Sample records for enhancer element located

  1. System performance and performance enhancement relative to element position location errors for distributed linear antenna arrays

    NASA Astrophysics Data System (ADS)

    Adrian, Andrew

    For the most part, antenna phased arrays have traditionally been comprised of antenna elements that are very carefully and precisely placed in very periodic grid structures. Additionally, the relative positions of the elements to each other are typically mechanically fixed as best as possible. There is never an assumption the relative positions of the elements are a function of time or some random behavior. In fact, every array design is typically analyzed for necessary element position tolerances in order to meet necessary performance requirements such as directivity, beamwidth, sidelobe level, and beam scanning capability. Consider an antenna array that is composed of several radiating elements, but the position of each of the elements is not rigidly, mechanically fixed like a traditional array. This is not to say that the element placement structure is ignored or irrelevant, but each element is not always in its relative, desired location. Relative element positioning would be analogous to a flock of birds in flight or a swarm of insects. They tend to maintain a near fixed position with the group, but not always. In the antenna array analog, it would be desirable to maintain a fixed formation, but due to other random processes, it is not always possible to maintain perfect formation. This type of antenna array is referred to as a distributed antenna array. A distributed antenna array's inability to maintain perfect formation causes degradations in the antenna factor pattern of the array. Directivity, beamwidth, sidelobe level and beam pointing error are all adversely affected by element relative position error. This impact is studied as a function of element relative position error for linear antenna arrays. The study is performed over several nominal array element spacings, from lambda to lambda, several sidelobe levels (20 to 50 dB) and across multiple array illumination tapers. Knowing the variation in performance, work is also performed to utilize a minimum

  2. An enhancer element is located 340 base pairs upstream from the adenovirus-2 E1A capsite.

    PubMed Central

    Hen, R; Borrelli, E; Sassone-Corsi, P; Chambon, P


    A chimeric recombinant, containing the 270 bp left-terminal fragment of Adenovirus-2 (Ad2) inserted upstream from the -34 to +33 Ad2 major late promoter (Ad2MLP) element, has been used to characterize the transcription stimulatory element which is located at least 231 bp upstream from the E1A capsite in the left-end of Ad2 (Ref. 1). We demonstrate that this element, which acts in cis, possesses several properties characteristic of transcriptional enhancers. Firstly, it potentiates initiation of transcription from the capsite of the heterologous Ad2MLP and from "cryptic" sites often preceded by TATA box-like sequences. Secondly, although there is no critical distance requirement between the enhancer element and the Ad2MLP, the extent of stimulation decreases as the distance between the two element increases. However, in contrast to the other known viral or cellular enhancers which are bidirectional, the Ad2 enhancer is unidirectional, i.e. it potentiates the Ad2MLP element only when it is inserted in its "natural" orientation with respect to the direction of transcription. Using two convergent series of deletions, we have localized the Ad2 enhancer element within a 24 bp segment located at approximately 160 bp from the Ad2 left-end, i.e. 340 bp upstream from the E1A capsite. This 24 bp segment contains a sequence which exhibits a striking homology with the consensus sequence of several viral and cellular enhancers. Images PMID:6324099

  3. Functional dissection of an enhancer-like element located within the second intron of the human U2AF1L4 gene.


    Didych, D A; Smirnov, N A; Kotova, E S; Akopov, S B; Nikolaev, L G; Sverdlov, E D


    A detailed functional and evolutionary analysis of an enhancer element of the human genome (enhancer 12) located in the second intron of the U2AF1L4 gene, which we identified earlier, is presented. Overlapping fragments of the studied genome region were analyzed for enhancer activity, and the site responsible for the activity of this element was identified using transient transfections of HeLa cells. Comparison of the enhancer 12 sequence with orthologous sequences from seven primate species revealed the existence of evolutionarily conserved sequences within this element. One of the identified conservative regions is likely responsible for the enhancer activity and is able to specifically interact in vitro with proteins of HeLa cell nuclear extract. The ability of orthologous primate sequences to compete with enhancer 12 for binding with HeLa cell nuclear extract proteins and to enhance the activity of the reporter gene in transient transfection of HeLa cells is demonstrated. PMID:22022969

  4. Arousal-Enhanced Location Memory for Pictures

    ERIC Educational Resources Information Center

    Mather, Mara; Nesmith, Kathryn


    Four experiments revealed arousal-enhanced location memory for pictures. After an incidental encoding task, participants were more likely to remember the locations of positive and negative arousing pictures than the locations of non-arousing pictures, indicating better binding of location to picture. This arousal-enhanced binding effect did not…

  5. Saccade execution suppresses discrimination at distractor locations rather than enhancing the saccade goal location.


    Khan, Aarlenne Z; Blohm, Gunnar; Pisella, Laure; Munoz, Douglas P


    As we have limited processing abilities with respect to the plethora of visual information entering our brain, spatial selection mechanisms are crucial. These mechanisms result in both enhancing processing at a location of interest and in suppressing processing at other locations; together, they enable successful further processing of locations of interest. It has been suggested that saccade planning modulates these spatial selection mechanisms; however, the precise influence of saccades on the distribution of spatial resources underlying selection remains unclear. To this end, we compared discrimination performance at different locations (six) within a work space during different saccade tasks. We used visual discrimination performance as a behavioral measure of enhancement and suppression at the different locations. A total of 14 participants performed a dual discrimination/saccade countermanding task, which allowed us to specifically isolate the consequences of saccade execution. When a saccade was executed, discrimination performance at the cued location was never better than when fixation was maintained, suggesting that saccade execution did not enhance processing at a location more than knowing the likelihood of its appearance. However, discrimination was consistently lower at distractor (uncued) locations in all cases where a saccade was executed compared with when fixation was maintained. Based on these results, we suggest that saccade execution specifically suppresses distractor locations, whereas attention shifts (with or without an accompanying saccade) are involved in enhancing perceptual processing at the goal location.

  6. The cryptic enhancer elements of the tCUP promoter.


    Wu, Keqiang; Hu, Ming; Martin, Teresa; Wang, Changming; Li, Xiu-Qing; Tian, Lining; Brown, Dan; Miki, Brian


    Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. PMID:12602866

  7. 49 CFR 236.560 - Contact element, mechanical trip type; location with respect to rail.

    Code of Federal Regulations, 2013 CFR


    ... 49 Transportation 4 2013-10-01 2013-10-01 false Contact element, mechanical trip type; location... Instructions; Locomotives § 236.560 Contact element, mechanical trip type; location with respect to rail. Contact element of automatic train stop device of the mechanical trip type shall be maintained at a...

  8. 49 CFR 236.560 - Contact element, mechanical trip type; location with respect to rail.

    Code of Federal Regulations, 2014 CFR


    ... 49 Transportation 4 2014-10-01 2014-10-01 false Contact element, mechanical trip type; location... Instructions; Locomotives § 236.560 Contact element, mechanical trip type; location with respect to rail. Contact element of automatic train stop device of the mechanical trip type shall be maintained at a...

  9. 49 CFR 236.560 - Contact element, mechanical trip type; location with respect to rail.

    Code of Federal Regulations, 2012 CFR


    ... 49 Transportation 4 2012-10-01 2012-10-01 false Contact element, mechanical trip type; location... Instructions; Locomotives § 236.560 Contact element, mechanical trip type; location with respect to rail. Contact element of automatic train stop device of the mechanical trip type shall be maintained at a...

  10. 49 CFR 236.560 - Contact element, mechanical trip type; location with respect to rail.

    Code of Federal Regulations, 2011 CFR


    ... 49 Transportation 4 2011-10-01 2011-10-01 false Contact element, mechanical trip type; location... Instructions; Locomotives § 236.560 Contact element, mechanical trip type; location with respect to rail. Contact element of automatic train stop device of the mechanical trip type shall be maintained at a...

  11. 49 CFR 236.560 - Contact element, mechanical trip type; location with respect to rail.

    Code of Federal Regulations, 2010 CFR


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Contact element, mechanical trip type; location... Instructions; Locomotives § 236.560 Contact element, mechanical trip type; location with respect to rail. Contact element of automatic train stop device of the mechanical trip type shall be maintained at a...

  12. Commissural Gain Control Enhances the Midbrain Representation of Sound Location

    PubMed Central

    Orton, Llwyd David; Papasavvas, Christoforos A.


    Accurate localization of sound sources is essential for survival behavior in many species. The inferior colliculi (ICs) are the first point in the auditory pathway where cues used to locate sounds, ie, interaural time differences (ITDs), interaural level differences (ILDs), and pinna spectral cues, are all represented in the same location. These cues are first extracted separately on each side of the midline in brainstem nuclei that project to the ICs. Because of this segregation, each IC predominantly represents stimuli in the contralateral hemifield. We tested the hypothesis that commissural connections between the ICs mediate gain control that enhances sound localization acuity. We recorded IC neurons sensitive to either ITDs or ILDs in anesthetized guinea pig, before, during, and following recovery from deactivation of the contralateral IC by cryoloop cooling or microdialysis of procaine. During deactivation, responses were rescaled by divisive gain change and additive shifts, which reduced the dynamic range of ITD and ILD response functions and the ability of neurons to signal changes in sound location. These data suggest that each IC exerts multiplicative gain control and subtractive shifts over the other IC that enhances the neural representation of sound location. Furthermore, this gain control operates in a similar manner on both ITD- and ILD-sensitive neurons, suggesting a shared mechanism operates across localization cues. Our findings reveal a novel dependence of sound localization on commissural processing. SIGNIFICANCE STATEMENT Sound localization, a fundamental process in hearing, is dependent on bilateral computations in the brainstem. How this information is transmitted from the brainstem to the auditory cortex, through several stages of processing, without loss of signal fidelity, is not clear. We show that the ability of neurons in the auditory midbrain to encode azimuthal sound location is dependent on gain control mediated by the commissure of

  13. Google Earth locations of USA and seafloor hydrothermal vents with associated rare earth element data

    DOE Data Explorer

    Andrew Fowler


    Google Earth .kmz files that contain the locations of geothermal wells and thermal springs in the USA, and seafloor hydrothermal vents that have associated rare earth element data. The file does not contain the actual data, the actual data is available through the GDR website in two tier 3 data sets entitled "Compilation of Rare Earth Element Analyses from US Geothermal Fields and Mid Ocean Ridge (MOR) Hydrothermal Vents" and "Rare earth element content of thermal fluids from Surprise Valley, California"

  14. Genome-wide identification of enhancer elements.


    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel


    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems.

  15. Genome-wide identification of enhancer elements.


    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel


    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems. PMID:27389984

  16. A reciprocal space approach for locating symmetry elements in Patterson superposition maps

    SciTech Connect

    Hendrixson, T.


    A method for determining the location and possible existence of symmetry elements in Patterson superposition maps has been developed. A comparison of the original superposition map and a superposition map operated on by the symmetry element gives possible translations to the location of the symmetry element. A reciprocal space approach using structure factor-like quantities obtained from the Fourier transform of the superposition function is then used to determine the best'' location of the symmetry element. Constraints based upon the space group requirements are also used as a check on the locations. The locations of the symmetry elements are used to modify the Fourier transform coefficients of the superposition function to give an approximation of the structure factors, which are then refined using the EG relation. The analysis of several compounds using this method is presented. Reciprocal space techniques for locating multiple images in the superposition function are also presented, along with methods to remove the effect of multiple images in the Fourier transform coefficients of the superposition map. In addition, crystallographic studies of the extended chain structure of (NHC{sub 5}H{sub 5})SbI{sub 4} and of the twinning method of the orthorhombic form of the high-{Tc} superconductor YBa{sub 2}Cu{sub 3}O{sub 7-x} are presented. 54 refs.

  17. Spatial Attention Enhances Perceptual Processing of Single-Element Displays

    NASA Technical Reports Server (NTRS)

    Bacon, William; Johnston, James C.; Remington, Roger W.; Null, Cynthia H. (Technical Monitor)


    Shiu and Pashler (1993) reported that precueing masked, single-element displays had negligible effects on identification accuracy. They argued that spatial attention does not actually enhance stimulus perceptibility, but only reduces decision noise. Alternatively, such negative results may arise if cues are sub-optimal, or if masks place an insufficient premium on timely deployment of attention. We report results showing that valid cueing enhances processing of even single-element displays. Spatial attention does indeed enhance perceptual processes.

  18. Protein location and elemental composition of urine spheres in different avian species.


    Casotti, Giovanni; Braun, Eldon J


    We examined the internal morphology, location of protein, and identity and location of elements, in avian urate-containing spheres in 9 species of birds. The urine spheres were collected from voided samples. The spheres ranged in size from 0.5-5.0 microm, except in the domestic fowl, where they ranged up to 10 microm in diameter. The internal morphology of the spheres was examined using freeze-fracture microscopy. Protein location within the spheres was identified using fluorescein isothiocyanate (FITC). The urine spheres were analyzed for content and internal location of elements using Energy Dispersal System Analysis (EDS). Internally, the spheres consisted of a central nidus surrounded by 3-4 concentric narrow rings of protein. Elements found within the spheres included nitrogen, potassium, calcium, sodium, phosphorus, chloride and sulfur; however, only nitrogen, potassium and chloride were common in the spheres of all species. Nitrogen comprised the majority of the elemental content of the spheres (77-90%) followed by potassium (8-45%), with all other ions present in trace amounts. Unlike protein, the location of elements was random within the spheres. Protein and urate are both negatively charged and known to associate to form the spheres and as potassium is the only cation common to all spheres, it too may play a role in their formation. PMID:15229868

  19. 20 CFR 655.537 - The fourth attestation element for locations in Alaska: Notice of filing.

    Code of Federal Regulations, 2010 CFR


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false The fourth attestation element for locations in Alaska: Notice of filing. 655.537 Section 655.537 Employees' Benefits EMPLOYMENT AND TRAINING... performed; (ii) Contract stevedoring companies which employ or intend to employ United States...

  20. Enhancing bilinear subspace learning by element rearrangement.


    Xu, Dong; Yan, Shuicheng; Lin, Stephen; Huang, Thomas S; Chang, Shih-Fu


    The success of bilinear subspace learning heavily depends on reducing correlations among features along rows and columns of the data matrices. In this work, we study the problem of rearranging elements within a matrix in order to maximize these correlations so that information redundancy in matrix data can be more extensively removed by existing bilinear subspace learning algorithms. An efficient iterative algorithm is proposed to tackle this essentially integer programming problem. In each step, the matrix structure is refined with a constrained Earth Mover's Distance procedure that incrementally rearranges matrices to become more similar to their low-rank approximations, which have high correlation among features along rows and columns. In addition, we present two extensions of the algorithm for conducting supervised bilinear subspace learning. Experiments in both unsupervised and supervised bilinear subspace learning demonstrate the effectiveness of our proposed algorithms in improving data compression performance and classification accuracy.

  1. Modulation of tissue repair by regeneration enhancer elements.


    Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D


    How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

  2. Variable transposition of eight maize activator (ac) elements located on the short arm of chromosome 1.


    Sheridan, William F


    Eight Activator (Ac) transposable elements mapped to the maize chromosome arm 1S were assessed for Ac transposition rates. For each of the Ac stocks, plants homozygous for the single Ac element and the Ds reporter r1-sc:m3 on chromosome 10 were crossed as females by a homozygous r1-sc:m3 tester color-converted W22 line. The resulting ears produced mostly coarsely spotted kernels and a low frequency of either near-colorless fine-spotted kernels or nonspotted kernels. The relative frequency of these two types of near-colorless kernels differed among the eight Ac stocks. The extent to which increased Ac dosage results in nonspotted kernels may be Ac-specific. Although all of the Ac elements are in near-isogenic inbred W22 lines, they varied to a large extent in their transposition frequency. These differences might possibly result from structural differences among the Ac elements. Because one pair of Ac elements derived from Ac33 on chromosome arm 5S differed about 13-fold in transposition frequency and a second pair of Ac elements derived from Ac12 on chromosome arm 1S differed about 3-fold in transposition frequency, this is not a likely explanation for all eight Ac elements. The data presented here support the notion that the differences in transposition frequency of the eight Ac elements may be a reflection of variability in Ac transcription or accessibility of the transposase to the Ac element, resulting from differences in the chromatin environments wherein the Ac elements are located. This is the first report of variability in transposition rates among different Ac donor lines.

  3. 20 CFR 655.535 - The second attestation element for locations in Alaska: Employment of United States longshore...

    Code of Federal Regulations, 2014 CFR


    ... 20 Employees' Benefits 3 2014-04-01 2014-04-01 false The second attestation element for locations... Alaska Exception § 655.535 The second attestation element for locations in Alaska: Employment of United States longshore workers. (a) The second attestation element shall be satisfied when the employer...

  4. 20 CFR 655.535 - The second attestation element for locations in Alaska: Employment of United States longshore...

    Code of Federal Regulations, 2012 CFR


    ... 20 Employees' Benefits 3 2012-04-01 2012-04-01 false The second attestation element for locations... Alaska Exception § 655.535 The second attestation element for locations in Alaska: Employment of United States longshore workers. (a) The second attestation element shall be satisfied when the employer...

  5. 20 CFR 655.535 - The second attestation element for locations in Alaska: Employment of United States longshore...

    Code of Federal Regulations, 2013 CFR


    ... 20 Employees' Benefits 3 2013-04-01 2013-04-01 false The second attestation element for locations... Alaska Exception § 655.535 The second attestation element for locations in Alaska: Employment of United States longshore workers. (a) The second attestation element shall be satisfied when the employer...

  6. Location, Location, Location!

    ERIC Educational Resources Information Center

    Ramsdell, Kristin


    Of prime importance in real estate, location is also a key element in the appeal of romances. Popular geographic settings and historical periods sell, unpopular ones do not--not always with a logical explanation, as the author discovered when she conducted a survey on this topic last year. (Why, for example, are the French Revolution and the…

  7. Micro-PIXE analysis of trace element concentrations of natural rubies from different locations in Myanmar

    NASA Astrophysics Data System (ADS)

    Sanchez, J. L.; Osipowicz, T.; Tang, S. M.; Tay, T. S.; Win, T. T.


    The trace element concentrations found in geological samples can shed light on the formation process. In the case of gemstones, which might be of artificial or natural origin, there is also considerable interest in the development of methods that provide identification of the origin of a sample. For rubies, trace element concentrations present in natural samples were shown previously to be significant indicators of the region of origin [S.M. Tang et al., Appl. Spectr. 42 (1988) 44, and 43 (1989) 219]. Here we report the results of micro-PIXE analyses of trace element (Ti, V, Cr, Fe, Cu and Ga) concentrations of a large set ( n = 130) of natural rough rubies from nine locations in Myanmar (Burma). The resulting concentrations are subjected to statistical analysis. Six of the nine groups form clusters when the data base is evaluated using tree clustering and principal component analysis.

  8. Trace element fingerprinting of cockle (Cerastoderma edule) shells can reveal harvesting location in adjacent areas.


    Ricardo, Fernando; Génio, Luciana; Costa Leal, Miguel; Albuquerque, Rui; Queiroga, Henrique; Rosa, Rui; Calado, Ricardo


    Determining seafood geographic origin is critical for controlling its quality and safeguarding the interest of consumers. Here, we use trace element fingerprinting (TEF) of bivalve shells to discriminate the geographic origin of specimens. Barium (Ba), manganese (Mn), magnesium (Mg), strontium (Sr) and lead (Pb) were quantified in cockle shells (Cerastoderma edule) captured with two fishing methods (by hand and by hand-raking) and from five adjacent fishing locations within an estuarine system (Ria de Aveiro, Portugal). Results suggest no differences in TEF of cockle shells captured by hand or by hand-raking, thus confirming that metal rakes do not act as a potential source of metal contamination that could somehow bias TEF results. In contrast, significant differences were recorded among locations for all trace elements analysed. A Canonical Analysis of Principal Coordinates (CAP) revealed that 92% of the samples could be successfully classified according to their fishing location using TEF. We show that TEF can be an accurate, fast and reliable method to determine the geographic origin of bivalves, even among locations separated less than 1 km apart within the same estuarine system. Nonetheless, follow up studies are needed to determine if TEF can reliably discriminate between bivalves originating from different ecosystems.

  9. Trace element fingerprinting of cockle (Cerastoderma edule) shells can reveal harvesting location in adjacent areas.


    Ricardo, Fernando; Génio, Luciana; Costa Leal, Miguel; Albuquerque, Rui; Queiroga, Henrique; Rosa, Rui; Calado, Ricardo


    Determining seafood geographic origin is critical for controlling its quality and safeguarding the interest of consumers. Here, we use trace element fingerprinting (TEF) of bivalve shells to discriminate the geographic origin of specimens. Barium (Ba), manganese (Mn), magnesium (Mg), strontium (Sr) and lead (Pb) were quantified in cockle shells (Cerastoderma edule) captured with two fishing methods (by hand and by hand-raking) and from five adjacent fishing locations within an estuarine system (Ria de Aveiro, Portugal). Results suggest no differences in TEF of cockle shells captured by hand or by hand-raking, thus confirming that metal rakes do not act as a potential source of metal contamination that could somehow bias TEF results. In contrast, significant differences were recorded among locations for all trace elements analysed. A Canonical Analysis of Principal Coordinates (CAP) revealed that 92% of the samples could be successfully classified according to their fishing location using TEF. We show that TEF can be an accurate, fast and reliable method to determine the geographic origin of bivalves, even among locations separated less than 1 km apart within the same estuarine system. Nonetheless, follow up studies are needed to determine if TEF can reliably discriminate between bivalves originating from different ecosystems. PMID:26149418

  10. Considering Affective Responses towards Environments for Enhancing Location Based Services

    NASA Astrophysics Data System (ADS)

    Huang, H.; Gartner, G.; Klettner, S.; Schmidt, M.


    A number of studies in the field of environmental psychology show that humans perceive and evaluate their surroundings affectively. Some places are experienced as unsafe, while some others as attractive and interesting. Experiences from daily life show that many of our daily behaviours and decision-making are often influenced by this kind of affective responses towards environments. Location based services (LBS) are often designed to assist and support people's behaviours and decision-making in space. In order to provide services with high usefulness (usability and utility), LBS should consider these kinds of affective responses towards environments. This paper reports on the results of a research project, which studies how people's affective responses towards environments can be modelled and acquired, as well as how LBS can benefit by considering these affective responses. As one of the most popular LBS applications, mobile pedestrian navigation systems are used as an example for illustration.

  11. Syringe filtration methods for examining dissolved and colloidal trace element distributions in remote field locations

    NASA Technical Reports Server (NTRS)

    Shiller, Alan M.


    It is well-established that sampling and sample processing can easily introduce contamination into dissolved trace element samples if precautions are not taken. However, work in remote locations sometimes precludes bringing bulky clean lab equipment into the field and likewise may make timely transport of samples to the lab for processing impossible. Straightforward syringe filtration methods are described here for collecting small quantities (15 mL) of 0.45- and 0.02-microm filtered river water in an uncontaminated manner. These filtration methods take advantage of recent advances in analytical capabilities that require only small amounts of waterfor analysis of a suite of dissolved trace elements. Filter clogging and solute rejection artifacts appear to be minimal, although some adsorption of metals and organics does affect the first approximately 10 mL of water passing through the filters. Overall the methods are clean, easy to use, and provide reproducible representations of the dissolved and colloidal fractions of trace elements in river waters. Furthermore, sample processing materials can be prepared well in advance in a clean lab and transported cleanly and compactly to the field. Application of these methods is illustrated with data from remote locations in the Rocky Mountains and along the Yukon River. Evidence from field flow fractionation suggests that the 0.02-microm filters may provide a practical cutoff to distinguish metals associated with small inorganic and organic complexes from those associated with silicate and oxide colloids.

  12. Disease-associated variants in different categories of disease located in distinct regulatory elements

    PubMed Central


    Background The invention of high throughput sequencing technologies has led to the discoveries of hundreds of thousands of genetic variants associated with thousands of human diseases. Many of these genetic variants are located outside the protein coding regions, and as such, it is challenging to interpret the function of these genetic variants by traditional genetic approaches. Recent genome-wide functional genomics studies, such as FANTOM5 and ENCODE have uncovered a large number of regulatory elements across hundreds of different tissues or cell lines in the human genome. These findings provide an opportunity to study the interaction between regulatory elements and disease-associated genetic variants. Identifying these diseased-related regulatory elements will shed light on understanding the mechanisms of how these variants regulate gene expression and ultimately result in disease formation and progression. Results In this study, we curated and categorized 27,558 Mendelian disease variants, 20,964 complex disease variants, 5,809 cancer predisposing germline variants, and 43,364 recurrent cancer somatic mutations. Compared against nine different types of regulatory regions from FANTOM5 and ENCODE projects, we found that different types of disease variants show distinctive propensity for particular regulatory elements. Mendelian disease variants and recurrent cancer somatic mutations are 22-fold and 10- fold significantly enriched in promoter regions respectively (q<0.001), compared with allele-frequency-matched genomic background. Separate from these two categories, cancer predisposing germline variants are 27-fold enriched in histone modification regions (q<0.001), 10-fold enriched in chromatin physical interaction regions (q<0.001), and 6-fold enriched in transcription promoters (q<0.001). Furthermore, Mendelian disease variants and recurrent cancer somatic mutations share very similar distribution across types of functional effects. We further found that

  13. Experimental and Computational Investigation of Lift-Enhancing Tabs on a Multi-Element Airfoil

    NASA Technical Reports Server (NTRS)

    Ashby, Dale L.


    An experimental and computational investigation of the effect of lift-enhancing tabs on a two-element airfoil has been conducted. The objective of the study was to develop an understanding of the flow physics associated with lift-enhancing tabs on a multi-element airfoil. An NACA 63(2)-215 ModB airfoil with a 30% chord fowler flap was tested in the NASA Ames 7- by 10-Foot Wind Tunnel. Lift-enhancing tabs of various heights were tested on both the main element and the flap for a variety of flap riggings. A combination of tabs located at the main element and flap trailing edges increased the airfoil lift coefficient by 11% relative to the highest lift coefficient achieved by any baseline configuration at an angle of attack of 0 deg, and C(sub 1max) was increased by 3%. Computations of the flow over the two-element airfoil were performed using the two-dimensional incompressible Navier-Stokes code INS2D-UP. The computed results predicted all of the trends observed in the experimental data quite well. In addition, a simple analytic model based on potential flow was developed to provide a more detailed understanding of how lift-enhancing tabs work. The tabs were modeled by a point vortex at the air-foil or flap trailing edge. Sensitivity relationships were derived which provide a mathematical basis for explaining the effects of lift-enhancing tabs on a multi-element airfoil. Results of the modeling effort indicate that the dominant effects of the tabs on the pressure distribution of each element of the airfoil can be captured with a potential flow model for cases with no flow separation.

  14. Elemental abundances of flaring solar plasma - Enhanced neon and sulfur

    NASA Technical Reports Server (NTRS)

    Schmelz, J. T.


    Elemental abundances of two flares observed with the SMM Flat Crystal Spectrometer are compared and contrasted. The first had a gradual rise and a slow decay, while the second was much more impulsive. Simultaneous spectra of seven bright soft X-ray resonance lines provide information over a broad temperature range and are available throughout both flares, making these events unique in the SMM data base. For the first flare, the plasma seemed to be characterized by coronal abundances but, for the second, the plasma composition could not be coronal, photospheric, or a linear combination of both. A good differential emission measure fit required enhanced neon such that Ne/O = 0.32 +/- 0.02, a value which is inconsistent with the current models of coronal abundances based on the elemental first-ionization potential. Similar values of enhanced neon are found for flaring plasma observed by the SMM gamma-ray spectrometer, in (He-3)-rich solar energetic particle events, and in the decay phase of several long duration soft X-ray events. Sulfur is also enhanced in the impulsive flare, but not as dramatically as neon. These events are compared with two models which attempt to explain the enhanced values of neon and sulfur.

  15. Nanoparticle location and material dependent dose enhancement in X-ray radiation therapy

    PubMed Central

    Hossain, Mainul


    Nanoparticles of high atomic number (Z) materials can act as radiosensitizers to enhance radiation dose delivered to tumors. An analytical approach is used to calculate dose enhancements to tumor endothelial cells and their nuclei for a series of nanoparticles (bismuth, gold and platinum) located at different locations relative to nuclei by considering contributions from both photoelectrons and Auger electrons. The ratio of the dose delivered to cells with and without the nanoparticles is known as the dose enhancement factor (DEF). DEFs depend on material composition, size and location of nanoparticles with respect to the cell and the nucleus. Energy of irradiating X-ray beam affects X-ray absorption by nanoparticles and plays an important role in dose enhancements. For diagnostic X-ray sources, bismuth nanoparticles provide higher dose enhancements than gold and platinum nanoparticles for a given nanoparticle size, concentration and location. The highest DEFs are achieved for nanoparticles located closest to the nucleus where energy depositions from short range Auger electrons are maximum. With nanoparticles ranging in diameter between 2-400 nm, the dose enhancement increases with decrease in particle size. The results are useful in finding optimized conditions for nanoparticle enhanced X-ray radiation therapy of cancer. PMID:23393610

  16. Nanoparticle location and material dependent dose enhancement in X-ray radiation therapy.


    Hossain, Mainul; Su, Ming


    Nanoparticles of high atomic number (Z) materials can act as radiosensitizers to enhance radiation dose delivered to tumors. An analytical approach is used to calculate dose enhancements to tumor endothelial cells and their nuclei for a series of nanoparticles (bismuth, gold and platinum) located at different locations relative to nuclei by considering contributions from both photoelectrons and Auger electrons. The ratio of the dose delivered to cells with and without the nanoparticles is known as the dose enhancement factor (DEF). DEFs depend on material composition, size and location of nanoparticles with respect to the cell and the nucleus. Energy of irradiating X-ray beam affects X-ray absorption by nanoparticles and plays an important role in dose enhancements. For diagnostic X-ray sources, bismuth nanoparticles provide higher dose enhancements than gold and platinum nanoparticles for a given nanoparticle size, concentration and location. The highest DEFs are achieved for nanoparticles located closest to the nucleus where energy depositions from short range Auger electrons are maximum. With nanoparticles ranging in diameter between 2-400 nm, the dose enhancement increases with decrease in particle size. The results are useful in finding optimized conditions for nanoparticle enhanced X-ray radiation therapy of cancer.

  17. Harvest locations of goose barnacles can be successfully discriminated using trace elemental signatures.


    Albuquerque, Rui; Queiroga, Henrique; Swearer, Stephen E; Calado, Ricardo; Leandro, Sérgio M


    European Union regulations state that consumers must be rightfully informed about the provenance of fishery products to prevent fraudulent practices. However, mislabeling of the geographical origin is a common practice. It is therefore paramount to develop forensic methods that allow all players involved in the supply chain to accurately trace the origin of seafood. In this study, trace elemental signatures (TES) of the goose barnacle Pollicipes pollicipes, collected from ten sites along the Portuguese coast, were employed to discriminate individual's origin. Barium (Ba), boron (B), cadmium (Cd), chromium (Cr), lithium (Li), magnesium (Mg), manganese (Mn), phosphorous (P), lead (Pb), strontium (Sr) and zinc (Zn) - were quantified using Inductively Coupled Plasma-Mass Spectrometry (ICP-MS). Significant differences were recorded among locations for all elements. A regularized discriminant analysis (RDA) revealed that 83% of all individuals were correctly assigned. This study shows TES can be a reliable tool to confirm the geographic origin of goose barnacles at fine spatial resolution. Although additional studies are required to ascertain the reliability of TES on cooked specimens and the temporal stability of the signature, the approach holds great promise for the management of goose barnacles fisheries, enforcement of conservation policies and assurance in accurate labeling. PMID:27292413

  18. Harvest locations of goose barnacles can be successfully discriminated using trace elemental signatures.


    Albuquerque, Rui; Queiroga, Henrique; Swearer, Stephen E; Calado, Ricardo; Leandro, Sérgio M


    European Union regulations state that consumers must be rightfully informed about the provenance of fishery products to prevent fraudulent practices. However, mislabeling of the geographical origin is a common practice. It is therefore paramount to develop forensic methods that allow all players involved in the supply chain to accurately trace the origin of seafood. In this study, trace elemental signatures (TES) of the goose barnacle Pollicipes pollicipes, collected from ten sites along the Portuguese coast, were employed to discriminate individual's origin. Barium (Ba), boron (B), cadmium (Cd), chromium (Cr), lithium (Li), magnesium (Mg), manganese (Mn), phosphorous (P), lead (Pb), strontium (Sr) and zinc (Zn) - were quantified using Inductively Coupled Plasma-Mass Spectrometry (ICP-MS). Significant differences were recorded among locations for all elements. A regularized discriminant analysis (RDA) revealed that 83% of all individuals were correctly assigned. This study shows TES can be a reliable tool to confirm the geographic origin of goose barnacles at fine spatial resolution. Although additional studies are required to ascertain the reliability of TES on cooked specimens and the temporal stability of the signature, the approach holds great promise for the management of goose barnacles fisheries, enforcement of conservation policies and assurance in accurate labeling.

  19. Harvest locations of goose barnacles can be successfully discriminated using trace elemental signatures

    PubMed Central

    Albuquerque, Rui; Queiroga, Henrique; Swearer, Stephen E.; Calado, Ricardo; Leandro, Sérgio M.


    European Union regulations state that consumers must be rightfully informed about the provenance of fishery products to prevent fraudulent practices. However, mislabeling of the geographical origin is a common practice. It is therefore paramount to develop forensic methods that allow all players involved in the supply chain to accurately trace the origin of seafood. In this study, trace elemental signatures (TES) of the goose barnacle Pollicipes pollicipes, collected from ten sites along the Portuguese coast, were employed to discriminate individual’s origin. Barium (Ba), boron (B), cadmium (Cd), chromium (Cr), lithium (Li), magnesium (Mg), manganese (Mn), phosphorous (P), lead (Pb), strontium (Sr) and zinc (Zn) - were quantified using Inductively Coupled Plasma−Mass Spectrometry (ICP-MS). Significant differences were recorded among locations for all elements. A regularized discriminant analysis (RDA) revealed that 83% of all individuals were correctly assigned. This study shows TES can be a reliable tool to confirm the geographic origin of goose barnacles at fine spatial resolution. Although additional studies are required to ascertain the reliability of TES on cooked specimens and the temporal stability of the signature, the approach holds great promise for the management of goose barnacles fisheries, enforcement of conservation policies and assurance in accurate labeling. PMID:27292413

  20. An AP-2 element acts synergistically with the cyclic AMP- and Phorbol ester-inducible enhancer of the human proenkephalin gene

    SciTech Connect

    Hyman, S.E.; Comb, M.; Pearlberg, J.; Goodman, H.M.


    An enhancer with two DNA elements, one containing the sequence CGTCA, is required for cyclic AMP-and phorbol ester-inducible transcription of the human proenkephalin gene. The authors report that an AP-2 element located adjacent to the enhancer acts synergistically with it to confer maximal response to cyclic AMP and phorbol esters.

  1. Mutations in ash1 and trx enhance P-element-dependent silencing in Drosophila melanogaster.


    McCracken, Allen; Locke, John


    In Drosophila melanogaster, the mini-w(+) transgene in Pci is normally expressed throughout the adult eye; however, when other P or KP elements are present, a variegated-eye phenotype results, indicating random w(+) silencing during development called P-element-dependent silencing (PDS). Mutant Su(var)205 and Su(var)3-7 alleles act as haplo-suppressors/triplo-enhancers of this variegated phenotype, indicating that these heterochromatic modifiers act dose dependently in PDS. Previously, we recovered a spontaneous mutation of P{lacW}ci(Dplac) called P{lacW}ci(DplacE1) (E1) that variegated in the absence of P elements, presumably due to the insertion of an adjacent gypsy element. From a screen for genetic modifiers of E1 variegation, we describe here the isolation of five mutations in ash1 and three in trx that enhance the E1 variegated phenotype in a dose-dependent and cumulative manner. These mutant alleles enhance PDS at E1, and in E1/P{lacW}ci(Dplac), but suppress position effect variegation (PEV) at In(1)w(m)(4). This opposite action is consistent with a model where ASH1 and TRX mark transcriptionally active chromatin domains. If ASH1 or TRX function is lost or reduced, heterochromatin can spread into these domains creating a sink that diverts heterochromatic proteins from other variegating locations, which then may express a suppressed phenotype.

  2. Mutations in ash1 and trx enhance P-element-dependent silencing in Drosophila melanogaster.


    McCracken, Allen; Locke, John


    In Drosophila melanogaster, the mini-w(+) transgene in Pci is normally expressed throughout the adult eye; however, when other P or KP elements are present, a variegated-eye phenotype results, indicating random w(+) silencing during development called P-element-dependent silencing (PDS). Mutant Su(var)205 and Su(var)3-7 alleles act as haplo-suppressors/triplo-enhancers of this variegated phenotype, indicating that these heterochromatic modifiers act dose dependently in PDS. Previously, we recovered a spontaneous mutation of P{lacW}ci(Dplac) called P{lacW}ci(DplacE1) (E1) that variegated in the absence of P elements, presumably due to the insertion of an adjacent gypsy element. From a screen for genetic modifiers of E1 variegation, we describe here the isolation of five mutations in ash1 and three in trx that enhance the E1 variegated phenotype in a dose-dependent and cumulative manner. These mutant alleles enhance PDS at E1, and in E1/P{lacW}ci(Dplac), but suppress position effect variegation (PEV) at In(1)w(m)(4). This opposite action is consistent with a model where ASH1 and TRX mark transcriptionally active chromatin domains. If ASH1 or TRX function is lost or reduced, heterochromatin can spread into these domains creating a sink that diverts heterochromatic proteins from other variegating locations, which then may express a suppressed phenotype. PMID:27373142

  3. Functional characterization of the GDEP promoter and three enhancer elements in retinoblastoma and prostate cell lines.


    Cross, D S; Burmester, J K


    GDEP (gene differentially expressed in prostate cancer aka. PCAN1), a newly discovered gene with remarkable tissue specificity, is a promising candidate for regulatory analysis because it exhibits a high level of expression that is limited to two tissues, the retina and the prostate. As these two tissues have different origins and disparate functions it is likely that the regulatory mechanisms responsible for expression are not shared in their entirety. In addition, both the retina and prostate are prime targets for gene therapy. To date there have been no functional studies of the GDEP promoter. Therefore to understand tissue-specific expression of GDEP we constructed promoter expression constructs. To further characterize functional regulatory regions within the GDEP gene, we investigated potential regulatory components for tissue-specific expression in the 40 kb intron of this gene. We have identified a 1.5 kb prostate-specific promoter from the proximal region of the GDEP gene. A smaller 0.5 kb promoter exhibited minimal activity in the retinoblastoma cell line Y79, but not in the prostate cells tested. In addition we have investigated three enhancer elements located in the 40 kb intron of the GDEP gene. We identified two enhancer elements that increase reporter gene expression in prostate cell line LNCaP and one additional enhancer element that increases expression in the Y79 cell line approximately 8-fold making it a strong retinal-specific enhancer. PMID:18188713

  4. Modelling elemental carbon at regional, urban and traffic locations in The Netherlands

    NASA Astrophysics Data System (ADS)

    Keuken, M. P.; Zandveld, P.; Jonkers, S.; Moerman, M.; Jedynska, A. D.; Verbeek, R.; Visschedijk, A.; Elshout van den, S.; Panteliadis, P.; Velders, G. J. M.


    The annual concentration of elemental carbon (EC) has been derived for The Netherlands in 2011. National emissions contribute 55% to the average EC concentration in the Netherlands. About 65% of the national contribution comes from emissions from road traffic and about 35% from other mobile sources (15%), households (14%), shipping (4%) and other combustion sources (2%). Conversion factors were established to compare different methods of EC measurement such as Black Smoke, Black Carbon and thermal analysis. The measured regional and urban background concentrations and variability were 0.5 ± 0.1 and 0.9 ± 0.1 μg EC per m3, respectively. The ratios between modelled and measured regional and urban background concentrations were 1.6 ± 0.5 and 1.8 ± 0.4, respectively. The modelled values are likely to be overestimated. The modelled and measured traffic contributions to EC concentrations near motorways and in street canyons were in the range 1.1-1.3 μg m-3 with total EC concentrations of 2.0 and 2.2 μg m-3, respectively. Our study showed that EC concentrations near intense traffic are increased with a factor 2-4 as compared to the urban and regional background, respectively. Consequently there is a similar variation in exposure and potential health effects in the population. More measurements of EC are required to improve modelling of EC concentrations in particular at urban background and near traffic locations.

  5. Location of caspase 3-like protease in the development of sieve element and tracheary element of stem in Cucurbita moschata.


    Hao, Xia; Qian, Jie; Xu, Shan; Song, Xin; Zhu, Jian


    The casepase is considered to regulate the process of programmed cell death in the development of organisms. In this study, caspase 3-like protease was detected by immunohistochemistry and immunoelectron microscopy during the development of sieve element and tracheary element of stem in Cucurbita moschata Duch. Antibody with brown color (under light microscopy) and gold particles (under transmission electron microscopy) for detecting caspase 3-like protease was mainly displayed in inner phloem, external phloem and xylem in the region close to procambium. From the results it was considered that caspase 3-like protease did exist in vascular elements and played different roles during the development of sieve and tracheary elements, and different types of programmed cell death might be carried out. The caspase 3-like protease mainly participated in making cytoplasmic streaming cease and in degrading P-protein bodies; however, it rarely participated in the function for signal transferring in the developmental sieve element. However, it might induce calcium accumulation for rupturing the tonoplast in the signal of PCD in the developmental tracheary element.

  6. Enhancement of the visibility of objects located below the surface of a scattering medium


    Demos, Stavros


    Techniques are provided for enhancing the visibility of objects located below the surface of a scattering medium such as tissue, water and smoke. Examples of such an object include a vein located below the skin, a mine located below the surface of the sea and a human in a location covered by smoke. The enhancement of the image contrast of a subsurface structure is based on the utilization of structured illumination. In the specific application of this invention to image the veins in the arm or other part of the body, the issue of how to control the intensity of the image of a metal object (such as a needle) that must be inserted into the vein is also addressed.

