IVC attempts following black pepper was also half that of the control group. Topical application of black pepper is a viable and effective way to enhance vein visibility and palpability prior to intravenous insertion in patients with limited vein accessibility; it also improves ease of IVC insertion.
Cornelis, P; Anjaiah, V; Koedam, N; Delfosse, P; Jacques, P; Thonart, P; Neirinckx, L
1992-07-01
Tn5 mutagenesis of different fluorescent pseudomonads was achieved by conjugational transfer of the suicide vector pSUP 10141. Pyoverdine negative (Pvd-) mutants were detected by the absence of fluorescence on King's B medium and by their inability to grow in the presence of the iron chelator EDDHA [ethylenediamine di(o-hydroxyphenylacetic acid)]. In P. fluorescens ATCC 17400 and three rhizosphere isolates (one P. putida and two P. fluorescens), the percentage of Pvd- mutants ranged between 0 and 0.54%. In a P. chlororaphis rhizosphere isolate, this percentage was higher (4%). In these mutants both of the Tn5 antibiotic resistances (Km and Tc) were stable and the transposon could be detected by hybridization. In Pvd- mutants of P. fluorescens ATCC 17400, the transposon was found to be inserted twice in the chromosome while single insertions were detected in the DNA of other, randomly tested mutants. In P. aeruginosa PAO1, where 13.1% of the mutants were Pvd-, both antibiotic resistances were rapidly lost and accordingly no transposon insertion could be detected by hybridization. However, the Pvd- phenotype was generally stable in these mutants. The plasmid pNK862 containing a mini-Tn10 transposon was introduced by electroporation into P. aeruginosa PAO1 and Kmr mutants were recovered, 89% of which were Pvd- and confirmed to be P. aeruginosa by PCR amplification of the P. aeruginosa lipoprotein gene. The mini-Tn10 insertions were also found to be unstable in PAO1.
NASA Astrophysics Data System (ADS)
Jiang, Fan; Chen, Jingwen; Bi, Han; Li, Luying; Jing, Wenkui; Zhang, Jun; Dai, Jiangnan; Che, Renchao; Chen, Changqing; Gao, Yihua
2018-01-01
Non-polar a-plane n-ZnO/p-AlGaN and n-ZnO/i-ZnO/p-AlGaN heterojunction film light-emitting diodes (LEDs) are fabricated with good crystalline quality. The optical measurements show obvious performance enhancement with i-ZnO layer insertion. Off-axis electron holography reveals a potential drop of ˜1.5 V across the heterojunctions with typical p-n junction characteristics. It is found that the electrostatic potentials are inclined and the corresponding electrostatic fields are opposite to each other in n-ZnO and p-AlGaN regions. The electrostatic fields are mainly attributed to strain induced piezoelectric polarizations. After an insertion of an i-ZnO layer into the p-n heterojunction, comparatively flat electrostatic potential generates in the intrinsic ZnO region and contributes to faster movements of the injected electrons and holes, making the i-ZnO layer more conductive to the radiative recombination with enhanced exciton recombination possibilities and at last the LED performance enhancement.
Technical note: Computer-manufactured inserts for prosthetic sockets.
Sanders, Joan E; McLean, Jake B; Cagle, John C; Gardner, David W; Allyn, Katheryn J
2016-08-01
The objective of this research was to use computer-aided design software and a tabletop 3-D additive manufacturing system to design and fabricate custom plastic inserts for trans-tibial prosthesis users. Shape quality of inserts was tested right after they were inserted into participant's test sockets and again after four weeks of wear. Inserts remained properly positioned and intact throughout testing. Right after insertion the inserts caused the socket to be slightly under-sized, by a mean of 0.11mm, approximately 55% of the thickness of a nylon sheath. After four weeks of wear the under-sizing was less, averaging 0.03mm, approximately 15% of the thickness of a nylon sheath. Thus the inserts settled into the sockets over time. If existing prosthetic design software packages were enhanced to conduct insert design and to automatically generate fabrication files for manufacturing, then computer manufactured inserts may offer advantages over traditional methods in terms of speed of fabrication, ease of design, modification, and record keeping. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.
Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.
Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime
2014-02-01
Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.
The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies
Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.
2007-01-01
Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782
QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.
Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S
2009-07-01
Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.
2015-01-01
We have developed an improved tool for imaging acidic tumors by reporting the insertion of a transmembrane helix: the pHLIP-Fluorescence Insertion REporter (pHLIP-FIRE). In acidic tissues, such as tumors, peptides in the pHLIP family insert as α-helices across cell membranes. The cell-inserting end of the pHLIP-FIRE peptide has a fluorophore–fluorophore or fluorophore–quencher pair. A pair member is released by disulfide cleavage after insertion into the reducing environment inside a cell, resulting in dequenching of the probe. Thus, the fluorescence of the pHLIP-FIRE probe is enhanced upon cell-insertion in the targeted tissues but is suppressed elsewhere due to quenching. Targeting studies in mice bearing breast tumors show strong signaling by pHLIP-FIRE, with a contrast index of ∼17, demonstrating (i) direct imaging of pHLIP insertion and (ii) cargo translocation in vivo. Imaging and targeted cargo delivery should each have clinical applications. PMID:25184440
Transposon integration enhances expression of stress response genes.
Feng, Gang; Leem, Young-Eun; Levin, Henry L
2013-01-01
Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.
Transposon integration enhances expression of stress response genes
Feng, Gang; Leem, Young-Eun; Levin, Henry L.
2013-01-01
Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295
Yamashita, Shinya; Tanemura, Masahiro; Sawada, Genta; Moon, Jeongho; Shimizu, Yosuke; Yamaguchi, Toshiki; Kuwai, Toshio; Urata, Yasuo; Kuraoka, Kazuya; Hatanaka, Nobutaka; Yamashita, Yoshinori; Taniyama, Kiyomi
2018-01-01
The placement of a self-expanding metallic stent (SEMS) in obstructive colorectal cancer (OCRC) is acknowledged to be a safe and effective procedure for the relief of obstruction. However, there is concern that shear forces acting on the tumor during stent expansion may release cancer cells into the circulation, resulting in a poor prognosis. The aim of the present study was to determine whether colonic stent insertion increases viable circulating tumor cells (v-CTCs). A telomerase-specific replication-selective adenovirus-expressing GFP (TelomeScanF35) detection system was used to detect v-CTCs in 8 OCRC patients with a SEMS before and after stent insertion and after surgical resection. In 7 patients, a SEMS was inserted as a bridge to surgery (BTS), and in one patient, a SEMS was inserted for palliation. Surgical resection (R0) was performed in 7 patients. Four patients had no v-CTCs before SEMS placement, two of four measurable patients had an increased number of v-CTCs after SEMS placement (1–3 v-CTCs), and one of two patients with increased v-CTCs developed distant lymphatic metastasis despite curative resection. Four patients had v-CTCs (1–19 cells) before SEMS placement, and two of these four patients had an increase in the number of v-CTCs (20–21 cells) after SEMS placement, while one of the four patients died early with distant metastasis. The present study demonstrated that endoscopic stent insertion for OCRC may result in tumor cell dissemination into the peripheral circulation and may induce distant metastases. PMID:29391884
Yamashita, Shinya; Tanemura, Masahiro; Sawada, Genta; Moon, Jeongho; Shimizu, Yosuke; Yamaguchi, Toshiki; Kuwai, Toshio; Urata, Yasuo; Kuraoka, Kazuya; Hatanaka, Nobutaka; Yamashita, Yoshinori; Taniyama, Kiyomi
2018-01-01
The placement of a self-expanding metallic stent (SEMS) in obstructive colorectal cancer (OCRC) is acknowledged to be a safe and effective procedure for the relief of obstruction. However, there is concern that shear forces acting on the tumor during stent expansion may release cancer cells into the circulation, resulting in a poor prognosis. The aim of the present study was to determine whether colonic stent insertion increases viable circulating tumor cells (v-CTCs). A telomerase-specific replication-selective adenovirus-expressing GFP (TelomeScanF35) detection system was used to detect v-CTCs in 8 OCRC patients with a SEMS before and after stent insertion and after surgical resection. In 7 patients, a SEMS was inserted as a bridge to surgery (BTS), and in one patient, a SEMS was inserted for palliation. Surgical resection (R0) was performed in 7 patients. Four patients had no v-CTCs before SEMS placement, two of four measurable patients had an increased number of v-CTCs after SEMS placement (1-3 v-CTCs), and one of two patients with increased v-CTCs developed distant lymphatic metastasis despite curative resection. Four patients had v-CTCs (1-19 cells) before SEMS placement, and two of these four patients had an increase in the number of v-CTCs (20-21 cells) after SEMS placement, while one of the four patients died early with distant metastasis. The present study demonstrated that endoscopic stent insertion for OCRC may result in tumor cell dissemination into the peripheral circulation and may induce distant metastases.
BSM Delta qualification 2, volume 1
NASA Technical Reports Server (NTRS)
1994-01-01
This report, presented in three volumes, provides the results of a two-motor Delta Qualification 2 program conducted in 1993 to certify the following enhancements for incorporation into Booster Separation Motor (BSM) flight hardware: (1) vulcanized-in-place nozzle aft closure insulation; (2) new isostatic ATJ bulk graphite throat insert material; (3) adhesive EA 9394 for bonding the nozzle throat, igniter grain rod/centering insert/igniter case; (4) deletion of the igniter adapter insulator ring; (5) deletion of igniter adapter/igniter case interface RTV; and (6) deletion of Loctite from igniter retainer plate threads. The enhancements above directly resulted from (1) the BSM Total Quality Management (TQM) Team initiatives to enhance the BSM producibility, and (2) the necessity to qualify new throat insert and adhesive systems to replace existing materials that will not be available. Testing was completed at both the component and motor levels. Component testing was accomplished to screen candidate materials (e.g., throat materials, adhesive systems) and to optimize processes (e.g., aft closure insulator vulcanization approach) prior to their incorporation into the test motors. Motor testing - consisting of two motors, randomly selected by USBI's onsite quality personnel from production lot AAY, which were modified to accept the enhancements - were completed to provide the final qualification of the enhancements for incorporation into flight hardware. It is concluded that all of the enhancements herein tested are qualified to be incorporated into flight hardware for the BSM.
Rest Intervals Reduce the Number of Loading Bouts Required to Enhance Bone Formation
Srinivasan, Sundar; Ausk, Brandon J.; Bain, Steven D.; Gardiner, Edith M.; Kwon, Ronald Y.; Gross, Ted S.
2015-01-01
Purpose As our society becomes increasingly sedentary, compliance with exercise regimens that require numerous high-energy activities each week become less likely. Alternatively, given an osteogenic exercise intervention that required minimal effort, it is reasonable to presume that participation would be enhanced. Insertion of brief rest-intervals between each cycle of mechanical loading holds potential to achieve this result as substantial osteoblast function is activated by many fewer loading repetitions within each loading bout. Here, we examined the complementary hypothesis that the number of bouts/wk of rest-inserted loading could be reduced from 3/wk without loss of osteogenic efficacy. Methods We conducted a series of 3 wk in vivo experiments that non-invasively exposed the right tibiae of mice to either cyclic (1 Hz) or rest-inserted loading interventions and quantified osteoblast function via dynamic histomorphometry. Results While reducing loading bouts from 3/wk (i.e., 9 total bouts) to 1/wk (3 total bouts) effectively mitigated the osteogenic benefit of cyclic loading, the same reduction did not significantly reduce periosteal bone formation parameters induced by rest-inserted loading. The osteogenic response was robust to the timing of the rest-inserted loading bouts (3 bouts in the first week vs 1 bout/wk for three weeks). However, elimination of any single bout of the three 1/wk bouts mitigated the osteogenic response to rest-inserted loading. Finally, periosteal osteoblast function assessed after the 3 wk intervention was not sensitive to the timing or number of rest-inserted loading bouts. Conclusions We conclude that rest-inserted loading holds potential to retain the osteogenic benefits of mechanical loading with significantly reduced frequency of bouts of activity while also enabling greater flexibility in the timing of the activity. PMID:25207932
BSM Delta Qualification 2, volume 3, book 2
NASA Technical Reports Server (NTRS)
1994-01-01
This report, presented in three volumes, provides the results of a two-motor Delta Qualification 2 program conducted in 1993 to certify the following enhancements for incorporation into booster separation motor (BSM0 flight hardware: vulcanized-in-place nozzle aft closure insulation; new iso-static ATJ bulk graphite throat insert material, adhesive EA9394 for bonding the nozzle throat, igniter grain rod/centering insert/igniter case; deletion of the igniter adapter insulator ring; deletion of the igniter adapter/igniter case interface RTV; and deletion of loctite from igniter retainer plate threads. The enhancements above directly resulted from (1) the BSM total quality management (TQM) team initiatives to enhance the BSM producibility, and (2) the necessity to qualify new throat insert and adhesive systems to replace existing materials that will not be available. Testing was completed at both the component and motor levels. Component testing was accomplished to screen candidate materials (e.g., throat materials, adhesive systems) and to optimize processes (e.g., aft closure insulator vulcanization approach) prior to their incorporation into the test motors. Motor testing--consisting of two motors, randomly selected by USBI's on-site quality personnel from production lot AAY, which were modified to accept the enhancements -- was completed to provide the final qualification of the enhancements for incorporation into flight hardware. Volume 3, Book 2 provides various supporting documentation to the previous volumes with regards to the testing of the two Delta qualification units: data acceptance records, thermal conditioning analysis, igniter adapter thermal flake analysis, laboratory adhesive (EA-9394) qualification report, throat insert thermal/structural analysis, Delta Qualification Nonconformance Reports (NCR's), O-ring seating tests, and interim test report for vulcanization process qualification.
Indel detection from DNA and RNA sequencing data with transIndel.
Yang, Rendong; Van Etten, Jamie L; Dehm, Scott M
2018-04-19
Insertions and deletions (indels) are a major class of genomic variation associated with human disease. Indels are primarily detected from DNA sequencing (DNA-seq) data but their transcriptional consequences remain unexplored due to challenges in discriminating medium-sized and large indels from splicing events in RNA-seq data. Here, we developed transIndel, a splice-aware algorithm that parses the chimeric alignments predicted by a short read aligner and reconstructs the mid-sized insertions and large deletions based on the linear alignments of split reads from DNA-seq or RNA-seq data. TransIndel exhibits competitive or superior performance over eight state-of-the-art indel detection tools on benchmarks using both synthetic and real DNA-seq data. Additionally, we applied transIndel to DNA-seq and RNA-seq datasets from 333 primary prostate cancer patients from The Cancer Genome Atlas (TCGA) and 59 metastatic prostate cancer patients from AACR-PCF Stand-Up- To-Cancer (SU2C) studies. TransIndel enhanced the taxonomy of DNA- and RNA-level alterations in prostate cancer by identifying recurrent FOXA1 indels as well as exitron splicing in genes implicated in disease progression. Our study demonstrates that transIndel is a robust tool for elucidation of medium- and large-sized indels from DNA-seq and RNA-seq data. Including RNA-seq in indel discovery efforts leads to significant improvements in sensitivity for identification of med-sized and large indels missed by DNA-seq, and reveals non-canonical RNA-splicing events in genes associated with disease pathology.
The use of transient evoked otoacoustic emissions as a hearing screen following grommet insertion.
Dale, O T; McCann, L J; Thio, D; Wells, S C; Drysdale, A J
2011-07-01
This study aimed to evaluate the sensitivity of transient evoked otoacoustic emission testing as a screening tool for hearing loss in children, after grommet insertion. A prospective study was conducted of 48 children (91 ears) aged three to 16 years who had undergone grommet insertion for glue ear. At post-operative review, pure tone audiometry was performed followed by transient evoked otoacoustic emission testing. Outcomes for both tests, in each ear, were compared. The pure tone audiometry threshold was ≤ 20 dB in 85 ears (93.4 per cent), 25 dB in two ears (2.2 per cent) and ≥ 30 dB in four ears (4.4 per cent). Transient evoked otoacoustic emissions were detected in 69 ears (75.8 per cent). The sensitivity of transient evoked otoacoustic emission testing for detecting hearing loss was 100 per cent for ≥ 30 dB loss but only 66.7 per cent for ≥ 25 dB loss. Transient evoked otoacoustic emission testing offers a sensitive means of detecting hearing loss of ≥ 30 dB following grommet insertion in children. However, the use of such testing as a screening tool may miss some cases of mild hearing loss.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peters, J.J.; Barnard, D.J.; Hsu, D.K.
2005-04-09
Metallic inserts are embedded into composite honeycomb sandwiches as hard points for mechanical connections. Air-coupled ultrasound can be used for detecting disbonds between the insert and the facesheet. It was discovered in such inspections that a surprisingly large amplitude could be transmitted through thick metallic inserts (e.g. 0.75'' thick and 1.5'' diameter), whereas a thin plate of the same material will transmit a much weaker signal. This paper reports an experimental and analytic study of the geometrical effect of inserts on transmitted UT signals. Modal analyses of cylindrical inserts were made using the finite element code ANSYS. The transmission efficiencymore » or air-coupled ultrasound correlated well with the longitudinal vibration mode of the cylinder.« less
Redundant via insertion in self-aligned double patterning
NASA Astrophysics Data System (ADS)
Song, Youngsoo; Jung, Jinwook; Shin, Youngsoo
2017-03-01
Redundant via (RV) insertion is employed to enhance via manufacturability, and has been extensively studied. Self-aligned double patterning (SADP) process, brings a new challenge to RV insertion since newly created cut for each RV insertion has to be taken care of. Specifically, when a cut for RV, which we simply call RV-cut, is formed, cut conflict may occur with nearby line-end cuts, which results in a decrease in RV candidates. We introduce cut merging to reduce the number of cut conflicts; merged cuts are processed with stitch using litho-etch-litho-etch (LELE) multi-patterning method. In this paper, we propose a new RV insertion method with cut merging in SADP for the first time. In our experiments, a simple RV insertion yields 55.3% vias to receives RVs; our proposed method that considers cut merging increases that number to 69.6% on average of test circuits.
NASA Astrophysics Data System (ADS)
Venkitaraj, K. P.; Suresh, S.; Alwin Mathew, T.; Bibin, B. S.; Abraham, Jisa
2018-03-01
Nanofluids are advanced heat transfer fluids that exhibit thermal properties superior than that of the conventional fluids such as water, oil etc. This paper reports the experimental study on convective heat transfer characteristics of water based titanium dioxide nanofluids in fully developed flow through a uniformly heated pipe heat exchanger fitted with modified butterfly inserts. Nanofluids are prepared by dispersing TiO2 nanoparticles of average particle size 29 nm in deionized water. The heat transfer experiments are performed in laminar regime using nanofluids prepared with 0.1% and 0.3% volume fractions of TiO2 nanoparticles. The thermal performance characteristics of conventional butterfly inserts and modified butterfly inserts are also compared using TiO2 nanofluid. The inserts with different pitches 6 cm, 9 cm and 12 cm are tested to determine the effect of pitch distance of inserts in the heat transfer and friction. The experimental results showed that the modification made in the butterfly inserts were able to produce higher heat transfer than conventional butterfly inserts.
Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra
2009-01-01
The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778
Hudak, Steven J.; McGeady, James; Shindel, Alan W.; Breyer, Benjamin N.
2013-01-01
Introduction Self-insertion of penile foreign bodies is performed worldwide, largely due to a perception that it will enhance sexual performance and virility. There are relatively few cases reported in the United States. Aim We report three cases of Hispanic men incarcerated in separate southwest United States prisons who utilized a similar technique to insert foreign bodies fabricated out of dominos into the subcutaneous tissues of the penis. Methods Details of the three cases were retrospectively reviewed. Main Outcome Measure Resolution of the case. Results In each case, an incarcerated Hispanic male or fellow inmate filed a domino into a unique shape for placement under the penile skin. Utilizing the tip of a ballpoint pen or a sharpened shard of plastic to create a puncture wound, each man inserted the domino fragment into the subcutaneous tissue of the penis. All three men presented with infection requiring operative removal. Conclusions Incarcerated males put themselves at risk for injury and infection when attempting penile enhancement with improvised equipment. PMID:22081893
Hudak, Steven J; McGeady, James; Shindel, Alan W; Breyer, Benjamin N
2012-02-01
Self-insertion of penile foreign bodies is performed worldwide, largely due to a perception that it will enhance sexual performance and virility. There are relatively few cases reported in the United States. We report three cases of Hispanic men incarcerated in separate southwest United States prisons who utilized a similar technique to insert foreign bodies fabricated out of dominos into the subcutaneous tissues of the penis. Details of the three cases were retrospectively reviewed. Resolution of the case. In each case, an incarcerated Hispanic male or fellow inmate filed a domino into a unique shape for placement under the penile skin. Utilizing the tip of a ballpoint pen or a sharpened shard of plastic to create a puncture wound, each man inserted the domino fragment into the subcutaneous tissue of the penis. All three men presented with infection requiring operative removal. Incarcerated males put themselves at risk for injury and infection when attempting penile enhancement with improvised equipment. © 2011 International Society for Sexual Medicine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Yukun; Wang, Shuai; Feng, Lungang
In this study, gallium nitride (GaN) based light-emitting diodes (LEDs) with single and multiple hole-reservoir layers (HRLs) inserted in the electron-blocking layer (EBL) have been investigated numerically and experimentally. According to simulation results, a better electron confinement and a higher hole injection level can be achieved by the multiple HRLs inserted in the EBL region. To further reveal the underlying mechanism of hole injection enhancement experimentally, the active regions were intentionally designed to emit photons with three different wavelengths of 440 nm, 460 nm, and 480 nm, respectively. Based on the experimental results of photoluminescence (PL) and time-resolved PL (TRPL) measurements conducted atmore » 298 K, the remarkable enhancement (148%) of PL intensities and significant increase in the decay times of the quantum wells close to p-GaN can be obtained. Therefore, the mechanism is proposed that carriers are able to reserve in the EBL region with multiple HRLs for a much longer time. Meanwhile, carriers could diffuse into the active region by tunnelling and/or thermo-electronic effect and then recombine efficiently, leading to the better carrier reservoir effect and higher hole injection in LEDs. As a result, by inserting multiple HRLs in the EBL region instead of single HRL, the experimental external quantum efficiency is enhanced by 19.8%, while the serious droop ratio is markedly suppressed from 37.0% to 27.6% at the high current injection of 100 A/cm{sup 2}.« less
A Novel Assay for the Identification of NOTCH1 PEST Domain Mutations in Chronic Lymphocytic Leukemia
Petroni, Roberta Cardoso; Muto, Nair Hideko; Sitnik, Roberta; de Carvalho, Flavia Pereira; Bacal, Nydia Strachman; Velloso, Elvira Deolinda Rodrigues Pereira; Oliveira, Gislaine Borba; Pinho, João Renato Rebello; Torres, Davi Coe; Mansur, Marcela Braga; Hassan, Rocio; Lorand-Metze, Irene Gyongyvér Heidemarie; Chiattone, Carlos Sérgio; Hamerschlak, Nelson; Mangueira, Cristovão Luis Pitangueira
2016-01-01
Aims. To develop a fast and robust DNA-based assay to detect insertions and deletions mutations in exon 34 that encodes the PEST domain of NOTCH1 in order to evaluate patients with chronic lymphocytic leukemia (CLL). Methods. We designed a multiplexed allele-specific polymerase chain reaction (PCR) combined with a fragment analysis assay to detect specifically the mutation c.7544_7545delCT and possibly other insertions and deletions in exon 34 of NOTCH1. Results. We evaluated our assay in peripheral blood samples from two cohorts of patients with CLL. The frequency of NOTCH1 mutations was 8.4% in the first cohort of 71 unselected CLL patients. We then evaluated a second cohort of 26 CLL patients with known cytogenetic abnormalities that were enriched for patients with trisomy 12. NOTCH1 mutations were detected in 43.7% of the patients with trisomy 12. Conclusions. We have developed a fast and robust assay combining allele-specific PCR and fragment analysis able to detect NOTCH1 PEST domain insertions and deletions. PMID:28074183
IUD knowledge and experience among family medicine residents.
Schubert, Finn D; Herbitter, Cara; Fletcher, Jason; Gold, Marji
2015-06-01
The intrauterine device (IUD) is a highly effective contraceptive method with few contraindications; however, clinician lack of training in insertion and misconceptions about IUD risks are barriers to utilization. Previous research has shown gaps in IUD training in family medicine residency programs. An online survey addressing experience with IUD insertion, knowledge of patient eligibility and IUD risks, and intent to insert IUDs in practice was circulated to residents at 15 US family medicine residency programs. Programs were eligible to participate if they were receiving funding to enhance training in family planning and abortion care and interested in additional support to enhance IUD training. The overall response rate for the surveys was 76.1% (332/436). Experience with the levonorgestrel intrauterine system was more common than with the copper IUD. Residents performed well on knowledge questions, but many would not insert in common patient scenarios in which insertion was not contraindicated, including a history of sexually transmitted infection in the past 6 months (48.2% would not insert), a history of ectopic pregnancy (37.0%), no pap smear in the past year (30.7%), or if the patient was not in a monogamous relationship (29.2%). The vast majority of residents (88.7%) reported that they were likely or very likely to provide IUDs in their future family medicine practice. Although residents overwhelmingly expressed interest in providing IUDs after residency, our results suggest that additional clinical and didactic training is needed, particularly interventions targeted at dispelling misconceptions about patient eligibility for IUDs.
Furusho, Junji; Kobayashi, Hiroshi; Kikuchi, Takehito; Yamamoto, Tatsuro; Tanaka, Hidekazu; Terayama, Motokazu; Monden, Morito
2008-01-01
The purpose of this study is to realize the mechanically-controllable needle-insertion system using the CMTD (Curved Multi-Tube Device) which was developed by Furusho Laboratory. A CMTD, was developed for minimally-invasive surgery and needle insertion. And we use ultrasonograph as a sensing device to detect the position of bible duct or tumor and the orientation and position of the needle which is inserted into liver. This system makes safe minimally-invasive surgery possible, because all complex mechanisms are arranged outside of the body.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brooks, Robert T.
A transition duct system (100) for routing a gas flow from a combustor (102) to the first stage (104) of a turbine section (106) in a combustion turbine engine (108), wherein the transition duct system (100) includes one or more converging flow joint inserts (120) forming a trailing edge (122) at an intersection (124) between adjacent transition ducts (126, 128) is disclosed. The transition duct system (100) may include a transition duct (126, 128) having an internal passage (130) extending between an inlet (132, 184) to an outlet (134, 186) and may expel gases into the first stage turbine (104)more » with a tangential component. The converging flow joint insert (120) may be contained within a converging flow joint insert receiver (136) and disconnected from the transition duct bodies (126, 128) by which the converging flow joint insert (120) is positioned. Being disconnected eliminates stress formation within the converging flow joint insert (120), thereby enhancing the life of the insert. The converging flow joint insert (120) may be removable such that the insert (120) can be replaced once worn beyond design limits.« less
Wang, Qingguo; Jia, Peilin; Zhao, Zhongming
2015-01-01
Fueled by widespread applications of high-throughput next generation sequencing (NGS) technologies and urgent need to counter threats of pathogenic viruses, large-scale studies were conducted recently to investigate virus integration in host genomes (for example, human tumor genomes) that may cause carcinogenesis or other diseases. A limiting factor in these studies, however, is rapid virus evolution and resulting polymorphisms, which prevent reads from aligning readily to commonly used virus reference genomes, and, accordingly, make virus integration sites difficult to detect. Another confounding factor is host genomic instability as a result of virus insertions. To tackle these challenges and improve our capability to identify cryptic virus-host fusions, we present a new approach that detects Virus intEgration sites through iterative Reference SEquence customization (VERSE). To the best of our knowledge, VERSE is the first approach to improve detection through customizing reference genomes. Using 19 human tumors and cancer cell lines as test data, we demonstrated that VERSE substantially enhanced the sensitivity of virus integration site detection. VERSE is implemented in the open source package VirusFinder 2 that is available at http://bioinfo.mc.vanderbilt.edu/VirusFinder/.
BSM Delta Qualification 2, volume 2
NASA Technical Reports Server (NTRS)
1994-01-01
This report, presented in three volumes, provides the results of a two-motor Delta Qualification 2 program conducted in 1993 to certify the following enhancements for incorporation into booster separation motor (BSM) flight hardware: vulcanized-in-place nozzle aft closure insulation; new iso-static ATJ bulk graphite throat insert material; adhesive EA 9394 for bonding the nozzle throat, igniter grain rod/centering insert/igniter case; deletion of the igniter adapter insulator ring; deletion of the igniter adapter/igniter case interface RTV; and deletion of loctite from igniter retainer plate threads. The enhancements above directly resulted from (1) the BSM total quality management (TQM) team initiatives to enhance the BSM producibility, and (2) the necessity to qualify new throat insert and adhesive systems to replace existing materials that will not be available. Testing was completed at both the component and motor levels. Component testing was accomplished to screen candidate materials (e.g., throat materials, adhesive systems) and to optimize processes (e.g., aft closure insulator vulcanization approach) prior to their incorporation into the test motors. Motor tests -- consisting of two motors, randomly selected by USBI's on-site quality personnel from production lot AAY, which were modified to accept the enhancements -- were completed to provide the final qualification of the enhancements for incorporation into flight hardware. Volume 2 details the environmental testing (vibration and shock) conducted at Marshall Space Flight Center (MSFC) to which the motors were subjected prior to static tests.
Identification of elemental mercury in the subsurface
Jackson, Dennis G
2015-01-06
An apparatus and process is provided for detecting elemental mercury in soil. A sacrificial electrode of aluminum is inserted below ground to a desired location using direct-push/cone-penetrometer based equipment. The insertion process removes any oxides or previously found mercury from the electrode surface. Any mercury present adjacent the electrode can be detected using a voltmeter which indicates the presence or absence of mercury. Upon repositioning the electrode within the soil, a fresh surface of the aluminum electrode is created allowing additional new measurements.
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Astrophysics Data System (ADS)
Zhu, Xiao; Xing, Da
2012-12-01
A new label-free isothermal fluorescence amplification detection for nucleic acid has been developed. In this paper, we first developed a novel sensitive and specific detection platform with an unmodified hairpin probe (HP) combination of the graphene oxid (GO)/ SYBR green I dye (SG), which was relied on the selective principle of adsorption and the high quenching efficiency of GO. Then for the application of this new strategy, we used Mirco RNA-21 (Mir-21) as the target to evaluate this working principle of our design. When the target was hybridizing with the HP and inducing its conformation of change, an efficient isothermal circular strand-displacement polymerization reaction was activating to assist the first signal amplification. In this format, the formed complex conformation of DNA would interact with its high affinity dye, then detached from the surface of GO after incubating with the platform of GO/intercalating dye. This reaction would accompany with obvious fluorescence recovery, and accomplish farther signal enhancement by a mass of intercalating dye inserting into the minor groove of the long duplex replication product. By taking advantage of the multiple amplification of signal, this method exerted substantial enhancement in sensitivity and could be used for rapid and selective detection of Mir-21 with attomole range. It is expected that this cost-effective GO based sensor might hold considerable potential to apply in bioanalysis studies.
Casanova, Fernando; Carney, Paul R; Sarntinoranont, Malisa
2014-01-01
Flow back along a needle track (backflow) can be a problem during direct infusion, e.g. convection-enhanced delivery (CED), of drugs into soft tissues such as brain. In this study, the effect of needle insertion speed on local tissue injury and backflow was evaluated in vivo in the rat brain. Needles were introduced at three insertion speeds (0.2, 2, and 10 mm/s) followed by CED of Evans blue albumin (EBA) tracer. Holes left in tissue slices were used to reconstruct penetration damage. These measurements were also input into a hyperelastic model to estimate radial stress at the needle-tissue interface (pre-stress) before infusion. Fast insertion speeds were found to produce more tissue bleeding and disruption; average hole area at 10 mm/s was 1.87-fold the area at 0.2 mm/s. Hole measurements also differed at two fixation time points after needle retraction, 10 and 25 min, indicating that pre-stresses are influenced by time-dependent tissue swelling. Calculated pre-stresses were compressive (0 to 485 Pa) and varied along the length of the needle with smaller average values within white matter (116 Pa) than gray matter (301 Pa) regions. Average pre-stress at 0.2 mm/s (351.7 Pa) was calculated to be 1.46-fold the value at 10 mm/s. For CED backflow experiments (0.5, 1, and 2 µL/min), measured EBA backflow increased as much as 2.46-fold between 10 and 0.2 mm/s insertion speeds. Thus, insertion rate-dependent damage and changes in pre-stress were found to directly contribute to the extent of backflow, with slower insertion resulting in less damage and improved targeting.
Verification of Triple Modular Redundancy (TMR) Insertion for Reliable and Trusted Systems
NASA Technical Reports Server (NTRS)
Berg, Melanie; LaBel, Kenneth A.
2016-01-01
We propose a method for TMR insertion verification that satisfies the process for reliable and trusted systems. If a system is expected to be protected using TMR, improper insertion can jeopardize the reliability and security of the system. Due to the complexity of the verification process, there are currently no available techniques that can provide complete and reliable confirmation of TMR insertion. This manuscript addresses the challenge of confirming that TMR has been inserted without corruption of functionality and with correct application of the expected TMR topology. The proposed verification method combines the usage of existing formal analysis tools with a novel search-detect-and-verify tool. Field programmable gate array (FPGA),Triple Modular Redundancy (TMR),Verification, Trust, Reliability,
Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.
2017-01-01
M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507
Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons
2017-01-01
M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.
Register file soft error recovery
Fleischer, Bruce M.; Fox, Thomas W.; Wait, Charles D.; Muff, Adam J.; Watson, III, Alfred T.
2013-10-15
Register file soft error recovery including a system that includes a first register file and a second register file that mirrors the first register file. The system also includes an arithmetic pipeline for receiving data read from the first register file, and error detection circuitry to detect whether the data read from the first register file includes corrupted data. The system further includes error recovery circuitry to insert an error recovery instruction into the arithmetic pipeline in response to detecting the corrupted data. The inserted error recovery instruction replaces the corrupted data in the first register file with a copy of the data from the second register file.
Tsai, Wei-Yu; Huang, Guan-Rong; Wang, Kuang-Kuo; Chen, Chin-Fu; Huang, J. C.
2017-01-01
Aluminum alloys, which serve as heat sink in light-emitting diode (LED) lighting, are often inherent with a high thermal conductivity, but poor thermal total emissivity. Thus, high emissive coatings on the Al substrate can enhance the thermal dissipation efficiency of radiation. In this study, the ultrasonic mechanical coating and armoring (UMCA) technique was used to insert various ceramic combinations, such as Al2O3, SiO2, or graphite, to enhance thermal dissipation. Analytic models have been established to couple the thermal radiation and convection on the sample surface through heat flow equations. A promising match has been reached between the theoretical predictions and experimental measurements. With the adequate insertion of ceramic powders, the temperature of the Al heat sinks can be lowered by 5–11 °C, which is highly favorable for applications requiring cooling components. PMID:28772814
Tsai, Wei-Yu; Huang, Guan-Rong; Wang, Kuang-Kuo; Chen, Chin-Fu; Huang, J C
2017-04-26
Aluminum alloys, which serve as heat sink in light-emitting diode (LED) lighting, are often inherent with a high thermal conductivity, but poor thermal total emissivity. Thus, high emissive coatings on the Al substrate can enhance the thermal dissipation efficiency of radiation. In this study, the ultrasonic mechanical coating and armoring (UMCA) technique was used to insert various ceramic combinations, such as Al₂O₃, SiO₂, or graphite, to enhance thermal dissipation. Analytic models have been established to couple the thermal radiation and convection on the sample surface through heat flow equations. A promising match has been reached between the theoretical predictions and experimental measurements. With the adequate insertion of ceramic powders, the temperature of the Al heat sinks can be lowered by 5-11 °C, which is highly favorable for applications requiring cooling components.
2016-02-01
certification process. INTRODUCTION The ultrasonic inspection of aerospace composites has been demonstrated to be one of the most effective methods to...normal part conditions. Anomalous indications studied in this program include inserted materials, porosity, ply ‘laps and gaps’, and wrinkles . Inserted...partially scanned inserts at the radii. Wrinkles , laps and gaps have also been included in the truth table, but detection rates for these flaws are
Shiely, Amy E; Slattery, Catherine N; Ford, Alan; Eccles, Kevin S; Lawrence, Simon E; Maguire, Anita R
2017-03-22
Enantioselectivities in C-H insertion reactions, employing the copper-bis(oxazoline)-NaBARF catalyst system, leading to cyclopentanones are highest with sulfonyl substituents on the carbene carbon, and furthermore, the impact is enhanced by increased steric demand on the sulfonyl substituent (up to 91%ee). Enantioselective intramolecular C-H insertion reactions of α-diazo-β-keto phosphine oxides and 2-diazo-1,3-diketones are reported for the first time.
NASA Astrophysics Data System (ADS)
Lee, Jooran; Choi, Sunyoung; Bae, Seon Joo; Yoon, Seok Min; Choi, Joon Sig; Yoon, Minjoong
2013-10-01
Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes.Nanoscale cell injection techniques combined with nanoscopic photoluminescence (PL) spectroscopy have been important issues in high-resolution optical biosensing, gene and drug delivery and single-cell endoscopy for medical diagnostics and therapeutics. However, the current nanoinjectors remain limited for optical biosensing and communication at the subwavelength level, requiring an optical probe such as semiconductor quantum dots, separately. Here, we show that waveguided red emission is observed at the tip of a single visible light-sensitive APTES-modified ZnO nanowire (APTES-ZnO NW) and it exhibits great enhancement upon interaction with a complementary sequence-based double stranded (ds) DNA, whereas it is not significantly affected by non-complementary ds DNA. Further, the tip of a single APTES-ZnO NW can be inserted into the subcellular region of living HEK 293 cells without significant toxicity, and it can also detect the enhancement of the tip emission from subcellular regions with high spatial resolution. These results indicate that the single APTES-ZnO NW would be useful as a potent nanoinjector which can guide visible light into intracellular compartments of mammalian cells, and can also detect nanoscopic optical signal changes induced by interaction with the subcellular specific target biomolecules without separate optical probes. Electronic supplementary information (ESI) available: Synthesis of APTES-modified ZnO nanowires, DNA functionalization and spectroscopic measurements with additional fluorescence image ad fluorescence decay times, cell culture, injection of a single nanowire into living cells, subcellular imaging and determination of cytotoxicity. See DOI: 10.1039/c3nr03042c
Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young
2017-08-15
Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.
Towards the use of computationally inserted lesions for mammographic CAD assessment
NASA Astrophysics Data System (ADS)
Ghanian, Zahra; Pezeshk, Aria; Petrick, Nicholas; Sahiner, Berkman
2018-03-01
Computer-aided detection (CADe) devices used for breast cancer detection on mammograms are typically first developed and assessed for a specific "original" acquisition system, e.g., a specific image detector. When CADe developers are ready to apply their CADe device to a new mammographic acquisition system, they typically assess the CADe device with images acquired using the new system. Collecting large repositories of clinical images containing verified cancer locations and acquired by the new image acquisition system is costly and time consuming. Our goal is to develop a methodology to reduce the clinical data burden in the assessment of a CADe device for use with a different image acquisition system. We are developing an image blending technique that allows users to seamlessly insert lesions imaged using an original acquisition system into normal images or regions acquired with a new system. In this study, we investigated the insertion of microcalcification clusters imaged using an original acquisition system into normal images acquired with that same system utilizing our previously-developed image blending technique. We first performed a reader study to assess whether experienced observers could distinguish between computationally inserted and native clusters. For this purpose, we applied our insertion technique to clinical cases taken from the University of South Florida Digital Database for Screening Mammography (DDSM) and the Breast Cancer Digital Repository (BCDR). Regions of interest containing microcalcification clusters from one breast of a patient were inserted into the contralateral breast of the same patient. The reader study included 55 native clusters and their 55 inserted counterparts. Analysis of the reader ratings using receiver operating characteristic (ROC) methodology indicated that inserted clusters cannot be reliably distinguished from native clusters (area under the ROC curve, AUC=0.58±0.04). Furthermore, CADe sensitivity was evaluated on mammograms with native and inserted microcalcification clusters using a commercial CADe system. For this purpose, we used full field digital mammograms (FFDMs) from 68 clinical cases, acquired at the University of Michigan Health System. The average sensitivities for native and inserted clusters were equal, 85.3% (58/68). These results demonstrate the feasibility of using the inserted microcalcification clusters for assessing mammographic CAD devices.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Shin, Sung Joon; Lee, Ji-Ho; Lee, Jae Hyup
2017-07-01
A prospective, within-patient, left-right comparative study. To evaluate the efficacy of hydroxyapatite (HA) stick augmentation method by comparing the insertional torque of the pedicle screw in osteoporotic and nonosteoporotic patients. Unsatisfactory clinical outcomes after spine surgery in osteoporotic patients are related to pedicle screw loosening or pull-outs. HA, as a bone graft extender, has a possibility to enhance the fixation strength at the bone-screw interface. From November 2009 to December 2010, among patients who required bilateral pedicle screw fixation for lumbar spine surgery, 22 patients were enrolled, who recieved unilateral HA stick augmentation and completed intraoperative insertional torque measurement of each pedicle screws. On the basis of preoperative evaluation of bone mineral density, patients with osteoporosis had 2 HA sticks inserted unilaterally, and 1 stick for patients without osteoporosis. Pedicle screw loosening and pull-outs were assessed using 12-month postoperative CT scans and follow-up radiographs. Clinical evaluation was done preoperatively and at 1 year postoperatively, based on Visual Analog Scale score, Oswestry Disability Index, and Short Form-36 Health Survey. Regardless of bone mineral density, the average torque value of all pedicle screws with HA stick insertion (HA stick inserted group) was significantly higher than that of all pedicle screws without HA insertion (control group) (P<0.0001). Same results were seen in the HA stick inserted subgroups and the control subgroups within both of the osteoporosis group (P=0.009) and the nonosteoporosis group (P=0.0004). There was no statistically significant difference of the rate of pedicle screw loosening in between the HA stick inserted group and the control group. Clinical evaluation also showed no statistically significant difference in between patients with loosening and those without. The enhancement of initial pedicle screw fixation strength in osteoporotic patients can be achieved by HA stick augmentation.
Robert, Marc-André; Lytvyn, Viktoria; Deforet, Francis; Gilbert, Rénald; Gaillet, Bruno
2017-01-01
Virus-like particles (VLPs) derived from retroviruses and lentiviruses can be used to deliver recombinant proteins without the fear of causing insertional mutagenesis to the host cell genome. In this study we evaluate the potential of an inducible lentiviral vector packaging cell line for VLP production. The Gag gene from HIV-1 was fused to a gene encoding a selected protein and it was transfected into the packaging cells. Three proteins served as model: the green fluorescent protein and two transcription factors-the cumate transactivator (cTA) of the inducible CR5 promoter and the human Krüppel-like factor 4 (KLF4). The sizes of the VLPs were 120-150 nm in diameter and they were resistant to freeze/thaw cycles. Protein delivery by the VLPs reached up to 100% efficacy in human cells and was well tolerated. Gag-cTA triggered up to 1100-fold gene activation of the reporter gene in comparison to the negative control. Protein engineering was required to detect Gag-KLF4 activity. Thus, insertion of the VP16 transactivation domain increased the activity of the VLPs by eightfold. An additional 2.4-fold enhancement was obtained by inserting nuclear export signal. In conclusion, our platform produced VLPs capable of efficient protein transfer, and it was shown that protein engineering can be used to improve the activity of the delivered proteins as well as VLP production.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aihara, Taketo; Fukuyama, Atsuhiko; Yokoyama, Yuki
2014-07-28
To investigate the effect of the miniband formation on the optical absorption spectrum, we adopted two non-destructive methodologies of piezoelectric photothermal (PPT) and photoreflectance (PR) spectroscopies for strain-balanced InGaAs/GaAsP multiple quantum-well (MQW) and superlattice (SL) structures inserted GaAs p-i-n solar cells. Because the barrier widths of the SL sample were very thin, miniband formations caused by coupling the wave functions between adjacent wells were expected. From PR measurements, a critical energy corresponding to the inter-subband transition between first-order electron and hole subbands was estimated for MQW sample, whereas two critical energies corresponding to the mini-Brillouin-zone center (Γ) and edge (π)more » were obtained for SL sample. The miniband width was calculated to be 19 meV on the basis of the energy difference between Γ and π. This coincided with the value of 16 meV calculated using the simple Kronig–Penney potential models. The obtained PPT spectrum for the SL sample was decomposed into the excitonic absorption and inter-miniband transition components. The latter component was expressed using the arcsine-like signal rise corresponding to the Γ point in the mini-Brillouin zone that was enhanced by the Sommerfeld factor. The usefulness of the PPT methodology for investigating the inserted MQW and/or SL structure inserted solar cells is clearly demonstrated.« less
Improved efficiency of nanoneedle insertion by modification with a cell-puncturing protein
NASA Astrophysics Data System (ADS)
Ryu, Seunghwan; Matsumoto, Yuta; Matsumoto, Takahiro; Ueno, Takafumi; Silberberg, Yaron R.; Nakamura, Chikashi
2018-03-01
An atomic force microscope (AFM) probe etched into an ultra-sharp cylindrical shape (a nanoneedle) can be inserted into a living cell and mechanical responses of the insertion process are represented as force-distance curves using AFM. A probe-molecule-functionalized nanoneedle can be used to detect intracellular molecules of interest in situ. The insertion efficiencies of nanoneedles vary among cell types due to the cortex structures of cells, and some cell types, such as mouse fibroblast Balb/3T3 cells, show extremely low efficacy of insertion. We addressed this issue by using a cell membrane puncturing protein from bacteriophage T4 (gp5), a needle-like protein that spontaneously penetrates through the cell membrane. Gp5 was immobilized onto a nanoneedle surface. The insertion efficiency of the functionalized nanoneedle increased by over 15% compared to the non-functionalized control. Gp5-modification is a versatile approach in cell manipulation techniques for the insertion of other types of nanostructures into cells.
Evaluation of air-liquid interface exposure systems for in vitro ...
Exposure of cells to airborne pollutants at the air-liquid interface (ALI) is a more realistic approach than exposures of submerged cells. The published literature, however, describes irreproducible and/or unrealistic experimental conditions using ALI systems. We have compared five ALI systems for their ability to deliver both particulate matter (PM) and gases to cells cultured on porous membrane inserts. The ALI systems use different mechanisms to deliver pollutants to the inserts: diffusion, sedimentation, electrostatic precipitation (ESP), and thermophoresis (THP). We used fluorescent polystyrene latex spheres (PSLs) as a surrogate for PM to assess the efficacy of particle deposition in each system. PM loading in each insert was determined by dissolving the PSLs in ethyl acetate and measuring the fluorescence. Results show that using ESP as an external force enhances deposition of 50-nm PSLs by 5.5-fold and 11-fold for 1-µm PSLs when compared to diffusion alone. Similarly, THP enhances deposition of 50-nm and 1-µm PSLs by 4.5-fold and 2.7-fold, respectively. The interaction of ozone with an indigo dye on the surface of the insert showed that diffusion alone permitted gas-cell interaction. For each system there were various design and operational factors, such as the flow rate, surface materials and flow path geometry that adversely affected performance. Increased flow rates correlated with increased efficacy of the systems to deliver the gas to the inserts.
MSeq-CNV: accurate detection of Copy Number Variation from Sequencing of Multiple samples.
Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi
2018-03-05
Currently a few tools are capable of detecting genome-wide Copy Number Variations (CNVs) based on sequencing of multiple samples. Although aberrations in mate pair insertion sizes provide additional hints for the CNV detection based on multiple samples, the majority of the current tools rely only on the depth of coverage. Here, we propose a new algorithm (MSeq-CNV) which allows detecting common CNVs across multiple samples. MSeq-CNV applies a mixture density for modeling aberrations in depth of coverage and abnormalities in the mate pair insertion sizes. Each component in this mixture density applies a Binomial distribution for modeling the number of mate pairs with aberration in the insertion size and also a Poisson distribution for emitting the read counts, in each genomic position. MSeq-CNV is applied on simulated data and also on real data of six HapMap individuals with high-coverage sequencing, in 1000 Genomes Project. These individuals include a CEU trio of European ancestry and a YRI trio of Nigerian ethnicity. Ancestry of these individuals is studied by clustering the identified CNVs. MSeq-CNV is also applied for detecting CNVs in two samples with low-coverage sequencing in 1000 Genomes Project and six samples form the Simons Genome Diversity Project.
SvABA: genome-wide detection of structural variants and indels by local assembly.
Wala, Jeremiah A; Bandopadhayay, Pratiti; Greenwald, Noah F; O'Rourke, Ryan; Sharpe, Ted; Stewart, Chip; Schumacher, Steve; Li, Yilong; Weischenfeldt, Joachim; Yao, Xiaotong; Nusbaum, Chad; Campbell, Peter; Getz, Gad; Meyerson, Matthew; Zhang, Cheng-Zhong; Imielinski, Marcin; Beroukhim, Rameen
2018-04-01
Structural variants (SVs), including small insertion and deletion variants (indels), are challenging to detect through standard alignment-based variant calling methods. Sequence assembly offers a powerful approach to identifying SVs, but is difficult to apply at scale genome-wide for SV detection due to its computational complexity and the difficulty of extracting SVs from assembly contigs. We describe SvABA, an efficient and accurate method for detecting SVs from short-read sequencing data using genome-wide local assembly with low memory and computing requirements. We evaluated SvABA's performance on the NA12878 human genome and in simulated and real cancer genomes. SvABA demonstrates superior sensitivity and specificity across a large spectrum of SVs and substantially improves detection performance for variants in the 20-300 bp range, compared with existing methods. SvABA also identifies complex somatic rearrangements with chains of short (<1000 bp) templated-sequence insertions copied from distant genomic regions. We applied SvABA to 344 cancer genomes from 11 cancer types and found that short templated-sequence insertions occur in ∼4% of all somatic rearrangements. Finally, we demonstrate that SvABA can identify sites of viral integration and cancer driver alterations containing medium-sized (50-300 bp) SVs. © 2018 Wala et al.; Published by Cold Spring Harbor Laboratory Press.
NASA Astrophysics Data System (ADS)
Qin, Hao; Kumar, Rupesh; Alleaume, Romain
2015-10-01
We report here a new side channel attack on a practical continuous-variable (CV) quantum key distribution (QKD) system. Inspired by blinding attack in discrete-variable QKD, we formalize an attack strategy by inserting an external light into a CV QKD system implemented Gaussian-modulated coherent state protocol and show that our attack can compromise its practical security. In this attack, we concern imperfections of a balanced homodyne detector used in CV QKD. According to our analysis, if one inserts an external light into Bob's signal port, due to the imperfect subtraction from the homodyne detector, the leakage of the external light contributes a displacement on the homodyne signal which causes detector electronics saturation. In consequence, Bob's quadrature measurement is not linear with the quadrature sent by Alice. By considering such vulnerability, a potential Eve can launch a full intercept-resend attack meanwhile she inserts an external light into Bob's signal port. By selecting proper properties of the external light, Eve actively controls the induced displacement value from the inserted light which results saturation of homodyne detection. In consequence, Eve can bias the excess noise due to the intercept-resend attack and the external light, such that Alice and Bob believe their excess noise estimation is below the null key threshold and they can still share a secret key. Our attack shows that the detector loopholes also exist in CV QKD, and it seems influence all the CV QKD systems using homodyne detection, since all the practical detectors have finite detection range.
Method of generating ploynucleotides encoding enhanced folding variants
Bradbury, Andrew M.; Kiss, Csaba; Waldo, Geoffrey S.
2017-05-02
The invention provides directed evolution methods for improving the folding, solubility and stability (including thermostability) characteristics of polypeptides. In one aspect, the invention provides a method for generating folding and stability-enhanced variants of proteins, including but not limited to fluorescent proteins, chromophoric proteins and enzymes. In another aspect, the invention provides methods for generating thermostable variants of a target protein or polypeptide via an internal destabilization baiting strategy. Internally destabilization a protein of interest is achieved by inserting a heterologous, folding-destabilizing sequence (folding interference domain) within DNA encoding the protein of interest, evolving the protein sequences adjacent to the heterologous insertion to overcome the destabilization (using any number of mutagenesis methods), thereby creating a library of variants. The variants in the library are expressed, and those with enhanced folding characteristics selected.
USDA-ARS?s Scientific Manuscript database
Marek’s disease (MD) is a lymphoproliferative disease of chicken caused by serotype 1 MD virus (MDV). Vaccination of commercial poultry has drastically reduced losses from MD and the poultry industry cannot be sustained without the use of vaccines. Retrovirus insertion into herpesviruses genome is a...
Yoon, Seok Min; Lou, Sylvia J; Loser, Stephen; Smith, Jeremy; Chen, Lin X; Facchetti, Antonio; Marks, Tobin J; Marks, Tobin
2012-12-12
Zinc oxide is a promising candidate as an interfacial layer (IFL) in inverted organic photovoltaic (OPV) cells due to the n-type semiconducting properties as well as chemical and environmental stability. Such ZnO layers collect electrons at the transparent electrode, typically indium tin oxide (ITO). However, the significant resistivity of ZnO IFLs and an energetic mismatch between the ZnO and the ITO layers hinder optimum charge collection. Here we report that inserting nanoscopic copper hexadecafluorophthalocyanine (F(16)CuPc) layers, as thin films or nanowires, between the ITO anode and the ZnO IFL increases OPV performance by enhancing interfacial electron transport. In inverted P3HT:PC(61)BM cells, insertion of F(16)CuPc nanowires increases the short circuit current density (J(sc)) versus cells with only ZnO layers, yielding an enhanced power conversion efficiency (PCE) of ∼3.6% vs ∼3.0% for a control without the nanowire layer. Similar effects are observed for inverted PTB7:PC(71)BM cells where the PCE is increased from 8.1% to 8.6%. X-ray scattering, optical, and electrical measurements indicate that the performance enhancement is ascribable to both favorable alignment of the nanowire π-π stacking axes parallel to the photocurrent flow and to the increased interfacial layer-active layer contact area. These findings identify a promising strategy to enhance inverted OPV performance by inserting anisotropic nanostructures with π-π stacking aligned in the photocurrent flow direction.
Casanova, Fernando; Carney, Paul R; Sarntinoranont, Malisa
2014-11-30
Convection enhanced delivery (CED) infuses drugs directly into brain tissue. Needle insertion is required and results in tissue damage which can promote flowback along the needle track and improper targeting. The goal of this study was to evaluate friction stress (calculated from needle insertion force) as a measure of tissue contact and damage during needle insertion for varying insertion speeds. Forces and surface dimpling during needle insertion were measured in rat brain in vivo. Needle retraction forces were used to calculate friction stresses. These measures were compared to track damage from a previous study. Differences between brain tissues and soft hydrogels were evaluated for varying insertion speeds: 0.2, 2, and 10mm/s. In brain tissue, average insertion force and surface dimpling increased with increasing insertion speed. Average friction stress along the needle-tissue interface decreased with insertion speed (from 0.58 ± 0.27 to 0.16 ± 0.08 kPa). Friction stress varied between brain regions: cortex (0.227 ± 0.27 kPa), external capsule (0.222 ± 0.19 kPa), and CPu (0.383 ± 0.30 kPa). Hydrogels exhibited opposite trends for dimpling and friction stress with insertion speed. Previously, increasing needle damage with insertion speed has been measured with histological methods. Friction stress appears to decrease with increasing tissue damage and decreasing tissue contact, providing the potential for in vivo and real time evaluation along the needle track. Force derived friction stress decreased with increasing insertion speed and was smaller within white matter regions. Hydrogels exhibited opposite trends to brain tissue. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhu, D. C.; Su, C. Q.; Deng, Y. D.; Wang, Y. P.; Liu, X.