  7. Method of locating a leaking fuel element in a fast breeder power reactor


    Honekamp, John R.; Fryer, Richard M.


    Leaking fuel elements in a fast reactor are identified by measuring the ratio of .sup.134 Xe to .sup.133 Xe in the reactor cover gas following detection of a fuel element leak, this ratio being indicative of the power and burnup of the failed fuel element. This procedure can be used to identify leaking fuel elements in a power breeder reactor while continuing operation of the reactor since the ratio measured is that of the gases stored in the plenum of the failed fuel element. Thus, use of a cleanup system for the cover gas makes it possible to identify sequentially a multiplicity of leaking fuel elements without shutting the reactor down.


    SciTech Connect



    Washington River Protection Solutions, LLC (WRPS) developed an enhanced single-shell tank (SST) integrity project in 2009. An expert panel on SST integrity was created to provide recommendations supporting the development of the project. One primary recommendation was to expand the leak assessment reports (substitute report or LD-1) to include leak causes and locations. The recommendation has been included in the M-045-9IF Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) as one of four targets relating to SST leak integrity. The 241-SX Farm (SX Farm) tanks with leak losses were addressed on an individual tank basis as part of LD-1. Currently, 8 out of 23 SSTs that have been reported to having a liner leak are located in SX Farm. This percentage was the highest compared to other tank farms which is why SX Farm was analyzed first. The SX Farm is comprised of fifteen SSTs built 1953-1954. The tanks are arranged in rows of three tanks each, forming a cascade. Each of the SX Farm tanks has a nominal I-million-gal storage capacity. Of the fifteen tanks in SX Farm, an assessment reported leak losses for the following tanks: 241-SX-107, 241-SX-108, 241-SX-109, 241-SX-111, 241-SX-112, 241-SX-113, 241-SX-114 and 241-SX-115. The method used to identify leak location consisted of reviewing in-tank and ex-tank leak detection information. This provided the basic data identifying where and when the first leaks were detected. In-tank leak detection consisted of liquid level measurement that can be augmented with photographs which can provide an indication of the vertical leak location on the sidewall. Ex-tank leak detection for the leaking tanks consisted of soil radiation data from laterals and drywells near the tank. The in-tank and ex-tank leak detection can provide an indication of the possible leak location radially around and under the tank. Potential leak causes were determined using in-tank and ex-tank information that is not directly related to

  9. Single-Shell Tanks Leak Integrity Elements/ SX Farm Leak Causes and Locations - 12127

    SciTech Connect

    Girardot, Crystal; Harlow, Don; Venetz, Theodore; Washenfelder, Dennis; Johnson, Jeremy


    Washington River Protection Solutions, LLC (WRPS) developed an enhanced single-shell tank (SST) integrity project in 2009. An expert panel on SST integrity was created to provide recommendations supporting the development of the project. One primary recommendation was to expand the leak assessment reports (substitute report or LD-1) to include leak causes and locations. The recommendation has been included in the M-045-91F Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) as one of four targets relating to SST leak integrity. The 241-SX Farm (SX Farm) tanks with leak losses were addressed on an individual tank basis as part of LD-1. Currently, 8 out of 23 SSTs that have been reported to having a liner leak are located in SX Farm. This percentage was the highest compared to other tank farms which is why SX Farm was analyzed first. The SX Farm is comprised of fifteen SSTs built 1953-1954. The tanks are arranged in rows of three tanks each, forming a cascade. Each of the SX Farm tanks has a nominal 1-million-gal storage capacity. Of the fifteen tanks in SX Farm, an assessment reported leak losses for the following tanks: 241-SX-107, 241-SX-108, 241-SX-109, 241-SX- 111, 241-SX-112, 241-SX-113, 241-SX-114 and 241-SX-115. The method used to identify leak location consisted of reviewing in-tank and ex-tank leak detection information. This provided the basic data identifying where and when the first leaks were detected. In-tank leak detection consisted of liquid level measurement that can be augmented with photographs which can provide an indication of the vertical leak location on the sidewall. Ex-tank leak detection for the leaking tanks consisted of soil radiation data from laterals and dry-wells near the tank. The in-tank and ex-tank leak detection can provide an indication of the possible leak location radially around and under the tank. Potential leak causes were determined using in-tank and ex-tank information that is not directly related to

  10. Dispersive Elements for Enhanced Laser Gyroscopy and Cavity Stabilization

    NASA Technical Reports Server (NTRS)

    Smith, David D.; Chang, Hongrok; Diels, J. C.


    We analyze the effect of a highly dispersive element placed inside a modulated optical cavity on the frequency and amplitude of the modulation to determine the conditions for cavity self-stabilization and enhanced gyroscopic sensitivity. We find an enhancement in the sensitivity of a laser gyroscope to rotation for normal dispersion, while anomalous dispersion can be used to self-stabilize an optical cavity. Our results indicate that atomic media, even coherent superpositions in multilevel atoms, are of limited use for these applications, because the amplitude and phase filters work against one another, i.e., decreasing the modulation frequency increases its amplitude and vice-versa. On the other hand, for optical resonators the dispersion reversal associated with critical coupling enables the amplitude and phase filters to work together. We find that for over-coupled resonators, the absorption and normal dispersion on-resonance increase the contrast and frequency of the beat-note, respectively, resulting in a substantial enhancement of the gyroscopic response. Under-coupled resonators can be used to stabilize the frequency of a laser cavity, but result in a concomitant increase in amplitude fluctuations. As a more ideal solution we propose the use of a variety of coupled-resonator-induced transparency that is accompanied by anomalous dispersion.

  11. The Canadian Geo-location Endeavour Using Isotopes and Trace Elements in Hair

    NASA Astrophysics Data System (ADS)

    Chartrand, Michelle M. G.; St-Jean, Gilles; Dalpe, Claude; Wojtyk, James


    The Canadian human hair provenance project has two main objectives: 1) to build a Canadian database of isotopes and trace elements from tap water and hair samples, and 2) to assess the extent of temporal effects on these samples. To address objective 1, a cross-Canada sampling campaign has been started to collect hair and tap water samples. In the past two years, our group has collected samples from the eastern part of Canada (Newfoundland, Nova Scotia, New Brunswick, Prince Edward Island, Quebec and Ontario). Water samples are divided into three groups - groundwater, surface water and bottled water. The GIS maps show the isotopic distribution of the tap water sources varies with latitude. Hair is analyzed for carbon (C), nitrogen (N) and hydrogen (H) isotopes. The C and N results show that in general, Canadians eat a typical diet showing a small isotopic variation. However, some cases will be presented which may explain why some people have C and N values outlying the collected sample average. In terms of H isotopes in human hair, GIS maps illustrate the distribution of this isotope in the eastern provinces of Canada. In some cases, a large variation in H was observed for the same locality with no significant difference in human activities and/or consumption. However, based on hair collected from across Canada from previous years, H isotopes in hair show a correlation to water collected from the same locality. To address objective 2, hair and tap water samples were collected at 4 month intervals (to represent different seasons in Canada) from several volunteers residing in two cities located in the province of Ontario (i.e. Sudbury and Ottawa) and one city from the province of Quebec (i.e. Montreal). For all isotopes measured, there was little variation observed over the course of the year in any individual from those small to medium-size cities. On-going sampling efforts will address if any variation may occur on a yearly basis.

  12. Effects and limitations of elemental sulphur applications for enhanced phytoextraction.


    Fässler, Erika; Stauffer, Werner; Gupta, Satish K; Schulin, Rainer


    The application of elemental sulphur (S) to heavy metal contaminated soils is a strategy to increase metal extraction by plants. Here, we examined to which degree the efficiency of phytoextraction could be enhanced by increasing the S application rate on afield where S had already been applied for 6 years. For this purpose, the field experiment was continued for another two years doubling the S application rate on half of the S treatment plots, while continuing application at the previous rate on the other half. Doubling the application rate significantly accelerated the dissolution of calcite and the decrease in soil pH and also increased cadmium (Cd) and zinc (Zn) uptake by sunflower and tobacco. But even in a best-case-scenario remediation of the site would still take more than a century. The results indicate that we reached the maximum potential of S application to enhance metal phytoextraction on the study site. Further decrease in pH by additional S applications would bear an excessive risk of decreasing yields and increasing metal leaching out of the root zone. PMID:22908636

  13. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.


    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R


    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  14. 20 CFR 655.536 - The third attestation element for locations in Alaska: No intention or design to influence...

    Code of Federal Regulations, 2010 CFR


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false The third attestation element for locations in Alaska: No intention or design to influence bargaining representative election. 655.536 Section... Alaska: No intention or design to influence bargaining representative election. (a) The employer...

  15. Identifier (ID) elements are not preferentially located to brain-specific genes: high ID element representation in other tissue-specific- and housekeeping genes of the rat.


    Goldman, Andrés; Capoano, Carlos A; González-López, Evangelina; Geisinger, Adriana


    BC1 is a short non-coding RNA from rodents, which is transcribed by RNA pol III. Its RNA is highly abundant in the brain, where it exerts a post-transcriptional regulatory role in dendrites. Upon transcription, retroposition and insertion, BC1 gives rise to a subclass of short interspersed repetitive sequences (SINEs) named identifier (ID) elements. IDs can become integrated inside non-coding regions of RNA pol II transcription units, and - although challenged by a couple of reports - their preferential location to brain-specific genes has been long proposed. Furthermore, an additional, cis-regulatory role in the control of brain-specific pol II-directed transcripts has been suggested for these sequences. In this work we used Northern blot and in silico analyses to examine IDs' location among pol II transcription units in different tissues, and in housekeeping genes. ID sequences appeared distributed in a similar fashion within tissue-specific hnRNA populations of the brain, testis and liver, and within housekeeping primary transcripts as well. Moreover, when the lengths of the unprocessed transcripts were considered, ID representation was higher in housekeeping ones. On the other hand, ID elements appeared similarly distributed among the different gene regions, with the obvious exclusion of those sequences where strict constraints for proper gene expression exist. Altogether, the widespread distribution of ID elements in all the analyzed genes - including housekeeping - and in all gene regions, suggests a random location, raising questions about the specific cis-regulatory role of those sequences.

  16. Two locations, two times, and the element set. [applicable to orbit determination of artificial satellites

    NASA Technical Reports Server (NTRS)

    Taff, L. G.; Randall, P. M. S.


    A robust analytical formulation is developed to apply classical initial orbital determination to artificial satellites whose locations are uncertain to about 1 cu km and separated in time by no more than 30 min. An analytical simplification reduces Gauss's method, iteration on the semilatus rectum, iteration on the true anomaly, and the Lambert-Euler technique, to the solution of a single equation in one unknown, instead of the usual coupled triplet of three equations in three unknowns. The method is demonstrated for all common artificial satellite orbits over a variety of time intervals between the two location vectors, and for a varied set of position and distance errors.

  17. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    SciTech Connect

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.; Gartside, C.L.; Hauschka, S.D.


    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer. This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.

  18. Trans-silencing by P elements inserted in subtelomeric heterochromatin involves the Drosophila Polycomb group gene, Enhancer of zeste.

    PubMed Central

    Roche, S E; Rio, D C


    Drosophila P-element transposition is regulated by a maternally inherited state known as P cytotype. An important aspect of P cytotype is transcriptional repression of the P-element promoter. P cytotype can also repress non-P-element promoters within P-element ends, suggesting that P cytotype repression might involve chromatin-based transcriptional silencing. To learn more about the role of chromatin in P cytotype repression, we have been studying the P strain Lk-P(1A). This strain contains two full-length P elements inserted in the heterochromatic telomere-associated sequences (TAS elements) at cytological location 1A. Mutations in the Polycomb group gene (Pc-G gene), Enhancer of zeste (E(z)), whose protein product binds at 1A, resulted in a loss of Lk-P(1A) cytotype control. E(z) mutations also affected the trans-silencing of heterologous promoters between P-element termini by P-element transgenes inserted in the TAS repeats. These data suggest that pairing interactions between P elements, resulting in exchange of chromatin structures, may be a mechanism for controlling the expression and activity of P elements. PMID:9691041

  19. Elemental characterization of urban particulates at receptor locations in Abuja, north-central Nigeria

    NASA Astrophysics Data System (ADS)

    Abiye, Olawale Emmanuel; Obioh, Imoh B.; Ezeh, Godwin C.


    The rising population and increasing urban infrastructures of Abuja have led to increased pressure on the urban environment. Two decades after putting the city of Abuja to use, there is yet no information on the air quality status of the city. Hence, this study was conducted in order to assess the mass concentration and elemental characterization of airborne particulate matter in Abuja, north-central Nigeria. Sampling of PM2.5: aerodynamic diameter ≤2.5 μm and PM10: aerodynamic diameter ≤10 μm were carried out in five urban sites within the city from April, 2009 to May, 2010. "Gent" stacked filter unit sampler equipped with a double stage filters in series was employed for sample collection. Charged helium (4He+) Particle Induced X-ray Emission technique of 2500 keV particle energy and Genie 2000 software were used for spectra acquisition while elemental characterization was achieved using Gupixwin software in order to determine the concentration of eighteen elements (Si, S, K, Ca, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Cd, Sn, Ba, Ta and Pb). Mass concentrations range between 7-86 μg m-3 and 22-343 μg m-3 for PM2.5 and PM10 respectively. Crustal elements (Si, Ca, and Fe) were found to be predominant in PM10 than in PM2.5 fraction with very high values. Positive correlation r > 0.90 and r > 0.53 to 0.90 exist between metals (V, Co, Ni, Cd, Zn and Pb). PM2.5/PM10 mass ratios were well within the range specified by WHO for developing urban scenario.

  20. Time elements for enhanced performance of the Dromo orbit propagator

    SciTech Connect

    Baù, Giulio; Bombardelli, Claudio E-mail:


    We propose two time elements for the orbit propagator named Dromo. One is linear and the other constant with respect to the independent variable, which coincides with the osculating true anomaly in the Keplerian motion. They are defined from a generalized Kepler's equation written for negative values of the total energy and, unlike the few existing time elements of this kind, are free of singularities. To our knowledge it is the first time that a constant time element is associated with a second-order Sundman time transformation. Numerical tests to assess the performance of the Dromo method equipped with a time element show the remarkable improvement in accuracy for the perturbed bounded motion around the Earth compared to the case in which the physical time is a state variable. Moreover, the method is competitive with and even better than other efficient sets of elements. Finally, we also derive a time element for a null and positive total energy.

  1. Optical signal processing of video surveillance for recognizing and measurement location railway infrastructure elements

    NASA Astrophysics Data System (ADS)

    Diyazitdinov, Rinat R.; Vasin, Nikolay N.


    Processing of optical signals, which are received from CCD sensors of video cameras, allows to extend the functionality of video surveillance systems. Traditional video surveillance systems are used for saving, transmitting and preprocessing of the video content from the controlled objects. Video signal processing by analytics systems allows to get more information about object's location and movement, the flow of technological processes and to measure other parameters. For example, the signal processing of video surveillance systems, installed on carriage-laboratories, are used for getting information about certain parameters of the railways. Two algorithms for video processing, allowing recognition of pedestrian crossings of the railways, as well as location measurement of the so-called "Anchor Marks" used to control the mechanical stresses of continuous welded rail track are described in this article. The algorithms are based on the principle of determining the region of interest (ROI), and then the analysis of the fragments inside this ROI.

  2. Quasi-optimal locations of piezo-elements on a rectangular plate

    NASA Astrophysics Data System (ADS)

    Koszewnik, Andrzej; Gosiewski, Zdzisław


    The optimal location of piezo-actuators and piezo-sensors for the vibration control of a rectangular plate with SFSF (Simply Supported - Free - Simply Supported - Free) boundary conditions is presented in the paper. Based on bending moments, Mx(x,y) and My(x,y), the modal control forces generated by the piezo-stripes are calculated for the first five mode shapes. Calculations are carried out for different locations of two piezo-strips directed along the X and Y axes. The obtained results are used to define performance indexes of modal control forces for the two considered directions of vibration. In a similar way the modal unit elongations of the piezo-sensors are calculated for two different orientations of the piezos on the plate. Based on these results the objective cost functions J_{ɛ - odd} and J_{ɛ - even} are defined separately for odd and even modes. The quasi-optimal locations of the piezo-actuators and piezo-sensors are determined by maximizing the proposed cost functions. After analytical and numerical investigations the process of the full model identification is carried out at the laboratory stand. A chirp signal is applied in the identification process. The rectangular plate is excited with the chirp force while output signals are measured by the piezo-sensors oriented in the perpendicular directions X and Y. In such a way two mathematical models are obtained to control the vibration of the plate separately for odd and even natural modes.-1

  3. VIP gene transcription is regulated by far upstream enhancer and repressor elements.


    Liu, D; Krajniak, K; Chun, D; Sena, M; Casillas, R; Lelièvre, V; Nguyen, T; Bravo, D; Colburn, S; Waschek, J A


    SK-N-SH human neuroblastoma subclones differ widely in basal and second messenger induction of the gene encoding the neuropeptide vasoactive intestinal peptide (VIP). These differences were recapitulated by a chimeric gene which consisted of 5.2 kb of the human VIP gene 5' flanking sequence fused to a reporter. Subsequent gene deletion experiments revealed several regulatory regions on the gene, including a 645-bp sequence located approximately 4.0 upstream from the transcription start site. Here we examined this upstream region in detail. Inhibitory sequences were found to be present on each end of the 645-bp fragment. When removed, basal transcription increased more than 50-fold. Subsequent deletion/mutation analysis showed that the 213-bp fragment contained at least two enhancer elements. One of these was localized to an AT-rich 42-bp sequence shown by others to bind Oct proteins in neuroblastoma cells, while the other corresponded to a composite AP-1/ets element. In addition to these enhancers, a 28-bp sequence on the 213-bp fragment with no apparent homology to known silencers inhibited transcription. The studies provide molecular details of a complex regulatory region on the VIP gene that is likely to be used to finely tune the level of gene transcription in vivo.

  4. Baseline System Costs for 50.0 MW Enhanced Geothermal System -- A Function of: Working Fluid, Technology, and Location, Location, Location

    SciTech Connect

    Dunn, Paul; Selman, Nancy; Volpe, Anthony Della; Moss, Deborah; Mobley, Rick; Dickey, Halley; Unruh, Jeffery; Hitchcock, Chris; Tanguay, Jasmine; Butler, Steven; Stacey, Robert; Robertson-Tait, Ann; Pruess, Karsten; Gutoski, Greg; Fay, Jamie M.; Stitzer, John T.; Oglesby, Ken


    Substantial unexploited opportunity exists for the US, and the world, in Enhanced Geothermal Systems (EGS). As a result of US DOE investment, new drilling technology, new power generation equipment and cycles enable meaningful power production, in a compact and modular fashion; at lower and lower top side EGS working fluid temperatures and in a broader range of geologies and geographies. This cost analysis effort supports the expansion of Enhanced Geothermal Systems (EGS), furthering DOE strategic themes of energy security and sub goal of energy diversity; reducing the Nation's dependence on foreign oil while improving the environment.

  5. Bmp2 Transcription in Osteoblast Progenitors Is Regulated by a Distant 3′ Enhancer Located 156.3 Kilobases from the Promoter▿ †

    PubMed Central

    Chandler, Ronald L.; Chandler, Kelly J.; McFarland, Karen A.; Mortlock, Douglas P.


    Bone morphogenetic protein 2 (encoded by Bmp2) has been implicated as an important signaling ligand for osteoblast differentiation and bone formation and as a genetic risk factor for osteoporosis. To initially survey a large genomic region flanking the mouse Bmp2 gene for cis-regulatory function, two bacterial artificial chromosome (BAC) clones that extend far upstream and downstream of the gene were engineered to contain a lacZ reporter cassette and tested in transgenic mice. Each BAC clone directs a distinct subset of normal Bmp2 expression patterns, suggesting a modular arrangement of distant Bmp2 regulatory elements. Strikingly, regulatory sequences required for Bmp2 expression in differentiating osteoblasts, as well as tooth buds, hair placodes, kidney, and other tissues, are located more than 53 kilobases 3′ to the promoter. By testing BACs with engineered deletions across this distant 3′ region, we parsed these regulatory elements into separate locations and more closely refined the location of the osteoblast progenitor element. Finally, a conserved osteoblast progenitor enhancer was identified within a 656-bp sequence located 156.3 kilobases 3′ from the promoter. The identification of this enhancer should permit further investigation of upstream regulatory mechanisms that control Bmp2 transcription during osteoblast differentiation and are relevant to further studies of Bmp2 as a candidate risk factor gene for osteoporosis. PMID:17283059

  6. True-3D accentuating of grids and streets in urban topographic maps enhances human object location memory.


    Edler, Dennis; Bestgen, Anne-Kathrin; Kuchinke, Lars; Dickmann, Frank


    Cognitive representations of learned map information are subject to systematic distortion errors. Map elements that divide a map surface into regions, such as content-related linear symbols (e.g. streets, rivers, railway systems) or additional artificial layers (coordinate grids), provide an orientation pattern that can help users to reduce distortions in their mental representations. In recent years, the television industry has started to establish True-3D (autostereoscopic) displays as mass media. These modern displays make it possible to watch dynamic and static images including depth illusions without additional devices, such as 3D glasses. In these images, visual details can be distributed over different positions along the depth axis. Some empirical studies of vision research provided first evidence that 3D stereoscopic content attracts higher attention and is processed faster. So far, the impact of True-3D accentuating has not yet been explored concerning spatial memory tasks and cartography. This paper reports the results of two empirical studies that focus on investigations whether True-3D accentuating of artificial, regular overlaying line features (i.e. grids) and content-related, irregular line features (i.e. highways and main streets) in official urban topographic maps (scale 1/10,000) further improves human object location memory performance. The memory performance is measured as both the percentage of correctly recalled object locations (hit rate) and the mean distances of correctly recalled objects (spatial accuracy). It is shown that the True-3D accentuating of grids (depth offset: 5 cm) significantly enhances the spatial accuracy of recalled map object locations, whereas the True-3D emphasis of streets significantly improves the hit rate of recalled map object locations. These results show the potential of True-3D displays for an improvement of the cognitive representation of learned cartographic information.

  7. Enhanced phytoextraction of germanium and rare earth elements - a rhizosphere-based approach

    NASA Astrophysics Data System (ADS)

    Wiche, Oliver


    Germanium (Ge) and rare earth elements (REEs) are economically valuable raw materials that have become an integral part of our modern high tech society. While most of these elements are not actually rare in terms of general amounts in the earth's crust, they are rarely found in sufficient abundances in single locations for their mining to be economically viable. The average concentration of Ge in soils is estimated at 1.6 μg g-1. The REEs comprise a group of 16 elements including La, the group of lanthanides and Y that are abundant in the earth crust with concentrations varying from 35 μg g-1 (La), 40 μg g-1 (Nd), 6 μg g-1 (Gd) and 3.5 μg g-1 (Er) to 0.5 μg g-1 in Tm. Thus, a promising chance to improve supply of these elements could be phytomining. Unfortunately, bioavailability of Ge and REEs in soils appears to be low, in particular in neutral or alkaline soils. A sequential dissolution analysis of 120 soil samples taken from the A-horizons of soils in the area of Freiberg (Saxony, Germany) revealed that only 0.2% of total Ge and about 0.5% of La, Nd, Gd and Er of bulk concentrations were easily accessible by leaching with NH4-acetate (pH 7). Most of the investigated elements were bound to Fe-/Mn-oxides and silicates and were therefore only poorly available for plant uptake. Here we report an environmentally friendly approach for enhanced phytoextraction of Ge and REEs from soils using mixed cultures of plant species with efficient mechanisms for the acquisition of nutrients in the rhizosphere. The rhizosphere is characterized as the zone in soil sourrounding a plant root that consists of a gradient in chemical, physical and biological soil properties driven by rhizodeposits like carboxylates and protons. Some species like white lupin (Lupinus albus) are able to excrete large amounts of organic acid anions(predominantly citrate and malate) and show a particularly high potential for the acidification of the rhizosphere. In our experiments, mixed cultures

  8. Relation between the location of elements in the periodic table and various organ-uptake rates.


    Ando, A; Ando, I; Hiraki, T; Hisada, K


    Fifty four elements and 65 radioactive compounds were examined to determine the organ uptake rates for rats 3, 24 and 48 h after i.v. injection of these compounds. They were prepared as carrier free nuclides, or containing a small amount of stable nuclide. Generally speaking, behaviors of K, Rb, Cs and Tl in all the organs were very similar to one another, but they differed from that of Na. Bivalent hard acids were avidly taken up into bone; therefore, uptake rates in soft tissues were very small. Hard acids of tri-, quadri- and pentavalence which were taken up into the soft tissue organs decreased more slowly from these organs than other ions. Soft acids such as Hg2+ were bound very firmly to the component in the kidney. Anions (with few exceptions), GeCl4 and SbCl3 were rapidly excreted in urine, so that the uptake rates in organs were low.

  9. Relation between the location of elements in the periodic table and various organ-uptake rates.


    Ando, A; Ando, I; Hiraki, T; Hisada, K


    Fifty four elements and 65 radioactive compounds were examined to determine the organ uptake rates for rats 3, 24 and 48 h after i.v. injection of these compounds. They were prepared as carrier free nuclides, or containing a small amount of stable nuclide. Generally speaking, behaviors of K, Rb, Cs and Tl in all the organs were very similar to one another, but they differed from that of Na. Bivalent hard acids were avidly taken up into bone; therefore, uptake rates in soft tissues were very small. Hard acids of tri-, quadri- and pentavalence which were taken up into the soft tissue organs decreased more slowly from these organs than other ions. Soft acids such as Hg2+ were bound very firmly to the component in the kidney. Anions (with few exceptions), GeCl4 and SbCl3 were rapidly excreted in urine, so that the uptake rates in organs were low. PMID:2715001

  10. Regulation of Dlx3 gene expression in visceral arches by evolutionarily conserved enhancer elements

    SciTech Connect

    Kenta Sumiyama; Frank H. Ruddle


    The mammalian Distal-less (Dlx) clusters (Dlx1-2, Dlx5-6, and Dlx3-7) have a nested expression pattern in developing visceral (branchial) arches. Genetic regulatory mechanisms controlling Dlx spatial expression within the visceral arches have not yet been defined. Here we show that an enhancer in the Dlx3-7 cluster can regulate the visceral arch specific expression pattern of the Dlx3 gene. We have used a 79-kb transgene construct containing the entire Dlx3-7 bigene cluster with a LacZ reporter inserted in frame in the first exon of the Dlx3 gene. Visceral arch expression is absent when a 4-kb element located within the Dlx3-7 intergenic region is deleted. A 245-bp element (I37-2) whose DNA sequence is highly conserved between human and mouse located within the 4kb-deleted region can drive visceral arch expression when fused to a hsp68-lacZ reporter transgene construct. Reporter expression is detected in 9.5 and 10.5 days postcoitum transgenic embryos in a manner consistent with the endogenous Dlx3 expression pattern in the mesenchyme of the first and second visceral arches. Thus the I37-2 element is both necessary and sufficient for Dlx3 expression. The I37-2 element contains several putative binding sites for several transcription factors including Dlx and other homeodomain proteins within the evolutionarily conserved region. Significantly, the I37-2 element shows a sequence-match including a Dlx binding site to a cis-element in the Dlx5-6 intermediate region designated mI56i [Zerucha, T., Stuhmer, T., Hatch, G., Park, B. K., Long, Q., Yu, G., Gambarotta, A., Schultz, J. R., Rubenstein, J. L. & Ekker, M. (2000) J. Neurosci. 20, 709-721], despite distant phylogenetic relationship between these clusters. Our results provide evidence for a concerted role for DLX auto- and cross-regulation in the establishment of a nested expression pattern for Dlx3-7 and Dlx5-6 clusters within the visceral arches.

  11. Relation between the location of elements in the periodic table and tumor-uptake rate.


    Ando, A; Ando, I; Hiraki, T; Hisada, K


    The bipositive ions and anions, with few exceptions, indicated a low tumor uptake rate. On the other hand, compounds of Hg, Au and Bi, which have a strong binding power to protein, showed a high tumor uptake rate. As Hg2+, Au+ and Bi3+ are soft acids according to the classification of Lewis acids, it was thought that these ions would bind strongly to soft bases (R-SH, R-S-) present in tumor tissue. For many hard acids such as 85Sr2+, 67Ga3+, 181Hf4+, and 95Nb5+, tumor uptake rates are shown as a function of ionic potentials (valency/ionic radii) of the metal ions. Considering the present data and previously reported results, it was presumed that hard acids of trivalence, quadrivalence and pentavalence would replace calcium in the calcium salts of hard bases (calcium salts of acid mucopolysaccharides, etc.). Ionic potentials of alkaline metals and Tl were small, but the tumor-uptake rate of these elements indicated various values. As Ge and Sb are bound by covalent bonds to chloride, GeCl4 and SbCl3 behaved differently from many metallic compounds in tumor tissue.

  12. [Relation between location of elements in periodic table and affinity for the malignant tumor (author's transl)].


    Ando, A; Hisada, K; Ando, I


    Affinity of many inorganic compounds for the malignant tumor was examined, using the rats which were subcutaneously transplanted with Yoshida sarcoma. And the relations between the uptake rate into the malignant tumor and in vitro binding power to the protein were investigated in these compounds. In these experiments, the bipositive ions and anions had not affinity for the tumor tissue with a few exceptions. On the other hand, Hg, Au and Bi, which have strong binding power to the protein, showed high uptake rate into the malignant tumor. As Hg++, Au+ and Bi+++ are soft acids according to classification of Lewis acids, it was thought that these elements would bind strongly to soft base (R-SH, R-S-) present in the tumor tissue. In many hard acids (according to classification of Lewis acids), the uptake rate into the tumor was shown as a function of ionic potentials (valency/ionic radii) of the metal ions. It is presumed that the chemical bond of these hard acids in the tumor tissue is ionic bond to hard base (R-COO-, R-PO3(2-), R-SO3-, R-NH2).

  13. [Relations between location of elements in periodic table and affinity for the kidneys (author's transl)].


    Ando, A; Hisada, K; Ando, I


    The distribution of many inorganic compounds in rats was investigated in order to evaluate kidney affinity of inorganic compounds. In these experiments, 30%, 10-20% and 4-10% of administered dose was localized in the kidneys in 203Hg-acetate and 203 Bi-acetate, in H198AuCl4, 103PdCl2, 201TlCl, 210Pd(NO3)2 and H2(127M)TeO3, and in Na2(51)CrO4, 54MnCl2, (114m)InCl3 and 7BeCl2, respectively. Some bipositive ions and anions was hardly taken up into the kidneys. And in many hard acids according to classification of Lewis acids, the uptake rate into the kidneys was usually small. On the other hand, Hg, Au and Bi, which have strong binding power to the protein, showed high uptake rate in the kidneys. As Hg++, Au+ and Bi+++ was soft acids according to classification of Lewis acids, it was thought that these elements would bind strongly to soft base (RSH, RS-) present in the kidney.

  14. Transposable element insertion location bias and the dynamics of gene drive in mosquito populations.


    Rasgon, J L; Gould, F


    Some vector-borne disease control strategies using transgenic mosquitoes require transgene spread to high frequency in populations. Transposable elements (TEs) are DNA sequences that replicate and transpose within the genomes of other organisms and may therefore be represented in the next generation in higher frequencies than predicted by Mendelian segregation. This over-representation has allowed some TEs to spread through natural populations. Transgenes incorporated within a TE sequence are expected to be driven into populations as long as there is a positive balance between fitness costs and over-representation. Models have been used to examine parameters that affect this balance but did not take into account biased insertion of TEs to linked sites in the genome. A simulation model was created to examine the impact of insertion bias on TE spread in mosquito populations. TEs that induce no fitness costs are predicted to increase in frequency over a wide range of parameter values but spread is slower for lower levels of transposition and non-local movement. If TEs are costly, high proportions of local movement can slow or halt spread. To function as a robust transgene drive mechanism a TE should replicate and transpose > 10%/insert/generation, induce < 1% fitness cost/insert, and move preferentially to unlinked sites in the genome.

  15. Prediction of coronary plaque location on arteries having myocardial bridge, using finite element models.


    Nikolić, Dalibor; Radović, Miloš; Aleksandrić, Srđan; Tomašević, Miloje; Filipović, Nenad


    This study was performed to evaluate the influences of the myocardial bridges on the plaque initializations and progression in the coronary arteries. The wall structure is changed due to the plaque presence, which could be the reason for multiple heart malfunctions. Using simplified parametric finite element model (FE model) of the coronary artery having myocardial bridge and analyzing different mechanical parameters from blood circulation through the artery (wall shear stress, oscillatory shear index, residence time), we investigated the prediction of "the best" position for plaque progression. We chose six patients from the angiography records and used data from DICOM images to generate FE models with our software tools for FE preprocessing, solving and post-processing. We found a good correlation between real positions of the plaque and the ones that we predicted to develop at the proximal part of the myocardial bridges with wall shear stress, oscillatory shear index and residence time. This computer model could be additional predictive tool for everyday clinical examination of the patient with myocardial bridge. PMID:25139775

  16. Finite element methods for enhanced oil recovery Simulation

    SciTech Connect

    Cohen, M.F.


    A general, finite element procedure for reservoir simulation is presented. This effort is directed toward improving the numerical behavior of standard upstream, or upwind, finite difference techniques, without significantly increasing the computational costs. Two methods from previous authors' work are modified and developed: upwind finite elements and the Petrov-Galerkin method. These techniques are applied in a one- and two-dimensional, surfactant/ polymer simulator. The paper sets forth the mathematical formulation and several details concerning the implementation. The results indicate that the PetrovGalerkin method does significantly reduce numericaldiffusion errors, while it retains the stability of the first-order, upwind methods. It is also relatively simple to implement. Both the upwind, and PetrovGalerkin, finite element methods demonstrate little sensitivity to grid orientation.

  17. Enhanced finite element scheme for vibrational and flow induced sound

    NASA Astrophysics Data System (ADS)

    Kaltenbacher, M.; Triebenbacher, S.; Wohlmuth, B.; Zörnre, S.


    The paper presents Finite Element (FE) methods for classical vibroacoustics as well as computational aeroacoustics. Therewith, we can handle different grid sizes in different regions and ensure a correct coupling at the interfaces by applying the Mortar FE method. Furthermore, we can fully take into account free radiation by a new Perfectly Matched Layer (PML) technique, which is stable even for long term computations. The applicability of our developed numerical methods will be demonstrated by simulation results of the human phonation.

  18. Enhancing bioplastic-substrate interaction via pore induction and directed migration of enzyme location.


    Lele, Bhalchandra S; Papworth, Glenn; Katsemi, Vicky; Rüterjans, Heinz; Martyano, Igor; Klabunde, Kenneth J; Russell, Alan J


    We demonstrate two novel approaches to enhance interactions of polymer-immobilized biomolecules with their substrates. In the first approach, diisopropylfluorophosphatase (DFPase) containing poly(urethane) (PU) coatings were made microporous by incorporating, then extracting, poly(ethylene glycol)-based diesters as porogens. Incorporation of 2% w/w porogen increased the effective diffusion coefficient of diisopropylfluorophosphate (DFP) through the coatings by 30% and increased the apparent turnover number of immobilized DFPase 3-fold. In the second approach, prior to immobilization, hydrophobic modification of DFPase was achieved through its conjugation with a dimer/trimer mixture of a uretdione based on 1,6-diisocyanatohexane. When the hydrophobically modified DFPase was immobilized in coatings, catalytic activity was 4-fold higher than that of the equivalent, immobilized, native DFPase. This activity enhancement was independent of the presence or absence of pores. Confocal microscopy images of coatings containing fluorescently labeled lysozyme show that the native enzyme is distributed uniformly over the entire thickness of the coatings. Hydrophobically modified and fluorescently labeled lysozyme is accumulated only in the upper 10 microm cross-sectional layer of a 100 microm-thick coating. Interactions of bioplastics with their substrates are tunable either by pore induction in a polymer or by directed migration of the hydrophobically modified biomolecule to the desired location. The latter approach has broad implications, including overcoming mass transfer limitations experienced by immobilized biocatalysts.

  19. Urban enhancement of PM10 bioaerosol tracers relative to background locations in the Midwestern United States

    NASA Astrophysics Data System (ADS)

    Rathnayake, Chathurika M.; Metwali, Nervana; Baker, Zach; Jayarathne, Thilina; Kostle, Pamela A.; Thorne, Peter S.; O'Shaughnessy, Patrick T.; Stone, Elizabeth A.


    Bioaerosols are well-known immune-active particles that exacerbate respiratory diseases. Human exposures to bioaerosols and their resultant health impacts depend on their ambient concentrations, seasonal and spatial variation, and copollutants, which are not yet widely characterized. In this study, chemical and biological tracers of bioaerosols were quantified in respirable particulate matter (PM10) collected at three urban and three background sites in the Midwestern United States across four seasons in 2012. Endotoxins from Gram-negative bacteria (and a few Gram-positive bacteria), water-soluble proteins, and tracers for fungal spores (fungal glucans, arabitol, and mannitol) were ubiquitous and showed significant seasonal variation and dependence on temperature. Fungal spores were elevated in spring and peaked in summer, following the seasonal growing cycle, while endotoxins peaked in autumn during the row crop harvesting season. Paired comparisons of bioaerosols in urban and background sites revealed significant urban enhancements in PM10, fungal glucans, endotoxins, and water-soluble proteins relative to background locations, such that urban populations have a greater outdoor exposure to bioaerosols. These bioaerosols contribute, in part, to the urban excesses in PM10. Higher bioaerosol mass fractions in urban areas relative to background sites indicate that urban areas serve as a source of bioaerosols. Similar urban enhancements in water-soluble calcium and its correlation with bioaerosol tracers point toward windblown soil as an important source of bioaerosols in urban areas.

  20. Effects of electrode location on EHD-enhanced natural convection in an enclosure

    SciTech Connect

    Liu, K.S.; Lai, F.C.


    Numerical results are presented for natural convection in an enclosure under the influence of electric field. The geometry considered is a two-dimensional cavity with an aspect ratio of 5. The electrical field is generated by positive corona from an electrode wire charged with a high dc voltage. Three wire locations have been considered, which result in symmetric and non-symmetric electric fields. Numerical calculations have covered a wide range of parameters (i.e., V{sub o} = 12, 15 and 18 kV, 10{sup 3} {le} Ra {le} 10{sup 6}). In the presence of electric field, the flow and temperature fields may reach a steady, steady-periodic or non-periodic state. For low Rayleigh numbers, it is observed that the flow and temperature fields are basically oscillatory in nature. When the Rayleigh number is sufficiently increased, a steady state may be reached. Due to the oscillatory flows, there is a significant increase in heat transfer. It is found that heat transfer enhancement increases with the applied voltage but decreases with the Rayleigh number. In addition, it is found that heat transfer enhancement can be maximized by placing the electrode toward the leading edge of the heat transfer surface, that is, to perturb the thermal boundary layer as early as it begins to develop.

  1. A Collaborative Location Based Travel Recommendation System through Enhanced Rating Prediction for the Group of Users

    PubMed Central

    Ravi, Logesh; Vairavasundaram, Subramaniyaswamy


    Rapid growth of web and its applications has created a colossal importance for recommender systems. Being applied in various domains, recommender systems were designed to generate suggestions such as items or services based on user interests. Basically, recommender systems experience many issues which reflects dwindled effectiveness. Integrating powerful data management techniques to recommender systems can address such issues and the recommendations quality can be increased significantly. Recent research on recommender systems reveals an idea of utilizing social network data to enhance traditional recommender system with better prediction and improved accuracy. This paper expresses views on social network data based recommender systems by considering usage of various recommendation algorithms, functionalities of systems, different types of interfaces, filtering techniques, and artificial intelligence techniques. After examining the depths of objectives, methodologies, and data sources of the existing models, the paper helps anyone interested in the development of travel recommendation systems and facilitates future research direction. We have also proposed a location recommendation system based on social pertinent trust walker (SPTW) and compared the results with the existing baseline random walk models. Later, we have enhanced the SPTW model for group of users recommendations. The results obtained from the experiments have been presented. PMID:27069468

  2. A Collaborative Location Based Travel Recommendation System through Enhanced Rating Prediction for the Group of Users.


    Ravi, Logesh; Vairavasundaram, Subramaniyaswamy


    Rapid growth of web and its applications has created a colossal importance for recommender systems. Being applied in various domains, recommender systems were designed to generate suggestions such as items or services based on user interests. Basically, recommender systems experience many issues which reflects dwindled effectiveness. Integrating powerful data management techniques to recommender systems can address such issues and the recommendations quality can be increased significantly. Recent research on recommender systems reveals an idea of utilizing social network data to enhance traditional recommender system with better prediction and improved accuracy. This paper expresses views on social network data based recommender systems by considering usage of various recommendation algorithms, functionalities of systems, different types of interfaces, filtering techniques, and artificial intelligence techniques. After examining the depths of objectives, methodologies, and data sources of the existing models, the paper helps anyone interested in the development of travel recommendation systems and facilitates future research direction. We have also proposed a location recommendation system based on social pertinent trust walker (SPTW) and compared the results with the existing baseline random walk models. Later, we have enhanced the SPTW model for group of users recommendations. The results obtained from the experiments have been presented.

  3. A Collaborative Location Based Travel Recommendation System through Enhanced Rating Prediction for the Group of Users.


    Ravi, Logesh; Vairavasundaram, Subramaniyaswamy


    Rapid growth of web and its applications has created a colossal importance for recommender systems. Being applied in various domains, recommender systems were designed to generate suggestions such as items or services based on user interests. Basically, recommender systems experience many issues which reflects dwindled effectiveness. Integrating powerful data management techniques to recommender systems can address such issues and the recommendations quality can be increased significantly. Recent research on recommender systems reveals an idea of utilizing social network data to enhance traditional recommender system with better prediction and improved accuracy. This paper expresses views on social network data based recommender systems by considering usage of various recommendation algorithms, functionalities of systems, different types of interfaces, filtering techniques, and artificial intelligence techniques. After examining the depths of objectives, methodologies, and data sources of the existing models, the paper helps anyone interested in the development of travel recommendation systems and facilitates future research direction. We have also proposed a location recommendation system based on social pertinent trust walker (SPTW) and compared the results with the existing baseline random walk models. Later, we have enhanced the SPTW model for group of users recommendations. The results obtained from the experiments have been presented. PMID:27069468

  4. Levels and spatial distribution of airborne chemical elements in a heavy industrial area located in the north of Spain.