2017-11-01
Automotive exhaust-based thermoelectric generators are currently a hot topic in energy recovery. The waste heat of automotive exhaust gas can be converted into electricity by means of thermoelectric modules. Generally, inserting fins into the cooling unit contributes to enhancing the heat transfer for a higher power output. However, the introduction of fins will result in a pressure drop in the cooling system. In current research, in order to enhance the heat transfer and avoid a large pressure drop, a cooling unit with cylindrical grooves on the interior surface was proposed. To evaluate the performance of the cylindrical grooves, different inner topologies, including a smooth interior surface,a smooth interior surface with inserted fins and an interior surface with cylindrical grooves, were compared. The results revealed that compared with the smooth interior surface, the smooth interior surface with inserted fins and the interior surface with cylindrical grooves both enhanced the heat transfer, but the interior surface with cylindrical grooves obtained a lower pressure drop. To improve the performance of the cylindrical grooves, different groove-depth ratios were tried, and the results showed that a groove-depth ratio of 0.081 could provide the best overall performance.
NASA Astrophysics Data System (ADS)
Zhu, D. C.; Su, C. Q.; Deng, Y. D.; Wang, Y. P.; Liu, X.
2018-06-01
Automotive exhaust-based thermoelectric generators are currently a hot topic in energy recovery. The waste heat of automotive exhaust gas can be converted into electricity by means of thermoelectric modules. Generally, inserting fins into the cooling unit contributes to enhancing the heat transfer for a higher power output. However, the introduction of fins will result in a pressure drop in the cooling system. In current research, in order to enhance the heat transfer and avoid a large pressure drop, a cooling unit with cylindrical grooves on the interior surface was proposed. To evaluate the performance of the cylindrical grooves, different inner topologies, including a smooth interior surface,a smooth interior surface with inserted fins and an interior surface with cylindrical grooves, were compared. The results revealed that compared with the smooth interior surface, the smooth interior surface with inserted fins and the interior surface with cylindrical grooves both enhanced the heat transfer, but the interior surface with cylindrical grooves obtained a lower pressure drop. To improve the performance of the cylindrical grooves, different groove-depth ratios were tried, and the results showed that a groove-depth ratio of 0.081 could provide the best overall performance.
Volkov, Alexander G; Nyasani, Eunice K; Tuckett, Clayton; Scott, Jessenia M; Jackson, Mariah M Z; Greeman, Esther A; Greenidge, Ariane S; Cohen, Devin O; Volkova, Maia I; Shtessel, Yuri B
2017-02-01
Electrostimulation of plants can induce plant movements, activation of ion channels, ion transport, gene expression, enzymatic systems activation, electrical signaling, plant-cell damage, enhanced wound healing, and influence plant growth. Here we found that electrical networks in plant tissues have electrical differentiators. The amplitude of electrical responses decreases along a leaf and increases by decreasing the distance between polarizing Pt-electrodes. Intercellular Ag/AgCl electrodes inserted in a leaf and extracellular Ag/AgCl electrodes attached to the leaf surface were used to detect the electrotonic potential propagation along a leaf of Aloe vera. There is a difference in duration and amplitude of electrical potentials measured by electrodes inserted in a leaf and those attached to a leaf's surface. If the external reference electrode is located in the soil near the root, it changes the amplitude and duration of electrotonic potentials due to existence of additional resistance, capacitance, ion channels and ion pumps in the root. The information gained from this study can be used to elucidate extracellular and intercellular communication in the form of electrical signals within plants. Copyright © 2016 Elsevier B.V. All rights reserved.
Near real-time, on-the-move software PED using VPEF
NASA Astrophysics Data System (ADS)
Green, Kevin; Geyer, Chris; Burnette, Chris; Agarwal, Sanjeev; Swett, Bruce; Phan, Chung; Deterline, Diane
2015-05-01
The scope of the Micro-Cloud for Operational, Vehicle-Based EO-IR Reconnaissance System (MOVERS) development effort, managed by the Night Vision and Electronic Sensors Directorate (NVESD), is to develop, integrate, and demonstrate new sensor technologies and algorithms that improve improvised device/mine detection using efficient and effective exploitation and fusion of sensor data and target cues from existing and future Route Clearance Package (RCP) sensor systems. Unfortunately, the majority of forward looking Full Motion Video (FMV) and computer vision processing, exploitation, and dissemination (PED) algorithms are often developed using proprietary, incompatible software. This makes the insertion of new algorithms difficult due to the lack of standardized processing chains. In order to overcome these limitations, EOIR developed the Government off-the-shelf (GOTS) Video Processing and Exploitation Framework (VPEF) to be able to provide standardized interfaces (e.g., input/output video formats, sensor metadata, and detected objects) for exploitation software and to rapidly integrate and test computer vision algorithms. EOIR developed a vehicle-based computing framework within the MOVERS and integrated it with VPEF. VPEF was further enhanced for automated processing, detection, and publishing of detections in near real-time, thus improving the efficiency and effectiveness of RCP sensor systems.
Overdentures on implants placed in bone augmented with fresh frozen bone.
Rigo, L; Viscioni, A; Franco, M; Lucchese, A; Zollino, I; Brunelli, G; Carinci, F
2011-01-01
In the last decade several studies have been performed to evaluate the clinical outcome of one or two stage loaded implants supporting overdentures. Since fresh frozen bone (FFB) has an ever-increasing number of clinical applications and few reports are available on implants inserted into FFB, we performed a retrospective study on fixtures inserted in FFB and bearing overdentures. In the period between December 2003 and December 2006, 17 patients (14 females and 3 males with a median age of about 56 years) were grafted and 60 implants inserted thereafter. A total of 17 overdentures were delivered: 8 in the mandible and 9 in the maxilla. Multiple implant systems were used: 22 Double etched, 7 SLA, 9 Anodic oxidized, and 22 CaPo4 ceramic-blasted. Implant diameter ranged from 3.25 to 4.3 mm and length from 11.5 to 16.0 mm. Implants were inserted to replace 23 incisors, 9 cuspids, 20 premolars and 8 molars. No implants were lost (i.e., survival rate=100%) and no differences were detected among the studied variables. Kaplan Meier algorithm and Cox regression did not reveal any statistical differences among the studied variables also as regards the success rate. Implants inserted FFB and bearing overdentures have a high survival rate and success rates, which are comparable to those of implants inserted in non-grafted bone. FFB bone is a reliable material for alveolar ridge augmentation. No difference was detected among removable prostheses supported by two or more implants.
Baker, L. Robert; Seo, Hyungtak; Hervier, Antoine; Somorjai, Gabor A.
2016-04-12
A new composition of matter is disclosed wherein oxygen vacancies in a semiconducting transition metal oxide such as titanium dioxide are filled with a halogen such as Fluorine, whereby the conductivity of the composition is greatly enhanced, while at the same time the chemical stability of the composition is greatly improved. Stoichiometric titanium dioxide having less than 3 % oxygen vacancies is subject to fluorine insertion such that oxygen vacancies are filled, limited amounts of fluorine replace additional oxygen atoms and fluorine interstitially inserts into the body of the TiO.sub.2 composition.
Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo
2016-10-15
Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Hamilton, Preci; Soryal, Imad; Dhahri, Prince; Wimalachandra, Welege; Leat, Anna; Hughes, Denise; Toghill, Nicole; Hodson, James; Sawlani, Vijay; Hayton, Tom; Samarasekera, Shanika; Bagary, Manny; McCorry, Dougall; Chelvarajah, Ramesh
2018-05-01
To compare the efficacy of AspireSR ® to preceding VNS battery models for battery replacements, and to determine the efficacy of the AspireSR ® for new implants. Data were collected retrospectively from patients with epilepsy who had VNS AspireSR ® implanted over a three-year period between June 2014 and June 2017 by a single surgeon. Cases were divided into two cohorts, those in whom the VNS was a new insertion, and those in whom the VNS battery was changed from a previous model to AspireSR ® . Within each group, the seizure burden was compared between the periods before and after insertion of AspireSR ® . Fifty-one patients with a newly inserted AspireSR ® VNS model had a significant reduction in seizure frequency (p < 0.001), with 59% (n = 30) reporting ≥50% reduction. Of the 62 patients who had an existing VNS, 53% (n = 33) reported ≥50% reduction in seizure burden when the original VNS was inserted. After the battery was changed to the AspireSR ® , 71% (n = 44) reported a further reduction of ≥50% in their seizure burden. The size of this reduction was at least as large as that resulting from the insertion of their existing VNS in 98% (61/62) of patients. The results suggest that approximately 70% of patients with existing VNS insertions could have significant additional benefit from cardiac based seizure detection and closed loop stimulation from the AspireSR ® device. For new insertions, the AspireSR ® device has efficacy in 59% of patients. The 'rule of thirds' used in counseling patients may need to be modified accordingly. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.
Security scheme in IMDD-OFDM-PON system with the chaotic pilot interval and scrambling
NASA Astrophysics Data System (ADS)
Chen, Qianghua; Bi, Meihua; Fu, Xiaosong; Lu, Yang; Zeng, Ran; Yang, Guowei; Yang, Xuelin; Xiao, Shilin
2018-01-01
In this paper, a random chaotic pilot interval and permutations scheme without any requirement of redundant sideband information is firstly proposed for the physical layer security-enhanced intensity modulation direct detection orthogonal frequency division multiplexing passive optical network (IMDD-OFDM-PON) system. With the help of the position feature of inserting the pilot, a simple logistic chaos map is used to generate the random pilot interval and scramble the chaotic subcarrier allocation of each column pilot data for improving the physical layer confidentiality. Due to the dynamic chaotic permutations of pilot data, the enhanced key space of ∼103303 is achieved in OFDM-PON. Moreover, the transmission experiment of 10-Gb/s 16-QAM encrypted OFDM data is successfully demonstrated over 20-km single-mode fiber, which indicates that the proposed scheme not only improves the system security, but also can achieve the same performance as in the common IMDD-OFDM-PON system without encryption scheme.
Morikawa, Takamitsu J.; Fujita, Hideaki; Kitamura, Akira; Horio, Takashi; Yamamoto, Johtaro; Kinjo, Masataka; Sasaki, Akira; Machiyama, Hiroaki; Yoshizawa, Keiko; Ichimura, Taro; Imada, Katsumi; Nagai, Takeharu; Watanabe, Tomonobu M.
2016-01-01
Fluorescent proteins have been widely used in biology because of their compatibility and varied applications in living specimens. Fluorescent proteins are often undesirably sensitive to intracellular conditions such as pH and ion concentration, generating considerable issues at times. However, harnessing these intrinsic sensitivities can help develop functional probes. In this study, we found that the fluorescence of yellow fluorescent protein (YFP) depends on the protein concentration in the solution and that this dependence can be enhanced by adding a glycine residue in to the YFP; we applied this finding to construct an intracellular protein-crowding sensor. A Förster resonance energy transfer (FRET) pair, involving a cyan fluorescent protein (CFP) insensitive to protein concentration and a glycine-inserted YFP, works as a genetically encoded probe to evaluate intracellular crowding. By measuring the fluorescence of the present FRET probe, we were able to detect dynamic changes in protein crowding in living cells. PMID:26956628
Yeo, Seon-Ju; Huong, Dinh Thi; Hong, Nguyen Ngoc; Li, Chun-Ying; Choi, Kyunghan; Yu, Kyoungsik; Choi, Du-Young; Chong, Chom-Kyu; Choi, Hak Soo; Mallik, Shyam Kumar; Kim, Hak Sung; Sung, Haan Woo; Park, Hyun
2014-01-01
Great efforts have been made to develop robust signal-generating fluorescence materials which will help in improving the rapid diagnostic test (RDT) in terms of sensitivity and quantification. In this study, we developed coumarin-derived dendrimer-based fluorescent immunochromatographic strip test (FICT) assay with enhanced sensitivity as a quantitative diagnostic tool in typical RDT environments. The accuracy of the proposed FICT was compared with that of dot blot immunoassay techniques and conventional RDTs. Through conjugation of coumarin-derived dendrimers with latex beads, fluorescent emission covering broad output spectral ranges was obtained which provided a distinct advantage of easy discrimination of the fluorescent emission of the latex beads with a simple insertion of a long-pass optical filter away from the excitation wavelength. The newly developed FICT assay was able to detect 100 ng/10 μL of influenza A nucleoprotein (NP) antigen within 5 minutes, which corresponded to 2.5-fold higher sensitivity than that of the dot blot immunoassay or conventional RDTs. Moreover, the FICT assay was confirmed to detect at least four avian influenza A subtypes (H5N3, H7N1, H7N7, and H9N2). On applying the FICT to the clinical swab samples infected with respiratory viruses, our FICT assay was confirmed to differentiate influenza H1N1 infection from other respiratory viral diseases. These data demonstrate that the proposed FICT assay is able to detect zoonotic influenza A viruses with a high sensitivity, and it enables the quantitation of the infection intensity by providing the numerical diagnostic values; thus demonstrating enhanced detectability of influenza A viruses.
Selective Tuning of Gilbert Damping in Spin-Valve Trilayer by Insertion of Rare-Earth Nanolayers.
Zhang, Wen; Zhang, Dong; Wong, Ping Kwan Johnny; Yuan, Honglei; Jiang, Sheng; van der Laan, Gerrit; Zhai, Ya; Lu, Zuhong
2015-08-12
Selective tuning of the Gilbert damping constant, α, in a NiFe/Cu/FeCo spin-valve trilayer has been achieved by inserting different rare-earth nanolayers adjacent to the ferromagnetic layers. Frequency dependent analysis of the ferromagnetic resonances shows that the initially small magnitude of α in the NiFe and FeCo layers is improved by Tb and Gd insertions to various amounts. Using the element-specific technique of X-ray magnetic circular dichroism, we find that the observed increase in α can be attributed primarily to the orbital moment enhancement of Ni and Co, rather than that of Fe. The amplitude of the enhancement depends on the specific rare-earth element, as well as on the lattice and electronic band structure of the transition metals. Our results demonstrate an effective way for individual control of the magnetization dynamics in the different layers of the spin-valve sandwich structures, which will be important for practical applications in high-frequency spintronic devices.
Critical technology experiment results for lightweight space heat receiver
NASA Technical Reports Server (NTRS)
Schneider, Michael G.; Brege, Mark A.; Heidenreich, Gary R.
1991-01-01
Critical technology experiments have been performed on thermal energy storage modules in support of the NASA Advanced Solar Dynamic Brayton Heat Receiver Program. The modules, wedge-shaped canisters containing lithium fluoride (LiF), were designed to minimize the mechanical stresses that occur during the phase change of the LiF. Nickel foam inserts were placed in two of the test canisters to provide thermal conductivity enhancement and to distribute the void volume throughout the canister. A procedure was developed for reducing the nickel oxides on the nickel foam to enhance the wicking ability of the foam. The canisters were filled with LiF and closure-welded at the NASA Lewis Research Center. Two canisters, one with a nickel foam insert, the other without an insert, were thermally cycled in various orientations in a fluidized bed furnace. Computer-aided tomography was successfully used to nondestructively determine void locations in the canisters. Finally, canister dimensional stability was measured after thermal cycling with an inspection fixture.
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Harker, JO; Leung, JW; Siao-Salera, RM; Mann, SK; Ramirez, FC; Friedland, S; Amato, A; Radaelli, F; Paggi, S; Terruzzi, V; Hsieh, YH
2011-01-01
Introduction Variation in outcomes in RcTs comparing water-related methods and air insufflation raises challenging questions regarding the new approach. This report reviews impact of water exchange - simultaneous infusion and removal of infused water during insertion on adenoma detection rate (ADR) defined as proportion of patients with a least one adenoma of any size. Methods Medline (2008–2011) searches, abstract of 2011 Digestive Disease Week (DDW) meeting and personal communications were considered to identify RcTs that compared water-related methods and air insufflation to aid insertion of colonoscope. Results Since 2008, eleven reports of RcTs (6 published, 1 submitted and 4 abstracts, n=1728) described ADR in patients randomized to be examined by air and water-related methods. The water-related methods differed in timing of removal of the infused water -predominantly during insertion (water exchange) (n=825) or predominantly during withdrawal (water immersion) (n=903). Water immersion was associated with both increases and decreases in ADR compared to respective air method patients and the net overall change (-7%) was significant. On the other hand water exchange was associated with increases in ADR consistently and the net changes (overall, 8%; proximal overall, 11%; and proximal <10 mm, 12%) were all significant. Conclusion Comparative data generated the hypothesis that significantly larger increases in overall and proximal colon ADRs were associated with water exchange than water immersion or air insufflation during insertion. The hypothesis should be evaluated by RCTs to elucidate the mechanism of water exchange on adenoma detection. PMID:22163082
Chandler, John E; Lee, Cameron M; Babchanik, Alexander P; Melville, C David; Saunders, Michael D; Seibel, Eric J
2012-01-01
Purpose Direct visualization of pancreatic ductal tissue is critical for early diagnosis of pancreatic diseases and for guiding therapeutic interventions. A novel, ultrathin (5 Fr) scanning fiber endoscope (SFE) with tip-bending capability has been developed specifically to achieve high resolution imaging as a pancreatoscope during endoscopic retrograde cholangiopancreatography (ERCP). This device has potential to dramatically improve both diagnostic and therapeutic capabilities during ERCP by providing direct video feedback and tool guidance to clinicians. Methods Invasiveness of the new tip-bending SFE was evaluated by a performance comparison to ERCP guide wires, which are routinely inserted into the pancreatic duct during ERCP. An in vitro test model with four force sensors embedded in a synthetic pancreas was designed to detect and compare the insertion forces for 0.89 mm and 0.53 mm diameter guide wires as well as the 1.7 mm diameter SFE. Insertions were performed through the working channel of a therapeutic duodenoscope for the two types of guide wires and using a statistically similar direct insertion method for comparison to the SFE. Results Analysis of the forces detected by the sensors showed the smaller diameter 0.53 mm wire produced significantly less average and maximum forces during insertion than the larger diameter 0.89 mm wire. With the use of tip-bending and optical visualization, the 1.7 mm diameter SFE produced significantly less average force during insertion than the 0.89 mm wire at every sensor, despite its larger size. It was further shown that the use of tip-bending with the SFE significantly reduced the forces at all sensors, compared to insertions when tip-bending was not used. Conclusion Combining high quality video imaging with two-axis tip-bending allows a larger diameter guide wire-style device to be inserted into the pancreatic duct during ERCP with improved capacity to perform diagnostics and therapy. PMID:23166452
Investigation of the phototoxic effect of ZnO nanorods on fibroblasts and melanoma human cells
NASA Astrophysics Data System (ADS)
Kishwar, S.; Siddique, M.; Israr-Qadir, M.; Nur, O.; Willander, M.; Öllinger, K.
2014-11-01
Photocytotoxic effects of as-grown and zinc oxide (ZnO) nanorods coated with 5-aminolevulinic acid (ALA) have been studied on human cells, i.e. melanoma and foreskin fibroblast, under dark and ultraviolet light exposures. Zinc oxide nanorods have been grown on the very sharp tip (diameter = 700 nm) of borosilicate glass pipettes and then were coated by the photosensitizer for targeted investigations inside human cells. The coated glass pipette’s tip with photosensitizer has been inserted inside the cells with the help of a micro-manipulator and irradiated through ultraviolet light (UVA), which reduces the membrane potential of the mitochondria leading to cell death. Cell viability loss has been detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction assay when exposed to the dissolved ZnO nanorods and the production of the reactive oxygen species (ROS) has been detected along with the enhanced cytotoxic effect under UVA irradiation. Additionally, the influence of the lipid soluble antioxidant vitamin E and water-soluble N-acetyl-cysteine toward the enhancement or reduction of the toxicity has been investigated. A comparative analysis of the toxic nature of ZnO nanorods has been drawn between normal human fibroblast and melanoma cells, which can be favorable for understanding the clinical setting for killing tumor cells.
The use of genes for performance enhancement: doping or therapy?
Oliveira, R S; Collares, T F; Smith, K R; Collares, T V; Seixas, F K
2011-12-01
Recent biotechnological advances have permitted the manipulation of genetic sequences to treat several diseases in a process called gene therapy. However, the advance of gene therapy has opened the door to the possibility of using genetic manipulation (GM) to enhance athletic performance. In such 'gene doping', exogenous genetic sequences are inserted into a specific tissue, altering cellular gene activity or leading to the expression of a protein product. The exogenous genes most likely to be utilized for gene doping include erythropoietin (EPO), vascular endothelial growth factor (VEGF), insulin-like growth factor type 1 (IGF-1), myostatin antagonists, and endorphin. However, many other genes could also be used, such as those involved in glucose metabolic pathways. Because gene doping would be very difficult to detect, it is inherently very attractive for those involved in sports who are prepared to cheat. Moreover, the field of gene therapy is constantly and rapidly progressing, and this is likely to generate many new possibilities for gene doping. Thus, as part of the general fight against all forms of doping, it will be necessary to develop and continually improve means of detecting exogenous gene sequences (or their products) in athletes. Nevertheless, some bioethicists have argued for a liberal approach to gene doping.
Label-free and pH-sensitive colorimetric materials for the sensing of urea
NASA Astrophysics Data System (ADS)
Li, Lu; Long, Yue; Gao, Jin-Ming; Song, Kai; Yang, Guoqiang
2016-02-01
This communication demonstrates a facile method for naked-eye detection of urea based on the structure color change of pH-sensitive photonic crystals. The insertion of urease provides excellent selectivity over other molecules. The detection of urea in different concentration ranges could be realized by changing the molar ratio between the functional monomer and cross-linker.This communication demonstrates a facile method for naked-eye detection of urea based on the structure color change of pH-sensitive photonic crystals. The insertion of urease provides excellent selectivity over other molecules. The detection of urea in different concentration ranges could be realized by changing the molar ratio between the functional monomer and cross-linker. Electronic supplementary information (ESI) available: Materials and chemicals, characterization, experimental details, and SEM images. See DOI: 10.1039/c5nr07690k
Detection of drugs in the urine of body-packers.
Gherardi, R K; Baud, F J; Leporc, P; Marc, B; Dupeyron, J P; Diamant-Berger, O
1988-05-14
The presence of opiates and benzoylecgonine, the major metabolite of cocaine, in the urine was detected by means of enzyme immunoassay in a series of 120 smugglers who had either ingested or inserted into their rectum cocaine or heroin packaged for transportation. There was a striking relation between the presence of drugs in the urine and swallowing of drug-filled bundles (cocaine 49 of 50 cases, heroin 9 of 10). The proportion of positive results was also high in cases of rectal insertion (cocaine 2 of 2, heroin 35 of 58). In 30 cases of cocaine-packet ingestion, serial measurements showed that the accuracy of the test progressively decreased with respect to the detection of residual packets in the body. Drug detection in the urine of suspected body-packers seems to be a useful test, positive results justifying subsequent radiological investigations.
Limberger, Jones; Leal, Bárbara C.; Monteiro, Adriano L.
2015-01-01
In recent years, charge-tagged ligands (CTLs) have become valuable tools in organometallic catalysis. Insertion of an ionic side chain into the molecular skeleton of a known ligand has become a useful protocol for anchoring ligands, and consequently catalysts, in polar and ionic liquid phases. In addition, the insertion of a cationic moiety into a ligand is a powerful tool that can be used to detect reaction intermediates in organometallic catalysis through electrospray ionisation mass spectrometry (ESI-MS) experiments. The insertion of an ionic tag ensures the charge in the intermediates independently of the ESI-MS. For this reason, these ligands have been used as ionic probes in mechanistic studies for several catalytic reactions. Here, we summarise selected examples on the use of CTLs as immobilising agents in organometallic catalysis and as probes for studying mechanisms through ESI-MS. PMID:28553458
NASA Astrophysics Data System (ADS)
Guo, Wensong; Jian, Jianming; San, Yunlong; Lui, Rui; Li, Gang; Hou, Shulin
2017-08-01
Traditional rake type mulching film recycling machine has the problem of difficulty in unloading and packing film, poor continuity of the work. In order to solve such problems, this paper designs a kind of chain rake type mulching film recycling machine which can realize continuous raking film, collecting film, transporting film, shaking off soil, unloading film. Rake teeth is the basic part of chain rake mulching recycling machine. The stability of rake teeth's inserting soil is an important factor to ensure recovery efficiency of the plastic film recovery. By virtual prototype simulation, this paper study the influence of different factors on the stability of rake teeth inserting soil. The results are as follows: The speed of chain rake has no significant effect on the stability of rake teeth inserting soil; Reducing resistance of rake teeth in the process of working, is conducive to improve the stability of rake teeth inserting soil; Appropriate increasing elastic modulus of chain rake, is helpful to enhance the stability of rake teeth inserting soil.
Deflection measurement system for the hybrid iii six-year-old biofidelic abdomen.
Gregory, T Stan; Howes, Meghan K; Rouhana, Stephen W; Hardy, Warren N
2012-01-01
Motor vehicle collisions are the leading cause of death for children ages 5 to 14. Enhancement of child occupant protection is partly dependent on the ability to accurately assess the interaction of child-size occupants with restraint systems. Booster seat design and belt fit are evaluated using child anthropomorphic test devices, such as the Hybrid III 6-year-old dummy., A biofidelic abdomen for the Hybrid III 6-year-old dummy is being developed by the Ford Motor Company to enhance the dummys ability to assess injury risk and further quantify submarining risk by measuring abdominal deflection. A practical measurement system for the biofidelic abdominal insert has been developed and demonstrated for three dimensional determination of abdominal deflection. Quantification of insert deflection is achieved via differential signal measurement using electrodes mounted within a conductive medium. Signal amplitude is proportional to the distance between the electrodes. A microcontroller is used to calculate distances between ventral electrodes and a dorsal electrode in three dimensions. This system has been calibrated statically, and its performance demonstrated in a series of sled tests. Deflection measurements from the instrumented abdominal insert indicate performance differences between two booster seat designs, yielding an average peak anterior to posterior displacement of the abdomen of 1.0 ± 3.4 mm and 31.2 ± 7.2 mm for the seats, respectively. Implementation of a 6-year-old abdominal insert with the ability to evaluate submarining potential will likely help safety researchers further enhance booster seat design and interaction with vehicle restraint systems , and help to further understand child occupant injury risk in automobile collisions.
Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun
2015-12-29
In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C. glutamicum, emphasizing the importance of developing IS element free host strains.
BSA Delta Qualification 2, volume 3, book 1
NASA Technical Reports Server (NTRS)
1994-01-01
This report, presented in three volumes, provides the results of a two-motor Delta Qualification 2 program conducted in 1993 to certify the following enhancements for incorporation into booster separation motor (BSM) flight hardware: vulcanized-in-place nozzle aft closure insulation; new iso-static ATJ bulk graphite throat insert material; adhesive EA 9394 for bonding the nozzle throat, igniter grain rod/centering insert/igniter case; deletion of the igniter adapter insulator ring; deletion of the igniter adapter/igniter case interface RTV; and deletion of Loctite from igniter retainer plate threads. The enhancements above directly resulted from (1) the BSM total quality management (TQM) team initiatives to enhance the BSM producibility, and (2) the necessity to qualify new throat insert and adhesive systems to replace existing materials that will not be available. Testing was completed at both the component and motor levels. Component testing was accomplished to screen candidate materials (e.g., throat materials, adhesive systems) and to optimize processes (e.g., aft closure insulator vulcanization approach) prior to their incorporation into the test motors. Motor tests -- consisting of two motors, randomly selected by USBI's on-site quality personnel from production lot AAY, which were modified to accept the enhancements -- were completed to provide the final qualification of the enhancements for incorporation into flight hardware. Volume 3 book 1 provides supporting documentation to the analyses and plans of testing the two Delta Qualification units including thermal cycling planning/data acceptance records, environmental test procedures and pretest temperature conditioning history, Delta Qualification test plan, and specification SE0837 -- mix acceptance test specification.
Enhanced photovoltaic performances of graphene/Si solar cells by insertion of a MoS₂ thin film.
Tsuboi, Yuka; Wang, Feijiu; Kozawa, Daichi; Funahashi, Kazuma; Mouri, Shinichiro; Miyauchi, Yuhei; Takenobu, Taishi; Matsuda, Kazunari
2015-09-14
Transition-metal dichalcogenides exhibit great potential as active materials in optoelectronic devices because of their characteristic band structure. Here, we demonstrated that the photovoltaic performances of graphene/Si Schottky junction solar cells were significantly improved by inserting a chemical vapor deposition (CVD)-grown, large MoS2 thin-film layer. This layer functions as an effective electron-blocking/hole-transporting layer. We also demonstrated that the photovoltaic properties are enhanced with the increasing number of graphene layers and the decreasing thickness of the MoS2 layer. A high photovoltaic conversion efficiency of 11.1% was achieved with the optimized trilayer-graphene/MoS2/n-Si solar cell.
Wen, Wei; Hu, Rong; Bao, Ting; Zhang, Xiuhua; Wang, Shengfu
2015-09-15
In this work, a sensitive exonuclease-assisted amplification electrochemical aptasensor through insertion approach was developed for the detection of mucin 1 (MUC 1). In order to construct the aptasensor, 6-Mercapto-1-hexanol (MCH) was used to block partial sites of gold electrode (GE), followed by thiolated capture probe self-assembled on GE. Methylene blue (MB) labeled aptamer hybridized with capture probe at both ends to form double-strand DNA. For the MB labeled termini was close to GE, the electrochemical response was remarkable. The presence of MUC 1 caused the dissociation of the double-strand DNA owing to the specific recognition of aptamer to MUC 1. Then exonuclease I (Exo I) selectively digested the aptamer which bound with MUC 1, the released MUC 1 participated new binding with the rest aptamer. Insertion approach improved the reproducibility and Exo I-catalyzed target recycling improved the sensitivity of the aptasensor significantly. Under optimal experimental conditions, the proposed aptasensor had a good linear correlation ranged from 10 pM to 1 μM with a detection limit of 4 pM (Signal to Noise ratio, S/N=3). The strategy had great potential for the simple and sensitive detection of other cancer markers. Copyright © 2015 Elsevier B.V. All rights reserved.
Spin-Orbit Torque and Spin Pumping in YIG/Pt with Interfacial Insertion Layers (Postprint)
2018-05-03
Distribution Statement A. Approved for public release: distribution unlimited. © 2018 AMERICAN INSTITUTE OF PHYSICS (STINFO COPY) AIR FORCE RESEARCH ...SPONSORING/MONITORING AGENCY ACRONYM(S) Air Force Research Laboratory Materials and Manufacturing Directorate Wright-Patterson Air Force Base, OH... observe a large enhancement of Gilbert damping with the insertion of Py that cannot be accounted for solely by spin pumping, revealing significant spin
Enhancement of spin-Seebeck effect by inserting ultra-thin Fe{sub 70}Cu{sub 30} interlayer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kikuchi, D., E-mail: d.kikuchi@imr.tohoku.ac.jp; WPI Advanced Institute for Materials Research, Tohoku University, Sendai 980-8577; Spin Quantum Rectification Project, ERATO, Japan Science and Technology Agency, Sendai 980-8577
2015-02-23
We report the longitudinal spin-Seebeck effects (LSSEs) for Pt/Fe{sub 70}Cu{sub 30}/BiY{sub 2}Fe{sub 5}O{sub 12} (BiYIG) and Pt/BiYIG devices. The LSSE voltage was found to be enhanced by inserting an ultra-thin Fe{sub 70}Cu{sub 30} interlayer. This enhancement decays sharply with increasing the Fe{sub 70}Cu{sub 30} thickness, suggesting that it is not due to bulk phenomena, such as a superposition of conventional thermoelectric effects, but due to interface effects related to the Fe{sub 70}Cu{sub 30} interlayer. Combined with control experiments using Pt/Fe{sub 70}Cu{sub 30} devices, we conclude that the enhancement of the LSSE voltage in the Pt/Fe{sub 70}Cu{sub 30}/BiYIG devices is attributedmore » to the improvement of the spin-mixing conductance at the Pt/BiYIG interfaces.« less
Small molecules enhance CRISPR genome editing in pluripotent stem cells.
Yu, Chen; Liu, Yanxia; Ma, Tianhua; Liu, Kai; Xu, Shaohua; Zhang, Yu; Liu, Honglei; La Russa, Marie; Xie, Min; Ding, Sheng; Qi, Lei S
2015-02-05
The bacterial CRISPR-Cas9 system has emerged as an effective tool for sequence-specific gene knockout through non-homologous end joining (NHEJ), but it remains inefficient for precise editing of genome sequences. Here we develop a reporter-based screening approach for high-throughput identification of chemical compounds that can modulate precise genome editing through homology-directed repair (HDR). Using our screening method, we have identified small molecules that can enhance CRISPR-mediated HDR efficiency, 3-fold for large fragment insertions and 9-fold for point mutations. Interestingly, we have also observed that a small molecule that inhibits HDR can enhance frame shift insertion and deletion (indel) mutations mediated by NHEJ. The identified small molecules function robustly in diverse cell types with minimal toxicity. The use of small molecules provides a simple and effective strategy to enhance precise genome engineering applications and facilitates the study of DNA repair mechanisms in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Gene-specific cell labeling using MiMIC transposons
Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.
2015-01-01
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101
Niu, Ying; Li, Jian-Sheng; Luo, Xian-Run
2014-01-25
This work aimed to study a novel transgenic expression system of the CD/TK double suicide genes enhanced by the nuclear matrix attachment region (MAR) for gene therapy. The recombinant vector pMS-CD/TK containing the MAR-survivin promoter-CD/TK cassette was developed and transfected into human gastric cancer SGC-7901 cells. Expression of the CD/TK genes was detected by quantitative real-time PCR (qPCR) and Western blot. Cell viability and apoptosis were measured using the methyl thiazolyl tetrazolium (MTT) assay and flow cytometry. When the MAR fragment was inserted into the upstream of the survivin promoter, the qPCR result showed that the expression of the CD/TK genes significantly increased 7.7-fold in the transgenic SGC-7901 cells with plasmid pMS-CD/TK compared with that without MAR. MTT and flow cytometry analyses indicated that treatment with the prodrugs (5-FC+GCV) significantly decreased the cellular survival rate and enhanced the cellular apoptosis in the SGC-7901 cells. The expression of the CD/TK double suicide genes driven by the survivin promoter can be enhanced by the MAR fragment in human gastric cancer cells. Copyright © 2013 Elsevier B.V. All rights reserved.
Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing
2009-08-26
Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.
Engtrakul, Dr. Chaiwat; Hu, Michael Z.; Bischoff, Brian L; ...
2016-01-01
The impact of surface-selective coatings on water permeation through a membrane when exposed to catalytic fast pyrolysis (CFP) vapor products was studied by tailoring the surface properties of the membrane coating from superhydrophilic to superhydrophobic. Our approach utilized high-performance architectured surface-selective (HiPAS) membranes that were inserted after a CFP reactor. At this insertion point, the inner wall surface of a tubular membrane was exposed to a mixture of water and upgraded product vapors, including light gases and deoxygenated hydrocarbons. Under proper membrane operating conditions, a high selectivity for water over 1-ring upgraded biomass pyrolysis hydrocarbons was observed due to amore » surface-enhanced capillary condensation process. Owing to this surface-enhanced effect, HiPAS membranes have the potential to enable high flux separations suggesting that water can be selectively removed from the CFP product vapors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jiangsheng; Faculty of Materials Science and Chemical Engineering, Ningbo University, No. 818 Fenghua Road, Ningbo 315211; Jiu, Tonggang, E-mail: jiutonggang@nimte.ac.cn, E-mail: fangjf@nimte.ac.cn
2016-05-02
A thin potassium stearate (KSt) film combined with an optimized ZnO film was introduced to improve the fill factor (FF) of highly efficient inverted polymer solar cells (PSCs). Atomic force microscopy and contact angle measurements were used to show that the introduction of KSt did not change the morphology of interlayer. On the contrary, it is beneficial for the spread of the active layer on the interlayer. The origin of enhanced FF was systematically studied by the ideal current-voltage model for a single heterojunction solar cell and electrochemical impedance spectroscopy. On the basis of the data analysis, the reduced chargemore » recombination loss was responsible for this improved FF. At last, when KSt was replaced by sodium stearate (NaSt), the similar experiment phenomenon was observed. This indicates that inserting a metallic stearate modified layer is a promising strategy to enhance inverted PSCs performance.« less
High efficiency and enhanced ESD properties of UV LEDs by inserting p-GaN/p-AlGaN superlattice
NASA Astrophysics Data System (ADS)
Huang, Yong; Li, PeiXian; Yang, Zhuo; Hao, Yue; Wang, XiaoBo
2014-05-01
Significantly improved electrostatic discharge (ESD) properties of InGaN/GaN-based UV light-emitting diode (LED) with inserting p-GaN/p-AlGaN superlattice (p-SLs) layers (instead of p-AlGaN single layer) between multiple quantum wells and Mg-doped GaN layer are reported. The pass yield of the LEDs increased from 73.53% to 93.81% under negative 2000 V ESD pulses. In addition, the light output power (LOP) and efficiency droop at high injection current were also improved. The mechanism of the enhanced ESD properties was then investigated. After excluding the effect of capacitance modulation, high-resolution X-ray diffraction (XRD) and atomic force microscope (AFM) measurements demonstrated that the dominant mechanism of the enhanced ESD properties is the material quality improved by p-SLs, which indicated less leakage paths, rather than the current spreading improved by p-SLs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Engtrakul, Chaiwat; Hu, Michael Z.; Bischoff, Brian L.
2016-10-20
The impact of surface-selective coatings on water permeation through a membrane when exposed to catalytic fast pyrolysis (CFP) vapor products was studied by tailoring the surface properties of the membrane coating from superhydrophilic to superhydrophobic. Our approach used high-performance architectured surface-selective (HiPAS) membranes that were inserted after a CFP reactor. At this insertion point, the inner wall surface of a tubular membrane was exposed to a mixture of water and upgraded product vapors, including light gases and deoxygenated hydrocarbons. Under proper membrane operating conditions, a high selectivity for water over one-ring upgraded biomass pyrolysis hydrocarbons was observed as a resultmore » of a surface-enhanced capillary condensation process. Owing to this surface-enhanced effect, HiPAS membranes have the potential to enable high flux separations, suggesting that water can be selectively removed from the CFP product vapors.« less
Grant, Angeline; Njiru, James; Okoth, Edgar; Awino, Imelda; Briend, André; Murage, Samuel; Abdirahman, Saida; Myatt, Mark
2018-01-01
A novel approach for improving community case-detection of acute malnutrition involves mothers/caregivers screening their children for acute malnutrition using a mid-upper arm circumference (MUAC) insertion tape. The objective of this study was to test three simple MUAC classification devices to determine whether they improved the sensitivity of mothers/caregivers at detecting acute malnutrition. Prospective, non-randomised, partially-blinded, clinical diagnostic trial describing and comparing the performance of three "Click-MUAC" devices and a MUAC insertion tape. The study took place in twenty-one health facilities providing integrated management of acute malnutrition (IMAM) services in Isiolo County, Kenya. Mothers/caregivers classified their child ( n =1040), aged 6-59 months, using the "Click-MUAC" devices and a MUAC insertion tape. These classifications were compared to a "gold standard" classification (the mean of three measurements taken by a research assistant using the MUAC insertion tape). The sensitivity of mother/caregiver classifications was high for all devices (>93% for severe acute malnutrition (SAM), defined by MUAC < 115 mm, and > 90% for global acute malnutrition (GAM), defined by MUAC < 125 mm). Mother/caregiver sensitivity for SAM and GAM classification was higher using the MUAC insertion tape (100% sensitivity for SAM and 99% sensitivity for GAM) than using "Click-MUAC" devices. Younden's J for SAM classification, and sensitivity for GAM classification, were significantly higher for the MUAC insertion tape (99% and 99% respectively). Specificity was high for all devices (>96%) with no significant difference between the "Click-MUAC" devices and the MUAC insertion tape. The results of this study indicate that, although the "Click-MUAC" devices performed well, the MUAC insertion tape performed best. The results for sensitivity are higher than found in previous studies. The high sensitivity for both SAM and GAM classification by mothers/caregivers with the MUAC insertion tape could be due to the use of an improved MUAC tape design which has a number of new design features. The one-on-one demonstration provided to mothers/caregivers on the use of the devices may also have helped improve sensitivity. The results of this study provide evidence that mothers/caregivers can perform sensitive and specific classifications of their child's nutritional status using MUAC. Clinical trials registration number: NCT02833740.
Dunn, R. C.; Laurie, C. C.
1995-01-01
Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745
2017-01-01
ABSTRACT Strong viral enhancers in gammaretrovirus vectors have caused cellular proto-oncogene activation and leukemia, necessitating the use of cellular promoters in “enhancerless” self-inactivating integrating vectors. However, cellular promoters result in relatively low transgene expression, often leading to inadequate disease phenotype correction. Vectors derived from foamy virus, a nonpathogenic retrovirus, show higher preference for nongenic integrations than gammaretroviruses/lentiviruses and preferential integration near transcriptional start sites, like gammaretroviruses. We found that strong viral enhancers/promoters placed in foamy viral vectors caused extremely low immortalization of primary mouse hematopoietic stem/progenitor cells compared to analogous gammaretrovirus/lentivirus vectors carrying the same enhancers/promoters, an effect not explained solely by foamy virus' modest insertional site preference for nongenic regions compared to gammaretrovirus/lentivirus vectors. Using CRISPR/Cas9-mediated targeted insertion of analogous proviral sequences into the LMO2 gene and then measuring LMO2 expression, we demonstrate a sequence-specific effect of foamy virus, independent of insertional bias, contributing to reduced genotoxicity. We show that this effect is mediated by a 36-bp insulator located in the foamy virus long terminal repeat (LTR) that has high-affinity binding to the CCCTC-binding factor. Using our LMO2 activation assay, LMO2 expression was significantly increased when this insulator was removed from foamy virus and significantly reduced when the insulator was inserted into the lentiviral LTR. Our results elucidate a mechanism underlying the low genotoxicity of foamy virus, identify a novel insulator, and support the use of foamy virus as a vector for gene therapy, especially when strong enhancers/promoters are required. IMPORTANCE Understanding the genotoxic potential of viral vectors is important in designing safe and efficacious vectors for gene therapy. Self-inactivating vectors devoid of viral long-terminal-repeat enhancers have proven safe; however, transgene expression from cellular promoters is often insufficient for full phenotypic correction. Foamy virus is an attractive vector for gene therapy. We found foamy virus vectors to be remarkably less genotoxic, well below what was expected from their integration site preferences. We demonstrate that the foamy virus long terminal repeats contain an insulator element that binds CCCTC-binding factor and reduces its insertional genotoxicity. Our study elucidates a mechanism behind the low genotoxic potential of foamy virus, identifies a unique insulator, and supports the use of foamy virus as a vector for gene therapy. PMID:29046446
Development of Bend Sensor for Catheter Tip
NASA Astrophysics Data System (ADS)
Nagano, Yoshitaka; Sano, Akihito; Fujimoto, Hideo
Recently, a minimally invasive surgery which makes the best use of the catheter has been becoming more popular. In endovascular coil embolization for a cerebral aneurysm, the observation of the catheter's painting phenomenon is very important to execute the appropriate manipulation of the delivery wire and the catheter. In this study, the internal bend sensor which consists of at least two bending enhanced plastic optical fibers was developed in order to measure the curvature of the catheter tip. Consequently, the painting could be more sensitively detected in the neighborhood of the aneurysm. In this paper, the basic characteristics of the developed sensor system are described and its usefulness is confirmed from the comparison of the insertion force of delivery wire and the curvature of catheter tip in the experiment of coil embolization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jung, J. W.; Sakuraba, Y., E-mail: Sakuraba.Yuya@nims.go.jp; Sasaki, T. T.
2016-03-07
We have investigated the effects of insertion of a thin NiAl layer (≤0.63 nm) into a Co{sub 2}FeGa{sub 0.5}Ge{sub 0.5} (CFGG)/Ag interface on the magnetoresistive properties in CFGG/Ag/CFGG current-perpendicular-to-plane giant magnetoresistance (CPP-GMR) pseudo spin valves (PSVs). First-principles calculations of ballistic transmittance clarified that the interfacial band matching at the (001)-oriented NiAl/CFGG interface is better than that at the (001)-Ag/CFGG interface. The insertion of 0.21-nm-thick NiAl layers at the Co{sub 2}FeGa{sub 0.5}Ge{sub 0.5}/Ag interfaces effectively improved the magnetoresistance (MR) output; the observed average and the highest MR ratio (ΔRA) are 62% (25 mΩ μm{sup 2}) and 77% (31 mΩ μm{sup 2}) atmore » room temperature, respectively, which are much higher than those without NiAl insertion. Microstructural analysis using scanning transmission electron microscopy confirmed the existence of thin NiAl layers at the Ag interfaces with only modest interdiffusion even after annealing at 550 °C. The improvement of the interfacial spin-dependent scattering by very thin NiAl insertion can be a predominant reason for the enhancement of the MR output.« less
Automated location detection of injection site for preclinical stereotactic neurosurgery procedure
NASA Astrophysics Data System (ADS)
Abbaszadeh, Shiva; Wu, Hemmings C. H.
2017-03-01
Currently, during stereotactic neurosurgery procedures, the manual task of locating the proper area for needle insertion or implantation of electrode/cannula/optic fiber can be time consuming. The requirement of the task is to quickly and accurately find the location for insertion. In this study we investigate an automated method to locate the entry point of region of interest. This method leverages a digital image capture system, pattern recognition, and motorized stages. Template matching of known anatomical identifiable regions is used to find regions of interest (e.g. Bregma) in rodents. For our initial study, we tackle the problem of automatically detecting the entry point.
Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T
2017-12-01
Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.
Sasaki, Hidefumi; Shimizu, Shigeki; Tani, Yoichi; Shitara, Masayuki; Okuda, Katsuhiro; Hikosaka, Yu; Moriyama, Satoru; Yano, Motoki; Fujii, Yoshitaka
2013-10-01
Mutations in components of the mitogen-activated protein kinase (MAPK) cascade may be a new candidate for target for lung cancer. The usefulness of immunohistochemistry (IHC) as a new approach for the detection of BRAF V600E in cancer patients has been recently reported. To increase the sensitivity, we modified BRAF V600E expression detection assay by IHC using mutation specific antibody. From the screening step, we found a novel 599 insertion T BRAF mutation in lung adenocarcinoma. In this study included 26 surgically removed cases with EGFR, Kras, erbB2, EML4-ALK and KIF5B-RET wild-type (wt) lung adenocarcinomas, including 7 BRAF mutants (5 V600E, 1 N581I, and 1 novel 599 insertion T mutation) analyzed by DNA sequencing. Detection of the BRAF V600E mutation was carried out by the Dako EnVision™ FLEX detection system using the VE1 clone antibody and compared with the results of direct sequencing. The autostainer IHC VE1 assay was positive in 5 of 5 (100%) BRAF V600E-mutated tumors and negative in 20 of 21 (95.2%) BRAF non-V600E tumors, except for a novel 599 insertion T case. IHC using the VE1 clone and FLEX linker is a specific method for the detection BRAF V600E and may be an alternative to molecular biology for the detection of mutations in lung adenocarcinomas. This method might be useful for screening to use molecular target therapy for lung adenocarcinomas. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Non-harmful insertion of data mimicking computer network attacks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neil, Joshua Charles; Kent, Alexander; Hash, Jr, Curtis Lee
Non-harmful data mimicking computer network attacks may be inserted in a computer network. Anomalous real network connections may be generated between a plurality of computing systems in the network. Data mimicking an attack may also be generated. The generated data may be transmitted between the plurality of computing systems using the real network connections and measured to determine whether an attack is detected.
Enhancing electron transport in molecular wires by insertion of a ferrocene center.
Sun, Yan-Yan; Peng, Zheng-Lian; Hou, Rong; Liang, Jing-Hong; Zheng, Ju-Fang; Zhou, Xiao-Yi; Zhou, Xiao-Shun; Jin, Shan; Niu, Zhen-Jiang; Mao, Bing-Wei
2014-02-14
We have determined the conductance of alkane-linked ferrocene molecules with carboxylic acid anchoring groups using the STM break junction technique, and three sets of conductance values were found, i.e. high conductance (HC), medium conductance (MC) and low conductance (LC) values. The enhancing effect of the incorporated ferrocene on the electron transport in saturated alkane molecular wires is demonstrated by the increased conductance of the ferrocene molecules, attributed to the reduction of the tunneling barrier and the HOMO-LUMO gap induced by the insertion of ferrocene. Furthermore, the electron-withdrawing carbonyl group on the unconjugated backbone has little or no influence on single-molecule conductance. The current work provides a feasible approach for the design of high-performance molecular wires.
NASA Astrophysics Data System (ADS)
Fu, H. R.; Ma, L.; Tian, N.; You, C. Y.; Wang, K.
2018-05-01
A systematic study of anomalous Hall effect (AHE) was performed in perpendicular magnetic anisotropic Pd/Co2MnSi(tCMS)/MgO/Pd films. The AHE was significantly intensified by inserting MgO layer, which can be ascribed to the enhancement of spin-orbit coupling and interfacial scattering contribution. Moreover, it was found that the Co and Mn ions were reduced at the interface of Co2MnSi/MgO with annealing process. The stable amount of Mn-O bonding was observed at the Co2MnSi/MgO interface after annealing, implying that the proper Mn-O bonding could be favorable for achieving large AHE.
Hong, Jin-Bon; Chou, Fu-Ju; Ku, Amy T; Fan, Hsiang-Hsuan; Lee, Tung-Lung; Huang, Yung-Hsin; Yang, Tsung-Lin; Su, I-Chang; Yu, I-Shing; Lin, Shu-Wha; Chien, Chung-Liang; Ho, Hong-Nerng; Chen, You-Tzung
2014-01-01
PiggyBac is a prevalent transposon system used to deliver transgenes and functionally explore the mammalian untouched genomic territory. The important features of piggyBac transposon are the relatively low insertion site preference and the ability of seamless removal from genome, which allow its potential uses in functional genomics and regenerative medicine. Efforts to increase its transposition efficiency in mammals were made through engineering the corresponding transposase (PBase) codon usage to enhance its expression level and through screening for mutant PBase variants with increased enzyme activity. To improve the safety for its potential use in regenerative medicine applications, site-specific transposition was achieved by using engineered zinc finger- and Gal4-fused PBases. An excision-prone PBase variant has also been successfully developed. Here we describe the construction of a nucleolus-predominant PBase, NP-mPB, by adding a nucleolus-predominant (NP) signal peptide from HIV-1 TAT protein to a mammalian codon-optimized PBase (mPB). Although there is a predominant fraction of the NP-mPB-tGFP fusion proteins concentrated in the nucleoli, an insertion site preference toward nucleolar organizer regions is not detected. Instead a 3-4 fold increase in piggyBac transposition efficiency is reproducibly observed in mouse and human cells.
NASA Astrophysics Data System (ADS)
Nam, Chunghee; Lee, Ki-Su; Cho, B. K.
2005-05-01
We studied the interlayer coupling strength (Hin) and GMR ratio of a spin-valve with the top free layer, separated by a nano-oxide layer (NOL). With the total thickness of the top free layer being fixed at 60Å, the physical properties of the NOL spin-valve were studied with the thickness (tf) of the free layer under the inserted NOL and compared with those of the normal spin-valve with the same thickness as tf. It was found that the spin-valve with NOL has a higher GMR ratio than that of the normal spin-valve at the optimal condition (tf=40Å) after thermal annealing at T =250°C. The NOL spin-valve also shows a lower Hin than that of the optimal normal spin-valve with tf=40Å, which is comparable to that of the normal spin-valve with tf=60Å. This indicates that the enhancement of GMR, while keeping the Hin to be low, can be achieved by inserting a NOL into the top free layer.
Liu, Da; Zhang, Yi; Lei, Wei; Wang, Cai-ru; Xie, Qing-yun; Liao, Dong-fa; Jiang, Kai; Zhou, Jin-song; Zhang, Bo; Pan, Xian-ming
2014-04-01
Expansive pedicle screw (EPS) and polymethylmethacrylate-augmented pedicle screw (PMMA-PS) were inserted in sheep vertebrae in vitro and were evaluated by performing biomechanical tests, radiographic examinations and histological observations. The objective of the study was to compare the biomechanical and interfacial performances of EPS and PMMA-PS in sheep lumbar vertebrae in vitro. It is a great challenge for orthopedic surgeons performing transpedicular fixation in the osteoporotic spine. It was reported that either the EPS or PMMA-PS could increase the screw stability. However, there are no studies comparing the 2 kinds of screws especially in primary spinal instrumentation. A total of 60 sheep lumbar vertebrae were randomly divided into 3 groups. A pilot hole was made in advance in all samples using the same method. Thereafter, the conventional pedicle screw (CPS) was inserted directly into the pilot hole in the CPS group; the hole in PMMA-PS group was first filled with polymethylmethacrylate (PMMA; 1.0 mL) and then inserted with CPS; and the EPS was inserted directly into the vertebrae in EPS group. After a period of 24 hours, biomechanical tests were performed to evaluate screw stability, and x-ray examination, micro-computerized tomography analysis, and histologic observation were performed to evaluate the interface between screw and bone. Compared with the stability of CPS, those of EPS and PMMA-PS were significantly enhanced. However, no significant differences were detected between the stabilities of EPS and PMMA-PS. The PMMA surrounding the screw blocked direct contact between bone and screw and formed a "screw-PMMA-bone" interface in the PMMA-PS group. There was a "screw-bone" interface in both CPS and EPS groups. Nevertheless, the expanded anterior part of EPS formed a claw-like structure pressing the surrounding bone trabeculae, which made the local bone tissue more compacted and denser than that in the CPS group. EPS can enhance the screw stability as markedly as the traditional PMMA-PS in primary surgery, and EPS can form a better immediate interface between screw and bone compared with PMMA-PS. EPS also can effectively avoid thermal injury, leakage, and compression caused by PMMA. A great feasibility was proved in this study to perform comparisons between the 2 kinds of pedicle screws in osteoporotic sheep vertebrae in vivo in the further research. In conclusion, we propose that EPS has a great application potential in augmentation of screw stability in the clinic.
Torsional Dynamics of Steerable Needles: Modeling and Fluoroscopic Guidance
Swensen, John P.; Lin, MingDe; Okamura, Allison M.; Cowan, Noah J.
2017-01-01
Needle insertions underlie a diversity of medical interventions. Steerable needles provide a means by which to enhance existing needle-based interventions and facilitate new ones. Tip-steerable needles follow a curved path and can be steered by twisting the needle base during insertion, but this twisting excites torsional dynamics that introduce a discrepancy between the base and tip twist angles. Here, we model the torsional dynamics of a flexible rod—such as a tip-steerable needle—during subsurface insertion and develop a new controller based on the model. The torsional model incorporates time-varying mode shapes to capture the changing boundary conditions inherent during insertion. Numerical simulations and physical experiments using two distinct setups—stereo camera feedback in semi-transparent artificial tissue and feedback control with real-time X-ray imaging in optically opaque artificial tissue— demonstrate the need to account for torsional dynamics in control of the needle tip. PMID:24860026
NASA Astrophysics Data System (ADS)
Lin, Chang-Yu; Huang, I.-Yu; Lan, Je-Wei
2013-01-01
Conventional flexural plate-wave (FPW) transducers have limited applications in biomedical sensing due to their disadvantages such as high insertion loss and low quality factor. To overcome these shortcomings, we propose a FPW transducer on a low phase velocity insulator membrane (5-μm-thick SiO2) with a novel groove-type reflective grating structure design. Additionally, a cystamine self-assembly monolayer and a glutaraldehyde cross-linking layer are implemented on the backside of the FPW device to immobilize alpha-fetoprotein (AFP) antibody. A FPW-based AFP biosensor with low detection limit (5 ng/mL) can be achieved and used to measure the extreme low concentration of AFP antigen in human serum for early detection of hepatocellular carcinoma. The proposed FPW-based AFP biosensor also demonstrates a very high quality factor (206), low insertion loss (-40.854 dB), low operating frequency (6.388 MHz), and high sensing linearity (90.7%).
Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H
2006-04-01
We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.
Gene-specific cell labeling using MiMIC transposons.
Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A
2015-04-30
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Quantitative multiplex detection of pathogen biomarkers
Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.
2016-02-09
The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.
Quantitative multiplex detection of pathogen biomarkers
Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K
2014-10-14
The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.
Deep electrode insertion and sound coding in cochlear implants.
Hochmair, Ingeborg; Hochmair, Erwin; Nopp, Peter; Waller, Melissa; Jolly, Claude
2015-04-01
Present-day cochlear implants demonstrate remarkable speech understanding performance despite the use of non-optimized coding strategies concerning the transmission of tonal information. Most systems rely on place pitch information despite possibly large deviations from correct tonotopic placement of stimulation sites. Low frequency information is limited as well because of the constant pulse rate stimulation generally used and, being even more restrictive, of the limited insertion depth of the electrodes. This results in a compromised perception of music and tonal languages. Newly available flexible long straight electrodes permit deep insertion reaching the apical region with little or no insertion trauma. This article discusses the potential benefits of deep insertion which are obtained using pitch-locked temporal stimulation patterns. Besides the access to low frequency information, further advantages of deeply inserted long electrodes are the possibility to better approximate the correct tonotopic location of contacts, the coverage of a wider range of cochlear locations, and the somewhat reduced channel interaction due to the wider contact separation for a given number of channels. A newly developed set of strategies has been shown to improve speech understanding in noise and to enhance sound quality by providing a more "natural" impression, which especially becomes obvious when listening to music. The benefits of deep insertion should not, however, be compromised by structural damage during insertion. The small cross section and the high flexibility of the new electrodes can help to ensure less traumatic insertions as demonstrated by patients' hearing preservation rate. This article is part of a Special Issue entitled
Effect of clinic related factors on continuation rates of IUDs.
Reading, A E; Goldstuck, N D
1982-01-01
This paper concerns factors relating to the clinic and the way in which the insertion of IUDs is managed from a psychological and technical standpoint. 3 aspects of clinical service are examined: 1) the influence of the psychological state at time of insertion, 2) individual differences in relation to side effects amongst users and the way in which those are influenced by managment techniques, and 3) technical aspects of the insertion of the device. Insertion pain and discomfort may influence subsequent tolerance of the IUD in 3 ways: 1) patient compliance may be enhanced by trouble-free insertion, 2) an unpleasant experience may influence attitudes towards the IUD, and 3) the experience of pain at insertion may reduce subsequent tolerance of discomfort. IUDs increase the amount of menstrual flow which, along with pain, constitute frequent requests for removal. Removal rates for pain and bleeding vary from 0-16.8/100 users. Removal rates for bleeding are also influenced by cultural attitudes. Insertion techniques influence acceptability of IUDs. Also, the incidence of expulsion, pregnancy, and removal declines with increasing age and parity. Discontinuation rates after 24 months were 91% for women below 2nd parity and only 37% for women of 6 or more parity. In the youngest age group the discontinuation rate was 76% compared with 35% in the oldest age group. The timing of IUD insertion and positioning of the IUD influence continuation rates. An implication of these concerns is that IUD insertion procedures may have to become more complex to achieve compatibility between IUD-uterine configurations.
Maurer-Stroh, Sebastian; Lee, Raphael T C; Gunalan, Vithiagaran; Eisenhaber, Frank
2013-05-01
A characteristic difference between highly and non-highly pathogenic avian influenza strains is the presence of an extended, often multibasic, cleavage motif insertion in the hemagglutinin protein. Such motif is found in H7N3 strains from chicken farm outbreaks in 2012 in Mexico. Through phylogenetic, sequence and structural analysis, we try to shed light on the role, prevalence, likelihood of appearance and origin of the inserted cleavage motifs in these H7N3 avian influenza strains. The H7N3 avian influenza strain which caused outbreaks in chicken farms in June/July 2012 in Mexico has a new extended cleavage site which is the likely reason for its high pathogenicity in these birds. This cleavage site appears to have been naturally acquired and was not present in the closest low pathogenic precursors. Structural modeling shows that insertion of a productive cleavage site is quite flexible to accept insertions of different length and with sequences from different possible origins. Different from recent cleavage site insertions, the origin of the insert here is not from the viral genome but from host 28S ribosomal RNA (rRNA) instead. This is a novelty for a natural acquisition as a similar insertion has so far only been observed in a laboratory strain before. Given the abundance of viral and host RNA in infected cells, the acquisition of a pathogenicity-enhancing extended cleavage site through a similar route by other low-pathogenic avian strains in future does not seem unlikely. Important for surveillance of these H7N3 strains, the structural sites known to enhance mammalian airborne transmission are dominated by the characteristic avian residues and the risk of human to human transmission should currently be low but should be monitored for future changes accordingly. This highly pathogenic H7N3 avian influenza strain acquired a novel extended cleavage site which likely originated from recombination with 28S rRNA from the avian host. Notably, this new virus can infect humans but currently lacks critical host receptor adaptations that would facilitate human to human transmission.
Golubenko, M V; Puzyrev, V P; Saliukov, V B; Kucher, A N; Sanchat, N O
2000-03-01
Mitochondrial DNA region V deletion-insertion polymorphism was examined in three Tuvinian populations inhabiting western, northeastern, and southeastern parts of the republic. The 9-bp deletion was characterized by nonrandom distribution across the Tuva territory: its frequency in the western population (13.37%) was statistically significantly higher than that in the northeastern (4.62%), and southeastern populations, as well as in Mongols, who are territorially and ethnically close to Tuvinians. The insertion mutation in the region V was detected with a frequency of about 3% in two out of the three populations tested.
In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction
Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt
2018-01-01
Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023
Lobanov, Alexey V.; Delgado, Cesar; Rahlfs, Stefan; Novoselov, Sergey V.; Kryukov, Gregory V.; Gromer, Stephan; Hatfield, Dolph L.; Becker, Katja; Gladyshev, Vadim N.
2006-01-01
The use of selenocysteine (Sec) as the 21st amino acid in the genetic code has been described in all three major domains of life. However, within eukaryotes, selenoproteins are only known in animals and algae. In this study, we characterized selenoproteomes and Sec insertion systems in protozoan Apicomplexa parasites. We found that among these organisms, Plasmodium and Toxoplasma utilized Sec, whereas Cryptosporidium did not. However, Plasmodium had no homologs of known selenoproteins. By searching computationally for evolutionarily conserved selenocysteine insertion sequence (SECIS) elements, which are RNA structures involved in Sec insertion, we identified four unique Plasmodium falciparum selenoprotein genes. These selenoproteins were incorrectly annotated in PlasmoDB, were conserved in other Plasmodia and had no detectable homologs in other species. We provide evidence that two Plasmodium SECIS elements supported Sec insertion into parasite and endogenous selenoproteins when they were expressed in mammalian cells, demonstrating that the Plasmodium SECIS elements are functional and indicating conservation of Sec insertion between Apicomplexa and animals. Dependence of the plasmodial parasites on selenium suggests possible strategies for antimalarial drug development. PMID:16428245
Minami, Yasunori; Kudo, Masatoshi
2009-12-31
The success rate of percutaneous radiofrequency (RF) ablation for hepatocellular carcinoma (HCC) depends on correct targeting via an imaging technique. However, RF electrode insertion is not completely accurate for residual HCC nodules because B-mode ultrasound (US), color Doppler, and power Doppler US findings cannot adequately differentiate between treated and viable residual tumor tissue. Electrode insertion is also difficult when we must identify the true HCC nodule among many large regenerated nodules in cirrhotic liver. Two breakthroughs in the field of US technology, harmonic imaging and the development of second-generation contrast agents, have recently been described and have demonstrated the potential to dramatically broaden the scope of US diagnosis of hepatic lesions. Contrast-enhanced harmonic US imaging with an intravenous contrast agent can evaluate small hypervascular HCC even when B-mode US cannot adequately characterize tumor. Therefore, contrast-enhanced harmonic US can facilitate RF ablation electrode placement in hypervascular HCC, which is poorly depicted by B-mode US. The use of contrast-enhanced harmonic US in ablation therapy for liver cancer is an efficient approach.
McNaughton, Candace; Zhou, Chuan; Robert, Linda; Storrow, Alan; Kennedy, Robert
2009-08-01
We compare pain and anxiety associated with peripheral intravenous (IV) cannula insertion after pretreatment with no local anesthesia, 4% lidocaine cream, or subcutaneously injected, buffered 1% lidocaine. In a randomized, crossover design, 3 peripheral IVs were inserted in each of 70 medical students or nurses. In random order, insertion sites were pretreated with nothing, lidocaine cream, or injected, buffered lidocaine. After each IV insertion, subjects recorded pain, anxiety, and preference (as patient and provider) for each technique on a 10-point numeric rating scale. Higher scores indicated greater pain, anxiety, and preference. Median pain scores (interquartile range [IQR]) were 7 (4 to 8) without local anesthesia, 3 (2 to 5) with lidocaine cream, and 1 (1 to 2) with injected, buffered lidocaine. Median anxiety scores (IQR) were 4 (2 to 7) without local anesthesia, 2 (1 to 4) with lidocaine cream, and 2 (1 to 3) with injected, buffered lidocaine. There was no detectable difference in anxiety scores between lidocaine cream and injected, buffered lidocaine. Most IV placement attempts were successful, regardless of technique. Seventy percent of subjects indicated they would "always" request buffered lidocaine for peripheral IV insertion. In adult health care providers, pain and anxiety associated with peripheral IV insertion is significantly reduced by using topical lidocaine cream or injected, buffered lidocaine. Injected, buffered lidocaine reduces IV insertion pain more than lidocaine cream, without affecting success. Adults desire the use of local anesthetic techniques for IV insertion for themselves and for their patients.
Bovine Pancreatic Trypsin Inhibitor-Trypsin Complex as a Detection System for Recombinant Proteins
NASA Astrophysics Data System (ADS)
Borjigin, Jimo; Nathans, Jeremy
1993-01-01
Bovine pancreatic trypsin inhibitor (BPTI) binds to trypsin and anhydrotrypsin (an enzymatically inactive derivative of trypsin) with affinities of 6 x 10-14 and 1.1 x 10-13 M, respectively. We have taken advantage of the high affinity and specificity of this binding reaction to develop a protein tagging system in which biotinylated trypsin or biotinylated anhydrotrypsin is used as the reagent to detect recombinant fusion proteins into which BPTI has been inserted. Two proteins, opsin and growth hormone, were used as targets for insertional mutagenesis with BPTI. In each case, both domains of the fusion protein appear to be correctly folded. The fusion proteins can be specifically and efficiently detected by biotinylated trypsin or biotinylated anhydrotrypsin, as demonstrated by staining of transfected cells, protein blotting, affinity purification, and a mobility shift assay in SDS/polyacrylamide gels.
Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.
Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang
2013-02-01
Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.
Optimal Sensor Fusion for Structural Health Monitoring of Aircraft Composite Components
2011-09-01
sensor networks combine or fuse different types of sensors. Fiber Bragg Grating ( FBG ) sensors can be inserted in layers of composite structures to...consideration. This paper describes an example of optimal sensor fusion, which combines FBG sensors and PZT sensors. Optimal sensor fusion tries to find...Fiber Bragg Grating ( FBG ) sensors can be inserted in layers of composite structures to provide local damage detection, while surface mounted
Arcjet nozzle area ratio effects
NASA Technical Reports Server (NTRS)
Curran, Francis M.; Sarmiento, Charles J.; Birkner, Bjorn W.; Kwasny, James
1990-01-01
An experimental investigation was conducted to determine the effect of nozzle area ratio on the operating characteristics and performance of a low power dc arcjet thruster. Conical thoriated tungsten nozzle inserts were tested in a modular laboratory arcjet thruster run on hydrogen/nitrogen mixtures simulating the decomposition products of hydrazine. The converging and diverging sides of the inserts had half angles of 30 and 20 degrees, respectively, similar to a flight type unit currently under development. The length of the diverging side was varied to change the area ratio. The nozzle inserts were run over a wide range of specific power. Current, voltage, mass flow rate, and thrust were monitored to provide accurate comparisons between tests. While small differences in performance were observed between the two nozzle inserts, it was determined that for each nozzle insert, arcjet performance improved with increasing nozzle area ratio to the highest area ratio tested and that the losses become very pronounced for area ratios below 50. These trends are somewhat different than those obtained in previous experimental and analytical studies of low Re number nozzles. It appears that arcjet performance can be enhanced via area ratio optimization.
Arcjet Nozzle Area Ratio Effects
NASA Technical Reports Server (NTRS)
Curran, Francis M.; Sarmiento, Charles J.; Birkner, Bjorn W.; Kwasny, James
1990-01-01
An experimental investigation was conducted to determine the effect of nozzle area ratio on the operating characteristics and performance of a low power dc arcjet thruster. Conical thoriated tungsten nozzle inserts were tested in a modular laboratory arcjet thruster run on hydrogen/nitrogen mixtures simulating the decomposition products of hydrazine. The converging and diverging sides of the inserts had half angles of 30 and 20 degrees, respectively, similar to a flight type unit currently under development. The length of the diverging side was varied to change the area ratio. The nozzle inserts were run over a wide range of specific power. Current, voltage, mass flow rate, and thrust were monitored to provide accurate comparisons between tests. While small differences in performance were observed between the two nozzle inserts, it was determined that for each nozzle insert, arcjet performance improved with increasing nozzle area ratio to the highest area ratio tested and that the losses become very pronounced for area ratios below 50. These trends are somewhat different than those obtained in previous experimental and analytical studies of low Re number nozzles. It appears that arcjet performance can be enhanced via area ratio optimization.
Family of pH-Low-Insertion-Peptides (pHLIPs)
NASA Astrophysics Data System (ADS)
Weerakkody, Dhammika; Moshnikova, Anna; Moshnikova, Valentina; Thakur, Mak; Rossi, Bethany; Engelman, Donald; Andreev, Oleg; Reshetnyak, Yana
2012-02-01
pHLIP (pH (Low) Insertion Peptide) is a novel delivery system for targeting of acidic diseased tissue such as solid tumors, sites of inflammation, arthritis and other pathological states. The molecular mechanism of pHLIP action is based on pH-dependent insertion and folding of pHLIP in membrane. We performed sequence variation and investigated 16 pHLIP variants with main goals of understanding the main principles of peptide-lipid interactions and tune delivery capability of pHLIP. The biophysical studies including thermodynamics and kinetics of the peptides interaction with a lipid bilayer of liposomes and cellular membranes were carried out. We found that peptides association to membrane at neutral and low pH could be modulated by 3-4 times. The apparent pK of transition from surface bound to membrane-inserted state could be tuned from 6.5 to 4.5. The rate of peptide's insertion across a bilayer could be enhanced 100 times compared to parent pHLIP. As a result, blood clearance and tumor targeting were modulated in a significant degree. The work is supported by NIH grants CA133890 to OAA, DME, YRK.
Simultaneous message framing and error detection
NASA Technical Reports Server (NTRS)
Frey, A. H., Jr.
1968-01-01
Circuitry simultaneously inserts message framing information and detects noise errors in binary code data transmissions. Separate message groups are framed without requiring both framing bits and error-checking bits, and predetermined message sequence are separated from other message sequences without being hampered by intervening noise.
Mitochondrial Ceramide-Rich Macrodomains Functionalize Bax upon Irradiation
Lee, Hyunmi; Rotolo, Jimmy A.; Mesicek, Judith; Penate-Medina, Tuula; Rimner, Andreas; Liao, Wen-Chieh; Yin, Xianglei; Ragupathi, Govind; Ehleiter, Desiree; Gulbins, Erich; Zhai, Dayong; Reed, John C.; Haimovitz-Friedman, Adriana; Fuks, Zvi; Kolesnick, Richard
2011-01-01
Background Evidence indicates that Bax functions as a “lipidic” pore to regulate mitochondrial outer membrane permeabilization (MOMP), the apoptosis commitment step, through unknown membrane elements. Here we show mitochondrial ceramide elevation facilitates MOMP-mediated cytochrome c release in HeLa cells by generating a previously-unrecognized mitochondrial ceramide-rich macrodomain (MCRM), which we visualize and isolate, into which Bax integrates. Methodology/Principal Findings MCRMs, virtually non-existent in resting cells, form upon irradiation coupled to ceramide synthase-mediated ceramide elevation, optimizing Bax insertion/oligomerization and MOMP. MCRMs are detected by confocal microscopy in intact HeLa cells and isolated biophysically as a light membrane fraction from HeLa cell lysates. Inhibiting ceramide generation using a well-defined natural ceramide synthase inhibitor, Fumonisin B1, prevented radiation-induced Bax insertion, oligomerization and MOMP. MCRM deconstruction using purified mouse hepatic mitochondria revealed ceramide alone is non-apoptogenic. Rather Bax integrates into MCRMs, oligomerizing therein, conferring 1–2 log enhanced cytochrome c release. Consistent with this mechanism, MCRM Bax isolates as high molecular weight “pore-forming” oligomers, while non-MCRM membrane contains exclusively MOMP-incompatible monomeric Bax. Conclusions/Significance Our recent studies in the C. elegans germline indicate that mitochondrial ceramide generation is obligate for radiation-induced apoptosis, although a mechanism for ceramide action was not delineated. Here we demonstrate that ceramide, generated in the mitochondrial outer membrane of mammalian cells upon irradiation, forms a platform into which Bax inserts, oligomerizes and functionalizes as a pore. We posit conceptualization of ceramide as a membrane-based stress calibrator, driving membrane macrodomain organization, which in mitochondria regulates intensity of Bax-induced MOMP, and is pharmacologically tractable in vitro and in vivo. PMID:21695182
Kooijmans, S A A; Fliervoet, L A L; van der Meel, R; Fens, M H A M; Heijnen, H F G; van Bergen En Henegouwen, P M P; Vader, P; Schiffelers, R M
2016-02-28
Extracellular vesicles (EVs) are increasingly being recognized as candidate drug delivery systems due to their ability to functionally transfer biological cargo between cells. However, the therapeutic applicability of EVs may be limited due to a lack of cell-targeting specificity and rapid clearance of exogenous EVs from the circulation. In order to improve EV characteristics for drug delivery to tumor cells, we have developed a novel method for decorating EVs with targeting ligands conjugated to polyethylene glycol (PEG). Nanobodies specific for the epidermal growth factor receptor (EGFR) were conjugated to phospholipid (DMPE)-PEG derivatives to prepare nanobody-PEG-micelles. When micelles were mixed with EVs derived from Neuro2A cells or platelets, a temperature-dependent transfer of nanobody-PEG-lipids to the EV membranes was observed, indicative of a 'post-insertion' mechanism. This process did not affect EV morphology, size distribution, or protein composition. After introduction of PEG-conjugated control nanobodies to EVs, cellular binding was compromised due to the shielding properties of PEG. However, specific binding to EGFR-overexpressing tumor cells was dramatically increased when EGFR-specific nanobodies were employed. Moreover, whereas unmodified EVs were rapidly cleared from the circulation within 10min after intravenous injection in mice, EVs modified with nanobody-PEG-lipids were still detectable in plasma for longer than 60min post-injection. In conclusion, we propose post-insertion as a novel technique to confer targeting capacity to isolated EVs, circumventing the requirement to modify EV-secreting cells. Importantly, insertion of ligand-conjugated PEG-derivatized phospholipids in EV membranes equips EVs with improved cell specificity and prolonged circulation times, potentially increasing EV accumulation in targeted tissues and improving cargo delivery. Copyright © 2015. Published by Elsevier B.V.
Coffey, Jacob W; Meliga, Stefano C; Corrie, Simon R; Kendall, Mark A F
2016-04-01
Surface modified microprojection arrays are a needle-free alternative to capture circulating biomarkers from the skin in vivo for diagnosis. The concentration and turnover of biomarkers in the interstitial fluid, however, may limit the amount of biomarker that can be accessed by microprojection arrays and ultimately their capture efficiency. Here we report that microprojection array insertion induces protein extravasation from blood vessels and increases the concentration of biomarkers in skin, which can synergistically improve biomarker capture. Regions of blood vessels in skin were identified in the upper dermis and subcutaneous tissue by multi-photon microscopy. Insertion of microprojection array designs with varying projection length (40-190 μm), density (5000-20,408 proj.cm(-2)) and array size (4-36 mm(2)) did not affect the degree of extravasation. Furthermore, the location of extravasated protein did not correlate with projection penetration to these highly vascularised regions, suggesting extravasation was not caused by direct puncture of blood vessels. Biomarker extravasation was also induced by dynamic application of flat control surfaces, and varied with the impact velocity, further supporting this conclusion. The extravasated protein distribution correlated well with regions of high mechanical stress generated during insertion, quantified by finite element models. Using this approach to induce extravasation prior to microprojection array-based biomarker capture, anti-influenza IgG was captured within a 2 min application time, demonstrating that extravasation can lead to rapid biomarker sampling and significantly improved microprojection array capture efficiency. These results have broad implications for the development of transdermal devices that deliver to and sample from the skin. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.
Virtually assisted optical colonoscopy
NASA Astrophysics Data System (ADS)
Marino, Joseph; Qiu, Feng; Kaufman, Arie
2008-03-01
We present a set of tools used to enhance the optical colonoscopy procedure in a novel manner with the aim of improving both the accuracy and efficiency of this procedure. In order to better present the colon information to the gastroenterologist performing a conventional (optical) colonoscopy, we undistort the radial distortion of the fisheye view of the colonoscope. The radial distortion is modeled with a function that converts the fisheye view to the perspective view, where the shape and size of polyps can be more readily observed. The conversion, accelerated on the graphics processing unit and running in real-time, calculates the corresponding position in the fisheye view of each pixel on the perspective image. We also merge our previous work in computer-aided polyp detection for virtual colonoscopy into the optical colonoscopy environment. The physical colonoscope path in the optical colonoscopy is approximated with the hugging corner shortest path, which is correlated with the centerline in the virtual colonoscopy. With the estimated distance that the colonoscope has been inserted, we are able to provide the gastroenterologist with visual cues along the observation path as to the location of possible polyps found by the detection process. In order to present the information to the gastroenterologist in a non-intrusive manner, we have developed a friendly user interface to enhance the optical colonoscopy without being cumbersome, distracting, or resulting in a more lackadaisical inspection by the gastroenterologist.
Hill, S L; Grieger, D M; Olson, K C; Jaeger, J R; Dahlen, C R; Crosswhite, M R; Pereira, N Negrin; Underdahl, S R; Neville, B W; Ahola, J; Fischer, M C; Seidel, G E; Stevenson, J S
2016-09-01
We hypothesized that GnRH would increase pregnancy risk (PR) in a split-time AI program for cows in which estrus was not detected. A total of 1,236 suckled beef cows at 12 locations in 3 states (Colorado, Kansas, and North Dakota) were enrolled. Before applying the fixed-time AI program, BCS was assessed. Cows were treated on d -7 with a progesterone insert concurrent with 100 μg GnRH and on d 0 with 25 mg PGF plus removal of the insert. Estrus-detection patches were affixed to cows at insert removal. Estrus was defined to have occurred when an estrus-detection patch was >50% colored (activated). Cows in estrus by 65 h ( = 758; 61.3% of all cows) were randomly allocated to 2 treatments: 1) 100 μg GnRH and early + GnRH (E+G; = 373) or 2) AI only at 65 h (early - no GnRH [E-G]; = 385). The remaining cows were randomly allocated to 2 treatments: 1) 5(L+G; = 252) or 2) AI only at 84 h (late no GnRH [L-G]; = 226). Pregnancy was determined 35 d after AI via transrectal ultrasound. Pregnancy risk did not differ ( = 0.68) between E+G and E-G cows (61.9 vs. 60.4%, respectively). Conversely, for cows inseminated at 84 h, PR was greater ( = 0.01) in cows that received GnRH (L+G) compared with their herd mates not receiving GnRH (L- G; 41.7 vs. 30.8%, respectively). Of those cows not detected in estrus by 65 h, 42.1% were detected by 84 h, for a total expression of estrus by all cows of 77.6%. Administration of GnRH increased ( < 0.01) PR in cows not detected in estrus by 84 h (+GnRH = 33.4% [ = 146] vs. no GnRH = 15.0% [ = 128]) but had no effect in cows expressing estrus by 84 h (+GnRH = 65.3% [ = 103] vs. no GnRH = 61.7% [ = 97]). Neither estrus expression by 65 or 84 h nor PR was influenced by BCS, parity, or days postpartum at AI. Cows had greater PR when they had been detected in estrus before AI, and PR was improved by administration of GnRH at 65 h after insert removal in cows that were not detected in estrus and inseminated at 84 h.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, C. G.; Li, Y. R.; Zhu, J.
2009-02-15
(100)-Ba{sub 0.65}Sr{sub 0.35}TiO{sub 3} (BST) films were deposited on Pt/Ti/SiO{sub 2}/Si substrates using a low-temperature self-buffered layer. X-ray diffraction and atomic force microscope investigations show that the microstructure of BST films strongly depends on surface morphology of annealed self-buffered layer. The mechanism of nucleus formation and the growth initiation of BST films on self-buffered layers were proposed. It was found that the pyroelectric properties of BST films can be greatly enhanced. The pyroelectric coefficient and material merit figure of (100)-BST films are 1.16x10{sup 4} {mu}C m{sup -2} K{sup -1} and 2.18x10{sup -4} Pa{sup -1/2}, respectively. The detectivity of 9.4x10{sup 7}more » cm Hz{sup 1/2} W{sup -1} was obtained in the (100)-BST film capacitors thermally isolated by 500 nm SiO{sub 2} films.« less
Effects of Hematopoietic Lineage and Precursor Age on CML Disease Progression
2007-03-01
ABL gene was inserted is bi-cistronic and contains the gene encoding green fluorescence protein (GFP) in addition to BCR-ABL, we were able to assess...ribosome entry site (IRES) enhanced green fluorescent protein (EGFP) or 5’ LTR-driven IRES EGFP for 24-36 hours; We received the BCR-ABL construct...from our collaborator, Dr. Owen Witte. This gene was then inserted into a murine retrovirus. We then prepared stocks of retrovirus to be used for
Compiler-assisted static checkpoint insertion
NASA Technical Reports Server (NTRS)
Long, Junsheng; Fuchs, W. K.; Abraham, Jacob A.
1992-01-01
This paper describes a compiler-assisted approach for static checkpoint insertion. Instead of fixing the checkpoint location before program execution, a compiler enhanced polling mechanism is utilized to maintain both the desired checkpoint intervals and reproducible checkpoint 1ocations. The technique has been implemented in a GNU CC compiler for Sun 3 and Sun 4 (Sparc) processors. Experiments demonstrate that the approach provides for stable checkpoint intervals and reproducible checkpoint placements with performance overhead comparable to a previously presented compiler assisted dynamic scheme (CATCH) utilizing the system clock.
Pandey, Prem C; Pandey, Govind; Narayan, Roger J
2017-03-27
Mesoporous silica nanoparticles (MSNPs) have been used as an efficient and safe carrier for drug delivery and biocatalysis. The surface modification of MSNPs using suitable reagents may provide a robust framework in which two or more components can be incorporated to give multifunctional capabilities (e.g., synthesis of noble metal nanoparticles within mesoporous architecture along with loading of a bioactive molecule). In this study, the authors reported on a new synthetic route for the synthesis of gold nanoparticles (AuNPs) within (1) unmodified MSNPs and (2) 3-trihydroxysilylpropyl methylphosphonate-modified MSNPs. A cationic polymer, polyethylenimine (PEI), and formaldehyde were used to mediate synthetic incorporation of AuNPs within MSNPs. The AuNPs incorporated within the mesoporous matrix were characterized by transmission electron microscopy, energy dispersive x-ray analysis, and high-resolution scanning electron microscopy. PEI in the presence of formaldehyde enabled synthetic incorporation of AuNPs in both unmodified and modified MSNPs. The use of unmodified MSNPs was associated with an increase in the polycrystalline structure of the AuNPs within the MSNPs. The AuNPs within modified MSNPs showed better catalytic activity than those within unmodified MSNPs. MSNPs with an average size of 200 nm and with a pore size of 4-6 nm were used for synthetic insertion of AuNPs. It was found that the PEI coating enabled AuNPs synthesis within the mesopores in the presence of formaldehyde or tetrahydrofuran hydroperoxide at a temperature between 10 and 25 °C or at 60 °C in the absence of organic reducing agents. The as-made AuNP-inserted MSNPs exhibited enhanced catalytic activity. For example, these materials enabled rapid catalytic oxidation of the o-dianisidine substrate to produce a colored solution in proportion to the amount of H 2 O 2 generated as a function of glucose oxidase-catalyzed oxidation of glucose; a linear concentration range from 80 to 800 μM and a detection limit as low as 80 μM were observed. The mesoscale pores of the as developed AuNP-inserted MSNPs were also used to entrap the hydrophobic drug paclitaxel. The results of this study indicate the potential use of the AuNP-inserted MSNPs in biocatalysis and drug delivery.
Multisensory System for the Detection and Localization of Peripheral Subcutaneous Veins
Fernández, Roemi; Armada, Manuel
2017-01-01
This paper proposes a multisensory system for the detection and localization of peripheral subcutaneous veins, as a first step for achieving automatic robotic insertion of catheters in the near future. The multisensory system is based on the combination of a SWIR (Short-Wave Infrared) camera, a TOF (Time-Of-Flight) camera and a NIR (Near Infrared) lighting source. The associated algorithm consists of two main parts: one devoted to the features extraction from the SWIR image, and another envisaged for the registration of the range data provided by the TOF camera, with the SWIR image and the results of the peripheral veins detection. In this way, the detected subcutaneous veins are mapped onto the 3D reconstructed surface, providing a full representation of the region of interest for the automatic catheter insertion. Several experimental tests were carried out in order to evaluate the capabilities of the presented approach. Preliminary results demonstrate the feasibility of the proposed design and highlight the potential benefits of the solution. PMID:28422075
Leak locating microphone, method and system for locating fluid leaks in pipes
Kupperman, David S.; Spevak, Lev
1994-01-01
A leak detecting microphone inserted directly into fluid within a pipe includes a housing having a first end being inserted within the pipe and a second opposed end extending outside the pipe. A diaphragm is mounted within the first housing end and an acoustic transducer is coupled to the diaphragm for converting acoustical signals to electrical signals. A plurality of apertures are provided in the housing first end, the apertures located both above and below the diaphragm, whereby to equalize fluid pressure on either side of the diaphragm. A leak locating system and method are provided for locating fluid leaks within a pipe. A first microphone is installed within fluid in the pipe at a first selected location and sound is detected at the first location. A second microphone is installed within fluid in the pipe at a second selected location and sound is detected at the second location. A cross-correlation is identified between the detected sound at the first and second locations for identifying a leak location.
Convolution neural networks for real-time needle detection and localization in 2D ultrasound.
Mwikirize, Cosmas; Nosher, John L; Hacihaliloglu, Ilker
2018-05-01
We propose a framework for automatic and accurate detection of steeply inserted needles in 2D ultrasound data using convolution neural networks. We demonstrate its application in needle trajectory estimation and tip localization. Our approach consists of a unified network, comprising a fully convolutional network (FCN) and a fast region-based convolutional neural network (R-CNN). The FCN proposes candidate regions, which are then fed to a fast R-CNN for finer needle detection. We leverage a transfer learning paradigm, where the network weights are initialized by training with non-medical images, and fine-tuned with ex vivo ultrasound scans collected during insertion of a 17G epidural needle into freshly excised porcine and bovine tissue at depth settings up to 9 cm and [Formula: see text]-[Formula: see text] insertion angles. Needle detection results are used to accurately estimate needle trajectory from intensity invariant needle features and perform needle tip localization from an intensity search along the needle trajectory. Our needle detection model was trained and validated on 2500 ex vivo ultrasound scans. The detection system has a frame rate of 25 fps on a GPU and achieves 99.6% precision, 99.78% recall rate and an [Formula: see text] score of 0.99. Validation for needle localization was performed on 400 scans collected using a different imaging platform, over a bovine/porcine lumbosacral spine phantom. Shaft localization error of [Formula: see text], tip localization error of [Formula: see text] mm, and a total processing time of 0.58 s were achieved. The proposed method is fully automatic and provides robust needle localization results in challenging scanning conditions. The accurate and robust results coupled with real-time detection and sub-second total processing make the proposed method promising in applications for needle detection and localization during challenging minimally invasive ultrasound-guided procedures.
Enhanced sensitivity to near-infrared with high fill factor in small molecular organic solar cells
NASA Astrophysics Data System (ADS)
Shim, Hyun-Sub; Kim, Hyo Jung; Kim, Ji Whan; Kim, Sei-Yong; Jeong, Won-Ik; Kim, Tae-Min; Kim, Jang-Joo
2012-09-01
High efficiency near-infrared (NIR) absorbing solar cells based on lead phthalocyanine (PbPc) are reported using copper iodide (CuI) as a templating layer to control the crystal structure of PbPc. Devices with CuI inserted between the ITO and PbPc layers exhibit a two times enhancement of the JSC compared to the case in the absence of the CuI layer. This is due to the increase of crystallinity in the molecules grown on the CuI templating layer, which is investigated via an x-ray diffraction study. Moreover, fill factor is also enhanced to 0.63 from 0.57 due to low series resistance although the additional CuI layer is inserted between the ITO and the PbPc layer. As a result, the corrected power conversion efficiency of 2.5% was obtained, which is the highest one reported up to now among the PbPc based solar cells.
Fabrication and Characterization of Miniaturized Thermocouples
NASA Astrophysics Data System (ADS)
Munzel, Marco; Peinke, Joachim; Kittel, Achim
2002-11-01
The measurement of thermal fluctuations is important for discovering transport features of a passive scalar in fluids. We present a thermal sensor based on a miniaturized thermocouple. Its coaxial setup results from the fabrication as a micropipette normally used in neurobiology. The glass micropipettes contain a core of gold, antimony, or resistance wire and are coated with platinum. The core material is inserted as molten metal or wire and thinned during the fabrication process. The achieved tip diameters are 1μm and less which enhance the spatial and temporal resolution significantly. Because of its chemically inert coating, these sensors are applicative for detecting temperature fluctuations in large variety of liquids and gases. In addition, such thermocouples are intrinsically suitable for applications in scanning probe microscopy. The characterization of these sensors and first results from turbulent free-jet measurements are presented.
Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D
1994-01-01
For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267
Development of a smart IUD launcher for prevention of uterine perforation.
Al-Ashwal, Rania Hussein; Aziz, Noor Afatin Che; Nooh, Syed Mohd
2016-10-01
Intrauterine contraception is a widely used, highly effective and reversible means of birth control. One potential disadvantage with the use of intrauterine devices (IUDs) is the risk of uterine perforation. During the process of IUD insertion, there is a possibility to perforate the wall of the uterus during which health workers might injure the fundus of the uterus, due to inadequate knowledge or insufficient training. This paper discusses the development of a smart IUD launcher insertion system that would be used to prevent perforation of the uterine wall by detecting a specific distance to the wall for the safe release of the IUD using a sensor. Several launcher prototypes were developed prior to the final version of the IUD launcher. The results from testing experiments, that have been conducted to evaluate the performance of the proposed device, show that the sensor is able to detect a distance up to 5 mm and is also capable of detecting the distance to the target even in high viscosity liquid. The developed prototype promises a solution for more accurate IUD insertion that could be used as a training module for health care providers, helping remove fear from using this long-lasting contraceptive method and promote an affordable modern contraceptive method to society.
Chao, Michael C.; Pritchard, Justin R.; Zhang, Yanjia J.; Rubin, Eric J.; Livny, Jonathan; Davis, Brigid M.; Waldor, Matthew K.
2013-01-01
The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or ‘sick’). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data. PMID:23901011
The Effect of Intravenous Infiltration Management Program for Hospitalized Children.
Park, Soon Mi; Jeong, Ihn Sook; Kim, Kyoung Lae; Park, Kyung Ju; Jung, Moon Ju; Jun, Seong Suk
2016-01-01
This study aimed to identify the effect of IV infiltration management program among hospitalized children. This was a quasi-experimental study with history comparison group design with 2,894 catheters inserted during 3 months comparison phase and 3,651 catheters inserted during 4 months experimental phase. The intervention was composed of seven activities including applying poster, documentation of catheter insertion, parents education, making infiltration report, assessment of vein condition before inserting catheter, appropriate site selection, and documentation of catheter insertion, and assessment of peripheral catheter insertion site every shift. Data were analyzed using of X2-test, Fisher's exact test. The infiltration incidence rate was 0.9% for experimental group and 4.4% for comparison group, which was significantly different (x2=80.42, p<.001). The catheter maintenance period (p=.035) and infiltration state (p=.039) were significantly different among participants with infiltration between comparison and experimental groups. IV Infiltration management program was founded to be effective in reducing the IV infiltration incidence rate and increasing early detection of IV infiltration. Considering the effect of IV Infiltration management program, we recommend that this infiltration management program would be widely used in the clinical settings. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Cockmartin, L.; Marshall, N. W.; Zhang, G.; Lemmens, K.; Shaheen, E.; Van Ongeval, C.; Fredenberg, E.; Dance, D. R.; Salvagnini, E.; Michielsen, K.; Bosmans, H.
2017-02-01
This paper introduces and applies a structured phantom with inserted target objects for the comparison of detection performance of digital breast tomosynthesis (DBT) against 2D full field digital mammography (FFDM). The phantom consists of a 48 mm thick breast-shaped polymethyl methacrylate (PMMA) container filled with water and PMMA spheres of different diameters. Three-dimensionally (3D) printed spiculated masses (diameter range: 3.8-9.7 mm) and non-spiculated masses (1.6-6.2 mm) along with microcalcifications (90-250 µm) were inserted as targets. Reproducibility of the phantom application was studied on a single system using 30 acquisitions. Next, the phantom was evaluated on five different combined FFDM & DBT systems and target detection was compared for FFDM and DBT modes. Ten phantom images in both FFDM and DBT modes were acquired on these 5 systems using automatic exposure control. Five readers evaluated target detectability. Images were read with the four-alternative forced-choice (4-AFC) paradigm, with always one segment including a target and 3 normal background segments. The percentage of correct responses (PC) was assessed based on 10 trials of each reader for each object type, size and imaging modality. Additionally, detection threshold diameters at 62.5 PC were assessed via non-linear regression fitting of the psychometric curve. The reproducibility study showed no significant differences in PC values. Evaluation of target detection in FFDM showed that microcalcification detection thresholds ranged between 110 and 118 µm and were similar compared to the detection in DBT (range of 106-158 µm). In DBT, detection of both mass types increased significantly (p = 0.0001 and p = 0.0002 for non-spiculated and spiculated masses respectively) compared to FFDM, achieving almost 100% detection for all spiculated mass diameters. In conclusion, a structured phantom with inserted targets was able to show evidence for detectability differences between FFDM and DBT modes for five commercial systems. This phantom has potential for application in task-based assessment at acceptance and commissioning testing of DBT systems.
Analysis of Nonlinear Insertion Loss of Hearing Protection Devices using an Acoustic Test Fixture
2015-09-01
USAARL Report No. 2016-05 Analysis of Nonlinear Insertion Loss of Hearing Protection Devices using an Acoustic Test Fixture By Robert Williams1...through circuitry. Talk through circuits use electro- acoustic transducers to pass ambient sounds through the protector. When the circuitry detects...the SPL of the acoustic insult. If the protective capacity is variable, it should be accounted for in the selection of appropriate HPDs. REAT
Sitzwohl, Christian; Langheinrich, Angelika; Schober, Andreas; Krafft, Peter; Sessler, Daniel I; Herkner, Harald; Gonano, Christopher; Weinstabl, Christian; Kettner, Stephan C
2010-11-09
To determine which bedside method of detecting inadvertent endobronchial intubation in adults has the highest sensitivity and specificity. Prospective randomised blinded study. Department of anaesthesia in tertiary academic hospital. 160 consecutive patients (American Society of Anesthesiologists category I or II) aged 19-75 scheduled for elective gynaecological or urological surgery. Patients were randomly assigned to eight study groups. In four groups, an endotracheal tube was fibreoptically positioned 2.5-4.0 cm above the carina, whereas in the other four groups the tube was positioned in the right mainstem bronchus. The four groups differed in the bedside test used to verify the position of the endotracheal tube. To determine whether the tube was properly positioned in the trachea, in each patient first year residents and experienced anaesthetists were randomly assigned to independently perform bilateral auscultation of the chest (auscultation); observation and palpation of symmetrical chest movements (observation); estimation of the position of the tube by the insertion depth (tube depth); or a combination of all three (all three). Correct and incorrect judgments of endotracheal tube position. 160 patients underwent 320 observations by experienced and inexperienced anaesthetists. First year residents missed endobronchial intubation by auscultation in 55% of cases and performed significantly worse than experienced anaesthetists with this bedside test (odds ratio 10.0, 95% confidence interval 1.4 to 434). With a sensitivity of 88% (95% confidence interval 75% to 100%) and 100%, respectively, tube depth and the three tests combined were significantly more sensitive for detecting endobronchial intubation than auscultation (65%, 49% to 81%) or observation(43%, 25% to 60%) (P<0.001). The four tested methods had the same specificity for ruling out endobronchial intubation (that is, confirming correct tracheal intubation). The average correct tube insertion depth was 21 cm in women and 23 cm in men. By inserting the tube to these distances, however, the distal tip of the tube was less than 2.5 cm away from the carina (the recommended safety distance, to prevent inadvertent endobronchial intubation with changes in the position of the head in intubated patients) in 20% (24/118) of women and 18% (7/42) of men. Therefore optimal tube insertion depth was considered to be 20 cm in women and 22 cm in men. Less experienced clinicians should rely more on tube insertion depth than on auscultation to detect inadvertent endobronchial intubation. But even experienced physicians will benefit from inserting tubes to 20-21 cm in women and 22-23 cm in men, especially when high ambient noise precludes accurate auscultation (such as in emergency situations or helicopter transport). The highest sensitivity and specificity for ruling out endobronchial intubation, however, is achieved by combining tube depth, auscultation of the lungs, and observation of symmetrical chest movements. NCT01232166.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Manohar, N; Cho, S; Reynoso, F
Purpose: To make benchtop x-ray fluorescence computed tomography (XFCT) practical for routine preclinical imaging tasks with gold nanoparticles (GNPs) by deploying, integrating, and characterizing a dedicated high-performance x-ray source and addition of simultaneous micro-CT functionality. Methods: Considerable research effort is currently under way to develop a polychromatic benchtop cone-beam XFCT system capable of imaging GNPs by stimulation and detection of gold K-shell x-ray fluorescence (XRF) photons. Recently, an ad hoc high-power x-ray source was incorporated and used to image the biodistribution of GNPs within a mouse, postmortem. In the current work, a dedicated x-ray source system featuring a liquid-cooled tungsten-targetmore » x-ray tube (max 160 kVp, ∼3 kW power) was deployed. The source was operated at 125 kVp, 24 mA. The tube’s compact dimensions allowed greater flexibility for optimizing both the irradiation and detection geometries. Incident x-rays were shaped by a conical collimator and filtered by 2 mm of tin. A compact “OEM” cadmium-telluride x-ray detector was implemented for detecting XRF/scatter spectra. Additionally, a flat panel detector was installed to allow simultaneous transmission CT imaging. The performance of the system was characterized by determining the detection limit (10-second acquisition time) for inserts filled with water/GNPs at various concentrations (0 and 0.010–1.0 wt%) and embedded in a small-animal-sized phantom. The phantom was loaded with 0.5, 0.3, and 0.1 wt% inserts and imaged using XFCT and simultaneous micro-CT. Results: An unprecedented detection limit of 0.030 wt% was experimentally demonstrated, with a 33% reduction in acquisition time. The reconstructed XFCT image accurately localized the imaging inserts. Micro-CT imaging did not provide enough contrast to distinguish imaging inserts from the phantom under the current conditions. Conclusion: The system is immediately capable of in vivo preclinical XFCT imaging with GNPs. Micro-CT imaging will require optimization of irradiation parameters to improve contrast. Supported by NIH/NCI grant R01CA155446; This investigation was supported by NIH/NCI grant R01CA155446.« less
USDA-ARS?s Scientific Manuscript database
Chemical mutagenesis efficiently generates phenotypic variation in otherwise homogeneous genetic backgrounds, enabling functional analysis of genes. Advances in mutation detection have brought the utility of induced mutant populations on par with those produced by insertional mutagenesis, but system...
Alu repeat discovery and characterization within human genomes
Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.
2011-01-01
Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385
Hill, S L; Grieger, D M; Olson, K C; Jaeger, J R; Dahlen, C R; Bridges, G A; Dantas, F; Larson, J E; Muth-Spurlock, A M; Ahola, J K; Fischer, M C; Perry, G A; Larimore, E L; Steckler, T L; Whittier, W D; Currin, J F; Stevenson, J S
2016-09-01
A multilocation study examined pregnancy risk (PR) after delaying AI in suckled beef cows from 60 to 75 h when estrus had not been detected by 60 h in response to a 7-d CO-Synch + progesterone insert (CIDR) timed AI (TAI) program (d -7: CIDR insert concurrent with an injection of GnRH; d 0: PGF injection and removal of CIDR insert; and GnRH injection at TAI [60 or 75 h after CIDR removal]). A total of 1,611 suckled beef cows at 15 locations in 9 states (CO, IL, KS, MN, MS, MT, ND, SD, and VA) were enrolled. Before applying the fixed-time AI program, BCS was assessed, and blood samples were collected. Estrus was defined to have occurred when an estrus detection patch was >50% colored (activated). Pregnancy was determined 35 d after AI via transrectal ultrasound. Cows ( = 746) detected in estrus by 60 h (46.3%) after CIDR removal were inseminated and treated with GnRH at AI (Control). Remaining nonestrous cows were allocated within location to 3 treatments on the basis of parity and days postpartum: 1) GnRH injection and AI at 60 h (early-early = EE; = 292), 2) GnRH injection at 60 h and AI at 75 h (early-delayed = ED; = 282), or 3) GnRH injection and AI at 75 h (delayed-delayed = DD; = 291). Control cows had a greater ( < 0.01) PR (64.2%) than other treatments (EE = 41.7%, ED = 52.8%, DD = 50.0%). Use of estrus detection patches to delay AI in cows not in estrus by 60 h after CIDR insert removal (ED and DD treatments) increased ( < 0.05) PR to TAI when compared with cows in the EE treatment. More ( < 0.001) cows that showed estrus by 60 h conceived to AI at 60 h than those not showing estrus (64.2% vs. 48.1%). Approximately half (49.2%) of the cows not in estrus by 60 h had activated patches by 75 h, resulting in a greater ( < 0.05) PR than their nonestrous herd mates in the EE (46.1% vs. 34.5%), ED (64.2% vs. 39.2%), and DD (64.8% vs. 31.5%) treatments, respectively. Overall, cows showing estrus by 75 h (72.7%) had greater ( < 0.001) PR to AI (61.3% vs. 37.9%) than cows not showing estrus. Use of estrus detection patches to allow for a delayed AI in cows not in estrus by 60 h after removal of the CIDR insert improved PR to TAI by optimizing the timing of the AI in those cows.
Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system.
Peng, Feng; Wang, Xinyue; Sun, Yang; Dong, Guibin; Yang, Yankun; Liu, Xiuxia; Bai, Zhonghu
2017-11-14
Corynebacterium glutamicum (C. glutamicum) has traditionally been used as a microbial cell factory for the industrial production of many amino acids and other industrially important commodities. C. glutamicum has recently been established as a host for recombinant protein expression; however, some intrinsic disadvantages could be improved by genetic modification. Gene editing techniques, such as deletion, insertion, or replacement, are important tools for modifying chromosomes. In this research, we report a CRISPR/Cas9 system in C. glutamicum for rapid and efficient genome editing, including gene deletion and insertion. The system consists of two plasmids: one containing a target-specific guide RNA and a homologous sequence to a target gene, the other expressing Cas9 protein. With high efficiency (up to 100%), this system was used to disrupt the porB, mepA, clpX and Ncgl0911 genes, which affect the ability to express proteins. The porB- and mepA-deletion strains had enhanced expression of green fluorescent protein, compared with the wild-type stain. This system can also be used to engineer point mutations and gene insertions. In this study, we adapted the CRISPR/Cas9 system from S. pyogens to gene deletion, point mutations and insertion in C. glutamicum. Compared with published genome modification methods, methods based on the CRISPR/Cas9 system can rapidly and efficiently achieve genome editing. Our research provides a powerful tool for facilitating the study of gene function, metabolic pathways, and enhanced productivity in C. glutamicum.
Schmidt, Nathan W.; Grigoryan, Gevorg
2017-01-01
Abstract Coiled‐coils are essential components of many protein complexes. First discovered in structural proteins such as keratins, they have since been found to figure largely in the assembly and dynamics required for diverse functions, including membrane fusion, signal transduction and motors. Coiled‐coils have a characteristic repeating seven‐residue geometric and sequence motif, which is sometimes interrupted by the insertion of one or more residues. Such insertions are often highly conserved and critical to interdomain communication in signaling proteins such as bacterial histidine kinases. Here we develop the “accommodation index” as a parameter that allows automatic detection and classification of insertions based on the three dimensional structure of a protein. This method allows precise identification of the type of insertion and the “accommodation length” over which the insertion is structurally accommodated. A simple theory is presented that predicts the structural perturbations of 1, 3, 4 residue insertions as a function of the length over which the insertion is accommodated. Analysis of experimental structures is in good agreement with theory, and shows that short accommodation lengths give rise to greater perturbation of helix packing angles, changes in local helical phase, and increased structural asymmetry relative to long accommodation lengths. Cytoplasmic domains of histidine kinases in different signaling states display large changes in their accommodation lengths, which can now be seen to underlie diverse structural transitions including symmetry/asymmetry and local variations in helical phase that accompany signal transduction. PMID:27977891
Cassini/CIRS Observations of Water Vapor in Saturn's Stratosphere
NASA Technical Reports Server (NTRS)
Bjoraker, Gordon; Achterberg, R. K.; Simon-Miller, A. A.; Jennings, D. E.
2010-01-01
The Composite Infrared Spectrometer (CIRS) on the Cassini spacecraft has obtained numerous spectra of Saturn at varying spectral and spatial resolutions since Saturn Orbit Insertion in 2001. Emission lines due to water vapor in Saturn's stratosphere were first detected using whole-disk observations from the Infrared Space Observatory [1] and subsequently confirmed by the Submillimeter Wave Astronomy Satellite [2], CIRS has detected water and the data permit the retrieval of the latitudinal variation of water on Saturn. Emission lines of H2O on Saturn are very weak in the CIRS data. Thus, large spectral averages as well as improvements in calibration are necessary to detect water vapor. long integrations at the full 0.5/cm spectral resolution were performed at targeted latitudes on Saturn. High emission angles were chosen to enhance stratospheric emission. Over the course of the prime and extended mission a set of observations has been built up spaced roughly every 10 degrees of latitude. Stratospheric temperatures in the 0.5 - 5.0 mbar range were obtained by inverting spectra of CH4 in the v'4 band centered at 1501/cm. The origin of water vapor is believed to be from the ablation of micrometeorites containing eater ice, followed by photochemistry. This external source of oxygen originates either from the Saturn system (from the rings or perhaps from Enceladus) or from the interplanetary medium. Connerney [3] proposed a mechanism to transport water from the inner edge of the B-ring along magnetic field lines to specific latitudes (50N and 44S) on Saturn. Prange et al [4] interpreted a minimum in the abundance of acetylene from ultraviolet spectra gear 41S on Saturn as possibly due to an enhanced influx of water. We will be able to test the "ring rain" mechanism by searching, for localized water vapor enhancement at mid-latitudes. Our results may be used to constrain photochemical models of Saturn's stratosphere [5].
Novel genes associated with enhanced motility of Escherichia coli ST131
Kakkanat, Asha; Phan, Minh-Duy; Lo, Alvin W.; Beatson, Scott A.
2017-01-01
Uropathogenic Escherichia coli (UPEC) is the cause of ~75% of all urinary tract infections (UTIs) and is increasingly associated with multidrug resistance. This includes UPEC strains from the recently emerged and globally disseminated sequence type 131 (ST131), which is now the dominant fluoroquinolone-resistant UPEC clone worldwide. Most ST131 strains are motile and produce H4-type flagella. Here, we applied a combination of saturated Tn5 mutagenesis and transposon directed insertion site sequencing (TraDIS) as a high throughput genetic screen and identified 30 genes associated with enhanced motility of the reference ST131 strain EC958. This included 12 genes that repress motility of E. coli K-12, four of which (lrhA, ihfA, ydiV, lrp) were confirmed in EC958. Other genes represented novel factors that impact motility, and we focused our investigation on characterisation of the mprA, hemK and yjeA genes. Mutation of each of these genes in EC958 led to increased transcription of flagellar genes (flhD and fliC), increased expression of the FliC flagellin, enhanced flagella synthesis and a hyper-motile phenotype. Complementation restored all of these properties to wild-type level. We also identified Tn5 insertions in several intergenic regions (IGRs) on the EC958 chromosome that were associated with enhanced motility; this included flhDC and EC958_1546. In both of these cases, the Tn5 insertions were associated with increased transcription of the downstream gene(s), which resulted in enhanced motility. The EC958_1546 gene encodes a phage protein with similarity to esterase/deacetylase enzymes involved in the hydrolysis of sialic acid derivatives found in human mucus. We showed that over-expression of EC958_1546 led to enhanced motility of EC958 as well as the UPEC strains CFT073 and UTI89, demonstrating its activity affects the motility of different UPEC strains. Overall, this study has identified and characterised a number of novel factors associated with enhanced UPEC motility. PMID:28489862
An, Z; Tang, Z; Ma, B; Mason, A S; Guo, Y; Yin, J; Gao, C; Wei, L; Li, J; Fu, D
2014-07-01
Although many studies have shown that transposable element (TE) activation is induced by hybridisation and polyploidisation in plants, much less is known on how different types of TE respond to hybridisation, and the impact of TE-associated sequences on gene function. We investigated the frequency and regularity of putative transposon activation for different types of TE, and determined the impact of TE-associated sequence variation on the genome during allopolyploidisation. We designed different types of TE primers and adopted the Inter-Retrotransposon Amplified Polymorphism (IRAP) method to detect variation in TE-associated sequences during the process of allopolyploidisation between Brassica rapa (AA) and Brassica oleracea (CC), and in successive generations of self-pollinated progeny. In addition, fragments with TE insertions were used to perform Blast2GO analysis to characterise the putative functions of the fragments with TE insertions. Ninety-two primers amplifying 548 loci were used to detect variation in sequences associated with four different orders of TE sequences. TEs could be classed in ascending frequency into LTR-REs, TIRs, LINEs, SINEs and unknown TEs. The frequency of novel variation (putative activation) detected for the four orders of TEs was highest from the F1 to F2 generations, and lowest from the F2 to F3 generations. Functional annotation of sequences with TE insertions showed that genes with TE insertions were mainly involved in metabolic processes and binding, and preferentially functioned in organelles. TE variation in our study severely disturbed the genetic compositions of the different generations, resulting in inconsistencies in genetic clustering. Different types of TE showed different patterns of variation during the process of allopolyploidisation. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
Howard, M; Jiang, X; Stolz, D B; Hill, W G; Johnson, J A; Watkins, S C; Frizzell, R A; Bruton, C M; Robbins, P D; Weisz, O A
2000-08-01
Channel gating of the cystic fibrosis transmembrane conductance regulator (CFTR) is activated in response to cAMP stimulation. In addition, CFTR activation may also involve rapid insertion of a subapical pool of CFTR into the plasma membrane (PM). However, this issue has been controversial, in part because of the difficulty in distinguishing cell surface vs. intracellular CFTR. Recently, a fully functional, epitope-tagged form of CFTR (M2-901/CFTR) that can be detected immunologically in nonpermeabilized cells was characterized (Howard M, Duvall MD, Devor DC, Dong J-Y, Henze K, and Frizzell RA. Am J Physiol Cell Physiol 269: C1565-C1576, 1995; and Schultz BD, Takahashi A, Liu C, Frizzell RA, and Howard M. Am J Physiol Cell Physiol 273: C2080-C2089, 1997). We have developed replication-defective recombinant adenoviruses that express M2-901/CFTR and used them to probe cell surface CFTR in forskolin (FSK)-stimulated polarized Madin-Darby canine kidney (MDCK) cells. Virally expressed M2-901/CFTR was functional and was readily detected on the apical surface of FSK-stimulated polarized MDCK cells. Interestingly, at low multiplicity of infection, we observed FSK-stimulated insertion of M2901/CFTR into the apical PM, whereas at higher M2-901/CFTR expression levels, no increase in surface expression was detected using indirect immunofluorescence. Immunoelectron microscopy of unstimulated and FSK-stimulated cells confirmed the M2-901/CFTR redistribution to the PM upon FSK stimulation and demonstrates that the apically inserted M2-901/CFTR originates from a population of subapical vesicles. Our observations may reconcile previous conflicting reports regarding the effect of cAMP stimulation on CFTR trafficking.