    Lage, J; Almeida, S M; Reis, M A; Chaves, P C; Ribeiro, T; Garcia, S; Faria, J P; Fernández, B G; Wolterbeek, H T


    The adverse health effects of airborne particles have been subjected to intense investigation in recent years; however, more studies on the chemical characterization of particles from pollution emissions are needed to (1) identify emission sources, (2) better understand the relative toxicity of particles, and (3) pinpoint more targeted emission control strategies and regulations. The main objective of this study was to assess the levels and spatial distribution of airborne chemical elements in a heavy industrial area located in the north of Spain. Instrumental and biomonitoring techniques were integrated and analytical methods for k0 instrumental neutron activation analysis and particle-induced x-ray emission were used to determine element content in aerosol filters and lichens. Results indicated that in general local industry contributed to the emissions of As, Sb, Cu, V, and Ni, which are associated with combustion processes. In addition, the steelwork emitted significant quantities of Fe and Mn and the cement factory was associated with Ca emissions. The spatial distribution of Zn and Al also indicated an important contribution of two industries located outside the studied area. PMID:25072718

  5. Enhanced capture of elemental mercury by bamboo-based sorbents.


    Tan, Zengqiang; Xiang, Jun; Su, Sheng; Zeng, Hancai; Zhou, Changsong; Sun, Lushi; Hu, Song; Qiu, Jianrong


    To develop cost-effective sorbent for gas-phase elemental mercury removal, the bamboo charcoal (BC) produced from renewable bamboo and KI modified BC (BC-I) were used for elemental mercury removal. The effect of NO, SO2 on gas-phase Hg0 adsorption by KI modified BC was evaluated on a fixed bed reactor using an online mercury analyzer. BET surface area analysis, temperature programmed desorption (TPD) and X-ray photoelectron spectroscopy (XPS) were used to determine the pore structure and surface chemistry of the sorbents. The results show that KI impregnation reduced the sorbents' BET surface area and total pore volume compared with that of the original BC. But the BC-I has excellent adsorption capacity for elemental mercury at a relatively higher temperature of 140 °C and 180 °C. The presence of NO or SO2 could inhibit Hg0 capture, but BC-I has strong anti-poisoning ability. The specific reaction mechanism has been further analyzed.

  6. Enhanced capture of elemental mercury by bamboo-based sorbents.


    Tan, Zengqiang; Xiang, Jun; Su, Sheng; Zeng, Hancai; Zhou, Changsong; Sun, Lushi; Hu, Song; Qiu, Jianrong


    To develop cost-effective sorbent for gas-phase elemental mercury removal, the bamboo charcoal (BC) produced from renewable bamboo and KI modified BC (BC-I) were used for elemental mercury removal. The effect of NO, SO2 on gas-phase Hg0 adsorption by KI modified BC was evaluated on a fixed bed reactor using an online mercury analyzer. BET surface area analysis, temperature programmed desorption (TPD) and X-ray photoelectron spectroscopy (XPS) were used to determine the pore structure and surface chemistry of the sorbents. The results show that KI impregnation reduced the sorbents' BET surface area and total pore volume compared with that of the original BC. But the BC-I has excellent adsorption capacity for elemental mercury at a relatively higher temperature of 140 °C and 180 °C. The presence of NO or SO2 could inhibit Hg0 capture, but BC-I has strong anti-poisoning ability. The specific reaction mechanism has been further analyzed. PMID:22995206

  7. Simple Syringe Filtration Methods for Reliably Examining Dissolved and Colloidal Trace Element Distributions in Remote Field Locations

    NASA Astrophysics Data System (ADS)

    Shiller, A. M.


    Methods for obtaining reliable dissolved trace element samples frequently utilize clean labs, portable laminar flow benches, or other equipment not readily transportable to remote locations. In some cases unfiltered samples can be obtained in a remote location and transported back to a lab for filtration. However, this may not always be possible or desirable. Additionally, methods for obtaining information on colloidal composition are likewise frequently too cumbersome for remote locations as well as being time-consuming. For that reason I have examined clean methods for collecting samples filtered through 0.45 and 0.02 micron syringe filters. With this methodology, only small samples are collected (typically 15 mL). However, with the introduction of the latest generation of ICP-MS's and microflow nebulizers, sample requirements for elemental analysis are much lower than just a few years ago. Thus, a determination of a suite of first row transition elements is frequently readily obtainable with samples of less than 1 mL. To examine the "traditional" (<0.45 micron) dissolved phase, 25 mm diameter polypropylene syringe filters and all polyethylene/polypropylene syringes are utilized. Filters are pre-cleaned in the lab using 40 mL of approx. 1 M HCl followed by a clean water rinse. Syringes are pre-cleaned by leaching with hot 1 M HCl followed by a clean water rinse. Sample kits are packed in polyethylene bags for transport to the field. Results are similar to results obtained using 0.4 micron polycarbonate screen filters, though concentrations may differ somewhat depending on the extent of sample pre-rinsing of the filter. Using this method, a multi-year time series of dissolved metals in a remote Rocky Mountain stream has been obtained. To examine the effect of colloidal material on dissolved metal concentrations, 0.02 micron alumina syringe filters have been utilized. Other workers have previously used these filters for examining colloidal Fe distributions in lake

  8. A novel myoblast enhancer element mediates MyoD transcription.

    PubMed Central

    Tapscott, S J; Lassar, A B; Weintraub, H


    The MyoD gene can orchestrate the expression of the skeletal muscle differentiation program. We have identified the regions of the gene necessary to reproduce transcription specific to skeletal myoblasts and myotubes. A proximal regulatory region (PRR) contains a conserved TATA box, a CCAAT box, and a GC-rich region that includes a consensus SP1 binding site. The PRR is sufficient for high levels of skeletal muscle-specific activity in avian muscle cells. In murine cells the PRR alone has only low levels of activity and requires an additional distal regulatory region to achieve high levels of muscle-specific activity. The distal regulatory region differs from a conventional enhancer in that chromosomal integration appears necessary for productive interactions with the PRR. While the Moloney leukemia virus long terminal repeat can enhance transcription from the MyoD PRR in both transient and stable assays, the simian virus 40 enhancer cannot, suggesting that specific enhancer-promoter interactions are necessary for PRR function. Images PMID:1328870

  9. Reconfiguration of nucleosome-depleted regions at distal regulatory elements accompanies DNA methylation of enhancers and insulators in cancer

    PubMed Central

    Taberlay, Phillippa C.; Statham, Aaron L.; Kelly, Theresa K.


    It is well established that cancer-associated epigenetic repression occurs concomitant with CpG island hypermethylation and loss of nucleosomes at promoters, but the role of nucleosome occupancy and epigenetic reprogramming at distal regulatory elements in cancer is still poorly understood. Here, we evaluate the scope of global epigenetic alterations at enhancers and insulator elements in prostate and breast cancer cells using simultaneous genome-wide mapping of DNA methylation and nucleosome occupancy (NOMe-seq). We find that the genomic location of nucleosome-depleted regions (NDRs) is mostly cell type specific and preferentially found at enhancers in normal cells. In cancer cells, however, we observe a global reconfiguration of NDRs at distal regulatory elements coupled with a substantial reorganization of the cancer methylome. Aberrant acquisition of nucleosomes at enhancer-associated NDRs is associated with hypermethylation and epigenetic silencing marks, and conversely, loss of nucleosomes with demethylation and epigenetic activation. Remarkably, we show that nucleosomes remain strongly organized and phased at many facultative distal regulatory elements, even in the absence of a NDR as an anchor. Finally, we find that key transcription factor (TF) binding sites also show extensive peripheral nucleosome phasing, suggesting the potential for TFs to organize NDRs genome-wide and contribute to deregulation of cancer epigenomes. Together, our findings suggest that “decommissioning” of NDRs and TFs at distal regulatory elements in cancer cells is accompanied by DNA hypermethylation susceptibility of enhancers and insulator elements, which in turn may contribute to an altered genome-wide architecture and epigenetic deregulation in malignancy. PMID:24916973

  10. Study of Co-Located and Distant Collaboration with Symbolic Support via a Haptics-Enhanced Virtual Reality Task

    ERIC Educational Resources Information Center

    Yeh, Shih-Ching; Hwang, Wu-Yuin; Wang, Jin-Liang; Zhan, Shi-Yi


    This study intends to investigate how multi-symbolic representations (text, digits, and colors) could effectively enhance the completion of co-located/distant collaborative work in a virtual reality context. Participants' perceptions and behaviors were also studied. A haptics-enhanced virtual reality task was developed to conduct…

  11. Comparative Study of Antenna Elements for TDRSS Enhanced Multiple Access System

    NASA Technical Reports Server (NTRS)

    Kory, Carol L.; Lambert, Kevin; Acosta, Roberto; Nessel, James


    We compare three antennas, which are candidates for the TDRSS-Continuation enhanced MA array antenna elements. Measured and simulated data show very good agreement for all antenna elements. All of the antennas meet the specifications with the exception of the SBA isolation. However, improvements can likely be made with further design efforts.

  12. Convective Enhancement of Icing Roughness Elements in Stagnation Region Flows

    NASA Technical Reports Server (NTRS)

    Hughes, Michael T.; McClain, Stephen T.; Vargas, Mario; Broeren, Andy


    To improve existing ice accretion simulation codes, more data regarding ice roughness and its effects on convective heat transfer are required. To build on existing research on this topic, this study used the Vertical Icing Studies Tunnel (VIST) at NASA Glenn Research to model realistic ice roughness in the stagnation region of a NACA 0012 airfoil. Using the VIST, a test plate representing the leading 2% chord of the airfoil was subjected to flows of 7.62 m/s (25 ft/s), 12.19 m/s (40 ft/s), and 16.76 m/s (55 ft/s). The test plate was fitted with 3 surfaces, each with a different representation of ice roughness: 1) a control surface with no ice roughness, 2) a surface with ice roughness with element height scaled by 10x and streamwise rough zone width from the stagnation point scaled by 10x, and 3) a surface with ice roughness with element height scaled by 10x and streamwise rough zone width from the stagnation point scaled by 25x. Temperature data from the tests were recorded using an infrared camera and thermocouples imbedded in the test plate. From the temperature data, a convective heat transfer coefficient map was created for each case. Additional testing was also performed to validate the VIST's flow quality. These tests included five-hole probe and hot-wire probe velocity traces to provide flow visualization and to study boundary layer formation on the various test surfaces. The knowledge gained during the experiments will help improve ice accretion codes by providing heat transfer coefficient validation data and by providing flow visualization data helping understand current and future experiments performed in the VIST.

  13. Modeling insights into the locations of density enhancements from the Enceladus water vapor jets

    NASA Astrophysics Data System (ADS)

    Hurley, Dana M.; Perry, Mark E.; Waite, J. Hunter


    Monte Carlo modeling of the vapor erupting from Enceladus' south polar region is presented to demonstrate the influence of physical characteristics of the emitted vapor on the distribution of particles at altitude. The modeled sources include localized jets and eruptions distributed along the surface features labeled "tiger stripes." The modeling reveals that density enhancements are displaced from the source location caused not only by the angle of emission but also by superposition of material from nearby sources. The altitude of the superposition is mass dependent and contributes to differences observed in the mass 28 and mass 44 channels of the Cassini Ion and Neutral Mass Spectrometer (INMS) during Enceladus encounters. INMS data are well modeled using only the tiger stripe sources; however, certain regions require additional sources to reproduce some features of the data. In particular, an excess source is required for 44 unified atomic mass unit (u) on the Saturn-facing hemisphere of Baghdad Sulcus. It is apparent in three parallel Cassini flybys. A relative decrease in the source rate is observed for mass 28 u for E14. The more diffuse nature of the 28 u INMS observations compared to the more collimated structure of the 44 u INMS observations is consistent with increased thermal spreading for low-mass constituents of the plume.

  14. Finite Element Analysis Enhancement or B-25 Container Dynamic Compaction

    SciTech Connect

    Jones, W.E.


    The document describes initial structural finite element modeling for dynamic compaction of B-25 containers buried in Engineered Trench number 1 at the U.S. Department of Energy's Savannah River Site (SRS), Aiken, South Carolina. Dynamic compaction is the practice of dropping a heavy weight to compact material that has been placed in the subsurface for disposal. B-25s placed in Engineered Trench number 1 contain low-level radioactive waste. Dynamic compaction of buried B-25s is an option that could mitigate subsidence of the cap that is eventually constructed over an engineered trench disposal site. The objective of numerical modeling of the Engineered trench system was to evaluate the response of B-25 Containers to dynamic compaction, eventually incorporating dynamic compaction behavior with various degrees of B-25 corrosion. Understanding the structural behavior of buried B-25s over time is important for anticipating and dealing with subsidence. Subsidence may compromise the long-term integrity of the caps placed over the buried waste to limit downward water and contaminant movement through the material.

  15. Enhanced element-specific modal formulations for flexible multibody dynamics

    NASA Technical Reports Server (NTRS)

    Ryan, Robert R.


    The accuracy of current flexible multibody formalisms based on assumed modes is examined in the context of standard spacecraft motions involving structural components undergoing both slow and fast overall translational and rotational motions as well as small deformations. Limitations of current techniques in treating: (1) element-specific coupling behavior of large motion and small deformation, and (2) motion-induced structural stiffness variations, are noted. The roles of nonlinear and linear elastic structural theories in accurately predicting transient large-displacement dynamic behavior of flexible multibody systems are examined in detail. Coupling effects between deformation and overall motion are carefully scrutinized in the context of assumed-mode discretization techniques. Consistently linearized beam, plate, and shell formulations involving in-plane stretch variables are proposed and shown to yield very accurate simulation results and extremely fast modal convergence for most motions involving small strains. In some particular cases, however, in which membrane stiffness dominates bending stiffness, a nonlinear strain formulation is required in order to capture proper coupling between deformation and overall motion.

  16. Enhanced secondary organic aerosols during fog episodes over typical location in Indo-Gangetic region

    NASA Astrophysics Data System (ADS)

    Kaul, D. S.; Tripathi, S. N.; Gupta, T.


    This study examines the reason of enhanced SOA yield during foggy days and hypothesizes likely production of SOA through aqueous phase chemistry during fog episodes. PM1 samples were collected from January 16, 2010 to February 20, 2010 at Kanpur to study the secondary organic aerosol (SOA) production during clear and foggy days. Of the 180 samples collected, 56 were from foggy days. Micro-Pulse Lidar Network (MPLNET), a part of National Aeronautic Space Administration (NASA), was used for identification of fog duration. Organic Carbon (OC), Elemental Carbon (EC) and water soluble organic carbon analysis were carried out by a EC-OC analyzer and a TOC analyzer, respectively. Trace gases and solar flux measurement were carried out by gas analyzers and a pyranometer (a part of NASA), respectively to identify the photo-chemical activity. Meteorological data were measured by atmospheric weather station. SOA was estimated during foggy and clear days using tracer method. Enhanced SOA was observed during foggy days, production of SOA was highest in the afternoon and lower during morning and evening. Peak of OC/EC ratio during foggy days occurred earlier indicating role of aqueous phase chemistry in addition to gas-particle portioning which is the prevalent mechanism of SOA production during clear days. The possible contribution of biomass burning to SOA which could otherwise confound the SOA estimate during foggy days was also examined by biomass tracer, potassium ion. The influence of biomass to SOA during foggy days was found to be negligible. This is so because organic carbon from biomass origin is highly hygroscopic and is scavenged by the fog droplets. The lesser average concentration of water soluble organic carbon during foggy days support the scavenging and removal of the biomass originated organic carbon. Evaporation of individual fog and subsequent increase of OC/EC ratio further supported the aqueous phase production of SOA. The temperature and relative humidity

  17. Functional genetic screens for enhancer elements in the human genome using CRISPR-Cas9.


    Korkmaz, Gozde; Lopes, Rui; Ugalde, Alejandro P; Nevedomskaya, Ekaterina; Han, Ruiqi; Myacheva, Ksenia; Zwart, Wilbert; Elkon, Ran; Agami, Reuven


    Systematic identification of noncoding regulatory elements has, to date, mainly relied on large-scale reporter assays that do not reproduce endogenous conditions. We present two distinct CRISPR-Cas9 genetic screens to identify and characterize functional enhancers in their native context. Our strategy is to target Cas9 to transcription factor binding sites in enhancer regions. We identified several functional enhancer elements and characterized the role of two of them in mediating p53 (TP53) and ERα (ESR1) gene regulation. Moreover, we show that a genomic CRISPR-Cas9 tiling screen can precisely map functional domains within enhancer elements. Our approach expands the utility of CRISPR-Cas9 to elucidate the functions of the noncoding genome.

  18. Conserved enhancer and silencer elements responsible for differential Adh transcription in Drosophila cell lines.

    PubMed Central

    Ayer, S; Benyajati, C


    The distal promoter of Adh is differentially expressed in Drosophila tissue culture cell lines. After transfection with an exogenous Adh gene, there was a specific increase in distal alcohol dehydrogenase (ADH) transcripts in ADH-expressing (ADH+) cells above the levels observed in transfected ADH-nonexpressing (ADH-) cells. We used deletion mutations and a comparative transient-expression assay to identify the cis-acting elements responsible for enhanced Adh distal transcription in ADH+ cells. DNA sequences controlling high levels of distal transcription were localized to a 15-base-pair (bp) region nearly 500 bp upstream of the distal RNA start site. In addition, a 61-bp negative cis-acting element was found upstream from and adjacent to the enhancer. When this silencer element was deleted, distal transcription increased only in the ADH+ cell line. These distant upstream elements must interact with the promoter elements, the Adf-1-binding site and the TATA box, as they only influenced transcription when at least one of these two positive distal promoter elements was present. Internal deletions targeted to the Adf-1-binding site or the TATA box reduced transcription in both cell types but did not affect the transcription initiation site. Distal transcription in transfected ADH- cells appears to be controlled primarily through these promoter elements and does not involve the upstream regulatory elements. Evolutionary conservation in distantly related Drosophila species suggests the importance of these upstream elements in correct developmental and tissue-specific expression of ADH. Images PMID:1694013

  19. Elemental Fluorine-18 Gas: Enhanced Production and Availability

    SciTech Connect

    VanBrocklin, Henry F.


    The overall objective of this project was to develop an efficient, reproducible and reliable process for the preparation of fluorine-18 labeled fluorine gas ([¹⁸F]F₂) from readily available cyclotron-produced [¹⁸F]fluoride ion. The two step process entailed the production of [¹⁸F]fluoromethane with subsequent conversion to [¹⁸F]F₂ by electric discharge of [¹⁸F]fluoromethane in the presence of carrier nonradioactive F₂ gas. The specific goals of this project were i) to optimize the preparation of [¹⁸F]fluoromethane from [¹⁸F]fluoride ion; ii) to develop a prototype automated system for the production of [¹⁸F]F₂ from [¹⁸F]fluoride ion and iii) develop a compact user friendly automated system for the preparation of [¹⁸F]F₂ with initial synthesis of fluorine-18 labeled radiotracers. Over the last decade there has been an increased interest in the production of "non-standard" positron-emitting isotopes for the preparation of new radiotracers for a variety of applications including medical imaging and therapy. The increased availability of these isotopes from small biomedical cyclotrons has prompted their use in labeling radiotracers. In much the same way the production of [¹⁸F]F₂ gas has been known for several decades. However, access to [¹⁸F]F₂ gas has been limited to those laboratories with the means (e.g. F₂ targetry for the cyclotron) and the project-based need to work with [¹⁸F]F₂ gas. Relatively few laboratories, compared to those that produce [¹⁸F]fluoride ion on a daily basis, possess the capability to produce and use [¹⁸F]F₂ gas. A simplified, reliable system employing [¹⁸F]fluoride ion from cyclotron targetry systems that are already in place coupled with on-demand production of the [¹⁸F]F₂ gas would greatly enhance its availability. This would improve the availability of [¹⁸F]F₂ gas and promote further work with a valuable precursor. The major goals of the project were accomplished

  20. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V

    PubMed Central

    Pyle, Jay; Patel, Tejas; Merrill, Brianna; Nsokoshi, Chabu; McCall, Morgan; Proctor, Robert H.; Brown, Daren W.; Hammond, Thomas M.


    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny from an SkK × Spore killer-susceptible (SkS) cross to inherit the SkK allele. SkK has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an SkK × SkS mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of SkK to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to SkS genotypes, SkK genotypes have one extra gene within this region for a total of 42 genes. The additional gene in SkK genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1. The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed. PMID:27317777

  1. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V.


    Pyle, Jay; Patel, Tejas; Merrill, Brianna; Nsokoshi, Chabu; McCall, Morgan; Proctor, Robert H; Brown, Daren W; Hammond, Thomas M


    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (Sk(K)) that causes nearly all surviving meiotic progeny from an Sk(K) × Spore killer-susceptible (Sk(S)) cross to inherit the Sk(K) allele. Sk(K) has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an Sk(K) × Sk(S) mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of Sk(K) to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to Sk(S) genotypes, Sk(K) genotypes have one extra gene within this region for a total of 42 genes. The additional gene in Sk(K) genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1 The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed.

  2. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V.


    Pyle, Jay; Patel, Tejas; Merrill, Brianna; Nsokoshi, Chabu; McCall, Morgan; Proctor, Robert H; Brown, Daren W; Hammond, Thomas M


    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (Sk(K)) that causes nearly all surviving meiotic progeny from an Sk(K) × Spore killer-susceptible (Sk(S)) cross to inherit the Sk(K) allele. Sk(K) has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an Sk(K) × Sk(S) mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of Sk(K) to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to Sk(S) genotypes, Sk(K) genotypes have one extra gene within this region for a total of 42 genes. The additional gene in Sk(K) genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1 The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed. PMID:27317777

  3. Androgen response element of the glycine N-methyltransferase gene is located in the coding region of its first exon.


    Lee, Cheng-Ming; Yen, Chia-Hung; Tzeng, Tsai-Yu; Huang, Yu-Zen; Chou, Kuan-Hsien; Chang, Tai-Jay; Arthur Chen, Yi-Ming


    Androgen plays an important role in the pathogenesis of PCa (prostate cancer). Previously, we identified GNMT (glycine N-methyltransferase) as a tumour susceptibility gene and characterized its promoter region. Besides, its enzymatic product-sarcosine has been recognized as a marker for prognosis of PCa. The goals of this study were to determine whether GNMT is regulated by androgen and to map its AREs (androgen response elements). Real-time PCR analyses showed that R1881, a synthetic AR (androgen receptor) agonist induced GNMT expression in AR-positive LNCaP cells, but not in AR-negative DU145 cells. In silico prediction showed that there are four putative AREs in GNMT-ARE1, ARE2 and ARE3 are located in the intron 1 and ARE4 is in the intron 2. Consensus ARE motif deduced from published AREs was used to identify the fifth ARE-ARE5 in the coding region of exon 1. Luciferase reporter assay found that only ARE5 mediated the transcriptional activation of R1881. ARE3 overlaps with a YY1 [Yin and Yang 1 (motif (CaCCATGTT, +1118/+1126)] that was further confirmed by antibody supershift and ChIP (chromatin immunoprecipitation) assays. EMSA (electrophoretic mobility shift assay) and ChIP assay confirmed that AR interacts with ARE5 in vitro and in vivo. In summary, GNMT is an AR-targeted gene with its functional ARE located at +19/+33 of the first exon. These results are valuable for the study of the influence of androgen on the gene expression of GNMT especially in the pathogenesis of cancer. PMID:23883094

  4. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes.


    Yao, Lijing; Berman, Benjamin P; Farnham, Peggy J


    Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer-target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  5. Enhanced light element imaging in atomic resolution scanning transmission electron microscopy.


    Findlay, S D; Kohno, Y; Cardamone, L A; Ikuhara, Y; Shibata, N


    We show that an imaging mode based on taking the difference between signals recorded from the bright field (forward scattering region) in atomic resolution scanning transmission electron microscopy provides an enhancement of the detectability of light elements over existing techniques. In some instances this is an enhancement of the visibility of the light element columns relative to heavy element columns. In all cases explored it is an enhancement in the signal-to-noise ratio of the image at the light column site. The image formation mechanisms are explained and the technique is compared with earlier approaches. Experimental data, supported by simulation, are presented for imaging the oxygen columns in LaAlO₃. Case studies looking at imaging hydrogen columns in YH₂ and lithium columns in Al₃Li are also explored through simulation, particularly with respect to the dependence on defocus, probe-forming aperture angle and detector collection aperture angles.

  6. Hydrogen atom donor compounds as contrast enhancers for black-and-white photothermographic and thermographic elements


    Harring, Lori S.; Simpson, Sharon M.; Sansbury, Francis H.


    Hydrogen atom donor compounds are useful as contrast enhancers when used in combination with (i) hindered phenol developers, and (ii) trityl hydrazide and/or formyl-phenyl hydrazine co-developers, to produce ultra-high contrast black-and-white photothermographic and thermographic elements. The photothermographic and thermographic elements may be used as a photomask in a process where there is a subsequent exposure of an ultraviolet or short wavelength visible radiation-sensitive imageable medium.

  7. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.


    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  8. Activation of enhancer elements by the homeobox gene Cdx2 is cell line specific.

    PubMed Central

    Taylor, J K; Levy, T; Suh, E R; Traber, P G


    Cdx2 is a caudal-related homeodomain transcription factor that is expressed in complex patterns during mouse development and at high levels in the intestinal epithelium of adult mice. Cdx2 activates transcription of intestinal gene promoters containing specific binding sites. Moreover, Cdx2 has been shown to induce intestinal differentiation in cell lines. In this study, we show that Cdx2 is able to bind to two well defined enhancer elements in the HoxC8 gene. We then demonstrate that Cdx2 is able to activate transcription of heterologous promoters when its DNA binding element is placed in an enhancer context. Furthermore, the ability to activate enhancer elements is cell-line dependent. When the Cdx2 activation domain was linked to the Gal4 DNA binding domain, the chimeric protein was able to activate Gal4 enhancer constructs in an intestinal cell line, but was unable to activate transcription in NIH3T3 cells. These data suggest that there are cell-specific factors that allow the Cdx2 activation domain to function in the activation of enhancer elements. We hypothesize that either a co-activator protein or differential phosphorylation of the activation domain may be the mechanism for intestinal cell line-specific function of Cdx2 and possibly in other tissues in early development. PMID:9171078

  9. Seeing and Feeling for Self and Other: Proprioceptive Spatial Location Determines Multisensory Enhancement of Touch

    ERIC Educational Resources Information Center

    Cardini, Flavia; Haggard, Patrick; Ladavas, Elisabetta


    We have investigated the relation between visuo-tactile interactions and the self-other distinction. In the Visual Enhancement of Touch (VET) effect, non-informative vision of one's own hand improves tactile spatial perception. Previous studies suggested that looking at "another"person's hand could also enhance tactile perception, but did not…

  10. A DNA-binding protein factor recognizes two binding domains within the octopine synthase enhancer element.

    PubMed Central

    Tokuhisa, J G; Singh, K; Dennis, E S; Peacock, W J


    A protein that binds to the enhancing element of the octopine synthase gene has been identified in nuclear extracts from maize cell suspension cultures. Two protein-DNA complexes are distinguishable by electrophoretic mobility in gel retardation assays. Footprint analyses of these low and high molecular weight complexes show, respectively, half and complete protection of the ocs-element DNA from cleavage by methidiumpropyl-EDTA.FE(II). Two lines of evidence indicate that the element has two recognition sites, each of which can bind identical protein units. Elements that are mutated in one or the other half and form only the low molecular weight complex interfere with the formation of both the low and high molecular weight complexes by the wild-type element. Protein isolated from a complex with only one binding site occupied can bind to the wild-type ocs-element and generate complexes with protein occupying one or both binding sites. Occupation of both sites of the ocs-element is a prerequisite for transcriptional enhancement. PMID:2152113

  11. SEM/EDX analysis of inorganic elements in human scalp hairs with special reference to the variation with different locations on the head.


    Seta, S; Sato, H; Yoshino, M; Miyasaka, S


    In order to obtain additional data for individualizing hair samples collected from the scene of crime, the authors attempted to analyze the inorganic elements in scalp hairs such as sodium, phosphorus, potassium and calcium by a SEM/EDX method. For the purpose of detecting such elements from scalp hairs efficiently, the samples were ashed on a carbon specimen mount for 60 minutes by an oxygen plasma microincineration technique. The characteristic X-ray counts of the elements were investigated as functions of hair location, viz., the frontal, the vertex, the nape, the left and the right lateral, on the head of the same person. The oxygen plasma microincineration method was very efficient in detecting sodium, phosphorus, potassium and calcium from scalp hairs. The characteristic X-ray counts of the elements, especially potassium and calcium, varied from person to person. Within the same location, the variation of X-ray counts was relatively low, with a standard deviation of less than 20%. It was observed that hairs from the frontal and the vertex locations, in general, showed lower X-ray counts for potassium than did those from the nape, the left and the right lateral locations. The calcium X-ray counts varied considerably from person to person but generally tended to give the highest value at the vertex location. The EDX spectrum pattern associated with such elements could be helpful in individualizing hair samples collected as forensic evidence.

  12. PEA1 and PEA3 enhancer elements are primary components of the polyomavirus late transcription initiator element.

    PubMed Central

    Yoo, W; Martin, M E; Folk, W R


    The circular polyomavirus genome is transcribed from divergent promoter regions. Early mRNAs are initiated from a transcription complex formed at a TATA motif, the site of binding of transcription factor TFIID. Early transcription is promoted at a distance by the viral enhancer, which includes DNA motifs bound by cellular proteins of the PEA1 and PEA3 families of transcription activators. In contrast, the predominant viral late mRNAs are initiated within the viral enhancer, which lacks a TATA motif, near the PEA1 and PEA3 DNA motifs. Here, we demonstrate that these PEA1 and PEA3 binding sites are primary components of an autonomous transcription initiator element (Inr). They cause transcription of most polyomavirus late mRNAs and can direct the transcription of heterologous reporter genes. Alternative roles of these DNA motifs as activators of early mRNA transcription and as an initiator element for late mRNA transcription help explain how polyomavirus gene expression is regulated during lytic growth and provides a model for cellular transcription during development. Images PMID:1654447

  13. Promiscuity of enhancer, coding and non-coding transcription functions in ultraconserved elements

    PubMed Central


    Background Ultraconserved elements (UCEs) are highly constrained elements of mammalian genomes, whose functional role has not been completely elucidated yet. Previous studies have shown that some of them act as enhancers in mouse, while some others are expressed in both normal and cancer-derived human tissues. Only one UCE element so far was shown to present these two functions concomitantly, as had been observed in other isolated instances of single, non ultraconserved enhancer elements. Results We used a custom microarray to assess the levels of UCE transcription during mouse development and integrated these data with published microarray and next-generation sequencing datasets as well as with newly produced PCR validation experiments. We show that a large fraction of non-exonic UCEs is transcribed across all developmental stages examined from only one DNA strand. Although the nature of these transcripts remains a mistery, our meta-analysis of RNA-Seq datasets indicates that they are unlikely to be short RNAs and that some of them might encode nuclear transcripts. In the majority of cases this function overlaps with the already established enhancer function of these elements during mouse development. Utilizing several next-generation sequencing datasets, we were further able to show that the level of expression observed in non-exonic UCEs is significantly higher than in random regions of the genome and that this is also seen in other regions which act as enhancers. Conclusion Our data shows that the concurrent presence of enhancer and transcript function in non-exonic UCE elements is more widespread than previously shown. Moreover through our own experiments as well as the use of next-generation sequencing datasets, we were able to show that the RNAs encoded by non-exonic UCEs are likely to be long RNAs transcribed from only one DNA strand. PMID:20202189

  14. A comparison of stress in cracked fibrous tissue specimens with varied crack location, loading, and orientation using finite element analysis.


    Peloquin, John M; Elliott, Dawn M


    Cracks in fibrous soft tissue, such as intervertebral disc annulus fibrosus and knee meniscus, cause pain and compromise joint mechanics. A crack concentrates stress at its tip, making further failure and crack extension (fracture) more likely. Ex vivo mechanical testing is an important tool for studying the loading conditions required for crack extension, but prior work has shown that it is difficult to reproduce crack extension. Most prior work used edge crack specimens in uniaxial tension, with the crack 90° to the edge of the specimen. This configuration does not necessarily represent the loading conditions that cause in vivo crack extension. To find a potentially better choice for experiments aiming to reproduce crack extension, we used finite element analysis to compare, in factorial combination, (1) center crack vs. edge crack location, (2) biaxial vs. uniaxial loading, and (3) crack-fiber angles ranging from 0° to 90°. The simulated material was annulus fibrosus fibrocartilage with a single fiber family. We hypothesized that one of the simulated test cases would produce a stronger stress concentration than the commonly used uniaxially loaded 90° crack-fiber angle edge crack case. Stress concentrations were compared between cases in terms of fiber-parallel stress (representing risk of fiber rupture), fiber-perpendicular stress (representing risk of matrix rupture), and fiber shear stress (representing risk of fiber sliding). Fiber-perpendicular stress and fiber shear stress concentrations were greatest in edge crack specimens (of any crack-fiber angle) and center crack specimens with a 90° crack-fiber angle. However, unless the crack is parallel to the fiber direction, these stress components alone are insufficient to cause crack opening and extension. Fiber-parallel stress concentrations were greatest in center crack specimens with a 45° crack-fiber angle, either biaxially or uniaxially loaded. We therefore recommend that the 45° center crack case be

  15. Analysis of organic and elemental carbon in heating and non-heating periods in four locations of Beijing.


    Sun, Fengbin; Lun, Xiaoxiu; Liu, Xuhui; Mo, Li; Li, Renna; Zhang, Hongxia; Chen, Jungang; Cao, Yingying; Shi, Fangtian; Yu, Xinxiao


    The concentrations of elemental carbon (EC) and organic carbon (OC) in PM2.5 atmospheric aerosol were measured at four different sites in Beijing: Beijing Olympic Forest Park (OF), Jiufeng National Forest Park (JF), Beijing Forestry University campus lawn (G), and roads near the Beijing Forestry University (S). The winter heating period concentrations were 30-45% higher than the spring non-heating period. Possible reasons for this could be the severe convective weather in spring due to the temperate monsoon, deposition of PM2.5 to plants in spring, stable atmospheric conditions in winter, and/or a greater number of sources of carbonaceous aerosols in winter. The proportion of total carbon (i.e. EC + OC) in PM2.5 in Beijing is high. The OC/EC value was 2.45 (OF) and 2.39 (JF) in winter and 1.6 (OF) and 1.43 (JF) in spring. These ratios and the high correlation of OC with EC in the winter samples indicate a strong primary source of OC. Eight carbon fractions from the four different sampling locations were analysed, and the OC1-4 values were found to vary considerably. In winter, the OC1 values from all four sites were higher than the spring values. Although there were differences at each site, the percentages of OC2, OC3, EC1-OP, and EC2 were the largest. Secondary organic carbon (SOC) formed during long-range transport from the emission sources to the monitoring sites, and the increase of OC2 and OC3 concentrations could be associated with SOC.

  16. Analysis of organic and elemental carbon in heating and non-heating periods in four locations of Beijing.


    Sun, Fengbin; Lun, Xiaoxiu; Liu, Xuhui; Mo, Li; Li, Renna; Zhang, Hongxia; Chen, Jungang; Cao, Yingying; Shi, Fangtian; Yu, Xinxiao


    The concentrations of elemental carbon (EC) and organic carbon (OC) in PM2.5 atmospheric aerosol were measured at four different sites in Beijing: Beijing Olympic Forest Park (OF), Jiufeng National Forest Park (JF), Beijing Forestry University campus lawn (G), and roads near the Beijing Forestry University (S). The winter heating period concentrations were 30-45% higher than the spring non-heating period. Possible reasons for this could be the severe convective weather in spring due to the temperate monsoon, deposition of PM2.5 to plants in spring, stable atmospheric conditions in winter, and/or a greater number of sources of carbonaceous aerosols in winter. The proportion of total carbon (i.e. EC + OC) in PM2.5 in Beijing is high. The OC/EC value was 2.45 (OF) and 2.39 (JF) in winter and 1.6 (OF) and 1.43 (JF) in spring. These ratios and the high correlation of OC with EC in the winter samples indicate a strong primary source of OC. Eight carbon fractions from the four different sampling locations were analysed, and the OC1-4 values were found to vary considerably. In winter, the OC1 values from all four sites were higher than the spring values. Although there were differences at each site, the percentages of OC2, OC3, EC1-OP, and EC2 were the largest. Secondary organic carbon (SOC) formed during long-range transport from the emission sources to the monitoring sites, and the increase of OC2 and OC3 concentrations could be associated with SOC. PMID:26101900

  17. Identification of minute damage in composite bridge structures equipped with fiber optic sensors using the location of neutral axis and finite element analysis

    NASA Astrophysics Data System (ADS)

    Li, Xi; Glisic, Branko


    By definition, the neutral axis of a loaded composite beam structure is the curve along which the section experiences zero bending strain. When no axial loading is present, the location of the neutral axis passes through the centroid of stiffness of the beam cross-section. In the presence of damage, the centroid of stiffness, as well as the neutral axis, shift from the healthy position. The concept of neutral axis can be widely applied to all beam-like structures. According to literature, a change in location of the neutral axis can be associated with damage in the corresponding cross-section. In this paper, the movement of neutral axis near locations of minute damage in a composite bridge structure was studied using finite element analysis and experimental results. The finite element model was developed based on a physical scale model of a composite simply-supported structure with controlled minute damage in the reinforced concrete deck. The structure was equipped with long-gauge fiber optic strain and temperature sensors at a healthy reference location as well as two locations of damage. A total of 12 strain sensors were installed during construction and used to monitor the structure during various loading events. This paper aims to explain previous experimental results which showed that the observed positions of neutral axis near damage locations were higher than the predicted healthy locations in some loading events. Analysis has shown that finite element analysis has potential to simulate and explain the physical behavior of the test structure.

  18. Student Voice in a Chinese Context: Investigating the Key Elements of Leadership That Enhance Student Voice

    ERIC Educational Resources Information Center

    Cheng, Annie Yan Ni


    This study examines the issues surrounding "student voice" in a specific Chinese context, and assesses the key elements of leadership that could enhance student voice in that context. It reports the results of a research conducted in a community-based educational centre in Hong Kong that provides after-school educational and social adjustment…

  19. Fluid rare earth element anlayses from geothermal wells located on the Reykjanes Peninsula, Iceland and Middle Valley seafloor hydrothermal system on the Juan de Fuca Ridge.

    DOE Data Explorer

    Andrew Fowler


    Results for fluid rare earth element analyses from four Reykjanes peninsula high-temperature geothermal fields. Data for fluids from hydrothermal vents located 2400 m below sea level from Middle Valley on the Juan de Fuca Ridge are also included. Data have been corrected for flashing. Samples preconcentrated using a chelating resin with IDA functional group (InertSep ME-1). Analyzed using an Element magnetic sector inductively coupled plasma mass spectrometry (ICP-MS).

  20. Knockdown of Nuclear-Located Enhancer RNAs and Long ncRNAs Using Locked Nucleic Acid GapmeRs.


    Roux, Benoit T; Lindsay, Mark A; Heward, James A


    The human genome is widely transcribed outside of protein-coding genes, producing thousands of noncoding RNAs from different subfamilies including enhancer RNAs. Functional studies to determine the role of individual genes are challenging with noncoding RNAs appearing to be more difficult to knockdown than mRNAs. One factor that may have hindered progress is that the majority of noncoding RNAs are thought to be located within the nucleus, where the efficiency of traditional RNA interference techniques is debatable. Here we present an alternative RNA interference technique utilizing Locked Nucleic Acids, which is able to efficiently knockdown noncoding RNAs irrespective of intracellular location. PMID:27662866

  1. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences.

    PubMed Central

    Ch'ang, L Y; Yang, W K; Myer, F E; Yang, D M


    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenicol acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base-pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-bp inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs of the enhancer segment as well as the upstream LTR sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression. Further analyses using chimeric LTR constructs located the presence of a strong negative regulatory element within the region containing the 5' portion of the enhancer and the immediate upstream sequences in the MuLV-related LTRs. Images PMID:2542587

  2. Horizontal Saccadic Eye Movements Enhance the Retrieval of Landmark Shape and Location Information

    ERIC Educational Resources Information Center

    Brunye, Tad T.; Mahoney, Caroline R.; Augustyn, Jason S.; Taylor, Holly A.


    Recent work has demonstrated that horizontal saccadic eye movements enhance verbal episodic memory retrieval, particularly in strongly right-handed individuals. The present experiments test three primary assumptions derived from this research. First, horizontal eye movements should facilitate episodic memory for both verbal and non-verbal…

  3. Enhanced Associative Memory for Colour (but Not Shape or Location) in Synaesthesia

    ERIC Educational Resources Information Center

    Pritchard, Jamie; Rothen, Nicolas; Coolbear, Daniel; Ward, Jamie


    People with grapheme-colour synaesthesia have been shown to have enhanced memory on a range of tasks using both stimuli that induce synaesthesia (e.g. words) and, more surprisingly, stimuli that do not (e.g. certain abstract visual stimuli). This study examines the latter by using multi-featured stimuli consisting of shape, colour and location…

  4. Computational Analysis of Enhanced Magnetic Bioseparation in Microfluidic Systems with Flow-Invasive Magnetic Elements

    PubMed Central

    Khashan, S. A.; Alazzam, A.; Furlani, E. P.