Spin Hall driven domain wall motion in magnetic bilayers coupled by a magnetic oxide interlayer
NASA Astrophysics Data System (ADS)
Liu, Yang; Furuta, Masaki; Zhu, Jian-Gang Jimmy
2018-05-01
mCell, previously proposed by our group, is a four-terminal magnetoresistive device with isolated write- and read-paths for all-spin logic and memory applications. A mCell requires an electric-insulating magnetic layer to couple the spin Hall driven write-path to the magnetic free layer of the read-path. Both paths are magnetic layers with perpendicular anisotropy and their perpendicularly oriented magnetization needs to be maintained with this insertion layer. We have developed a magnetic oxide (FeOx) insertion layer to serve for these purposes. We show that the FeOx insertion layer provides sufficient magnetic coupling between adjacent perpendicular magnetic layers. Resistance measurement shows that this magnetic oxide layer can act as an electric-insulating layer. In addition, spin Hall driven domain wall motion in magnetic bi-layers coupled by the FeOx insertion layer is significantly enhanced compared to that in magnetic single layer; it also requires low voltage threshold that poses possibility for power-efficient device applications.
Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.
Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana
2015-03-01
We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Precision grid and hand motion for accurate needle insertion in brachytherapy
DOE Office of Scientific and Technical Information (OSTI.GOV)
McGill, Carl S.; Schwartz, Jonathon A.; Moore, Jason Z.
2011-08-15
Purpose: In prostate brachytherapy, a grid is used to guide a needle tip toward a preplanned location within the tissue. During insertion, the needle deflects en route resulting in target misplacement. In this paper, 18-gauge needle insertion experiments into phantom were performed to test effects of three parameters, which include the clearance between the grid hole and needle, the thickness of the grid, and the needle insertion speed. Measurement apparatus that consisted of two datum surfaces and digital depth gauge was developed to quantify needle deflections. Methods: The gauge repeatability and reproducibility (GR and R) test was performed on themore » measurement apparatus, and it proved to be capable of measuring a 2 mm tolerance from the target. Replicated experiments were performed on a 2{sup 3} factorial design (three parameters at two levels) and analysis included averages and standard deviation along with an analysis of variance (ANOVA) to find significant single and two-way interaction factors. Results: Results showed that grid with tight clearance hole and slow needle speed increased precision and accuracy of needle insertion. The tight grid was vital to enhance precision and accuracy of needle insertion for both slow and fast insertion speed; additionally, at slow speed the tight, thick grid improved needle precision and accuracy. Conclusions: In summary, the tight grid is important, regardless of speed. The grid design, which shows the capability to reduce the needle deflection in brachytherapy procedures, can potentially be implemented in the brachytherapy procedure.« less
Gause, Maria; Morcillo, Patrick; Dorsett, Dale
2001-01-01
The Drosophila mod(mdg4) gene products counteract heterochromatin-mediated silencing of the white gene and help activate genes of the bithorax complex. They also regulate the insulator activity of the gypsy transposon when gypsy inserts between an enhancer and promoter. The Su(Hw) protein is required for gypsy-mediated insulation, and the Mod(mdg4)-67.2 protein binds to Su(Hw). The aim of this study was to determine whether Mod(mdg4)-67.2 is a coinsulator that helps Su(Hw) block enhancers or a facilitator of activation that is inhibited by Su(Hw). Here we provide evidence that Mod(mdg4)-67.2 acts as a coinsulator by showing that some loss-of-function mod(mdg4) mutations decrease enhancer blocking by a gypsy insert in the cut gene. We find that the C terminus of Mod(mdg4)-67.2 binds in vitro to a region of Su(Hw) that is required for insulation, while the N terminus mediates self-association. The N terminus of Mod(mdg4)-67.2 also interacts with the Chip protein, which facilitates activation of cut. Mod(mdg4)-67.2 truncated in the C terminus interferes in a dominant-negative fashion with insulation in cut but does not significantly affect heterochromatin-mediated silencing of white. We infer that multiple contacts between Su(Hw) and a Mod(mdg4)-67.2 multimer are required for insulation. We theorize that Mod(mdg4)-67.2 usually aids gene activation but can also act as a coinsulator by helping Su(Hw) trap facilitators of activation, such as the Chip protein. PMID:11416154
Kuhn, Alexandre; Ong, Yao Min; Cheng, Ching-Yu; Wong, Tien Yin; Quake, Stephen R; Burkholder, William F
2014-06-03
Insertions of the human-specific subfamily of LINE-1 (L1) retrotransposon are highly polymorphic across individuals and can critically influence the human transcriptome. We hypothesized that L1 insertions could represent genetic variants determining important human phenotypic traits, and performed an integrated analysis of L1 elements and single nucleotide polymorphisms (SNPs) in several human populations. We found that a large fraction of L1s were in high linkage disequilibrium with their surrounding genomic regions and that they were well tagged by SNPs. However, L1 variants were only partially captured by SNPs on standard SNP arrays, so that their potential phenotypic impact would be frequently missed by SNP array-based genome-wide association studies. We next identified potential phenotypic effects of L1s by looking for signatures of natural selection linked to L1 insertions; significant extended haplotype homozygosity was detected around several L1 insertions. This finding suggests that some of these L1 insertions may have been the target of recent positive selection.
Interrogation of electrical connector faults using miniaturized UWB sources
NASA Astrophysics Data System (ADS)
Tokgöz, Çaǧata; Dardona, Sameh
2017-01-01
A diagnostic method for the detection, identification, and characterization of precursors of faults due to partial insertion of pin-socket contacts within electrical connectors commonly used in avionics systems is presented. It is demonstrated that a miniaturized ultrawideband (UWB) source and a minispectrum analyzer can be employed to measure resonant frequency shifts in connector S parameters as a small and low-cost alternative to a large and expensive network analyzer. The transfer function of an electrical connector is represented as a ratio of the spectra measured using the spectrum analyzer with and without the connector. Alternatively, the transfer function is derived in terms of the connector S parameters and the reflection coefficients at both ports of the connector. The transfer function data obtained using this derivation agreed well with its representation as a measured spectral ratio. The derivation enabled the extraction of the connector S parameters from the measured transfer function data as a function of the insertion depth of a pin-socket contact within the connector. In comparison with the S parameters measured directly using a network analyzer at multiple insertion depths, the S parameters extracted from the measured transfer function showed consistent and reliable representation of the electrical connector fault. The results demonstrate the potential of integrating a low-cost miniaturized UWB device into a connector harness for real-time detection of precursors to partially inserted connector faults.
Abdelsalam, Mohamed; Chen, Shih-Chu; Yoshida, Terutoyo
2010-08-01
The Lancefield group C alpha-hemolytic Streptococcus dysgalactiae ssp. dysgalactiae (GCSD) causes systemic granulomatous inflammatory disease and high mortality rates in infected fish. Superantigen and streptolysin S genes are the most important virulence factors contributing to an invasive streptococcal infection. PCR amplification revealed that all strains isolated from moribund fish harbored the streptolysin S structural gene (sagA). GCSD fish isolates were PCR negative for emm, speA, speB, speC, speM, smeZ, and ssa. However, the size of the streptococcal pyrogenic exotoxin G (spegg) locus, a superantigen, in positive S. dysgalactiae fish and pig strains was variable. The ORF of the spegg locus of 26 GCSD fish strains and one GCSD pig strain was inserted with IS981SC. Interestingly, the ORF of the spegg locus of two fish strains of GCSD collected in Malaysia was inserted with an IS981SC-IS1161 hybrid IS element. The hybrid IS element was found in all of the GCSD fish isolates and one GCSD pig through PCR screening. Although no insertion sequence (IS) was detected in the spegg locus of S. dysgalactiae ssp. equisimilis (GCSE) strains, a five-nucleotide deletion mutation was detected in the ORF of the spegg locus of one GCSE strain at the supposed site of IS981SC insertion, resulting in a frameshift mutation.
A Novel Symmetrical Split Ring Resonator Based on Microstrip for Microwave Sensors
NASA Astrophysics Data System (ADS)
Alahnomi, Rammah A.; Zakaria, Z.; Ruslan, E.; Bahar, Amyrul Azuan Mohd
2016-02-01
In this paper, novel symmetrical split ring resonator (SSRR) is proposed as a suitable component for performance enhancement of microwave sensors. SSRR has been employed for enhancing the insertion loss of the microwave sensors. Using the same device area, we can achieve a high Q-factor of 141.54 from the periphery enhancement using Quasi-linear coupling SSRR, whereas loose coupling SSRR can achieve a Q-factor of 33.98 only. Using Quasi-linear coupling SSRR, the Q-factor is enhanced 4.16 times the loose coupling SSRR using the same device area. After the optimization was made, the SSRR sensor with loose coupling scheme has achieved a very high Qfactor value around 407.34 while quasi-linear scheme has achieved high Q-factor value of 278.78 at the same operating frequency with smaller insertion loss. Spurious passbands at 1st, 2nd, 3rd, and 4th harmonics have been completely suppressed well above -20 dB rejection level without visible changes in the passband filter characteristics. The most significant of using SSRR is to be used for various industrial applications such as food industry, quality control, bio-sensing medicine and pharmacy. The simulation result that Quasi-linear coupling SSRR is a viable candidate for the performance enhancement of microwave sensors has been verified.
Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D
2014-05-27
We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.
Garcia, Anthony R.; Johnston, Roger G.
2003-07-08
The present invention provides an apparatus and method whereby the reliability and tamper-resistance of tamper indicators can be improved. A flexible connector may be routed through a latch for an enclosure such as a door or container, and the free ends of the flexible connector may be passed through a first locking member and firmly attached to an insert through the use of one or more attachment members such as set screws. A second locking member may then be assembled in interlocking relation with the first locking member to form an interlocked assembly around the insert. The insert may have one or more sharp projections extending toward the first or second locking member so that any compressive force applied in an attempt to disassemble the interlocked assembly results in permanent, visible damage to the first or second locking member.
Implementation of rectangular slit-inserted ultra-wideband tapered slot antenna.
Kim, Sun-Woong; Choi, Dong-You
2016-01-01
In this paper, a tapered slot antenna capable of ultra-wideband communication was designed. In the proposed antenna, rectangular slits were inserted to enhance the bandwidth and reduce the area of the antenna. The rectangular slit-inserted tapered slot antenna operated at a bandwidth of 8.45 GHz, and the bandwidth improved upon the basic tapered slot antenna by 4.72 GHz. The radiation pattern of the antenna was suitable for location recognition in a certain direction owing to an appropriate 3 dB beam width. The antenna gain was analyzed within the proposed bandwidth, and the highest gain characteristic at 7.55 dBi was exhibited at a 5-GHz band. The simulation and measurement results of the proposed tapered slot antenna were similar.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gong, Y.; Li, X.M.; Shapiro, L.J.
1994-09-01
Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand,more » and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.« less
Lim, Geraldine S; Zidar, Jernej; Cheong, Daniel W; Jaenicke, Stephan; Klähn, Marco
2014-09-04
The impact of five different imidazolium-based ionic liquids (ILs) diluted in water on the properties of a bacterial plasma membrane is investigated using molecular dynamics (MD) simulations. Cations considered are 1-octyl-3-methylimidazolium (OMIM), 1-octyloxymethyl-3-methylimidazolium (OXMIM), and 1-tetradecyl-3-methylimidazolium (TDMIM), as well as the anions chloride and lactate. The atomistic model of the membrane bilayer is designed to reproduce the lipid composition of the plasma membrane of Gram-negative Escherichia coli. Spontaneous insertion of cations into the membrane is observed in all ILs. Substantially more insertions of OMIM than of OXMIM occur and the presence of chloride reduces cation insertions compared to lactate. In contrast, anions do not adsorb onto the membrane surface nor diffuse into the bilayer. Once inserted, cations are oriented in parallel to membrane lipids with cation alkyl tails embedded into the hydrophobic membrane core, while the imidazolium-ring remains mostly exposed to the solvent. Such inserted cations are strongly associated with one to two phospholipids in the membrane. The overall order of lipids decreased after OMIM and OXMIM insertions, while on the contrary the order of lipids in the vicinity of TDMIM increased. The short alkyl tails of OMIM and OXMIM generate voids in the bilayer that are filled by curling lipids. This cation induced lipid disorder also reduces the average membrane thickness. This effect is not observed after TDMIM insertions due to the similar length of cation alkyl chain and the fatty acids of the lipids. This lipid-mimicking behavior of inserted TDMIM indicates a high membrane affinity of this cation that could lead to an enhanced accumulation of cations in the membrane over time. Overall, the simulations reveal how cations are inserted into the bacterial membrane and how such insertions change its properties. Moreover, the different roles of cations and anions are highlighted and the fundamental importance of cation alkyl chain length and its functionalization is demonstrated.
USDA-ARS?s Scientific Manuscript database
The ability to rescue an infectious, recombinant, RNA virus from a cDNA clone, has led to new opportunities for measuring viral replication from a viral expressed reporter gene. In this protocol, the process of inserting enhanced green fluorescent protein (EGFP) gene into the human parainfluenza vi...
Schmidt, Kristina Maria; Schümann, Michael; Olejnik, Judith; Krähling, Verena
2011-01-01
The generation of recombinant enhanced green fluorescent protein (EGFP)--expressing viruses has significantly improved the study of their life cycle and opened up the possibility for the rapid screening of antiviral drugs. Here we report rescue of a recombinant Marburg virus (MARV) expressing EGFP from an additional transcription unit (ATU). The ATU was inserted between the second and third genes, encoding VP35 and VP40, respectively. Live-cell imaging was used to follow virus spread in real time. EGFP expression was detected at 32 hours postinfection (hpi), and infection of neighboring cells was monitored at 55 hpi. Compared to the parental virus, production of progeny rMARV-EGFP was reduced 4-fold and lower protein levels of VP40, but not nucleoprotein, were observed, indicating a decrease in downstream protein expression due to the insertion of an ATU. Interestingly, EGFP concentrated in viral inclusions in infected cells. This was reproduced by transient expression of both EGFP and other fluorescent proteins along with filovirus nucleocapsid proteins, and may suggest that a general increase in protein synthesis occurs at viral inclusion sites. In conclusion, the EGFP-expressing MARV will be a useful tool not only to monitor virus spread and screen for antiviral compounds, but also to investigate the biology of inclusion body formation. PMID:21987762
Radecke, Sarah; Radecke, Frank; Cathomen, Toni; Schwarz, Klaus
2010-01-01
Correcting a mutated gene directly at its endogenous locus represents an alternative to gene therapy protocols based on viral vectors with their risk of insertional mutagenesis. When solely a single-stranded oligodeoxynucleotide (ssODN) is used as a repair matrix, the efficiency of the targeted gene correction is low. However, as shown with the homing endonuclease I-SceI, ssODN-mediated gene correction can be enhanced by concomitantly inducing a DNA double-strand break (DSB) close to the mutation. Because I-SceI is hardly adjustable to cut at any desired position in the human genome, here, customizable zinc-finger nucleases (ZFNs) were used to stimulate ssODN-mediated repair of a mutated single-copy reporter locus stably integrated into human embryonic kidney-293 cells. The ZFNs induced faithful gene repair at a frequency of 0.16%. Six times more often, ZFN-induced DSBs were found to be modified by unfaithful addition of ssODN between the termini and about 60 times more often by nonhomologous end joining-related deletions and insertions. Additionally, ZFN off-target activity based on binding mismatch sites at the locus of interest was detected in in vitro cleavage assays and also in chromosomal DNA isolated from treated cells. Therefore, the specificity of ZFN-induced ssODN-mediated gene repair needs to be improved, especially regarding clinical applications. PMID:20068556
A Superconducting Switch for Insertion Devices with Variable Period Length
NASA Astrophysics Data System (ADS)
Holubek, T.; Baumbach, T.; Casalbuoni, S.; Gerstl, S.; Grau, A.; Hagelstein, M.; Jauregui, D. Saez de; Boffo, C.; Walter, W.
Superconducting insertion devices (IDs) are very attractive for synchrotron light sources since they offer the possibility to enhance the tuning range and functionality significantly by period length switching. Period length switching can be realized by reversing the current in a separately powered subset of the superconducting windings.So far, the first demonstration mock-up coil allowing period length tripling was fabricated and tested successfully. Here, we report on the feasibility of superconducting switches built to operate in a liquid helium bath and under conduction cooled conditions.
Development and testing of the rack insertion device
NASA Technical Reports Server (NTRS)
Strickland, G. Scott
1995-01-01
Installing and removing experiment racks in a Space Station Logistics Module will become a repetitive operation at Kennedy Space Center (KSC) in the near future. A Rack Insertion Device (RID) consisting of an Extendible Boom, End Effector, and Positioning Base is being developed for the task. This paper discusses the key elements of the RlD's function and design. Prototype test results for the RlD's Extendible Boom and End Effector are presented. Also discussed are future end effectors that will further enhance the RlD's Space Station processing capability.
NASA Astrophysics Data System (ADS)
Ajadi, O. A.; Meyer, F. J.
2014-12-01
Automatic oil spill detection and tracking from Synthetic Aperture Radar (SAR) images is a difficult task, due in large part to the inhomogeneous properties of the sea surface, the high level of speckle inherent in SAR data, the complexity and the highly non-Gaussian nature of amplitude information, and the low temporal sampling that is often achieved with SAR systems. This research presents a promising new oil spill detection and tracking method that is based on time series of SAR images. Through the combination of a number of advanced image processing techniques, the develop approach is able to mitigate some of these previously mentioned limitations of SAR-based oil-spill detection and enables fully automatic spill detection and tracking across a wide range of spatial scales. The method combines an initial automatic texture analysis with a consecutive change detection approach based on multi-scale image decomposition. The first step of the approach, a texture transformation of the original SAR images, is performed in order to normalize the ocean background and enhance the contrast between oil-covered and oil-free ocean surfaces. The Lipschitz regularity (LR), a local texture parameter, is used here due to its proven ability to normalize the reflectivity properties of ocean water and maximize the visibly of oil in water. To calculate LR, the images are decomposed using two-dimensional continuous wavelet transform (2D-CWT), and transformed into Holder space to measure LR. After texture transformation, the now normalized images are inserted into our multi-temporal change detection algorithm. The multi-temporal change detection approach is a two-step procedure including (1) data enhancement and filtering and (2) multi-scale automatic change detection. The performance of the developed approach is demonstrated by an application to oil spill areas in the Gulf of Mexico. In this example, areas affected by oil spills were identified from a series of ALOS PALSAR images acquired in 2010. The comparison showed exceptional performance of our method. This method can be applied to emergency management and decision support systems with a need for real-time data, and it shows great potential for rapid data analysis in other areas, including volcano detection, flood boundaries, forest health, and wildfires.
NASA Technical Reports Server (NTRS)
Soderman, Paul T.; Olsen, Larry E.
1990-01-01
An engineering feasibility study was made of aeroacoustic inserts designed for large-scale acoustic research on aircraft models in the 80 by 120 foot Wind Tunnel at NASA Ames Research Center. The advantages and disadvantages of likely designs were analyzed. Results indicate that the required maximum airspeed leads to the design of a particular insert. Using goals of 200, 150, and 100 knots airspeed, the analysis indicated a 30 x 60 ft open-jet test section, a 40 x 80 ft open jet test section, and a 70 x 100 ft closed test section with enhanced wall lining, respectively. The open-jet inserts would be composed of a nozzle, collector, diffuser, and acoutic wedges incorporated in the existing 80 x 120 test section. The closed test section would be composed of approximately 5 ft acoustic wedges covered by a porous plate attached to the test section walls of the existing 80 x 120. All designs would require a double row of acoustic vanes between the test section and fan drive to attenuate fan noise and, in the case of the open-jet designs, to control flow separation at the diffuser downstream end. The inserts would allow virtually anechoic acoustic studies of large helicopter models, jets, and V/STOL aircraft models in simulated flight. Model scale studies would be necessary to optimize the aerodynamic and acoustic performance of any of the designs. In all designs studied, the existing structure would have to be reinforced. Successful development of acoustically transparent walls, though not strictly necessary to the project, would lead to a porous-wall test section that could be substituted for any of the open-jet designs, and thereby eliminate many aerodynamic and acoustic problems characteristic of open-jet shear layers. The larger size of the facility would make installation and removal of the insert components difficult. Consequently, scheduling of the existing 80 x 120 aerodynamic test section and scheduling of the open-jet test section would likely be made on an annual or longer basis. The enhanced wall-lining insert would likely be permanent. Although the modifications are technically feasible, the economic practicality of the project was not evaluated.
Soon, Reni; Tschann, Mary; Salcedo, Jennifer; Stevens, Katelyn; Ahn, Hyeong Jun; Kaneshiro, Bliss
2017-08-01
To evaluate the efficacy of a paracervical block to decrease pain during osmotic dilator insertion before second-trimester abortion. In this double-blind, randomized trial, 41 women undergoing Laminaria insertion before a second-trimester abortion received either a paracervical block with 18 mL 1% lidocaine and 2 mL sodium bicarbonate or a sham block. Women were between 14 and 23 6/7 weeks of gestation. The primary outcome was pain immediately after insertion of Laminaria. Women assessed their pain on a 100-mm visual analog scale. Secondary outcomes included assessment of pain at other times during the insertion procedure and overall satisfaction with pain control. To detect a 25-mm difference in pain immediately after Laminaria insertion, at an α of 0.05 and 80% power, we aimed to enroll 20 patients in each arm. From May 2015 to December 2015, 20 women received a paracervical block and 21 received a sham block. Groups were similar in demographics, including parity, history of surgical abortion, and number of Laminaria placed. The paracervical block reduced pain after Laminaria insertion (median scores 13 mm [interquartile range 2-39] compared with 54 mm [interquartile range 27-61], P=.01, 95% CI -47.0 to -4.0). Women who received a paracervical block also reported higher satisfaction with overall pain control throughout the entire Laminaria insertion procedure (median scores 95 mm [interquartile range 78-100] compared with 70 mm [interquartile range 44-90], P=.05, 95% CI 0.0-37.0). Paracervical block is effective at reducing the pain of Laminaria insertion. Additionally, a paracervical block increases overall patient satisfaction with pain control during Laminaria placement. ClinicalTrials.gov, NCT02454296.
Schuyler, A C; Masvawure, T B; Smit, J A; Beksinska, M; Mabude, Z; Ngoloyi, C; Mantell, J E
2016-04-01
Partner negotiation and insertion difficulties are key barriers to female condom (FC) use in sub-Saharan Africa. Few FC interventions have provided comprehensive training in both negotiation and insertion skills, or focused on university students. In this study we explored whether training in FC insertion and partner negotiation influenced young women's FC use. 296 female students at a South African university were randomized to a one-session didactic information-only minimal intervention (n= 149) or a two-session cognitive-behavioral enhanced intervention (n= 147), which received additional information specific to partner negotiation and FC insertion. Both groups received FCs. We report the 'experiences of' 39 randomly selected female students who participated in post-intervention qualitative interviews. Two-thirds of women reported FC use. Most women (n= 30/39) applied information learned during the interventions to negotiate with partners. Women reported that FC insertion practice increased their confidence. Twelve women failed to convince male partners to use the FC, often due to its physical attributes or partners' lack of knowledge about insertion. FC educational and skills training can help facilitate use, improve attitudes toward the device and help women to successfully negotiate safer sex with partners. Innovative strategies and tailored interventions are needed to increase widespread FC adoption. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Konstantinou, Evangelos A; Stafylarakis, Emmanuil; Kapritsou, Maria; Mitsos, Aristotelis P; Fotis, Theofanis G; Kiekkas, Panagiotis; Mariolis-Sapsakos, Theodoros; Argyras, Eriphyli; Nomikou, Irini Th; Dimitrakopoulos, Antonios
2012-09-01
Placement of peripherally inserted central catheters (PICCs), definitely offers a clear advantage over any other method regarding central venous catheterization. Its ultrasonographic orientation enhances significantly its accuracy, safety and efficacy, making this method extremely comfortable for the patient who can continue his or her therapy even in an outpatient basis. We present the first reported case of a PICCS insertion in Greece, which has been performed by a university-degree nurse. The aim of this review of literature was to present the evolution in nursing practice in Greece. A PICC was inserted in a 77-year-old male patient suffering from a recent chemical pneumonia with a history of Alzheimer's disease. A description of all the technical details of this insertion is reported, focusing on the pros and cons of the method and a thorough review of the history and advances in central venous catheterization throughout the years is also presented. PICCs provide long-term intravenous access and facilitate the delivery of extended antibiotic therapy, chemotherapy and total parenteral nutrition. We strongly believe that PICCs are the safest and most effective method of peripherally inserted central venous catheterization. Larger series are necessary to prove the above hypothesis, and they are under construction by our team. Copyright © 2012 Society for Vascular Nursing, Inc. Published by Mosby, Inc. All rights reserved.
Khan, Faisal Aziz; Niazi, Shafaq Pervez Khan; Khan, Assad Zaman
2017-09-01
To determine the relationship of the van Herick angle grading system with the level of iris insertion and peripheral iris configuration. Observational study. Eye department, Combined Military Hospital, Malir Cantt., Karachi, from May to October 2015. Sixty-five eyes of 65 patients were recruited. Anterior chamber depth at the temporal limbus was measured as a fraction of corneal section thickness using van Herick technique and graded on the standard 4-point scale of the van Herick grading system. Gonioscopy of the temporal quadrant was performed with a Posner 4 mirror goniolens and both the true level of iris insertion and peripheral iris configuration were recorded on a 4-point scale so as to equate with the van Herick 4-point grading system. Spearman's rho test was applied to determine the relationship of the van Herick grading system with level of iris root insertion and peripheral iris configuration. Amoderate positive correlation between van Herick grade and peripheral iris configuration was found which was statistically significant (rs=0.42, p < 0.001). Astatistically significant and moderate positive correlation was also detected between van Herick grade and the level of iris insertion (rs=0.45, p < 0.001). The van Herick grade has a moderately positive relationship with the peripheral iris configuration and true level of iris insertion.
Gattelli, Albana; Zimberlin, María N; Meiss, Roberto P; Castilla, Lucio H; Kordon, Edith C
2006-11-01
Mice harboring three mouse mammary tumor virus (MMTV) variants develop pregnancy-dependent (PD) tumors that progress to pregnancy-independent (PI) behavior through successive passages. Herein, we identified 10 predominant insertions in PI transplants from 8 independent tumor lines. These mutations were also detected in small cell populations in the early PD passages. In addition, we identified a new viral insertion upstream of the gene Rspo3, which is overexpressed in three of the eight independent tumor lines and codes for a protein very similar to the recently described protein encoded by Int7. This study suggests that during progression towards hormone independence, clonal expansion of cells with specific mutations might be more relevant than the occurrence of new MMTV insertions.
Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L
1994-01-01
A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933
Cassini/CIRS Observations of Water Vapor in Saturn's Stratosphere
NASA Technical Reports Server (NTRS)
Bjoraker, G. L.; Achterberg, R. K.; Simon-Miller, A. A.; Carlson, R. C.; Jennings, D. E.
2008-01-01
The Composite Infrared Spectrometer (CIRS) on the Cassini spacecraft has obtained numerous spectra of Saturn at varying spectral and spatial resolutions since Saturn Orbit Insertion in 2004. Emission lines due to water vapor in Saturn's stratosphere were first detected using whole-disk observations from the Infrared Space Observatory (Feuchtgruber et al 1997) and subsequently confirmed by the Submillimeter Wave Astronomy Satellite (Rergin et al 2000). CIRS has detected water and the data permit the retrieval of the latitudinal variation of water on Saturn. Emission lines of H2O on Saturn are very weak in the CIRS data. Thus. large spectral averages as well as improvements in calibration are necessary to detect water vapor. Zonally averaged nadir spectra were produced every 10 degrees of latitude. Stratospheric temperatures in the 0.5 - 5.0 mbar range were obtained by inverting spectra of CH4 in the v4 band centered at 1304 cm(exp -1). The origin of water vapor is believed to be from the ablation of micrometeorites containing water ice, followed by photochemistry. This external source of oxygen originates either from the Saturn system (from the rings or perhaps from Enceladus) or from the interplanetary medium. Connerney (1986) proposed a mechanism to transport water from the inner edge of the B-ring along magnetic field lines to specific latitudes (50N and 44S) on Saturn. Prange et al (2006) interpreted a minimum in the abundance of acetylene from ultraviolet spectra near 41S on Saturn as possibly due to an enhanced influx of water. Existing CIRS far-IR spectra are at relatively low spatial resolution, but observations at closer range planned for the extended mission will be able to test the "ring rain" mechanism by searching for localized water vapor enhancement at midlatitudes.
Mulier, Michiel; Pastrav, Cesar; Van der Perre, Georges
2008-01-01
Defining the stem insertion end point during total hip replacement still relies on the surgeon's feeling. When a custom-made stem prosthesis with an optimal fit into the femoral canal is used, the risk of per-operative fractures is even greater than with standard prostheses. Vibration analysis is used in other clinical settings and has been tested as a means to detect optimal stem insertion in the laboratory. The first per-operative use of vibration analysis during non-cemented custom-made stem insertion in 30 patients is reported here. Thirty patients eligible for total hip replacement with uncemented stem prosthesis were included. The neck of the stem was connected with a shaker that emitted white noise as excitation signal and an impedance head that measured the frequency response. The response signal was sent to a computer that analyzed the frequency response function after each insertion phase. A technician present in the operating theatre but outside the laminated airflow provided feed-back to the surgeon. The correlation index between the frequency response function measured during the last two insertion hammering sessions was >0.99 in 86.7% of the cases. In four cases the surgeon stopped the insertion procedure because of a perceived risk of fracture. Two special cases illustrating the potential benefit of per-operative vibration analysis are described. The results of intra-operative vibration analysis indicate that this technique may be a useful tool assisting the orthopaedic surgeon in defining the insertion endpoint of the stem. The development of a more user-friendly device is therefore warranted.
Sugimoto, Mitsuru; Takagi, Tadayuki; Suzuki, Rei; Konno, Naoki; Asama, Hiroyuki; Sato, Yuki; Irie, Hiroki; Watanabe, Ko; Nakamura, Jun; Kikuchi, Hitomi; Waragai, Yuichi; Takasumi, Mika; Hikichi, Takuto; Ohira, Hiromasa
2018-06-14
To investigate the location to which a pancreatic stent should be inserted to prevent post-endoscopic retrograde cholangiopancreatography (ERCP) pancreatitis (PEP). Over a ten-year period at our hospital, 296 patients underwent their first ERCP procedure and had a pancreatic stent inserted; this study included 147 patients who had ERCP performed primarily for biliary investigation and had a pancreatic stent inserted to prevent PEP. We divided these patients into two groups: 131 patients with a stent inserted into the pancreatic head (head group) and 16 patients with a stent inserted up to the pancreatic body or tail (body/tail group). Patient characteristics and ERCP factors were compared between the groups. Pancreatic amylase isoenzyme (p-AMY) levels in the head group were significantly higher than those in the body/tail group [138.5 (7.0-2086) vs 78.5 (5.0-1266.5), P = 0.03] [median (range)]. No cases of PEP were detected in the body/tail group [head group, 12 (9.2%)]. Of the risk factors for post-ERCP hyperamylasemia (≥ p-AMY median, 131 IU/L), procedure time ≥ 60 min [odds ratio (OR) 2.65, 95%CI: 1.17-6.02, P = 0.02) and stent insertion into the pancreatic head (OR 3.80, 95%CI: 1.12-12.9, P = 0.03) were identified as independent risk factors by multivariate analysis. Stent insertion up to the pancreatic body or tail reduces the risk of post-ERCP hyperamylasemia and may reduce the risk of PEP.
Anaerobically Grown Escherichia coli Has an Enhanced Mutation Rate and Distinct Mutational Spectra
Shewaramani, Sonal; Finn, Thomas J.; Kassen, Rees; Rainey, Paul B.
2017-01-01
Oxidative stress is a major cause of mutation but little is known about how growth in the absence of oxygen impacts the rate and spectrum of mutations. We employed long-term mutation accumulation experiments to directly measure the rates and spectra of spontaneous mutation events in Escherichia coli populations propagated under aerobic and anaerobic conditions. To detect mutations, whole genome sequencing was coupled with methods of analysis sufficient to identify a broad range of mutational classes, including structural variants (SVs) generated by movement of repetitive elements. The anaerobically grown populations displayed a mutation rate nearly twice that of the aerobic populations, showed distinct asymmetric mutational strand biases, and greater insertion element activity. Consistent with mutation rate and spectra observations, genes for transposition and recombination repair associated with SVs were up-regulated during anaerobic growth. Together, these results define differences in mutational spectra affecting the evolution of facultative anaerobes. PMID:28103245
Operational efficiency subpanel advanced mission control
NASA Technical Reports Server (NTRS)
Friedland, Peter
1990-01-01
Herein, the term mission control will be taken quite broadly to include both ground and space based operations as well as the information infrastructure necessary to support such operations. Three major technology areas related to advanced mission control are examined: (1) Intelligent Assistance for Ground-Based Mission Controllers and Space-Based Crews; (2) Autonomous Onboard Monitoring, Control and Fault Detection Isolation and Reconfiguration; and (3) Dynamic Corporate Memory Acquired, Maintained, and Utilized During the Entire Vehicle Life Cycle. The current state of the art space operations are surveyed both within NASA and externally for each of the three technology areas and major objectives are discussed from a user point of view for technology development. Ongoing NASA and other governmental programs are described. An analysis of major research issues and current holes in the program are provided. Several recommendations are presented for enhancing the technology development and insertion process to create advanced mission control environments.
Mueller, Cornelia Katharina; Solcher, Philipp; Peisker, Andrè; Mtsariashvilli, Maia; Schlegel, Karl Andreas; Hildebrand, Gerhard; Rost, Juergen; Liefeith, Klaus; Chen, Jiang; Schultze-Mosgau, Stefan
2013-07-01
It was the aim of this study to analyze the influence of implant design and surface topography on the osseointegration of dental zirconium implants. Six different implant designs were tested in the study. Nine or 10 test implants were inserted in the frontal skull in each of 10 miniature pigs. Biopsies were harvested after 2 and 4 months and subjected to microradiography. No significant differences between titanium and zirconium were found regarding the microradiographically detected bone-implant contact (BIC). Cylindric zirconium implants showed a higher BIC at the 2-month follow-up than conic zirconium implants. Among zirconium implants, those with an intermediate Ra value showed a significantly higher BIC compared with low and high Ra implants 4 months after surgery. Regarding osseointegration, titanium and zirconium showed equal properties. Cylindric implant design and intermediate surface roughness seemed to enhance osseointegration. Copyright © 2013 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Gong, Hao; Yu, Lifeng; Leng, Shuai; Dilger, Samantha; Zhou, Wei; Ren, Liqiang; McCollough, Cynthia H.
2018-03-01
Channelized Hotelling observer (CHO) has demonstrated strong correlation with human observer (HO) in both single-slice viewing mode and multi-slice viewing mode in low-contrast detection tasks with uniform background. However, it remains unknown if the simplest single-slice CHO in uniform background can be used to predict human observer performance in more realistic tasks that involve patient anatomical background and multi-slice viewing mode. In this study, we aim to investigate the correlation between CHO in a uniform water background and human observer performance at a multi-slice viewing mode on patient liver background for a low-contrast lesion detection task. The human observer study was performed on CT images from 7 abdominal CT exams. A noise insertion tool was employed to synthesize CT scans at two additional dose levels. A validated lesion insertion tool was used to numerically insert metastatic liver lesions of various sizes and contrasts into both phantom and patient images. We selected 12 conditions out of 72 possible experimental conditions to evaluate the correlation at various radiation doses, lesion sizes, lesion contrasts and reconstruction algorithms. CHO with both single and multi-slice viewing modes were strongly correlated with HO. The corresponding Pearson's correlation coefficient was 0.982 (with 95% confidence interval (CI) [0.936, 0.995]) and 0.989 (with 95% CI of [0.960, 0.997]) in multi-slice and single-slice viewing modes, respectively. Therefore, this study demonstrated the potential to use the simplest single-slice CHO to assess image quality for more realistic clinically relevant CT detection tasks.
NASA Astrophysics Data System (ADS)
Kiasaleh, Kamran
1994-02-01
A novel optical phase-locked loop (OPLL) system for the self-homodyne detection of digitally phase modulated optical signals is introduced. A Mach-Zehnder type interferometer is used to self-homodyne binary phase-modulated optical signals with an external phase modulator inserted in the control arm of the interferometer.
Error Detection/Correction in Collaborative Writing
ERIC Educational Resources Information Center
Pilotti, Maura; Chodorow, Martin
2009-01-01
In the present study, we examined error detection/correction during collaborative writing. Subjects were asked to identify and correct errors in two contexts: a passage written by the subject (familiar text) and a passage written by a person other than the subject (unfamiliar text). A computer program inserted errors in function words prior to the…
Use of molecular probes to detect parasites and retrotransposons in gypsy moths
John H. Werren; Thomas O' Dell
1991-01-01
Retrotransposon screen: Gypsy moth families containing straggling and nonstraggling individuals were divided into categories of straggling, medium, and nonstraggling individuals, from which DNA was extracted. Four families were tested by southern hybridization and probing with ribosomal sequences designed to detect R1 and R2 retrotransposon insertions. Results showed...
Adams, Lori; Agrawal, Anoop; Cronin, John P; Ashley, Kevin
2017-01-01
Exposures to beryllium (Be), even at extremely low levels, can cause severe health effects in a percentage of those exposed; consequently, occupational exposure limits (OELs) promulgated for this element are the lowest established for any element. This work describes the advantages of using highly alkaline dye solutions for determination of Be in occupational hygiene and environmental samples by means of an optical molecular fluorescence technique after sample extraction in 1-3% (w˖w -1 ) aqueous ammonium bifluoride (NH 4 HF 2 ). Improved attributes include the ability to further enhance the detection limits of Be in extraction solutions of high acidity with minimal dilution, which is particularly beneficial when NH 4 HF 2 solutions of higher concentration are used for extraction of Be from soil samples. Significant improvements in Be method detection limits (MDLs) are obtained at levels many-fold below those reported previously for this methodology. Notably, MDLs for Be of <0.01 ng l -1 / 0.1 ng per sample have been attained, which are superior to MDLs routinely reported for this element by means of the most widely used ultra-trace elemental measurement technique, inductively coupled plasma mass spectrometry (ICP-MS). Very low MDLs for Be are essential in consideration of reductions in OELs for this element in workplace air by health organizations and regulatory agencies in the USA and internationally. Applications of enhanced Be measurements to air filter samples, surface wipe samples, soils and newly-designed occupational air sampler inserts are illustrated.
On-chip tunable dispersion in a ring laser gyroscope for enhanced rotation sensing
NASA Astrophysics Data System (ADS)
Zhang, Hao; Liu, Jiaming; Lin, Jian; Li, Wenxiu; Xue, Xia; Huang, Anping; Xiao, Zhisong
2016-05-01
A gyroscope structure with tailored local dispersion profile to enhance sensitivity is proposed, which uses lithium niobate (LiNbO3) thin film as the on-chip material of gyroscope's resonator. A Mach-Zehnder interferometer (MZI) structure as a coupler, which induces a different reference phase shift in each arm, is inserted into the position between ring resonator and output bus waveguide. Through modulating reference phase shift in MZI, theoretical rotation sensitivity enhancement as large as one order of magnitude is presented.
Li, Wei; Jiang, Wei; Wang, Lei
2016-10-12
In this work, a novel self-locked aptamer probe mediated cascade amplification strategy has been constructed for highly sensitive and specific detection of protein. First, the self-locked aptamer probe was designed with three functions: one was specific molecular recognition attributed to the aptamer sequence, the second was signal transduction owing to the transduction sequence, and the third was self-locking through the hybridization of the transduction sequence and part of the aptamer sequence. Then, the aptamer sequence specific recognized the target and folded into a three-way helix junction, leading to the release of the transduction sequence. Next, the 3'-end of this three-way junction acted as primer to trigger the strand displacement amplification (SDA), yielding a large amount of primers. Finally, the primers initiated the dual-exponential rolling circle amplification (DE-RCA) and generated numerous G-quadruples sequences. By inserting the fluorescent dye N-methyl mesoporphyrin IX (NMM), enhanced fluorescence signal was achieved. In this strategy, the self-locked aptamer probe was more stable to reduce the interference signals generated by the uncontrollable folding in unbounded state. Through the cascade amplification of SDA and DE-RCA, the sensitivity was further improved with a detection limit of 3.8 × 10(-16) mol/L for protein detection. Furthermore, by changing the aptamer sequence of the probe, sensitive and selective detection of adenosine has been also achieved, suggesting that the proposed strategy has good versatility and can be widely used in sensitive and selective detection of biomolecules. Copyright © 2016 Elsevier B.V. All rights reserved.
Gray, Joe W.; Pinkel, Daniel; Kallioniemi, Olli-Pekka; Kallioniemi, Anne; Sakamoto, Masaru
2009-10-06
Methods and compositions for staining based upon nucleic acid sequence that employ nudeic nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyses. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML), retinoblastoma, ovarian and uterine cancers, and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar but genetically different diseases, and for many prognostic and diagnostic applications.
The detection of large deletions or duplications in genomic DNA.
Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R
2002-11-01
While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.
Optical Enhancement in Optoelectronic Devices Using Refractive Index Grading Layers.
Lee, Illhwan; Park, Jae Yong; Gim, Seungo; Kim, Kisoo; Cho, Sang-Hwan; Choi, Chung Sock; Song, Seung-Yong; Lee, Jong-Lam
2016-02-10
We enhanced the optical transmittance of a multilayer barrier film by inserting a refractive index grading layer (RIGL). The result indicates that the Fresnel reflection, induced by the difference of refractive indices between Si(x)N(y) and SiO2, is reduced by the RIGL. To eliminate the Fresnel reflection while maintaining high transmittance, the optimized design of grading structures with the RIGL was conducted using an optical simulator. With the RIGL, we achieved averaged transmittance in the visible wavelength region by 89.6%. It is found that the optimized grading structure inserting the multilayer barrier film has a higher optical transmittance (89.6%) in the visible region than that of a no grading sample (82.6%). Furthermore, luminance is enhanced by 14.5% (from 10,190 to 11,670 cd m(-2) at 30 mA cm(-2)) when the grading structure is applied to organic light-emitting diodes. Finally, the results offer new opportunities in development of multilayer barrier films, which assist industrialization of very cost-effective flexible organic electronic devices.
Enhancement of neutron radiation dose by the addition of sulphur-33 atoms.
Porras, I
2008-04-07
The use of neutrons in radiotherapy allows the possibility of producing nuclear reactions in a specific target inserted in the medium. (10)B is being used to induce reactions (n, alpha), a technique called boron neutron capture therapy. I have studied the possibility of inducing a similar reaction using the nucleus of (33)S, for which the reaction cross section presents resonances for keV neutrons, the highest peak occurring at 13.5 keV. Here shown, by means of Monte Carlo simulation of point-like sources of neutrons in this energy range, is an enhancement effect on the absorbed dose in water by the addition of (33)S atoms. In addition to this, as the range of the alpha particle is of the order of a mammalian cell size, the energy deposition via this reaction results mainly inside the cells adjacent to the interaction site. The main conclusion of the present work is that the insertion of these sulphur atoms in tumoral cells would enhance the effect of neutron irradiation in the keV range.
Quantum hacking on quantum key distribution using homodyne detection
NASA Astrophysics Data System (ADS)
Huang, Jing-Zheng; Kunz-Jacques, Sébastien; Jouguet, Paul; Weedbrook, Christian; Yin, Zhen-Qiang; Wang, Shuang; Chen, Wei; Guo, Guang-Can; Han, Zheng-Fu
2014-03-01
Imperfect devices in commercial quantum key distribution systems open security loopholes that an eavesdropper may exploit. An example of one such imperfection is the wavelength-dependent coupling ratio of the fiber beam splitter. Utilizing this loophole, the eavesdropper can vary the transmittances of the fiber beam splitter at the receiver's side by inserting lights with wavelengths different from what is normally used. Here, we propose a wavelength attack on a practical continuous-variable quantum key distribution system using homodyne detection. By inserting light pulses at different wavelengths, this attack allows the eavesdropper to bias the shot-noise estimation even if it is done in real time. Based on experimental data, we discuss the feasibility of this attack and suggest a prevention scheme by improving the previously proposed countermeasures.
Shoe inserts and orthotics for sport and physical activities.
Nigg, B M; Nurse, M A; Stefanyshyn, D J
1999-07-01
The purposes of this paper were to discuss the perceived benefits of inserts and orthotics for sport activities and to propose a new concept for inserts and orthotics. There is evidence that inserts or orthotics reduce or prevent movement-related injuries. However, there is limited knowledge about the specific functioning an orthotic or insert provides. The same orthotic or insert is often proposed for different problems. Changes in skeletal movement due to inserts or orthotics seem to be small and not systematic. Based on the results of a study using bone pins, one may question the idea that a major function of orthotics or inserts consists in aligning the skeleton. Impact cushioning with shoe inserts or orthotics is typically below 10%. Such small reductions might not be important for injury reduction. It has been suggested that changes in material properties might produce adjustments in the muscular response of the locomotor system. The foot has various sensors to detect input signals with subject specific thresholds. Subjects with similar sensitivity threshold levels seem to respond in their movement pattern in a similar way. Comfort is an important variable. From a biomechanical point of view, comfort may be related to fit, additional stabilizing muscle work, fatigue, and damping of soft tissue vibrations. Based on the presented evidence, the concept of minimizing muscle work is proposed when using orthotics or inserts. A force signal acts as an input variable on the shoe. The shoe sole acts as a first filter, the insert or orthotic as a second filter, the plantar surface of the foot as a third filter for the force input signal. The filtered information is transferred to the central nervous system that provides a subject specific dynamic response. The subject performs the movement for the task at hand. For a given movement task, the skeleton has a preferred path. If an intervention supports/counteracts the preferred movement path, muscle activity can/must be reduced/increased. Based on this concept, an optimal insert or orthotic would reduce muscle activity, feel comfortable, and should increase performance.
Influence of conformity on the wear of total knee replacement: An experimental study
Brockett, Claire L; Carbone, Silvia; Fisher, John; Jennings, Louise M
2017-01-01
Wear of total knee replacement continues to be a significant factor influencing the clinical longevity of implants. Historically, failure due to delamination and fatigue directed design towards more conforming inserts to reduce contact stress. As new generations of more oxidatively stable polyethylene have been developed, more flexibility in bearing design has been introduced. The aim of this study was to investigate the effect of insert conformity on the wear performance of a fixed bearing total knee replacement through experimental simulation. Two geometries of insert were studied under standard gait conditions. There was a significant reduction in wear with reducing implant conformity. This study has demonstrated that bearing conformity has a significant impact on the wear performance of a fixed bearing total knee replacement, providing opportunities to improve clinical performance through enhanced material and design selection. PMID:29251167
NASA Astrophysics Data System (ADS)
Suri, Amar Raj Singh; Kumar, Anil; Maithani, Rajesh
2018-01-01
The present work deals with experimental investigation of heat transfer and fluid flow characteristics of multiple square perforated twisted tape with wing inserts in a heat exchanger tube. The range of selected geometrical parameters are, perforation width ratio (a/WT) of 0.083-0.333, twist ratio (TL/WT) of 2.0-3.5, wing depth ratio (Wd/WT) of 0.042-0.167 and number of twisted tapes (TP) of 4. The Reynolds number (Ren) selected for experimentation ranges from 5000 to 27,000. The maximum heat transfer and friction factor enhancement was found to be 6.96 and 8.34 times that of plane tube, respectively. The maximum heat transfer enhancement is observed at a a/WT of 0.250, TL/WT of 2.5, and Wd/WT of 0.167.
NASA Astrophysics Data System (ADS)
Suri, Amar Raj Singh; Kumar, Anil; Maithani, Rajesh
2018-06-01
The present work deals with experimental investigation of heat transfer and fluid flow characteristics of multiple square perforated twisted tape with wing inserts in a heat exchanger tube. The range of selected geometrical parameters are, perforation width ratio (a/WT) of 0.083-0.333, twist ratio (TL/WT) of 2.0-3.5, wing depth ratio (Wd/WT) of 0.042-0.167 and number of twisted tapes (TP) of 4. The Reynolds number (Ren) selected for experimentation ranges from 5000 to 27,000. The maximum heat transfer and friction factor enhancement was found to be 6.96 and 8.34 times that of plane tube, respectively. The maximum heat transfer enhancement is observed at a a/WT of 0.250, TL/WT of 2.5, and Wd/WT of 0.167.
Time-Resolved Transposon Insertion Sequencing Reveals Genome-Wide Fitness Dynamics during Infection.
Yang, Guanhua; Billings, Gabriel; Hubbard, Troy P; Park, Joseph S; Yin Leung, Ka; Liu, Qin; Davis, Brigid M; Zhang, Yuanxing; Wang, Qiyao; Waldor, Matthew K
2017-10-03
Transposon insertion sequencing (TIS) is a powerful high-throughput genetic technique that is transforming functional genomics in prokaryotes, because it enables genome-wide mapping of the determinants of fitness. However, current approaches for analyzing TIS data assume that selective pressures are constant over time and thus do not yield information regarding changes in the genetic requirements for growth in dynamic environments (e.g., during infection). Here, we describe structured analysis of TIS data collected as a time series, termed pattern analysis of conditional essentiality (PACE). From a temporal series of TIS data, PACE derives a quantitative assessment of each mutant's fitness over the course of an experiment and identifies mutants with related fitness profiles. In so doing, PACE circumvents major limitations of existing methodologies, specifically the need for artificial effect size thresholds and enumeration of bacterial population expansion. We used PACE to analyze TIS samples of Edwardsiella piscicida (a fish pathogen) collected over a 2-week infection period from a natural host (the flatfish turbot). PACE uncovered more genes that affect E. piscicida 's fitness in vivo than were detected using a cutoff at a terminal sampling point, and it identified subpopulations of mutants with distinct fitness profiles, one of which informed the design of new live vaccine candidates. Overall, PACE enables efficient mining of time series TIS data and enhances the power and sensitivity of TIS-based analyses. IMPORTANCE Transposon insertion sequencing (TIS) enables genome-wide mapping of the genetic determinants of fitness, typically based on observations at a single sampling point. Here, we move beyond analysis of endpoint TIS data to create a framework for analysis of time series TIS data, termed pattern analysis of conditional essentiality (PACE). We applied PACE to identify genes that contribute to colonization of a natural host by the fish pathogen Edwardsiella piscicida. PACE uncovered more genes that affect E. piscicida 's fitness in vivo than were detected using a terminal sampling point, and its clustering of mutants with related fitness profiles informed design of new live vaccine candidates. PACE yields insights into patterns of fitness dynamics and circumvents major limitations of existing methodologies. Finally, the PACE method should be applicable to additional "omic" time series data, including screens based on clustered regularly interspaced short palindromic repeats with Cas9 (CRISPR/Cas9). Copyright © 2017 Yang et al.
Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.
2013-01-01
High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572
Public antibodies to malaria antigens generated by two LAIR1 insertion modalities.
Pieper, Kathrin; Tan, Joshua; Piccoli, Luca; Foglierini, Mathilde; Barbieri, Sonia; Chen, Yiwei; Silacci-Fregni, Chiara; Wolf, Tobias; Jarrossay, David; Anderle, Marica; Abdi, Abdirahman; Ndungu, Francis M; Doumbo, Ogobara K; Traore, Boubacar; Tran, Tuan M; Jongo, Said; Zenklusen, Isabelle; Crompton, Peter D; Daubenberger, Claudia; Bull, Peter C; Sallusto, Federica; Lanzavecchia, Antonio
2017-08-31
In two previously described donors, the extracellular domain of LAIR1, a collagen-binding inhibitory receptor encoded on chromosome 19 (ref. 1), was inserted between the V and DJ segments of an antibody. This insertion generated, through somatic mutations, broadly reactive antibodies against RIFINs, a type of variant antigen expressed on the surface of Plasmodium falciparum-infected erythrocytes. To investigate how frequently such antibodies are produced in response to malaria infection, we screened plasma from two large cohorts of individuals living in malaria-endemic regions. Here we report that 5-10% of malaria-exposed individuals, but none of the European blood donors tested, have high levels of LAIR1-containing antibodies that dominate the response to infected erythrocytes without conferring enhanced protection against febrile malaria. By analysing the antibody-producing B cell clones at the protein, cDNA and gDNA levels, we characterized additional LAIR1 insertions between the V and DJ segments and discovered a second insertion modality whereby the LAIR1 exon encoding the extracellular domain and flanking intronic sequences are inserted into the switch region. By exon shuffling, this mechanism leads to the production of bispecific antibodies in which the LAIR1 domain is precisely positioned at the elbow between the VH and CH1 domains. Additionally, in one donor the genomic DNA encoding the VH and CH1 domains was deleted, leading to the production of a camel-like LAIR1-containing antibody. Sequencing of the switch regions of memory B cells from European blood donors revealed frequent templated inserts originating from transcribed genes that, in rare cases, comprised exons with orientations and frames compatible with expression. These results reveal different modalities of LAIR1 insertion that lead to public and dominant antibodies against infected erythrocytes and suggest that insertion of templated DNA represents an additional mechanism of antibody diversification that can be selected in the immune response against pathogens and exploited for B cell engineering.
Quantifying electrical impacts on redundant wire insertion in 7nm unidirectional designs
NASA Astrophysics Data System (ADS)
Mohyeldin, Ahmed; Schroeder, Uwe Paul; Srinivasan, Ramya; Narisetty, Haritez; Malik, Shobhit; Madhavan, Sriram
2017-04-01
In nano-meter scale Integrated Circuits, via fails due to random defects is a well-known yield detractor, and via redundancy insertion is a common method to help enhance semiconductors yield. For the case of Self Aligned Double Patterning (SADP), which might require unidirectional design layers as in the case of some advanced technology nodes, the conventional methods of inserting redundant vias don't work any longer. This is because adding redundant vias conventionally requires adding metal shapes in the non-preferred direction, which will violate the SADP design constraints in that case. Therefore, such metal layers fabricated using unidirectional SADP require an alternative method for providing the needed redundancy. This paper proposes a post-layout Design for Manufacturability (DFM) redundancy insertion method tailored for the design requirements introduced by unidirectional metal layers. The proposed method adds redundant wires in the preferred direction - after searching for nearby vacant routing tracks - in order to provide redundant paths for electrical signals. This method opportunistically adds robustness against failures due to silicon defects without impacting area or incurring new design rule violations. Implementation details of this redundancy insertion method will be explained in this paper. One known challenge with similar DFM layout fixing methods is the possible introduction of undesired electrical impact, causing other unintentional failures in design functionality. In this paper, a study is presented to quantify the electrical impacts of such redundancy insertion scheme and to examine if that electrical impact can be tolerated. The paper will show results to evaluate DFM insertion rates and corresponding electrical impact for a given design utilization and maximum inserted wire length. Parasitic extraction and static timing analysis results will be presented. A typical digital design implemented using GLOBALFOUNDRIES 7nm technology is used for demonstration. The provided results can help evaluate such extensive DFM insertion method from an electrical standpoint. Furthermore, the results could provide guidance on how to implement the proposed method of adding electrical redundancy such that intolerable electrical impacts could be avoided.
Mobile Interspersed Repeats Are Major Structural Variants in the Human Genome
Huang, Cheng Ran Lisa; Schneider, Anna M.; Lu, Yunqi; Niranjan, Tejasvi; Shen, Peilin; Robinson, Matoya A.; Steranka, Jared P.; Valle, David; Civin, Curt I.; Wang, Tao; Wheelan, Sarah J.; Ji, Hongkai; Boeke, Jef D.; Burns, Kathleen H.
2010-01-01
Summary Characterizing structural variants in the human genome is of great importance, but a genome wide analysis to detect interspersed repeats has not been done. Thus, the degree to which mobile DNAs contribute to genetic diversity, heritable disease, and oncogenesis remains speculative. We perform transposon insertion profiling by microarray (TIP-chip) to map human L1(Ta) retrotransposons (LINE-1 s) genome-wide. This identified numerous novel human L1(Ta) insertional polymorphisms with highly variant allelic frequencies. We also explored TIP-chip's usefulness to identify candidate alleles associated with different phenotypes in clinical cohorts. Our data suggest that the occurrence of new insertions is twice as high as previously estimated, and that these repeats are under-recognized as sources of human genomic and phenotypic diversity. We have just begun to probe the universe of human L1(Ta) polymorphisms, and as TIP-chip is applied to other insertions such as Alu SINEs, it will expand the catalog of genomic variants even further. PMID:20602999
Modeling and characterization of partially inserted electrical connector faults
NASA Astrophysics Data System (ADS)
Tokgöz, ćaǧatay; Dardona, Sameh; Soldner, Nicholas C.; Wheeler, Kevin R.
2016-03-01
Faults within electrical connectors are prominent in avionics systems due to improper installation, corrosion, aging, and strained harnesses. These faults usually start off as undetectable with existing inspection techniques and increase in magnitude during the component lifetime. Detection and modeling of these faults are significantly more challenging than hard failures such as open and short circuits. Hence, enabling the capability to locate and characterize the precursors of these faults is critical for timely preventive maintenance and mitigation well before hard failures occur. In this paper, an electrical connector model based on a two-level nonlinear least squares approach is proposed. The connector is first characterized as a transmission line, broken into key components such as the pin, socket, and connector halves. Then, the fact that the resonance frequencies of the connector shift as insertion depth changes from a fully inserted to a barely touching contact is exploited. The model precisely captures these shifts by varying only two length parameters. It is demonstrated that the model accurately characterizes a partially inserted connector.
Internal carotid artery rupture caused by carotid shunt insertion
Illuminati, Giulio; Caliò, Francesco G.; Pizzardi, Giulia; Vietri, Francesco
2015-01-01
Introduction Shunting is a well-accepted method of maintaining cerebral perfusion during carotid endarterectomy (CEA). Nonetheless, shunt insertion may lead to complications including arterial dissection, embolization, and thrombosis. We present a complication of shunt insertion consisting of arterial wall rupture, not reported previously. Presentation of case A 78-year-old woman underwent CEA combined with coronary artery bypass grafting (CABG). At the time of shunt insertion an arterial rupture at the distal tip of the shunt was detected and was repaired via a small saphenous vein patch. Eversion CEA and subsequent CABG completed the procedure whose postoperative course was uneventful. Discussion Shunting during combined CEA-CABG may be advisable to assure cerebral protection from possible hypoperfusion due to potential hemodynamic instability of patients with severe coronary artery disease. Awareness and prompt management of possible shunt-related complications, including the newly reported one, may contribute to limiting their harmful effect. Conclusion Arterial wall rupture is a possible, previously not reported, shunt-related complication to be aware of when performing CEA. PMID:26255001
NASA Astrophysics Data System (ADS)
Harashima, Takuya; Morikawa, Takumi; Kino, Hisashi; Fukushima, Takafumi; Tanaka, Tetsu
2017-04-01
A Si neural probe is one of the most important tools for neurophysiology and brain science because of its various functions such as optical stimulation and drug delivery. However, the Si neural probe is not robust compared with a metal tetrode, and could be broken by mechanical stress caused by insertion to the brain. Therefore, the Si neural probe becomes more useful if it has a stress sensor that can measure mechanical forces applied to the probe so as not to be broken. In this paper, we proposed and fabricated the Si neural probe with a piezoresistive force sensor for minimally invasive and precise monitoring of insertion forces. The fabricated piezoresistive force sensor accurately measured forces and successfully detected insertion events without buckling or bending in the shank of the Si neural probe. This Si neural probe with a piezoresistive force sensor has become one of the most versatile tools for neurophysiology and brain science.
Olsen, Flemming J; Biering-Sørensen, Tor; Krieger, Derk W
2015-05-01
Continuous cardiac rhythm monitoring has undergone compelling progress over the past decades. Cardiac monitoring has emerged from 12-lead electrocardiograms being performed at the discretion of the treating physician to in-hospital telemetry, Holter monitoring, prolonged external event monitoring and most recently toward insertable device monitoring for several years. Significant advantages and disadvantages pertaining to these monitoring options will be addressed in this review. Insertable cardiac monitors have several advantages over external monitoring techniques and may signify a clinical turning point in the field of arrhythmia management. However, their role in the detection of paroxysmal atrial fibrillation after cryptogenic strokes has yet to evolve. This will be the main focus of this review. Issues surrounding patient selection, clinical relevance and determination of cost-effectiveness for prolonged cardiac monitoring require further studies. Furthermore, insertable cardiac monitoring has not only the potential to augment diagnostic capabilities but also to improve the management of paroxysmal atrial fibrillation.
Surface-enhanced Raman spectroscopic monitor of triglyceride hydrolysis in a skin pore phantom
NASA Astrophysics Data System (ADS)
Weldon, Millicent K.; Morris, Michael D.
1999-04-01
Bacterial hydrolysis of triglycerides is followed in a sebum probe phantom by microprobe surface-enhanced Raman scattering (SERS) spectroscopy. The phantom consists of a purpose-built syringe pump operating at physiological flow rates connected to a 300 micron i.d. capillary. We employ silicon substrate SERS microprobes to monitor the hydrolysis products. The silicon support allows some tip flexibility that makes these probes ideal for insertion into small structures. Propionibacterium acnes are immobilized on the inner surface of the capillary. These bacteria hydrolyze the triglycerides in a model sebum emulsion flowing through the capillary. The transformation is followed in vitro as changes in the SERS caused by hydrolysis of triglyceride to fatty acid. The breakdown products consists of a mixture of mono- and diglycerides and their parent long chain fatty acids. The fatty acids adsorb as their carboxylates and can be readily identified by their characteristic spectra. The technique can also confirm the presence of bacteria by detection of short chain carboxylic acids released as products of glucose fermentation during the growth cycle of these cells. Co-adsorption of propionate is observed. Spatial localization of the bacteria is obtained by ex-situ line imaging of the probe.
Predeployment validation of fault-tolerant systems through software-implemented fault insertion
NASA Technical Reports Server (NTRS)
Czeck, Edward W.; Siewiorek, Daniel P.; Segall, Zary Z.
1989-01-01
Fault injection-based automated testing (FIAT) environment, which can be used to experimentally characterize and evaluate distributed realtime systems under fault-free and faulted conditions is described. A survey is presented of validation methodologies. The need for fault insertion based on validation methodologies is demonstrated. The origins and models of faults, and motivation for the FIAT concept are reviewed. FIAT employs a validation methodology which builds confidence in the system through first providing a baseline of fault-free performance data and then characterizing the behavior of the system with faults present. Fault insertion is accomplished through software and allows faults or the manifestation of faults to be inserted by either seeding faults into memory or triggering error detection mechanisms. FIAT is capable of emulating a variety of fault-tolerant strategies and architectures, can monitor system activity, and can automatically orchestrate experiments involving insertion of faults. There is a common system interface which allows ease of use to decrease experiment development and run time. Fault models chosen for experiments on FIAT have generated system responses which parallel those observed in real systems under faulty conditions. These capabilities are shown by two example experiments each using a different fault-tolerance strategy.
Predicting cancellous bone failure during screw insertion.
Reynolds, Karen J; Cleek, Tammy M; Mohtar, Aaron A; Hearn, Trevor C
2013-04-05
Internal fixation of fractures often requires the tightening of bone screws to stabilise fragments. Inadequate application of torque can leave the fracture unstable, while over-tightening results in the stripping of the thread and loss of fixation. The optimal amount of screw torque is specific to each application and in practice is difficult to attain due to the wide variability in bone properties including bone density. The aim of the research presented in this paper is to investigate the relationships between motor torque and screw compression during powered screw insertion, and to evaluate whether the torque during insertion can be used to predict the ultimate failure torque of the bone. A custom test rig was designed and built for bone screw experiments. By inserting cancellous bone screws into synthetic, ovine and human bone specimens, it was established that variations related to bone density could be automatically detected through the effects of the bone on the rotational characteristics of the screw. The torque measured during screw insertion was found to be directly related to bone density and can be used, on its own, as a good predictor of ultimate failure torque of the bone. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Weiss, William M; Saucedo, Ramon P; Robinson, John D; Lo, Chung-Chieh Jason; Morris, Randal P; Panchbhavi, Vinod K
2017-10-01
Refractory cases of Achilles tendinopathy amenable to surgery may include reattachment of the tendon using suture anchors. However, there is paucity of information describing the optimal insertion angle to maximize the tendon footprint and anchor stability in the calcaneus. The purpose of this investigation is to compare the fixation strength of suture anchors inserted at 90° and 45° (the Deadman's angle) relative to the primary compressive trabeculae of the calcaneus. A total of 12 matched pairs of adult cadaveric calcanei were excised and potted to approximate their alignment in vivo. Each pair was implanted with 5.5-mm bioabsorbable suture anchors placed either perpendicular (90°) or oblique (45°) to the primary compressive trabeculae. A tensile load was applied until failure of anchor fixation. Differences in failure load and stiffness between anchor fixation angles were determined by paired t-tests. No significant differences were detected between perpendicular and oblique suture anchor insertion relative to primary compressive trabeculae in terms of load to failure or stiffness. This investigation suggests that the fixation strength of suture anchors inserted perpendicular to the primary compression trabeculae and at the Deadman's angle are possibly comparable. Biomechanical comparison study.
Zhang, J-J; Wu, S-Y; Jiang, L; Wang, J-L; Zhang, X; Guo, X-P; Wu, C-Y; Wan, J-M
2015-03-01
Bulliform cells are large, thin-walled and highly vacuolated cells, and play an important role in controlling leaf rolling in response to drought and high temperature. However, the molecular mechanisms regulating bulliform cell development have not been well documented. Here, we report isolation and characterisation of a rice leaf-rolling mutant, named shallot-like 2 (sll2). The sll2 plants exhibit adaxially rolled leaves, starting from the sixth leaf stage, accompanied by increased photosynthesis and reduced plant height and tiller number. Histological analyses showed shrinkage of bulliform cells, resulting in inward-curved leaves. The mutant is recessive and revertible at a rate of 9%. The leaf rolling is caused by a T-DNA insertion. Cloning of the insertion using TAIL-PCR revealed that the T-DNA was inserted in the promoter region of LOC_Os07 g38664. Unexpectedly, the enhanced expression of LOC_Os07 g38664 by the 35S enhancer in the T-DNA is not responsible for the leaf rolling phenotype. Further, the enhancer also exerted a long-distance effect, including up-regulation of several bulliform cell-related genes. sll2 suppressed the outward leaf rolling of oul1 in the sll2oul1 double mutant. We conclude that leaf rolling in sll2 could be a result of the combined effect of multi-genes, implying a complex network in regulation of bulliform cell development. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
Optical absorption enhancement by inserting ZnO optical spacer in plasmonic organic solar cells
NASA Astrophysics Data System (ADS)
N'Konou, Kekeli; Torchio, Philippe
2018-01-01
Optical absorption enhancement (AE) using coupled optical spacer and plasmonic effects in standard and inverted organic solar cells (OSCs) are demonstrated using the finite-difference time-domain numerical method. The influence of an added zinc oxide (ZnO) optical spacer layer inserted below the active layer in standard architecture is first theoretically investigated while the influence of varying the ZnO cathodic buffer layer thickness in inverted design is studied on AE. Then, the embedding of a square periodic array of core-shell silver-silica nanospheres (Ag@SiO2 NSs) at different positions in standard and inverted OSCs is performed while AE and short-circuit current density (Jsc) are calculated. As a result of previous combined effects, the optimized standard plasmonic OSCs present 15% and 79.45% enhancement in J over the reference with and without ZnO optical spacer layer, respectively, and a 16% increase of AE when Ag@SiO2 NSs are placed on top of the PEDOT:PSS layer. Compared to the inverted OSC reference, the plasmonic OSCs present 26% and 27% enhancement in J and AE, respectively, when the Ag@SiO2 NSs are located on top of the ZnO layer. Furthermore, the spatial position of these NSs in such OSCs is a key parameter for increasing light absorption via enhanced electromagnetic field distribution.
Krupke, Oliver A; Zysk, Ivona; Mellott, Dan O; Burke, Robert D
2016-01-01
The mechanisms that underlie directional cell migration are incompletely understood. Eph receptors usually guide migrations of cells by exclusion from regions expressing Ephrin. In sea urchin embryos, pigmented immunocytes are specified in vegetal epithelium, transition to mesenchyme, migrate, and re-enter ectoderm, distributing in dorsal ectoderm and ciliary band, but not ventral ectoderm. Immunocytes express Sp-Eph and Sp-Efn is expressed throughout dorsal and ciliary band ectoderm. Interfering with expression or function of Sp-Eph results in rounded immunocytes entering ectoderm but not adopting a dendritic form. Expressing Sp-Efn throughout embryos permits immunocyte insertion in ventral ectoderm. In mosaic embryos, immunocytes insert preferentially in ectoderm expressing Sp-Efn. We conclude that Sp-Eph signaling is necessary and sufficient for epithelial insertion. As well, we propose that immunocytes disperse when Sp-Eph enhances adhesion, causing haptotactic movement to regions of higher ligand abundance. This is a distinctive example of Eph/Ephrin signaling acting positively to pattern migrating cells. DOI: http://dx.doi.org/10.7554/eLife.16000.001 PMID:27474796
Modified band alignment effect in ZnO/Cu2O heterojunction solar cells via Cs2O buffer insertion
NASA Astrophysics Data System (ADS)
Eom, Kiryung; Lee, Dongyoon; Kim, Seunghwan; Seo, Hyungtak
2018-02-01
The effects of a complex buffer layer of cesium oxide (Cs2O) on the photocurrent response in oxide heterojunction solar cells (HSCs) were investigated. A p-n junction oxide HSC was fabricated using p-type copper (I) oxide (Cu2O) and n-type zinc oxide (ZnO); the buffer layer was inserted between the Cu2O and fluorine-doped tin oxide (FTO). Ultraviolet-visible (UV-vis) and x-ray and ultraviolet photoelectron spectroscopy analyses were performed to characterize the electronic band structures of cells, both with and without this buffer layer. In conjunction with the measured band electronic structures, the significantly improved visible-range photocurrent spectra of the buffer-inserted HSC were analyzed in-depth. As a result, the 1 sun power conversion efficiency was increased by about three times by the insertion of buffer layer. The physicochemical origin of the photocurrent enhancement was mainly ascribed to the increased photocarrier density in the buffer layer and modified valence band offset to promote the effective hole transfer at the interface to FTO on the band-alignment model.
Senthilkumar, Sirugaloor Thangavel; Bae, Hyuntae; Han, Jinhyup; Kim, Youngsik
2018-05-04
A strategy is described to increase charge storage in a dual electrolyte Na-ion battery (DESIB) by combining the redox chemistry of the electrolyte with a Na + ion de-insertion/insertion cathode. Conventional electrolytes do not contribute to charge storage in battery systems, but redox-active electrolytes augment this property via charge transfer reactions at the electrode-electrolyte interface. The capacity of the cathode combined with that provided by the electrolyte redox reaction thus increases overall charge storage. An aqueous sodium hexacyanoferrate (Na 4 Fe(CN) 6 ) solution is employed as the redox-active electrolyte (Na-FC) and sodium nickel Prussian blue (Na x -NiBP) as the Na + ion insertion/de-insertion cathode. The capacity of DESIB with Na-FC electrolyte is twice that of a battery using a conventional (Na 2 SO 4 ) electrolyte. The use of redox-active electrolytes in batteries of any kind is an efficient and scalable approach to develop advanced high-energy-density storage systems. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Qi, Beier; Liu, Bo; Liu, Sha; Liu, Haihong; Dong, Ruijuan; Zhang, Ning; Gong, Shusheng
2011-05-01
To study the effect of cochlear electrode coverage and different insertion region on speech recognition, especially tone perception of cochlear implant users whose native language is Mandarin Chinese. Setting seven test conditions by fitting software. All conditions were created by switching on/off respective channels in order to simulate different insertion position. Then Mandarin CI users received 4 Speech tests, including Vowel Identification test, Consonant Identification test, Tone Identification test-male speaker, Mandarin HINT test (SRS) in quiet and noise. To all test conditions: the average score of vowel identification was significantly different, from 56% to 91% (Rank sum test, P < 0.05). The average score of consonant identification was significantly different, from 72% to 85% (ANOVNA, P < 0.05). The average score of Tone identification was not significantly different (ANOVNA, P > 0.05). However the more channels activated, the higher scores obtained, from 68% to 81%. This study shows that there is a correlation between insertion depth and speech recognition. Because all parts of the basement membrane can help CI users to improve their speech recognition ability, it is very important to enhance verbal communication ability and social interaction ability of CI users by increasing insertion depth and actively stimulating the top region of cochlear.
Campagna, Raphael; Pessis, Eric; Guerini, Henri; Feydy, Antoine; Drapé, Jean-Luc
2013-02-01
To evaluate the occurrence of coring after needle insertion through the rubber stopper of prednisolone acetate vials. Two-hundred vials of prednisolone acetate were randomly distributed to two radiologists. Prednisolone acetate was drawn up through the rubber bung of the vials with an 18-gauge cutting bevelled needle and aspirated with a 5-ml syringe. The presence of coring was noted visually. We systematically put each core in a syringe refilled with 3 ml prednisolone acetate, and injected the medication through a 20-gauge spine needle. Computed tomography was performed to measure the size of each coring. Coring occurred in 21 out of 200 samples (10.5 %), and was visually detected in the syringe filled up with prednisolone in 11 of the 21 cases. Ten more occult cores were detected only after the syringes and needles were taken apart and rinsed. The core size ranged from 0.6 to 1.1 mm, and 1 of the 21 (4.7 %) cores was ejected through the 20-gauge needle. Coring can occur after the insertion of a needle through the rubber stopper of a vial of prednisolone acetate, and the resultant core can then be aspirated into the syringe.
NASA Technical Reports Server (NTRS)
Parrish, Russell V.; Busquets, Anthony M.; Williams, Steven P.; Nold, Dean E.
2003-01-01
A simulation study was conducted in 1994 at Langley Research Center that used 12 commercial airline pilots repeatedly flying complex Microwave Landing System (MLS)-type approaches to parallel runways under Category IIIc weather conditions. Two sensor insert concepts of 'Synthetic Vision Systems' (SVS) were used in the simulated flights, with a more conventional electro-optical display (similar to a Head-Up Display with raster capability for sensor imagery), flown under less restrictive visibility conditions, used as a control condition. The SVS concepts combined the sensor imagery with a computer-generated image (CGI) of an out-the-window scene based on an onboard airport database. Various scenarios involving runway traffic incursions (taxiing aircraft and parked fuel trucks) and navigational system position errors (both static and dynamic) were used to assess the pilots' ability to manage the approach task with the display concepts. The two SVS sensor insert concepts contrasted the simple overlay of sensor imagery on the CGI scene without additional image processing (the SV display) to the complex integration (the AV display) of the CGI scene with pilot-decision aiding using both object and edge detection techniques for detection of obstacle conflicts and runway alignment errors.
Photonics Research and Technology Insertion
2015-06-05
Alp Artar, Ahmet Ali Yanik, Hatice Altug. Fabry –Pe?rot nanocavities in multilayered plasmonic crystals for enhanced biosensing, Applied Physics...involved collaborative research with the US Army Medical Research Institute of Infectious Diseases (USAMRIID). The output of these programs has resulted
Reactivity Insertion Accident (RIA) Capability Status in the BISON Fuel Performance Code
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williamson, Richard L.; Folsom, Charles Pearson; Pastore, Giovanni
2016-05-01
One of the Challenge Problems being considered within CASL relates to modelling and simulation of Light Water Reactor LWR) fuel under Reactivity Insertion Accident (RIA) conditions. BISON is the fuel performance code used within CASL for LWR fuel under both normal operating and accident conditions, and thus must be capable of addressing the RIA challenge problem. This report outlines required BISON capabilities for RIAs and describes the current status of the code. Information on recent accident capability enhancements, application of BISON to a RIA benchmark exercise, and plans for validation to RIA behavior are included.
Viswanathan, Gopinath; Yadav, Sangya
2017-01-01
ABSTRACT In a Mycobacterium smegmatis mutant library screen, transposon mutants with insertions in fhaA, dprE2, rpsT, and parA displayed hypersusceptibility to antibiotics, including the β-lactams meropenem, ampicillin, amoxicillin, and cefotaxime. Sub-MIC levels of octoclothepin, a psychotic drug inhibiting ParA, phenocopied the parA insertion and enhanced the bactericidal activity of meropenem against Mycobacterium tuberculosis in combination with clavulanate. Our study identifies novel factors associated with antibiotic resistance, with implications in repurposing β-lactams for tuberculosis treatment. PMID:28438925
A penal problem: the increasing incidence of implantation of penile foreign bodies.
Flynn, Ryan M; Mostafa, Hesham I; Khan, Omar A; Haselhuhn, Gregory D; Jain, Samay
2014-12-01
Our objective is to describe a novel presentation of subcutaneous penile insertion of foreign bodies. This is a practice performed globally and mostly has been reported outside of the United States. We present three cases of incarcerated males that implanted sculpted dominos into the penile subcutaneous tissue. The patients presented with erosion of the foreign bodies through the skin without evidence of infection. We believe that insertion of foreign bodies into penile subcutaneous tissue by incarcerated American males for sexual enhancement is more widespread than previously reported. Erosion is a novel presentation.
Gattelli, Albana; Zimberlin, María N.; Meiss, Roberto P.; Castilla, Lucio H.; Kordon, Edith C.
2006-01-01
Mice harboring three mouse mammary tumor virus (MMTV) variants develop pregnancy-dependent (PD) tumors that progress to pregnancy-independent (PI) behavior through successive passages. Herein, we identified 10 predominant insertions in PI transplants from 8 independent tumor lines. These mutations were also detected in small cell populations in the early PD passages. In addition, we identified a new viral insertion upstream of the gene Rspo3, which is overexpressed in three of the eight independent tumor lines and codes for a protein very similar to the recently described protein encoded by Int7. This study suggests that during progression towards hormone independence, clonal expansion of cells with specific mutations might be more relevant than the occurrence of new MMTV insertions. PMID:16971449
[Methods of hygromycin B phosphotransferase activity assay in transgenic plant].
Zhuo, Qin; Yang, Xiaoguang
2004-07-01
Hygromycin B phosphotransferase (HPT) is a widely used selectable marker protein of transgenic plant. Detection of its activity is critical to studies on the development of various transgenic plants, silence of inserted gene, marker-free system development and safety assessment of transgenic food. In this paper, several methods for detecting the activity of this enzyme were reviewed.
Lysenin Toxin Membrane Insertion Is pH-Dependent but Independent of Neighboring Lysenins.
Munguira, Ignacio L B; Takahashi, Hirohide; Casuso, Ignacio; Scheuring, Simon
2017-11-07
Pore-forming toxins form a family of proteins that act as virulence factors of pathogenic bacteria, but similar proteins are found in all kingdoms of life, including the vertebrate immune system. They are secreted as soluble monomers that oligomerize on target membranes in the so-called prepore state; after activation, they insert into the membrane and adopt the pore state. Lysenin is a pore-forming toxin from the earthworm Eisenida foetida, of which both the soluble and membrane-inserted structures are solved. However, the activation and membrane-insertion mechanisms have remained elusive. Here, we used high-speed atomic force microscopy to directly visualize the membrane-insertion mechanism. Changing the environmental pH from pH 7.5 to below pH 6.0 favored membrane insertion. We detected a short α-helix in the soluble structure that comprised three glutamic acids (Glu92, Glu94, and Glu97) that we hypothesized may represent a pH-sensor (as in similar toxins, e.g., Listeriolysin). Mutant lysenin still can form pores, but mutating these glutamic acids to glutamines rendered the toxin pH-insensitive. On the other hand, toxins in the pore state did not favor insertion of neighboring prepores; indeed, pore insertion breaks the hexagonal ordered domains of prepores and separates from neighboring molecules in the membrane. pH-dependent activation of toxins may represent a common feature of pore-forming toxins. High-speed atomic force microscopy with single-molecule resolution at high temporal resolution and the possibility of exchanging buffers during the experiments presents itself as a unique tool for the study of toxin-state conversion. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
2013-01-01
Background Persistent infection of Penaeus stylirostris densovirus (PstDNV) (also called IHHNV) and its non-infectious inserts in the black tiger shrimp, Penaeus monodon (P. monodon) genome are commonly found without apparent disease. Here, we introduced the method of multiplex PCR in order to differentiate shrimp with viral inserts from ones with the infectious virus. The method allowed us to study the effect of pre-infection of IHHNV, in comparison to IHHNV inserts, on WSSV resistance in P. monodon. Results A multiplex PCR system was developed to amplify the entire IHHNV genome, ensuring the accurate diagnosis. Field samples containing IHHNV DNA templates as low as 20 pg or equivalent 150 viral copies can be detected by this method. By challenging the two groups of diagnosed shrimp with WSSV, we found that shrimp with IHHNV infection and those with viral inserts responded to WSSV differently. Considering cumulative mortality, average time to death of shrimp in IHHNV-infected group (day 14) was significantly delayed relative to that (day 10) of IHHNV-inserted group. Real-time PCR analysis of WSSV copy number indicated the lower amount of WSSV in the IHHNV-infected group than the virus-inserted group. The ratio of IHHNV: WSSV copy number in all determined IHHNV-infected samples ranged from approximately 4 to 300-fold. Conclusion The multiplex PCR assay developed herein proved optimal for convenient differentiation of shrimp specimens with real IHHNV infection and those with insert types. Diagnosed shrimp were also found to exhibit different WSSV tolerance. After exposed to WSSV, the naturally pre-infected IHHNV P. monodon were less susceptible to WSSV and, consequently, survived longer than the IHHNV-inserted shrimp. PMID:23414329
Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun
2017-09-01
Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.
[The expression of interferon-lambda1 in CHO cell].
Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu
2013-06-01
To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.
Early Identification of Aortic Valve Sclerosis Using Iron Oxide Enhanced MRI
Hamilton, Amanda M.; Rogers, Kem A.; Belisle, Andre J.L.; Ronald, John A.; Rutt, Brian K.; Weissleder, Ralph; Boughner, Derek R.
2017-01-01
Purpose To test the ability of MION-47 enhanced MRI to identify tissue macrophage infiltration in a rabbit model of aortic valve sclerosis (AVS). Materials and Methods The aortic valves of control and cholesterol-fed New Zealand White rabbits were imaged in vivo pre- and 48 h post-intravenous administration of MION-47 using a 1.5 Tesla (T) MR clinical scanner and a CINE fSPGR sequence. MION-47 aortic valve cusps were imaged ex vivo on a 3.0T whole-body MR system with a custom gradient insert coil and a three-dimensional (3D) FIESTA sequence and compared with aortic valve cusps from control and cholesterol-fed contrast-free rabbits. Histopathological analysis was performed to determine the site of iron oxide uptake. Results MION-47 enhanced the visibility of both control and cholesterol-fed rabbit valves in in vivo images. Ex vivo image analysis confirmed the presence of significant signal voids in contrast-administered aortic valves. Signal voids were not observed in contrast-free valve cusps. In MION-47 administered rabbits, histopathological analysis revealed iron staining not only in fibrosal macrophages of cholesterol-fed valves but also in myofibroblasts from control and cholesterol-fed valves. Conclusion Although iron oxide labeling of macrophage infiltration in AVS has the potential to detect the disease process early, a macrophage-specific iron compound rather than passive targeting may be required. PMID:20027578
A virtual reality based simulator for learning nasogastric tube placement.
Choi, Kup-Sze; He, Xuejian; Chiang, Vico Chung-Lim; Deng, Zhaohong
2015-02-01
Nasogastric tube (NGT) placement is a common clinical procedure where a plastic tube is inserted into the stomach through the nostril for feeding or drainage. However, the placement is a blind process in which the tube may be mistakenly inserted into other locations, leading to unexpected complications or fatal incidents. The placement techniques are conventionally acquired by practising on unrealistic rubber mannequins or on humans. In this paper, a virtual reality based training simulation system is proposed to facilitate the training of NGT placement. It focuses on the simulation of tube insertion and the rendering of the feedback forces with a haptic device. A hybrid force model is developed to compute the forces analytically or numerically under different conditions, including the situations when the patient is swallowing or when the tube is buckled at the nostril. To ensure real-time interactive simulations, an offline simulation approach is adopted to obtain the relationship between the insertion depth and insertion force using a non-linear finite element method. The offline dataset is then used to generate real-time feedback forces by interpolation. The virtual training process is logged quantitatively with metrics that can be used for assessing objective performance and tracking progress. The system has been evaluated by nursing professionals. They found that the haptic feeling produced by the simulated forces is similar to their experience during real NGT insertion. The proposed system provides a new educational tool to enhance conventional training in NGT placement. Copyright © 2014 Elsevier Ltd. All rights reserved.
Robinson, Andrew P; Tipping, Jill; Cullen, David M; Hamilton, David; Brown, Richard; Flynn, Alex; Oldfield, Christopher; Page, Emma; Price, Emlyn; Smith, Andrew; Snee, Richard
2016-12-01
Patient-specific absorbed dose calculations for molecular radiotherapy require accurate activity quantification. This is commonly derived from Single-Photon Emission Computed Tomography (SPECT) imaging using a calibration factor relating detected counts to known activity in a phantom insert. A series of phantom inserts, based on the mathematical models underlying many clinical dosimetry calculations, have been produced using 3D printing techniques. SPECT/CT data for the phantom inserts has been used to calculate new organ-specific calibration factors for (99m) Tc and (177)Lu. The measured calibration factors are compared to predicted values from calculations using a Gaussian kernel. Measured SPECT calibration factors for 3D printed organs display a clear dependence on organ shape for (99m) Tc and (177)Lu. The observed variation in calibration factor is reproduced using Gaussian kernel-based calculation over two orders of magnitude change in insert volume for (99m) Tc and (177)Lu. These new organ-specific calibration factors show a 24, 11 and 8 % reduction in absorbed dose for the liver, spleen and kidneys, respectively. Non-spherical calibration factors from 3D printed phantom inserts can significantly improve the accuracy of whole organ activity quantification for molecular radiotherapy, providing a crucial step towards individualised activity quantification and patient-specific dosimetry. 3D printed inserts are found to provide a cost effective and efficient way for clinical centres to access more realistic phantom data.
Can a virtual reality assessment of fine motor skill predict successful central line insertion?
Mohamadipanah, Hossein; Parthiban, Chembian; Nathwani, Jay; Rutherford, Drew; DiMarco, Shannon; Pugh, Carla
2016-10-01
Due to the increased use of peripherally inserted central catheter lines, central lines are not performed as frequently. The aim of this study is to evaluate whether a virtual reality (VR)-based assessment of fine motor skills can be used as a valid and objective assessment of central line skills. Surgical residents (N = 43) from 7 general surgery programs performed a subclavian central line in a simulated setting. Then, they participated in a force discrimination task in a VR environment. Hand movements from the subclavian central line simulation were tracked by electromagnetic sensors. Gross movements as monitored by the electromagnetic sensors were compared with the fine motor metrics calculated from the force discrimination tasks in the VR environment. Long periods of inactivity (idle time) during needle insertion and lack of smooth movements, as detected by the electromagnetic sensors, showed a significant correlation with poor force discrimination in the VR environment. Also, long periods of needle insertion time correlated to the poor performance in force discrimination in the VR environment. This study shows that force discrimination in a defined VR environment correlates to needle insertion time, idle time, and hand smoothness when performing subclavian central line placement. Fine motor force discrimination may serve as a valid and objective assessment of the skills required for successful needle insertion when placing central lines. Copyright © 2016 Elsevier Inc. All rights reserved.
Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar
2014-01-01
Numerical investigation has been carried out on heat transfer and friction factor characteristics of copper-water nanofluid flow in a constant heat-fluxed tube with the existence of new configuration of vortex generator using Computational Fluid Dynamics (CFD) simulation. Two types of swirl flow generator: Classical twisted tape (CTT) and Parabolic-cut twisted tape (PCT) with a different twist ratio (y = 2.93, 3.91 and 4.89) and different cut depth (w = 0.5, 1.0 and 1.5 cm) with 2% and 4% volume concentration of CuO nanofluid were used for simulation. The effect of different parameters such as flow Reynolds number, twist ratio, cut depth and nanofluid were considered. The results show that the enhancement of heat transfer rate and the friction factor induced by the Classical (CTT) and Parabolic-cut (PCT) inserts increases with twist ratio and cut depth decreases. The results also revealed that the heat transfer enhancement increases with an increase in the volume fraction of the CuO nanoparticle. Furthermore, the twisted tape with twist ratio (y = 2.93) and cut depth w = 0.5 cm offered 10% enhancement of the average Nusselt number with significant increases in friction factor than those of Classical twisted tape. PMID:24605055
Evanescent-wave photoacoustic spectroscopy with optical micro/nano fibers.
Cao, Yingchun; Jin, Wei; Ho, Lut Hoi; Liu, Zhibo
2012-01-15
We demonstrate gas detection based on evanescent-wave photoacoustic (PA) spectroscopy with tapered optical fibers. Evanescent-field instead of open-path absorption is exploited for PA generation, and a quartz tuning fork is used for PA detection. A tapered optical fiber with a diameter down to the wavelength scale demonstrates detection sensitivity similar to an open-path system but with the advantages of easier optical alignment, smaller insertion loss, and multiplexing capability.
Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.
Kietrys, Anna M; Velema, Willem A; Kool, Eric T
2017-11-29
Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.
Jin, Dayong; Piper, James A
2011-03-15
Application of standard immuno-fluorescence microscopy techniques for detection of rare-event microorganisms in dirty samples is severely limited by autofluorescence of nontarget organisms or other debris. Time-gated detection using gateable array detectors in combination with microsecond-lifetime luminescent bioprobes (usually lanthanide-based) is highly effective in suppression of (nanosecond-lifetime) autofluorescence background; however, the complexity and cost of the instrumentation is a major barrier to application of these techniques to routine diagnostics. We report a practical, low-cost implementation of time-gated luminescence detection in a standard epifluorescence microscope which has been modified to include a high-power pulsed UV light-emitting diode (LED) illumination source and a standard fast chopper inserted in the focal plane behind a microscope eyepiece. Synchronization of the pulsed illumination/gated detection cycle is driven from the clock signal from the chopper. To achieve time-gated luminescence intensities sufficient for direct visual observation, we use high cycle rates, up to 2.5 kHz, taking advantage of the fast switching capabilities of the LED source. We have demonstrated real-time direct-visual inspection of europium-labeled Giardia lamblia cysts in dirty samples and Cryptosporidium parvum oocysts in fruit juice concentrate. The signal-to-background ratio has been enhanced by a factor of 18 in time-gated mode. The availability of low-cost, robust time-gated microscopes will aid development of long-lifetime luminescence bioprobes and accelerate their application in routine laboratory diagnostics.
Microwave Ablation With a Triaxial Antenna: Results in ex vivo Bovine Liver
Brace, Christopher L.; Laeseke, Paul F.; van der Weide, Daniel W.; Lee, Fred T.
2007-01-01
We apply a new triaxial antenna for microwave ablation procedures to an ex vivo bovine liver. The antenna consists of a coaxial monopole inserted through a biopsy needle positioned one quarter-wavelength from the antenna base. The insertion needle creates a triaxial structure, which enhances return loss more than 10 dB, maximizing energy transfer to the tissue while minimizing feed cable heating and invasiveness. Numerical electromagnetic and thermal simulations are used to optimize the antenna design and predict heating patterns. Numerical and ex vivo experimental results show that the lesion size depends strongly on ablation time and average input power, but not on peak power. Pulsing algorithms are also explored. We were able to measure a 3.8-cm lesion using 50 W for 7 min, which we believe to be the largest lesion reported thus far using a 17-gauge insertion needle. PMID:18079981
Axial diffusion barriers in near-infrared nanopillar LEDs.
Scofield, Adam C; Lin, Andrew; Haddad, Michael; Huffaker, Diana L
2014-11-12
The growth of GaAs/GaAsP axial heterostructures is demonstrated and implemented as diffusion current barriers in nanopillar light-emitting diodes at near-infrared wavelengths. The nanopillar light-emitting diodes utilize an n-GaAs/i-InGaAs/p-GaAs axial heterostructure for current injection. Axial GaAsP segments are inserted into the n- and p-GaAs portions of the nanopillars surrounding the InGaAs emitter region, acting as diffusion barriers to provide enhanced carrier confinement. Detailed characterization of growth of the GaAsP inserts and electronic band-offset measurements are used to effectively implement the GaAsP inserts as diffusion barriers. The implementation of these barriers in nanopillar light-emitting diodes provides a 5-fold increase in output intensity, making this a promising approach to high-efficiency pillar-based emitters in the near-infrared wavelength range.
Compact High Current Rare-Earth Emitter Hollow Cathode for Hall Effect Thrusters
NASA Technical Reports Server (NTRS)
Goebel, Dan M. (Inventor); Watkins, Ronnie M. (Inventor); Hofer, Richard R. (Inventor)
2012-01-01
An apparatus and method for achieving an efficient central cathode in a Hall effect thruster is disclosed. A hollow insert disposed inside the end of a hollow conductive cathode comprises a rare-earth element and energized to emit electrons from an inner surface. The cathode employs an end opening having an area at least as large as the internal cross sectional area of the rare earth insert to enhance throughput from the cathode end. In addition, the cathode employs a high aspect ratio geometry based on the cathode length to width which mitigates heat transfer from the end. A gas flow through the cathode and insert may be impinged by the emitted electrons to yield a plasma. One or more optional auxiliary gas feeds may also be employed between the cathode and keeper wall and external to the keeper near the outlet.
Enhancement of acoustical performance of hollow tube sound absorber
DOE Office of Scientific and Technical Information (OSTI.GOV)
Putra, Azma, E-mail: azma.putra@utem.edu.my; Khair, Fazlin Abd, E-mail: fazlinabdkhair@student.utem.edu.my; Nor, Mohd Jailani Mohd, E-mail: jai@utem.edu.my
This paper presents acoustical performance of hollow structures utilizing the recycled lollipop sticks as acoustic absorbers. The hollow cross section of the structures is arranged facing the sound incidence. The effects of different length of the sticks and air gap on the acoustical performance are studied. The absorption coefficient was measured using impedance tube method. Here it is found that improvement on the sound absorption performance is achieved by introducing natural kapok fiber inserted into the void between the hollow structures. Results reveal that by inserting the kapok fibers, both the absorption bandwidth and the absorption coefficient increase. For testmore » sample backed by a rigid surface, best performance of sound absorption is obtained for fibers inserted at the front and back sides of the absorber. And for the case of test sample with air gap, this is achieved for fibers introduced only at the back side of the absorber.« less
Enhancement of acoustical performance of hollow tube sound absorber
NASA Astrophysics Data System (ADS)
Putra, Azma; Khair, Fazlin Abd; Nor, Mohd Jailani Mohd
2016-03-01
This paper presents acoustical performance of hollow structures utilizing the recycled lollipop sticks as acoustic absorbers. The hollow cross section of the structures is arranged facing the sound incidence. The effects of different length of the sticks and air gap on the acoustical performance are studied. The absorption coefficient was measured using impedance tube method. Here it is found that improvement on the sound absorption performance is achieved by introducing natural kapok fiber inserted into the void between the hollow structures. Results reveal that by inserting the kapok fibers, both the absorption bandwidth and the absorption coefficient increase. For test sample backed by a rigid surface, best performance of sound absorption is obtained for fibers inserted at the front and back sides of the absorber. And for the case of test sample with air gap, this is achieved for fibers introduced only at the back side of the absorber.
Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Çağlayan, Melike; Horton, Julie K.; Dai, Da-Peng; Stefanick, Donna F.; Wilson, Samuel H.
2017-01-01
Oxidative stress in cells can lead to accumulation of reactive oxygen species and oxidation of DNA precursors. Oxidized purine nucleotides can be inserted into DNA during replication and repair. The main pathway for correcting oxidized bases in DNA is base excision repair (BER), and in vertebrates DNA polymerase β (pol β) provides gap filling and tailoring functions. Here we report that the DNA ligation step of BER is compromised after pol β insertion of oxidized purine nucleotides into the BER intermediate in vitro. These results suggest the possibility that BER mediated toxic strand breaks are produced in cells under oxidative stress conditions. We observe enhanced cytotoxicity in oxidizing-agent treated pol β expressing mouse fibroblasts, suggesting formation of DNA strand breaks under these treatment conditions. Increased cytotoxicity following MTH1 knockout or treatment with MTH1 inhibitor suggests the oxidation of precursor nucleotides. PMID:28067232
USDA-ARS?s Scientific Manuscript database
Biotechnology can be used to enhance the management of weeds in several ways. Crops have been made resistant to herbicides by inserting transgenes that impart herbicide resistance into the plant genome. Glyphosate and glufosinate-resistant crops are commercialized in North America and crops made res...
Quaba, Omar; Quaba, Awf
2013-09-01
To determine the true rupture rates of PIP implants from a large single surgeon cohort and to assess whether rupture rates varied depending on time of implant insertion. In addition, the efficacy of ultra sound scanning (USS) in determining rupture is examined. Predominantly prospectively based analysis of patient records, investigations and surgical findings. 338 patients (676 implants) were included in the study and they all had removal of their implants. The senior author operated on all patients at some stage of their treatment. 160 patients were imaged pre-operatively with USS. Patients had implants inserted between 1999 and 2007 for cosmetic breast augmentation. A total of 144 ruptured implants were removed from 119 patients, giving a rupture rate of 35.2% per patient and 21.3% per implant over a mean implantation period of 7.8 years. A statistical difference (P < 0.001) in rupture rates between implants inserted prior to 2003 and those inserted from 2003 was demonstrated, with higher failure rates in the latter group. There was a significant difference in rupture rates depending on pocket placement of the implants. The sensitivity and specificity of USS at detecting rupture was 90.6% and 98.3% respectively. A proportion of patients (29.4%) demonstrated loco-regional spread of silicone to the axilla on scanning. Our paper has confirmed high rates of PIP implant failure in the largest published series to date. The significant difference in rupture rates between implants inserted prior to 2003 and those after this time supports the view that industrial silicone was used in the devices after 2003. Implants are more likely to rupture if inserted in the sub muscular plane compared to the sub glandular plane. USS is highly effective at detecting rupture in PIP implants and loco-regional spread is high compared to other devices. We believe this paper provides hard data enabling more informed decision making for patients, clinicians and providers in what remains an active issue affecting thousands of women. Copyright © 2013 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aravalli, Rajagopal N., E-mail: aravalli@umn.edu; Park, Chang W.; Steer, Clifford J., E-mail: steer001@umn.edu
The Sleeping Beauty transposon (SB-Tn) system is being used widely as a DNA vector for the delivery of therapeutic transgenes, as well as a tool for the insertional mutagenesis in animal models. In order to accurately assess the insertional potential and properties related to the integration of SB it is essential to determine the copy number of SB-Tn in the host genome. Recently developed SB100X transposase has demonstrated an integration rate that was much higher than the original SB10 and that of other versions of hyperactive SB transposases, such as HSB3 or HSB17. In this study, we have constructed amore » series of SB vectors carrying either a DsRed or a human β-globin transgene that was encompassed by cHS4 insulator elements, and containing the SB100X transposase gene outside the SB-Tn unit within the same vector in cis configuration. These SB-Tn constructs were introduced into the K-562 erythroid cell line, and their presence in the genomes of host cells was analyzed by Southern blot analysis using non-radioactive probes. Many copies of SB-Tn insertions were detected in host cells regardless of transgene sequences or the presence of cHS4 insulator elements. Interestingly, the size difference of 2.4 kb between insulated SB and non-insulated controls did not reflect the proportional difference in copy numbers of inserted SB-Tns. We then attempted methylation-sensitive Southern blots to assess the potential influence of cHS4 insulator elements on the epigenetic modification of SB-Tn. Our results indicated that SB100X was able to integrate at multiple sites with the number of SB-Tn copies larger than 6 kb in size. In addition, the non-radioactive Southern blot protocols developed here will be useful to detect integrated SB-Tn copies in any mammalian cell type.« less
Increased androgen receptor (AR) activity drives therapeutic resistance in advanced prostate cancer. The most common resistance mechanism is amplification of this locus presumably targeting the AR gene. Here, we identify and characterize a somatically acquired AR enhancer located 650 kb centromeric to the AR. Systematic perturbation of this enhancer using genome editing decreased proliferation by suppressing AR levels. Insertion of an additional copy of this region sufficed to increase proliferation under low androgen conditions and to decrease sensitivity to enzalutamide.
Contribution of transposable elements in the plant's genome.
Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Rice, David; Rafii, M Y; Azizi, Parisa; Osman, Mohamad; Taheri, Sima; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat; Noor, Yusuf Muhammad
2018-07-30
Plants maintain extensive growth flexibility under different environmental conditions, allowing them to continuously and rapidly adapt to alterations in their environment. A large portion of many plant genomes consists of transposable elements (TEs) that create new genetic variations within plant species. Different types of mutations may be created by TEs in plants. Many TEs can avoid the host's defense mechanisms and survive alterations in transposition activity, internal sequence and target site. Thus, plant genomes are expected to utilize a variety of mechanisms to tolerate TEs that are near or within genes. TEs affect the expression of not only nearby genes but also unlinked inserted genes. TEs can create new promoters, leading to novel expression patterns or alternative coding regions to generate alternate transcripts in plant species. TEs can also provide novel cis-acting regulatory elements that act as enhancers or inserts within original enhancers that are required for transcription. Thus, the regulation of plant gene expression is strongly managed by the insertion of TEs into nearby genes. TEs can also lead to chromatin modifications and thereby affect gene expression in plants. TEs are able to generate new genes and modify existing gene structures by duplicating, mobilizing and recombining gene fragments. They can also facilitate cellular functions by sharing their transposase-coding regions. Hence, TE insertions can not only act as simple mutagens but can also alter the elementary functions of the plant genome. Here, we review recent discoveries concerning the contribution of TEs to gene expression in plant genomes and discuss the different mechanisms by which TEs can affect plant gene expression and reduce host defense mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.
Chen, Kuang-Ti; Wu, Ching-Hsiang; Tsai, Mang-Hung; Wu, Ya-Chieh; Jou, Ming-Jia; Huang, Chih-Chia; Wei, I-Hua
2017-01-01
Sarcosine, an N-methyl-d-aspartate receptor enhancer, can improve depression-like behavior in rodent models and depression in humans. We found that a single dose of sarcosine exerted antidepressant-like effects with rapid concomitant increases in the mammalian target of rapamycin (mTOR) signaling pathway activation and enhancement of α-amino-3-hydroxy-5-methylisoxazole-4-propionate receptor (AMPAR) membrane insertion. Sarcosine may play a crucial role in developing novel therapy for depression. For a detailed understanding of sarcosine, this study examined the effects of long-term sarcosine treatment on the forced swim test (FST), mTOR signaling, and AMPAR membrane insertion in rats. The effects of long-term sarcosine treatment were examined in naive rats and rats exposed to chronic unpredictable stress (CUS). Long-term sarcosine treatment (560mg/kg/d for 21 d) significantly ameliorated the increased immobility induced by CUS in the FST, reaffirming the potential role of sarcosine as an antidepressant for depressed patients. The same long-term treatment exhibited no such effect in naive rats despite increased mTOR activation and AMPAR membrane insertion in both groups. Our findings clearly show CUS-exposed rats are sensitive to long-term sarcosine treatment in FST and the response at the same dose is absent in naïve rats. Nevertheless, the distinct sensitivity to long-term sarcosine treatment in rats with or without CUS is not associated with the activated mTOR signaling pathway or increased AMPAR membrane insertion. Additionally, understanding the behavioral and molecular basis of distinct responses is vital important for developing personalized treatment programs to increase the probability of success when treating depression. Copyright © 2016. Published by Elsevier B.V.
Histopathology of tympanic membranes from patients with ventilation tubes.
Oktay, Mehmet Faruk; Tansuker, Hasan Deniz; Fukushima, Hisaki; Paparella, Michael M; Schachern, Patricia A; Cureoglu, Sebahattin
2018-06-01
To evaluate the histopathologic changes in tympanic membranes (TMs) with ventilation tubes (VTs). In this retrospective human temporal bone study our overall study group included 4 subgroups of TMs from deceased donors as follows: 24 with a history of VT insertion for chronic otitis media with effusion (COME-VT); 5 with a history of VT insertion for Meniere's disease (MD-VT); 33 without a history of VT insertion for chronic otitis media with effusion (COME); and 14 without a history of VT insertion for Meniere's disease (MD). We classified the extent of migration of the outer keratinized squamous epithelium onto the inner surface of TM perforations and noted the presence and location of tympanosclerosis, of atrophy, of perforation, and/or of cholesteatoma formation. Tympanosclerosis occurred in 14/24 TMs in the COME-VT subgroup; 2/5, MD-VT; 7/33, COME; and 0/14, MD. The VT insertion site was mostly in the anteroinferior (63%) quadrant of the TM; tympanosclerosis occurred more frequently in the posteroinferior (42%) and posterosuperior (33%) quadrants. We found no significant correlation between the location of tympanosclerosis and the VT insertion site (P>0.05). Atrophy occurred in 7/24 TMs in the COME-VT subgroup; 3/5, MD-VT; 8/33, COME; and 2/14, MD. We found no significant correlation between the location of atrophy and the VT insertion site; however, atrophy was located mostly in the anteroinferior quadrant (one of the most common VT insertion sites) of the TM. Regarding the ingrowth of keratinized epithelium, the mucocutanous junction was detected at any point at the inner surface of the TM in 50% of the specimens. We observed intratympanic cholesteatoma formation in 2/24 TMs in the COME-VT subgroup. TM changes due to VT insertion are more common than previously realized. Meticulous otomicroscopic evaluation of the TM is necessary during tympanomastoidectomies in order to prevent the intratympanic inclusion pearls and squamous epithelial ingrowth to prevent any further cholesteatoma formation. Copyright © 2017. Published by Elsevier B.V.
Detection Rate and Clinical Relevance of Ink Tattooing during Balloon-Assisted Enteroscopy
Ebigbo, A.; Schrempf, M.; Messmann, H.; Gölder, S. K.
2017-01-01
Background and Aims Balloon-assisted enteroscopy (BAE) is a well-established tool in the diagnosis and therapy of small bowel diseases. Ink tattooing of the small bowel is used to mark pathologic lesions or the depth of small bowel insertion. The purpose of this study was to determine the safety, the detection rate, and the clinical relevance of ink tattooing during BAE. Methods We performed a retrospective analysis of all 81 patients who received an ink tattooing during BAE between 2010 and 2015. Results In all patients, ink tattooing was performed with no complications. 26 patients received a capsule endoscopy after BAE. The tattoo could be detected via capsule endoscopy in 19 of these 26 patients. The tattoo of the previous BAE could be detected via opposite BAE in 2 of 11 patients. In 9 patients, ink tattooing influenced the choice of approach for reenteroscopy. In 7 patients, the tattoo was used for intraoperative localization and in 3 patients for intraoperative localization as well as for reenteroscopy. The intraoperative detection rate of the tattoo was 100%. Conclusion Ink tattooing of the small intestine is a safe endoscopic procedure to mark the depth of scope insertion or a pathologic lesion during balloon-assisted enteroscopy. PMID:29230241
NASA Astrophysics Data System (ADS)
Higashi, H.; Kudo, K.; Yamamoto, K.; Yamada, S.; Kanashima, T.; Tsunoda, I.; Nakashima, H.; Hamaya, K.
2018-06-01
We study the electrical properties of pseudo-single-crystalline Ge (PSC-Ge) films grown by a Au-induced layer exchange crystallization method at 250 °C. By inserting the SiNx layer between PSC-Ge and SiO2, we initiatively suppress the influence of the Ge/SiO2 interfacial defective layers, which have been reported in our previous works, on the electrical properties of the PSC-Ge layers. As a result, we can detect the influence of the ionized Au+ donors on the temperature-dependent hole concentration and Hall mobility. To further examine their electrical properties in detail, we also fabricate p-thin-film transistors (TFTs) with the PSC-Ge layer. Although the off-state leakage currents are suppressed by inserting the SiNx layer, the value of on/off ratio remains poor (<102). Even after the post-annealing at 400 °C for the TFTs, the on/off ratio is still poor (˜102) because of the gate-induced drain leakage current although a nominal field effect mobility is enhanced up to ˜25 cm2/V s. Considering these features, we conclude that the Au contaminations into the PSC-Ge layer can affect the electrical properties and device performances despite a low-growth temperature of 250 °C. To achieve further high-performance p-TFTs, we have to suppress the Au contaminations into PSC-Ge during the Au-induced crystallization growth.
A multi-electrode biomimetic electrolocation sensor
NASA Astrophysics Data System (ADS)
Mayekar, K.; Damalla, D.; Gottwald, M.; Bousack, H.; von der Emde, G.
2012-04-01
We present the concept of an active multi-electrode catheter inspired by the electroreceptive system of the weakly electric fish, Gnathonemus petersii. The skin of this fish exhibits numerous electroreceptor organs which are capable of sensing a self induced electrical field. Our sensor is composed of a sending electrode and sixteen receiving electrodes. The electrical field produced by the sending electrode was measured by the receiving electrodes and objects were detected by the perturbation of the electrical field they induce. The intended application of such a sensor is in coronary diagnostics, in particular in distinguishing various types of plaques, which are major causes of heart attack. For calibration of the sensor system, finite element modeling (FEM) was performed. To validate the model, experimental measurements were carried out with two different systems. The physical system was glass tubing with metal and plastic wall insertions as targets. For the control of the experiment and for data acquisition, the software LabView designed for 17 electrodes was used. Different parameters of the electric images were analyzed for the prediction of the electrical properties and size of the inserted targets in the tube. Comparisons of the voltage modulations predicted from the FEM model and the experiments showed a good correspondence. It can be concluded that this novel biomimetic method can be further developed for detailed investigations of atherosclerotic lesions. Finally, we discuss various design strategies to optimize the output of the sensor using different simulated models to enhance target recognition.