    A microfluidic design is proposed for realizing greatly enhanced separation of magnetically-labeled bioparticles using integrated soft-magnetic elements. The elements are fixed and intersect the carrier fluid (flow-invasive) with their length transverse to the flow. They are magnetized using a bias field to produce a particle capture force. Multiple stair-step elements are used to provide efficient capture throughout the entire flow channel. This is in contrast to conventional systems wherein the elements are integrated into the walls of the channel, which restricts efficient capture to limited regions of the channel due to the short range nature of the magnetic force. This severely limits the channel size and hence throughput. Flow-invasive elements overcome this limitation and enable microfluidic bioseparation systems with superior scalability. This enhanced functionality is quantified for the first time using a computational model that accounts for the dominant mechanisms of particle transport including fully-coupled particle-fluid momentum transfer. PMID:24931437

  5. Computational analysis of enhanced magnetic bioseparation in microfluidic systems with flow-invasive magnetic elements.


    Khashan, S A; Alazzam, A; Furlani, E P


    A microfluidic design is proposed for realizing greatly enhanced separation of magnetically-labeled bioparticles using integrated soft-magnetic elements. The elements are fixed and intersect the carrier fluid (flow-invasive) with their length transverse to the flow. They are magnetized using a bias field to produce a particle capture force. Multiple stair-step elements are used to provide efficient capture throughout the entire flow channel. This is in contrast to conventional systems wherein the elements are integrated into the walls of the channel, which restricts efficient capture to limited regions of the channel due to the short range nature of the magnetic force. This severely limits the channel size and hence throughput. Flow-invasive elements overcome this limitation and enable microfluidic bioseparation systems with superior scalability. This enhanced functionality is quantified for the first time using a computational model that accounts for the dominant mechanisms of particle transport including fully-coupled particle-fluid momentum transfer. PMID:24931437

  6. Optical detection enhancement in porous volumetric microfluidic capture elements using refractive index matching fluids

    PubMed Central

    Wiederoder, M. S.; Peterken, L.; Lu, A. X.; Rahmanian, O. D.; Raghavan, S. R.; DeVoe, D. L.


    Porous volumetric capture elements in microfluidic sensors are advantageous compared to planar capture surfaces due to higher reaction site density and decreased diffusion lengths that can reduce detection limits and total assay time. However a mismatch in refractive indices between the capture matrix and fluid within the porous interstices results in scattering of incident, reflected, or emitted light, significantly reducing the signal for optical detection. Here we demonstrate that perfusion of an index-matching fluid within a porous matrix minimizes scattering, thus enhancing optical signal by enabling the entire capture element volume to be probed. Signal enhancement is demonstrated for both fluorescence and absorbance detection, using porous polymer monoliths in a silica capillary and packed beds of glass beads within thermoplastic microchannels, respectively. Fluorescence signal was improved by a factor of 3.5× when measuring emission from a fluorescent compound attached directly to the polymer monolith, and up to 2.6× for a rapid 10 min direct immunoassay. When combining index matching with a silver enhancement step, a detection limit of 0.1 ng/mL human IgG and a 5 log dynamic range was achieved. The demonstrated technique provides a simple method for enhancing optical sensitivity for a wide range of assays, enabling the full benefits of porous detection elements in miniaturized analytical systems to be realized. PMID:26160546

  7. Optical detection enhancement in porous volumetric microfluidic capture elements using refractive index matching fluids.


    Wiederoder, M S; Peterken, L; Lu, A X; Rahmanian, O D; Raghavan, S R; DeVoe, D L


    Porous volumetric capture elements in microfluidic sensors are advantageous compared to planar capture surfaces due to higher reaction site density and decreased diffusion lengths that can reduce detection limits and total assay time. However a mismatch in refractive indices between the capture matrix and fluid within the porous interstices results in scattering of incident, reflected, or emitted light, significantly reducing the signal for optical detection. Here we demonstrate that perfusion of an index-matching fluid within a porous matrix minimizes scattering, thus enhancing optical signal by enabling the entire capture element volume to be probed. Signal enhancement is demonstrated for both fluorescence and absorbance detection, using porous polymer monoliths in a silica capillary and packed beds of glass beads within thermoplastic microchannels, respectively. Fluorescence signal was improved by a factor of 3.5× when measuring emission from a fluorescent compound attached directly to the polymer monolith, and up to 2.6× for a rapid 10 min direct immunoassay. When combining index matching with a silver enhancement step, a detection limit of 0.1 ng mL(-1) human IgG and a 5 log dynamic range was achieved. The demonstrated technique provides a simple method for enhancing optical sensitivity for a wide range of assays, enabling the full benefits of porous detection elements in miniaturized analytical systems to be realized. PMID:26160546

  8. Experimental and computational investigation of lift-enhancing tabs on a multi-element airfoil

    NASA Technical Reports Server (NTRS)

    Ashby, Dale


    An experimental and computational investigation of the effect of lift enhancing tabs on a two-element airfoil was conducted. The objective of the study was to develop an understanding of the flow physics associated with lift enhancing tabs on a multi-element airfoil. A NACA 63(sub 2)-215 ModB airfoil with a 30 percent chord Fowler flap was tested in the NASA Ames 7 by 10 foot wind tunnel. Lift enhancing tabs of various heights were tested on both the main element and the flap for a variety of flap riggings. Computations of the flow over the two-element airfoil were performed using the two-dimensional incompressible Navier-Stokes code INS2D-UP. The computer results predict all of the trends in the experimental data quite well. When the flow over the flap upper surface is attached, tabs mounted at the main element trailing edge (cove tabs) produce very little change in lift. At high flap deflections. however, the flow over the flap is separated and cove tabs produce large increases in lift and corresponding reductions in drag by eliminating the separated flow. Cove tabs permit high flap deflection angles to be achieved and reduce the sensitivity of the airfoil lift to the size of the flap gap. Tabs attached to the flap training edge (flap tabs) are effective at increasing lift without significantly increasing drag. A combination of a cove tab and a flap tab increased the airfoil lift coefficient by 11 percent relative to the highest lift tab coefficient achieved by any baseline configuration at an angle of attack of zero percent and the maximum lift coefficient was increased by more than 3 percent. A simple analytic model based on potential flow was developed to provide a more detailed understanding of how lift enhancing tabs work. The tabs were modeled by a point vortex at the training edge. Sensitivity relationships were derived which provide a mathematical basis for explaining the effects of lift enhancing tabs on a multi-element airfoil. Results of the modeling

  9. The ocs element: a 16 base pair palindrome essential for activity of the octopine synthase enhancer

    PubMed Central

    Ellis, J. G.; Llewellyn, D. J.; Walker, J. C.; Dennis, E. S.; Peacock, W. J.


    A 176 bp DNA sequence lying upstream of the octopine synthase (ocs) promoter, previously shown to have enhancer-like properties in transgenic tobacco [Ellis et al. (1987) EMBO J., 6, 11-16], functions as an enhancer in protoplasts of Zea mays (a monocot plant) and Nicotiana plumbaginifolia (a dicotplant). We have characterized this element by transient expression assays using a linked alcohol dehydrogenase (Adh1) promoter from Z. mays and the chloramphenicol acetyltransferase coding sequences. The ocs sequence functions in both orientations but its enhancing activity is dependent upon its distance from the Adh1 promoter. Transient expression assays using deletion mutants and synthetic oligonucleotides show that a 16 bp palindrome ACGTAAGCGCTTACGT, contained within the 176 bp fragment, is essential and sufficient for enhancing activity in transient expression assays. ImagesFig. 2.Fig. 4.Fig. 5. PMID:16453801

  10. 20 CFR 655.535 - The second attestation element for locations in Alaska: Employment of United States longshore...

    Code of Federal Regulations, 2011 CFR


    ... this subpart are met (e.g., “qualified and available in sufficient numbers”), the employer is still... full work units (i.e., number of workers by job title), and the date(s) and location(s) where the... qualified and available in sufficient numbers and are needed to perform the longshore activity at...

  11. A novel regulatory element (E77) isolated from CHO‐K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells

    PubMed Central

    Kang, Shin‐Young; Kim, Yeon‐Gu; Kang, Seunghee; Lee, Hong Weon


    Abstract Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO‐K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO‐K1 genomic DNA fragments with a CMV promoter‐driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  12. Geo-Located Tweets. Enhancing Mobility Maps and Capturing Cross-Border Movement.


    Blanford, Justine I; Huang, Zhuojie; Savelyev, Alexander; MacEachren, Alan M


    Capturing human movement patterns across political borders is difficult and this difficulty highlights the need to investigate alternative data streams. With the advent of smart phones and the ability to attach accurate coordinates to Twitter messages, users leave a geographic digital footprint of their movement when posting tweets. In this study we analyzed 10 months of geo-located tweets for Kenya and were able to capture movement of people at different temporal (daily to periodic) and spatial (local, national to international) scales. We were also able to capture both long and short distances travelled, highlighting regional connections and cross-border movement between Kenya and the surrounding countries. The findings from this study has broad implications for studying movement patterns and mapping inter/intra-region movement dynamics.

  13. Geo-Located Tweets. Enhancing Mobility Maps and Capturing Cross-Border Movement

    PubMed Central

    Blanford, Justine I.; Huang, Zhuojie; Savelyev, Alexander; MacEachren, Alan M.


    Capturing human movement patterns across political borders is difficult and this difficulty highlights the need to investigate alternative data streams. With the advent of smart phones and the ability to attach accurate coordinates to Twitter messages, users leave a geographic digital footprint of their movement when posting tweets. In this study we analyzed 10 months of geo-located tweets for Kenya and were able to capture movement of people at different temporal (daily to periodic) and spatial (local, national to international) scales. We were also able to capture both long and short distances travelled, highlighting regional connections and cross-border movement between Kenya and the surrounding countries. The findings from this study has broad implications for studying movement patterns and mapping inter/intra-region movement dynamics. PMID:26086772

  14. Geo-Located Tweets. Enhancing Mobility Maps and Capturing Cross-Border Movement.


    Blanford, Justine I; Huang, Zhuojie; Savelyev, Alexander; MacEachren, Alan M


    Capturing human movement patterns across political borders is difficult and this difficulty highlights the need to investigate alternative data streams. With the advent of smart phones and the ability to attach accurate coordinates to Twitter messages, users leave a geographic digital footprint of their movement when posting tweets. In this study we analyzed 10 months of geo-located tweets for Kenya and were able to capture movement of people at different temporal (daily to periodic) and spatial (local, national to international) scales. We were also able to capture both long and short distances travelled, highlighting regional connections and cross-border movement between Kenya and the surrounding countries. The findings from this study has broad implications for studying movement patterns and mapping inter/intra-region movement dynamics. PMID:26086772

  15. A Distribution-class Locational Marginal Price (DLMP) Index for Enhanced Distribution Systems

    NASA Astrophysics Data System (ADS)

    Akinbode, Oluwaseyi Wemimo

    The smart grid initiative is the impetus behind changes that are expected to culminate into an enhanced distribution system with the communication and control infrastructure to support advanced distribution system applications and resources such as distributed generation, energy storage systems, and price responsive loads. This research proposes a distribution-class analog of the transmission LMP (DLMP) as an enabler of the advanced applications of the enhanced distribution system. The DLMP is envisioned as a control signal that can incentivize distribution system resources to behave optimally in a manner that benefits economic efficiency and system reliability and that can optimally couple the transmission and the distribution systems. The DLMP is calculated from a two-stage optimization problem; a transmission system OPF and a distribution system OPF. An iterative framework that ensures accurate representation of the distribution system's price sensitive resources for the transmission system problem and vice versa is developed and its convergence problem is discussed. As part of the DLMP calculation framework, a DCOPF formulation that endogenously captures the effect of real power losses is discussed. The formulation uses piecewise linear functions to approximate losses. This thesis explores, with theoretical proofs, the breakdown of the loss approximation technique when non-positive DLMPs/LMPs occur and discusses a mixed integer linear programming formulation that corrects the breakdown. The DLMP is numerically illustrated in traditional and enhanced distribution systems and its superiority to contemporary pricing mechanisms is demonstrated using price responsive loads. Results show that the impact of the inaccuracy of contemporary pricing schemes becomes significant as flexible resources increase. At high elasticity, aggregate load consumption deviated from the optimal consumption by up to about 45 percent when using a flat or time-of-use rate. Individual load

  16. Viral expression cassette elements to enhance transgene target specificity and expression in gene therapy.


    Powell, Sara Kathleen; Rivera-Soto, Ricardo; Gray, Steven James


    Over the last five years, the number of clinical trials involving AAV (adeno-associated virus) and lentiviral vectors continue to increase by about 150 trials each year. For continued success, AAV and lentiviral expression cassettes need to be designed to meet each disease's specific needs. This review discusses how viral vector expression cassettes can be engineered with elements to enhance target specificity and increase transgene expression. The key differences relating to target specificity between ubiquitous and tissue-specific promoters are discussed, as well as how endogenous miRNAs and their target sequences have been used to restrict transgene expression. Specifically, relevant studies indicating how cis-acting elements such as introns, WPRE, polyadenylation signals, and the CMV enhancer are highlighted to show their utility for enhancing transgene expression in gene therapy applications. All discussion bears in mind that expression cassettes have space constraints. In conclusion, this review can serve as a menu of vector genome design elements and their cost in terms of space to thoughtfully engineer viral vectors for gene therapy. PMID:25636961

  17. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy

    PubMed Central

    Powell, Sara Kathleen; Rivera-Soto, Ricardo; Gray, Steven James


    Over the last five years, the number of clinical trials involving AAV (adeno-associated virus) and lentiviral vectors continue to increase by about 150 trials each year. For continued success, AAV and lentiviral expression cassettes need to be designed to meet each disease's specific needs. This review discusses how viral vector expression cassettes can be engineered with elements to enhance target specificity and increase transgene expression. The key differences relating to target specificity between ubiquitous and tissue-specific promoters are discussed, as well as how endogenous miRNAs and their target sequences have been used to restrict transgene expression. Specifically, relevant studies indicating how cis-acting elements such as introns, WPRE, polyadenylation signals, and the CMV enhancer are highlighted to show their utility for enhancing transgene expression in gene therapy applications. All discussion bears in mind that expression cassettes have space constraints. In conclusion, this review can serve as a menu of vector genome design elements and their cost in terms of space to thoughtfully engineer viral vectors for gene therapy. PMID:25636961

  18. Enhancing effect of marine oligotrophy on environmental concentrations of particle-reactive trace elements

    SciTech Connect

    Jeffree, R.A.; Szymczak, R.


    A biogeochemical model has been previously developed that explains the inverse and nonlinear relationship between Po-210 concentration in zooplankton and their biomass, under oligotrophic conditions in French Polynesia. In this study the model structure was reviewed to determine a set of biogeochemical behaviors of Po-210, proposed to be critical to its environmental enhancement under oligotrophy: this set was then used to identify 25 other elements with comparable behaviors to Po-210. Field investigation in the Timor Sea showed that four of these a priori identified elements, viz. Cd, Co, Pb, and Mn as well as Cr and Ni, showed elevated water concentrations with reduced particle removal rates in the euphotic zone, results that are consistent with those previously obtained for Po-210 and the proposed explanatory model. These findings point to the enhanced susceptibility to contamination with particle-reactive elements of oligotrophic marine systems, whose degree and geographic extent may be enhanced by projected increases in sea surface temperatures from global warming.

  19. Identifying elements of the plumbing system beneath Kilauea Volcano, Hawaii, from the source locations of very-long-period signals

    USGS Publications Warehouse

    Almendros, J.; Chouet, B.; Dawson, P.; Bond, T.


    We analyzed 16 seismic events recorded by the Hawaiian broad-band seismic network at Kilauca Volcano during the period September 9-26, 1999. Two distinct types of event are identified based on their spectral content, very-long-period (VLP) waveform, amplitude decay pattern and particle motion. We locate the VLP signals with a method based on analyses of semblance and particle motion. Different source regions are identified for the two event types. One source region is located at depths of ~1 km beneath the northeast edge of the Halemaumau pit crater. A second region is located at depths of ~8 km below the northwest quadrant of Kilauea caldera. Our study represents the first time that such deep sources have been identified in VLP data at Kilauea. This discovery opens the possibility of obtaining a detailed image of the location and geometry of the magma plumbing system beneath this volcano based on source locations and moment tensor inversions of VLP signals recorded by a permanent, large-aperture broad-band network.

  20. A meiotic drive element in the maize pathogen Fusarium verticillioides is located within a 102-kb region of chromosome V

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny f...

  1. Dissection of a Ciona regulatory element reveals complexity of cross-species enhancer activity.


    Chen, Wei-Chung; Pauls, Stefan; Bacha, Jamil; Elgar, Greg; Loose, Matthew; Shimeld, Sebastian M


    Vertebrate genomes share numerous conserved non-coding elements, many of which function as enhancer elements and are hypothesised to be under evolutionary constraint due to a need to be bound by combinations of sequence-specific transcription factors. In contrast, few such conserved elements can be detected between vertebrates and their closest invertebrate relatives. Despite this lack of sequence identity, cross-species transgenesis has identified some cases where non-coding DNA from invertebrates drives reporter gene expression in transgenic vertebrates in patterns reminiscent of the expression of vertebrate orthologues. Such instances are presumed to reflect the presence of conserved suites of binding sites in the regulatory regions of invertebrate and vertebrate orthologues, such that both regulatory elements can correctly interpret the trans-activating environment. Shuffling of binding sites has been suggested to lie behind loss of sequence conservation; however this has not been experimentally tested. Here we examine the underlying basis of enhancer activity for the Ciona intestinalis βγ-crystallin gene, which drives expression in the lens of transgenic vertebrates despite the Ciona lineage predating the evolution of the lens. We construct an interactive gene regulatory network (GRN) for vertebrate lens development, allowing network interactions to be robustly catalogued and conserved network components and features to be identified. We show that a small number of binding motifs are necessary for Ciona βγ-crystallin expression, and narrow down the likely factors that bind to these motifs. Several of these overlap with the conserved core of the vertebrate lens GRN, implicating these sites in cross species function. However when we test these motifs in a transgenic vertebrate they prove to be dispensable for reporter expression in the lens. These results show that current models depicting cross species enhancer function as dependent on conserved binding

  2. Whistler wave radiation from a pulsed loop antenna located in a cylindrical duct with enhanced plasma density

    SciTech Connect

    Kudrin, Alexander V.; Shkokova, Natalya M.; Ferencz, Orsolya E.; Zaboronkova, Tatyana M.


    Pulsed radiation from a loop antenna located in a cylindrical duct with enhanced plasma density is studied. The radiated energy and its distribution over the spatial and frequency spectra of the excited waves are derived and analyzed as functions of the antenna and duct parameters. Numerical results referring to the case where the frequency spectrum of the antenna current is concentrated in the whistler range are reported. It is shown that under ionospheric conditions, the presence of an artificial duct with enhanced density can lead to a significant increase in the energy radiated from a pulsed loop antenna compared with the case where the same source is immersed in the surrounding uniform magnetoplasma. The results obtained can be useful in planning active ionospheric experiments with pulsed electromagnetic sources operated in the presence of artificial field-aligned plasma density irregularities that are capable of guiding whistler waves.

  3. A Modular Enhancer Is Differentially Regulated by GATA and NFAT Elements That Direct Different Tissue-Specific Patterns of Nucleosome Positioning and Inducible Chromatin Remodeling▿

    PubMed Central

    Bert, Andrew G.; Johnson, Brett V.; Baxter, Euan W.; Cockerill, Peter N.


    We investigated alternate mechanisms employed by enhancers to position and remodel nucleosomes and activate tissue-specific genes in divergent cell types. We demonstrated that the granulocyte-macrophage colony-stimulating factor (GM-CSF) gene enhancer is modular and recruits different sets of transcription factors in T cells and myeloid cells. The enhancer recruited distinct inducible tissue-specific enhanceosome-like complexes and directed nucleosomes to different positions in these cell types. In undifferentiated T cells, the enhancer was activated by inducible binding of two NFAT/AP-1 complexes which disrupted two specifically positioned nucleosomes (N1 and N2). In myeloid cells, the enhancer was remodeled by GATA factors which constitutively displaced an upstream nucleosome (N0) and cooperated with inducible AP-1 elements to activate transcription. In mast cells, which express both GATA-2 and NFAT, these two pathways combined to activate the enhancer and generate high-level gene expression. At least 5 kb of the GM-CSF locus was organized as an array of nucleosomes with fixed positions, but the enhancer adopted different nucleosome positions in T cells and mast cells. Furthermore, nucleosomes located between the enhancer and promoter were mobilized upon activation in an enhancer-dependent manner. These studies reveal that distinct tissue-specific mechanisms can be used either alternately or in combination to activate the same enhancer. PMID:17283044

  4. Boundary element method applied to a gas-fired pin-fin-enhanced heat pipe

    SciTech Connect

    Andraka, C.E.; Knorovsky, G.A.; Drewien, C.A.


    The thermal conduction of a portion of an enhanced surface heat exchanger for a gas fired heat pipe solar receiver was modeled using the boundary element and finite element methods (BEM and FEM) to determine the effect of weld fillet size on performance of a stud welded pin fin. A process that could be utilized by others for designing the surface mesh on an object of interest, performing a conversion from the mesh into the input format utilized by the BEM code, obtaining output on the surface of the object, and displaying visual results was developed. It was determined that the weld fillet on the pin fin significantly enhanced the heat performance, improving the operating margin of the heat exchanger. The performance of the BEM program on the pin fin was measured (as computational time) and used as a performance comparison with the FEM model. Given similar surface element densities, the BEM method took longer to get a solution than the FEM method. The FEM method creates a sparse matrix that scales in storage and computation as the number of nodes (N), whereas the BEM method scales as N{sup 2} in storage and N{sup 3} in computation.

  5. Enhanced signal processing algorithms for buried unexploded ordnance detection and location estimation with magnetometer and electromagnetic induction measurements

    SciTech Connect

    Witten, A.


    Enhanced signal processing algorithms have been developed for the detection and location of buried unexploded ordnance using magnetometry and electromagnetic induction (EMI) measurements. These signal processing algorithms are related to those used to image with geophysical diffraction tomography (GDT) employing wave-based measurements. The underlying relationship of GDT is the Generalized Projection Slice Theorem (GPST) that relates the spatial Fourier transform of acquired data to the spatial Fourier transform of subsurface inhomogeneities of one higher dimension. This relationship can be used to simulate data templates for known targets and, by virtue of the shift property of Fourier transforms, a data simulation need only be computed for one reference target location. All other target locations are generated by an appropriate phase shift. These data templates can be correlated with acquired data to determine the spatial distribution of probable target location. This approach to target detection and location estimation, referred to as a maximum likelihood estimation, can be used to produce an {open_quotes}image{close_quotes} of the likelihood of a specified target`s position. For non wave-based methods, the relationship between data and target characteristics is not strictly associated with Fourier transforms. In the case of magnetometry, the appropriate GPST requires a Fourier-Laplace transform of the target characteristics while the EMI GPST is based on an integral transform with a complex wavenumber. Nevertheless, the shift rule for integral transforms can be invoked to yield GPST`s for these tools and the associated computationally efficient maximum likelihood estimators. The EMI detection algorithm was applied to data acquired at a known underground storage tank site and the algorithms for both magnetometry and EMI were applied to data acquired at the Magnetic Range of the Naval EOD Tech Center in Indian Head, Maryland.

  6. Disruption of the Abdominal-B Promoter Tethering Element Results in a Loss of Long-Range Enhancer-Directed Hox Gene Expression in Drosophila

    PubMed Central

    Ho, Margaret C. W.; Schiller, Benjamin J.; Akbari, Omar S.; Bae, Esther; Drewell, Robert A.


    There are many examples within gene complexes of transcriptional enhancers interacting with only a subset of target promoters. A number of molecular mechanisms including promoter competition, insulators and chromatin looping are thought to play a role in regulating these interactions. At the Drosophila bithorax complex (BX-C), the IAB5 enhancer specifically drives gene expression only from the Abdominal-B (Abd-B) promoter, even though the enhancer and promoter are 55 kb apart and are separated by at least three insulators. In previous studies, we discovered that a 255 bp cis-regulatory module, the promoter tethering element (PTE), located 5′ of the Abd-B transcriptional start site is able to tether IAB5 to the Abd-B promoter in transgenic embryo assays. In this study we examine the functional role of the PTE at the endogenous BX-C using transposon-mediated mutagenesis. Disruption of the PTE by P element insertion results in a loss of enhancer-directed Abd-B expression during embryonic development and a homeotic transformation of abdominal segments. A partial deletion of the PTE and neighboring upstream genomic sequences by imprecise excision of the P element also results in a similar loss of Abd-B expression in embryos. These results demonstrate that the PTE is an essential component of the regulatory network at the BX-C and is required in vivo to mediate specific long-range enhancer-promoter interactions. PMID:21283702

  7. Evidence for enhanced bioavailability of trace elements in the marine ecosystem of Deception Island, a volcano in Antarctica.


    Deheyn, Dimitri D; Gendreau, Philippe; Baldwin, Roberta J; Latz, Michael I


    This study assessed whether trace elements present at Deception Island, an active submarine volcano in the Antarctic Peninsula, show enhanced biological availability to the local marine community. Using a weak acid extraction method to dissolve organic material and leach associated but not constitutive trace elements of sediments, fifteen elements were measured from seafloor sediment, seawater particulates, and tissues of benthic (bivalves, brittlestars, sea urchins) and pelagic (demersal and pelagic fishes, krill) organisms collected in the flooded caldera. The highest element concentrations were associated with seafloor sediment, the lowest with seawater particulates and organism tissues. In the case of Ag and Se, concentrations were highest in organism tissue, indicating contamination through the food chain and biomagnification of those elements. The elements Al, Fe, Mn, Sr, Ti, and to a lesser extent Zn, were the most concentrated of the trace elements for all sample types. This indicates that the whole ecosystem of Deception Island is contaminated with trace elements from local geothermal activity, which is also reflected in the pattern of element contamination in organisms. Accordingly, element concentrations were higher in organisms collected at Deception Island compared to those from the neighboring non-active volcanic King George Island, suggesting that volcanic activity enhances bioavailability of trace elements to marine organisms. Trace element concentrations were highest in digestive tissue of organisms, suggesting that elements at Deception Island are incorporated into the marine food web mainly through a dietary route.

  8. Evidence for enhanced bioavailability of trace elements in the marine ecosystem of Deception Island, a volcano in Antarctica.


    Deheyn, Dimitri D; Gendreau, Philippe; Baldwin, Roberta J; Latz, Michael I


    This study assessed whether trace elements present at Deception Island, an active submarine volcano in the Antarctic Peninsula, show enhanced biological availability to the local marine community. Using a weak acid extraction method to dissolve organic material and leach associated but not constitutive trace elements of sediments, fifteen elements were measured from seafloor sediment, seawater particulates, and tissues of benthic (bivalves, brittlestars, sea urchins) and pelagic (demersal and pelagic fishes, krill) organisms collected in the flooded caldera. The highest element concentrations were associated with seafloor sediment, the lowest with seawater particulates and organism tissues. In the case of Ag and Se, concentrations were highest in organism tissue, indicating contamination through the food chain and biomagnification of those elements. The elements Al, Fe, Mn, Sr, Ti, and to a lesser extent Zn, were the most concentrated of the trace elements for all sample types. This indicates that the whole ecosystem of Deception Island is contaminated with trace elements from local geothermal activity, which is also reflected in the pattern of element contamination in organisms. Accordingly, element concentrations were higher in organisms collected at Deception Island compared to those from the neighboring non-active volcanic King George Island, suggesting that volcanic activity enhances bioavailability of trace elements to marine organisms. Trace element concentrations were highest in digestive tissue of organisms, suggesting that elements at Deception Island are incorporated into the marine food web mainly through a dietary route. PMID:15649525

  9. Enhanced Low-Enriched Uranium Fuel Element for the Advanced Test Reactor

    SciTech Connect

    Pope, M. A.; DeHart, M. D.; Morrell, S. R.; Jamison, R. K.; Nef, E. C.; Nigg, D. W.


    Under the current US Department of Energy (DOE) policy and planning scenario, the Advanced Test Reactor (ATR) and its associated critical facility (ATRC) will be reconfigured to operate on low-enriched uranium (LEU) fuel. This effort has produced a conceptual design for an Enhanced LEU Fuel (ELF) element. This fuel features monolithic U-10Mo fuel foils and aluminum cladding separated by a thin zirconium barrier. As with previous iterations of the ELF design, radial power peaking is managed using different U-10Mo foil thicknesses in different plates of the element. The lead fuel element design, ELF Mk1A, features only three fuel meat thicknesses, a reduction from the previous iterations meant to simplify manufacturing. Evaluation of the ELF Mk1A fuel design against reactor performance requirements is ongoing, as are investigations of the impact of manufacturing uncertainty on safety margins. The element design has been evaluated in what are expected to be the most demanding design basis accident scenarios and has met all initial thermal-hydraulic criteria.


    NASA Astrophysics Data System (ADS)

    McAlexander, W. I.; Rau, G. H.; Dobeck, L.; Spangler, L.


    A commercial instrument (Los Gatos Research, model 908-0003) utilizing Cavity Enhanced Laser Absorption Spectroscopy was deployed in 2009 at the ZERT carbon release site (Bozeman, MT) for real time measurement of above-ground CO2 concentration and isotope ratio (δ13C). An automated switching system sampled 13 different locations in the field, as well as two known references, over an 8 day period. Real-time Keeling plots were constructed showing distinct signatures of soil (-27.0 ‰) and fossil (-56.0 ‰) sources compared to background air (-8.2 ‰). Instrument performance gave 0.2 ‰ precision with only 100 seconds of averaging per inlet. Sequential sampling of the various inlets gave a temporal and physical mapping of the CO2 release plume that is difficult to obtain using more conventional techniques. The figures show the nature and quality of the data from one of the locations. Details concerning instrument performance, systematics, calibration, and data processing will be discussed. Fig1: Time chart of CO2 concentration and isotope ratio δ13C from one of 13 sample inlet locations at ZERT release field, July, 2009. Fig2: Keeling plot of data from Fig1 illustrating the two source mixing of soil (-27 ‰) and fossil (-56 ‰) CO2 with background air.

  11. Statins enhance cognitive performance in object location test in albino Swiss mice: involvement of beta-adrenoceptors.


    Vandresen-Filho, Samuel; França, Lucas Moreira; Alcantara-Junior, José; Nogueira, Lucas Caixeta; de Brito, Thiago Marques; Lopes, Lousã; Junior, Fernando Mesquita; Vanzeler, Maria Luzinete; Bertoldo, Daniela Bohn; Dias, Paula Gomes; Colla, André R S; Hoeller, Alexandre; Duzzioni, Marcelo; Rodrigues, Ana Lúcia S; de Lima, Thereza C M; Tasca, Carla Inês; Viola, Giordano Gubert


    Statins are inhibitors of the 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase, thereby inhibiting cell synthesis of cholesterol and isoprenoids. Moreover, several studies have been evaluating pleiotropic effects of statins, mainly because they present neuroprotective effects in various pathological conditions. However, knowledge about behavioral effects of statins per se is relatively scarce. Considering these facts, we aimed to analyze behavioral responses of atorvastatin or simvastatin-treated mice in the open field test, elevated plus maze and object location test. Atorvastatin treatment for 7 consecutive days at 1 mg/kg or 10 mg/kg (v.o.) or simvastatin 10 mg/kg or 20 mg/kg enhanced cognitive performance in object location test when compared to control group (saline-treated mice). Simvastatin effects on mice performance in the object location test was abolished by post-training infusion of the beta-adrenoceptor antagonist propranolol. Atorvastatin and simvastatin did not change the behavioral response in open field and elevated plus-maze (EPM) tests in any of the used doses. These data demonstrate the positive effects of both statins in cognitive processes in mice, without any alteration in locomotor parameters in the open field test or anxiolytic-like behavior in EPM. In conclusion, we demonstrate that atorvastatin and simvastatin per se improve the cognitive performance in a rodent model of spatial memory and this effect is related to beta-adrenergic receptors modulation.

  12. Dependence of radiation belt enhancements on the radial extent of Pc5 waves and the plasmapause location

    NASA Astrophysics Data System (ADS)

    Georgiou, M.; Daglis, I. A.; Zesta, E.; Balasis, G.; Katsavrias, C.; Mann, I. R.; Tsinganos, K.


    Low-energy electrons are accelerated to relativistic energies through different mechanisms, transporting them across their drift shells to the outer radiation belt. Among the different acceleration mechanisms, radial diffusion describes the result of ULF magnetic field pulsations resonantly interacting with radiation belt electrons. In this paper, the radial positioning of the relativistic electron population during 39 intense and moderate magnetic storms is examined against that of ULF Pc5 wave power and the plasmapause location. The relativistic electron population of the outer radiation belt appeared enhanced in the 2 - 6 MeV electron flux data from SAMPEX and in > 2 MeV electron flux data from the geosynchronous GOES satellites following 27 of the magnetic storms. We compared relativistic electrons observations with concurrent radial distribution of wave power enhancements at Pc5 frequencies as detected by the IMAGE and CARISMA magnetometer arrays, as well as by additional magnetic stations collaborating in SuperMAG. We discuss the growth and decay characteristics of Pc5 waves in association with the plasmapause location, determined from IMAGE EUV observations, as the controlling factor for wave power penetration deep into the magnetosphere. We show that, during magnetic storms characterized by increased post-storm fluxes, Pc5 wave power penetrates to L shells of 4 and lower. On the other hand, magnetic storms which were characterised by loss of electrons were related to low Pc5 wave activity, which was not intensified at low L shells. These observations provide support for the hypothesis that enhanced Pc5 wave activity deep into the magnetosphere during the main and recovery phase can discriminate between storms that result in increases of electron fluxes from those that do not. The work leading to this paper has received funding from the European Union's Seventh Framework Programme (FP7-SPACE-2011-1) under grant agreement no. 284520 for the MAARBLE

  13. Histone H3 K27 acetylation marks a potent enhancer element on the adipogenic master regulator gene Pparg2

    PubMed Central

    Ramlee, Muhammad Khairul; Zhang, Qiongyi; Idris, Muhammad; Peng, Xu; Sim, Choon Kiat; Han, Weiping; Xu, Feng


    PPARγ2 is expressed almost exclusively in adipose tissue and plays a central role in adipogenesis. Despite intensive studies over the last 2 decades, the mechanism regulating the expression of the Pparg2 gene, especially the role of cis-regulatory elements, is still not completely understood. Here, we report a comprehensive investigation of the enhancer elements within the murine Pparg2 gene. Utilizing the combined techniques of sequence conservation analysis and chromatin marker examination, we identified a potent enhancer element that augmented the expression of a reporter gene under the control of the Pparg2 promoter by 20-fold. This enhancer element was first identified as highly conserved non-coding sequence 10 (CNS10) and was later shown to be enriched with the enhancer marker H3 K27 acetylation. Further studies identified a binding site for p300 as the essential enhancer element in CNS10. Moreover, p300 physically binds to CNS10 and is required for the enhancer activity of CNS10. The depletion of p300 by siRNA resulted in significantly impaired activation of Pparg2 at the early stages of 3T3-L1 adipogenesis. In summary, our study identified a novel enhancer element on the murine Pparg2 gene and suggested a novel mechanism for the regulation of Pparg2 expression by p300 in 3T3-L1 adipogenesis. PMID:25485585

  14. [Structural and functional study of prokaryotic enhancer-like element VV1 from vaccinia virus].


    Cao, R; Bi, X L; Han, F; Yang, G B; Wu, S H


    Enhancer VV1 (about 283 bp) is selected as the target to analyze its structure and function systemically. Stepwise deletion experiment is used to identify the functional domain of VV1 element. The results suggest that the 20 bp at 5' terminal and 20 bp at 3' terminal are important to the activity of VV1, for without either of them its activity decreased greatly. Furthermore, the 30-50 bp at 5' terminal is essential to its activity, without which will lead to complete loss of its activity. By random mutagenesis assay it is found that base mutation can regulate the activity of enhancer VV1 positively or negatively. The more the activities of mutants descend, the more mutations take place. For singlebase mutation, the activities change relatively little, and most of the mutations always occur in the 50 bp at the 5' terminal. PMID:11517611

  15. Genome-Wide Computational Analysis of Dioxin Response Element Location and Distribution in the Human, Mouse and Rat Genomes

    PubMed Central

    Dere, Edward; Forgacs, Agnes L; Zacharewski, Timothy R; Burgoon, Lyle D


    The aryl hydrocarbon receptor (AhR) mediates responses elicited by 2,3,7,8-tetrachlorodibenzo-p-dioxin by binding to dioxin response elements (DRE) containing the core consensus sequence 5′-GCGTG-3′. The human, mouse and rat genomes were computationally searched for all DRE cores. Each core was then extended by 7bp upstream and downstream, and matrix similarity (MS) scores for the resulting 19bp DRE sequences were calculated using a revised position weight matrix constructed from bona fide functional DREs. In total, 72,318 human, 70,720 mouse and 88,651 rat high-scoring (MS ≥ 0.8437) putative DREs were identified. Gene encoding intragenic DNA regions had ~1.6-times more putative DREs than the non-coding intergenic DNA regions. Furthermore, the promoter region spanning ±1.5kb of a TSS had the highest density of putative DREs within the genome. Chromosomal analysis found that the putative DRE densities of chromosomes X and Y were significantly lower than the mean chromosomal density. Interestingly, the 10kb upstream promoter region on chromosome X of the genomes were significantly less dense than the chromosomal mean, while the same region in chromosome Y was the most dense. In addition to providing a detailed genomic map of all DRE cores in the human, mouse and rat genomes, these data will further aid the elucidation of AhR-mediated signal transduction. PMID:21370876

  16. Intercomparison of thermal and optical measurement methods for elemental carbon and black carbon at an urban location.


    Hitzenberger, R; Petzold, A; Bauer, H; Ctyroky, P; Pouresmaeil, P; Laskus, L; Puxbaum, H


    Despite intensive efforts during the past 20 years, no generally accepted standard method exists to measure black carbon (BC) or elemental carbon (EC). Data on BC and EC concentrations are method specific and can differ widely (e.g. Schmid et al., 2001, ten Brink et al., 2004). In this study, a comprehensive set of methods (both optical and thermal) is compared. Measurements were performed under urban background conditions in Vienna, Austria, a city heavily impacted by diesel emissions. Filter and impactor samples were taken during 3 weeks in summer 2002 and analyzed for EC with thermal methods: a modified Cachier method (Cachier et al., 1989), a thermal-optical method (Schmid et al., 2001), and the VDI method (VDI, 1996); for BC with optical methods: a filter transmission method and the integrating sphere method (Hitzenberger et al., 1996); and for total carbon (TC) with a combustion method (Puxbaum and Rendl, 1983). The online methods aethalometer (Hansen et al., 1984) and the multiangle absorption photometer MAAP (Petzold et al., 2002) to measure BC were also used. The average values of BC and EC obtained with the methods agreed within their standard deviations. A conversion table was set up to allow comparisons between data measured elsewhere under urban background conditions (with similar source characteristics) with different instruments. An approach to estimate the absorption coefficient from attenuation data is derived so that existing records of aethalometer data in urban environments may be used to obtain also the absorption coefficients.

  17. Wall thickness measurement using resonant phenomena of circumferential Lamb waves generated by plural transducer elements located evenly on girth

    NASA Astrophysics Data System (ADS)

    Nishino, Hideo; Iwata, Kodai; Ishikawa, Masashi


    We present a novel method of measuring the pipe wall thickness using the resonance of the circumferential (C-) Lamb wave generated by a piezoelectric ring-shaped sensor (PS). The PS is a special device for an axially propagating torsional wave; however, the C-Lamb waves are generated simultaneously as spurious signals owing to the structure of the PS. Particularly under resonant conditions, the C-Lamb waves are dominantly generated, distorting the axially propagating wave. In this method, these troublesome spurious signals are used effectively for the measurement of the wall thickness under the PS location that is a dead zone of the PS itself. The method can compensate for its drawback, namely, the dead zone problem, without using additional instruments. In this study, the mechanisms of the generation and resonance of the C-Lamb waves were first explained. Secondly, the principle of the wall thickness estimation utilizing the resonance of the C-Lamb waves was proposed. Finally, experimental verifications were carried out. The estimated wall thicknesses agreed very well (maximum 1.5% error) with those measured by a micrometer caliper under suitable resonant conditions.

  18. S-S synapsis during class switch recombination is promoted by distantly located transcriptional elements and activation-induced deaminase.


    Wuerffel, Robert; Wang, Lili; Grigera, Fernando; Manis, John; Selsing, Erik; Perlot, Thomas; Alt, Frederick W; Cogne, Michel; Pinaud, Eric; Kenter, Amy L


    Molecular mechanisms underlying synapsis of activation-induced deaminase (AID)-targeted S regions during class switch recombination (CSR) are poorly understood. By using chromosome conformation capture techniques, we found that in B cells, the Emicro and 3'Ealpha enhancers were in close spatial proximity, forming a unique chromosomal loop configuration. B cell activation led to recruitment of the germline transcript (GLT) promoters to the Emicro:3'Ealpha complex in a cytokine-dependent fashion. This structure facilitated S-S synapsis because Smicro was proximal to Emicro and a downstream S region was corecruited with the targeted GLT promoter to Emicro:3'Ealpha. We propose that GLT promoter association with the Emicro:3'Ealpha complex creates an architectural scaffolding that promotes S-S synapsis during CSR and that these interactions are stabilized by AID. Thus, the S-S synaptosome is formed as a result of the self-organizing transcription system that regulates GLT expression and may serve to guard against spurious chromosomal translocations.

  19. Functional Analysis of a Bacitracin Resistance Determinant Located on ICECp1, a Novel Tn916-Like Element from a Conjugative Plasmid in Clostridium perfringens

    PubMed Central

    Han, Xiaoyan; Du, Xiang-Dang; Southey, Luke; Bulach, Dieter M.; Seemann, Torsten; Yan, Xu-Xia; Bannam, Trudi L.