A Non-invasive Real-time Localization System for Enhanced Efficacy in Nasogastric Intubation.
Sun, Zhenglong; Foong, Shaohui; Maréchal, Luc; Tan, U-Xuan; Teo, Tee Hui; Shabbir, Asim
2015-12-01
Nasogastric (NG) intubation is one of the most commonly performed clinical procedures. Real-time localization and tracking of the NG tube passage at the larynx region into the esophagus is crucial for safety, but is lacking in current practice. In this paper, we present the design, analysis and evaluation of a non-invasive real-time localization system using passive magnetic tracking techniques to improve efficacy of the clinical NG intubation process. By embedding a small permanent magnet at the insertion tip of the NG tube, a wearable system containing embedded sensors around the neck can determine the absolute position of the NG tube inside the body in real-time to assist in insertion. In order to validate the feasibility of the proposed system in detecting erroneous tube placement, typical reference intubation trajectories are first analyzed using anatomically correct models and localization accuracy of the system are evaluated using a precise robotic platform. It is found that the root-mean-squared tracking accuracy is within 5.3 mm for both the esophagus and trachea intubation pathways. Experiments were also designed and performed to demonstrate that the system is capable of tracking the NG tube accurately in biological environments even in presence of stationary ferromagnetic objects (such as clinical instruments). With minimal physical modification to the NG tube and clinical process, this system allows accurate and efficient localization and confirmation of correct NG tube placement without supplemental radiographic methods which is considered the current clinical standard.
Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali
2016-01-01
Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641
Ho, Dean; Chang, Stacy; Montemagno, Carlo D
2006-06-01
Fabrication of next-generation biologically active materials will involve the integration of proteins with synthetic membrane materials toward a wide spectrum of applications in nanoscale medicine, including high-throughput drug testing, energy conversion for powering medical devices, and bio-cloaking films for mimicry of cellular membrane surfaces toward the enhancement of implant biocompatibility. We have used ABA triblock copolymer membranes (PMOXA-PDMS-PMOXA) of varied thicknesses as platform materials for Langmuir film-based functionalization with the OmpF pore protein from Escherichia coli by fabricating monolayers of copolymer amphiphile-protein complexes on the air/water interface. Here we demonstrate that the ability for protein insertion at the air/water interface during device fabrication is dependent upon the initial surface coverage with the copolymer as well as copolymer thickness. Methacrylate-terminated block copolymer structures that were 4 nm (4METH) and 8 nm (8METH) in length were used as the protein reconstitution matrix, whereas a 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) lipid (~4 nm thickness) was used as a comparison to demonstrate the effects of copolymer length on protein integration capabilities. Wilhemy surface pressure measurements (mN/m) revealed a greater protein insertion in the 4METH and POPC structures compared with the 8METH structure, indicating that shorter copolymer chains possess enhanced biomimicry of natural lipid-based membranes. In addition, comparisons between the isothermal characteristics of the 4METH, 8METH, and POPC membranes reveal that phase transitions of the 4METH resemble a blend of the 8METH and POPC materials, indicating that the 4METH chain may possess hybrid properties of both copolymers and lipids. Furthermore, we have shown that following the deposition of the amphiphilic materials on the air/water interface, the OmpF can be deposited directly on top of the amphiphiles (surface addition), thus effectively further enhancing protein insertion because of the buoying effects of the membranes. These characteristics of Langmuir-Blodgett-based fabrication of copolymer-biomolecule hybrids represent a synthesis strategy for next-generation biomedical materials.
Nam, Jae-Kook; Lee, Mi-Hyang; Seo, Hae-Hyun; Kim, Seok-Ki; Lee, Kang-Huyn; Kim, In-Hoo; Lee, Sang-Jin
2010-05-01
Tumor or tissue specific replicative adenovirus armed with a therapeutic gene has shown a promising anti-cancer therapeutic modality. However, because the genomic packaging capacity is constrained, only a few places inside it are available for transgene insertion. In the present study, we introduce a novel strategy utilizing the early E4 region for the insertion of therapeutic gene(s). We constructed the conditionally replication-competent adenovirus (CRAd), Ad5E4(mRFP) by: (i) replacing the E4/E1a promoter by the prostate-specific enhancer element; (ii) inserting mRFP inside the E4orf1-4 deletion region; and (iii) sub-cloning enhanced green fluorescent protein controlled by cytomegalovirus promoter in the left end of the viral genome. Subsequently, we evaluated its replication abilities and killing activities in vitro, as well as its in vivo anti-tumor efficacy in CWR22rv xenografts. When infected with Ad5E4(mRFP), the number and intensity of the mRFP gene products increased in a prostate cancer cell-specific manner as designed, suggesting that the mRFP gene and E4orfs other than E4orf1-4 were well synthesized from one transcript via alternative splicing as the recombinant adenovirus replicated. As expected from the confirmed virus replication capability, Ad5E4(mRFP) induced cell lysis as potent as the wild-type adenovirus and effectively suppressed tumor growth when tested in the CWR22rv xenografts in nude mice. Furthermore, Ad5E4(endo/angio) harboring an endostatin-angiostatin gene in E4orf1-4 was able to enhance CRAd by replacing mRFP with a therapeutic gene. The approach employed in the present study for the insertion of a therapeutic transgene in CRAd should facilitate the construction of CRAd containing multiple therapeutic genes in the viral genome that may have the potential to serve as highly potent cancer therapeutic reagents. Copyright (c) 2010 John Wiley & Sons, Ltd.
Smartphones and e-tablets in perioperative medicine.
Michard, Frederic
2017-10-01
Smartphones and electronic tablets (e-tablets) have become ubiquitous devices. Their ease of use, smartness, accessibility, mobility and connectivity create unique opportunities to improve quality of surgical care from prehabilitation to rehabilitation. Before surgery, digital applications (Apps), serious games and text messaging may help for a better control of risk factors (hypertension, overweight), for smoking cessation, and for optimizing adherence to preoperative recommendations (e.g., regarding anticoagulation or antihypertensive treatments). During surgery, Apps may help to rationalize fluid management and estimate blood loss. After surgery, smartphones and/or connected sensors (pulse oximeter, adhesive path, electronic tattoo, bioimpedance necklace) can be used to monitor body temperature, heart rate, heart rate variability (detection of cardiac arrhythmia), respiratory rate, arterial oxygen saturation and thoracic fluid content. Therefore, these tools have potential for the early detection of infectious, cardiac and respiratory complications in the wards and from home. When connected to echo probes, smartphones and e-tablets can also be used as ultrasound devices during central venous catheter insertion, for peripheral nerve blocks, and to perform echocardiography in patients developing cardiac complications. Finally, electronic checklists now exist as Apps to enhance communication between patients and healthcare professionals, and to track and record step by step each element of the surgical journey. Studies are now urgently needed to investigate whether this digital revolution can translate into a better outcome, an earlier detection of postoperative complications, a decrease in hospital readmissions and in health care costs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Xiangjie; Belser, Jessica A.; Tumpey, Terrence M., E-mail: tft9@cdc.gov
In 2012, an avian influenza A H7N3 (A/Mexico/InDRE7218/2012; Mx/7218) virus was responsible for two confirmed cases of human infection and led to the death or culling of more than 22 million chickens in Jalisco, Mexico. Interestingly, this virus acquired an 8-amino acid (aa)-insertion (..PENPK-DRKSRHRR-TR/GLF) near the hemagglutinin (HA) cleavage site by nonhomologous recombination with host rRNA. It remains unclear which specific residues at the cleavage site contribute to the virulence of H7N3 viruses in mammals. Using loss-of-function approaches, we generated a series of cleavage site mutant viruses by reverse genetics and characterized the viruses in vitro and in vivo. Wemore » found that the 8-aa insertion and the arginine at position P4 of the Mx/7218 HA cleavage site are essential for intracellular HA cleavage in 293T cells, but have no effect on the pH of membrane fusion. However, we identified a role for the histidine residue at P5 position in viral fusion pH. In mice, the 8-aa insertion is required for Mx/7218 virus virulence; however, the basic residues upstream of the P4 position are dispensable for virulence. Overall, our study provides the first line of evidence that the insertion in the Mx/7218 virus HA cleavage site confers its intracellular cleavability, and consequently contributes to enhanced virulence in mice. - Highlights: • An avian influenza H7N3 virus acquired a unique 8-amino acid (aa) insertion. • The role of specific basic residues in the HA insertion in viral pathogenesis was determined. • In mice, the 8-aa insertion is required for H7N3 virus virulence. • The R residue at position P4 is essential for HA intracellular cleavage and virus virulence.« less
The clinical anatomy of the insertion of the rotator cuff tendons.
Vosloo, M; Keough, N; De Beer, M A
2017-04-01
The rotator cuff (RC) insertions according to most anatomical texts are described as being separate from one another. However, clear fusion of the RC tendon fibres exists with prior studies showing this interdigitation forming a common, continuous insertion onto and around the lesser and greater tubercles (LT and GT) of the humerus. Current surgical repair methods (especially arthroscopic techniques) rarely mention or consider these connections during repair and suture anchor implantation. The general principles of RC surgery remain a controversial subject, due to various available techniques, surgeon experience and preference, and the contradicting success rates. This results from old-fashioned knowledge of the anatomy of the RC complex and its functional aspects. Therefore, the purpose of this project was to visualise and define the RC footprint and extension insertions with the aim of enhancing and improving knowledge of the basic anatomy in the hopes that this will be considered during orthopaedic repair. Twenty shoulders (16 cadaveric and 4 fresh) were used in the study. The fresh shoulders were received from the National Tissue Bank, and ethical clearance was obtained (239/2015). Reverse dissection was performed to better visualise the RC unit exposing the interdigitated rotator hood (extension insertions), as well as the complete RC unit (tendons + internal capsule) separated from the scapula and humerus. Once the insertions were exposed and documented, the RC muscle footprint (articular surface area) was measured and recorded, using AutoCAD 2016. No statistical significant difference between left and right (p = 0.424) was noted, but a significant difference between males and females (p = 0.000) was. Collectively, these findings indicate and strengthen evidence towards the notion that the RC muscles/tendons and the internal capsule are one complete and inseparable unit/complex. The fact that the RC unit is more complex in its structure and attachment places importance on the biomechanical stresses encountered after repair. Functions of one RC muscle are not necessarily isolated but instead can be influenced by surrounding muscles as well. In addition to providing greater understanding of the basic anatomy of the RC unit, these findings also provide clarity for surgeons with the goal of improving and enhancing surgical methods for better post-operative patient outcome.
NASA Astrophysics Data System (ADS)
Dogan, Mesut; Yesilyurt, Omer; Turhan-Sayan, Gonul
2018-04-01
Ground penetrating radar (GPR) is an ultra-wideband electromagnetic sensor used not only for subsurface sensing but also for the detection of objects which may be hidden behind a wall or inserted within the wall. Such applications of the GPR technology are used in both military and civilian operations such as mine or IED (improvised explosive device) detection, rescue missions after earthquakes and investigation of archeological sites. Detection of concealed objects with low metal content is known to be a challenging problem in general. Use of A-scan, B-scan and C-scan GPR data in combination provides valuable information for target recognition in such applications. In this paper, we study the problem of target detection for potentially explosive objects embedded inside a wall. GPR data is numerically simulated by using an FDTD-based numerical computation tool when dielectric targets and targets with low metal content are inserted into different types of walls. A small size plastic bottle filled with trinitrotoluene (TNT) is used as the target with and without a metal fuse in it. The targets are buried into two different types of wall; a homogeneous brick wall and an inhomogeneous wall constructed by bricks having periodically located air holes in it. Effects of using an inhomogeneous wall structure with internal boundaries are investigated as a challenging scenario, paying special attention to preprocessing.
Electrochromic devices based on lithium insertion
Richardson, Thomas J.
2006-05-09
Electrochromic devices having as an active electrode materials comprising Sb, Bi, Si, Ge, Sn, Te, N, P, As, Ga, In, Al, C, Pb, I and chalcogenides are disclosed. The addition of other metals, i.e. Ag and Cu to the active electrode further enhances performance.
Peltan, Ithan D.; Shiga, Takashi; Gordon, James A.; Currier, Paul F.
2015-01-01
Background Simulation training may improve proficiency at and reduces complications from central venous catheter (CVC) placement, but the scope of simulation’s effect remains unclear. This randomized controlled trial evaluated the effects of a pragmatic CVC simulation program on procedural protocol adherence, technical skill, and patient outcomes. Methods Internal medicine interns were randomized to standard training for CVC insertion or standard training plus simulation-based mastery training. Standard training involved a lecture, a video-based online module, and instruction by the supervising physician during actual CVC insertions. Intervention-group subjects additionally underwent supervised training on a venous access simulator until they demonstrated procedural competence. Raters evaluated interns’ performance during internal jugular CVC placement on actual patients in the medical intensive care unit. Generalized estimating equations were used to account for outcome clustering within trainees. Results We observed 52 interns place 87 CVCs. Simulation-trained interns exhibited better adherence to prescribed procedural technique than interns who received only standard training (p=0.024). There were no significant differences detected in first-attempt or overall cannulation success rates, mean needle passes, global assessment scores or complication rates. Conclusions Simulation training added to standard training improved protocol adherence during CVC insertion by novice practitioners. This study may have been too small to detect meaningful differences in venous cannulation proficiency and other clinical outcomes, highlighting the difficulty of patient-centered simulation research in settings where poor outcomes are rare. For high-performing systems, where protocol deviations may provide an important proxy for rare procedural complications, simulation may improve CVC insertion quality and safety. PMID:26154250
Wang, Quanxiu; Zhao, Hu; Jiang, Junpeng; Xu, Jiuyue; Xie, Weibo; Fu, Xiangkui; Liu, Chang; He, Yuqing; Wang, Gongwei
2017-01-01
The photoprotective processes conferred by nonphotochemical quenching (NPQ) serve fundamental roles in maintaining plant fitness and sustainable yield. So far, few loci have been reported to be involved in natural variation of NPQ capacity in rice (Oryza sativa), and the extents of variation explored are very limited. Here we conducted a genome-wide association study (GWAS) for NPQ capacity using a diverse worldwide collection of 529 O. sativa accessions. A total of 33 significant association loci were identified. To check the validity of the GWAS signals, three F2 mapping populations with parents selected from the association panel were constructed and assayed. All QTLs detected in mapping populations could correspond to at least one GWAS signal, indicating the GWAS results were quite reliable. OsPsbS1 was repeatedly detected and explained more than 40% of the variation in the whole association population in two years, and demonstrated to be a common major QTL in all three mapping populations derived from inter-group crosses. We revealed 43 single nucleotide polymorphisms (SNPs) and 7 insertions and deletions (InDels) within a 6,997-bp DNA fragment of OsPsbS1, but found no non-synonymous SNPs or InDels in the coding region, indicating the PsbS1 protein sequence is highly conserved. Haplotypes with the 2,674-bp insertion in the promoter region exhibited significantly higher NPQ values and higher expression levels of OsPsbS1. The OsPsbS1 RNAi plants and CRISPR/Cas9 mutants exhibited drastically decreased NPQ values. OsPsbS1 had specific and high-level expression in green tissues of rice. However, we didn't find significant function for OsPsbS2, the other rice PsbS homologue. Manipulation of the significant loci or candidate genes identified may enhance photoprotection and improve photosynthesis and yield in rice. PMID:29081789
Wang, Quanxiu; Zhao, Hu; Jiang, Junpeng; Xu, Jiuyue; Xie, Weibo; Fu, Xiangkui; Liu, Chang; He, Yuqing; Wang, Gongwei
2017-01-01
The photoprotective processes conferred by nonphotochemical quenching (NPQ) serve fundamental roles in maintaining plant fitness and sustainable yield. So far, few loci have been reported to be involved in natural variation of NPQ capacity in rice ( Oryza sativa ), and the extents of variation explored are very limited. Here we conducted a genome-wide association study (GWAS) for NPQ capacity using a diverse worldwide collection of 529 O. sativa accessions. A total of 33 significant association loci were identified. To check the validity of the GWAS signals, three F2 mapping populations with parents selected from the association panel were constructed and assayed. All QTLs detected in mapping populations could correspond to at least one GWAS signal, indicating the GWAS results were quite reliable. OsPsbS1 was repeatedly detected and explained more than 40% of the variation in the whole association population in two years, and demonstrated to be a common major QTL in all three mapping populations derived from inter-group crosses. We revealed 43 single nucleotide polymorphisms (SNPs) and 7 insertions and deletions (InDels) within a 6,997-bp DNA fragment of OsPsbS1 , but found no non-synonymous SNPs or InDels in the coding region, indicating the PsbS1 protein sequence is highly conserved. Haplotypes with the 2,674-bp insertion in the promoter region exhibited significantly higher NPQ values and higher expression levels of OsPsbS1 . The OsPsbS1 RNAi plants and CRISPR/Cas9 mutants exhibited drastically decreased NPQ values. OsPsbS1 had specific and high-level expression in green tissues of rice. However, we didn't find significant function for OsPsbS2 , the other rice PsbS homologue. Manipulation of the significant loci or candidate genes identified may enhance photoprotection and improve photosynthesis and yield in rice.
Rose, K; Allan, A; Gauldie, S; Stapleton, G; Dobbie, L; Dott, K; Martin, C; Wang, L; Hedlund, E; Seckl, J R; Gustafsson, J A; Lathe, R
2001-06-29
The major adrenal steroid dehydroepiandrosterone (DHEA) enhances memory and immune function but has no known dedicated receptor; local metabolism may govern its activity. We described a cytochrome P450 expressed in brain and other tissues, CYP7B, that catalyzes the 7alpha-hydroxylation of oxysterols and 3beta-hydroxysteroids including DHEA. We report here that CYP7B mRNA and 7alpha-hydroxylation activity are widespread in rat tissues. However, steroids related to DHEA are reported to be modified at positions other than 7alpha, exemplified by prominent 6alpha-hydroxylation of 5alpha-androstane-3beta,17beta-diol (A/anediol) in some rodent tissues including brain. To determine whether CYP7B is responsible for these and other activities we disrupted the mouse Cyp7b gene by targeted insertion of an IRES-lacZ reporter cassette, placing reporter enzyme activity (beta-galactosidase) under Cyp7b promoter control. In heterozygous mouse brain, chromogenic detection of reporter activity was strikingly restricted to the dentate gyrus. Staining did not exactly reproduce the in situ hybridization expression pattern; post-transcriptional control is inferred. Lower level staining was detected in cerebellum, liver, and kidney, and which largely paralleled mRNA distribution. Liver and kidney expression was sexually dimorphic. Mice homozygous for the insertion are viable and superficially normal, but ex vivo metabolism of DHEA to 7alpha-hydroxy-DHEA was abolished in brain, spleen, thymus, heart, lung, prostate, uterus, and mammary gland; lower abundance metabolites were also eliminated. 7alpha-Hydroxylation of 25-hydroxycholesterol and related substrates was also abolished, as was presumed 6alpha-hydroxylation of A/anediol. These different enzyme activities therefore derive from the Cyp7b gene. CYP7B is thus a major extrahepatic steroid and oxysterol hydroxylase and provides the predominant route for local metabolism of DHEA and related molecules in brain and other tissues.
Mokarizadeh, Aram; Delirezh, Nowruz; Morshedi, Ahhmad; Mosayebi, Ghasem; Farshid, Amir-Abbas; Dalir-Naghadeh, Bahram
2012-01-01
Auto-reactive cells-mediated immune responses are responsible for the current tissue damages during autoimmunity. Accordingly, functional modulation of auto-reactive cells has been a pivotal aim in many of recent studies. In the current study, we investigated the possibility for insertion of regulatory molecules onto auto-reactive cells through exosomal nano-shuttles as a novel approach for phenotype modification of auto-reactive cells. The exosomes were isolated from supernatant of mesenchymal stem cells culture. Resultant exosomes co-cultured with lymphocytes were harvested from established EAE mice in the presence of antigenic MOG35-55 peptide. After 24 hr, insertion of exosomal tolerogenic molecules (PD-L1, TGF-β, galectin-1) onto auto-reactive cells were explored through flow cytometry. The potency of exosomal inserted membrane molecules to modulate phenotype of auto-reactive lymphocytes was assessed upon ELISA test for their-derived cytokines IFN-γ and IL-17. Incorporation of exosomal molecules into lymohocytes' membrane was confirmed by flow cytometric analyses for surface levels of mentioned molecules. Additionally, the decreased secretion of IFN-γ and IL-17 were detected in exosome pre-treated lymphocytes upon stimulation with MOG peptide. Mesenchymal stem cells -derived exosomes showed to be efficient organelles for insertion of bioactive tolerogenic molecules onto auto-reactive cells and modulation of their phenotypes.
In vivo field-cycling relaxometry using an insert coil for magnetic field offset.
Pine, Kerrin J; Goldie, Fred; Lurie, David J
2014-11-01
The T(1) of tissue has a strong dependence on the measurement magnetic field strength. T(1) -dispersion could be a useful contrast parameter, but is unavailable to clinical MR systems which operate at fixed magnetic field strength. The purpose of this work was to implement a removable insert magnet coil for field-cycling T(1) -dispersion measurements on a vertical-field MRI scanner, by offsetting the static field over a volume of interest. An insert magnet coil was constructed for use with a whole-body sized 59 milli-Tesla (mT) vertical-field, permanent-magnet based imager. The coil has diameter 38 cm and thickness 6.1 cm and a homogeneous region (± 5%) of 5 cm DSV, offset by 5 cm from the coil surface. Surface radiofrequency (RF) coils were also constructed. The insert coil was used in conjunction with a surface RF coil and a volume-localized inversion-recovery pulse sequence to plot T(1) -dispersion in a human volunteer's forearm over a range of field strengths from 1 mT to 70 mT. T(1) -dispersion measurements were demonstrated on a fixed-field MRI scanner, using an insert coil. This demonstrates the feasibility of relaxation dispersion measurements on an otherwise conventional MR imager, facilitating the exploitation of T(1) -dispersion contrast for enhanced diagnosis. Copyright © 2013 Wiley Periodicals, Inc.
Adams, Lori; Agrawal, Anoop; Cronin, John P.; Ashley, Kevin
2017-01-01
Exposures to beryllium (Be), even at extremely low levels, can cause severe health effects in a percentage of those exposed; consequently, occupational exposure limits (OELs) promulgated for this element are the lowest established for any element. This work describes the advantages of using highly alkaline dye solutions for determination of Be in occupational hygiene and environmental samples by means of an optical molecular fluorescence technique after sample extraction in 1–3% (w˖w−1) aqueous ammonium bifluoride (NH4HF2). Improved attributes include the ability to further enhance the detection limits of Be in extraction solutions of high acidity with minimal dilution, which is particularly beneficial when NH4HF2 solutions of higher concentration are used for extraction of Be from soil samples. Significant improvements in Be method detection limits (MDLs) are obtained at levels many-fold below those reported previously for this methodology. Notably, MDLs for Be of <0.01 ng l−1 / 0.1 ng per sample have been attained, which are superior to MDLs routinely reported for this element by means of the most widely used ultra-trace elemental measurement technique, inductively coupled plasma mass spectrometry (ICP-MS). Very low MDLs for Be are essential in consideration of reductions in OELs for this element in workplace air by health organizations and regulatory agencies in the USA and internationally. Applications of enhanced Be measurements to air filter samples, surface wipe samples, soils and newly-designed occupational air sampler inserts are illustrated. PMID:28626294
Expression of sall4 in taste buds of zebrafish.
Jackson, Robyn; Braubach, Oliver R; Bilkey, Jessica; Zhang, Jing; Akimenko, Marie-Andrée; Fine, Alan; Croll, Roger P; Jonz, Michael G
2013-07-01
We characterized the expression of sall4, a gene encoding a zinc finger transcription factor involved in the maintenance of embryonic stem cells, in taste buds of zebrafish (Danio rerio). Using an enhancer trap line (ET5), we detected enhanced green fluorescent protein (EGFP) in developing and adult transgenic zebrafish in regions containing taste buds: the lips, branchial arches, and the nasal and maxillary barbels. Localization of EGFP to taste cells of the branchial arches and lips was confirmed by co-immunolabeling with antibodies against calretinin and serotonin, and a zebrafish-derived neuronal marker (zn-12). Transgenic insertion of the ET construct into the zebrafish genome was evaluated and mapped to chromosome 23 in proximity (i.e. 23 kb) to the sall4 gene. In situ hybridization and expression analysis between 24 and 96 h post-fertilization (hpf) demonstrated that transgenic egfp expression in ET5 zebrafish was correlated with the spatial and temporal pattern of expression of sall4 in the wild-type. Expression was first observed in the central nervous system and branchial arches at 24 hpf. At 48 hpf, sall4 and egfp expression was observed in taste bud primordia surrounding the mouth and branchial arches. At 72 and 96 hpf, expression was detected in the upper and lower lips and branchial arches. Double fluorescence in situ hybridization at 3 and 10 dpf confirmed colocalization of sall4 and egfp in the lips and branchial arches. These studies reveal sall4 expression in chemosensory cells and implicate this transcription factor in the development and renewal of taste epithelia in zebrafish. Copyright © 2013 Wiley Periodicals, Inc.
Insert Design and Manufacturing for Foam-Core Composite Sandwich Structures
NASA Astrophysics Data System (ADS)
Lares, Alan
Sandwich structures have been used in the aerospace industry for many years. The high strength to weight ratios that are possible with sandwich constructions makes them desirable for airframe applications. While sandwich structures are effective at handling distributed loads such as aerodynamic forces, they are prone to damage from concentrated loads at joints or due to impact. This is due to the relatively thin face-sheets and soft core materials typically found in sandwich structures. Carleton University's Uninhabited Aerial Vehicle (UAV) Project Team has designed and manufactured a UAV (GeoSury II Prototype) which features an all composite sandwich structure fuselage structure. The purpose of the aircraft is to conduct geomagnetic surveys. The GeoSury II Prototype serves as the test bed for many areas of research in advancing UAV technologies. Those areas of research include: low cost composite materials manufacturing, geomagnetic data acquisition, obstacle detection, autonomous operations and magnetic signature control. In this thesis work a methodology for designing and manufacturing inserts for foam-core sandwich structures was developed. The results of this research work enables a designer wishing to design a foam-core sandwich airframe structure, a means of quickly manufacturing optimized inserts for the safe introduction of discrete loads into the airframe. The previous GeoSury II Prototype insert designs (v.1 & v.2) were performance tested to establish a benchmark with which to compare future insert designs. Several designs and materials were considered for the new v.3 inserts. A plug and sleeve design was selected, due to its ability to effectively transfer the required loads to the sandwich structure. The insert material was chosen to be epoxy, reinforced with chopped carbon fibre. This material was chosen for its combination of strength, low mass and also compatibility with the face-sheet material. The v.3 insert assembly is 60% lighter than the previous insert designs. A casting process for manufacturing the v.3 inserts was developed. The developed casting process, when producing more than 13 inserts, becomes more economical than machining. An exploratory study was conducted looking at the effects of dynamic loading on the v.3 insert performance. The results of this study highlighted areas for improving dynamic testing of foam-core sandwich structure inserts. Correlations were developed relating design variables such as face-sheet thickness and insert diameter to a failure load for different load cases. This was done through simulations using Computer Aided Engineering (CAE) software, and experimental testing. The resulting correlations were integrated into a computer program which outputs the required insert dimensions given a set of design parameters, and load values.
Can contrast-enhanced ultrasonography improve Zone III REBOA placement for prehospital care?
Chaudery, Muzzafer; Clark, James; Morrison, Jonathan J; Wilson, Mark H; Bew, Duncan; Darzi, Ara
2016-01-01
Torso hemorrhage is the primary cause of potentially preventable mortality in trauma. Resuscitative endovascular balloon occlusion of the aorta (REBOA) has been advocated as an adjunct to bridge patients to definitive hemorrhage control. The primary aim of this study was to assess whether contrast-enhanced ultrasonography can improve the accuracy of REBOA placement in the infrarenal aorta (Zone III). A fluoroscopy-free "enhanced" Zone III REBOA technique was developed using a porcine cadaver model. A "standard" over-the-wire Seldinger technique was used, which was enhanced with the addition of a microbubble contrast medium to inflate the balloon, observed with ultrasonography. Following this, attending- and resident-level physicians were randomized into two groups. They were taught either the enhanced with ultrasonography guidance (Group A) or the standard measuring length of catheter insertion (Group B) technique as part of a human cadaver trauma skills course. Outcomes assessed included time (seconds) from insertion to inflation, accuracy, and missed targets. All results were benchmarked against three endovascular experts. There were 20 participants who performed REBOA with Group A (51 [31]) being significantly faster than Group B (90 [63]) (p = 0.003) and more accurate (p = 0.023) with no missed targets. Group B had five missed targets, the most common error being inflation within Zone II. For Zone III REBOA, contrast-enhanced ultrasonography technique is faster and more accurate than the standard technique. This may have value in time-critical and austere environments. Clinical studies are now required to evaluate this approach further.
2008-01-01
The kinetics and thermodynamics of binding of transportan 10 (tp10) and four of its variants to phospholipid vesicles, and the kinetics of peptide-induced dye efflux, were compared. Tp10 is a 21-residue, amphipathic, cationic, cell-penetrating peptide similar to helical antimicrobial peptides. The tp10 variants examined include amidated and free peptides, and replacements of tyrosine by tryptophan. Carboxy-terminal amidation or substitution of tryptophan for tyrosine enhance binding and activity. The Gibbs energies of peptide binding to membranes determined experimentally and calculated from the interfacial hydrophobicity scale are in good agreement. The Gibbs energy for insertion into the bilayer core was calculated using hydrophobicity scales of residue transfer from water to octanol and to the membrane/water interface. Peptide-induced efflux becomes faster as the Gibbs energies for binding and insertion of the tp10 variants decrease. If anionic lipids are included, binding and efflux rate increase, as expected because all tp10 variants are cationic and an electrostatic component is added. Whether the most important effect of peptide amidation is the change in charge or an enhancement of helical structure, however, still needs to be established. Nevertheless, it is clear that the changes in efflux rate reflect the differences in the thermodynamics of binding and insertion of the free and amidated peptide groups. PMID:18260641
Silicheva, Margarita; Golovnin, Anton; Pomerantseva, Ekaterina; Parshikov, Aleksander; Georgiev, Pavel; Maksimenko, Oksana
2010-01-01
The white gene, which is responsible for eye pigmentation, is widely used to study position effects in Drosophila. As a result of insertion of P-element vectors containing mini-white without enhancers into random chromosomal sites, flies with different eye color phenotypes appear, which is usually explained by the influence of positive/negative regulatory elements located around the insertion site. We found that, in more than 70% of cases when mini-white expression was subject to positive position effects, deletion of the white promoter had no effect on eye pigmentation; in these cases, the transposon was inserted into the transcribed regions of genes. Therefore, transcription through the mini-white gene could be responsible for high levels of its expression in most of chromosomal sites. Consistently with this conclusion, transcriptional terminators proved to be efficient in protecting mini-white expression from positive position effects. On the other hand, the best characterized Drosophila gypsy insulator was poorly effective in terminating transcription and, as a consequence, only partially protected mini-white expression from these effects. Thus, to ensure maximum protection of a transgene from position effects, a perfect boundary/insulator element should combine three activities: to block enhancers, to provide a barrier between active and repressed chromatin, and to terminate transcription. PMID:19854952
[Isolation and function of genes regulating aphB expression in Vibrio cholerae].
Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao
2012-02-04
We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.
Internal carotid artery rupture caused by carotid shunt insertion.
Illuminati, Giulio; Caliò, Francesco G; Pizzardi, Giulia; Vietri, Francesco
2015-01-01
Shunting is a well-accepted method of maintaining cerebral perfusion during carotid endarterectomy (CEA). Nonetheless, shunt insertion may lead to complications including arterial dissection, embolization, and thrombosis. We present a complication of shunt insertion consisting of arterial wall rupture, not reported previously. A 78-year-old woman underwent CEA combined with coronary artery bypass grafting (CABG). At the time of shunt insertion an arterial rupture at the distal tip of the shunt was detected and was repaired via a small saphenous vein patch. Eversion CEA and subsequent CABG completed the procedure whose postoperative course was uneventful. Shunting during combined CEA-CABG may be advisable to assure cerebral protection from possible hypoperfusion due to potential hemodynamic instability of patients with severe coronary artery disease. Awareness and prompt management of possible shunt-related complications, including the newly reported one, may contribute to limiting their harmful effect. Arterial wall rupture is a possible, previously not reported, shunt-related complication to be aware of when performing CEA. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier
2016-05-01
Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.
Hunter, Arianne C; Schlitzer, Steven C; Sharma, Indrajeet
2016-11-02
A novel and highly efficient diazo-OH insertion/Conia-ene cascade reaction of readily available homopropargylic acids and alcohols with diazo carbonyl compounds is described. The cascade reaction involves a synergistic Rh/Ag/Au catalyst cocktail and proceeds instantly with a variety of substituted diazo compounds and acids/alcohols to provide functionalized γ-butyrolactones and tetrahydrofurans with complete regio- and stereoselectivity. The unprecedented rate-enhancement, complete stereoselectivity, and the enabling of new Conia-ene cyclizations suggest a concerted [4+1]-cycloaddition reaction pathway under synergistic (Rh/Ag/Au)-catalysis conditions. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Urethral Foreign Bodies: Clinical Presentation and Management.
Palmer, Cristina J; Houlihan, Matthew; Psutka, Sarah P; Ellis, K Alexandria; Vidal, Patricia; Hollowell, Courtney M P
2016-11-01
To review a single institution's 15-year experience with urethral foreign bodies, including evaluation, clinical findings, and treatment. In total, 27 patients comprising 35 episodes of inserted urethral foreign bodies were reviewed at Cook County Hospital between 2000 and 2015. Retrospective chart review was performed to describe the clinical presentation, rationale for insertion, management, recidivism, and sequelae. Median patient age was 26 (range 12-60). Twenty-six patients (97 %) were male, 1 was female (3%). Items inserted included pieces of plastic forks, spoons, metal screws and aluminum, pieces of cardboard or paper, staples, writing utensils such as pens and pencils, as well as coaxial cable and spray foam sealant. Reported reasons for insertion were self-stimulation, erectile enhancement, and attention seeking. Presenting symptoms included dysuria, gross hematuria, urinary retention, urinary tract infection, and penile discharge. The most common technique for removal was manual extraction with extrinsic pressure (n = 19, 54%). Other methods include endoscopic retrieval (n = 8, 23%), open cystotomy (n = 1, 3%), and voiding to expel the foreign body (n = 7, 20%). Postremoval complications included urinary tract infection (n = 7), sepsis (n = 4), urethral false passage (n = 5), laceration (n = 5), and stricture (n = 1). We present the largest single-institutional series of urethral foreign bodies to date. Urethral foreign body insertion is a relatively rare occurrence and, commonly, is a recurrent behavior. Urethral trauma related to foreign body insertion is associated with significant risk of infection and urethral injury with long-term sequelae. Copyright © 2016 Elsevier Inc. All rights reserved.
Vicente-Pérez, Eva M; Quinn, Helen L; McAlister, Emma; O'Neill, Shannon; Hanna, Lezley-Anne; Barry, Johanne G; Donnelly, Ryan F
2016-12-01
To evaluate the combination of a pressure-indicating sensor film with hydrogel-forming microneedle arrays, as a method of feedback to confirm MN insertion in vivo. Pilot in vitro insertion studies were conducted using a Texture Analyser to insert MN arrays, coupled with a pressure-indicating sensor film, at varying forces into excised neonatal porcine skin. In vivo studies involved twenty human volunteers, who self-applied two hydrogel-forming MN arrays, one with a pressure-indicating sensor film incorporated and one without. Optical coherence tomography was employed to measure the resulting penetration depth and colorimetric analysis to investigate the associated colour change of the pressure-indicating sensor film. Microneedle insertion was achieved in vitro at three different forces, demonstrating the colour change of the pressure-indicating sensor film upon application of increasing pressure. When self-applied in vivo, there was no significant difference in the microneedle penetration depth resulting from each type of array, with a mean depth of 237 μm recorded. When the pressure-indicating sensor film was present, a colour change occurred upon each application, providing evidence of insertion. For the first time, this study shows how the incorporation of a simple, low-cost pressure-indicating sensor film can indicate microneedle insertion in vitro and in vivo, providing visual feedback to assure the user of correct application. Such a strategy may enhance usability of a microneedle device and, hence, assist in the future translation of the technology to widespread clinical use.
Tietz, Andreas; Frei, Reno; Dangel, Marc; Bolliger, Dora; Passweg, Jakob R; Gratwohl, Alois; Widmer, Andreas E
2005-08-01
To determine the efficacy and tolerability of octenidine hydrochloride, a non-alcoholic skin antiseptic, for the care of central venous catheter (CVC) insertion sites. Prospective, observational study. Bone marrow transplantation unit of a university hospital. All consecutive patients with a nontunneled CVC were enrolled prospectively after informed consent. Octenidine hydrochloride (0.1%) was applied for disinfection at the CVC insertion site during dressing changes. The following cultures were performed weekly as well as at the occurrence of any systemic inflammatory response syndrome criteria: cultures of the skin surrounding the CVC entry site, cultures of the three-way hub connected to the CVC, blood cultures, and cultures of the CVC tip on removal. Enhanced microbiological methods (skin swabs of a 24-cm2 standardized area, roll plate, and sonication of catheter tips) were applied. One hundred thirty-five CVCs were inserted in 62 patients during the study period and remained for a mean period of 19.1 days, corresponding to 2,462 catheter-days. Bacterial density at the insertion site declined substantially over time, and most cultures became negative 2 weeks after insertion. Only 6 patients had a documented catheter-related bloodstream infection. The incidence density was 2.39 catheter infections per 1,000 catheter-days. No side effects were noted with application of the antiseptic. Disinfection with a skin antiseptic that contains octenidine hydrochloride is highly active and well tolerated. It leads to a decrease in skin colonization over time and may be a new option for CVC care.
Chia, Ian; Grote, David; Marcotte, Michael; Batourina, Ekaterina; Mendelsohn, Cathy; Bouchard, Maxime
2011-05-01
Urinary tract development depends on a complex series of events in which the ureter moves from its initial branch point on the nephric duct (ND) to its final insertion site in the cloaca (the primitive bladder and urethra). Defects in this maturation process can result in malpositioned ureters and hydronephrosis, a common cause of renal disease in children. Here, we report that insertion of the ND into the cloaca is an unrecognized but crucial step that is required for proper positioning of the ureter and that depends on Ret signaling. Analysis of Ret mutant mice at birth reveals hydronephrosis and defective ureter maturation, abnormalities that our results suggest are caused, at least in part, by delayed insertion of the ND. We find a similar set of malformations in mutants lacking either Gata3 or Raldh2. We show that these factors act in parallel to regulate ND insertion via Ret. Morphological analysis of ND extension in wild-type embryos reveals elaborate cellular protrusions at ND tips that are not detected in Ret, Gata3 or Raldh2 mutant embryos, suggesting that these protrusions may normally be important for fusion with the cloaca. Together, our studies reveal a novel Ret-dependent event, ND insertion, that, when abnormal, can cause obstruction and hydronephrosis at birth; whether ND defects underlie similar types of urinary tract abnormalities in humans is an interesting possibility.
A Primary Study of Indirect ECG Monitor Embedded in a Bed for Home Health Care
NASA Astrophysics Data System (ADS)
Ueno, Akinori; Shiogai, Yuuki; Ishiyama, Yoji
A system for monitoring electrocardiogram (ECG) through clothes inserted between the measuring electrodes and the body surface of a subject when lying on a mattress has been proposed. The principle of the system is based on capacitive coupling involving the electrode, the clothes, and the skin. Validation of the system revealed the following: (1) In spite of the gain attenuation in the pass band of the system, distortion of the detected signal was subtle even when clothes thicker than 1mm were inserted, (2) The system was able to yield a stable ECG from a subject particularly during sound sleep, (3) The system succeeded in detecting ECG after changing the posture into any of supine, right lateral, or left lateral positions by adopting a newly devised electrode configuration. Therefore, the proposed system appears promising for application to bedding as a non-invasive and awareness-free system for ECG monitoring during sleep.
Silin, D; Lyubomska, O; Ludlow, M; Duprex, W P; Rima, B K
2007-12-01
We demonstrate that insertion of the open reading frame of enhanced green fluorescent protein (EGFP) into the coding sequence for the second hinge region of the viral L (large) protein (RNA-dependent RNA polymerase) attenuates a wild-type canine distemper virus. Moreover, we show that single intranasal immunization with this recombinant virus provides significant protection against challenge with the virulent parental virus. Protection against wild-type challenge was gained either after recovery of cellular immunity postimmunization or after development of neutralizing antibodies. Insertion of EGFP seems to result in overattenuation of the virus, while our previous experiments demonstrated that the insertion of an epitope tag into a similar position did not affect L protein function. Thus, a desirable level of attenuation could be reached by manipulating the length of the insert (in the second hinge region of the L protein), providing additional tools for optimization of controlled attenuation. This strategy for controlled attenuation may be useful for a "quick response" in vaccine development against well-known and "new" viral infections and could be combined efficiently with other strategies of vaccine development and delivery systems.
Fluorinated Aromatic Amino Acids Distinguish Cation-π Interactions from Membrane Insertion*
He, Tao; Gershenson, Anne; Eyles, Stephen J.; Lee, Yan-Jiun; Liu, Wenshe R.; Wang, Jiangyun; Gao, Jianmin; Roberts, Mary F.
2015-01-01
Cation-π interactions, where protein aromatic residues supply π systems while a positive-charged portion of phospholipid head groups are the cations, have been suggested as important binding modes for peripheral membrane proteins. However, aromatic amino acids can also insert into membranes and hydrophobically interact with lipid tails. Heretofore there has been no facile way to differentiate these two types of interactions. We show that specific incorporation of fluorinated amino acids into proteins can experimentally distinguish cation-π interactions from membrane insertion of the aromatic side chains. Fluorinated aromatic amino acids destabilize the cation-π interactions by altering electrostatics of the aromatic ring, whereas their increased hydrophobicity enhances membrane insertion. Incorporation of pentafluorophenylalanine or difluorotyrosine into a Staphylococcus aureus phosphatidylinositol-specific phospholipase C variant engineered to contain a specific PC-binding site demonstrates the effectiveness of this methodology. Applying this methodology to the plethora of tyrosine residues in Bacillus thuringiensis phosphatidylinositol-specific phospholipase C definitively identifies those involved in cation-π interactions with phosphatidylcholine. This powerful method can easily be used to determine the roles of aromatic residues in other peripheral membrane proteins and in integral membrane proteins. PMID:26092728
NASA Astrophysics Data System (ADS)
Kumar, Birendra; Nayak, Rajen Kumar; Singh, S. N.
2018-05-01
A twisted tape inserted in an absorber tube may be an excellent option to enhance the performance of a cylindrical parabolic concentrating solar collector (CPC). The present work is an experimental study of the flow and heat transfer with and without twisted tape inserts in the absorber tube of a CPC. Results are presented for mass flow rates of water, ṁ=0.0198-0.0525 kg/s, twist ratio, y=5-10 and Reynolds number, Re=2577.46-6785.55. In the present study, we found that the outlet water temperature, collector efficiency and Nusselt number (Nu) are higher in the twisted tapes as compared to those without the twisted tape inserts in the absorber tube of the CPC. For fixed mass flow rate of water ṁ, the To and η increased with the decrease in twist ratio, y, and is higher in lower twist ratio, y=5, of the twisted tapes. The whole experiment was performed at the Indian Institute of Technology (ISM) in Dhanbad, India during the months of March-April 2017. Based on the experimental data, the correlations for the Nu and friction factor were also developed.
Silin, D.; Lyubomska, O.; Ludlow, M.; Duprex, W. P.; Rima, B. K.
2007-01-01
We demonstrate that insertion of the open reading frame of enhanced green fluorescent protein (EGFP) into the coding sequence for the second hinge region of the viral L (large) protein (RNA-dependent RNA polymerase) attenuates a wild-type canine distemper virus. Moreover, we show that single intranasal immunization with this recombinant virus provides significant protection against challenge with the virulent parental virus. Protection against wild-type challenge was gained either after recovery of cellular immunity postimmunization or after development of neutralizing antibodies. Insertion of EGFP seems to result in overattenuation of the virus, while our previous experiments demonstrated that the insertion of an epitope tag into a similar position did not affect L protein function. Thus, a desirable level of attenuation could be reached by manipulating the length of the insert (in the second hinge region of the L protein), providing additional tools for optimization of controlled attenuation. This strategy for controlled attenuation may be useful for a “quick response” in vaccine development against well-known and “new” viral infections and could be combined efficiently with other strategies of vaccine development and delivery systems. PMID:17898047
Image contrast enhancement of Ni/YSZ anode during the slice-and-view process in FIB-SEM.
Liu, Shu-Sheng; Takayama, Akiko; Matsumura, Syo; Koyama, Michihisa
2016-03-01
Focused ion beam-scanning electron microscopy (FIB-SEM) is a widely used and easily operational equipment for three-dimensional reconstruction with flexible analysis volume. It has been using successfully and increasingly in the field of solid oxide fuel cell. However, the phase contrast of the SEM images is indistinct in many cases, which will bring difficulties to the image processing. Herein, the phase contrast of a conventional Ni/yttria stabilized zirconia anode is tuned in an FIB-SEM with In-Lens secondary electron (SE) and backscattered electron detectors. Two accessories, tungsten probe and carbon nozzle, are inserted during the observation. The former has no influence on the contrast. When the carbon nozzle is inserted, best and distinct contrast can be obtained by In-Lens SE detector. This method is novel for contrast enhancement. Phase segmentation of the image can be automatically performed. The related mechanism for different images is discussed. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.
Irwin, Michael D.; Buchholz, D. Bruce; Hains, Alexander W.; Chang, Robert P. H.; Marks, Tobin J.
2008-01-01
To minimize interfacial power losses, thin (5–80 nm) layers of NiO, a p-type oxide semiconductor, are inserted between the active organic layer, poly(3-hexylthiophene) (P3HT) + [6,6]-phenyl-C61 butyric acid methyl ester (PCBM), and the ITO (tin-doped indium oxide) anode of bulk-heterojunction ITO/P3HT:PCBM/LiF/Al solar cells. The interfacial NiO layer is deposited by pulsed laser deposition directly onto cleaned ITO, and the active layer is subsequently deposited by spin-coating. Insertion of the NiO layer affords cell power conversion efficiencies as high as 5.2% and enhances the fill factor to 69% and the open-circuit voltage (Voc) to 638 mV versus an ITO/P3HT:PCBM/LiF/Al control device. The value of such hole-transporting/electron-blocking interfacial layers is clearly demonstrated and should be applicable to other organic photovoltaics.
Kotaki, Tomohiro; Khairunisa, Siti Qamariyah; Sukartiningrum, Septhia Dwi; Witaningrum, Adiana Mutamsari; Rusli, Musofa; Diansyah, M Noor; Arfijanto, M Vitanata; Rahayu, Retno Pudji; Nasronudin; Kameoka, Masanori
2014-05-01
Although human immunodeficiency virus type 1 (HIV-1) infection causes serious health problems in Indonesia, information in regard to drug resistance is limited. We performed a genotypic study on HIV-1 integrase derived from drug-naive individuals in Surabaya, Indonesia. Sequencing analysis revealed that no primary mutations associated with drug resistance to integrase inhibitors were detected; however, secondary mutations, V72I, L74I/M, V165I, V201I, I203M, and S230N, were detected in more than 5% of samples. In addition, V201I was conserved among all samples. Most integrase genes were classified into CRF01_AE genes. Interestingly, 40% of the CRF01_AE genes had an unusual insertion in the C-terminus of integrase. These mutations and insertions were considered natural polymorphisms since these mutations coincided with previous reports, and integrase inhibitors have not been used in Indonesia. Our results indicated that further studies may be required to assess the impact of these mutations on integrase inhibitors prior to their introduction into Indonesia.
Laser Generated Leaky Acoustic Waves for Needle Visualization.
Wu, Kai-Wen; Wang, Yi-An; Li, Pai-Chi
2018-04-01
Ultrasound (US)-guided needle operation is usually used to visualize both tissue and needle position such as tissue biopsy and localized drug delivery. However, the transducer-needle orientation is limited due to reflection of the acoustic waves. We proposed a leaky acoustic wave method to visualize the needle position and orientation. Laser pulses are emitted on top of the needle to generate acoustic waves; then, these acoustic waves propagate along the needle surface. Leaky wave signals are detected by the US array transducer. The needle position can be calculated by phase velocities of two different wave modes and their corresponding emission angles. In our experiments, a series of needles was inserted into a tissue mimicking phantom and porcine tissue to evaluate the accuracy of the proposed method. The results show that the detection depth is up to 51 mm and the insertion angle is up to 40° with needles of different diameters. It is demonstrated that the proposed approach outperforms the conventional B-mode US-guided needle operation in terms of the detection range while achieving similar accuracy. The proposed method reveals the potentials for further clinical applications.
Graphene-carbon nanotube composite aerogel for selective detection of uric acid
NASA Astrophysics Data System (ADS)
Zhang, Feifei; Tang, Jie; Wang, Zonghua; Qin, Lu-Chang
2013-12-01
Graphene and single-walled carbon nanotube (SWNT) composite aerogel has been prepared by hydrothermal synthesis. The restacking of graphene is effectively reduced by SWNTs inserted in between graphene layers in order to make available more active sites and reactive surface area. Electrochemical experiments show that the graphene-SWNT composite electrode has superior catalytic performance in selective detection of uric acid (UA).
Positron autoradiography for intravascular imaging: feasibility evaluation
NASA Astrophysics Data System (ADS)
Shikhaliev, Polad M.; Xu, Tong; Ducote, Justin L.; Easwaramoorthy, Balasubramaniam; Mukherjee, Jogeshwar; Molloi, Sabee
2006-02-01
Approximately 70% of acute coronary artery disease is caused by unstable (vulnerable) plaques with an inflammation of the overlying cap and high lipid content. A rupturing of the inflamed cap of the plaque results in propagation of the thrombus into the lumen, blockage of the artery and acute ischaemic syndrome or sudden death. Morphological imaging such as angiography or intravascular ultrasound cannot determine inflammation status of the plaque. A radiotracer such as 18F-FDG is accumulated in vulnerable plaques due to higher metabolic activity of the inflamed cap and could be used to detect a vulnerable plaque. However, positron emission tomography (PET) cannot detect the FDG-labelled plaques because of respiratory and heart motions, small size and low activity of the plaques. Plaques can be detected using a miniature particle (positron) detector inserted into the artery. In this work, a new detector concept is investigated for intravascular imaging of the plaques. The detector consists of a storage phosphor tip bound to the end of an intravascular catheter. It can be inserted into an artery, absorb the 18F-FDG positrons from the plaques, withdrawn from the artery and read out. Length and diameter of the storage phosphor tip can be matched to the length and the diameter of the artery. Monte Carlo simulations and experimental evaluations of coronary plaque imaging with the proposed detector were performed. It was shown that the sensitivity of the storage phosphor detector to the positrons of 18F-FDG is sufficient to detect coronary plaques with 1 mm and 2 mm sizes and 590 Bq and 1180 Bq activities in the arteries with 2 mm and 3 mm diameters, respectively. An experimental study was performed using plastic tubes with 2 mm diameter filled with an FDG solution, which simulates blood. FDG spots simulating plaques were placed over the surface of the tube. A phosphor tip was inserted into the tube and imaged the plaques. Exposure time was 1 min in all simulations and experiments. Experiments showed that detecting the coronary plaques using the proposed technique is possible. The proposed technique has the potential for fast and accurate detection of vulnerable coronary and other intravascular plaques.
Hooks, David O; Rehm, Bernd H A
2015-10-01
The polyhydroxyalkanoate (PHA) synthase catalyzes the synthesis of PHA and remains attached to the hydrophobic PHA inclusions it creates. Although this feature is actively exploited to generate functionalized biobeads via protein engineering, little is known about the structure of the PHA synthase. Here, the surface topology of Ralstonia eutropha PHA synthase was probed to inform rational protein engineering toward the production of functionalized PHA beads. Surface-exposed residues were detected by conjugating biotin to inclusion-bound PHA synthase and identifying the biotin-conjugated lysine and cysteine residues using peptide fingerprinting analysis. The identified sites (K77, K90, K139, C382, C459, and K518) were investigated as insertion sites for the generation of new protein fusions. Insertions of FLAG epitopes into exposed sites K77, K90, K139, and K518 were tolerated, retaining >65 % of in vivo activity. Sites K90, K139, and K518 were also tested by insertion of the immunoglobulin G (IgG)-binding domain (ZZ), successfully producing PHA inclusions able to bind human IgG in vitro. Although simultaneous insertions of the ZZ domain into two sites was permissive, insertion at all three lysine sites inactivated the synthase. The K90/K139 double ZZ insertion had the optimum IgG-binding capacity of 16 mg IgG/g wet PHA beads and could selectively purify the IgG fraction from human serum. Overall, this study identified surface-exposed flexible regions of the PHA synthase which either tolerate protein/peptide insertions or are critical for protein function. This further elucidates the structure and function of PHA synthase and provides new opportunities for generating functionalized PHA biobeads.
Burns, Kathleen H.; Boeke, Jef D.
2012-01-01
Mobile DNAs have had a central role in shaping our genome. More than half of our DNA is comprised of interspersed repeats resulting from replicative copy and paste events of retrotransposons. Although most are fixed, incapable of templating new copies, there are important exceptions to retrotransposon quiescence. De novo insertions cause genetic diseases and cancers, though reliably detecting these occurrences has been difficult. New technologies aimed at uncovering polymorphic insertions reveal that mobile DNAs provide a substantial and dynamic source of structural variation. Key questions going forward include the how and how much new transposition events affect human health and disease. PMID:22579280
Semiconductor radiation detector
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patt, Bradley E.; Iwanczyk, Jan S.; Tull, Carolyn R.
A semiconductor radiation detector is provided to detect x-ray and light photons. The entrance electrode is segmented by using variable doping concentrations. Further, the entrance electrode is physically segmented by inserting n+ regions between p+ regions. The p+ regions and the n+ regions are individually biased. The detector elements can be used in an array, and the p+ regions and the n+ regions can be biased by applying potential at a single point. The back side of the semiconductor radiation detector has an n+ anode for collecting created charges and a number of p+ cathodes. Biased n+ inserts can bemore » placed between the p+ cathodes, and an internal resistor divider can be used to bias the n+ inserts as well as the p+ cathodes. A polysilicon spiral guard can be implemented surrounding the active area of the entrance electrode or surrounding an array of entrance electrodes.« less
Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A
1987-01-15
The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.
Jeong, Hyundoo; Yoon, Byung-Jun
2017-03-14
Network querying algorithms provide computational means to identify conserved network modules in large-scale biological networks that are similar to known functional modules, such as pathways or molecular complexes. Two main challenges for network querying algorithms are the high computational complexity of detecting potential isomorphism between the query and the target graphs and ensuring the biological significance of the query results. In this paper, we propose SEQUOIA, a novel network querying algorithm that effectively addresses these issues by utilizing a context-sensitive random walk (CSRW) model for network comparison and minimizing the network conductance of potential matches in the target network. The CSRW model, inspired by the pair hidden Markov model (pair-HMM) that has been widely used for sequence comparison and alignment, can accurately assess the node-to-node correspondence between different graphs by accounting for node insertions and deletions. The proposed algorithm identifies high-scoring network regions based on the CSRW scores, which are subsequently extended by maximally reducing the network conductance of the identified subnetworks. Performance assessment based on real PPI networks and known molecular complexes show that SEQUOIA outperforms existing methods and clearly enhances the biological significance of the query results. The source code and datasets can be downloaded from http://www.ece.tamu.edu/~bjyoon/SEQUOIA .