    Bacitracins are mixtures of structurally related cyclic polypeptides with antibiotic properties. They act by interfering with the biosynthesis of the bacterial cell wall. In this study, we analyzed an avian necrotic enteritis strain of Clostridium perfringens that was resistant to bacitracin and produced NetB toxin. We identified a bacitracin resistance locus that resembled a bacitracin resistance determinant from Enterococcus faecalis. It contained the structural genes bcrABD and a putative regulatory gene, bcrR. Mutagenesis studies provided evidence that both bcrA and bcrB are essential for bacitracin resistance, and that evidence was supported by the results of experiments in which the introduction of both the bcrA and bcrB genes into a bacitracin-susceptible C. perfringens strain was required to confer bacitracin resistance. The wild-type strain was shown to contain at least three large, putatively conjugative plasmids, and the bcrRABD locus was localized to an 89.7-kb plasmid, pJIR4150. This plasmid was experimentally shown to be conjugative and was sequenced. The sequence revealed that it also carries a tpeL toxin gene and is related to the pCW3 family of conjugative antibiotic resistance and toxin plasmids from C. perfringens. The bcr genes were located on a genetic element, ICECp1, which is related to the Tn916 family of integrative conjugative elements (ICEs). ICECp1 appears to be the first Tn916-like element shown to confer bacitracin resistance. In summary, we identified in a toxin-producing C. perfringens strain a novel mobile bacitracin resistance element which was experimentally shown to be essential for bacitracin resistance and is carried by a putative ICE located on a conjugative plasmid. PMID:26282424

  20. Crystal Structure of NFAT Bound to the HIV-1 LTR Tandem κB Enhancer Element

    SciTech Connect

    Bates, Darren L.; Barthel, Kristen K.B.; Wu, Yongqing; Kalhor, Reza; Stroud, James C.; Giffin, Michael J.; Chen, Lin


    Here, we have determined the crystal structure of the DNA binding domain of NFAT bound to the HIV-1 long terminal repeat (LTR) tandem {kappa}B enhancer element of 3.05 {angstrom} resolution. NFAT binds as a dimer to the upstream {kappa}B site (Core II), but as a monomer to the 3' end of the downstream {kappa}B site (Core I). The DNA shows a significant bend near the 5' end of Core I, where a lysine residue from NFAT bound to the 3' end of Core II inserts into the minor groove and seems to cause DNA bases to flip out. Consistent with this structural feature, the 5' end of Core I become hypersensitive to dimethylsulfate in the in vivo footprinting upon transcriptional activation of the HIV-1 LTR. Our studies provide a basis for futher investigating the functional mechanism of NFAT in HIV-1 transcription and replication.

  1. Enhanced plasmonic light absorption engineering of graphene: simulation by boundary-integral spectral element method.


    Niu, Jun; Luo, Ma; Zhu, Jinfeng; Liu, Qing Huo


    Graphene's relatively poor absorption is an essential obstacle for designing graphene-based photonic devices with satisfying photo-responsivity. To enhance the tunable light absorption of graphene, appropriate excitation of localized surface plasmon resonance is considered as a promising approach. In this work, the strategy of incorporating periodic cuboid gold nanoparticle (NP) cluster arrays and cylindrical gold NP arrays with Bragg reflectors into graphene-based photodetectors are theoretically studied by the boundary-integral spectral element method (BI-SEM). With the BI-SEM, the models can be numerically analyzed with excellent accuracy and efficiency. Numerical simulation shows that the proposed structures can effectively engineer the light absorption in graphene by tuning plasmon resonance. In the spectra of 300 nm to 1000 nm, a maximum light absorption of 67.54% is observed for the graphene layer with optimal parameters of the photodetector model.

  2. An enhanced Kurtogram method for fault diagnosis of rolling element bearings

    NASA Astrophysics Data System (ADS)

    Wang, Dong; Tse, Peter W.; Tsui, Kwok Leung


    The Kurtogram is based on the kurtosis of temporal signals that are filtered by the short-time Fourier transform (STFT), and has proved useful in the diagnosis of bearing faults. To extract transient impulsive signals more effectively, wavelet packet transform is regarded as an alternative method to STFT for signal decomposition. Although kurtosis based on temporal signals is effective under some conditions, its performance is low in the presence of a low signal-to-noise ratio and non-Gaussian noise. This paper proposes an enhanced Kurtogram, the major innovation of which is kurtosis values calculated based on the power spectrum of the envelope of the signals extracted from wavelet packet nodes at different depths. The power spectrum of the envelope of the signals defines the sparse representation of the signals and kurtosis measures the protrusion of the sparse representation. This enhanced Kurtogram helps to determine the location of resonant frequency bands for further demodulation with envelope analysis. The frequency signatures of the envelope signal can then be used to determine the type of fault that has affected a bearing by identifying its characteristic frequency. In many cases, discrete frequency noise always exists and may mask the weak bearing faults. It is usually preferable to remove such discrete frequency noise by using autoregressive filtering before the enhanced Kurtogram is performed. At last, we used a number of simulated bearing fault signals and three real bearing fault signals obtained from an experimental motor to validate the efficiency of these proposed modifications. The results show that both the proposed method and the enhanced Kurtogram are effective in the detection of various bearing faults.

  3. Parkinson-associated risk variant in enhancer element produces subtle effect on target gene expression

    PubMed Central

    Soldner, Frank; Stelzer, Yonatan; Shivalila, Chikdu S.; Abraham, Brian J.; Latourelle, Jeanne C.; Barrasa, M. Inmaculada; Goldmann, Johanna; Myers, Richard H.; Young, Richard A.; Jaenisch, Rudolf


    Genome-wide association studies (GWAS) have identified numerous genetic variants associated with complex diseases but mechanistic insights are impeded by the lack of understanding of how specific risk variants functionally contribute to the underlying pathogenesis1. It has been proposed that cis-acting effects of non-coding risk variants on gene expression are a major factor for phenotypic variation of complex traits and disease susceptibility. Recent genome-scale chromatin mapping studies have highlighted the enrichment of GWAS variants in regulatory DNA elements of disease-relevant cell types2–6. Furthermore, single nucleotide polymorphism (SNP)-specific changes in transcription factor (TF) binding are correlated with heritable alterations in chromatin state and considered a major mediator of sequence-dependent regulation of gene expression7–10. Here we describe a novel strategy to functionally dissect the cis-acting effect of genetic risk variants in regulatory elements on gene expression by combining genome-wide epigenetic information with clustered regularly-interspaced short palindromic repeats (CRISPR)/Cas9 genome editing in human pluripotent stem cells (hPSCs). By generating a genetically precisely controlled experimental system we identify a common Parkinson’s disease (PD)-associated risk variant in a non-coding distal enhancer element that regulates the expression of alpha-synuclein (SNCA), a key gene implicated in the pathogenesis of PD. Our data suggest that the transcriptional deregulation of SNCA is associated with sequence-dependent binding of the brain-specific TFs EMX2 and NKX6-1. This work establishes an experimental paradigm to functionally connect genetic variation with disease relevant phenotypes. PMID:27096366

  4. GABA acting on GABAB receptors located in a medullary pain facilitatory area enhances nociceptive behaviors evoked by intraplantar formalin injection.


    Martins, Isabel; Carvalho, Paulina; de Vries, Martin G; Teixeira-Pinto, Armando; Wilson, Steven P; Westerink, Ben H C; Tavares, Isaura


    The dorsal reticular nucleus (DRt) plays a key role in facilitation of nociceptive transmission at the spinal cord. In this study, we evaluated the mechanisms involved in GABA-mediated control of the DRt focusing on the role of local GABAB receptors. First, we used in vivo microdialysis to study the release of GABA in the DRt during the course of the formalin test. An increase of GABA levels in comparison with baseline values was detected in the second phase of the test. Because we previously showed that GABAB receptors are expressed by opioidergic DRt neurons, which respond to nociceptive stimuli and inhibit spinally projecting DRt neurons involved in descending pronociception, we then interfered with local GABAB receptors using gene transfer and pharmacological approaches. Lentiviral-mediated knockdown of GABAB1a expression decreased nociceptive responses during the second phase of the test. Local administration of the GABAB receptor antagonist CGP 35348 also decreased nociceptive responses in the second phase of the test, whereas the opposite was detected after injection of the GABAB agonist baclofen. Finally, we determined the GABAergic afferents of the DRt, namely those arising from its main brain afferents, which are located at the telencephalon and diencephalon. For that purpose, we combined retrograde tract-tracing from the DRt with immunodetection of glutamate decarboxylase, the GABA-synthesizing enzyme. The higher numbers of retrogradely labelled glutamate decarboxylase-immunoreactive neurons were located at insular, somatosensory, and motor cortices. Collectively, the results suggest that GABA acting on GABAB receptors may enhance pain facilitation from the DRt during inflammatory pain.

  5. Optical and surface enhanced Raman scattering properties of Au nanoparticles embedded in and located on a carbonaceous matrix.


    Prakash, Jai; Kumar, Vinod; Kroon, R E; Asokan, K; Rigato, V; Chae, K H; Gautam, S; Swart, H C


    Au nanoparticles (NPs) on the surface and embedded in a matrix have been the subject of studies dealing with a variety of spectroscopic and sensing applications. Here, we report on low energy Ar ion induced evolution of the morphology of a thin Au film on a polyethylene terephthalate (PET) substrate along with thermodynamic interpretations, and corresponding unique surface plasmon resonance (SPR) and photoluminescence (PL) properties. These properties are linked to the variation of surface nanostructures and the surface enhanced Raman scattering (SERS) effect of methyl orange (MO) dye molecules adsorbed on the surface. Ion induced thermal spike and sputtering resulted in dewetting of the film with subsequent formation of spherical NPs. This was followed by embedding of the NPs in the modified PET due to the thermodynamic driving forces involved. The surface and interface morphologies were studied using atomic force microscopy and cross-sectional transmission electron microscopy. X-ray photoelectron spectroscopy was used to study the chemical changes in the system upon irradiation. The optical properties were studied by diffuse reflectance UV-Vis spectroscopy and PL using a 325 nm He-Cd laser. The red shift of the SPR absorption and the blue shift of the PL emission have been correlated with the surface morphology. The blue PL emission bands at around 3.0 eV are in good agreement with the literature with respect to the morphological changes and the blue shift is attributed to compressive strain on the embedded Au NPs. Enhancement of the SERS signals is observed and found to be correlated with the SPR response of the Au nanostructures. The SERS analyses indicate that MO molecules may be adsorbed with different orientations on these surfaces i.e. Au NPs located on the surface or embedded in the modified PET. These polymeric substrates modified by NPs can have a potential application in solid-state light emitting devices and can be applied in SERS based sensors for the

  6. Enhanced seamount location database for the western and central Pacific Ocean: Screening and cross-checking of 20 existing datasets

    NASA Astrophysics Data System (ADS)

    Allain, Valérie; Kerandel, Julie-Anne; Andréfouët, Serge; Magron, Franck; Clark, Malcolm; Kirby, David S.; Muller-Karger, Frank E.


    Seamounts are habitats of considerable interest in terms of conservation and biodiversity, and in terms of fisheries for bentho-pelagic and pelagic species. Twenty previously compiled datasets including seamount/underwater feature lists, bathymetric maps and emerged feature maps from different sources (ship-derived and satellite altimetry-derived) at different spatial scales (from individual cruise to worldwide satellite data) were gathered in order to compile an enhanced list of underwater features for parts of the western and central Pacific Ocean (WCPO). The KL04 dataset [Kitchingman, A., and Lai, S., 2004. Inferences on potential seamount locations from mid-resolution bathymetric data. Fisheries Centre Research Reports 12 (5), 7-12], listing seamount positions and depths as calculated from satellite altimetry-derived bathymetry, provided the baseline data for this study as it covered the entire region of interest and included summit depth information. All KL04 potential seamounts were cross-checked with other datasets to remove any atolls and islands that had been incorrectly classified as seamounts, to add seamounts undetected by KL04, to update the overall database (geolocation, depth, elevation, and name) and to compile a 12-class typology of the different types of underwater features. Of the 4626 potential seamounts identified in KL04, 719 were multiple identifications of the same large underwater features and 373 (10%) were actually emerged banks, atolls and islands, leaving 3534 actual underwater features. Conversely, 487 underwater features were documented in other datasets but not registered by KL04. The screening of all the potential WCPO seamounts produced a final list of 4021 underwater features with agreed upon position and information. This enhanced list should have many applications in oceanography, biodiversity conservation and studies of the influence of seamounts on pelagic ecosystems and fisheries.

  7. Soil-water coupling finite element analysis on seismic enhancement effect of group-pile foundation with ground improvement

    NASA Astrophysics Data System (ADS)

    Zhang, F.; Jin, Y.; Bao, X.; Kondo, Y.; Nakamura, K.


    In this paper, soil-water coupling finite element analyses on a real-scale field test of 9-pile foundation subjected to horizontal cyclic loading is conducted at first using a program named as DBLEAVES (Ye, 2007). In the analysis, nonlinear behaviors of ground and piles are described by cyclic mobility model (Zhang et al, 2007) and axial force dependent model (AFD model) proposed by Zhang and Kimura (2002) which can take into consideration of axial-force dependency in the nonlinear moment-curvature relations. After the applicability of the proposed numerical method is verified by comparing the numerical results with the field test results, numerical experiments on seismic enhancement effect of group-pile foundation with ground improvement are conducted both in static loading and dynamic loading. In finding out the optimum pattern of ground improvement around existing pile foundation, three influential factors are considered in the numerical experiments, that is, the size, the location and the shape of ground-improvement zone around the pile group.

  8. Principal Locations of Major-Ion, Trace-Element, Nitrate, and Escherichia coli Loading to Emigration Creek, Salt Lake County, Utah, October 2005

    USGS Publications Warehouse

    Kimball, Briant A.; Runkel, Robert L.; Walton-Day, Katherine


    Housing development and recreational activity in Emigration Canyon have increased substantially since 1980, perhaps causing an observed decrease in water quality of this northern Utah stream located near Salt Lake City. To identify reaches of the stream that contribute to water-quality degradation, a tracer-injection and synoptic-sampling study was done to quantify mass loading of major ions, trace elements, nitrate, and Escherichia coli (E. coli) to the stream. The resulting mass-loading profiles for major ions and trace elements indicate both geologic and anthropogenic inputs to the stream, principally from tributary and spring inflows to the stream at Brigham Fork, Burr Fork, Wagner Spring, Emigration Tunnel Spring, Blacksmith Hollow, and Killyon Canyon. The pattern of nitrate loading does not correspond to the major-ion and trace-element loading patterns. Nitrate levels in the stream did not exceed water-quality standards at the time of synoptic sampling. The majority of nitrate mass loading can be considered related to anthropogenic input, based on the field settings and trends in stable isotope ratios of nitrogen. The pattern of E. coli loading does not correspond to the major-ion, trace-element, or nitrate loading patterns. The majority of E. coli loading was related to anthropogenic sources based on field setting, but a considerable part of the loading also comes from possible animal sources in Killyon Canyon, in Perkins Flat, and in Rotary Park. In this late summer sampling, E. coli concentrations only exceeded water-quality standards in limited sections of the study reach. The mass-loading approach used in this study provides a means to design future studies and to evaluate the loading on a catchment scale.

  9. Sequences Just Upstream of the Simian Immunodeficiency Virus Core Enhancer Allow Efficient Replication in the Absence of NF-κB and Sp1 Binding Elements

    PubMed Central

    Pöhlmann, Stefan; Flöss, Stefan; Ilyinskii, Petr O.; Stamminger, Thomas; Kirchhoff, Frank


    Large deletions of the upstream U3 sequences in the long terminal repeats (LTRs) of human immunodeficiency virus and simian immunodeficiency virus (SIV) accumulate in vivo in the absence of an intact nef gene. In the SIV U3 region, about 65 bp just upstream of the single NF-κB binding site always remained intact, and some evidence for a novel enhancer element in this region exists. We analyzed the transcriptional and replicative capacities of SIVmac239 mutants containing deletions or mutations in these upstream U3 sequences and/or the NF-κB and Sp1 binding sites. Even in the absence of 400 bp of upstream U3 sequences, the NF-κB site and all four Sp1 binding sites, the SIV promoter maintained about 15% of the wild-type LTR activity and was fully responsive to Tat activation in transient reporter assays. The effects of these deletions on virus production after transfection of COS-1 cells with full-length proviral constructs were much greater. Deletion of the upstream U3 sequences had no significant influence on viral replication when either the single NF-κB site or the Sp1 binding sites were intact. In contrast, the 26 bp of sequence located immediately upstream of the NF-κB site was essential for efficient replication when all core enhancer elements were deleted. A purine-rich site in this region binds specifically to the transcription factor Elf-1, a member of the ets proto-oncogene-encoded family. Our results indicate a high degree of functional redundancy in the SIVmac U3 region. Furthermore, we defined a novel regulatory element located immediately upstream of the NF-κB binding site that allows efficient viral replication in the absence of the entire core enhancer region. PMID:9621017

  10. Recognition of enhancer element-specific histone methylation by TIP60 in transcriptional activation.


    Jeong, Kwang Won; Kim, Kyunghwan; Situ, Alan Jialun; Ulmer, Tobias S; An, Woojin; Stallcup, Michael R


    Many co-regulator proteins are recruited by DNA-bound transcription factors to remodel chromatin and activate transcription. However, mechanisms for coordinating actions of multiple co-regulator proteins are poorly understood. We demonstrate that multiple protein-protein interactions by the protein acetyltransferase TIP60 are required for estrogen-induced transcription of a subset of estrogen receptor alpha (ERα) target genes in human cells. Estrogen-induced recruitment of TIP60 requires direct binding of TIP60 to ERα and the action of chromatin-remodeling ATPase BRG1, leading to increased recruitment of histone methyltransferase MLL1 and increased monomethylation of histone H3 at Lys4. TIP60 recruitment also requires preferential binding of the TIP60 chromodomain to histone H3 containing monomethylated Lys4, which marks active and poised enhancer elements. After recruitment, TIP60 increases acetylation of histone H2A at Lys5. Thus, complex cooperation of TIP60 with ERα and other chromatin-remodeling enzymes is required for estrogen-induced transcription. PMID:22081016

  11. Search for enhancers: teleost models in comparative genomic and transgenic analysis of cis regulatory elements.


    Müller, Ferenc; Blader, Patrick; Strähle, Uwe


    Homology searches between DNA sequences of evolutionary distant species (phylogenetic footprinting) offer a fast detection method for regulatory sequences. Because of the small size of their genomes, tetraodontid species such as the Japanese pufferfish and green spotted pufferfish have become attractive models for comparative genomics. A disadvantage of the tetraodontid species is, however, that they cannot be bred and manipulated routinely under laboratory conditions, so these species are less attractive for developmental and genetic analysis. In contrast, an increasing arsenal of transgene techniques with the developmental model species zebrafish and medaka are being used for functional analysis of cis regulatory sequences. The main disadvantage is the much larger genome. While comparison between many loci proved the suitability of phylogenetic footprinting using fish and mammalian sequences, fast rate of change in enhancer structure and gene duplication within teleosts may obscure detection of homologies. Here we discuss the contribution and potentials provided by different teleost models for the detection and functional analysis of conserved cis-regulatory elements. PMID:12111739

  12. The enhanced locating performance of an integrated cross-correlation and genetic algorithm for radio monitoring systems.


    Chang, Yao-Tang; Wu, Chi-Lin; Cheng, Hsu-Chih


    The rapid development of wireless broadband communication technology has affected the location accuracy of worldwide radio monitoring stations that employ time-difference-of-arrival (TDOA) location technology. In this study, TDOA-based location technology was implemented in Taiwan for the first time according to International Telecommunications Union Radiocommunication (ITU-R) recommendations regarding monitoring and location applications. To improve location accuracy, various scenarios, such as a three-dimensional environment (considering an unequal locating antenna configuration), were investigated. Subsequently, the proposed integrated cross-correlation and genetic algorithm was evaluated in the metropolitan area of Tainan. The results indicated that the location accuracy at a circular error probability of 50% was less than 60 m when a multipath effect was present in the area. Moreover, compared with hyperbolic algorithms that have been applied in conventional TDOA-based location systems, the proposed algorithm yielded 17-fold and 19-fold improvements in the mean difference when the location position of the interference station was favorable and unfavorable, respectively. Hence, the various forms of radio interference, such as low transmission power, burst and weak signals, and metropolitan interference, was proved to be easily identified, located, and removed. PMID:24763254

  13. The Enhanced Locating Performance of an Integrated Cross-Correlation and Genetic Algorithm for Radio Monitoring Systems

    PubMed Central

    Chang, Yao-Tang; Wu, Chi-Lin; Cheng, Hsu-Chih


    The rapid development of wireless broadband communication technology has affected the location accuracy of worldwide radio monitoring stations that employ time-difference-of-arrival (TDOA) location technology. In this study, TDOA-based location technology was implemented in Taiwan for the first time according to International Telecommunications Union Radiocommunication (ITU-R) recommendations regarding monitoring and location applications. To improve location accuracy, various scenarios, such as a three-dimensional environment (considering an unequal locating antenna configuration), were investigated. Subsequently, the proposed integrated cross-correlation and genetic algorithm was evaluated in the metropolitan area of Tainan. The results indicated that the location accuracy at a circular error probability of 50% was less than 60 m when a multipath effect was present in the area. Moreover, compared with hyperbolic algorithms that have been applied in conventional TDOA-based location systems, the proposed algorithm yielded 17-fold and 19-fold improvements in the mean difference when the location position of the interference station was favorable and unfavorable, respectively. Hence, the various forms of radio interference, such as low transmission power, burst and weak signals, and metropolitan interference, was proved to be easily identified, located, and removed. PMID:24763254

  14. The first intron of the 4F2 heavy-chain gene contains a transcriptional enhancer element that binds multiple nuclear proteins

    SciTech Connect

    Karpinski, B.A.; Yang, L.H.; Cacheris, P.; Morle, G.D.; Leiden, J.M.


    The authors utilized the human 4F2 heavy-chain (4F2HC) gene as a model system to study the regulation of inducible gene expression during normal human T-cell activation. Previous studies have demonstrated that 4F2HC gene expression is induced during normal T-cell activation and that the activity of the gene is regulated, at least in part, by the interaction of a constitutively active 5'-flanking housekeeping promoter and a phorbol ester-responsive transcriptional attenuator element located in the exon 1-intron 1 region of the gene. They now report that 4F2HC intron 1 contains a transcriptional enhancer element which is active on a number of heterologous promoters in a variety of murine and human cells. This enhancer element has been mapped to a 187-base-pair RsaI-AluI fragment from 4F2HC intron 1. DNase I footprinting and gel mobility shift analyses demonstrated that this fragment contains two nuclear protein-binding sites (NF-4FA and NF-4FB) which flank a consensus binding site for the inducible AP-1 transcription factor. Deletion analysis showed that the NF-4FA, NF-4FB, and AP-1 sequences are each necessary for full enhancer activity. Murine 4F2HC intron 1 displayed enhancer activity similar to that of its human counterpart. Comparison of the sequences of human and murine 4F2HC intron 1s demonstrated that the NF-4FA, NF-4FB, and AP-1 sequence motifs have been highly conserved during mammalian evolution.

  15. Coordinately Co-opted Multiple Transposable Elements Constitute an Enhancer for wnt5a Expression in the Mammalian Secondary Palate

    PubMed Central

    Kimura-Yoshida, Chiharu; Yan, Kuo; Bormuth, Olga; Ding, Qiong; Nakanishi, Akiko; Sasaki, Takeshi; Hirakawa, Mika; Sumiyama, Kenta; Furuta, Yasuhide; Tarabykin, Victor; Matsuo, Isao; Okada, Norihiro


    Acquisition of cis-regulatory elements is a major driving force of evolution, and there are several examples of developmental enhancers derived from transposable elements (TEs). However, it remains unclear whether one enhancer element could have been produced via cooperation among multiple, yet distinct, TEs during evolution. Here we show that an evolutionarily conserved genomic region named AS3_9 comprises three TEs (AmnSINE1, X6b_DNA and MER117), inserted side-by-side, and functions as a distal enhancer for wnt5a expression during morphogenesis of the mammalian secondary palate. Functional analysis of each TE revealed step-by-step retroposition/transposition and co-option together with acquisition of a binding site for Msx1 for its full enhancer function during mammalian evolution. The present study provides a new perspective suggesting that a huge variety of TEs, in combination, could have accelerated the diversity of cis-regulatory elements involved in morphological evolution. PMID:27741242

  16. Finite Element Method Simulations of the Near-Field Enhancement at the Vicinity of Fractal Rough Metallic Surfaces

    SciTech Connect

    Micic, Miodrag; Klymyshyn, Nicholas A.; Lu, H PETER.


    Near-field optical enhancement at metal surfaces and methods such as surface plasmon resonance (SPR), surface-enhanced Raman scattering (SERS), fluorescent quenching and enhancement, and various near-field scanning microscopies (NSOM) all depend on a metals surface properties, mainly on its morphology and SPR resonant frequency. We report on simulations of the influence of different surface morphologies on electromagnetic field enhancements at the rough surfaces of noble metals and also evaluate the optimal conditions for the generation of a surface-enhanced Raman signal of absorbed species on a metallic substrate. All simulations were performed with a classical electrodynamics approach using the full set of Maxwells equations, which were solved with the three-dimensional finite element method (FEM). Two different classes of surfaces where modeled using fractals, representing diffusion limited aggregation growth dendritic structures, such as one on the surface of electrodes, and second one representing the sponge-like structure used to model surfaces of particles with high porosity, such as metal coated catalyst supports. The simulations depict the high inhomogeneity of an enhanced electromagnetic field as both a field enhancement and field attenuation near the surface. While the diffusion limited aggregation dendritical fractals enhanced the near-field electromagnetic field, the sponge fractals significantly reduced the local electromagnetic field intensity. Moreover, the fractal orders of the fractal objects did not significantly alter the total enhancement, and the distribution of a near-field enhancement was essentially invariant to the changes in the angle of an incoming laser beam.

  17. Disease-Associated SNPs From non-Coding Regions in Juvenile Idiopathic Arthritis Are Located Within or Adjacent to Functional Genomic Elements of Human Neutrophils and CD4+ T Cells

    PubMed Central

    Jiang, Kaiyu; Zhu, Lisha; Buck, Michael J.; Chen, Yanmin; Carrier, Bradley; Liu, Tao; Jarvis, James N.


    Background Juvenile idiopathic arthritis (JIA) is considered a complex trait in which the environment interacts with inherited genes to produce a phenotype that shows broad inter-individual variance. A recently completed genome-wide association study (GWAS) identified 24 regions of genetic risk for JIA, for example. However, as is typical for GWAS, most of the regions of genetic risk for JIA (22 of 24) were in non-coding regions of the genome. The studies reported here were undertaken to identify functional elements (other than genes) that might be located within the regions of genetic risk. Methods We used paired end RNA sequencing to identify non-coding RNAs located within 5 kb of the disease-associated SNPs. In addition, we used chromatin immunoprecipitation-sequencing (ChIP-Seq) to identify epigenetic marks associated with enhancer function (H3K4me1 and H3K27ac) in human neutrophils to determine whether there was enrichment of enhancer-associated histone marks in linkage disequilibrium (LD) blocks that encompassed the 22 GWAS SNPs from the non-coding genome. Results In human neutrophils, we identified H3K4me1 and/or H3K27ac marks in 15 of the 22 regions previously as identified as risk loci for JIA. In CD4+ T cells, 18 regions demonstrate H3K4me1 and/or H3K27ac marks. In addition, we identified non-coding RNA transcripts at the rs4705862 and rs6894249 loci in human neutrophils. Conclusion Much of the genetic risk for JIA lies within or adjacent to regions of neutrophil and CD4+ T cell genomes that carry epigenetic marks associated with enhancer function and/or ncRNA transcripts. These findings are consistent with the hypothesis that JIA is fundamentally a disorder of gene regulation that includes both the innate and adaptive immune system. Elucidating the specific roles of these non-coding elements within leukocyte genomes in JIA pathogenesis will be critical to our understanding disease pathogenesis. PMID:25833190

  18. Lactase persistence DNA variant enhances lactase promoter activity in vitro: functional role as a cis regulatory element.


    Olds, Lynne C; Sibley, Eric


    Lactase persistence is a heritable, autosomal dominant, condition that results in a sustained ability to digest the milk sugar lactose throughout adulthood. The majority of the world's human population experiences a decline in production of the digestive enzyme lactase-phlorizin hydrolase during maturation. However, individuals with lactase persistence continue to express high levels of the lactase gene into adulthood. Lactase persistence has been strongly correlated with single nucleotide genetic variants, C/T_(13910) and G/A_(22018), located 13.9 and 22 kb upstream from the lactase structural gene. We aimed to characterize a functional role for the polymorphisms in regulating lactase gene transcription. DNA in the region of the C/T_(13910) or G/A_(22018) human lactase variants was cloned upstream of the 3.0 kb rat lactase gene promoter in a luciferase reporter construct. Human intestinal Caco-2 cells were transfected with the lactase variant/promoter-reporter constructs and assayed for promoter activity. A 200 bp region surrounding the C_(13910) variant, associated with lactase non-persistence, results in a 2.2-fold increase in lactase promoter activity. The T_(13910) variant, associated with lactase persistence, results in an even greater 2.8-fold increase. The DNA sequence of the C/T_(13910) variants differentially interacts with intestinal cell nuclear proteins on EMSAs. AP2 co-transfection results in a similar repression of the C/T_(13910) variant/promoter-reporter constructs. The DNA region of the C/T_(13910) lactase persistence/non-persistence variant functions in vitro as a cis element capable of enhancing differential transcriptional activation of the lactase promoter. Such differential regulation by the C and T variants is consistent with a causative role in the mechanism specifying the lactase persistence/non-persistence phenotypes in humans.

  19. Teacher Self-Efficacy Enhancement and School Location: Implication for Students' Achievement in Economics in Senior Secondary School in Ibadan, Oyo State, Nigeria

    ERIC Educational Resources Information Center

    Durowoju, Esther O.; Onuka, Adams O. U.


    The paper investigated the effect of teacher self-efficacy enhancement and school location on students' achievement in Economics in Senior Secondary School in Ibadan Metropolis of Oyo State, Nigeria. Three hypotheses were tested at 0.05 level of significance. Multi-stage sampling technique was adopted in the study. Four Local Government Areas (two…

  20. Glucose Enhances Basal or Melanocortin-Induced cAMP-Response Element Activity in Hypothalamic Cells.


    Breit, Andreas; Wicht, Kristina; Boekhoff, Ingrid; Glas, Evi; Lauffer, Lisa; Mückter, Harald; Gudermann, Thomas


    Melanocyte-stimulating hormone (MSH)-induced activation of the cAMP-response element (CRE) via the CRE-binding protein in hypothalamic cells promotes expression of TRH and thereby restricts food intake and increases energy expenditure. Glucose also induces central anorexigenic effects by acting on hypothalamic neurons, but the underlying mechanisms are not completely understood. It has been proposed that glucose activates the CRE-binding protein-regulated transcriptional coactivator 2 (CRTC-2) in hypothalamic neurons by inhibition of AMP-activated protein kinases (AMPKs), but whether glucose directly affects hypothalamic CRE activity has not yet been shown. Hence, we dissected effects of glucose on basal and MSH-induced CRE activation in terms of kinetics, affinity, and desensitization in murine, hypothalamic mHypoA-2/10-CRE cells that stably express a CRE-dependent reporter gene construct. Physiologically relevant increases in extracellular glucose enhanced basal or MSH-induced CRE-dependent gene transcription, whereas prolonged elevated glucose concentrations reduced the sensitivity of mHypoA-2/10-CRE cells towards glucose. Glucose also induced CRCT-2 translocation into the nucleus and the AMPK activator metformin decreased basal and glucose-induced CRE activity, suggesting a role for AMPK/CRTC-2 in glucose-induced CRE activation. Accordingly, small interfering RNA-induced down-regulation of CRTC-2 expression decreased glucose-induced CRE-dependent reporter activation. Of note, glucose also induced expression of TRH, suggesting that glucose might affect the hypothalamic-pituitary-thyroid axis via the regulation of hypothalamic CRE activity. These findings significantly advance our knowledge about the impact of glucose on hypothalamic signaling and suggest that TRH release might account for the central anorexigenic effects of glucose and could represent a new molecular link between hyperglycaemia and thyroid dysfunction. PMID:27144291

  1. Glucose Enhances Basal or Melanocortin-Induced cAMP-Response Element Activity in Hypothalamic Cells.


    Breit, Andreas; Wicht, Kristina; Boekhoff, Ingrid; Glas, Evi; Lauffer, Lisa; Mückter, Harald; Gudermann, Thomas


    Melanocyte-stimulating hormone (MSH)-induced activation of the cAMP-response element (CRE) via the CRE-binding protein in hypothalamic cells promotes expression of TRH and thereby restricts food intake and increases energy expenditure. Glucose also induces central anorexigenic effects by acting on hypothalamic neurons, but the underlying mechanisms are not completely understood. It has been proposed that glucose activates the CRE-binding protein-regulated transcriptional coactivator 2 (CRTC-2) in hypothalamic neurons by inhibition of AMP-activated protein kinases (AMPKs), but whether glucose directly affects hypothalamic CRE activity has not yet been shown. Hence, we dissected effects of glucose on basal and MSH-induced CRE activation in terms of kinetics, affinity, and desensitization in murine, hypothalamic mHypoA-2/10-CRE cells that stably express a CRE-dependent reporter gene construct. Physiologically relevant increases in extracellular glucose enhanced basal or MSH-induced CRE-dependent gene transcription, whereas prolonged elevated glucose concentrations reduced the sensitivity of mHypoA-2/10-CRE cells towards glucose. Glucose also induced CRCT-2 translocation into the nucleus and the AMPK activator metformin decreased basal and glucose-induced CRE activity, suggesting a role for AMPK/CRTC-2 in glucose-induced CRE activation. Accordingly, small interfering RNA-induced down-regulation of CRTC-2 expression decreased glucose-induced CRE-dependent reporter activation. Of note, glucose also induced expression of TRH, suggesting that glucose might affect the hypothalamic-pituitary-thyroid axis via the regulation of hypothalamic CRE activity. These findings significantly advance our knowledge about the impact of glucose on hypothalamic signaling and suggest that TRH release might account for the central anorexigenic effects of glucose and could represent a new molecular link between hyperglycaemia and thyroid dysfunction.

  2. Blue eye color in humans may be caused by a perfectly associated founder mutation in a regulatory element located within the HERC2 gene inhibiting OCA2 expression.


    Eiberg, Hans; Troelsen, Jesper; Nielsen, Mette; Mikkelsen, Annemette; Mengel-From, Jonas; Kjaer, Klaus W; Hansen, Lars


    The human eye color is a quantitative trait displaying multifactorial inheritance. Several studies have shown that the OCA2 locus is the major contributor to the human eye color variation. By linkage analysis of a large Danish family, we finemapped the blue eye color locus to a 166 Kbp region within the HERC2 gene. By association analyses, we identified two SNPs within this region that were perfectly associated with the blue and brown eye colors: rs12913832 and rs1129038. Of these, rs12913832 is located 21.152 bp upstream from the OCA2 promoter in a highly conserved sequence in intron 86 of HERC2. The brown eye color allele of rs12913832 is highly conserved throughout a number of species. As shown by a Luciferase assays in cell cultures, the element significantly reduces the activity of the OCA2 promoter and electrophoretic mobility shift assays demonstrate that the two alleles bind different subsets of nuclear extracts. One single haplotype, represented by six polymorphic SNPs covering half of the 3' end of the HERC2 gene, was found in 155 blue-eyed individuals from Denmark, and in 5 and 2 blue-eyed individuals from Turkey and Jordan, respectively. Hence, our data suggest a common founder mutation in an OCA2 inhibiting regulatory element as the cause of blue eye color in humans. In addition, an LOD score of Z = 4.21 between hair color and D14S72 was obtained in the large family, indicating that RABGGTA is a candidate gene for hair color.

  3. The influence of contact ratio and its location on the primary stability of cementless total hip arthroplasty: A finite element analysis.


    Reimeringer, M; Nuño, N


    Cementless hip stems are fixed to the surrounding bone by means of press-fit. To ensure a good press-fit, current surgical technique specifies an under-reaming of the bone cavity using successively larger broaches. Nevertheless, this surgical technique is inaccurate. Several studies show that the contact ratio (percentage of stem interface in contact with bone) achieved after surgery can vary between 20% and 95%. Therefore, this study aimed to investigate the influence of the contact ratio and its location on the primary stability of a cementless total hip arthroplasty using finite element analysis. A straight tapered femoral stem implanted in a composite bone was subjected to stair climbing. Micromotion of 7600 nodes at the stem-bone interface was computed for different configurations of contact ratios between 2% and 98%) along the hip stem. Considering the 15 configurations evaluated, the average micromotion ranges between 27μm and 54μm. The percentage of the porous interface of the stem having micromotion below 40μm that allows bone ingrowth range between 25-57%. The present numerical study shows that full contact (100%) between stem and bone is not necessary to obtain a good primary stability. The stem primary stability is influenced by both the contact ratio and its location. Several configurations with contact ratio lower than 100% and involving either the proximal or the cortical contact provide better primary stability than the full contact configuration. However, with contact ratio lower than 40%, the stem should be in contact with cortical bone to ensure a good primary stability. PMID:26920509

  4. A Novel Four-Node Quadrilateral Smoothing Element for Stress Enhancement and Error Estimation

    NASA Technical Reports Server (NTRS)

    Tessler, A.; Riggs, H. R.; Dambach, M.


    A four-node, quadrilateral smoothing element is developed based upon a penalized-discrete-least-squares variational formulation. The smoothing methodology recovers C1-continuous stresses, thus enabling effective a posteriori error estimation and automatic adaptive mesh refinement. The element formulation is originated with a five-node macro-element configuration consisting of four triangular anisoparametric smoothing elements in a cross-diagonal pattern. This element pattern enables a convenient closed-form solution for the degrees of freedom of the interior node, resulting from enforcing explicitly a set of natural edge-wise penalty constraints. The degree-of-freedom reduction scheme leads to a very efficient formulation of a four-node quadrilateral smoothing element without any compromise in robustness and accuracy of the smoothing analysis. The application examples include stress recovery and error estimation in adaptive mesh refinement solutions for an elasticity problem and an aerospace structural component.

  5. An enhancer with cell-type dependent activity is located between the myeloid and epithelial aminopeptidase N (CD 13) promoters.

    PubMed Central

    Olsen, J; Kokholm, K; Troelsen, J T; Laustsen, L


    The 5' flanking region of the gene encoding the small intestinal brush-border peptidase aminopeptidase N (APN) was screened for the presence of enhancer regions. A 300 bp region with enhancer activity was identified 2.7 kb upstream of the transcriptional start site which is used in epithelial cells. The enhancer stimulated transcription from a heterologous promoter (the simian virus 40 early promoter) in a position- and orientation-independent manner. The activity of the enhancer is cell-type dependent and it is active in liver (HepG2), intestinal (Caco-2) and myeloid (K562) cells. As the epithelial APN promoter is active in the first two cell-types and the myeloid APN promoter in the last, the results may suggest that the enhancer, through a cooperation with either of the promoters, is important for the tissue-specific expression of APN. A detailed analysis of the enhancer led to the identification of four functionally important regions that are protected against DNase I digestion by Caco-2 nuclear extract. Sequence analysis suggests that two of the regions may interact with members of the Ets transcription factor family (Ets is a transformation-specific protein first discovered in the E26 avian erythroblastosis virus), one region with a CCAAT enhancer-binding protein and one region with Sp1, a transcriptional activator first described as a factor binding to the simian virus 40 early promoter. PMID:9148767

  6. A gene-type-specific enhancer regulates the carbamyl phosphate synthetase I promoter by cooperating with the proximal GAG activating element.

    PubMed Central

    Goping, I S; Lamontagne, S; Shore, G C; Nguyen, M


    The rat carbamyl phosphate synthetase I gene is expressed in two cell types: hepatocytes and epithelial cells of the intestinal mucosa. The proximal promoter contains a single activating element, GAG, two repressor elements (sites I and III) and an anti-repressor element (site II). Although these elements together exhibit the potential for complex regulation, they are unable to confer tissue-specific promoter activity. Here we have identified a cell-type-specific enhancer that lies 10 kilobases upstream of the promoter. Unexpectedly, the enhancer also functioned in a gene-type-specific manner. The enhancer stimulated promoter activity exclusively through the proximal GAG element. Abrogation of GAG, either directly by mutation of GAG or indirectly by sites I and III repressors, abolished enhancer activation. Conversely, activation of the heterologous thymidine kinase promoter by the enhancer required the introduction of GAG. The requirement for GAG, therefore, functions to constrain the enhancer to a specific target promoter. PMID:7784176

  7. Multiple elements within the 5' distal enhancer of the mouse heme oxygenase-1 gene mediate induction by heavy metals.


    Alam, J


    A 268-base pair 5' distal fragment, SX2, which mediates basal level and inducer-dependent activation of the mouse heme oxygenase-1 gene, contains two activator protein-1 (AP-1) binding sites (Alam, J., and Zhining, D. (1992) J. Biol. Chem. 267, 21894-21900). Mutation of both AP-1 binding elements diminishes (by 50-70%), but does not abolish, the enhancer activity of SX2 in transient expression assays, suggesting that other sequences contribute to enhancer function. Directly upstream of the AP-1 binding sites are two copies of a sequence motif, TGAGGAAAT, which resemble elements found in cellular and viral genes that are known to interact with the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. These SX2 sequences bind specifically to liver-enriched, heat-stable nuclear proteins and confer C/EBP alpha-dependent transactivation of the heterologous chloramphenicol acetyltransferase (CAT) gene. Site-directed mutagenesis of these 9-base pair elements abolishes protein binding and transactivation, establishing these sequences as functional C/EBP binding sites. Stably transfected SX2/CAT fusion genes are induced between 37- and 44-fold in mouse hepatoma, Hepa, cells and between 52- and 111-fold in mouse fibroblast L929 cells in response to CdCl2 treatment. Subfragments of SX2 lacking the AP-1 binding elements do not mediate cadmium-dependent activation of the CAT gene, whereas subfragments containing the AP-1 binding elements, but lacking the C/EBP binding sites, exhibit only partial transcriptional activity. Site-directed mutagenesis of one or more of the C/EBP and AP-1 binding sites indicates that each of these elements is required for optimal activity of the SX2 enhancer fragment. The AP-1 binding elements, however, appear to be more important for induction as constructs containing multiple copies of either of the AP-1 binding elements, but not the C/EBP binding sequences, are readily activated by CdCl2. Treatment of Hepa cells with cadmium or

  8. A Mammalian Conserved Element Derived from SINE Displays Enhancer Properties Recapitulating Satb2 Expression in Early-Born Callosal Projection Neurons

    PubMed Central

    Nakanishi, Akiko; Sasaki, Takeshi; Yan, Kuo; Tarabykin, Victor; Vigier, Lisa; Sumiyama, Kenta; Hirakawa, Mika; Nishihara, Hidenori; Pierani, Alessandra; Okada, Norihiro


    Short interspersed repetitive elements (SINEs) are highly repeated sequences that account for a significant proportion of many eukaryotic genomes and are usually considered “junk DNA”. However, we previously discovered that many AmnSINE1 loci are evolutionarily conserved across mammalian genomes, suggesting that they may have acquired significant functions involved in controlling mammalian-specific traits. Notably, we identified the AS021 SINE locus, located 390 kbp upstream of Satb2. Using transgenic mice, we showed that this SINE displays specific enhancer activity in the developing cerebral cortex. The transcription factor Satb2 is expressed by cortical neurons extending axons through the corpus callosum and is a determinant of callosal versus subcortical projection. Mouse mutants reveal a crucial function for Sabt2 in corpus callosum formation. In this study, we compared the enhancer activity of the AS021 locus with Satb2 expression during telencephalic development in the mouse. First, we showed that the AS021 enhancer is specifically activated in early-born Satb2+ neurons. Second, we demonstrated that the activity of the AS021 enhancer recapitulates the expression of Satb2 at later embryonic and postnatal stages in deep-layer but not superficial-layer neurons, suggesting the possibility that the expression of Satb2 in these two subpopulations of cortical neurons is under genetically distinct transcriptional control. Third, we showed that the AS021 enhancer is activated in neurons projecting through the corpus callosum, as described for Satb2+ neurons. Notably, AS021 drives specific expression in axons crossing through the ventral (TAG1−/NPY+) portion of the corpus callosum, confirming that it is active in a subpopulation of callosal neurons. These data suggest that exaptation of the AS021 SINE locus might be involved in enhancement of Satb2 expression, leading to the establishment of interhemispheric communication via the corpus callosum, a eutherian

  9. Genetic variation in T-box binding element functionally affects SCN5A/SCN10A enhancer.


    van den Boogaard, Malou; Wong, L Y Elaine; Tessadori, Federico; Bakker, Martijn L; Dreizehnter, Lisa K; Wakker, Vincent; Bezzina, Connie R; 't Hoen, Peter A C; Bakkers, Jeroen; Barnett, Phil; Christoffels, Vincent M


    The contraction pattern of the heart relies on the activation and conduction of the electrical impulse. Perturbations of cardiac conduction have been associated with congenital and acquired arrhythmias as well as cardiac arrest. The pattern of conduction depends on the regulation of heterogeneous gene expression by key transcription factors and transcriptional enhancers. Here, we assessed the genome-wide occupation of conduction system-regulating transcription factors TBX3, NKX2-5, and GATA4 and of enhancer-associated coactivator p300 in the mouse heart, uncovering cardiac enhancers throughout the genome. Many of the enhancers colocalized with ion channel genes repressed by TBX3, including the clustered sodium channel genes Scn5a, essential for cardiac function, and Scn10a. We identified 2 enhancers in the Scn5a/Scn10a locus, which were regulated by TBX3 and its family member and activator, TBX5, and are functionally conserved in humans. We also provided evidence that a SNP in the SCN10A enhancer associated with alterations in cardiac conduction patterns in humans disrupts TBX3/TBX5 binding and reduces the cardiac activity of the enhancer in vivo. Thus, the identification of key regulatory elements for cardiac conduction helps to explain how genetic variants in noncoding regulatory DNA sequences influence the regulation of cardiac conduction and the predisposition for cardiac arrhythmias. PMID:22706305

  10. The upstream muscle-specific enhancer of the rat muscle creatine kinase gene is composed of multiple elements.

    PubMed Central

    Horlick, R A; Benfield, P A


    A series of constructs that links the rat muscle creatine kinase promoter to the bacterial chloramphenicol acetyltransferase gene was generated. These constructs were introduced into differentiating mouse C2C12 myogenic cells to localize sequences that are important for up-regulation of the creatine kinase gene during myogenic differentiation. A muscle-specific enhancer element responsible for induction of chloramphenicol acetyltransferase expression during myogenesis was localized to a 159-base-pair region from 1,031 to 1,190 base pairs upstream of the transcription start site. Analysis of transient expression experiments using promoters mutated by deletion indicated the presence of multiple functional domains within this muscle-specific regulatory element. A DNA fragment spanning this region was used in DNase I protection experiments. Nuclear extracts derived from C2 myotubes protected three regions (designated E1, E2, and E3) on this fragment from digestion, which indicated there may be three or more trans-acting factors that interact with the creatine kinase muscle enhancer. Gel retardation assays revealed that factors able to bind specifically to E1, E2, and E3 are present in a wide variety of tissues and cell types. Transient expression assays demonstrated that elements in regions E1 and E3, but not necessarily E2, are required for full enhancer activity. Images PMID:2761536

  11. Pauses enhance chunk recognition in song element strings by zebra finches.


    Spierings, Michelle; de Weger, Anouk; Ten Cate, Carel


    When learning a language, it is crucial to know which syllables of a continuous sound string belong together as words. Human infants achieve this by attending to pauses between words or to the co-occurrence of syllables. It is not only humans that can segment a continuous string. Songbirds learning their song tend to copy 'chunks' from one or more tutors' songs and combine these into their own song. In the tutor songs, these chunks are often separated by pauses and a high co-occurrence of elements, suggesting that these features affect chunking and song learning. We examined experimentally whether the presence of pauses and element co-occurrence affect the ability of adult zebra finches to discriminate strings of song elements. Using a go/no-go design, two groups of birds were trained to discriminate between two strings. In one group (Pause-group), pauses were inserted between co-occurring element triplets in the strings, and in the other group (No-pause group), both strings were continuous. After making a correct discrimination, an individual proceeded to a reversal training using string segments. Segments were element triplets consistent in co-occurrence, triplets that were partly consistent in composition and triplets consisting of elements that did not co-occur in the strings. The Pause-group was faster in discriminating between the two strings. This group also responded differently to consistent triplets in the reversal training, compared to inconsistent triplets. The No-pause group did not differentiate among the triplet types. These results indicate that pauses in strings of song elements aid song discrimination and memorization of co-occurring element groups. PMID:25771964

  12. A proposed method for enhanced eigen-pair extraction using finite element methods: Theory and application

    NASA Technical Reports Server (NTRS)

    Jara-Almonte, J.; Mitchell, L. D.


    The paper covers two distinct parts: theory and application. The goal of this work was the reduction of model size with an increase in eigenvalue/vector accuracy. This method is ideal for the condensation of large truss- or beam-type structures. The theoretical approach involves the conversion of a continuum transfer matrix beam element into an 'Exact' dynamic stiffness element. This formulation is implemented in a finite element environment. This results in the need to solve a transcendental eigenvalue problem. Once the eigenvalue is determined the eigenvectors can be reconstructed with any desired spatial precision. No discretization limitations are imposed on the reconstruction. The results of such a combined finite element and transfer matrix formulation is a much smaller FEM eigenvalue problem. This formulation has the ability to extract higher eigenvalues as easily and as accurately as lower eigenvalues. Moreover, one can extract many more eigenvalues/vectors from the model than the number of degrees of freedom in the FEM formulation. Typically, the number of eigenvalues accurately extractable via the 'Exact' element method are at least 8 times the number of degrees of freedom. In contrast, the FEM usually extracts one accurate (within 5 percent) eigenvalue for each 3-4 degrees of freedom. The 'Exact' element results in a 20-30 improvement in the number of accurately extractable eigenvalues and eigenvectors.

  13. Accumulation of antimony and other potentially toxic elements in plants around a former antimony mine located in the Ribes Valley (Eastern Pyrenees)

    NASA Astrophysics Data System (ADS)

    Bech, Jaume; Corrales, Isabel; Duran, Paola; Roca, Núria; Tume, Pedro; Barceló, Juan; Poschenrieder, Charlotte


    Soil contamination by antimony is of increasing environmental concern due to the use of this amphoterous p-block element in many industrial applications such as flame retardant, electronics, alloys, rubber and textile industries. However, little is still known about the response of plants to antimony. Here we report on the accumulation of antimony and other potentially toxic elements (mainly As, Pb and Cu) in plants growing around a former antimony mine in the ribes Valley located in the Eastern Pyrenees (424078E, 4686100N alt. 1145 m.a.s.l) that was operating approximately between the years 1870 to 1960. The ore mineral veins are included in quartz gangue. The main ores were: Sulphides: Stibnite (Sb2S3), Pyrite (FeS2), Sphalerite (ZnS), Arsenopyrite (FeAs), Galenite (PbS), Chalcopyrite (CuFeS2), Tetrahydrite (Cu5Sb2S3). Sulphosals: Boulangerite (5PbS•2Sb2S3), Jamesonite (4PbS•FeS•3Sb2S3), Zinckenite (6PbS•7Sb2S3), Plagionite (5PbS•4Sb2S3), Bournonite PbCu (Sb,As)S3, Pyrargirite (Ag3SbS3). Soil and plant samples were taken at five locations with different levels of Sb, As, and polymetallic contamination. Both pseudototal (aqua regia soluble) and extractable (EDTA) concentrations of metals from sites with low (sites 1 and 2), moderate (site 3 and 4) and high (sites 5 and 6) pollutant burdens were studied. The range of agua regia and EDTA values in mgkg-1 is as follows: Sb 8-2904 and 0.88-44; As: 33-16186 and 3.2-167; Pb: 79-4794 and 49-397; Cu: 66-712 and 48-56 mg•kg-1, respectively). While sites 1 to 4 had alkaline soil pH (7.4-8.7), sites 5 and 6 were acidic with values of 6 and 4.6, respectively. Different herbaceous plant species (Poa annua, Echium vulgare, Sonchus asper, Barbera verna among others) at the low and moderately polluted sites were able to efficiently restrict Sb and As transport to shoots showing average concentration ranges between 5.5 and 23 mg/kg As and 1.21 mg/kg and 4.9 mg/kg Sb. However, at the highly polluted acidic sites (5 and

  14. Post-Training Intrahippocampal Inhibition of Class I Histone Deacetylases Enhances Long-Term Object-Location Memory

    ERIC Educational Resources Information Center

    Hawk, Joshua D.; Florian, Cedrick; Abel, Ted


    Long-term memory formation involves covalent modification of the histone proteins that package DNA. Reducing histone acetylation by mutating histone acetyltransferases impairs long-term memory, and enhancing histone acetylation by inhibiting histone deacetylases (HDACs) improves long-term memory. Previous studies using HDAC inhibitors to enhance…

  15. Evaluation of aircraft microwave data for locating zones for well stimulation and enhanced gas recovery. [Arkansas Arkoma Basin

    NASA Technical Reports Server (NTRS)

    Macdonald, H.; Waite, W.; Elachi, C.; Babcock, R.; Konig, R.; Gattis, J.; Borengasser, M.; Tolman, D.


    Imaging radar was evaluated as an adjunct to conventional petroleum exploration techniques, especially linear mapping. Linear features were mapped from several remote sensor data sources including stereo photography, enhanced LANDSAT imagery, SLAR radar imagery, enhanced SAR radar imagery, and SAR radar/LANDSAT combinations. Linear feature maps were compared with surface joint data, subsurface and geophysical data, and gas production in the Arkansas part of the Arkoma basin. The best LANDSAT enhanced product for linear detection was found to be a winter scene, band 7, uniform distribution stretch. Of the individual SAR data products, the VH (cross polarized) SAR radar mosaic provides for detection of most linears; however, none of the SAR enhancements is significantly better than the others. Radar/LANDSAT merges may provide better linear detection than a single sensor mapping mode, but because of operator variability, the results are inconclusive. Radar/LANDSAT combinations appear promising as an optimum linear mapping technique, if the advantages and disadvantages of each remote sensor are considered.

  16. EWS-FLI1 utilizes divergent chromatin remodeling mechanisms to directly activate or repress enhancer elements in Ewing sarcoma

    PubMed Central

    Rheinbay, Esther; Boulay, Gaylor; Suvà, Mario L.; Rossetti, Nikki E.; Boonseng, Wannaporn E.; Oksuz, Ozgur; Cook, Edward B.; Formey, Aurélie; Patel, Anoop; Gymrek, Melissa; Thapar, Vishal; Deshpande, Vikram; Ting, David T.; Hornicek, Francis J.; Nielsen, G. Petur; Stamenkovic, Ivan; Aryee, Martin J.


    Summary The aberrant transcription factor EWS-FLI1 drives Ewing sarcoma yet its molecular function is incompletely understood. We find that EWS-FLI1 reprograms gene regulatory circuits in Ewing sarcoma by directly inducing or repressing enhancers. At GGAA repeat elements, which lack evolutionary conservation and regulatory potential in other cell types, EWS-FLI1 multimers induce chromatin opening and create de novo enhancers that physically interact with target promoters. Conversely, EWS-FLI1 inactivates conserved enhancers containing canonical ETS motifs by displacing wild type ETS transcription factors. These divergent chromatin-remodeling patterns repress tumor suppressors and mesenchymal lineage regulators, while activating oncogenes and new potential therapeutic targets, such as the kinase VRK1. Our findings demonstrate how EWS-FLI1 establishes an oncogenic regulatory program governing both tumor survival and differentiation. PMID:25453903

  17. Discrete-Roughness-Element-Enhanced Swept-Wing Natural Laminar Flow at High Reynolds Numbers

    NASA Technical Reports Server (NTRS)

    Malik, Mujeeb; Liao, Wei; Li, Fei; Choudhari, Meelan


    Nonlinear parabolized stability equations and secondary-instability analyses are used to provide a computational assessment of the potential use of the discrete-roughness-element technology for extending swept-wing natural laminar flow at chord Reynolds numbers relevant to transport aircraft. Computations performed for the boundary layer on a natural-laminar-flow airfoil with a leading-edge sweep angle of 34.6 deg, freestream Mach number of 0.75, and chord Reynolds numbers of 17 × 10(exp 6), 24 × 10(exp 6), and 30 × 10(exp 6) suggest that discrete roughness elements could delay laminar-turbulent transition by about 20% when transition is caused by stationary crossflow disturbances. Computations show that the introduction of small-wavelength stationary crossflow disturbances (i.e., discrete roughness element) also suppresses the growth of most amplified traveling crossflow disturbances.

  18. Enhanced Fault Detection of Rolling Element Bearing Based on Cepstrum Editing and Stochastic Resonance

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaofei; Hu, Niaoqing; Hu, Lei; Fan, Bin; Cheng, Zhe


    By signal pre-whitening based on cepstrum editing,the envelope analysis can be done over the full bandwidth of the pre-whitened signal, and this enhances the bearing characteristic frequencies. The bearing faults detection could be enhanced without knowledge of the optimum frequency bands to demodulate, however, envelope analysis over full bandwidth brings more noise interference. Stochastic resonance (SR), which is now often used in weak signal detection, is an important nonlinear effect. By normalized scale transform, SR can be applied in weak signal detection of machinery system. In this paper, signal pre-whitening based on cepstrum editing and SR theory are combined to enhance the detection of bearing fault. The envelope spectrum kurtosis of bearing fault characteristic components is used as indicators of bearing faults. Detection results of planted bearing inner race faults on a test rig show the enhanced detecting effects of the proposed method. And the indicators of bearing inner race faults enhanced by SR are compared to the ones without enhancement to validate the proposed method.

  19. Location, Location, Location: Where Do Location-Based Services Fit into Your Institution's Social Media Mix?

    ERIC Educational Resources Information Center

    Nekritz, Tim


    Foursquare is a location-based social networking service that allows users to share their location with friends. Some college administrators have been thinking about whether and how to take the leap into location-based services, which are also known as geosocial networking services. These platforms, which often incorporate gaming elements like…

  20. Common Elements Enhance or Retard Negative Patterning Discrimination Learning Depending on Modality of Stimuli

    ERIC Educational Resources Information Center

    Redhead, Edward S.; Curtis, Cheryl


    Human contingency learning studies were used to compare the predictions of configural and elemental theories. In two experiments, participants were required to learn which stimuli were associated with an increase in core temperature of a fictitious nuclear plant. Experiments investigated the rate at which a simple negative patterning…

  1. Surface-enhanced raman detection of 2,4-dinitrotoluene impurity vapor as a marker to locate landmines.


    Sylvia, J M; Janni, J A; Klein, J D; Spencer, K M


    Time, cost, and casualties associated with demining efforts underscore the need for improved detection techniques. Reduction in the number of false positives by directly detecting the explosive material, rather than casing material, is desirable. The desired field sensor must, at a minimum, demonstrate reproducibility, the necessary level of sensitivity, portability, instrumental stability, and fast system response times. Ideally, vibrational spectroscopic techniques have the potential to remove false positives, since every chemical has a unique bond structure. Herein, we demonstrate the capabilities of surface-enhanced Raman spectroscopy to detect the chemical vapor signature emanating from buried TNT-based landmines. We present reproducible results obtained from blind tests controlled by the Defense Advanced Research Projects Agency (DARPA) that demonstrate vapor detection of 2,4-dinitrotoluene at concentration levels of 5 ppb or less. The results presented used acquisition times of 30 s on a fieldable system and showed that SERS can be a significant improvement over current landmine detection methods. PMID:11128944

  2. Surface-enhanced raman detection of 2,4-dinitrotoluene impurity vapor as a marker to locate landmines.


    Sylvia, J M; Janni, J A; Klein, J D; Spencer, K M


    Time, cost, and casualties associated with demining efforts underscore the need for improved detection techniques. Reduction in the number of false positives by directly detecting the explosive material, rather than casing material, is desirable. The desired field sensor must, at a minimum, demonstrate reproducibility, the necessary level of sensitivity, portability, instrumental stability, and fast system response times. Ideally, vibrational spectroscopic techniques have the potential to remove false positives, since every chemical has a unique bond structure. Herein, we demonstrate the capabilities of surface-enhanced Raman spectroscopy to detect the chemical vapor signature emanating from buried TNT-based landmines. We present reproducible results obtained from blind tests controlled by the Defense Advanced Research Projects Agency (DARPA) that demonstrate vapor detection of 2,4-dinitrotoluene at concentration levels of 5 ppb or less. The results presented used acquisition times of 30 s on a fieldable system and showed that SERS can be a significant improvement over current landmine detection methods.

  3. Probabilistic cost-benefit analysis of enhanced safety features for strategic nuclear weapons at a representative location

    SciTech Connect

    Stephens, D.R.; Hall, C.H.; Holman, G.S.; Graham, K.F.; Harvey, T.F.; Serduke, F.J.D.


    We carried out a demonstration analysis of the value of developing and implementing enhanced safety features for nuclear weapons in the US stockpile. We modified an approach that the Nuclear Regulatory Commission (NRC) developed in response to a congressional directive that NRC assess the ``value-impact`` of regulatory actions for commercial nuclear power plants. Because improving weapon safety shares some basic objectives with NRC regulations, i.e., protecting public health and safety from the effects of accidents involving radioactive materials, we believe the NRC approach to be appropriate for evaluating weapons-safety cost-benefit issues. Impact analysis includes not only direct costs associated with retrofitting the weapon system, but also the expected costs (or economic risks) that are avoided by the action, i.e., the benefits.

  4. Endoplasmic reticulum-located PDAT1-2 from castor bean enhances hydroxy fatty acid accumulation in transgenic plants.


    Kim, Hyun Uk; Lee, Kyeong-Ryeol; Go, Young Sam; Jung, Jin Hee; Suh, Mi-Chung; Kim, Jong Bum


    Ricinoleic acid (12-hydroxy-octadeca-9-enoic acid) is a major unusual fatty acid in castor oil. This hydroxy fatty acid is useful in industrial materials. This unusual fatty acid accumulates in triacylglycerol (TAG) in the seeds of the castor bean (Ricinus communis L.), even though it is synthesized in phospholipids, which indicates that the castor plant has an editing enzyme, which functions as a phospholipid:diacylglycerol acyltransferase (PDAT) that is specific to ricinoleic acid. Transgenic plants containing fatty acid Δ12-hydroxylase encoded by the castor bean FAH12 gene produce a limited amount of hydroxy fatty acid, a maximum of around 17% of TAGs present in Arabidopsis seeds, and this unusual fatty acid remains in phospholipids of cell membranes in seeds. Identification of ricinoleate-specific PDAT from castor bean and manipulation of the phospholipid editing system in transgenic plants will enhance accumulation of the hydroxy fatty acid in transgenic seeds. The castor plant has three PDAT genes; PDAT1-1 and PDAT2 are homologs of PDAT, which are commonly found in plants; however, PDAT1-2 is newly grouped as a castor bean-specific gene. PDAT1-2 is expressed in developing seeds and localized in the endoplasmic reticulum, similar to FAH12, indicating its involvement in conversion of ricinoleic acid into TAG. PDAT1-2 significantly enhances accumulation of total hydroxy fatty acid up to 25%, with a significant increase in castor-like oil, 2-OH TAG, in seeds of transgenic Arabidopsis, which is an identification of the key gene for oilseed engineering in production of unusual fatty acids.

  5. Characteristic element of matrix attachment region mediates vector attachment and enhances nerve growth factor expression in Chinese hamster ovary cells.


    Wang, X Y; Zhang, J H; Sun, Q L; Yao, Z Y; Deng, B G; Guo, W Y; Wang, L; Dong, W H; Wang, F; Zhao, C P; Wang, T Y


    Preliminary studies have suggested that a characteristic element of the matrix attachment region (MAR) in human interferon-β mediates the adhesion of vectors to Chinese hamster ovary (CHO) cells. In this study, we investigated if vector adhesion increased nerve growth factor (NGF) expression in CHO cells. The MAR characteristic element sequence of human interferon-β was inserted into the multiple-cloning site of the pEGFP-C1 vector. The target NGF gene was inserted upstream of the MAR characteristic element sequence to construct the MAR/NGF expression vector. The recombinant plasmid was transfected into CHO cells and stable monoclonal cells were selected using G418. NGF mRNA and protein expression was detected by reverse transcriptase-polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. Plasmid reduction experiments were used to determine the state of transfected plasmid in mammalian cells. The insertion of MAR into the vector increased NGF expression levels in CHO cells (1.93- fold) compared to the control. The recombinant plasmid expressing the MAR sequence was digested into a linear space vector. The inserted MAR and NGF sequences were consistent with those inserted into the plasmid before recombination. Therefore, we concluded that the MAR characteristic element mediates vector adhesion to CHO cells and enhances the stability and efficiency of the target gene expression.

  6. Enhanced detection of rolling element bearing fault based on stochastic resonance

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaofei; Hu, Niaoqing; Cheng, Zhe; Hu, Lei


    Early bearing faults can generate a series of weak impacts. All the influence factors in measurement may degrade the vibration signal. Currently, bearing fault enhanced detection method based on stochastic resonance(SR) is implemented by expensive computation and demands high sampling rate, which requires high quality software and hardware for fault diagnosis. In order to extract bearing characteristic frequencies component, SR normalized scale transform procedures are presented and a circuit module is designed based on parameter-tuning bistable SR. In the simulation test, discrete and analog sinusoidal signals under heavy noise are enhanced by SR normalized scale transform and circuit module respectively. Two bearing fault enhanced detection strategies are proposed. One is realized by pure computation with normalized scale transform for sampled vibration signal, and the other is carried out by designed SR hardware with circuit module for analog vibration signal directly. The first strategy is flexible for discrete signal processing, and the second strategy demands much lower sampling frequency and less computational cost. The application results of the two strategies on bearing inner race fault detection of a test rig show that the local signal to noise ratio of the characteristic components obtained by the proposed methods are enhanced by about 50% compared with the band pass envelope analysis for the bearing with weaker fault. In addition, helicopter transmission bearing fault detection validates the effectiveness of the enhanced detection strategy with hardware. The combination of SR normalized scale transform and circuit module can meet the need of different application fields or conditions, thus providing a practical scheme for enhanced detection of bearing fault.

  7. Unstructured finite element-based digital image correlation with enhanced management of quadrature and lens distortions

    NASA Astrophysics Data System (ADS)

    Pierré, J.-E.; Passieux, J.-C.; Périé, J.-N.; Bugarin, F.; Robert, L.


    Like subset-based methods, the very first finite element versions of digital image correlation were closely related to the regular structure of images, as they were based on regular quadrilateral elements corresponding to an integer number of pixels. The use of unstructured meshes, to exploit the full potential of FE-DIC in structural mechanics, is now widespread. Most of the time, the formulation, the quadrature and the definition of the region of interest still rely on the pixels grid. In this paper, a formulation in the physical coordinate system and not in the image frame is proposed for 2D digital image correlation. In addition to a more precise definition of the region of interest, it allows the use of a more accurate quadrature rule. It is also shown that lens distortions can be successfully taken into account directly with such a formalism.

  8. Enhancing Surface Finish of Additively Manufactured Titanium and Cobalt Chrome Elements Using Laser Based Finishing

    NASA Astrophysics Data System (ADS)

    Gora, Wojciech S.; Tian, Yingtao; Cabo, Aldara Pan; Ardron, Marcus; Maier, Robert R. J.; Prangnell, Philip; Weston, Nicholas J.; Hand, Duncan P.

    Additive manufacturing (AM) offers the possibility of creating a complex free form object as a single element, which is not possible using traditional mechanical machining. Unfortunately the typically rough surface finish of additively manufactured parts is unsuitable for many applications. As a result AM parts must be post-processed; typically mechanically machined and/or and polished using either chemical or mechanical techniques (both of which have their limitations). Laser based polishing is based on remelting of a very thin surface layer and it offers potential as a highly repeatable, higher speed process capable of selective area polishing, and without any waste problems (no abrasives or liquids). In this paper an in-depth investigation of CW laser polishing of titanium and cobalt chrome AM elements is presented. The impact of different scanning strategies, laser parameters and initial surface condition on the achieved surface finish is evaluated.

  9. Enhancing biogas production from vinasse in sugarcane biorefineries: Effects of urea and trace elements supplementation on process performance and stability.


    Janke, Leandro; Leite, Athaydes F; Batista, Karla; Silva, Witan; Nikolausz, Marcell; Nelles, Michael; Stinner, Walter


    In this study, the effects of nitrogen, phosphate and trace elements supplementation were investigated in a semi-continuously operated upflow anaerobic sludge blanket system to enhance process stability and biogas production from sugarcane vinasse. Phosphate in form of KH2PO4 induced volatile fatty acids accumulation possibly due to potassium inhibition of the methanogenesis. Although nitrogen in form of urea increased the reactor's alkalinity, the process was overloaded with an organic loading rate of 6.1gCODL(-1)d(-1) and a hydraulic retention time of 3.6days. However, by supplementing urea and trace elements a stable operation even at an organic loading rate of 9.6gCODL(-1)d(-1) and a hydraulic retention time of 2.5days was possible, resulting in 79% higher methane production rate with a stable specific methane production of 239mLgCOD(-1). PMID:26873284

  10. Enhancing biogas production from vinasse in sugarcane biorefineries: Effects of urea and trace elements supplementation on process performance and stability.


    Janke, Leandro; Leite, Athaydes F; Batista, Karla; Silva, Witan; Nikolausz, Marcell; Nelles, Michael; Stinner, Walter


    In this study, the effects of nitrogen, phosphate and trace elements supplementation were investigated in a semi-continuously operated upflow anaerobic sludge blanket system to enhance process stability and biogas production from sugarcane vinasse. Phosphate in form of KH2PO4 induced volatile fatty acids accumulation possibly due to potassium inhibition of the methanogenesis. Although nitrogen in form of urea increased the reactor's alkalinity, the process was overloaded with an organic loading rate of 6.1gCODL(-1)d(-1) and a hydraulic retention time of 3.6days. However, by supplementing urea and trace elements a stable operation even at an organic loading rate of 9.6gCODL(-1)d(-1) and a hydraulic retention time of 2.5days was possible, resulting in 79% higher methane production rate with a stable specific methane production of 239mLgCOD(-1).

  11. Sonication enhances polyphenolic compounds, sugars, carotenoids and mineral elements of apple juice.


    Abid, Muhammad; Jabbar, Saqib; Wu, Tao; Hashim, Malik Muhammad; Hu, Bing; Lei, Shicheng; Zeng, Xiaoxiong


    A study was initiated with the objective of evaluating the effects of sonication treatment on quality characteristics of apple juice such as polyphenolic compounds (chlorogenic acid, caffeic acid, catechin, epicatechin and phloridzin), sugars (fructose, glucose and sucrose), mineral elements (Na, K, Ca, P, Mg, Cu and Zn), total carotenoids, total anthocyanins, viscosity and electrical conductivity. The fresh apple juice samples were sonicated for 0, 30 and 60 min at 20 °C (frequency 25 kHz and amplitude 70%), respectively. As results, the contents of polyphenolic compounds and sugars significantly increased (P<0.05) but the increases were more pronounced in juice samples sonicated for 30 min whereas, total carotenoids, mineral elements (Na, K and Ca) and viscosity significantly increased (P<0.05) in samples treated for 60 min sonication. Losses of some mineral elements (P, Mg and Cu) also occurred. Total anthocyanins, Zn and electrical conductivity did not undergo any change in the sonicated samples. Findings of the present study suggest that sonication technique may be applied to improve phytonutrients present naturally in apple juice.

  12. Enhancer activity of light-responsive regulatory elements in the untranslated leader regions of cyanobacterial psbA genes.

    PubMed Central

    Li, R; Golden, S S


    Three psbA genes encoding the D1 protein of the photosystem II reaction center are differentially expressed under different light intensities in the cyanobacterium Synechococcus sp. strain PCC 7942. Two of the three psbA genes, psbAII and psbAIII, are induced rapidly when light intensity is increased from 125 x 10(-6) mol.m-2.s-1 to 750 x 10(-6) mol.m-2.s-1. A recombinational cloning vector that carries a transcriptional lacZ reporter gene was used to characterize the controlling elements responsible for light induction. At least three distinct cis elements are present in the regulatory regions of pbsAII and psbAIII: basal promoters, comparable to Escherichia coli sigma 70 promoters in position and sequence, confer constitutive expression of the genes under both low and high light intensities; negative elements upstream of the promoters down-regulate the expression of the corresponding gene; and sequences downstream of the promoters that correspond to the untranslated leader regions of the mRNAs (+1 to +41 in psbAII and +1 to +39 in psbAIII) are responsible for increased expression under high light. When these light-responsive elements were combined with an E. coli promoter (conII) in different positions and orientations, the expression of the lacZ gene was induced 4- to 11-fold. The induction of gene expression under high light by these enhancers was position independent but orientation dependent. When the elements were combined with the conII promoter in the correct orientation, they also conferred a small but reproducible level of light-responsive expression on this E. coli promoter. Images Fig. 1 Fig. 3 Fig. 4 PMID:8265608

  13. Application of an enhanced discrete element method to oil and gas drilling processes

    NASA Astrophysics Data System (ADS)

    Ubach, Pere Andreu; Arrufat, Ferran; Ring, Lev; Gandikota, Raju; Zárate, Francisco; Oñate, Eugenio


    The authors present results on the use of the discrete element method (DEM) for the simulation of drilling processes typical in the oil and gas exploration industry. The numerical method uses advanced DEM techniques using a local definition of the DEM parameters and combined FEM-DEM procedures. This paper presents a step-by-step procedure to build a DEM model for analysis of the soil region coupled to a FEM model for discretizing the drilling tool that reproduces the drilling mechanics of a particular drill bit. A parametric study has been performed to determine the model parameters in order to maintain accurate solutions with reduced computational cost.

  14. Understanding the Importance of Context: A Qualitative Study of a Location-Based Exergame to Enhance School Childrens Physical Activity.


    Robertson, Judy; Jepson, Ruth; Macvean, Andrew; Gray, Stuart


    Many public health interventions are less effective than expected in 'real life settings', yet little work is undertaken to understand the reasons why. The effectiveness of complex public health interventions can often be traced back to a robust programme theory (how and why an intervention brings about a change in outcome(s)) and assumptions that are made about the context in which it is implemented. Understanding whether effectiveness (or lack thereof) is due to the intervention or the context is hugely helpful in decisions about whether to a) modify the intervention; b) modify the context; c) stop providing the intervention. Exergames-also known as Active Video Games or AVGS-are video games which use the player's bodily movements as input and have potential to increase physical activity in children. However, the results of a recent pilot randomised controlled trial (RCT) of a location-based exergame (FitQuest) in a school setting were inconclusive; no significant effect was detected for any of the outcome measures. The aim of this study was to explore whether the programme theory for FitQuest was correct with respect to how and why it would change children's perceptions of physical activity (PA) and exercise self-efficacy in the school setting. A further aim was to investigate the features of the school setting (context) that may impact on FitQuest's implementation and effectiveness. Qualitative data (gathered during the RCT) were gathered from interviews with teachers and children, and observation of sessions using FitQuest. Thematic analysis indicated that whilst children enjoyed playing the game, engaged with goal setting within the game context and undertook low to vigorous physical activity, there were significant contextual factors that prevented it from being played as often as intended. These included environmental factors (e.g. size of the playground), school factors (cancellations due to other activities), school technology policy (rules relating to

  15. Understanding the Importance of Context: A Qualitative Study of a Location-Based Exergame to Enhance School Childrens Physical Activity

    PubMed Central

    Jepson, Ruth; Macvean, Andrew; Gray, Stuart


    Many public health interventions are less effective than expected in ‘real life settings’, yet little work is undertaken to understand the reasons why. The effectiveness of complex public health interventions can often be traced back to a robust programme theory (how and why an intervention brings about a change in outcome(s)) and assumptions that are made about the context in which it is implemented. Understanding whether effectiveness (or lack thereof) is due to the intervention or the context is hugely helpful in decisions about whether to a) modify the intervention; b) modify the context; c) stop providing the intervention. Exergames–also known as Active Video Games or AVGS–are video games which use the player's bodily movements as input and have potential to increase physical activity in children. However, the results of a recent pilot randomised controlled trial (RCT) of a location-based exergame (FitQuest) in a school setting were inconclusive; no significant effect was detected for any of the outcome measures. The aim of this study was to explore whether the programme theory for FitQuest was correct with respect to how and why it would change children’s perceptions of physical activity (PA) and exercise self-efficacy in the school setting. A further aim was to investigate the features of the school setting (context) that may impact on FitQuest’s implementation and effectiveness. Qualitative data (gathered during the RCT) were gathered from interviews with teachers and children, and observation of sessions using FitQuest. Thematic analysis indicated that whilst children enjoyed playing the game, engaged with goal setting within the game context and undertook low to vigorous physical activity, there were significant contextual factors that prevented it from being played as often as intended. These included environmental factors (e.g. size of the playground), school factors (cancellations due to other activities), school technology policy (rules

  16. Understanding the Importance of Context: A Qualitative Study of a Location-Based Exergame to Enhance School Childrens Physical Activity.


    Robertson, Judy; Jepson, Ruth; Macvean, Andrew; Gray, Stuart


    Many public health interventions are less effective than expected in 'real life settings', yet little work is undertaken to understand the reasons why. The effectiveness of complex public health interventions can often be traced back to a robust programme theory (how and why an intervention brings about a change in outcome(s)) and assumptions that are made about the context in which it is implemented. Understanding whether effectiveness (or lack thereof) is due to the intervention or the context is hugely helpful in decisions about whether to a) modify the intervention; b) modify the context; c) stop providing the intervention. Exergames-also known as Active Video Games or AVGS-are video games which use the player's bodily movements as input and have potential to increase physical activity in children. However, the results of a recent pilot randomised controlled trial (RCT) of a location-based exergame (FitQuest) in a school setting were inconclusive; no significant effect was detected for any of the outcome measures. The aim of this study was to explore whether the programme theory for FitQuest was correct with respect to how and why it would change children's perceptions of physical activity (PA) and exercise self-efficacy in the school setting. A further aim was to investigate the features of the school setting (context) that may impact on FitQuest's implementation and effectiveness. Qualitative data (gathered during the RCT) were gathered from interviews with teachers and children, and observation of sessions using FitQuest. Thematic analysis indicated that whilst children enjoyed playing the game, engaged with goal setting within the game context and undertook low to vigorous physical activity, there were significant contextual factors that prevented it from being played as often as intended. These included environmental factors (e.g. size of the playground), school factors (cancellations due to other activities), school technology policy (rules relating to

  17. Maternal separation enhances object location memory and prevents exercise-induced MAPK/ERK signalling in adult Sprague–Dawley rats

    PubMed Central

    Bugarith, Kishor; Russell, Vivienne A


    Early life stress increases the risk of developing psychopathology accompanied by reduced cognitive function in later life. Maternal separation induces anxiety-like behaviours and is associated with impaired memory. On the other hand, exercise has been shown to diminish anxiety-like behaviours and improve cognitive function. The effects of maternal separation and exercise on anxiety, memory and hippocampal proteins were investigated in male Sprague–Dawley rats. Maternal separation produced anxiety-like behaviours which were reversed by exercise. Maternal separation also enhanced object location memory which was not affected by exercise. Exercise did, however, increase synaptophysin and phospho-extracellular signal-regulated kinase (p-ERK) in the hippocampus of non-separated rats and this effect was not observed in maternally separated rats. These findings show that maternal separation selectively enhanced n memory and prevented activation of the MAPK/ERK signalling pathway in the adult rat hippocampus. PMID:22476924

  18. Maternal separation enhances object location memory and prevents exercise-induced MAPK/ERK signalling in adult Sprague-Dawley rats.


    Makena, Nokuthula; Bugarith, Kishor; Russell, Vivienne A


    Early life stress increases the risk of developing psychopathology accompanied by reduced cognitive function in later life. Maternal separation induces anxiety-like behaviours and is associated with impaired memory. On the other hand, exercise has been shown to diminish anxiety-like behaviours and improve cognitive function. The effects of maternal separation and exercise on anxiety, memory and hippocampal proteins were investigated in male Sprague-Dawley rats. Maternal separation produced anxiety-like behaviours which were reversed by exercise. Maternal separation also enhanced object location memory which was not affected by exercise. Exercise did, however, increase synaptophysin and phospho-extracellular signal-regulated kinase (p-ERK) in the hippocampus of non-separated rats and this effect was not observed in maternally separated rats. These findings show that maternal separation selectively enhanced n memory and prevented activation of the MAPK/ERK signalling pathway in the adult rat hippocampus.

  19. Adsorption enhancement of elemental mercury onto sulphur-functionalized silica gel adsorbents.


    Johari, Khairiraihanna; Saman, Norasikin; Mat, Hanapi


    In this study, elemental mercury (EM) adsorbents were synthesized using tetraethyl orthosilicate (TEOS) and 3-mercaptopropyl trimethoxysilane as silica precursors. The synthesized silica gel (SG)-TEOS was further functionalized through impregnation with elemental sulphur and carbon disulphide (CS2). The SG adsorbents were then characterized by using scanning electron microscope, Fourier transform infra-red spectrophotometer, nitrogen adsorption/desorption, and energy-dispersive X-ray diffractometer. The EM adsorption of the SG adsorbents was determined using fabricated fixed-bed adsorber. The EM adsorption results showed that the sulphur-functionalized SG adsorbents had a greater Hgo breakthrough adsorption capacity, confirming that the presence of sulphur in silica matrices can improve Hgo adsorption performance due to their high affinity towards mercury. The highest Hgo adsorption capacity was observed for SG-TEOS(CS2) (82.62 microg/g), which was approximately 2.9 times higher than SG-TEOS (28.47 microg/g). The rate of Hgo adsorption was observed higher for sulphur-impregnated adsorbents, and decreased with the increase in the bed temperatures.

  20. Fault feature extraction and enhancement of rolling element bearing in varying speed condition

    NASA Astrophysics Data System (ADS)

    Ming, A. B.; Zhang, W.; Qin, Z. Y.; Chu, F. L.


    In engineering applications, the variability of load usually varies the shaft speed, which further degrades the efficacy of the diagnostic method based on the hypothesis of constant speed analysis. Therefore, the investigation of the diagnostic method suitable for the varying speed condition is significant for the bearing fault diagnosis. In this instance, a novel fault feature extraction and enhancement procedure was proposed by the combination of the iterative envelope analysis and a low pass filtering operation in this paper. At first, based on the analytical model of the collected vibration signal, the envelope signal was theoretically calculated and the iterative envelope analysis was improved for the varying speed condition. Then, a feature enhancement procedure was performed by applying a low pass filter on the temporal envelope obtained by the iterative envelope analysis. Finally, the temporal envelope signal was transformed to the angular domain by the computed order tracking and the fault feature was extracted on the squared envelope spectrum. Simulations and experiments were used to validate the efficacy of the theoretical analysis and proposed procedure. It is shown that the computed order tracking method is recommended to be applied on the envelope of the signal in order to avoid the energy spreading and amplitude distortion. Compared with the feature enhancement method performed by the fast kurtogram and corresponding optimal band pass filtering, the proposed method can efficiently extract the fault character in the varying speed condition with less amplitude attenuation. Furthermore, do not involve the center frequency estimation, the proposed method is more concise for engineering applications.