Enhanced sensitivity of surface acoustic wave-based rate sensors incorporating metallic dot arrays.
Wang, Wen; Shao, Xiuting; Liu, Xinlu; Liu, Jiuling; He, Shitang
2014-02-26
A new surface acoustic wave (SAW)-based rate sensor pattern incorporating metallic dot arrays was developed in this paper. Two parallel SAW delay lines with a reverse direction and an operation frequency of 80 MHz on a same X-112°Y LiTaO3 wafer are fabricated as the feedback of two SAW oscillators, and mixed oscillation frequency was used to characterize the external rotation. To enhance the Coriolis force effect acting on the SAW propagation, a copper (Cu) dot array was deposited along the SAW propagation path of the SAW devices. The approach of partial-wave analysis in layered media was referred to analyze the response mechanisms of the SAW based rate sensor, resulting in determination of the optimal design parameters. To improve the frequency stability of the oscillator, the single phase unidirectional transducers (SPUDTs) and combed transducer were used to form the SAW device to minimize the insertion loss and accomplish the single mode selection, respectively. Excellent long-term (measured in hours) frequency stability of 0.1 ppm/h was obtained. Using the rate table with high precision, the performance of the developed SAW rate sensor was evaluated experimentally; satisfactory detection sensitivity (16.7 Hz∙deg∙s(-1)) and good linearity were observed.
Enhanced Sensitivity of Surface Acoustic Wave-Based Rate Sensors Incorporating Metallic Dot Arrays
Wang, Wen; Shao, Xiuting; Liu, Xinlu; Liu, Jiuling; He, Shitang
2014-01-01
A new surface acoustic wave (SAW)-based rate sensor pattern incorporating metallic dot arrays was developed in this paper. Two parallel SAW delay lines with a reverse direction and an operation frequency of 80 MHz on a same X-112°Y LiTaO3 wafer are fabricated as the feedback of two SAW oscillators, and mixed oscillation frequency was used to characterize the external rotation. To enhance the Coriolis force effect acting on the SAW propagation, a copper (Cu) dot array was deposited along the SAW propagation path of the SAW devices. The approach of partial-wave analysis in layered media was referred to analyze the response mechanisms of the SAW based rate sensor, resulting in determination of the optimal design parameters. To improve the frequency stability of the oscillator, the single phase unidirectional transducers (SPUDTs) and combed transducer were used to form the SAW device to minimize the insertion loss and accomplish the single mode selection, respectively. Excellent long-term (measured in hours) frequency stability of 0.1 ppm/h was obtained. Using the rate table with high precision, the performance of the developed SAW rate sensor was evaluated experimentally; satisfactory detection sensitivity (16.7 Hz·deg·s−1) and good linearity were observed. PMID:24577520
Microscopic studies of nonlocal spin dynamics and spin transport (invited)
NASA Astrophysics Data System (ADS)
Adur, Rohan; Du, Chunhui; Cardellino, Jeremy; Scozzaro, Nicolas; Wolfe, Christopher S.; Wang, Hailong; Herman, Michael; Bhallamudi, Vidya P.; Pelekhov, Denis V.; Yang, Fengyuan; Hammel, P. Chris
2015-05-01
Understanding the behavior of spins coupling across interfaces in the study of spin current generation and transport is a fundamental challenge that is important for spintronics applications. The transfer of spin angular momentum from a ferromagnet into an adjacent normal material as a consequence of the precession of the magnetization of the ferromagnet is a process known as spin pumping. We find that, in certain circumstances, the insertion of an intervening normal metal can enhance spin pumping between an excited ferromagnetic magnetization and a normal metal layer as a consequence of improved spin conductance matching. We have studied this using inverse spin Hall effect and enhanced damping measurements. Scanned probe magnetic resonance techniques are a complementary tool in this context offering high resolution magnetic resonance imaging, localized spin excitation, and direct measurement of spin lifetimes or damping. Localized magnetic resonance studies of size-dependent spin dynamics in the absence of lithographic confinement in both ferromagnets and paramagnets reveal the close relationship between spin transport and spin lifetime at microscopic length scales. Finally, detection of ferromagnetic resonance of a ferromagnetic film using the photoluminescence of nitrogen vacancy spins in neighboring nanodiamonds demonstrates long-range spin transport between insulating materials, indicating the complexity and generality of spin transport in diverse, spatially separated, material systems.
Microscopic studies of nonlocal spin dynamics and spin transport (invited)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adur, Rohan; Du, Chunhui; Cardellino, Jeremy
2015-05-07
Understanding the behavior of spins coupling across interfaces in the study of spin current generation and transport is a fundamental challenge that is important for spintronics applications. The transfer of spin angular momentum from a ferromagnet into an adjacent normal material as a consequence of the precession of the magnetization of the ferromagnet is a process known as spin pumping. We find that, in certain circumstances, the insertion of an intervening normal metal can enhance spin pumping between an excited ferromagnetic magnetization and a normal metal layer as a consequence of improved spin conductance matching. We have studied this usingmore » inverse spin Hall effect and enhanced damping measurements. Scanned probe magnetic resonance techniques are a complementary tool in this context offering high resolution magnetic resonance imaging, localized spin excitation, and direct measurement of spin lifetimes or damping. Localized magnetic resonance studies of size-dependent spin dynamics in the absence of lithographic confinement in both ferromagnets and paramagnets reveal the close relationship between spin transport and spin lifetime at microscopic length scales. Finally, detection of ferromagnetic resonance of a ferromagnetic film using the photoluminescence of nitrogen vacancy spins in neighboring nanodiamonds demonstrates long-range spin transport between insulating materials, indicating the complexity and generality of spin transport in diverse, spatially separated, material systems.« less
Molecular Active Sites in Heterogeneous Ir-La/C-Catalyzed Carbonylation of Methanol to Acetates.
Kwak, Ja Hun; Dagle, Robert; Tustin, Gerald C; Zoeller, Joseph R; Allard, Lawrence F; Wang, Yong
2014-02-06
We report that when Ir and La halides are deposited on carbon, exposure to CO spontaneously generates a discrete molecular heterobimetallic structure, containing an Ir-La covalent bond that acts as a highly active, selective, and stable heterogeneous catalyst for the carbonylation of methanol to produce acetic acid. This catalyst exhibits a very high productivity of ∼1.5 mol acetyl/mol Ir·s with >99% selectivity to acetyl (acetic acid and methyl acetate) without detectable loss in activity or selectivity for more than 1 month of continuous operation. The enhanced activity can be mechanistically rationalized by the presence of La within the ligand sphere of the discrete molecular Ir-La heterobimetallic structure, which acts as a Lewis acid to accelerate the normally rate-limiting CO insertion in Ir-catalyzed carbonylation. Similar approaches may provide opportunities for attaining molecular (single site) behavior similar to homogeneous catalysis on heterogeneous surfaces for other industrial applications.
NASA Astrophysics Data System (ADS)
Facius, R.; Scherer, K.; Strauch, W.; Nevzgodina, L. V.; Maximova, E. N.; Akatov, Yu. A.
Radiobiological effects of single cosmic heavy ions on individual, actively metabolizing test organisms, plants of Wolffia arrhiza, have been explored in an experiment flown aboard the Russian Biosatellite 10. Mortality induced during space flight, population dynamics during subsequent cultivation, and morphological anomalies occurring in the plants of these cultures were investigated. Correlation of these effects with the passage of a heavy ion was achieved by inserting monolayers of plants in a stack of surrounding plastic nuclear track detectors (BIOSTACK). Enhanced initial mortality and delayed decline of induced anomalies have been significantly associated with the passage of single heavy ions, in particular if ions penetrated the budding region of the plants. The prolonged persistence of anomalies in filial generations as an indication of delayed genetic damage has been detected for the first time as the consequence of the hit by a single heavy ion. Regarding radiation protection of space crew during prolonged missions, especially outside the magnetosphere, this appears to be a significant finding.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Beigi, Parmida; Rohling, Robert; Salcudean, Septimiu E; Ng, Gary C
2017-11-01
This paper presents a new micro-motion-based approach to track a needle in ultrasound images captured by a handheld transducer. We propose a novel learning-based framework to track a handheld needle by detecting microscale variations of motion dynamics over time. The current state of the art on using motion analysis for needle detection uses absolute motion and hence work well only when the transducer is static. We have introduced and evaluated novel spatiotemporal and spectral features, obtained from the phase image, in a self-supervised tracking framework to improve the detection accuracy in the subsequent frames using incremental training. Our proposed tracking method involves volumetric feature selection and differential flow analysis to incorporate the neighboring pixels and mitigate the effects of the subtle tremor motion of a handheld transducer. To evaluate the detection accuracy, the method is tested on porcine tissue in-vivo, during the needle insertion in the biceps femoris muscle. Experimental results show the mean, standard deviation and root-mean-square errors of [Formula: see text], [Formula: see text] and [Formula: see text] in the insertion angle, and 0.82, 1.21, 1.47 mm, in the needle tip, respectively. Compared to the appearance-based detection approaches, the proposed method is especially suitable for needles with ultrasonic characteristics that are imperceptible in the static image and to the naked eye.
A low molecular weight artificial RNA of unique size with multiple probe target regions
NASA Technical Reports Server (NTRS)
Pitulle, C.; Dsouza, L.; Fox, G. E.
1997-01-01
Artificial RNAs (aRNAs) containing novel sequence segments embedded in a deletion mutant of Vibrio proteolyticus 5S rRNA have previously been shown to be expressed from a plasmid borne growth rate regulated promoter in E. coli. These aRNAs accumulate to high levels and their detection is a promising tool for studies in molecular microbial ecology and in environmental monitoring. Herein a new construct is described which illustrates the versatility of detection that is possible with aRNAs. This 3xPen aRNA construct carries a 72 nucleotide insert with three copies of a unique 17 base probe target sequence. This aRNA is 160 nucleotides in length and again accumulates to high levels in the E. coli cytoplasm without incorporating into ribosomes. The 3xPen aRNA illustrates two improvements in detection. First, by appropriate selection of insert size, we obtained an aRNA which provides a unique and hence, easily quantifiable peak, on a high resolution gel profile of low molecular weight RNAs. Second, the existence of multiple probe targets results in a nearly commensurate increase in signal when detection is by hybridization. These aRNAs are naturally amplified and carry sequence segments that are not found in known rRNA sequences. It thus may be possible to detect them directly. An experimental step involving RT-PCR or PCR amplification of the gene could therefore be avoided.
Structural diversity of domain superfamilies in the CATH database.
Reeves, Gabrielle A; Dallman, Timothy J; Redfern, Oliver C; Akpor, Adrian; Orengo, Christine A
2006-07-14
The CATH database of domain structures has been used to explore the structural variation of homologous domains in 294 well populated domain structure superfamilies, each containing at least three sequence diverse relatives. Our analyses confirm some previously detected trends relating sequence divergence to structural variation but for a much larger dataset and in some superfamilies the new data reveal exceptional structural variation. Use of a new algorithm (2DSEC) to analyse variability in secondary structure compositions across a superfamily sheds new light on how structures evolve. 2DSEC detects inserted secondary structures that embellish the core of conserved secondary structures found throughout the superfamily. Analysis showed that for 56% of highly populated superfamilies (>9 sequence diverse relatives), there are twofold or more increases in the numbers of secondary structures in some relatives. In some families fivefold increases occur, sometimes modifying the fold of the domain. Manual inspection of secondary structure insertions or embellishments in 48 particularly variable superfamilies revealed that although these insertions were usually discontiguous in the sequence they were often co-located in 3D resulting in a larger structural motif that often modified the geometry of the active site or the surface conformation promoting diverse domain partnerships and protein interactions. These observations, supported by automatic analysis of all well populated CATH families, suggest that accretion of small secondary structure insertions may provide a simple mechanism for evolving new functions in diverse relatives. Some layered domain architectures (e.g. mainly-beta and alpha-beta sandwiches) that recur highly in the genomes more frequently exploit these types of embellishments to modify function. In these architectures, aggregation occurs most often at the edges, top or bottom of the beta-sheets. Information on structural variability across domain superfamilies has been made available through the CATH Dictionary of Homologous Structures (DHS).
[Analysis of ethnogeographic groups of Kazakhs based on nuclear genome DNA polymorphism].
Salimova, A Z; Kutuev, I A; Khusainova, R I; Akhmetova, V L; Sviatova, G S; Berezina, G M; Khusnutdinova, E K
2005-07-01
Eight nuclear DNA loci, including six Alu insertions (ACE, APOA1, PV92, TPA25, Ya5NBC27, and Ya5NBC148), 32-bp deletion in the CCR5 gene, and VNTR locus at the eNOS gene, were examined in three ethnogeographic groups of Kazakhs (342 individuals). The individuals examined lived in southeastern, central, and southwestern regions of Kazakhstan, and according to their tribal attribution, belonged to the Senior, Middle, and Junior Zhuzes. The Alu insertions appeared to be polymorphic in all populations examined: the insertion frequency varied from 0.264 in the populations of the Senior and Middle Zhuzes at the Ya5NBC27 and Ya5NBC148 loci, to 0.827 in Kazakhs of the Middle Zhuz at the APOA1 locus. In Kazakh groups examined only two alleles of the eNOS VNTR locus were detected with the number of repeats constituting four (A) and five (B) copies. The highest frequency of A allele was found in Kazakhs from the Junior Zhuz (0.113), while the highest frequency of B allele was detected in population of the Senior Zhuz (0.893). The frequency of the 32-bp deletion in the chemokine receptor CCR5 gene varied from 0.027 in the Junior Zhuz to 0.045 in the Senior Zhuz. Kazakhs showed high genetic diversity (Hex = 0.376). In general, in three ethnogeographic groups of Kazakhs, the coefficient of gene differentiation (G(ST)) over eight diallelic markers of nuclear genome constituted 1.1%. The differences in the Alu insertions made the highest contribution to the among-population diversity (G(ST) = 1.2%).
Thermo-Hydraulic Characteristics of Anatase Titania Nanofluids Flowing Through a Circular Conduit.
Kristiawan, Budi; Kamal, Samsul; Yanuar
2016-06-01
The thermo-hydraulic characteristics of anatase titanium dioxide dispersed into distilled water with particle concentration of 0.1, 0.3, and 0.5 vol.% were investigated experimentally in this work. The influence of rheological behavior on hydrodynamic and convective heat transfer characteristics was evaluated under both laminar and turbulent flow conditions in a plain conduit and with twisted tape insert for twist ratio of 7. The nanofluids exhibited a strong shear-thinning behavior at low shear rate particularly higher particle concentration. The non-Newtonian titania nanofluids have also demonstrated a drag reduction phenomena in turbulent flow. At equal Reynolds number, the values of performance evaluation criterion in a conduit inserted a twisted tape were lower than those of in a plain conduit. It implies the unfavourable energy budget for twisted tape insert. The convective heat transfer coefficient does not gradually enhance with an increase of particle concentration. The flow features due mainly to the rheology of colloidal dispersions might be a reason for this phenomenon.
A transposable element in a NAC gene is associated with drought tolerance in maize seedlings
Mao, Hude; Wang, Hongwei; Liu, Shengxue; Li, Zhigang; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Qin, Feng
2015-01-01
Drought represents a major constraint on maize production worldwide. Understanding the genetic basis for natural variation in drought tolerance of maize may facilitate efforts to improve this trait in cultivated germplasm. Here, using a genome-wide association study, we show that a miniature inverted-repeat transposable element (MITE) inserted in the promoter of a NAC gene (ZmNAC111) is significantly associated with natural variation in maize drought tolerance. The 82-bp MITE represses ZmNAC111 expression via RNA-directed DNA methylation and H3K9 dimethylation when heterologously expressed in Arabidopsis. Increasing ZmNAC111 expression in transgenic maize enhances drought tolerance at the seedling stage, improves water-use efficiency and induces upregulation of drought-responsive genes under water stress. The MITE insertion in the ZmNAC111 promoter appears to have occurred after maize domestication and spread among temperate germplasm. The identification of this MITE insertion provides insight into the genetic basis for natural variation in maize drought tolerance. PMID:26387805
NASA Astrophysics Data System (ADS)
Shang, T.; Yang, H. L.; Zhan, Q. F.; Zuo, Z. H.; Xie, Y. L.; Liu, L. P.; Zhang, S. L.; Zhang, Y.; Li, H. H.; Wang, B. M.; Wu, Y. H.; Zhang, S.; Li, Run-Wei
2016-10-01
We report an investigation of anomalous-Hall resistance (AHR) and spin-Hall magnetoresistance (SMR) in Pt/Ir20Mn80/Y3Fe5O12 (Pt/IrMn/YIG) heterostructures. The AHR of Pt/IrMn/YIG heterostructures with an antiferromagnetic inserted layer is dramatically enhanced as compared to that of the Pt/YIG bilayer. The temperature dependent AHR behavior is nontrivial, while the IrMn thickness dependent AHR displays a peak at an IrMn thickness of 3 nm. The observed SMR in the temperature range of 10-300 K indicates that the spin current generated in the Pt layer can penetrate the IrMn layer (≤3 nm) to interact with the ferromagnetic YIG layer. The lack of conventional anisotropic magnetoresistance (AMR) implies that the insertion of the IrMn layer between Pt and YIG could efficiently suppress the magnetic proximity effect (MPE) on induced Pt moments by YIG.
Objective evaluation of insert material for diabetic and athletic footwear.
Brodsky, J W; Kourosh, S; Stills, M; Mooney, V
1988-12-01
Five of the most commonly used materials for shoe inserts (soft Plastazote, medium Pelite, PPT, Spenco, and Sorbothane) were objectively evaluated in the laboratory to characterize their behavior in the following three specific functions that correspond to clinical use: (1) the effect on the materials of repeated compression. (2) the effect of a combination of repetitive shear and compression. (3) the force-distribution (force-attenuation) properties of these materials, both when new and after repeated compression. The last function represents a model for relief of pressure beneath plantar bony prominences, a topic of special concern for the insensitive foot. All materials were effective in reducing transmitted force over the simulated bony prominence with a rank order of effectiveness. Other factors considered were: amount and rate of permanent deformation offset by considerations of enhanced moldability when comparing the neoprene and urethane materials with the polyethylene foams. The ideal insert represents a combination of material to achieve both durability and moldability.
Effect of screw fixation on acetabular component alignment change in total hip arthroplasty.
Fujishiro, Takaaki; Hayashi, Shinya; Kanzaki, Noriyuki; Hashimoto, Shingo; Shibanuma, Nao; Kurosaka, Masahiro
2014-06-01
The use of screws can enhance immediate cup fixation, but the influence of screw insertion on cup position has not previously been measured. The purpose of this study was to quantitatively evaluate the effect of intra-operative screw fixation on acetabular component alignment that has been inserted with the use of a navigation system. We used a navigation system to measure cup alignment at the time of press-fit and after screw fixation in 144 hips undergoing total hip arthroplasty. We also compared those findings with factors measured from postoperative radiographs. The mean intra-operative change of cup position was 1.78° for inclination and 1.81° for anteversion. The intra-operative change of anteversion correlated with the number of screws. The intra-operative change of inclination also correlated with medial hip centre. The insertion of screws can induce changes in cup alignment, especially when multiple screws are used or if a more medial hip centre is required for rigid acetabular fixation.
Gas turbine row #1 steam cooled vane
Cunha, Frank J.
2000-01-01
A design for a vane segment having a closed-loop steam cooling system is provided. The vane segment comprises an outer shroud, an inner shroud and an airfoil, each component having a target surface on the inside surface of its walls. A plurality of rectangular waffle structures are provided on the target surface to enhance heat transfer between each component and cooling steam. Channel systems are provided in the shrouds to improve the flow of steam through the shrouds. Insert legs located in cavities in the airfoil are also provided. Each insert leg comprises outer channels located on a perimeter of the leg, each outer channel having an outer wall and impingement holes on the outer wall for producing impingement jets of cooling steam to contact the airfoil's target surface. Each insert leg further comprises a plurality of substantially rectangular-shaped ribs located on the outer wall and a plurality of openings located between outer channels of the leg to minimize cross flow degradation.
Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl
Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier
2013-01-01
Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950
Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.
Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier
2013-01-01
Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.
Wan, Fang; Zhang, Linlin; Dai, Xi; Wang, Xinyu; Niu, Zhiqiang; Chen, Jun
2018-04-25
Rechargeable aqueous zinc-ion batteries are promising energy storage devices due to their high safety and low cost. However, they remain in their infancy because of the limited choice of positive electrodes with high capacity and satisfactory cycling performance. Furthermore, their energy storage mechanisms are not well established yet. Here we report a highly reversible zinc/sodium vanadate system, where sodium vanadate hydrate nanobelts serve as positive electrode and zinc sulfate aqueous solution with sodium sulfate additive is used as electrolyte. Different from conventional energy release/storage in zinc-ion batteries with only zinc-ion insertion/extraction, zinc/sodium vanadate hydrate batteries possess a simultaneous proton, and zinc-ion insertion/extraction process that is mainly responsible for their excellent performance, such as a high reversible capacity of 380 mAh g -1 and capacity retention of 82% over 1000 cycles. Moreover, the quasi-solid-state zinc/sodium vanadate hydrate battery is also a good candidate for flexible energy storage device.
System and method for introduction and stabilization of genes in Thermus sp.
Kayser, Kevin J.; Park, Ho-Shin; Kilbane, II, John J.
2005-03-01
A method for introducing and stabilizing heterologous and recombinant genes in a thermophilic host in which a characteristic gene defining a detectable host characteristic is inactivated or deleted from the thermophilic host, resulting in a modified thermophilic host expressing an absence of the detectable host characteristic. A DNA fragment of interest is inserted into the modified thermophilic host together with an intact characteristic gene, whereby the detectable host characteristic is restored to the thermophilic host, thereby enabling detection and confirmation of successful transformation using plasmid vectors and integration of the DNA fragment into the chromosome of the thermophilic host.
Vasant, Bhakti R; Stafford, Russell J; Jennison, Amy V; Bennett, Sonya M; Bell, Robert J; Doyle, Christine J; Young, Jeannette R; Vlack, Susan A; Titmus, Paul; El Saadi, Debra; Jarvinen, Kari A J; Coward, Patricia; Barrett, Janine; Staples, Megan; Graham, Rikki M A; Smith, Helen V; Lambert, Stephen B
2017-10-01
During a large outbreak of Shiga toxin-producing Escherichia coli illness associated with an agricultural show in Australia, we used whole-genome sequencing to detect an IS1203v insertion in the Shiga toxin 2c subunit A gene of Shiga toxin-producing E. coli. Our study showed that clinical illness was mild, and hemolytic uremic syndrome was not detected.
Detection of discoloration and decay in living trees and utility poles
Alex L. Shigo; Alex Shigo
1974-01-01
A method is described for detecting discoloration and decay in living trees and creosoted utility poles. The method and devices have come from research involving many people over a seven-year period. A probe was inserted into a 3/32-inch (2.4 mm) diameter hole made by drill bits 8 inches (20.32 cm) and 12 inches (30.48 cm) long mounted in a portable, light-weight,...
Self-synchronization for spread spectrum audio watermarks after time scale modification
NASA Astrophysics Data System (ADS)
Nadeau, Andrew; Sharma, Gaurav
2014-02-01
De-synchronizing operations such as insertion, deletion, and warping pose significant challenges for watermarking. Because these operations are not typical for classical communications, watermarking techniques such as spread spectrum can perform poorly. Conversely, specialized synchronization solutions can be challenging to analyze/ optimize. This paper addresses desynchronization for blind spread spectrum watermarks, detected without reference to any unmodified signal, using the robustness properties of short blocks. Synchronization relies on dynamic time warping to search over block alignments to find a sequence with maximum correlation to the watermark. This differs from synchronization schemes that must first locate invariant features of the original signal, or estimate and reverse desynchronization before detection. Without these extra synchronization steps, analysis for the proposed scheme builds on classical SS concepts and allows characterizes the relationship between the size of search space (number of detection alignment tests) and intrinsic robustness (continuous search space region covered by each individual detection test). The critical metrics that determine the search space, robustness, and performance are: time-frequency resolution of the watermarking transform, and blocklength resolution of the alignment. Simultaneous robustness to (a) MP3 compression, (b) insertion/deletion, and (c) time-scale modification is also demonstrated for a practical audio watermarking scheme developed in the proposed framework.
46 CFR 115.810 - Fire protection.
Code of Federal Regulations, 2013 CFR
2013-10-01
... (7) Inspection and testing of smoke and fire detecting systems (including sensors and alarms) and... Coast Guard inspector. Dry chemical (cartridge operated) Examine pressure cartridge and replace if end... clear. Insert charged cartridge. Ensure dry chemical is free flowing, not caked, and extinguisher...
46 CFR 115.810 - Fire protection.
Code of Federal Regulations, 2012 CFR
2012-10-01
... (7) Inspection and testing of smoke and fire detecting systems (including sensors and alarms) and... Coast Guard inspector. Dry chemical (cartridge operated) Examine pressure cartridge and replace if end... clear. Insert charged cartridge. Ensure dry chemical is free flowing, not caked, and extinguisher...
46 CFR 115.810 - Fire protection.
Code of Federal Regulations, 2014 CFR
2014-10-01
... (7) Inspection and testing of smoke and fire detecting systems (including sensors and alarms) and... Coast Guard inspector. Dry chemical (cartridge operated) Examine pressure cartridge and replace if end... clear. Insert charged cartridge. Ensure dry chemical is free flowing, not caked, and extinguisher...
Increased Content Knowledge of Students with Visual Impairments as a Result of Extended Descriptions
ERIC Educational Resources Information Center
Ely, Richard; Emerson, Robert Wall; Maggiore, Theresa; Rothberg, Madeleine; O'Connell, Trisha; Hudson, Laurel
2006-01-01
The National Center for Accessible Media has developed a technology and protocol for inserting extended, enhanced descriptions of visually based concepts into artificially paused digital video. These "eDescriptions" describe material not fully explained by a narrator and provide analogies and explanation specifically designed for…
Microscale Enhancement of Heat and Mass Transfer for Hydrogen Energy Storage
DOE Office of Scientific and Technical Information (OSTI.GOV)
Drost, Kevin; Jovanovic, Goran; Paul, Brian
2015-09-30
The document summarized the technical progress associated with OSU’s involvement in the Hydrogen Storage Engineering Center of Excellence. OSU focused on the development of microscale enhancement technologies for improving heat and mass transfer in automotive hydrogen storage systems. OSU’s key contributions included the development of an extremely compact microchannel combustion system for discharging hydrogen storage systems and a thermal management system for adsorption based hydrogen storage using microchannel cooling (the Modular Adsorption Tank Insert or MATI).
Quantitative Mapping of Matrix Content and Distribution across the Ligament-to-Bone Insertion
Spalazzi, Jeffrey P.; Boskey, Adele L.; Pleshko, Nancy; Lu, Helen H.
2013-01-01
The interface between bone and connective tissues such as the Anterior Cruciate Ligament (ACL) constitutes a complex transition traversing multiple tissue regions, including non-calcified and calcified fibrocartilage, which integrates and enables load transfer between otherwise structurally and functionally distinct tissue types. The objective of this study was to investigate region-dependent changes in collagen, proteoglycan and mineral distribution, as well as collagen orientation, across the ligament-to-bone insertion site using Fourier transform infrared spectroscopic imaging (FTIR-I). Insertion site-related differences in matrix content were also evaluated by comparing tibial and femoral entheses. Both region- and site-related changes were observed. Collagen content was higher in the ligament and bone regions, while decreasing across the fibrocartilage interface. Moreover, interfacial collagen fibrils were aligned parallel to the ligament-bone interface near the ligament region, assuming a more random orientation through the bulk of the interface. Proteoglycan content was uniform on average across the insertion, while its distribution was relatively less variable at the tibial compared to the femoral insertion. Mineral was only detected in the calcified interface region, and its content increased exponentially across the mineralized fibrocartilage region toward bone. In addition to new insights into matrix composition and organization across the complex multi-tissue junction, findings from this study provide critical benchmarks for the regeneration of soft tissue-to-bone interfaces and integrative soft tissue repair. PMID:24019964
Ultrasound-guided three-dimensional needle steering in biological tissue with curved surfaces
Abayazid, Momen; Moreira, Pedro; Shahriari, Navid; Patil, Sachin; Alterovitz, Ron; Misra, Sarthak
2015-01-01
In this paper, we present a system capable of automatically steering a bevel-tipped flexible needle under ultrasound guidance toward a physical target while avoiding a physical obstacle embedded in gelatin phantoms and biological tissue with curved surfaces. An ultrasound pre-operative scan is performed for three-dimensional (3D) target localization and shape reconstruction. A controller based on implicit force control is developed to align the transducer with curved surfaces to assure the maximum contact area, and thus obtain an image of sufficient quality. We experimentally investigate the effect of needle insertion system parameters such as insertion speed, needle diameter and bevel angle on target motion to adjust the parameters that minimize the target motion during insertion. A fast sampling-based path planner is used to compute and periodically update a feasible path to the target that avoids obstacles. We present experimental results for target reconstruction and needle insertion procedures in gelatin-based phantoms and biological tissue. Mean targeting errors of 1.46 ± 0.37 mm, 1.29 ± 0.29 mm and 1.82 ± 0.58 mm are obtained for phantoms with inclined, curved and combined (inclined and curved) surfaces, respectively, for insertion distance of 86–103 mm. The achieved targeting errors suggest that our approach is sufficient for targeting lesions of 3 mm radius that can be detected using clinical ultrasound imaging systems. PMID:25455165
Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C. Kathy; Jin, Hong
2012-01-01
Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1st or the 3rd position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3rd position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation. PMID:22383906
Mobile-bearing total knee arthroplasty: a full traumatic rotation of 180°.
Sudanese, Alessandra; Castiello, Emanuela; Affatato, Saverio
2013-06-25
From February 2008 to September 2012 we implanted 204 mobile-bearing knee prostheses in 192 patients. All the prostheses were cemented (both femoral and tibial components), and the patella was not replaced. Only one early complication of the implants (1/204 = 0.004%) occurred after a traumatic event as a full 180° rotation of the mobile-bearing polyethylene insert. A 78-year-old woman presented with swelling and severe pain at her right knee. This traumatic event was the only case among our mobile-bearing insert patients. The failed polyethylene inserts were retrieved and studied using a scanning electron microscope (SEM, ZEISS EVO 50 EP, Cambridge, UK) operating at 20 kV. Scratching and pitting were found on the UHMWPE insert perpendicular to the machining tracks for the concave surface. SEM micrographs of the insert showed burnishing on the concave surfaces and longitudinal scratches were clearly detectable and well-marked on the analyzed surfaces. A traumatic, fully rotating, polyethylene insert is rare and our case is the first report describing a traumatic event with a complete 180 degree rotation mobile-bearing in a total knee prosthesis. In the literature few reports discuss clinical outcomes after total knee arthroplasty in patients with Parkinson's disease and they cite mixed results. However, some authors suggest that posterior-stabilized and cruciate-retaining TKA should work well while others prefer cruciate-retaining, condylar constrained kinetics, or hinged devices. Although we did not implant a posterior-stabilized mobile-bearing total knee prosthesis or a constrained prosthesis, we obtained good clinical and radiological results at the 2-year followup.
Matsubara, Noriaki; Miyachi, Shigeru; Izumi, Takashi; Yamada, Hiroyuki; Marui, Naoki; Ota, Keisuke; Tajima, Hayato; Shintai, Kazunori; Ito, Masashi; Imai, Tasuku; Nishihori, Masahiro; Wakabayashi, Toshihiko
2017-09-01
In endovascular embolization for intracranial aneurysms, it is important to properly control the coil insertion force. However, the force can only be subjectively detected by the subtle feedback experienced by neurointerventionists at their fingertips. The authors envisioned a system that would objectively sense and quantify that force. In this article, coil insertion force was measured in cases of intracranial aneurysm using this sensor, and its actual clinical application was investigated. The sensor consists of a hemostatic valve (Y-connector). A little flexure was intentionally added in the device, and it creates a bend in the delivery wire. The sensor measures the change in the position of the bent wire depending on the insertion force and translates it into a force value. Using this, embolization was performed for 10 unruptured intracranial aneurysms. The sensor adequately recorded the force, and it reflected the operators' usual clinical experience. The presence of the sensor did not affect the procedures. The sensor enabled the operators to objectively note and evaluate the insertion force and better cooperative handling was possible. Additionally, other members of the intervention team shared the information. Force records demonstrated the characteristic patterns according to every stage of coiling (framing, filling, and finishing). The force sensor system adequately measured coil insertion force in intracranial aneurysm coil embolization procedures. The safety of this sensor was demonstrated in clinical application for the limited number of patients. This system is useful adjunct for assisting during coil embolization for an intracranial aneurysm. Copyright © 2017 Elsevier Inc. All rights reserved.
Naproxen Sodium for Pain Control With Intrauterine Device Insertion: A Randomized Controlled Trial.
Ngo, Lynn L; Braaten, Kari P; Eichen, Eva; Fortin, Jennifer; Maurer, Rie; Goldberg, Alisa B
2016-12-01
To evaluate whether 550 mg oral naproxen sodium given 1 hour before intrauterine device (IUD) insertion is effective for pain relief as compared with placebo. This was a randomized, double-blind, placebo-controlled trial. The primary outcome was pain with IUD insertion measured on a 100-mm visual analog scale (VAS). Our sample size was calculated to detect a 15-mm difference in VAS scores with 80% power (α=0.05). Secondary outcomes included pain with tenaculum placement, uterine sounding, and 5 and 15 minutes postinsertion. A total of 118 women were enrolled and analyzed (58 in the naproxen sodium arm, 60 in the placebo arm, 97% nulliparous) between May 11, 2015, and March 25, 2016. There were no differences in baseline demographics or reproductive characteristics between arms. There were no differences in median VAS pain scores for the primary outcome of pain with IUD insertion between the naproxen sodium arm compared with the placebo arm (69 compared with 66 mm, P=.89). There were no differences in the secondary outcomes of median VAS pain scores with tenaculum placement (37 compared with 32 mm, P=.97) or uterine sounding (60 compared with 58 mm, P=.66). However, median pain scores postprocedure were lower in the naproxen arm as compared with the placebo arm: 17 compared with 26 mm (P=.01) at 5 minutes and 13 compared with 24 mm (P=.01) at 15 minutes postinsertion. Oral naproxen sodium does not reduce pain with IUD insertion but does reduce pain after insertion and should be considered as a premedication. ClinicalTrials.gov, http://clinicaltrials.gov, NCT02388191.
Enhancers Are Major Targets for Murine Leukemia Virus Vector Integration
De Ravin, Suk See; Su, Ling; Theobald, Narda; Choi, Uimook; Macpherson, Janet L.; Poidinger, Michael; Symonds, Geoff; Pond, Susan M.; Ferris, Andrea L.; Hughes, Stephen H.
2014-01-01
ABSTRACT Retroviral vectors have been used in successful gene therapies. However, in some patients, insertional mutagenesis led to leukemia or myelodysplasia. Both the strong promoter/enhancer elements in the long terminal repeats (LTRs) of murine leukemia virus (MLV)-based vectors and the vector-specific integration site preferences played an important role in these adverse clinical events. MLV integration is known to prefer regions in or near transcription start sites (TSS). Recently, BET family proteins were shown to be the major cellular proteins responsible for targeting MLV integration. Although MLV integration sites are significantly enriched at TSS, only a small fraction of the MLV integration sites (<15%) occur in this region. To resolve this apparent discrepancy, we created a high-resolution genome-wide integration map of more than one million integration sites from CD34+ hematopoietic stem cells transduced with a clinically relevant MLV-based vector. The integration sites form ∼60,000 tight clusters. These clusters comprise ∼1.9% of the genome. The vast majority (87%) of the integration sites are located within histone H3K4me1 islands, a hallmark of enhancers. The majority of these clusters also have H3K27ac histone modifications, which mark active enhancers. The enhancers of some oncogenes, including LMO2, are highly preferred targets for integration without in vivo selection. IMPORTANCE We show that active enhancer regions are the major targets for MLV integration; this means that MLV preferentially integrates in regions that are favorable for viral gene expression in a variety of cell types. The results provide insights for MLV integration target site selection and also explain the high risk of insertional mutagenesis that is associated with gene therapy trials using MLV vectors. PMID:24501411
NASA Astrophysics Data System (ADS)
Wang, Liang; Shen, Bin; Sun, Fanghong; Zhang, Zhiming
2014-04-01
Boron doped (B-doped) diamond films are deposited onto WC-Co inserts by HFCVD with the mixture of acetone, trimethyl borate (C3H9BO3) and H2. The as-deposited B-doped diamond films are characterized with scanning electron microscope (SEM), X-ray diffraction (XRD) spectroscopy, Raman spectroscopy, 3D surface topography based on white-light interferometry and Rockwell hardness tester. The effects of mechanical polishing on the friction behavior and cutting performance of B-doped diamond are evaluated by ball-on-plate type reciprocating tribometer and turning of aluminum alloy 7075 materials, respectively. For comparison, the same tests are also conducted for the bare WC-Co inserts with smooth surface. Friction tests suggest that the unpolished and polished B-doped diamond films possess relatively low fluctuation of friction coefficient than as-received bare WC-Co samples. The average stable friction coefficient for B-doped diamond films decreases apparently after mechanical polishing. The values for WC-Co sample, unpolished and polished B-doped diamond films are approximately 0.38, 0.25 and 0.11, respectively. The cutting results demonstrate that the low friction coefficient and high adhesive strength of B-doped diamond films play an essential role in the cutting performance enhancement of the WC-Co inserts. However, the mechanical polishing process may lower the adhesive strength of B-doped diamond films. Consequently, the polished B-doped diamond coated inserts show premature wear in the machining of adhesive aluminum alloy materials.
Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A
1990-01-01
Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322
Hampson, Robert E.; Song, Dong; Chan, Rosa H.M.; Sweatt, Andrew J.; Riley, Mitchell R.; Goonawardena, Anushka V.; Marmarelis, Vasilis Z.; Gerhardt, Greg A.; Berger, Theodore W.; Deadwyler, Sam A.
2012-01-01
A major factor involved in providing closed loop feedback for control of neural function is to understand how neural ensembles encode online information critical to the final behavioral endpoint. This issue was directly assessed in rats performing a short-term delay memory task in which successful encoding of task information is dependent upon specific spatiotemporal firing patterns recorded from ensembles of CA3 and CA1 hippocampal neurons. Such patterns, extracted by a specially designed nonlinear multi-input multi-output (MIMO) nonlinear mathematical model, were used to predict successful performance online via a closed loop paradigm which regulated trial difficulty (time of retention) as a function of the “strength” of stimulus encoding. The significance of the MIMO model as a neural prosthesis has been demonstrated by substituting trains of electrical stimulation pulses to mimic these same ensemble firing patterns. This feature was used repeatedly to vary “normal” encoding as a means of understanding how neural ensembles can be “tuned” to mimic the inherent process of selecting codes of different strength and functional specificity. The capacity to enhance and tune hippocampal encoding via MIMO model detection and insertion of critical ensemble firing patterns shown here provides the basis for possible extension to other disrupted brain circuitry. PMID:22498704
On the origin of the 1-hour pulsations in the Saturn's magnetosphere
NASA Astrophysics Data System (ADS)
Rusaitis, L.; Walker, R. J.; Khurana, K. K.; Kivelson, M.
2016-12-01
The quasi-periodic pulsations of approximately 1-hour periodicity in the magnetic field and particle fluxes have been regularly detected in the outer Saturnian magnetosphere by the Cassini spacecraft since the orbital insertion in 2004 [Palmaerts, 2016; Roussos, 2016]. In this study we focus on the Cassini's magnetometer (MAG) and the Cassini Plasma Spectrometer (CAPS) data from the July 1st, 2004 to June 4th, 2012 (when the CAPS instrument was turned off). Throughout this 8-year period we find over 130 pulsation events in the MAG data, ranging in periodicity from 40 to 90 minutes, and having a typical amplitude of 0.5-1nT in the transverse (φ ) direction. The pulsations typically last 4-6 hours before decaying, and occur both in the dawn and dusk sectors during the crossings of the outer magnetosphere. We study the pulsations in the azimuthal magnetic field as signatures for the periodic enhancements detected in the CAPS data in the plasma temperature and densities. Additionally, we investigate a high temporal resolution 3-D MHD simulation of Saturn's magnetosphere to look for the signatures of these pulsations at the equivalent positions, and use the simulation results to suggest their physical origin and the triggering mechanism by varying the solar wind parameters.
NASA Astrophysics Data System (ADS)
Ismail, Raid A.; Khashan, Khawla S.; Jawad, Muslim F.; Mousa, Ali M.; Mahdi, Farah
2018-05-01
In this study, low cost ZnO/Si and ZnO/MgO/Si heterojunction (HJ) photodetectors were fabricated using laser ablation and spray Pyrolysis techniques. MgO nanofibers were synthesized by laser ablation of Mg target in distilled water. Also; the ZnO films were prepared by spray pyrolysis technique. The optical and structural properties of nanostructured MgO were investigated using XRD, SEM and FT-IR. The XRD results showed that the MgO was polycrystalline with cubic structure. SEM investigation confirmed the formation of MgO nanofibers and sub-microparticles. The optical energy gaps of MgO and ZnO were calculated and found to be 5.7 eV and 3.3 eV, respectively. For the electrical properties; responsivity, quantum efficiency, specific detectivity, and speed of response of the photodetector were measured and found to enhance after the insertion of nanostructured MgO film. The Photoresponse results at 3 V reverse bias showed that the maximum responsivity of ZnO/Si and ZnO/MgO/Si photodetectors were 185 and 331 mAW‑1 at 500 nm, respectively. The specific detectivity of ZnO/MgO/Si Photodetector was higher than that of ZnO/Si.
Santamaría-Hernando, Saray; Krell, Tino; Ramos-González, María-Isabel
2012-01-01
Proteins of the animal heme peroxidase (ANP) superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20), where it was found to be involved in Ca(2+) coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+) binding with a K(D) of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821) is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of life.
Large exon size does not limit splicing in vivo.
Chen, I T; Chasin, L A
1994-03-01
Exon sizes in vertebrate genes are, with a few exceptions, limited to less than 300 bases. It has been proposed that this limitation may derive from the exon definition model of splice site recognition. In this model, a downstream donor site enhances splicing at the upstream acceptor site of the same exon. This enhancement may require contact between factors bound to each end of the exon; an exon size limitation would promote such contact. To test the idea that proximity was required for exon definition, we inserted random DNA fragments from Escherichia coli into a central exon in a three-exon dihydrofolate reductase minigene and tested whether the expanded exons were efficiently spliced. DNA from a plasmid library of expanded minigenes was used to transfect a CHO cell deletion mutant lacking the dhfr locus. PCR analysis of DNA isolated from the pooled stable cotransfectant populations displayed a range of DNA insert sizes from 50 to 1,500 nucleotides. A parallel analysis of the RNA from this population by reverse transcription followed by PCR showed a similar size distribution. Central exons as large as 1,400 bases could be spliced into mRNA. We also tested individual plasmid clones containing exon inserts of defined sizes. The largest exon included in mRNA was 1,200 bases in length, well above the 300-base limit implied by the survey of naturally occurring exons. We conclude that a limitation in exon size is not part of the exon definition mechanism.
Kato-Inui, Tomoko; Takahashi, Gou; Hsu, Szuyin; Miyaoka, Yuichiro
2018-05-18
Genome editing using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) predominantly induces non-homologous end joining (NHEJ), which generates random insertions or deletions, whereas homology-directed repair (HDR), which generates precise recombination products, is useful for wider applications. However, the factors that determine the ratio of HDR to NHEJ products after CRISPR/Cas9 editing remain unclear, and methods by which the proportion of HDR products can be increased have not yet been fully established. We systematically analyzed the HDR and NHEJ products after genome editing using various modified guide RNAs (gRNAs) and Cas9 variants with an enhanced conformational checkpoint to improve the fidelity at endogenous gene loci in HEK293T cells and HeLa cells. We found that these modified gRNAs and Cas9 variants were able to enhance HDR in both single-nucleotide substitutions and a multi-kb DNA fragment insertion. Our results suggest that the original CRISPR/Cas9 system from the bacterial immune system is not necessarily the best option for the induction of HDR in genome editing and indicate that the modulation of the kinetics of conformational checkpoints of Cas9 can optimize the HDR/NHEJ ratio.
Experimental Evaluation of a SiPM-Based Scintillation Detector for MR-Compatible SPECT Systems
NASA Astrophysics Data System (ADS)
Busca, Paolo; Occhipinti, Michele; Trigilio, Paolo; Cozzi, Giulia; Fiorini, Carlo; Piemonte, Claudio; Ferri, Alessandro; Gola, Alberto; Nagy, Kálmán; Bükki, Tamás; Rieger, Jan
2015-10-01
In the present work we briefly describe the architecture of a photo-detection module, designed in the framework of the INSERT (INtegrated SPECT/MRI for Enhanced Stratification in Radio-chemoTherapy) project, supported by the European Community. We focus on two main elements of the module: the SiPM photo-detector unit and the multi-channel ASIC. These two components have been investigated with dedicated and independent setups to assess preliminary performance of INSERT architecture. In details, we designed a 25.30 mm ×25.85 mm tile, comprising 9 pixels, each one with an 8 mm ×8 mm active area. We developed an Anger camera to characterize the tile coupled to a CsI:Tl scintillator (6 mm thick). We measured an average spatial resolution (FWHM) of 2 mm in the central region of the Field of View and a 15.3% energy resolution using a 57Co source (122 keV), when the tile is cooled down to 0 ° C to reduce the impact of the dark count rate. Furthermore, we developed ANGUS, a 36-channels 0.35 μm CMOS technology ASIC designed to cope with input capacitance up to 5 nF, typical of large area SiPM pixels. The spectroscopic capability of single readout channels were evaluated by coupling an 8 mm ×8 mm pixel with a cylindrical CsI:Tl scintillator (8 mm diameter, 10 mm thickness). Energy resolution at room temperature provided values between 13% and 13.5% (FWHM) at the 122 keV line for the nine pixels.
Trochantoplasty for Total Hip Arthroplasty in Patients With Coxa Vara Deformity.
Yoo, Jun-Il; Parvizi, Javad; Song, Ji-Ung; Ha, Yong-Chan; Lee, Young-Kyun; Koo, Kyung-Hoi
2017-07-01
In total hip arthroplasty (THA) of hips with coxa vara, the femoral stems might be inserted in a varus alignment. To avoid varus insertion, we designed a technique, which we termed "trochantoplasty." In this procedure, the medial half of the greater trochanter was removed during THA. We evaluated 30 patients (31 hips) who had coxa vara deformity and underwent THA using trochantoplasty at the mean follow-up of 5 years (range, 3-9 years). All stems were inserted in the neutral position. One Vancouver type 1 periprosthetic femoral fracture occurred after a fall at postoperative 2 months. At the latest follow-up, the mean power of abductor was 4.3 (range, 3-5). Four patients had moderate limp whereas 26 patients had slight limp. The abduction at 90° flexion ranged from 15° to 45° (mean, 35°). There was no revision. All prostheses had bone-ingrown stability without any detectable wear or osteolysis. The mean Harris hip score was improved from 66.9 to 89.4 points. Trochantoplasty can be used to avoid varus insertion of the femoral stem while performing THA in patients with coxa vara deformity without compromising the abductor mechanism. Copyright © 2017 Elsevier Inc. All rights reserved.
Mobile element biology – new possibilities with high-throughput sequencing
Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.
2014-01-01
Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846
CALIS—A CALibration Insertion System for the DarkSide-50 dark matter search experiment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Agnes, P.; Albuquerque, I. F. M.; Alexander, T.
This paper describes the design, fabrication, commissioning and use of a CALibration source Insertion System (CALIS) in the DarkSide-50 direct dark matter search experiment. CALIS deploys radioactive sources into the liquid scintillator veto to characterize the detector response and detection efficiency of the DarkSide-50 Liquid Argon Time Projection Chamber, and the surrounding 30 t organic liquid scintillator neutron veto. It was commissioned in September 2014 and has been used successfully in several gamma and neutron source campaigns since then. A description of the hardware and an excerpt of calibration analysis results are given below.
CALIS—A CALibration Insertion System for the DarkSide-50 dark matter search experiment
NASA Astrophysics Data System (ADS)
Agnes, P.; Albuquerque, I. F. M.; Alexander, T.; Alton, A. K.; Asner, D. M.; Back, H. O.; Baldin, B.; Biery, K.; Bocci, V.; Bonfini, G.; Bonivento, W.; Bossa, M.; Bottino, B.; Brigatti, A.; Brodsky, J.; Budano, F.; Bussino, S.; Cadeddu, M.; Cadonati, L.; Cadoni, M.; Calaprice, F.; Canci, N.; Candela, A.; Caravati, M.; Cariello, M.; Carlini, M.; Catalanotti, S.; Cavalcante, P.; Chepurnov, A.; Cicalò, C.; Cocco, A. G.; Covone, G.; D'Angelo, D.; D'Incecco, M.; Davini, S.; De Cecco, S.; De Deo, M.; De Vincenzi, M.; Derbin, A.; Devoto, A.; Di Eusanio, F.; Di Pietro, G.; Dionisi, C.; Edkins, E.; Empl, A.; Fan, A.; Fiorillo, G.; Fomenko, K.; Forster, G.; Franco, D.; Gabriele, F.; Galbiati, C.; Giagu, S.; Giganti, C.; Giovanetti, G. K.; Goretti, A. M.; Granato, F.; Grandi, L.; Gromov, M.; Guan, M.; Guardincerri, Y.; Hackett, B. R.; Herner, K.; Hughes, D.; Humble, P.; Hungerford, E. V.; Ianni, Al.; Ianni, An.; James, I.; Johnson, T. N.; Jollet, C.; Keeter, K.; Kendziora, C. L.; Koh, G.; Korablev, D.; Korga, G.; Kubankin, A.; Li, X.; Lissia, M.; Loer, B.; Lombardi, P.; Longo, G.; Ma, Y.; Machado, A. A.; Machulin, I. N.; Mandarano, A.; Mari, S. M.; Maricic, J.; Marini, L.; Martoff, C. J.; Meregaglia, A.; Meyers, P. D.; Milincic, R.; Miller, J. D.; Montanari, D.; Monte, A.; Mount, B. J.; Muratova, V. N.; Musico, P.; Napolitano, J.; Navrer Agasson, A.; Odrowski, S.; Orsini, M.; Ortica, F.; Pagani, L.; Pallavicini, M.; Pantic, E.; Parmeggiano, S.; Pelczar, K.; Pelliccia, N.; Pocar, A.; Pordes, S.; Pugachev, D. A.; Qian, H.; Randle, K.; Ranucci, G.; Razeti, M.; Razeto, A.; Reinhold, B.; Renshaw, A. L.; Rescigno, M.; Riffard, Q.; Romani, A.; Rossi, B.; Rossi, N.; Rountree, D.; Sablone, D.; Saggese, P.; Saldanha, R.; Sands, W.; Savarese, C.; Schlitzer, B.; Segreto, E.; Semenov, D. A.; Shields, E.; Singh, P. N.; Skorokhvatov, M. D.; Smirnov, O.; Sotnikov, A.; Stanford, C.; Suvorov, Y.; Tartaglia, R.; Tatarowicz, J.; Testera, G.; Tonazzo, A.; Trinchese, P.; Unzhakov, E. V.; Verducci, M.; Vishneva, A.; Vogelaar, B.; Wada, M.; Walker, S.; Wang, H.; Wang, Y.; Watson, A. W.; Westerdale, S.; Wilhelmi, J.; Wojcik, M. M.; Xiang, Xi.; Xiao, X.; Xu, J.; Yang, C.; Zec, A.; Zhong, W.; Zhu, C.; Zuzel, G.
2017-12-01
This paper describes the design, fabrication, commissioning and use of a CALibration source Insertion System (CALIS) in the DarkSide-50 direct dark matter search experiment. CALIS deploys radioactive sources into the liquid scintillator veto to characterize the detector response and detection efficiency of the DarkSide-50 Liquid Argon Time Projection Chamber, and the surrounding 30 t organic liquid scintillator neutron veto. It was commissioned in September 2014 and has been used successfully in several gamma and neutron source campaigns since then. A description of the hardware and an excerpt of calibration analysis results are given below.
CALIS—A CALibration Insertion System for the DarkSide-50 dark matter search experiment
Agnes, P.; Albuquerque, I. F. M.; Alexander, T.; ...
2017-12-18
This paper describes the design, fabrication, commissioning and use of a CALibration source Insertion System (CALIS) in the DarkSide-50 direct dark matter search experiment. CALIS deploys radioactive sources into the liquid scintillator veto to characterize the detector response and detection efficiency of the DarkSide-50 Liquid Argon Time Projection Chamber, and the surrounding 30 t organic liquid scintillator neutron veto. It was commissioned in September 2014 and has been used successfully in several gamma and neutron source campaigns since then. A description of the hardware and an excerpt of calibration analysis results are given below.
Safer laparoscopic trocar entry: it's all about pressure.
Tsaltas, Jim; Pearce, Scott; Lawrence, Anthony; Meads, Alan; Mezzatesta, Joseph; Nicolson, Scott
2004-08-01
This prospective observational study aimed to assess the feasibility of adapting peritoneal hyperdistention to 25 mmHg during laparoscopy in an Australian hospital environment. A total of 1150 consecutive diagnostic or operative laparoscopies were performed. All cases were monitored for early detection of untoward physiological changes. All patients had Veress needle insufflation with distension to 25 mmHg prior to insertion of the primary trocar. No patients experienced any surgical entry complications or adverse clinical effects noted during anaesthetic. The aim of the current study is to assess the feasibility and safety of increasing the peritoneal insufflation pressure to 25 mmHg for primary trocar insertion.
Wang, Hsin-Yi; Chen, Han-Yi; Hsu, Ying-Ya; Stimming, Ulrich; Chen, Hao Ming; Liu, Bin
2016-10-26
We report that an ultrafast kinetics of reversible metal-ion insertion can be realized in anatase titanium dioxide (TiO 2 ). Niobium ions (Nb 5+ ) were carefully chosen to dope and drive anatase TiO 2 into very thin nanosheets standing perpendicularly onto transparent conductive electrode (TCE) and simultaneously construct TiO 2 with an ion-conducting surface together with expanded ion diffusion channels, which enabled ultrafast metal ions to diffuse across the electrolyte/solid interface and into the bulk of TiO 2 . To demonstrate the superior metal-ion insertion rate, the electrochromic features induced by ion intercalation were examined, which exhibited the best color switching speed of 4.82 s for coloration and 0.91 s for bleaching among all reported nanosized TiO 2 devices. When performed as the anode for the secondary battery, the modified TiO 2 was capable to deliver a highly reversible capacity of 61.2 mAh/g at an ultrahigh specific current rate of 60 C (10.2 A/g). This fast metal-ion insertion behavior was systematically investigated by the well-controlled electrochemical approaches, which quantitatively revealed both the enhanced surface kinetics and bulk ion diffusion rate. Our study could provide a facile methodology to modulate the ion diffusion kinetics for metal oxides.
Germline transformation of the western corn rootworm, Diabrotica virgifera virgifera.