  1. Folding of the natural hammerhead ribozyme is enhanced by interaction of auxiliary elements

    PubMed Central



    It has been shown that the activity of the hammerhead ribozyme at μM magnesium ion concentrations is markedly increased by the inclusion of loops in helices I and II. We have studied the effect of such loops on the magnesium ion-induced folding of the ribozyme, using fluorescence resonance energy transfer. We find that with the loops in place, folding into the active conformation occurs in a single step, in the μM range of magnesium ion concentration. Disruption of the loop–loop interaction leads to a reversion to two-step folding, with the second stage requiring mM concentrations of magnesium ion. Sodium ions also promote the folding of the natural form of the ribozyme at high concentrations, but the folding occurs as a two-stage process. The loops clearly act as important auxiliary elements in the function of the ribozyme, permitting folding to occur efficiently under physiological conditions. PMID:15100442

  2. Precision enhancement in boundary element methods with application to electron optics.


    Loyd, Jody S; Gregory, Don A


    A hybrid approach is presented for obtaining electric potentials for use in electron optics modeling. An initial solution from the boundary element method (BEM) is used to derive the bounding potential of a cylindrical subdomain subsequently used in a Fourier series solution. The approach combines the inherent precision of this analytic solution with the flexibility of BEM to describe practical, non-idealized systems of electrodes. The resulting lens field in the Fourier series subdomain is of higher precision, thereby allowing smaller errors in subsequent calculations of electron ray paths. The effects of aberrations are thus easier to observe in tracing non-paraxial rays. Example ray-traces through a simple, known einzel lens are given as validation of this approach.

  3. Precision enhancement in boundary element methods with application to electron optics.


    Loyd, Jody S; Gregory, Don A


    A hybrid approach is presented for obtaining electric potentials for use in electron optics modeling. An initial solution from the boundary element method (BEM) is used to derive the bounding potential of a cylindrical subdomain subsequently used in a Fourier series solution. The approach combines the inherent precision of this analytic solution with the flexibility of BEM to describe practical, non-idealized systems of electrodes. The resulting lens field in the Fourier series subdomain is of higher precision, thereby allowing smaller errors in subsequent calculations of electron ray paths. The effects of aberrations are thus easier to observe in tracing non-paraxial rays. Example ray-traces through a simple, known einzel lens are given as validation of this approach. PMID:27068123

  4. The Use of Finite Element Analysis to Enhance Research and Clinical Practice in Orthopedics.


    Pfeiffer, Ferris M


    Finite element analysis (FEA) is a very powerful tool for the evaluation of biomechanics in orthopedics. Finite element (FE) simulations can effectively and efficiently evaluate thousands of variables (such as implant variation, surgical techniques, and various pathologies) to optimize design, screening, prediction, and treatment in orthopedics. Additionally, FEA can be used to retrospectively evaluate and troubleshoot complications or failures to prevent similar future occurrences. Finally, FE simulations are used to evaluate implants, procedures, and techniques in a time- and cost-effective manner. In this work, an overview of the development of FE models is provided and an example application is presented to simulate knee biomechanics for a specimen with medial meniscus insufficiency. FE models require the development of the geometry of interest, determination of the material properties of the tissues simulated, and an accurate application of a numerical solver to produce an accurate solution and representation of the field variables. The objectives of this work are to introduce the reader to the application of FEA in orthopedic analysis of the knee joint. A brief description of the model development process as well as a specific application to the investigation of knee joint stability in geometries with normal or compromised medial meniscal attachment is included. Significant increases in stretch of the anterior cruciate ligament were predicted in specimens with medial meniscus insufficiency (such behavior was confirmed in corresponding biomechanical testing). It can be concluded from this work that FE analysis of the knee can provide significant new information with which more effective clinical decisions can be made.

  5. The Use of Finite Element Analysis to Enhance Research and Clinical Practice in Orthopedics.


    Pfeiffer, Ferris M


    Finite element analysis (FEA) is a very powerful tool for the evaluation of biomechanics in orthopedics. Finite element (FE) simulations can effectively and efficiently evaluate thousands of variables (such as implant variation, surgical techniques, and various pathologies) to optimize design, screening, prediction, and treatment in orthopedics. Additionally, FEA can be used to retrospectively evaluate and troubleshoot complications or failures to prevent similar future occurrences. Finally, FE simulations are used to evaluate implants, procedures, and techniques in a time- and cost-effective manner. In this work, an overview of the development of FE models is provided and an example application is presented to simulate knee biomechanics for a specimen with medial meniscus insufficiency. FE models require the development of the geometry of interest, determination of the material properties of the tissues simulated, and an accurate application of a numerical solver to produce an accurate solution and representation of the field variables. The objectives of this work are to introduce the reader to the application of FEA in orthopedic analysis of the knee joint. A brief description of the model development process as well as a specific application to the investigation of knee joint stability in geometries with normal or compromised medial meniscal attachment is included. Significant increases in stretch of the anterior cruciate ligament were predicted in specimens with medial meniscus insufficiency (such behavior was confirmed in corresponding biomechanical testing). It can be concluded from this work that FE analysis of the knee can provide significant new information with which more effective clinical decisions can be made. PMID:26745731

  6. Enhanced efficiency of P-element mediated transgenesis in Drosophila: Microinjection of DNA complexed with nanomaterial.


    Sonane, Madhavi; Goyal, Ritu; Chowdhuri, Debapratim K; Ram, Kristipati Ravi; Gupta, Kailash C


    The efficiency of genetic transformation technology to generate stable transgenics depends upon the successful delivery of plasmid DNA in embryonic cells. The available gene vectors facilitate efficient plasmid DNA delivery to the cellular milieu but are exposed to nuclease degradation. Recent in vitro studies suggest encapsulation of plasmid DNA with nanomaterial(s) for better protection against nucleases. Therefore, in this study, we tested if complexing of free plasmid DNA with linear polyethylenimine (LPEI, 25 kDa) based nanoparticle (LPN) enhances the efficiency of transformation (transgenesis) by using Drosophila based germ-line transformation technology. Here, we show that the LPN-DNA complex not only enhances the efficiency of this transgenic technology at a DNA concentration of 0.04 μg/μl but also reduces the DNA quantity required to generate transgenics by ten folds. This approach has potential applications for other types of transgenesis and nucleic acid injection methods in Drosophila as well as other popular genetic model systems.

  7. Temporal predictability enhances judgements of causality in elemental causal induction from both observation and intervention.


    Greville, W James; Buehner, Marc J


    When the temporal interval or delay separating cause and effect is consistent over repeated instances, it becomes possible to predict when the effect will follow from the cause, hence temporal predictability serves as an appropriate term for describing consistent cause-effect delays. It has been demonstrated that in instrumental action-outcome learning tasks, enhancing temporal predictability by holding the cause-effect interval constant elicits higher judgements of causality compared to conditions involving variable temporal intervals. Here, we examine whether temporal predictability exerts a similar influence when causal learning takes place through observation rather than intervention through instrumental action. Four experiments demonstrated that judgements of causality were higher when the temporal interval was constant than when it was variable, and that judgements declined with increasing variability. We further found that this beneficial effect of predictability was stronger in situations where the effect base-rate was zero (Experiments 1 and 3). The results therefore clearly indicate that temporal predictability enhances impressions of causality, and that this effect is robust and general. Factors that could mediate this effect are discussed.

  8. Synthetic vision as an integrated element of an enhanced vision system

    NASA Astrophysics Data System (ADS)

    Jennings, Chad W.; Alter, Keith W.; Barrows, Andrew K.; Bernier, Ken L.; Guell, Jeff J.


    Enhanced Vision Systems (EVS) and Synthetic Vision Systems (SVS) have the potential to allow vehicle operators to benefit from the best that various image sources have to offer. The ability to see in all directions, even in reduced visibility conditions, offers considerable benefits for operational effectiveness and safety. Nav3D and The Boeing Company are conducting development work on an Enhanced Vision System with an integrated Synthetic Vision System. The EVS consists of several imaging sensors that are digitally fused together to give a pilot a better view of the outside world even in challenging visual conditions. The EVS is limited however to provide imagery within the viewing frustum of the imaging sensors. The SVS can provide a rendered image of an a priori database in any direction that the pilot chooses to look and thus can provide information of terrain and flight path that are outside the purview of the EVS. Design concepts of the system will be discussed. In addition the ground and flight testing of the system will be described.

  9. Gene promoter of apoptosis inhibitory protein IAP2: identification of enhancer elements and activation by severe hypoxia.

    PubMed Central

    Dong, Zheng; Nishiyama, Junichiro; Yi, Xiaolan; Venkatachalam, Manjeri A; Denton, Michael; Gu, Sumin; Li, Senlin; Qiang, Mei


    Inhibitors of apoptosis (IAPs) antagonize cell death and regulate the cell cycle. One mechanism controlling IAP expression is translation initiation through the internal ribosome entry sites. Alternatively, IAP expression can be regulated at the transcription level. We showed recently the activation of IAP2 transcription by severe hypoxia. To pursue this regulation, we have cloned the full-length cDNA of rat IAP2, and have isolated and analysed the promoter regions of this gene. The cDNA encodes a protein of 589 amino acids, exhibiting structural features of IAP. In rat tissues, a major IAP2 transcript of approximately 3.5 kb was detected. We subsequently isolated 3.3 kb of the proximal 5'-flanking regions of this gene, which showed significant promoter activity. Of interest, 5' sequential deletion of the promoter sequence identified an enhancer of approximately 200 bp. Deletion of cAMP-response-element-binding protein (CREB) sites in the enhancer sequence diminished its activity. Finally, the IAP2 gene promoter was activated significantly by severe hypoxia and not by CoCl(2) or desferrioxamine, pharmacological inducers of hypoxia-inducible factor-1. In conclusion, in this study we have cloned the full-length cDNA of rat IAP2, and for the first time we have isolated and analysed promoter sequences of this gene, leading to the identification of enhancer elements. Moreover, we have demonstrated activation of the gene promoter by severe hypoxia, a condition shown to induce IAP2. These findings provide a basis for further investigation of gene regulation of IAP2, a protein with multiple functions. PMID:12023884

  10. Migration of trace elements from basalt substrate to co-located vegetation (lichens and mosses) at the Wudalianchi volcanos, Northeast China

    NASA Astrophysics Data System (ADS)

    Bao, Yuan; Ju, Yiwen; Li, Boping; Sun, Yimin


    Vegetation (e.g., lichens and mosses) living on the basalt substrate have potential to accumulate trace elements in their tissues. Here, we analyze the trace elements in basalt (collected from major volcanic center to jet plate places, representing four different eruption phases) and adjacent lichens and mosses to assess their elemental source-receptor relation. The results indicate that As, Sr, Mo, Cd, and Ba are enriched in basalt, and depleted in lichens and mosses. However, Zn, Hg, and Pb are enriched in lichens and mosses and depleted in basalt. Moreover, with the increase of basalt age, Cr, Mn, Fe, Ni, and Cu are gradually enriched in lichen and moss, but gradually depleted in basalt. Compared with transition metals, large ion lithophiles, the platinum group, and rare earth elements, Cr, Co, Cu, Zn, and Os are more easily absorbed by No. 1 lichen. Specifically, S is highly assimilated in vegetation, with a highest value of 166, followed by I, C, Pb, Zn, and Hg. In addition, the hydrogen and oxygen isotopic compositions of water samples suggest that the surface water in the Wenbo area came from meteoric waters in summer with a high humidity, while the underground water in the Beiyaoquan area came from meteoric waters in winter with a low humidity.

  11. Characterization of antigen receptor response elements within the interleukin-2 enhancer.

    PubMed Central

    Durand, D B; Shaw, J P; Bush, M R; Replogle, R E; Belagaje, R; Crabtree, G R


    T-cell activation and induction of interleukin-2 (IL-2) expression in human T lymphocytes require both interaction of foreign antigen with the T-cell antigen receptor and protein kinase C (PKC) stimulation. Agents such as phorbol 12-myristate 13-acetate (PMA) that stimulate PKC augment the effects of antigen but are not sufficient for IL-2 activation. By analysis of deletion mutants, we identified three DNA sequences extending from -73 to -89, -217 to -255, and -263 to -279, designated IL-2 sites A, D, and E, respectively, that are required for maximal induction of IL-2 expression. One of these regions, site E, interacted with a protein (NF-IL-2E) present only in the nuclei of cells which have been stimulated. The other two sequences interacted with a protein (NF-IL-2A) that is constitutively expressed in T cells. When multiple tandem copies of either the E site or the A site were placed upstream of the gamma-fibrinogen promoter, they activated expression via this promoter in response to signals initiated at the antigen receptor but not following PMA stimulation. For this reason, we denoted them antigen receptor response elements. The uncoupling of antigen receptor and PKC requirements in these studies indicates that these signal pathways are, at least in part, distinct and integrated at the level of the gene. Images PMID:3260003

  12. Enhanced focus steering abilities of multi-element therapeutic arrays operating in nonlinear regimes

    SciTech Connect

    Yuldashev, P. Ilyin, S.; Gavrilov, L.; Sapozhnikov, O.; Khokhlova, V.; Kreider, W.


    Steering abilities of a typical HIFU therapeutic array operated in linear and nonlinear regimes were compared using numerical simulation with the 3D Westervelt equation. The array included 256 elements of 1.2 MHz frequency and 6.6 mm diameter distributed in a quasi-random pattern over a spherical shell with a 130 mm aperture and a focal length of 120 mm. In the case of linear focusing, thermal effects are proportional to the intensity level and the criterion for safe array operation is that the intensity in the grating lobes should be less than 10% of the intensity in the main focus. In the case of nonlinear focusing, the heating effect is no longer proportional to intensity; therefore the heat deposition rate was chosen as the relevant metric, using the same 10% threshold for the secondary lobe in comparison with the focal maximum. When steering the focus, the same linearly predicted intensity level at the main focus was maintained by increasing the array power. Numerical simulations of the acoustic field were performed for nonlinear propagation both in water and in tissue. It was shown that for shock-forming conditions in the main focus, the steering range of safe electronic focusing is larger than that for linear propagation conditions. Nonlinear sonication regimes therefore can be used to enlarge tissue volumes that can be sonicated using electronic steering of the focus of HIFU arrays.

  13. Mapping anisotropy of the proximal femur for enhanced image based finite element analysis.


    Enns-Bray, William S; Owoc, Jan S; Nishiyama, Kyle K; Boyd, Steven K


    Finite element (FE) models of bone derived from quantitative computed tomography (QCT) rely on realistic material properties to accurately predict bone strength. QCT cannot resolve bone microarchitecture, therefore QCT-based FE models lack the anisotropy apparent within the underlying bone tissue. This study proposes a method for mapping femoral anisotropy using high-resolution peripheral quantitative computed tomography (HR-pQCT) scans of human cadaver specimens. Femur HR-pQCT images were sub-divided into numerous overlapping cubic sub-volumes and the local anisotropy was quantified using a 'direct-mechanics' method. The resulting directionality reflected all the major stress lines visible within the trabecular lattice, and provided a realistic estimate of the alignment of Harvesian systems within the cortical compartment. QCT-based FE models of the proximal femur were constructed with isotropic and anisotropic material properties, with directionality interpolated from the map of anisotropy. Models were loaded in a sideways fall configuration and the resulting whole bone stiffness was compared to experimental stiffness and ultimate strength. Anisotropic models were consistently less stiff, but no statistically significant differences in correlation were observed between material models against experimental data. The mean difference in whole bone stiffness between model types was approximately 26%, suggesting that anisotropy can still effect considerable change in the mechanics of proximal femur models. The under prediction of whole bone stiffness in anisotropic models suggests that the orthotropic elastic constants require further investigation. The ability to map mechanical anisotropy from high-resolution images and interpolate information into clinical-resolution models will allow testing of new anisotropic material mapping strategies.

  14. Drosophila Immunity: Analysis of Larval Hemocytes by P-Element-Mediated Enhancer Trap

    PubMed Central

    Braun, A.; Lemaitre, B.; Lanot, R.; Zachary, D.; Meister, M.


    Our aim was to identify new genes involved in the cellular aspects of defense mechanisms of Drosophila, as well as in melanotic tumor formation processes that are linked to blood cell disregulation. We have screened 1341 enhancer detector fly lines for expression of the lacZ reporter gene in larval hemocytes at the end of the third instar. We have selected 21 lines in which we observed a reproducible lacZ expression in blood cells. These lines were classified according to the subsets of hemocytes in which lacZ was expressed, and we identified five lines that can be used as lamellocyte markers. Three lines were selected for further analysis. The first exhibited strong lacZ expression in all lamellocytes. The second expressed lacZ in plasmatocytes and lamellocytes, and exhibited a melanotic tumor phenotype in larvae homozygous for the insertion. A third line showed a striking insertion-linked phenotype of melanized lymph glands (the hematopoietic organ), which resulted in the total absence of circulating hemocytes in the mutant larvae. We anticipate that this mutation, which we named domino, will prove a useful tool in the analysis of the role of hemocytes during the various aspects of immune response and melanotic tumor formation. PMID:9335599

  15. The solar elemental abundances problem: Large enhancements in photoionization and bound-free opacity

    NASA Astrophysics Data System (ADS)

    Pradhan, A.; Nahar, S.


    Aimed at solving the outstanding problem of solar opacity and radiation transport, we report substantial photoabsorption in the high-energy regime due to atomic core photo-excitations not heretofore considered. In an extensive R-Matrix calculations of unprecedented complexity for an important iron ion Fe XVII, with a wave function expansion of 99 Fe XVIII core states from n <= 4 complexes (equivalent to 218 fine structure levels), we find: i) up to orders of magnitude enhancement in background photoionization cross sections, in addition to strongly peaked photo-excitation-of-core resonances not considered in current opacity models, and ii) demonstrate convergence with respect to successive core excitations. These findings may explain the ``higher-than-predicted'' monochromatic iron opacity measured recently at the Sandia Z-pinch fusion device at solar interior conditions. The findings will also impact the total atomic photoabsorption and radiation transport in laboratory and astrophysical plasmas, such as UV emission from host stars of extra-solar planets. Support: NSF, DOE, Ohio Supercomputer Center, Columbus, OH.

  16. Space bandwidth product enhancement of holographic display using high-order diffraction guided by holographic optical element.


    Li, Gang; Jeong, Jinsoo; Lee, Dukho; Yeom, Jiwoon; Jang, Changwon; Lee, Seungjae; Lee, Byoungho


    A space bandwidth product (SBP) enhancement method for holographic display using high-order diffraction of a spatial light modulator (SLM) is proposed. Among numerous high order diffraction terms, the plus-minus first and the zeroth are adopted and guided by holographic optical elements (HOEs) to an identical direction with the same intensity. By using a set of electro-shutters synchronized with corresponding order component, the system acts as if three SLMs are tiled in the horizontal direction. To confirm the feasibility of using HOE as the guiding optics for the system, several optical characteristics of the recording material are measured before using them. Furthermore, a computer generated hologram algorithm is proposed for compensating the wavefront distortion caused by use of the HOE. The demonstrated system achieves a three-fold increase in SBP of a single SLM. The results are verified experimentally. PMID:26831985

  17. Interfamilial recombination between viruses led to acquisition of a novel translation-enhancing RNA element that allows resistance breaking

    PubMed Central

    Miras, Manuel; Sempere, Raquel N.; Kraft, Jelena J.; Miller, W. Allen; Aranda, Miguel A.; Truniger, Veronica


    Summary Many plant viruses depend on functional RNA elements, called 3′-UTR cap-independent translation enhancers (3′-CITEs), for translation of their RNAs. In this manuscript we provide direct proof for the existing hypothesis that 3′-CITEs are modular and transferable by recombination in nature, and that this is associated with an advantage for the created virus. By characterizing a newly identified Melon necrotic spot virus (MNSV; Tombusviridae) isolate, which is able to overcome eukaryotic translation initiation factor 4E (eIF4E)-mediated resistance, we found that it contains a 55 nucleotide insertion in its 3′-UTR. We provide strong evidence that this insertion was acquired by interfamilial recombination with the 3′-UTR of an Asiatic Cucurbit aphid-borne yellows virus (CABYV; Luteoviridae). By constructing chimeric viruses, we showed that this recombined sequence is responsible for resistance breaking. Analysis of the translational efficiency of reporter constructs showed that this sequence functions as a novel 3′-CITE in both resistant and susceptible plants, being essential for translation control in resistant plants. In conclusion, we showed that a recombination event between two clearly identified viruses from different families led to the transfer of exactly the sequence corresponding to a functional RNA element, giving rise to a new isolate with the capacity to infect an otherwise non-susceptible host. PMID:24372390

  18. Post-buckled precompressed (PBP) elements: a new class of flight control actuators enhancing high-speed autonomous VTOL MAVs

    NASA Astrophysics Data System (ADS)

    Barrett, Ronald; McMurtry, Ross; Vos, Roelof; Tiso, Paolo; Breuker, Roeland D.


    This paper describes a new class of flight control actuators using Post-Buckled Precompressed (PBP) piezoelectric elements. These actuators are designed to produce significantly higher deflection and force levels than conventional piezoelectric actuator elements. Classical laminate plate theory (CLPT) models are shown to work very well in capturing the behavior of the free, unloaded elements. A new high transverse deflection model which employs nonlinear structural relations is shown to successfully predict the performance of the PBP actuators as they are exposed to higher and higher levels of axial force, which induces post buckling deflections. A proof-of-concept empennage assembly and actuator were fabricated using the principles of PBP actuation. A single grid-fin flight control effector was driven by a 3.5" (88.9mm) long piezoceramic bimorph PBP actuator. By using the PBP configuration, deflections were controllably magnified 4.5 times with excellent correlation between theory and experiment. Quasi-static bench testing showed deflection levels in excess of +/-6° at rates exceeding 15 Hz. The new solid state PBP actuator was shown to reduce the part count with respect to conventional servoactuators by an order of magnitude. Power consumption dropped from 24W to 100mW, weight was cut from 108g to 14g, slop went from 1.6° to 0.02° and current draw went from 5A to 1.4mA. The result was that the XQ-138 subscale UAV family experienced nearly a 4% reduction in operating empty weight via the switch from conventional to PBP actuators while in every other measure, gross performance was significantly enhanced.

  19. Enhanced carcinogenicity by coexposure to arsenic and iron and a novel remediation system for the elements in well drinking water.


    Kumasaka, Mayuko Y; Yamanoshita, Osamu; Shimizu, Shingo; Ohnuma, Shoko; Furuta, Akio; Yajima, Ichiro; Nizam, Saika; Khalequzzaman, Md; Shekhar, Hossain U; Nakajima, Tamie; Kato, Masashi


    Various carcinomas including skin cancer are explosively increasing in arsenicosis patients who drink arsenic-polluted well water, especially in Bangladesh. Although well drinking water in the cancer-prone areas contains various elements, very little is known about the effects of elements except arsenic on carcinogenicity. In order to clarify the carcinogenic effects of coexposure to arsenic and iron, anchorage-independent growth and invasion in human untransformed HaCaT and transformed A431 keratinocytes were examined. Since the mean ratio of arsenic and iron in well water was 1:10 in cancer-prone areas of Bangladesh, effects of 1 μM arsenic and 10 μM iron were investigated. Iron synergistically promoted arsenic-mediated anchorage-independent growth in untransformed and transformed keratinocytes. Iron additionally increased invasion in both types of keratinocytes. Activities of c-SRC and ERK that regulate anchorage-independent growth and invasion were synergistically enhanced in both types of keratinocytes. Our results suggest that iron promotes arsenic-mediated transformation of untransformed keratinocytes and progression of transformed keratinocytes. We then developed a low-cost and high-performance adsorbent composed of a hydrotalcite-like compound for arsenic and iron. The adsorbent rapidly reduced concentrations of both elements from well drinking water in cancer-prone areas of Bangladesh to levels less than those in WHO health-based guidelines for drinking water. Thus, we not only demonstrated for the first time increased carcinogenicity by coexposure to arsenic and iron but also proposed a novel remediation system for well drinking water.

  20. Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element

    PubMed Central

    Wang, Lizheng; Wang, Zixuan; Zhang, Fangfang; Zhu, Rui; Bi, Jinpeng; Wu, Jiaxin; Zhang, Haihong; Wu, Hui; Kong, Wei; Yu, Bin; Yu, Xianghui


    Adeno-associated virus (AAV) vectors have been utilized extensively in gene therapy and gene function studies, as strong transgene expression is a prerequisite for positive outcomes. AAV8 was reported as the most efficient AAV serotype for transduction of the liver, brain and muscle compared with other serotypes. However, AAV8-mediated transduction of human hepatocytes is rather poor with approximately 20-fold lower efficiency compared with that of mouse hepatocytes. Therefore, we applied the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) to enhance AAV8-mediated transgene expression driven by a combination promoter (CAG promoter) with a CMV-IE enhancer and chicken beta-actin promoter for a more efficient viral vector. Transgene expression from recombinant AAV8 (rAAV8) vectors harboring a red fluorescent protein (RFP) reporter gene with or without WPRE were evaluated in vitro and in vivo. The results demonstrated that WPRE improved AAV8-mediated RFP expression in different cell lines with clear increases of transgene expression in the liver, brain or muscle of animals. The findings of this study will help to substantially reduce the quantity of viral particles that must be injected in order to reach a therapeutic level of transgene expression in gene therapy. Consequently, such dose reductions may lessen the potential risks associated with high doses of viral vectors. PMID:27076785

  1. Shared Enhancer Activity in the Limbs and Phallus and Functional Divergence of a Limb-Genital cis-Regulatory Element in Snakes.


    Infante, Carlos R; Mihala, Alexandra G; Park, Sungdae; Wang, Jialiang S; Johnson, Kenji K; Lauderdale, James D; Menke, Douglas B


    The amniote phallus and limbs differ dramatically in their morphologies but share patterns of signaling and gene expression in early development. Thus far, the extent to which genital and limb transcriptional networks also share cis-regulatory elements has remained unexplored. We show that many limb enhancers are retained in snake genomes, suggesting that these elements may function in non-limb tissues. Consistent with this, our analysis of cis-regulatory activity in mice and Anolis lizards reveals that patterns of enhancer activity in embryonic limbs and genitalia overlap heavily. In mice, deletion of HLEB, an enhancer of Tbx4, produces defects in hindlimbs and genitalia, establishing the importance of this limb-genital enhancer for development of these different appendages. Further analyses demonstrate that the HLEB of snakes has lost hindlimb enhancer function while retaining genital activity. Our findings identify roles for Tbx4 in genital development and highlight deep similarities in cis-regulatory activity between limbs and genitalia.

  2. Comparative studies on mammalian Hoxc8 early enhancer sequence reveal a baleen whale-specific deletion of a cis-acting element

    PubMed Central

    Shashikant, Cooduvalli S.; Kim, Chang B.; Borbély, Marc A.; Wang, Wayne C. H.; Ruddle, Frank H.


    Variations in regulatory regions of developmental control genes have been implicated in the divergence of axial morphologies. To find potentially significant changes in cis-regulatory regions, we compared nucleotide sequences and activities of mammalian Hoxc8 early enhancers. The nucleotide sequence of the early enhancer region is extremely conserved among mammalian clades, with five previously described cis-acting elements, A–E, being invariant. However, a 4-bp deletion within element C of the Hoxc8 early enhancer sequence is observed in baleen whales. When assayed in transgenic mouse embryos, a baleen whale enhancer (unlike other mammalian enhancers) directs expression of the reporter gene to more posterior regions of the neural tube but fails to direct expression to posterior mesoderm. We suggest that regulation of Hoxc8 in baleen whales differs from other mammalian species and may be associated with variation in axial morphology. PMID:9860988

  3. Caffeine suppresses exercise-enhanced long-term and location memory in middle-aged rats: Involvement of hippocampal Akt and CREB signaling.


    Cechella, José L; Leite, Marlon R; da Rocha, Juliana T; Dobrachinski, Fernando; Gai, Bibiana M; Soares, Félix A A; Bresciani, Guilherme; Royes, Luiz F F; Zeni, Gilson


    The cognitive function decline is closely related with brain changes generated by age. The ability of caffeine and exercise to prevent memory impairment has been reported in animal models and humans. The purpose of the present study was to investigate whether swimming exercise and caffeine administration enhance memory in middle-aged Wistar rats. Male Wistar rats (18months) received caffeine at a dose of 30mg/kg, 5days per week by a period of 4weeks. Animals were subjected to swimming training with a workload (3% of body weight, 20min per day for 4weeks). After 4weeks, the object recognition test (ORT) and the object location test (OLT) were performed. The results of this study demonstrated that caffeine suppressed exercise-enhanced long-term (ORT) and spatial (OLT) memory in middle-aged and this effect may be related to a decrease in hippocampal p-CREB signaling. This study also provided evidence that the effects of this protocol on memory were not accompanied by alterations in the levels of activated Akt. The [(3)H] glutamate uptake was reduced in hippocampus of rats administered with caffeine and submitted to swimming protocol. PMID:25260559

  4. Caffeine suppresses exercise-enhanced long-term and location memory in middle-aged rats: Involvement of hippocampal Akt and CREB signaling.


    Cechella, José L; Leite, Marlon R; da Rocha, Juliana T; Dobrachinski, Fernando; Gai, Bibiana M; Soares, Félix A A; Bresciani, Guilherme; Royes, Luiz F F; Zeni, Gilson


    The cognitive function decline is closely related with brain changes generated by age. The ability of caffeine and exercise to prevent memory impairment has been reported in animal models and humans. The purpose of the present study was to investigate whether swimming exercise and caffeine administration enhance memory in middle-aged Wistar rats. Male Wistar rats (18months) received caffeine at a dose of 30mg/kg, 5days per week by a period of 4weeks. Animals were subjected to swimming training with a workload (3% of body weight, 20min per day for 4weeks). After 4weeks, the object recognition test (ORT) and the object location test (OLT) were performed. The results of this study demonstrated that caffeine suppressed exercise-enhanced long-term (ORT) and spatial (OLT) memory in middle-aged and this effect may be related to a decrease in hippocampal p-CREB signaling. This study also provided evidence that the effects of this protocol on memory were not accompanied by alterations in the levels of activated Akt. The [(3)H] glutamate uptake was reduced in hippocampus of rats administered with caffeine and submitted to swimming protocol.

  5. SOX2 Co-Occupies Distal Enhancer Elements with Distinct POU Factors in ESCs and NPCs to Specify Cell State

    PubMed Central

    Lodato, Michael A.; Cheng, Albert W.; Thai, Kevin K.; Fraenkel, Ernest; Jaenisch, Rudolf; Boyer, Laurie A.


    SOX2 is a master regulator of both pluripotent embryonic stem cells (ESCs) and multipotent neural progenitor cells (NPCs); however, we currently lack a detailed understanding of how SOX2 controls these distinct stem cell populations. Here we show by genome-wide analysis that, while SOX2 bound to a distinct set of gene promoters in ESCs and NPCs, the majority of regions coincided with unique distal enhancer elements, important cis-acting regulators of tissue-specific gene expression programs. Notably, SOX2 bound the same consensus DNA motif in both cell types, suggesting that additional factors contribute to target specificity. We found that, similar to its association with OCT4 (Pou5f1) in ESCs, the related POU family member BRN2 (Pou3f2) co-occupied a large set of putative distal enhancers with SOX2 in NPCs. Forced expression of BRN2 in ESCs led to functional recruitment of SOX2 to a subset of NPC-specific targets and to precocious differentiation toward a neural-like state. Further analysis of the bound sequences revealed differences in the distances of SOX and POU peaks in the two cell types and identified motifs for additional transcription factors. Together, these data suggest that SOX2 controls a larger network of genes than previously anticipated through binding of distal enhancers and that transitions in POU partner factors may control tissue-specific transcriptional programs. Our findings have important implications for understanding lineage specification and somatic cell reprogramming, where SOX2, OCT4, and BRN2 have been shown to be key factors. PMID:23437007

  6. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs.


    Glinsky, Gennadi V


    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals' genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  7. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.


    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  8. The developmental activation of the chicken lysozyme locus in transgenic mice requires the interaction of a subset of enhancer elements with the promoter.

    PubMed Central

    Huber, M C; Jägle, U; Krüger, G; Bonifer, C


    The complete chicken lysozyme locus is expressed in a position independent fashion in macrophages of transgenic mice and forms the identical chromatin structure as observed with the endogenous gene in chicken cells. Individual lysozyme cis -regulatory elements reorganize their chromatin structure at different developmental stages. Accordingly, their activities are developmentally regulated, indicating a differential role of these elements in locus activation. We have shown previously that a subset of enhancer elements and the promoter are sufficient to activate transcription of the chicken lysozyme gene at the correct developmental stage. Here, we analyzed to which grade the developmentally controlled chromatin reorganizing capacity of cis -regulatory elements in the 5'-region of the chicken lysozyme locus is dependent on promoter elements, and we examined whether the lysozyme locus carries a dominant chromatin reorganizing element. To this end we generated transgenic mouse lines carrying constructs with a deletion of the lysozyme promoter. Expression of the transgene in macrophages is abolished, however, the chromatin reorganizing ability of the cis -regulatory elements is differentially impaired. Some cis -elements require the interaction with the promoter to stabilize transcription factor complexes detectable as DNase I hypersensitive sites in chromatin, whereas other elements reorganize their chromatin structure autonomously. PMID:9224598

  9. Investigation of the effects of cell model and subcellular location of gold nanoparticles on nuclear dose enhancement factors using Monte Carlo simulation

    SciTech Connect

    Cai, Zhongli; Chattopadhyay, Niladri; Kwon, Yongkyu Luke; Pignol, Jean-Philippe; Lechtman, Eli; Reilly, Raymond M.


    Purpose: The authors’ aims were to model how various factors influence radiation dose enhancement by gold nanoparticles (AuNPs) and to propose a new modeling approach to the dose enhancement factor (DEF).Methods: The authors used Monte Carlo N-particle (MCNP 5) computer code to simulate photon and electron transport in cells. The authors modeled human breast cancer cells as a single cell, a monolayer, or a cluster of cells. Different numbers of 5, 30, or 50 nm AuNPs were placed in the extracellular space, on the cell surface, in the cytoplasm, or in the nucleus. Photon sources examined in the simulation included nine monoenergetic x-rays (10–100 keV), an x-ray beam (100 kVp), and {sup 125}I and {sup 103}Pd brachytherapy seeds. Both nuclear and cellular dose enhancement factors (NDEFs, CDEFs) were calculated. The ability of these metrics to predict the experimental DEF based on the clonogenic survival of MDA-MB-361 human breast cancer cells exposed to AuNPs and x-rays were compared.Results: NDEFs show a strong dependence on photon energies with peaks at 15, 30/40, and 90 keV. Cell model and subcellular location of AuNPs influence the peak position and value of NDEF. NDEFs decrease in the order of AuNPs in the nucleus, cytoplasm, cell membrane, and extracellular space. NDEFs also decrease in the order of AuNPs in a cell cluster, monolayer, and single cell if the photon energy is larger than 20 keV. NDEFs depend linearly on the number of AuNPs per cell. Similar trends were observed for CDEFs. NDEFs using the monolayer cell model were more predictive than either single cell or cluster cell models of the DEFs experimentally derived from the clonogenic survival of cells cultured as a monolayer. The amount of AuNPs required to double the prescribed dose in terms of mg Au/g tissue decreases as the size of AuNPs increases, especially when AuNPs are in the nucleus and the cytoplasm. For 40 keV x-rays and a cluster of cells, to double the prescribed x-ray dose (NDEF = 2

  10. Differential activation of the 21-base-pair enhancer element of human T-cell leukemia virus type I by its own trans-activator and cyclic AMP.

    PubMed Central

    Nakamura, M; Niki, M; Ohtani, K; Sugamura, K


    A transcriptional trans-acting factor p40tax of human T-cell leukemia virus type I (HTLV-I) functions as an inducer for expression of HTLV-I provirus via activation of the enhancer in the long terminal repeat of HTLV-I. In addition to p40tax and a tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA), an activator of protein kinase C, we report here that forskolin, an activator of adenyl cyclase, also induces function of the HTLV-I enhancer. Experiments with mutants of the HTLV-I enhancer revealed that TPA-induced activation was not mediated by solely a 21-base-pair (bp) sequence that is repeated three times in the enhancer, whereas the 21-bp enhancer element can act as a sufficient cis-acting sequence for activation by both p40tax and forskolin. In addition, we found that nuclear factor(s) like the cyclic AMP-responsive element (CRE) binding factor could bind to the HTLV-I 21-bp enhancer element. However, a difference was found in sequences required for activation by p40tax and forskolin. A CRE related sequence present in the 21-bp enhancer element was enough for forskolin-induced activation. On the other hand, p40tax required a much longer sequence that is overlapping but not identical to the CRE related sequence, suggesting that the forskolin-induced cyclic AMP pathway may be partly involved in, but not sufficient for p40tax-mediating trans-activation of the HTLV-I enhancer. Images PMID:2548156

  11. Elemental analysis by surface-enhanced Laser-Induced Breakdown Spectroscopy combined with liquid-liquid microextraction

    NASA Astrophysics Data System (ADS)

    Aguirre, M. A.; Legnaioli, S.; Almodóvar, F.; Hidalgo, M.; Palleschi, V.; Canals, A.


    In this work, the possibility of using Laser-Induced Breakdown Spectrometry (LIBS) combined with liquid-liquid microextraction techniques is evaluated as a simple and fast method for trace elemental analysis. Two different strategies for LIBS analysis of manganese contained in microdroplets of extraction solvent (Triton X-114) are studied: (i) analysis by direct laser irradiation of microdroplets; and (ii) analysis by laser irradiation of microdroplets dried on metallic substrates (surface-enhanced LIBS — SENLIBS). Experiments were carried out using synthetic samples with different concentrations of manganese in a 10% w/w Triton X-114 matrix. The analysis by direct laser irradiation of microdroplets showed low precision, sensitivity and poor linearity across the concentration range evaluated (R2 < 0.95). On the other hand, the SENLIBS method of analysis improved the sensitivity, the precision and the linearity of the calibration curve with respect to the direct analysis of microdroplets. In comparison with experimental results obtained by direct analysis, SENLIBS also allowed several replicate measurements to be carried out in a single microdroplet. The limit of detection obtained was 6 μg g- 1 of Mn.

  12. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    SciTech Connect

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li . E-mail:; Li Junfa . E-mail:


    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning.

  13. Rolling element bearing defect detection using the generalized synchrosqueezing transform guided by time-frequency ridge enhancement.


    Li, Chuan; Sanchez, Vinicio; Zurita, Grover; Cerrada Lozada, Mariela; Cabrera, Diego


    Healthy rolling element bearings are vital guarantees for safe operation of the rotating machinery. Time-frequency (TF) signal analysis is an effective tool to detect bearing defects under time-varying shaft speed condition. However, it is a challenging work dealing with defective characteristic frequency and rotation frequency simultaneously without a tachometer. For this reason, a technique using the generalized synchrosqueezing transform (GST) guided by enhanced TF ridge extraction is suggested to detect the existence of the bearing defects. The low frequency band and the resonance band are first chopped from the Fourier spectrum of the bearing vibration measurements. The TF information of the lower band component and the resonance band envelope are represented using short-time Fourier transform, where the TF ridge are extracted by harmonic summation search and ridge candidate fusion operations. The inverse of the extracted TF ridge is subsequently used to guide the GST mapping the chirped TF representation to the constant one. The rectified TF pictures are then synchrosqueezed as sharper spectra where the rotation frequency and the defective characteristic frequency can be identified, respectively. Both simulated and experimental signals were used to evaluate the present technique. The results validate the effectiveness of the suggested technique for the bearing defect detection.

  14. Analysis of the enhancer-blocking function of the TBS element from Petunia hybrida in transgenic Arabidopsis thaliana and Nicotiana tabacum.


    Singer, Stacy D; Hily, Jean-Michel; Cox, Kerik D


    Transcriptional enhancers possess the ability to override the tissue-specificity and efficiency of nearby promoters, which is of concern when generating transgenic constructs bearing multiple cassettes. One means of preventing these inappropriate interactions is through the use of enhancer-blocking insulators. The 2-kb transformation booster sequence (TBS) from Petunia hybrida has been shown previously to exhibit this function when inserted between an enhancer and promoter in transgenic Arabidopsis thaliana. In this study, we attempted to further characterize the ability of this fragment to impede enhancer-promoter interference through an analysis of transgenic Arabidopsis and Nicotiana tabacum lines bearing various permutations of the TBS element between the cauliflower mosaic virus (CaMV) 35S enhancer and an assortment of tissue-specific promoters fused to the β-glucuronidase (GUS) reporter gene. The full-length TBS fragment was found to function in both orientations, although to a significantly lesser degree in the reverse orientation, and was operational in both plant species tested. While multiple deletion fragments were found to exhibit activity, it appeared that several regions of the TBS were required for maximal enhancer-blocking function. Furthermore, we found that this element exhibited promoter-like activity, which has implications in terms of possible mechanisms behind its ability to impede enhancer-promoter communication in plants.

  15. Systematic analysis of enhancer and critical cis-acting RNA elements in the protein-encoding region of the hepatitis C virus genome.


    Chu, Derrick; Ren, Songyang; Hu, Stacy; Wang, Wei Gang; Subramanian, Aparna; Contreras, Deisy; Kanagavel, Vidhya; Chung, Eric; Ko, Justine; Amirtham Jacob Appadorai, Ranjit Singh; Sinha, Sanjeev; Jalali, Ziba; Hardy, David W; French, Samuel W; Arumugaswami, Vaithilingaraja


    Hepatitis C virus (HCV) causes chronic hepatitis, cirrhosis, and liver cancer. cis-acting RNA elements of the HCV genome are critical for translation initiation and replication of the viral genome. We hypothesized that the coding regions of nonstructural proteins harbor enhancer and essential cis-acting replication elements (CRE). In order to experimentally identify new cis RNA elements, we utilized an unbiased approach to introduce synonymous substitutions. The HCV genome coding for nonstructural proteins (nucleotide positions 3872 to 9097) was divided into 17 contiguous segments. The wobble nucleotide positions of each codon were replaced, resulting in 33% to 41% nucleotide changes. The HCV genome containing one of each of 17 mutant segments (S1 to S17) was tested for genome replication and infectivity. We observed that silent mutations in segment 13 (S13) (nucleotides [nt] 7457 to 7786), S14 (nt 7787 to 8113), S15 (nt 8114 to 8440), S16 (nt 8441 to 8767), and S17 (nt 8768 to 9097) resulted in impaired genome replication, suggesting CRE structures are enriched in the NS5B region. Subsequent high-resolution mutational analysis of NS5B (nt 7787 to 9289) using approximately 51-nucleotide contiguous subsegment mutant viruses having synonymous mutations revealed that subsegments SS8195-8245, SS8654-8704, and SS9011-9061 were required for efficient viral growth, suggesting that these regions act as enhancer elements. Covariant nucleotide substitution analysis of a stem-loop, JFH-SL9098, revealed the formation of an extended stem structure, which we designated JFH-SL9074. We have identified new enhancer RNA elements and an extended stem-loop in the NS5B coding region. Genetic modification of enhancer RNA elements can be utilized for designing attenuated HCV vaccine candidates.