Chu, F; Klobasa, W; Wu, P; Pinzi, S; Grubbs, N; Gorski, S; Cardoza, Y; Lorenzen, M D
2017-08-01
The western corn rootworm (WCR), a major pest of maize, is notorious for rapidly adapting biochemically, behaviourally and developmentally to a variety of control methods. Despite much effort, the genetic basis of WCR adaptation remains a mystery. Since transformation-based applications such as transposon tagging and enhancer trapping have facilitated genetic dissection of model species such as Drosophila melanogaster, we developed a germline-transformation system for WCR in an effort to gain a greater understanding of the basic biology of this economically important insect. Here we report the use of a fluorescent-marked Minos element to create transgenic WCR. We demonstrate that the transgenic strains express both an eye-specific fluorescent marker and piggyBac transposase. We identified insertion-site junction sequences via inverse PCR and assessed insertion copy number using digital droplet PCR (ddPCR). Interestingly, most WCR identified as transgenic via visual screening for DsRed fluorescence proved to carry multiple Minos insertions when tested via ddPCR. A total of eight unique insertion strains were created by outcrossing the initial transgenic strains to nontransgenic WCR mates. Establishing transgenic technologies for this beetle is the first step towards bringing a wide range of transformation-based tools to bear on understanding WCR biology. © 2017 The Royal Entomological Society.
Use of mini dental implants in ectodermal dysplasia children: follow-up of three cases.
Sfeir, E; Nassif, N; Moukarzel, C
2014-07-01
Ectodermal dysplasia is a hereditary genodermatosis characterised by a congenital defect of ectodermal structures, causing tooth malformations and anomalies. Implantology has become accepted in these subjects. However cases are often complicated by a reduction in the size of the alveolar process, making the insertion of conventional implants difficult without bone grafting. The reduced diameter of mini-implants and their ease of insertion provide an interesting solution in supporting removable or fixed prosthesis. The purpose of this paper is to report the follow-up of three cases of children (11-12 year- old) with ectodermal dysplasia in which mini-implants were used to support the prostheses. In the first case, two mini-implants were inserted into the anterior part of the mandible for stabilising a removable denture (2 years follow-up). In the other two cases, mini- implants were inserted in the maxilla and mandible to replace missing front teeth with fixed prostheses. Patients were called for follow- up every 6 months: in the sencod case follow-up lasted 4 years in the mandible and 2 years in the maxilla; in the third case, 2 years in the maxilla and 1 year in the mandible. The use of mini-implants in children with ectodermal dysplasia can enhance aesthetics, and functional and psychosocial development.
Acharya, Priyamvada; Luongo, Timothy; Louder, Mark K.; McKee, Krisha; Yang, Yongping; Kwon, Young Do; Mascola, John R.; Kessler, Pascal; Martin, Loïc; Kwong, Peter D.
2014-01-01
The interface between HIV-1 gp120 envelope glycoprotein and CD4 receptor contains an unusual interfacial cavity, the “Phe43 cavity”, which miniprotein mimetics of CD4 with non-natural extensions can potentially utilize to enhance their neutralization of HIV-1. Here we report co-crystal structures of HIV-1 gp120 with miniproteins M48U1 and M48U7, which insert cyclohexylmethoxy and 5-hydroxypentylmethoxy extensions, respectively, into the Phe43 cavity. Both inserts displayed flexibility and hydrophobic interactions, but the M48U1 insert showed better shape complementarity with the Phe43 cavity than the M48U7 insert. Subtle alteration in gp120 conformation played a substantial role in optimizing fit. With M48U1, these translated into a YU2-gp120 affinity of 0.015 nM and neutralization of all 180-circulating HIV-1 strains tested, except clade-A/E isolates with non-canonical Phe43 cavities. Ligand chemistry, shape complementary, surface burial, and gp120 conformation act in concert to modulate binding of ligands to the gp120-Phe43 cavity and, when optimized, can effect near pan-neutralization of HIV-1. PMID:23707685
Optimizing the Synthesis of Alumina Inserts Using Hot Isostatic Pressing (HIP)
NASA Astrophysics Data System (ADS)
Ariff, T. F.; Azhar, A. Z.; Sariff, M. N.; Rasid, S. N.; Zahari, S. Z.; Bahar, R.; Karim, M.; Nurul Amin, AKM
2018-01-01
Alumina or Aluminium Oxide (Al2O3) is well known for its high strength and hardness. Its low heat retention and low specific heat characteristics make it attractive to be used widely as a cutting tool for grinding, milling and turning processes. Various synthesis methods have been used for the purpose of enhancing the properties of the alumina inserts. However, the optimization process using Hot Isostatic Pressing (HIP) has not been performed. This research aims in finding the optimum parameters in synthesizing the alumina inserts (98Al2O3 1.6ZrO2 0.4MgO, 93Al2O3 6.4ZrO2 0.6MgO and 85Al2O3 14.5ZrO2 0.5MgO) using HIP at different temperatures (1200, 1250 and 1300°C) and sintering time (10, 30 and 60 minutes). Hardness, density, shrinkage and microstructure using SEM were analysed. The optimum sintering condition for the alumina insert was found in 98Al2O3 1.6ZrO2 0.4MgO sintered at 1300°C for 60 minutes for it exhibited the highest values of hardness (1917HV), density (3.95g/cm3), shrinkage (9.6%).
Smartphones and e-tablets in perioperative medicine
2017-01-01
Smartphones and electronic tablets (e-tablets) have become ubiquitous devices. Their ease of use, smartness, accessibility, mobility and connectivity create unique opportunities to improve quality of surgical care from prehabilitation to rehabilitation. Before surgery, digital applications (Apps), serious games and text messaging may help for a better control of risk factors (hypertension, overweight), for smoking cessation, and for optimizing adherence to preoperative recommendations (e.g., regarding anticoagulation or antihypertensive treatments). During surgery, Apps may help to rationalize fluid management and estimate blood loss. After surgery, smartphones and/or connected sensors (pulse oximeter, adhesive path, electronic tattoo, bioimpedance necklace) can be used to monitor body temperature, heart rate, heart rate variability (detection of cardiac arrhythmia), respiratory rate, arterial oxygen saturation and thoracic fluid content. Therefore, these tools have potential for the early detection of infectious, cardiac and respiratory complications in the wards and from home. When connected to echo probes, smartphones and e-tablets can also be used as ultrasound devices during central venous catheter insertion, for peripheral nerve blocks, and to perform echocardiography in patients developing cardiac complications. Finally, electronic checklists now exist as Apps to enhance communication between patients and healthcare professionals, and to track and record step by step each element of the surgical journey. Studies are now urgently needed to investigate whether this digital revolution can translate into a better outcome, an earlier detection of postoperative complications, a decrease in hospital readmissions and in health care costs. PMID:29046768
Fluorophore Labeled Kinase Detects Ligands That Bind within the MAPK Insert of p38α Kinase
Termathe, Martin; Grütter, Christian; Rabiller, Matthias; van Otterlo, Willem A. L.; Rauh, Daniel
2012-01-01
The vast majority of small molecules known to modulate kinase activity, target the highly conserved ATP-pocket. Consequently, such ligands are often less specific and in case of inhibitors, this leads to the inhibition of multiple kinases. Thus, selective modulation of kinase function remains a major hurdle. One of the next great challenges in kinase research is the identification of ligands which bind to less conserved sites and target the non-catalytic functions of protein kinases. However, approaches that allow for the unambiguous identification of molecules that bind to these less conserved sites are few in number. We have previously reported the use of fluorescent labels in kinases (FLiK) to develop direct kinase binding assays that exclusively detect ligands which stabilize inactive (DFG-out) kinase conformations. Here, we present the successful application of the FLiK approach to develop a high-throughput binding assay capable of directly monitoring ligand binding to a remote site within the MAPK insert of p38α mitogen-activated protein kinase (MAPK). Guided by the crystal structure of an initially identified hit molecule in complex with p38α, we developed a tight binding ligand which may serve as an ideal starting point for further investigations of the biological function of the MAPK insert in regulating the p38α signaling pathway. PMID:22768308
Liu, Yuchun; Xu, Ling; Zhao, Chen; Shao, Ming; Hu, Bin
2017-06-07
Fullerene (C 60 ) is an important n-type organic semiconductor with high electron mobility and low thermal conductivity. In this work, we report the experimental results on the tunable Seebeck effect of C 60 hybrid thin-film devices by adopting different oxide layers. After inserting n-type high-dielectric constant titanium oxide (TiO x ) and zinc oxide (ZnO) layers, we observed a significantly enhanced n-type Seebeck effect in oxide/C 60 hybrid devices with Seebeck coefficients of -5.8 mV K -1 for TiO x /C 60 and -2.08 mV K -1 for ZnO/C 60 devices at 100 °C, compared with the value of -400 μV K -1 for the pristine C 60 device. However, when a p-type nickel oxide (NiO) layer is inserted, the C 60 hybrid devices show a p-type to n-type Seebeck effect transition when the temperature increases. The remarkable Seebeck effect and change in Seebeck coefficient in different oxide/C 60 hybrid devices can be attributed to two reasons: the temperature-dependent surface polarization difference and thermally-dependent interface dipoles. Firstly, the surface polarization difference due to temperature-dependent electron-phonon coupling can be enhanced by inserting an oxide layer and functions as an additional driving force for the Seebeck effect development. Secondly, thermally-dependent interface dipoles formed at the electrode/oxide interface play an important role in modifying the density of interface states and affecting the charge diffusion in hybrid devices. The surface polarization difference and interface dipoles function in the same direction in hybrid devices with TiO x and ZnO dielectric layers, leading to enhanced n-type Seebeck effect, while the surface polarization difference and interface dipoles generate the opposite impact on electron diffusion in ITO/NiO/C 60 /Al, leading to a p-type to n-type transition in the Seebeck effect. Therefore, inserting different oxide layers could effectively modulate the Seebeck effect of C 60 -based hybrid devices through the surface polarization difference and thermally-dependent interface dipoles, which represents an effective approach to tune the vertical Seebeck effect in organic functional devices.
Li, Yuliang; Yu, Chao; Yang, Bo; Liu, Zhirui; Xia, Peiyuan; Wang, Qian
2018-04-15
Herein, a new type of multifunctional iron based metal-organic frameworks (PdNPs@Fe-MOFs) has been synthesized by assembly palladium nanoparticles on the surface of Fe-MIL-88NH 2 MOFs microcrystals, and first applied in electrochemical biosensor for ultrasensitive detection of microRNA-122 (miR-122, a biomarker of drug-induced liver injury). The nanohybrids have not only been utilized as ideal nanocarriers for immobilization of signal probes, but also used as redox probes and electrocatalysts. In this biosensor, two hairpin probes were designed as capture probes and signal probes, respectively. The nanohybrids conjugated with streptavidin and biotinylated signal probes were used as the tracer labels, target miR-122 was sandwiched between the tracer labels and thiol-terminated capture probes inserted in MCH monolayer on the gold nanoparticles-functionalized nitrogen-doped graphene sheets (AuNPs@N-G) modified electrode. Based on target-catalyzed hairpin assembly, target miR-122 could trigger the hybridization of capture probes and signal probes to further be released to initiate the next reaction process resulted in numerous tracer indicators anchored onto the sensing interfaces. Thus, the detection signal could be dramatically enhanced towards the electrocatalytic oxidation of 3,3',5,5'-tetramethylbenzidine in the presence of H 2 O 2 owing to the intrinsic and intriguing peroxidase-like activity of the nanohybrids. With the assist of target-catalyzed hairpin assembly and PdNPs@Fe-MOFs mimetic co-reaction for signal amplification, a wide detection range from 0.01fM to 10pM was achieved with a low detection limit of 0.003fM (S/N =3). Furthermore, the proposed biosensor exhibited excellent specificity and recovery in spiked serum samples, and was successfully used for detecting miR-122 in real biological samples, which provided a rapid and efficient method for detecting drug-induced liver injury at an early stage. Copyright © 2017. Published by Elsevier B.V.
Dong, Guo-Chung; Chiu, Li-Chen; Ting, Chien-Kun; Hsu, Jia-Ruei; Huang, Chih-Chung; Chang, Yin; Chen, Gin-Shin
2017-09-01
Ultrasound guidance for epidural block has improved clinical blind-trial problems but the design of present ultrasonic probes poses operating difficulty of ultrasound-guided catheterization, increasing the failure rate. The purpose of this study was to develop a novel ultrasonic probe to avoid needle contact with vertebral bone during epidural catheterization. The probe has a central circular passage for needle insertion. Two focused annular transducers are deployed around the passage for on-axis guidance. A 17-gauge insulated Tuohy needle containing the self-developed fiber-optic-modified stylet was inserted into the back of the anesthetized pig, in the lumbar region under the guidance of our ultrasonic probe. The inner transducer of the probe detected the shallow echo signals of the peak-peak amplitude of 2.8 V over L3 at the depth of 2.4 cm, and the amplitude was decreased to 0.8 V directly over the L3 to L4 interspace. The outer transducer could detect the echoes from the deeper bone at the depth of 4.5 cm, which did not appear for the inner transducer. The operator tilted the probe slightly in left-right and cranial-caudal directions until the echoes at the depth of 4.5 cm disappeared, and the epidural needle was inserted through the central passage of the probe. The needle was advanced and stopped when the epidural space was identified by optical technique. The needle passed without bone contact. Designs of the hollow probe for needle pass and dual transducers with different focal lengths for detection of shallow and deep vertebrae may benefit operation, bone/nonbone identification, and cost.
NASA Astrophysics Data System (ADS)
Zhang, Rongxiao; Jee, Kyung-Wook; Cascio, Ethan; Sharp, Gregory C.; Flanz, Jacob B.; Lu, Hsiao-Ming
2018-01-01
Proton radiography, which images patients with the same type of particles as those with which they are to be treated, is a promising approach to image guidance and water equivalent path length (WEPL) verification in proton radiation therapy. We have shown recently that proton radiographs could be obtained by measuring time-resolved dose rate functions (DRFs) using an x-ray amorphous silicon flat panel. The WEPL values were derived solely from the root-mean-square (RMS) of DRFs, while the intensity information in the DRFs was filtered out. In this work, we explored the use of such intensity information for potential improvement in WEPL accuracy and imaging quality. Three WEPL derivation methods based on, respectively, the RMS only, the intensity only, and the intensity-weighted RMS were tested and compared in terms of the quality of obtained radiograph images and the accuracy of WEPL values. A Gammex CT calibration phantom containing inserts made of various tissue substitute materials with independently measured relative stopping powers (RSP) was used to assess the imaging performances. Improved image quality with enhanced interfaces was achieved while preserving the accuracy by using intensity information in the calibration. Other objects, including an anthropomorphic head phantom, a proton therapy range compensator, a frozen lamb’s head and an ‘image quality phantom’ were also imaged. Both the RMS only and the intensity-weighted RMS methods derived RSPs within ± 1% for most of the Gammex phantom inserts, with a mean absolute percentage error of 0.66% for all inserts. In the case of the insert with a titanium rod, the method based on RMS completely failed, whereas that based on the intensity-weighted RMS was qualitatively valid. The use of intensity greatly enhanced the interfaces between different materials in the obtained WEPL images, suggesting the potential for image guidance in areas such as patient positioning and tumor tracking by proton radiography.
2012-05-01
methods demonstrated that desorption into solvents suitable for subsequent chemical analysis (into acetonitrile for HPLC analysis or hexane for GC...SPME. Analysis by HPLC with EPA 8310 with fluorescent detection. a) surface water quality criteria (NRWQC) are given for comparison to detection... analysis ) or hexane (for PCB analysis ) was added to the inserts. The vials were then analyzed directly by HPLC (PAHs) or GC-ECD (PCBs). Fiber achieved
Huang, Jun; Rozwadowski, Kevin; Bhinu, V S; Schäfer, Ulrike; Hannoufa, Abdelali
2008-07-01
Sinapoylcholine (sinapine) is the most abundant antinutritional phenolic compound in cruciferous seeds. The quaternary ammonium compounds, choline, betaine and N,N-dimethylglycine, reside along a biosynthetic pathway linked to the synthesis of membrane phospholipids and neurotransmitters with various biological functions. In chicken, choline intake is required for optimal egg-laying performance and a choline supplement in diet is positively correlated with weight gains. A key step in sinapine biosynthesis is catalyzed by sinapoylglucose: choline sinapoyltransferase (SCT; EC 2.3.1.91) to form an ester linkage with sinapoylglucose and choline. The objective of this work was to reduce the sinapine content and simultaneously enhance free choline levels in cruciferous seeds. We report here the characterization of an Arabidopsis T-DNA insertion mutant lacking SCT activity in the seed. The sct mutant seeds contain less than 1% of sinapine and a more than 2-fold increase in free choline compared with wild type. We further expressed a choline oxidase (COX; EC 1.1.3.17) gene from Arthrobacter pascens in the Arabidopsis sct mutant and wild-type background using a napin gene promoter to convert free choline into betaine, an effective stress-alleviating compound in plants. Betaine was not detected in WT or sct mutant seeds. The sct+COX seeds contain nearly 2-fold greater levels of betaine relative to WT+COX seeds, demonstrating a positive correlation between endogenous choline and betaine production. In contrast, stable comparable levels of free choline were detected between sct+COX and WT+COX plants suggesting choline homeostasis likely prevent high levels of betaine production in the seed of transgenic COX plants.
Posttraumatic venous gas in the liver - a case report and review of the current literature.
Fahrner, René; Rauchfuss, Falk; Scheuerlein, Hubert; Settmacher, Utz
2018-03-02
There are numerous causes of hepatic gas formation that range from serious pathologies to incidental findings, including mesenteric infarction, liver abscess, inflammatory bowel disease or minimally invasive hepatic interventions. We report a case of a 50-year-old man who was admitted to the emergency room after a car accident. The clinical examination and further diagnostics revealed a craniocerebral injury with a fracture of the skull, concomitant soft tissue lesions and subarachnoidal bleeding. Furthermore, a blunt thoracic trauma with hemopneumothorax due to rib fractures was treated with a chest tube. No obvious abdominal pathology was seen. While in the operating theatre for the surgical revision of the cranial soft tissue lesions, a femoral venous catheter was inserted without any complications. A routine ultrasound of the abdomen six hours after the trauma revealed unclear hepatic gas formation. A contrast-enhanced computer tomography (CT) scan of the abdomen was performed, and the gas formation was found to be localized within the left hepatic vein. Afterwards, there was no specific treatment of the hepatic venous gas formation, as no alterations of liver function or liver enzymes were seen. The further course of the patient was uneventful regarding the gas formation in the liver, and another ultrasound two days later revealed no further gas in the liver. The placement of a femoral venous catheter is a risk factor for gas formation in liver veins. No further treatment is needed in cases with stable liver function. To rule out serious pathologies, diagnostic findings (e.g., ultrasound, CT), clinical history and underlying diseases need to be analyzed carefully after the detection of intrahepatic gas formation. With contrast-enhanced CT, the localization of the gas and its potential causes might be detectable.
Novel genetic tools for diaminopimelic acid selection in virulence studies of Yersinia pestis.
Bland, David M; Eisele, Nicholas A; Keleher, Lauren L; Anderson, Paul E; Anderson, Deborah M
2011-03-02
Molecular studies of bacterial virulence are enhanced by expression of recombinant DNA during infection to allow complementation of mutants and expression of reporter proteins in vivo. For highly pathogenic bacteria, such as Yersinia pestis, these studies are currently limited because deliberate introduction of antibiotic resistance is restricted to those few which are not human treatment options. In this work, we report the development of alternatives to antibiotics as tools for host-pathogen research during Yersinia pestis infections focusing on the diaminopimelic acid (DAP) pathway, a requirement for cell wall synthesis in eubacteria. We generated a mutation in the dapA-nlpB(dapX) operon of Yersinia pestis KIM D27 and CO92 which eliminated the expression of both genes. The resulting strains were auxotrophic for diaminopimelic acid and this phenotype was complemented in trans by expressing dapA in single and multi-copy. In vivo, we found that plasmids derived from the p15a replicon were cured without selection, while selection for DAP enhanced stability without detectable loss of any of the three resident virulence plasmids. The dapAX mutation rendered Y. pestis avirulent in mouse models of bubonic and septicemic plague which could be complemented when dapAX was inserted in single or multi-copy, restoring development of disease that was indistinguishable from the wild type parent strain. We further identified a high level, constitutive promoter in Y. pestis that could be used to drive expression of fluorescent reporters in dapAX strains that had minimal impact to virulence in mouse models while enabling sensitive detection of bacteria during infection. Thus, diaminopimelic acid selection for single or multi-copy genetic systems in Yersinia pestis offers an improved alternative to antibiotics for in vivo studies that causes minimal disruption to virulence.
Ma, Yuanmei; Duan, Yue; Wei, Yongwei; Liang, Xueya; Niewiesk, Stefan; Oglesbee, Michael
2014-01-01
ABSTRACT Human norovirus (NoV) accounts for 95% of nonbacterial gastroenteritis worldwide. Currently, there is no vaccine available to combat human NoV as it is not cultivable and lacks a small-animal model. Recently, we demonstrated that recombinant vesicular stomatitis virus (rVSV) expressing human NoV capsid protein (rVSV-VP1) induced strong immunities in mice (Y. Ma and J. Li, J. Virol. 85:2942–2952, 2011). To further improve the safety and efficacy of the vaccine candidate, heat shock protein 70 (HSP70) was inserted into the rVSV-VP1 backbone vector. A second construct was generated in which the firefly luciferase (Luc) gene was inserted in place of HSP70 as a control for the double insertion. The resultant recombinant viruses (rVSV-HSP70-VP1 and rVSV-Luc-VP1) were significantly more attenuated in cell culture and viral spread in mice than rVSV-VP1. At the inoculation dose of 1.0 × 106 PFU, rVSV-HSP70-VP1 triggered significantly higher vaginal IgA than rVSV-VP1 and significantly higher fecal and vaginal IgA responses than rVSV-Luc-VP1, although serum IgG and T cell responses were similar. At the inoculation dose of 5.0 × 106 PFU, rVSV-HSP70-VP1 stimulated significantly higher T cell, fecal, and vaginal IgA responses than rVSV-VP1. Fecal and vaginal IgA responses were also significantly increased when combined vaccination of rVSV-VP1 and rVSV-HSP70 was used. Collectively, these data indicate that (i) insertion of an additional gene (HSP70 or Luc) into the rVSV-VP1 backbone further attenuates the VSV-based vaccine in vitro and in vivo, thus improving the safety of the vaccine candidate, and (ii) HSP70 enhances the human NoV-specific mucosal and T cell immunities triggered by a VSV-based human NoV vaccine. IMPORTANCE Human norovirus (NoV) is responsible for more than 95% of acute nonbacterial gastroenteritis worldwide. Currently, there is no vaccine for this virus. Development of a live attenuated vaccine for human NoV has not been possible because it is uncultivable. Thus, a live vector-based vaccine may provide an alternative vaccine strategy. In this study, we developed a vesicular stomatitis virus (VSV)-based human NoV vaccine candidate. We constructed rVSV-HSP70-VP1, coexpressing heat shock protein (HSP70) and capsid (VP1) genes of human NoV, and rVSV-Luc-VP1, coexpressing firefly luciferase (Luc) and VP1 genes. We found that VSVs with a double gene insertion were significantly more attenuated than VSV with a single VP1 insertion (rVSV-VP1). Furthermore, we found that coexpression or coadministration of HSP70 from VSV vector significantly enhanced human NoV-specific mucosal immunity. Collectively, we developed an improved live vectored vaccine candidate for human NoV which will be useful for future clinical studies. PMID:24574391
ERIC Educational Resources Information Center
Boyne, Matthew
2013-01-01
Commercial flight operational safety has dramatically improved in the last 30 years because of enhanced crew coordination, communication, leadership and team development. Technology insertion into cockpit operations, however, has been shown to create crew distractions, resulting in flight safety risks, limited use given policy limitations and…
Introducing Mobile Technology in Graduate Professional Education
ERIC Educational Resources Information Center
Anand, Gopesh; Chhajed, Dilip; Hong, Seung Won; Scagnoli, Norma
2014-01-01
The insertion of mobile technology in educational settings is becoming more prevalent, making it important to understand the effectiveness of such technology in enhancing students' learning and engagement. This article is based on research conducted to study the effects of the use of mobile technology--specifically iPads--by students in a graduate…
NASA Astrophysics Data System (ADS)
Riggs, William R.
1994-05-01
SHARP is a Navy wide logistics technology development effort aimed at reducing the acquisition costs, support costs, and risks of military electronic weapon systems while increasing the performance capability, reliability, maintainability, and readiness of these systems. Lower life cycle costs for electronic hardware are achieved through technology transition, standardization, and reliability enhancement to improve system affordability and availability as well as enhancing fleet modernization. Advanced technology is transferred into the fleet through hardware specifications for weapon system building blocks of standard electronic modules, standard power systems, and standard electronic systems. The product lines are all defined with respect to their size, weight, I/O, environmental performance, and operational performance. This method of defining the standard is very conducive to inserting new technologies into systems using the standard hardware. This is the approach taken thus far in inserting photonic technologies into SHARP hardware. All of the efforts have been related to module packaging; i.e. interconnects, component packaging, and module developments. Fiber optic interconnects are discussed in this paper.
Wu, Min; Xin, Huolin L.; Wang, Jie; ...
2015-03-13
A nitrogen and sulfur co-doped graphene/carbon black (NSGCB) nanocomposite for the oxygen reduction reaction (ORR) was synthesized through a one-pot annealing of a precursor mixture containing graphene oxide, thiourea, and acidized carbon black (CB). The NSGCB showed excellent performance for the ORR with the onset and half-way potentials at 0.96 V and 0.81 V (vs. RHE), respectively. It is significantly improved over that of the catalysts derived from only graphene (0.90 V and 0.76 V) or carbon nanosphere (0.82 V and 0.74 V). The enhanced catalytic activity on the NSGCB electrode could be attributed to the synergistic effect of N/Smore » co-doping and the enlarged interlayer space resulted from the insertion of carbon nanosphere into the graphene sheets. The four-electron selectivity and the limiting current density of the NSGCB nanocomposite are comparable to that of the commercially Pt/C catalyst. Furthermore, the NSGCB nanocomposite was superior to Pt/C in terms of long-term durability and tolerance to methanol poisoning.« less
Zhang, Zi-Hui; Ju, Zhengang; Liu, Wei; Tan, Swee Tiam; Ji, Yun; Kyaw, Zabu; Zhang, Xueliang; Hasanov, Namig; Sun, Xiao Wei; Demir, Hilmi Volkan
2014-04-15
The p-type AlGaN electron blocking layer (EBL) is widely used in InGaN/GaN light-emitting diodes (LEDs) for electron overflow suppression. However, a typical EBL also reduces the hole injection efficiency, because holes have to climb over the energy barrier generated at the p-AlGaN/p-GaN interface before entering the quantum wells. In this work, to address this problem, we report the enhancement of hole injection efficiency by manipulating the hole transport mechanism through insertion of a thin GaN layer of 1 nm into the p-AlGaN EBL and propose an AlGaN/GaN/AlGaN-type EBL outperforming conventional AlGaN EBLs. Here, the position of the inserted thin GaN layer relative to the p-GaN region is found to be the key to enhancing the hole injection efficiency. InGaN/GaN LEDs with the proposed p-type AlGaN/GaN/AlGaN EBL have demonstrated substantially higher optical output power and external quantum efficiency.
Jakobsen, Thomas; Baas, Jørgen; Kold, Søren; Bechtold, Joan E.; Elmengaard, Brian; Søballe, Kjeld
2013-01-01
It has been shown that fixation of primary cementless joint replacement can independently be enhanced by either: (1) use of hydroxyapatite (HA) coated implants, (2) compaction of the peri-implant bone, or (3) local application of bisphosphonate. We investigated whether the combined effect ofHAcoating and bone compaction can be further enhanced with the use of local bisphosphonate treatment .HA-coated implants were bilaterally inserted into the proximal tibiae of 10 dogs. On one side local bisphosphonate was applied prior to bone compaction. Saline was used as control on the contralateral side. Implants were evaluated with histomorphometry and biomechanical pushout test. We found that bisphosphonate increased the peri-implant bone volume fraction (1.3-fold), maximum shear strength (2.1-fold), and maximum shear stiffness (2.7-fold). No significant difference was found in bone-to-implant contact or total energy absorption. This study indicates that local alendronate treatment can further improve the fixation of porous-coated implants that have also undergone HA-surface coating and peri-implant bone compaction. PMID:18752278
Identifying Depression in Students with Mental Retardation.
ERIC Educational Resources Information Center
Stough, Laura M.; Baker, Lynn
1999-01-01
Offers guidelines to teachers for identifying depression in students with mental retardation. Discusses prevalence and symptoms of depression, causes of depression, difficulty of diagnosis in students with mental retardation, detecting symptoms in the classroom, treatment of depression, and psychological services. Inserts list ideas for helping…
A semi-automatic computer-aided method for surgical template design
NASA Astrophysics Data System (ADS)
Chen, Xiaojun; Xu, Lu; Yang, Yue; Egger, Jan
2016-02-01
This paper presents a generalized integrated framework of semi-automatic surgical template design. Several algorithms were implemented including the mesh segmentation, offset surface generation, collision detection, ruled surface generation, etc., and a special software named TemDesigner was developed. With a simple user interface, a customized template can be semi- automatically designed according to the preoperative plan. Firstly, mesh segmentation with signed scalar of vertex is utilized to partition the inner surface from the input surface mesh based on the indicated point loop. Then, the offset surface of the inner surface is obtained through contouring the distance field of the inner surface, and segmented to generate the outer surface. Ruled surface is employed to connect inner and outer surfaces. Finally, drilling tubes are generated according to the preoperative plan through collision detection and merging. It has been applied to the template design for various kinds of surgeries, including oral implantology, cervical pedicle screw insertion, iliosacral screw insertion and osteotomy, demonstrating the efficiency, functionality and generality of our method.
A semi-automatic computer-aided method for surgical template design
Chen, Xiaojun; Xu, Lu; Yang, Yue; Egger, Jan
2016-01-01
This paper presents a generalized integrated framework of semi-automatic surgical template design. Several algorithms were implemented including the mesh segmentation, offset surface generation, collision detection, ruled surface generation, etc., and a special software named TemDesigner was developed. With a simple user interface, a customized template can be semi- automatically designed according to the preoperative plan. Firstly, mesh segmentation with signed scalar of vertex is utilized to partition the inner surface from the input surface mesh based on the indicated point loop. Then, the offset surface of the inner surface is obtained through contouring the distance field of the inner surface, and segmented to generate the outer surface. Ruled surface is employed to connect inner and outer surfaces. Finally, drilling tubes are generated according to the preoperative plan through collision detection and merging. It has been applied to the template design for various kinds of surgeries, including oral implantology, cervical pedicle screw insertion, iliosacral screw insertion and osteotomy, demonstrating the efficiency, functionality and generality of our method. PMID:26843434
A semi-automatic computer-aided method for surgical template design.
Chen, Xiaojun; Xu, Lu; Yang, Yue; Egger, Jan
2016-02-04
This paper presents a generalized integrated framework of semi-automatic surgical template design. Several algorithms were implemented including the mesh segmentation, offset surface generation, collision detection, ruled surface generation, etc., and a special software named TemDesigner was developed. With a simple user interface, a customized template can be semi- automatically designed according to the preoperative plan. Firstly, mesh segmentation with signed scalar of vertex is utilized to partition the inner surface from the input surface mesh based on the indicated point loop. Then, the offset surface of the inner surface is obtained through contouring the distance field of the inner surface, and segmented to generate the outer surface. Ruled surface is employed to connect inner and outer surfaces. Finally, drilling tubes are generated according to the preoperative plan through collision detection and merging. It has been applied to the template design for various kinds of surgeries, including oral implantology, cervical pedicle screw insertion, iliosacral screw insertion and osteotomy, demonstrating the efficiency, functionality and generality of our method.
Pies, Ross E.
2016-03-29
A method and device for the detection of impact events on a security barrier. A hollow rebar is farmed within a security barrier, whereby the hollow rebar is completely surrounded by the security barrier. An optical fiber passes through the interior of the hollow rebar. An optical transmitter and an optical receiver are both optically connected to the optical fiber and connected to optical electronics. The optical electronics are configured to provide notification upon the detection of an impact event at the security barrier based on the detection of disturbances within the optical fiber.
Essure Permanent Birth Control, Effectiveness and Safety: An Italian 11-Year Survey.
Franchini, Mario; Zizolfi, Brunella; Coppola, Carmela; Bergamini, Valentino; Bonin, Cecilia; Borsellino, Giovanni; Busato, Enrico; Calabrese, Stefania; Calzolari, Stefano; Fantin, Gian Piero; Giarrè, Giovanna; Litta, Piero; Luerti, Massimo; Mangino, Francesco Paolo; Marchino, Gian Luigi; Molinari, Maria Antonietta; Scatena, Elisa; Scrimin, Federica; Telloli, Paolo; Di Spiezio Sardo, Attilio
To describe safety, tolerability, and effectiveness results through a minimum 2-year follow-up of patients who underwent permanent sterilization with the Essure insert. A retrospective multicenter study (Canadian Task Force classification II2). Seven general hospitals and 4 clinical teaching centers in Italy. A total of 1968 women, mean age 39.5 years (range, 23-48 years) who underwent office hysteroscopic sterilization using the Essure insert between April 1, 2003, and December 30, 2014. The women underwent office hysteroscopic bilateral Essure insert placement, with satisfactory device location and tube occlusion based on hysterosalpingography or hysterosalpingo-contrast sonography (HyCoSy). Placement rate, successful bilateral tubal occlusion, perioperative adverse events, early postoperative (during the first 3 months of follow-up), and late complications were evaluated. Satisfactory insertion was accomplished in 97.2% of women and, in 4, perforation and 1 expulsion were detected during hysterosalpingography. Three unintended pregnancies occurred before the 3-month confirmation test. Two pregnancies were reported among women relying on the Essure inserts. Postprocedure pain was minimal and brief; in 9 women, pelvic pain became intractable, necessitating removal of the devices via laparoscopy. On telephone interviews, overall satisfaction was rated as "very satisfied" by the majority of women (97.6%), and no long-term adverse events were reported. The findings from this extended Italian survey further support the effectiveness, tolerability, and satisfaction of Essure hysteroscopic sterilization when motivated women are selected and well informed of the potential risks of the device. Moreover, the results do not demonstrate an increased incidence of complications and pregnancies associated with long-term Essure use. Patients with a known hypersensitivity to nickel may be less suitable candidates for the Essure insert. Copyright © 2017 AAGL. Published by Elsevier Inc. All rights reserved.
Mahadevappa, Nagabhushana; Kochhar, Gaurav; Vilvapathy, Karthikeyan Senguttuvan; Dharwadkar, Sachin; Kumar, Sumit
2016-01-01
Objectives: To study retrospectively the frequency, demographic, phenomenological, and psychiatric profile in patients presented with self-insertion of foreign bodies in the lower genitourinary tract in our institute. Materials and Methods: From January 2009 to 2015, the records of patients admitted with self-insertion of foreign bodies into the lower urinary tract were analyzed retrospectively regarding demographic and phenomenological profile, the mode of presentation, diagnosis, management, complications, and possible contributing factors leading to the event. Results: Out of 17,978 inpatients, ten patients (0.055%) presented with foreign body insertion in the lower genitourinary tract in last 6 years. Mean age was 28.1 ± 13.9 (7–50) years. Objects used for insertion were varied from seeds, twigs to the electric wire. The contributing factors were lack of partner, misconception about masturbation, and underlying psychiatric illness. The presenting symptoms were pain and swelling of the penis, difficulty in voiding, and skin ulceration. The diagnosis was possible by simple observation in four patients, X-ray kidney, ureter, and bladder, and sonography of the pelvis in six patients. Five patients had endoscopic retrieval of foreign body, 2 had an open, suprapubic cystotomy, urethrotomy was needed in one patient, and forceps removal in two patients. There were no postoperative complications. Psychiatric profile was evaluated in nine patients. Conclusions: Foreign body insertion to lower urinary tract was rare. A main cause for insertion of foreign bodies was autoerotism, misconceptions regarding masturbation, and underlying psychiatric illness. In addition to suitable method of surgical removal, counseling and psychiatric evaluation are necessary to prevent recurrences or for early detection of psychiatric problems. PMID:27453657
"Turn-of-the-Nut" Method Is Not Appropriate for Use in Cancellous Bone.
Ryan, Melissa K; Mohtar, Aaron A; Costi, John J; Reynolds, Karen J
2015-11-01
The level to which bone screws are tightened is determined subjectively by the operating surgeon. It is likely that the tactile feedback that surgeons rely on is based on localized tissue yielding, which may predispose the screw-bone interface to failure. A limited number of studies have investigated the ratio between clinical tightening torque and stripping torque. The purpose of this study was to measure, for the first time, the ratio between yield torque (T yield) and stripping torque (T max) during screw insertion into the cancellous bone and to compare these torques with clinical levels of tightening reported in the literature. Additionally, a rotational limit was investigated as a potential end point for screw insertion in cancellous bone. A 6.5-mm outer diameter commercial cancellous bone screw was inserted into human femoral head specimens (n = 89). Screws were inserted to failure, while recording insertion torque, compression under the screw head, and rotation angle. The median, interquartile ranges, and coefficient of variation were calculated for each of the following parameters: T yield, T max, T yield/T max, slope, T plateau, and rotation angle. The median ratio of T yield/T max and rotation angle was 85.45% and 96.5 degrees, respectively. The coefficient of variation was greatest for the rotation angle compared with the ratio of T yield/T max (0.37 vs. 0.12). The detection of yield may be a more precise method than the rotation angle in cancellous bone; however, bone-screw constructs that exhibit a T yield close to T max may be more susceptible to stripping during insertion. Future work can identify factors that influence the ratio of T yield/T max may help to reduce the incidence of screw stripping.
NASA Astrophysics Data System (ADS)
Beigi, Parmida; Rohling, Robert
2014-03-01
Despite the wide range and long history of ultrasound guided needle insertions, an unresolved issue in many cases is clear needle visibility. A well-known ad hoc technique to detect the needle is to move the stylet and look for changes in the needle appearance. We present a new method to automatically locate a moving stylet/catheter within a stationary cannula using motion detection. We then use this information to detect the needle trajectory and the tip. The differences between the current frame and the previous frame are detected and localized, to minimize the influence of tissue global motions. A polynomial fit based on the detected needle axis determines the estimated stylet shaft trajectory, and the extent of the differences along the needle axis represents the tip. Over a few periodic movements of the stylet including its full insertion into the cannula to the tip, a combination of polynomial fits determines the needle trajectory and the last detected point represents the needle tip. Experiments are conducted in water bath and bovine muscle tissue for several stylet/catheter materials. Results show that a plastic stylet has the best needle shaft and tip localization accuracy in the water bath with RMSE = 0:16 mm and RMSE = 0:51 mm, respectively. In the bovine tissue, the needle tip was best localized with the plastic catheter with RMSE = 0:33 mm. The stylet tip localization was most accurate with the steel stylet, with RMSE = 2:81 mm and the shaft was best localized with the plastic catheter, with RMSE = 0:32 mm.
Incomplete Lineage Sorting and Hybridization Statistics for Large-Scale Retroposon Insertion Data
Kuritzin, Andrej; Kischka, Tabea
2016-01-01
Ancient retroposon insertions can be used as virtually homoplasy-free markers to reconstruct the phylogenetic history of species. Inherited, orthologous insertions in related species offer reliable signals of a common origin of the given species. One prerequisite for such a phylogenetically informative insertion is that the inserted element was fixed in the ancestral population before speciation; if not, polymorphically inserted elements may lead to random distributions of presence/absence states during speciation and possibly to apparently conflicting reconstructions of their ancestry. Fortunately, such misleading fixed cases are relatively rare but nevertheless, need to be considered. Here, we present novel, comprehensive statistical models applicable for (1) analyzing any pattern of rare genomic changes, (2) testing and differentiating conflicting phylogenetic reconstructions based on rare genomic changes caused by incomplete lineage sorting or/and ancestral hybridization, and (3) differentiating between search strategies involving genome information from one or several lineages. When the new statistics are applied, in non-conflicting cases a minimum of three elements present in both of two species and absent in a third group are considered significant support (p<0.05) for the branching of the third from the other two, if all three of the given species are screened equally for genome or experimental data. Five elements are necessary for significant support (p<0.05) if a diagnostic locus derived from only one of three species is screened, and no conflicting markers are detected. Most potentially conflicting patterns can be evaluated for their significance and ancestral hybridization can be distinguished from incomplete lineage sorting by considering symmetric or asymmetric distribution of rare genomic changes among possible tree configurations. Additionally, we provide an R-application to make the new KKSC insertion significance test available for the scientific community at http://retrogenomics.uni-muenster.de:3838/KKSC_significance_test/. PMID:26967525
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wagstaff, J.; Hemann, M.
1995-01-01
A child with phenotypic features of the 9p{sup {minus}} syndrome, including metopic craniosynostosis, small ears, abdominal wall defect, and mental retardation, as well as hypopigmentation, was found to have a cytogenetically balanced 3;9 translocation, with breakpoints at 3p11 and 9p23, inherited from his phenotypically normal father. Molecular analysis showed heterozygous deletion of the TYRP (tyrosinase-related protein) locus, as well as loci D9S157, D9S274, D9S268, and D9S267, in the child but in neither parent. FISH analysis of the proband`s father indicated that loci deleted in his son, including TYRP, were present on neither the der(3) nor the der(9) translocation products butmore » had been inserted into the long arm of chromosome 8. Therefore, the apparent deletion of these loci in the proband was the result of meiotic segregation of the father`s 3;9 translocation chromosomes together with his normal chromosome 8 (not bearing the insertion from 9p23). Neither the deletion of these 9p23 loci from the translocation chromosomes nor their insertion into 8q was detectable by standard chromosome banding techniques. The proband`s sister exhibited speech delay, mild facial dysmorphism, and renal malformation, and her karyotype was 46,XX. Molecular analysis showed that she had inherited normal chromosomes 3 and 9, as well as the chromosome 8 with the insertion of 9p23 material, from her father. This analysis illustrates a new mechanism to explain cases in which an apparently balanced translocation has been transmitted from a normal parent to a child with a phenotypic abnormality: submicroscopic deletion of material from the translocation breakpoint and insertion into a third chromosome in the balanced parent, with meiotic segregation leading to loss of the inserted material in the child. 36 refs., 9 figs., 1 tab.« less
Brunelle, Brian W; Greenlee, Justin J; Seabury, Christopher M; Brown, Charles E; Nicholson, Eric M
2008-01-01
Background Transmissible spongiform encephalopathies (TSEs) are neurodegenerative diseases that affect several mammalian species. At least three factors related to the host prion protein are known to modulate susceptibility or resistance to a TSE: amino acid sequence, atypical number of octapeptide repeats, and expression level. These factors have been extensively studied in breeds of Bos taurus cattle in relation to classical bovine spongiform encephalopathy (BSE). However, little is currently known about these factors in Bos indicus purebred or B. indicus × B. taurus composite cattle. The goal of our study was to establish the frequency of markers associated with enhanced susceptibility or resistance to classical BSE in B. indicus purebred and composite cattle. Results No novel or TSE-associated PRNP-encoded amino acid polymorphisms were observed for B. indicus purebred and composite cattle, and all had the typical number of octapeptide repeats. However, differences were observed in the frequencies of the 23-bp and 12-bp insertion/deletion (indel) polymorphisms associated with two bovine PRNP transcription regulatory sites. Compared to B. taurus, B. indicus purebred and composite cattle had a significantly lower frequency of 23-bp insertion alleles and homozygous genotypes. Conversely, B. indicus purebred cattle had a significantly higher frequency of 12-bp insertion alleles and homozygous genotypes in relation to both B. taurus and composite cattle. The origin of these disparities can be attributed to a significantly different haplotype structure within each species. Conclusion The frequencies of the 23-bp and 12-bp indels were significantly different between B. indicus and B. taurus cattle. No other known or potential risk factors were detected for the B. indicus purebred and composite cattle. To date, no consensus exists regarding which bovine PRNP indel region is more influential with respect to classical BSE. Should one particular indel region and associated genotypes prove more influential with respect to the incidence of classical BSE, differences regarding overall susceptibility and resistance for B. indicus and B. taurus cattle may be elucidated. PMID:18808703
Electron density modification in ionospheric E layer by inserting fine dust particles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Misra, Shikha, E-mail: shikhamish@gmail.com; Mishra, S. K.
2015-02-15
In this paper, we have developed the kinetics of E-region ionospheric plasma comprising of fine dust grains and shown that the electron density in E-layer can purposely be reduced/enhanced up to desired level by inserting fine dust particles of appropriate physical/material properties; this may certainly be promising for preferred rf-signal processing through these layers. The analytical formulation is based on average charge theory and includes the number and energy balance of the plasma constituents along with charge balance over dust particles. The effect of varying number density, work function, and photo-efficiency of dust particles on ionospheric plasma density at differentmore » altitude in E-layer has been critically examined and presented graphically.« less
NASA Technical Reports Server (NTRS)
Murri, Gretchen Bostaph; Martin, Roderick H.
1991-01-01
Static and fatigue double-cantilever beam (DCB) and end-notch flexure (ENF) tests were conducted to determine the effect of the simulated initial delamination in interlaminar fracture toughness, G(sub c), and fatigue fracture threshold, G(sub th). Unidirectional, 24-ply specimens of S2/SP250 glass/epoxy were tested using Kapton inserts of four different thickness - 13, 25, 75, and 130 microns, at the midplane at one end, or with tension or shear precracks, to simulate an initial delamination. To determine G(sub c), the fatigue fracture threshold below which no delamination growth would occur in less than 1 x 10(exp 6) cycles, fatigue tests were conducted by cyclically loading specimens until delamination growth was detected. Consistent values of model 1 fracture toughness, G(sub Ic), were measured from DCB specimens with inserts of thickness 75 microns or thinner, or with shear precracks. The fatigue DCB tests gave similar values of G(sub Ith) for the 13, 25, and 75 microns specimens. Results for the shear precracked specimens were significantly lower that for specimens without precracks. Results for both the static and fatigue ENF tests showed that measured G(IIc) and G(IIth) values decreased with decreasing insert thickness, so that no limiting thickness could be determined. Results for specimens with inserts of 75 microns or thicker were significantly higher than the results for precracked specimens or specimens with 13 or 25 microns inserts.
A Mechanical Coil Insertion System for Endovascular Coil Embolization of Intracranial Aneurysms
Haraguchi, K.; Miyachi, S.; Matsubara, N.; Nagano, Y.; Yamada, H.; Marui, N.; Sano, A.; Fujimoto, H.; Izumi, T.; Yamanouchi, T.; Asai, T.; Wakabayashi, T.
2013-01-01
Summary Like other fields of medicine, robotics and mechanization might be introduced into endovascular coil embolization of intracranial aneurysms for effective treatment. We have already reported that coil insertion force could be smaller and more stable when the coil delivery wire is driven mechanically at a constant speed. Another background is the difficulty in synchronizing operators' minds and hands when two operators control the microcatheter and the coil respectively. We have therefore developed a mechanical coil insertion system enabling a single operator to insert coils at a fixed speed while controlling the microcatheter. Using our new system, the operator manipulated the microcatheter with both hands and drove the coil using foot switches simultaneously. A delivery wire force sensor previously reported was used concurrently, allowing the operator to detect excessive stress on the wire. In vitro coil embolization was performed using three methods: simple mechanical advance of the coil; simple mechanical advance of the coil with microcatheter control; and driving (forward and backward) of the coil using foot switches in addition to microcatheter control. The system worked without any problems, and did not interfere with any procedures. In experimental coil embolization, delivery wire control using the foot switches as well as microcatheter manipulation helped to achieve successful insertion of coils. This system could offer the possibility of developing safer and more efficient coil embolization. Although we aim at total mechanization and automation of procedures in the future, microcatheter manipulation and synchronized delivery wire control are still indispensable using this system. PMID:23693038
NASA Astrophysics Data System (ADS)
Belim, S. V.; Vilkhovskiy, D. E.
2018-01-01
All articles must contain an abstract. The abstract text should be formatted using 10 point Times or Times New Roman and indented 25 mm from the left margin. Leave 10 mm space after the abstract before you begin the main text of your article, starting on the same page as the abstract. The abstract should give readers concise information about the content of the article and indicate the main results obtained and conclusions drawn. The abstract is not part of the text and should be complete in itself; no table numbers, figure numbers, references or displayed mathematical expressions should be included. It should be suitable for direct inclusion in abstracting services and should not normally exceed 200 words in a single paragraph. Since contemporary information-retrieval systems rely heavily on the content of titles and abstracts to identify relevant articles in literature searches, great care should be taken in constructing both. Keywords - search for LSB-inserts, analysis of steganography container, revealing of steganography inserts.
NASA Astrophysics Data System (ADS)
Panicali, Dennis; Paoletti, Enzo
1982-08-01
We have constructed recombinant vaccinia viruses containing the thymidine kinase gene from herpes simplex virus. The gene was inserted into the genome of a variant of vaccinia virus that had undergone spontaneous deletion as well as into the 120-megadalton genome of the large prototypic vaccinia variant. This was accomplished via in vivo recombination by contransfection of eukaryotic tissue culture cells with cloned BamHI-digested thymidine kinase gene from herpes simplex virus containing flanking vaccinia virus DNA sequences and infectious rescuing vaccinia virus. Pure populations of the recombinant viruses were obtained by replica filter techniques or by growth of the recombinant virus in biochemically selective medium. The herpes simplex virus thymidine kinase gene, as an insert in vaccinia virus, is transcribed in vivo and in vitro, and the fidelity of in vivo transcription into a functional gene product was detected by the phosphorylation of 5-[125I]iodo-2'-deoxycytidine.
Wear Distribution Detection of Knee Joint Prostheses by Means of 3D Optical Scanners
Affatato, Saverio; Valigi, Maria Cristina; Logozzo, Silvia
2017-01-01
The objective of this study was to examine total knee polyethylene inserts from in vitro simulation to evaluate and display—using a 3D optical scanner—wear patterns and wear rates of inserts exposed to wear by means of simulators. Various sets of tibial inserts have been reconstructed by using optical scanners. With this in mind, the wear behavior of fixed and mobile bearing polyethylene knee configurations was investigated using a knee wear joint simulator. After the completion of the wear test, the polyethylene menisci were analyzed by an innovative 3D optical scanners in order to evaluate the 3D wear distribution on the prosthesis surface. This study implemented a new procedure for evaluating polyethylene bearings of joint prostheses obtained after in vitro wear tests and the proposed new approach allowed quantification of the contact zone on the geometry of total knee prostheses. The results of the present study showed that mobile TKPs (total knee prosthesis) have lower wear resistance with respect to fixed TKPs. PMID:28772725
Niescierowicz, Katarzyna; Caro, Lydia; Cherezov, Vadim; Vivaudou, Michel; Moreau, Christophe J
2014-01-07
Structural studies of G protein-coupled receptors (GPCRs) extensively use the insertion of globular soluble protein domains to facilitate their crystallization. However, when inserted in the third intracellular loop (i3 loop), the soluble protein domain disrupts their coupling to G proteins and impedes the GPCRs functional characterization by standard G protein-based assays. Therefore, activity tests of crystallization-optimized GPCRs are essentially limited to their ligand binding properties using radioligand binding assays. Functional characterization of additional thermostabilizing mutations requires the insertion of similar mutations in the wild-type receptor to allow G protein-activation tests. We demonstrate that ion channel-coupled receptor technology is a complementary approach for a comprehensive functional characterization of crystallization-optimized GPCRs and potentially of any engineered GPCR. Ligand-induced conformational changes of the GPCRs are translated into electrical signal and detected by simple current recordings, even though binding of G proteins is sterically blocked by the added soluble protein domain. Copyright © 2014 Elsevier Ltd. All rights reserved.
MLESAC Based Localization of Needle Insertion Using 2D Ultrasound Images
NASA Astrophysics Data System (ADS)
Xu, Fei; Gao, Dedong; Wang, Shan; Zhanwen, A.
2018-04-01
In the 2D ultrasound image of ultrasound-guided percutaneous needle insertions, it is difficult to determine the positions of needle axis and tip because of the existence of artifacts and other noises. In this work the speckle is regarded as the noise of an ultrasound image, and a novel algorithm is presented to detect the needle in a 2D ultrasound image. Firstly, the wavelet soft thresholding technique based on BayesShrink rule is used to denoise the speckle of ultrasound image. Secondly, we add Otsu’s thresholding method and morphologic operations to pre-process the ultrasound image. Finally, the localization of the needle is identified and positioned in the 2D ultrasound image based on the maximum likelihood estimation sample consensus (MLESAC) algorithm. The experimental results show that it is valid for estimating the position of needle axis and tip in the ultrasound images with the proposed algorithm. The research work is hopeful to be used in the path planning and robot-assisted needle insertion procedures.
Mathurm, Manish; Gilhotra, Ritu Mehra
2011-01-01
An attempt has been made in the present study to formulate soluble ocular inserts of aceclofenac to facilitate the bioavailability of the drug into the eye, as no eye drop solution could be formulated. Glycero-gelatin ocular inserts/films were prepared and physicochemical parameters and drug release profiles of glycerol-gelatin films of aceclofenac were compared with surface cross-linked films of similar compositions. Ocular irritation of the developed formulation was also checked by HET-CAM test and efficacy of the developed formulation against prostaglandin-induced ocular inflammation in rabbit eye was determined. The non-cross-linked films showed poor mechanical, physicochemical properties, and very little potential of sustaining drug release, however cross-linking the films enhanced tensile strength by 70%, but elasticity decreased by 95%. The cross-linked ocular inserts showed less swelling than non-cross-linked. Formulation AF8 (20% gelatin and 70% glycerin, treated by cross-linker for 1 h) demonstrated the longest drug release for 24 h. As per the kinetic models all films showed a constant drug release with Higuchi diffusion mechanism. Formulation was found to be practically non-irritant. The optimized formulation was tested and compared with eye drops of aceclofenac for anti-inflammatory activity in rabbits against PGE₂-induced inflammation. In vivo studies with developed formulation indicated a significant inhibition of PGE₂-induced PMN migration as compared to eye drops. In conclusion, ocular inserts of aceclofenac was found promising as it achieved sustained drug release and better pharmacodynamic activity.
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
USDA-ARS?s Scientific Manuscript database
Miniature inverted-repeat transposable elements (MITEs) are non-autonomous transposons (devoid a transposase gene, tps) involving insertion/deletion of genomic DNA in bacterial genomes influencing gene functions. No transposon has yet been reported in “Candidatus Liberibacter asiaticus”, an alpha-pr...
Progress in performance enhancement methods for capacitive silicon resonators
NASA Astrophysics Data System (ADS)
Van Toan, Nguyen; Ono, Takahito
2017-11-01
In this paper, we review the progress in recent studies on the performance enhancement methods for capacitive silicon resonators. We provide information on various fabrication technologies and design considerations that can be employed to improve the performance of capacitive silicon resonators, including low motional resistance, small insertion loss, and high quality factor (Q). This paper contains an overview of device structures and working principles, fabrication technologies consisting of hermetic packaging, deep reactive-ion etching and neutral beam etching, and design considerations including mechanically coupled, movable electrode structures and piezoresistive heat engines.
Electrically-detected magnetic resonance in semiconductor nanostructures inserted in microcavities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bagraev, Nikolay; Danilovskii, Eduard; Gets, Dmitrii
2013-12-04
We present the first findings of the new electrically-detected electron spin resonance technique (EDESR), which reveal the point defects in the ultra-narrow silicon quantum wells (Si-QW) confined by the superconductor δ-barriers. This technique allows the ESR identification without application of an external cavity, as well as a high frequency source and recorder, and with measuring the only response of the magnetoresistance caused by the microcavities embedded in the Si-QW plane.