  16. Pectobacterium atrosepticum and Pectobacterium carotovorum Harbor Distinct, Independently Acquired Integrative and Conjugative Elements Encoding Coronafacic Acid that Enhance Virulence on Potato Stems

    PubMed Central

    Panda, Preetinanda; Vanga, Bhanupratap R.; Lu, Ashley; Fiers, Mark; Fineran, Peter C.; Butler, Ruth; Armstrong, Karen; Ronson, Clive W.; Pitman, Andrew R.


    Integrative and conjugative elements (ICEs) play a central role in the evolution of bacterial virulence, their transmission between bacteria often leading to the acquisition of virulence factors that alter host range or aggressiveness. Much is known about the functions of the virulence determinants that ICEs harbor, but little is understood about the cryptic effects of ICEs on their host cell. In this study, the importance of horizontally acquired island 2 (HAI2), an ICE in the genome of Pectobacterium atrosepticum SCRI1043, was studied using a strain in which the entire ICE had been removed by CRISPR-Cas-mediated genome editing. HAI2 encodes coronafacic acid, a virulence factor that enhances blackleg disease of potato stems caused by P. atrosepticum SCRI1043. As expected, deletion of HAI2 resulted in reduced blackleg symptoms in potato stems. A subsequent screen for HAI2-related ICEs in other strains of the Pectobacterium genus revealed their ubiquitous nature in P. atrosepticum. Yet, HAI2-related ICEs were only detected in the genomes of a few P. carotovorum strains. These strains were notable as blackleg causing strains belonging to two different subspecies of P. carotovorum. Sequence analysis of the ICEs in different strains of both P. atrosepticum and P. carotovorum confirmed that they were diverse and were present in different locations on the genomes of their bacterial host, suggesting that the cfa cluster was probably acquired independently on a number of occasions via chromosomal insertion of related ICEs. Excision assays also demonstrated that the ICEs in both P. atrosepticum and P. carotovorum are mobilized from the host chromosome. Thus, the future spread of these ICEs via lateral gene transfer might contribute to an increase in the prevalence of blackleg-causing strains of P. carotovorum. PMID:27065965

  17. Ubiquitous element approach to plasmonic enhanced photocatalytic water splitting: the case of Ti@TiO2 core-shell nanostructure.


    Pihosh, Yuriy; Turkevych, Ivan; Mawatari, Kazuma; Fukuda, Nobuko; Ohta, Ryoichi; Tosa, Masahiro; Shimamura, Kiyoshi; Villora, Encarnacion G; Kitamori, Takehiko


    We demonstrate a new approach to plasmonic enhanced photocatalytic water splitting by developing a novel core-shell Ti@TiO2 brush nanostructure where an elongated Ti nanorod forms a plasmonic core that concentrates light inside of a nanotubular anodic TiO2 shell. Following the ubiquitous element approach aimed at providing an enhanced device functionality without the usage of noble or rare earth elements, we utilized only inexpensive Ti to create a complex Ti@TiO2 nanostructure with an enhanced UV and Vis photocatalytic activity that emerges from the interplay between the surface plasmon resonance in the Ti core, Vis light absorption in the Ti-rich oxide layer at the Ti/TiO2 interface and UV light absorption in the nanotubular TiO2 shell. PMID:25030613

  18. TECHNICAL NOTE: The formulation of a refined hybrid enhanced assumed strain solid shell element and its application to model smart structures containing distributed piezoelectric sensors/actuators

    NASA Astrophysics Data System (ADS)

    Zheng, Shijie; Wang, Xinwei; Chen, Wanji


    In the present paper, a novel refined hybrid piezoelectric element formulation is developed for mechanical analysis and active vibration control of laminated structures bonded to piezoelectric sensors and actuators. By invoking the electrical field potential equation, a 'quasi-decoupling' method for treating the coupling electromechanical effects is presented and a modified generalized variational principle with a weaker interelement continuity condition is proposed. On the basis of this functional, a general formulation for a refined hybrid piezoelectric element method is established by incorporating an orthogonal interpolation approach and enhanced assumed strain (EAS) modes. A linearly distributed transverse EAS in the thickness direction is adopted to overcome the thickness locking of solid shell elements. Compared with the conventional incompatible brick element approach, the present formulation is very reliable, more accurate, computationally efficient and can be used to model the response of thin plates and shell structures.

  19. Differential dimerization of variants linked to enhanced S-Cone Sensitivity Syndrome (ESCS) located in the NR2E3 ligand-binding domain

    PubMed Central

    von Alpen, Désirée; Tran, H. Viet; Guex, Nicolas; Venturini, Giulia; Munier, Francis L.; Schorderet, Daniel F.; Haider, Neena B.; Escher, Pascal


    NR2E3 encodes the photoreceptor-specific nuclear hormone receptor that acts as a repressor of cone-specific gene expression in rod photoreceptors, and as an activator of several rod-specific genes. Recessive variants located in the ligand-binding domain (LBD) of NR2E3 cause enhanced short wavelength sensitive- (S-) cone syndrome (ESCS), a retinal degeneration characterized by an excess of Scones and non-functional rods. We analyzed the dimerization properties of NR2E3 and the effect of disease-causing LBD missense variants by bioluminescence resonance energy transfer (BRET2) protein interaction assays. Homodimerization was not affected in presence of p.A256V, p.R039G, p.R311Q and p.R334G variants, but abolished in presence of p.L263P, p.L336P, p.L353V, p.R385P and p.M407K variants. Homology modeling predicted structural changes induced by NR2E3 LBD variants. NR2E3 LBD variants did not affect interaction with CRX, but with NRL and rev-erbα/NR1D1. CRX and NRL heterodimerized more efficiently together, than did either with NR2E3. NR2E3 did not heterodimerize with TLX/NR2E1 and RXRα/NR2C1. The identification of a new compound heterozygous patient with detectable rod function, who expressed solely the p.A256V variant protein, suggests a correlation between LBD variants able to form functional NR2E3 dimers and atypical mild forms of ESCS with residual rod function. PMID:25703721

  20. Negative regulation of expression of the pituitary-specific transcription factor GHF-1/Pit-1 by thyroid hormones through interference with promoter enhancer elements.

    PubMed Central

    Sanchez-Pacheco, A; Palomino, T; Aranda, A


    Expression of the growth hormone gene is due to the presence of the pituitary-specific transcription factor GHF-1/Pit-1. The action of the thyroid hormone T3 is mediated by nuclear receptors that regulate transcription by interaction with DNA elements located near promoters of the regulated genes. In this study, we show that T3 inhibits expression of the GHF-1/Pit-1 gene in rat pituitary GH4C1 cells by a novel mechanism that involves transcriptional interference with other regulatory elements of the promoter. Sequences between bp -90 and -200 of the rat GHF-1/Pit-1 gene which do not contain a hormone response element but contain two cyclic AMP-responsive elements mediate most of the repressive effect of T3. The hormone reduces basal levels of GHF-1/Pit-1 promoter activity and antagonizes its response to cyclic AMP and the tumor promoter TPA (12-O-tetradecanoylphorbol-13-acetate). A similar repression is found with a heterologous promoter that contains four copies of the cyclic AMP-responsive element motif. This regulation provides a novel example of the cross-talk between the thyroid hormone receptor and the signal transduction pathways used by different hormones and growth factors. Additionally, T3 interferes with in vitro binding of GHF-1/Pit-1 to a positive autoregulatory element located at bp -45 to -63 and has a detectable inhibitory effect on the activity of a promoter construct which extends to bp -90 of 5'-flanking DNA. The regulation of the transcription factor provides a novel example of negative transcriptional regulation by thyroid hormones. PMID:7565785

  1. FEM (finite element method) thermal modeling and thermal hydraulic performance of an enhanced thermal conductivity UO2/BeO composite fuel

    SciTech Connect

    Zhou, Wenzhong


    An enhanced thermal conductivity UO2-BeO composite nuclear fuel was studied. A methodology to generate ANSYS (an engineering simulation software) FEM (Finite Element Method) thermal models of enhanced thermal conductivity oxide nuclear fuels was developed. The results showed significant increase in the fuel thermal conductivities and have good agreement with the measured ones. The reactor performance analysis showed that the decrease in centerline temperature was 250-350K for the UO2-BeO composite fuel, and thus we can improve nuclear reactors' performance and safety, and high-level radioactive waste generation.

  2. Targeted Deletion of the Antisilencer/Enhancer (ASE) Element from Intron 1 of the Myelin Proteolipid Protein Gene (Plp1) in Mouse Reveals that the Element Is Dispensable for Plp1 Expression in Brain during Development and Remyelination

    PubMed Central

    Pereira, Glauber B.; Meng, Fanxue; Kockara, Neriman T.; Yang, Baoli; Wight, Patricia A.


    Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. While removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is nonfunctional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. PMID:23157328

  3. Effects of a low severity prescribed fire on water-soluble elements in ash from a cork oak (Quercus suber) forest located in the northeast of the Iberian Peninsula

    USGS Publications Warehouse

    Pereira, P.; beda, X.; Martin, D.; Mataix-Solera, J.; Guerrero, C.


    Wildfire is the major disturbance in Mediterranean forests. Prescribed fire can be an alternative to reduce the amount of fuel and hence decrease the wildfire risk. However the effects of prescribed fire must be studied, especially on ash properties, because ash is an important nutrient source for ecosystem recovery. The aim of this study is to determine the effects of a low severity prescribed fire on water-soluble elements in ash including pH, electrical conductivity (EC), calcium (Ca), magnesium (Mg), sodium (Na), potassium (K), aluminum (Al), manganese (Mn), iron (Fe), zinc (Zn), silica (SiO2) and total sulphur (TS). A prescribed fire was conducted in a cork oak (Quercus suber) (Q.S) forest located in the northeast part of the Iberian Peninsula. Samples were collected from a flat plot of 40??70m mainly composed of Q.S and Quercus robur (Q.R) trees. In order to understand the effects of the prescribed fire on the soluble elements in ash, we conducted our data analysis on three data groups: all samples, only Q.S samples and only Q.R samples. All three sample groups exhibited a significant increase in pH, EC (p<0.001), water-soluble Ca, Mg, Na, SiO2 and TS and a decrease in water-soluble Mn, Fe and Zn. Differences were identified between oak species for water-soluble K, Al and Fe. In Q.S samples we registered a significant increase in the first two elements p<0.001 and p<0.01, respectively, and a non-significant impact in the third, at p<0.05. In Q.R data we identified a non-significant impact on water-soluble K and Al and a significant decrease in water-soluble Fe (p<0.05). These differences are probably due to vegetation characteristics and burn severity. The fire induced a higher variability in the ash soluble elements, especially in Q.S samples, that at some points burned with higher severity. The increase of pH, EC, Ca, Mg, Na and K will improve soil fertility, mainly in the study area where soils are acidic. The application of this low severity prescribed

  4. Effects of a low severity prescribed fire on water-soluble elements in ash from a cork oak (Quercus suber) forest located in the northeast of the Iberian Peninsula.


    Pereira, Paulo; Ubeda, Xavier; Martin, Deborah; Mataix-Solera, Jorge; Guerrero, César


    Wildfire is the major disturbance in Mediterranean forests. Prescribed fire can be an alternative to reduce the amount of fuel and hence decrease the wildfire risk. However the effects of prescribed fire must be studied, especially on ash properties, because ash is an important nutrient source for ecosystem recovery. The aim of this study is to determine the effects of a low severity prescribed fire on water-soluble elements in ash including pH, electrical conductivity (EC), calcium (Ca), magnesium (Mg), sodium (Na), potassium (K), aluminum (Al), manganese (Mn), iron (Fe), zinc (Zn), silica (SiO(2)) and total sulphur (TS). A prescribed fire was conducted in a cork oak (Quercus suber) (Q.S) forest located in the northeast part of the Iberian Peninsula. Samples were collected from a flat plot of 40×70m mainly composed of Q.S and Quercus robur (Q.R) trees. In order to understand the effects of the prescribed fire on the soluble elements in ash, we conducted our data analysis on three data groups: all samples, only Q.S samples and only Q.R samples. All three sample groups exhibited a significant increase in pH, EC (p<0.001), water-soluble Ca, Mg, Na, SiO(2) and TS and a decrease in water-soluble Mn, Fe and Zn. Differences were identified between oak species for water-soluble K, Al and Fe. In Q.S samples we registered a significant increase in the first two elements p<0.001 and p<0.01, respectively, and a non-significant impact in the third, at p<0.05. In Q.R data we identified a non-significant impact on water-soluble K and Al and a significant decrease in water-soluble Fe (p<0.05). These differences are probably due to vegetation characteristics and burn severity. The fire induced a higher variability in the ash soluble elements, especially in Q.S samples, that at some points burned with higher severity. The increase of pH, EC, Ca, Mg, Na and K will improve soil fertility, mainly in the study area where soils are acidic. The application of this low severity

  5. Enhancement of the excitation efficiency of a torsional wave PPM EMAT array for pipe inspection by optimizing the element number of the array based on 3-D FEM.


    Wang, Yugang; Wu, Xinjun; Sun, Pengfei; Li, Jian


    Electromagnetic acoustic transducers (EMATs) can generate non-dispersive T(0,1) mode guided waves in a metallic pipe for nondestructive testing (NDT) by using a periodic permanent magnet (PPM) EMAT circular array. In order to enhance the excitation efficiency of the sensor, the effects of varying the number of elements of the array on the excitation efficiency is studied in this paper. The transduction process of the PPM EMAT array is studied based on 3-D finite element method (FEM). The passing signal amplitude of the torsional wave is obtained to represent the excitation efficiency of the sensor. Models with different numbers of elements are established and the results are compared to obtain an optimal element number. The simulation result is verified by experiments. It is shown that after optimization, the amplitudes of both the passing signal and defect signal with the optimal element number are increased by 29%, which verifies the feasibility of this optimal method. The essence of the optimization is to find the best match between the static magnetic field and the eddy current field in a limited circumferential space to obtain the maximum circumferential Lorentz force.

  6. Evaluation of Dietary Supplement Contamination by Xenobiotic and Essential Elements Using Microwave-Enhanced Sample Digestion and Inductively Coupled Plasma-Mass Spectrometry.


    Zinn, Gregory M; Rahman, G M Mizanur; Faber, Scott; Wolle, Mesay Mulugeta; Pamuku, Matt; Kingston, H M Skip


    Dietary supplements were analyzed by evaluating the elemental content in six widely consumed products manufactured by four well-known companies. The elements included the neurotoxic and carcinogenic elements cadmium, mercury, aluminum, lead, arsenic, and antimony, as well as the essential elements zinc, selenium, chromium, iron, and copper, which were often not listed as ingredients on the product labels. Contamination from either xenobiotic or essential elements was found in all samples analyzed. The samples were prepared using US Environmental Protection Agency (EPA) Method 3052, microwave-enhanced digestion. The resulting digests were analyzed by Inductively Coupled Plasma-Mass Spectrometry based on EPA Method 6020B. The analytical protocols were validated by analyzing a multivitamin standard reference material, the National Institute of Standards and Technology Standard Reference Material 3280. The application of EPA standard methods demonstrated their utility in making accurate and precise measurements in complex matrices with multiple ingredients and excipients. In the future, the use of these methods could provide a uniform quality assurance protocol that can be implemented along with other industry guidelines to improve the production of dietary supplements.

  7. Enhancement of the Excitation Efficiency of a Torsional Wave PPM EMAT Array for Pipe Inspection by Optimizing the Element Number of the Array Based on 3-D FEM

    PubMed Central

    Wang, Yugang; Wu, Xinjun; Sun, Pengfei; Li, Jian


    Electromagnetic acoustic transducers (EMATs) can generate non-dispersive T(0,1) mode guided waves in a metallic pipe for nondestructive testing (NDT) by using a periodic permanent magnet (PPM) EMAT circular array. In order to enhance the excitation efficiency of the sensor, the effects of varying the number of elements of the array on the excitation efficiency is studied in this paper. The transduction process of the PPM EMAT array is studied based on 3-D finite element method (FEM). The passing signal amplitude of the torsional wave is obtained to represent the excitation efficiency of the sensor. Models with different numbers of elements are established and the results are compared to obtain an optimal element number. The simulation result is verified by experiments. It is shown that after optimization, the amplitudes of both the passing signal and defect signal with the optimal element number are increased by 29%, which verifies the feasibility of this optimal method. The essence of the optimization is to find the best match between the static magnetic field and the eddy current field in a limited circumferential space to obtain the maximum circumferential Lorentz force. PMID:25654722

  8. Enhancer/Suppressor mutator (En/Spm)-like transposable elements of cassava (Manihot esculenta) are transcriptionally inactive.


    Gbadegesin, M A; Beeching, J R


    Transposable elements contribute to the size, structure, variation, and diversity of the genome and have major effects on gene function. Sequencing projects have revealed the diversity of transposable elements in many organisms and have shown that they constitute a high percentage of the genome. PCR-based techniques using degenerate primers designed from conserved enzyme domains of transposable elements can provide quick and extensive surveys, making study of diversity and abundance and their applications possible in species where full genome sequence data are not yet available. We studied cassava (Manihot esculenta) En/Spm-like transposons (Meens) with regard to genomic distribution, sequence diversity and methylation status. Cassava transposase fragments characteristic of En/Spm-like transposons were isolated, cloned and characterized. Sequence analysis showed that cassava En/Spm-like elements are highly conserved, with overall identity in the range of 68-98%. Southern hybridization supports the presence of multiple copies of En/Spm-like transposons integrated in the genome of all cassava cultivars that we tested. Hybridization patterns of HpaII- and MspI-digested cassava genomic DNA revealed highly methylated sequences. There were no clear differences in hybridization pattern between the cultivars. We did not detect RNA transcripts of Meens by Northern procedures. We examined the possibility of recent transposition activities of the cassava En/Spm-like elements.

  9. Design and technical evaluation of an enhanced location-awareness service enabler for spatial disorientation management of elderly with mild cognitive impairment.


    Moreno, Pedro A; Hernando, M Elena; Gómez, Enrique J


    The progressive ageing of population has turned the mild cognitive impairment (MCI) into a prevalent disease suffered by elderly. Consequently, the spatial disorientation has become a significant problem for older people and their caregivers. The ambient-assisted living applications are offering location-based services for empowering elderly to go outside and encouraging a greater independence. Therefore, this paper describes the design and technical evaluation of a location-awareness service enabler aimed at supporting and managing probable wandering situations of a person with MCI. Through the presence capabilities of the IP multimedia subsystem (IMS) architecture, the service will alert patient's contacts if a hazardous situation is detected depending on his location. Furthermore, information about the older person's security areas has been included in the user profile managed by IMS. In doing so, the service enabler introduced contribute to "context-awareness" paradigm allowing the adaptation and personalization of services depending on user's context and specific conditions or preferences.

  10. An octopine synthase enhancer element directs tissue-specific expression and binds ASF-1, a factor from tobacco nuclear extracts.

    PubMed Central

    Fromm, H; Katagiri, F; Chua, N H


    We have investigated the expression pattern conferred by a cis-regulatory element (-212 to -154) from the upstream region of the octopine synthase (ocs) gene in transgenic tobacco plants. Analysis of beta-glucuronidase expression driven by the ocs regulatory element revealed a pattern that is tissue-specific and developmentally regulated. In young seedlings, expression is confined primarily to root tips. In older seedlings, expression is stronger and becomes apparent also in the shoot apex. Insertion of a 16-base pair palindromic sequence (-193 to -178), which is included in the regulatory element, into an rbcS promoter results in the expression of rbcS in roots. The 16-base pair palindrome binds activation sequence factor (ASF)-1, a factor from tobacco nuclear extracts that interacts with the sequence between -83 to -63, designated as activation sequence (as)-1, of the cauliflower mosaic virus 35S promoter [Lam et al. (1989). Proc. Natl. Acad. Sci. USA 86, in press]. The in vivo expression patterns and in vitro binding properties of the ocs palindromic sequence are remarkably similar to those of the as-1 element of the cauliflower mosaic virus 35S promoter. These results suggest the involvement of ASF-1 in the transcriptional regulation of the ocs promoter and the 35S promoter. PMID:2562557

  11. Sensor systems for precise location of depleted uranium in soil and for enhancing the recovery of both zero valence and uranium oxides

    SciTech Connect

    Etheridge, J.A.; Monts, D.L.; Su, Y.; Waggoner, C.A.


    Depleted uranium (DU) has been the primary material used for the past two decades by the US military in armor piercing rounds. Domestic firing ranges that have been used for DU training purposes are located around the country and vary with regard to soil type, depth of vadose zone, and extent of contamination with other types of projectiles. A project is underway to develop a set of sensor systems to locate expended DU rounds and to process soil and debris to recover the material. Reactivity of zero valence DU material, even in dry sandy soils, results in rapid oxidation and diffusion of uranium minerals within the soil column. Detection techniques must be robust for both metallic and uranyl species. Radiological sensor techniques including both gamma spectroscopy and prompt gamma neutron analysis are being used in conjunction with electromagnetic imaging to locate the DU for excavation. Detection limits for both zero valence DU (ZVDU) and oxidized material will be discussed. Applicability of active and passive optical methods, such as spectral imaging and fluorescence spectroscopy, will be discussed as aids for achieving clean soil margins while excavating DU materials. Instrumentation selection for controlling processing equipment used to separate ZVDU and uranyl species from contaminated soil and debris will also be discussed. Preliminary findings for use of sodium iodide detectors and multichannel analyzer software are discussed for locating 25 and 105 mm DU penetrators. Optimum detector height of 15 cm (six inches) and detection depths up to 15 cm are discussed. A comparison of detector response of the Geonics EM61 MKII electromagnetic induction unit for DU and ferrous materials is reported. Difficulty of locating small DU penetrators using the one meter detection coil and differences in detector response for target orientation relative to the detection coil are reported. (authors)


    SciTech Connect

    Lee, Hyun-chul; Worthey, Guy; Blakeslee, John P.


    We investigate the effects of alpha-element enhancement and the thermally pulsing-asymptotic giant branch (TP-AGB) stars on the surface brightness fluctuation (SBF) magnitudes and broadband colors of simple stellar populations and compare to the empirical calibrations. We consider a broad range of ages and metallicities using the recently updated Teramo BaSTI isochrones. We find that the alpha-element-enhanced I-band SBF magnitudes are about 0.35 mag brighter and their integrated V - I colors are about 0.02 mag redder, mostly because of oxygen-enhancement effects on the upper red giant branch and AGB. We also demonstrate, using both the Teramo BaSTI and Padova isochrones, the acute sensitivity of SBF magnitudes to the presence of TP-AGB stars, particularly in the near-IR, but in the I band as well. Empirical SBF trends therefore hold great promise for constraining this important but still highly uncertain stage of stellar evolution. In a similar vein, non-negligible disparities are found among several different models available in the literature due to intrinsic model uncertainties.

  13. Lymphoid-specific transcriptional activation by components of the IgH enhancer: studies on the E2/E3 and octanucleotide elements.

    PubMed Central

    Cook, G P; Neuberger, M S


    The IgH enhancer is a strong lymphoid-specific activator and is composed of multiple factor-binding motifs. One of these, the octamer, is common to enhancer and promoter, binds ubiquitous and lymphoid-specific factors and is able to act as a lymphoid-specific transcriptional activator. However, it is also found as an essential component of promoters active in non-lymphoid cells. From analysis of the activities of synthetic promoters, we suggest that recruitment of the lymphoid-specific octamer-binding protein next to the TATA is sufficient to create a functional lymphoid-specific promoter whereas the ubiquitous octamer binding protein is not active in single copy but can act in concert with other promoter binding factors. However, the activity of the IgH enhancer is not dependent on the octamer and we identify the E2/E3 elements as also being sufficient to confer lymphoid-specificity on a linked gene. Activity of the E2/E3 region results from the synergistic activity of the two motifs, E2 alone being able to confer a low level of activity which is dramatically increased by the adjacent E3. Thus, in the case of both the E2/E3 and the octamer motifs, interactions between adjacent elements can play a critical role in determining the tissue specificity of activity. Images PMID:2114013

  14. Mutational analysis of a Dcp2-binding element reveals general enhancement of decapping by 5′-end stem-loop structures

    PubMed Central

    Li, You; Ho, Eric S.; Gunderson, Samuel I.; Kiledjian, Megerditch


    mRNA decapping is a critical step in the control of mRNA stability and gene expression and is carried out by the Dcp2 protein. Dcp2 is an RNA-binding protein that must bind the RNA in order to recognize the cap for hydrolysis. We previously demonstrated that a 60 nucleotide (nt) element at the 5′ end of the mRNA encoding Rrp41 is preferentially bound and decapped by Dcp2. Here, we demonstrate that enhanced decapping of this element is dependent on the structural integrity of its first 33 nt and not its primary sequence. The structure consists of a stem-loop positioned <10 nt from the 5′ end of the mRNA. The generality of a stem-loop structure in enhanced Dcp2-mediated decapping was underscored by the identification of additional potential Dcp2 substrate mRNAs by a global analysis of human mRNAs containing a similar predicted stem-loop structure at their respective 5′ end. These studies suggest a general role for 5′ stem-loops in enhancing decapping activity and the utilization of this structure as a predictive tool for Dcp2 target substrates. These studies also demonstrate that Dcp2 alone in the absence of additional proteins can preferentially associate with and modulate mRNA decapping. PMID:19233875

  15. P Element Regulatory Products Enhance Zeste(1) Repression of a P[white(duplicated)] Transgene in Drosophila Melanogaster

    PubMed Central

    Coen, D.


    Drosophila P element mobilization is subject to a complex array of regulatory mechanisms. A fruitful approach to study them is the use of insertion mutations whose expression is influenced by P regulation. In the present report, it is shown that P element somatic products may influence the expression of an unrelated gene inserted in a P transposon. The P[w(d1)9.3]19DE transgene carries an in vitro modified white gene harboring a duplication of the 5' regulatory sequences. Expression of this transgene is repressed in a P background. No maternal effect is detected and repression can be relieved as soon as P chromosomes are replaced by M ones. The amplitude of repression is correlated to the P transposase activity of the individuals examined. Repression appears to be exerted by somatic products of complete autonomous P elements or of in vitro modified P elements lacking the capacity to express the fourth P exon. The P repression of P[w(d1)9.3]19DE is strongly dependent on the insertion site of this transgene. This P repression effect occurs only in the presence of the zeste(1) allele and is suppressed by Su(z)2 mutations. No qualitative differences of transcription pattern are observed between white(+) and P[w(d1)9.3]19DE in any backgrounds. P repression acts to reduce the amount of the major white transcript. This suggests that P regulatory products may act through cis-interactions at a distance of over 3 kb. PMID:1963871

  16. Gata4 expression in lateral mesoderm is downstream of BMP4 and isactivated directly by Forkhead and GATA transcription factors through adistal enhancer element

    SciTech Connect

    Rojas, Anabel; De Val, Sarah; Heidt, Analeah B.; Xu, Shan-Mei; Bristow, James; Black, Brian L.


    The GATA family of zinc-finger transcription factors plays key roles in the specification and differentiation of multiple cell types during development. GATA4 is an early regulator of gene expression during the development of endoderm and mesoderm, and genetic studies in mice have demonstrated that GATA4 is required for embryonic development.Despite the importance of GATA4 in tissue specification and differentiation, the mechanisms by which Gata4 expression is activated and the transcription factor pathways upstream of GATA4 remain largely undefined. To identify transcriptional regulators of Gata4 in the mouse,we screened conserved noncoding sequences from the mouse Gata4 gene for enhancer activity in transgenic embryos. Here, we define the regulation of a distal enhancer element from Gata4 that is sufficient to direct expression throughout the lateral mesoderm, beginning at 7.5 days of mouse embryonic development. The activity of this enhancer is initially broad but eventually becomes restricted to the mesenchyme surrounding the liver. We demonstrate that the function of this enhancer in transgenic embryos is dependent upon highly conserved Forkhead and GATA transcription factor binding sites, which are bound by FOXF1 and GATA4,respectively. Furthermore, the activity of the Gata4 lateral mesoderm enhancer is attenuated by the BMP antagonist Noggin, and the enhancer is not activated in Bmp4-null embryos. Thus, these studies establish that Gata4 is a direct transcriptional target of Forkhead and GATA transcription factors in the lateral mesoderm, and demonstrate that Gata4lateral mesoderm enhancer activation requires BMP4, supporting a model in which GATA4 serves as a downstream effector of BMP signaling in the lateral mesoderm.

  17. FORTRAN codes to implement enhanced local wave number technique to determine the depth and location and shape of the causative source using magnetic anomaly

    NASA Astrophysics Data System (ADS)

    Agarwal, B. N. P.; Srivastava, Shalivahan


    The total field magnetic anomaly is analyzed to compute the depth and location and geometry of the causative source using two FORTRAN source codes, viz., FRCON1D and ELW. No assumption on the nature of source geometry, susceptibility contrast, etc. has been made. The source geometry is estimated by computing the structural index from previously determined depth and location. A detailed procedure is outlined for using these codes through a theoretical anomaly. The suppression of high-frequency noise in the observed data is tackled by designing a box-car window with cosine termination. The termination criterion is based on the peak position of the derivative operator computed for a pre-assumed depth of a shallow source below which the target is situated. The applicability of these codes has been demonstrated by analyzing a total field aeromagnetic anomaly of the Matheson area of northern Ontario, Canada.

  18. Identification of QTLs that enhance the nutritional value of rice grain and limit accumulation of undesirable elements such as arsenic

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research into the mineral contents of cereal grains and vegetables is motivated by interest in improving their nutritional value. Biofortification refers to natural enhancement of grain/food products through traditional breeding. Since this approach does not require genetic engineering, it is acce...

  19. Simulation of the enhancement factor from an individual 3D hemisphere-on-post field emitter by using finite elements method.


    Roveri, D S; Sant'Anna, G M; Bertan, H H; Mologni, J F; Alves, M A R; Braga, E S


    This paper presents a 3D computational framework for evaluating electrostatic properties of a single field emitter characterized by the hemisphere-on-post geometry. Numerical simulations employed the finite elements method by using Ansys-Maxwell software. Extensive parametric simulations were focused on the threshold distance from which the emitter field enhancement factor (γ) becomes independent from the anode-substrate gap (G). This investigation allowed demonstrating that the ratio between G and the emitter height (h) is a reliable reference for a broad range of emitter dimensions; furthermore, results permitted establishing G/h ≥ 2.2 as the threshold condition for setting the anode without affecting γ.

  20. Plasmon Mapping in Metallic Nanostructures and its Application to Single Molecule Surface Enhanced Raman Scattering: Imaging Electromagnetic Hot-Spots and Analyte Location

    SciTech Connect

    Camden, Jon P


    A major component of this proposal is to elucidate the connection between optical and electron excitation of plasmon modes in metallic nanostructures. These accomplishments are reported: developed a routine protocol for obtaining spatially resolved, low energy EELS spectra, and resonance Rayleigh scattering spectra from the same nanostructures.; correlated optical scattering spectra and plasmon maps obtained using STEM/EELS.; and imaged electromagnetic hot spots responsible for single-molecule surface-enhanced Raman scattering (SMSERS).

  1. Organic complexant-enhanced mobility of toxic elements in low-level wastes. Quarterly progress report, January-March 1984

    SciTech Connect

    Swanson, J.L.


    The results obtained during the third quarter's activities of a project whose objective is to determine how and to what extent organic complexants affect the mobility of toxic elements in subsurface groundwaters at commercial low-level waste disposal sites are described. This project will study nonradioactive toxic elements as well as elements having radioactive isotopes of importance (e.g. /sup 63/Ni, /sup 239/Pu, /sup 241/Am). Organic complexants used in the nuclear industry are being emphasized, but others are being examined. Generic soil components (e.g. hydrous oxides, silica, clays) are being used so that the results will be broadly applicable. Substantiation of the previously indicated sorption of a Pu(IV)-EDTA complex by hydrous ferric oxide (Fe/sub 2/O/sub 3/.xH/sub 2/O) was obtained by comparing the sorption of EDTA in the presence and absence of Pu. Additional data on the sorption of a Ni-EDTA complex by Fe/sub 2/O/sub 3/.xH/sub 2/O were also obtained. Preliminary Ni sorption data were obtained with other complexants (picolinic acid and citric acid), and another generic soil component (TiO/sub 2/). Sorption of a Ni-EDTA complex by an anion exchange resin was observed. Complexed species are thus likely to be present in the resin wastes from certain reactor decontamination solution clean-up operations. An experimental problem that caused some erroneous results for uncomplexed Ni was discovered and corrected. The filters being used to assure good separation of solid and liquid phases were removing Ni from solution, which skewed some earlier results. 11 references, 13 figures, 2 tables.

  2. Tandemly Integrated HPV16 Can Form a Brd4-Dependent Super-Enhancer-Like Element That Drives Transcription of Viral Oncogenes

    PubMed Central

    Dooley, Katharine E.; Warburton, Alix


    ABSTRACT In cancer cells associated with human papillomavirus (HPV) infections, the viral genome is very often found integrated into the cellular genome. The viral oncogenes E6 and E7 are transcribed from the viral promoter, and integration events that alter transcriptional regulation of this promoter contribute to carcinogenic progression. In this study, we detected highly enriched binding of the super-enhancer markers Brd4, MED1, and H3K27ac, visible as a prominent nuclear focus by immunofluorescence, at the tandemly integrated copies of HPV16 in cells of the cervical neoplasia cell line W12 subclone 20861. Tumor cells are often addicted to super-enhancer-driven oncogenes and are particularly sensitive to disruption of transcription factor binding to the enhancers. Treatment of 20861 cells with bromodomain inhibitors displaced Brd4 from the HPV integration site, greatly decreased E6/E7 transcription, and inhibited cellular proliferation. Thus, Brd4 activates viral transcription at this integration site, and strong selection for E6/E7 expression can drive the formation of a super-enhancer-like element to promote oncogenesis. PMID:27624132

  3. Requirement of multiple cis-acting elements in the human cytomegalovirus major immediate-early distal enhancer for viral gene expression and replication.


    Meier, Jeffery L; Keller, Michael J; McCoy, James J


    We have shown previously that the human cytomegalovirus (HCMV) major immediate-early (MIE) distal enhancer is needed for MIE promoter-dependent transcription and viral replication at low multiplicities of infection (MOI). To understand how this region works, we constructed and analyzed a series of HCMVs with various distal enhancer mutations. We show that the distal enhancer is composed of at least two parts that function independently to coordinately activate MIE promoter-dependent transcription and viral replication. One such part is contained in a 47-bp segment that has consensus binding sites for CREB/ATF, SP1, and YY1. At low MOI, these working parts likely function in cis to directly activate MIE gene expression, thus allowing viral replication to ensue. Three findings support the view that these working parts are likely cis-acting elements. (i) Deletion of either part of a bisegmented distal enhancer only slightly alters MIE gene transcription and viral replication. (ii) Reversing the distal enhancer's orientation largely preserves MIE gene transcription and viral replication. (iii) Placement of stop codons at -300 or -345 in all reading frames does not impair MIE gene transcription and viral replication. Lastly, we show that these working parts are dispensable at high MOI, partly because of compensatory stimulation of MIE promoter activity and viral replication that is induced by a virion-associated component(s) present at a high viral particle/cell ratio. We conclude that the distal enhancer is a complex multicomponent cis-acting region that is required to augment both MIE promoter-dependent transcription and HCMV replication.

  4. Essential telemedicine elements (tele-ments) for connecting the academic health center and remote community providers to enhance patient care.


    Meyer, Brett C; Clarke, Christopher A; Troke, Tana M; Friedman, Lawrence S


    The authors draw on their experience with the University of California, San Diego Medical Center's successful enterprise-level clinical telemedicine program to present a paradigm for other academic health centers (AHCs) that wish to develop such a program. They detail key telemedicine program elements, or "tele-ments," that they consider essential to the development of a centralized, structured telemedicine program and relevant to the development of smaller programs. These tele-ments include an overall organizational vision, a centralized telemedicine infrastructure, telemedicine-specific policies and procedures, medical record documentation, relationships between the AHC clinical hub and its remote (spoke) partners, identification of and training for specialty providers, a business plan based on service agreements and/or insurance billing, and licensure/privileging. They discuss the importance of delaying equipment purchases until a plan is in place for sustaining the telemedicine enterprise and of establishing measures to define success at the outset of program development. In addition, they detail the benefits and concerns associated with telemedicine, provide a comprehensive listing of the roles and responsibilities of providers and staff involved in all aspects of telemedicine, and share samples of their program's informed consent forms and workflow checklists. Their goal is to offer support and guidance to other AHCs entering the telemedicine arena, enabling them to replicate key elements of a successful, enterprise-wide telemedicine infrastructure. PMID:22722348

  5. Enhancing the Contrast of ApoB to Locate the Surface Components in the 3D Density Map of Human LDL

    PubMed Central

    Liu, Yuhang; Atkinson, David


    A 26Å resolution map of the structure of human LDL was obtained from cryo-EM and single particle image reconstruction. The structure showed a discoidal shaped LDL particle with high-density regions mainly distributed at the edge of the particle and low-density regions at the flat surface that covers the core region. To determine the chemical components that correspond to these density regions and to delineate the distribution of protein and phospholipid located at the particle surface at the resolution of the map, we used Mono-Sulfo-NHS-Undecagold labeling to increase preferentially the contrast of the apoB protein component on the LDL particle. In the 3D maps from the image reconstruction of the undecagold labeled LDL particles, the high-density region from the undecagold label was distributed mainly at the edge of the particle and lower density regions were found at the flat surfaces that cover the neutral lipid core. This suggests that apoB mainly encircles LDL at the edge of the particle and the phospholipid monolayers are located at the flat surfaces, which are parallel to the cholesterol ester layers in the core and may interact with the core lipid layers through the acyl-chains. PMID:21029740

  6. The mitochondrion-located protein OsB12D1 enhances flooding tolerance during seed germination and early seedling growth in rice.


    He, Dongli; Zhang, Hui; Yang, Pingfang


    B12D belongs to a function unknown subgroup of the Balem (Barley aleurone and embryo) proteins. In our previous work on rice seed germination, we identified a B12D-like protein encoded by LOC_Os7g41350 (named OsB12D1). OsB12D1 pertains to an ancient protein family with an amino acid sequence highly conserved from moss to angiosperms. Among the six OsB12Ds, OsB12D1 is one of the major transcripts and is primarily expressed in germinating seed and root. Bioinformatics analyses indicated that OsB12D1 is an anoxic or submergence resistance-related gene. RT-PCR results showed OsB12D1 is induced remarkably in the coleoptiles or roots by flooding during seed germination and early seedling growth. The OsB12D1-overexpressed rice seeds could protrude radicles in 8 cm deep water, further exhibiting significant flooding tolerance compared to the wild type. Moreover, this tolerance was not affected by the gibberellin biosynthesis inhibitor paclobutrazol. OsB12D1 was identified in the mitochondrion by subcellular localization analysis and possibly enhances electron transport through mediating Fe and oxygen availability under flooded conditions. This work indicated that OsB12D1 is a promising gene that can help to enhance rice seedling establishment in farming practices, especially for direct seeding.

  7. Enhanced photocatalytic oxidation of gaseous elemental mercury by TiO2 in a high temperature environment.


    Shen, Huazhen; Ie, Iau-Ren; Yuan, Chung-Shin; Hung, Chung-Hsuang; Chen, Wei-Hsiang; Luo, Jinjing; Jen, Yi-Hsiu


    The photo-oxidation of Hg(0) in a lab-scale reactor by titanium dioxide (TiO2) coated on the surface of glass beads was investigated at high temperatures. TiO2 was calcinated at four different temperatures of 300 °C, 400 °C, 500 °C and 600 °C (noted as Ti300, Ti400, Ti500 and Ti600) and characterized for its physicochemical properties. The calcinated TiO2 coating on the glass beads was then tested to compare the photo-oxidation efficiencies of Hg(0) with an incident light of 365 nm. The results showed that the oxidation efficiencies of Hg(0) for Ti400 and Ti500 were higher than those of Ti300 and Ti600. To enhance the photo-oxidation efficiency of Hg(0), Ti400 was selected to examine the wave lengths (λ) of 254 nm, 365 nm and visible light with various influent Hg(0) concentrations. The effects of irradiation strength and the presence of oxygen on the photo-oxidation efficiency of Hg(0) were further investigated, respectively. This study revealed that the wave length (λ) of 254 nm could promote the photo-oxidation efficiency of Hg(0) at 140 and 160 °C, while increasing the influent Hg(0) concentration and could enhance the photo-oxidation rate of Hg(0). However, the influence of 5% O2 present in the flue gas for the enhancement of Hg(0) oxidation was limited. Moreover, the intensity of the incident wave length of 365 nm and visible light were demonstrated to boost the photo-oxidation efficiency of Hg(0) effectively.

  8. Enhanced photocatalytic oxidation of gaseous elemental mercury by TiO2 in a high temperature environment.


    Shen, Huazhen; Ie, Iau-Ren; Yuan, Chung-Shin; Hung, Chung-Hsuang; Chen, Wei-Hsiang; Luo, Jinjing; Jen, Yi-Hsiu


    The photo-oxidation of Hg(0) in a lab-scale reactor by titanium dioxide (TiO2) coated on the surface of glass beads was investigated at high temperatures. TiO2 was calcinated at four different temperatures of 300 °C, 400 °C, 500 °C and 600 °C (noted as Ti300, Ti400, Ti500 and Ti600) and characterized for its physicochemical properties. The calcinated TiO2 coating on the glass beads was then tested to compare the photo-oxidation efficiencies of Hg(0) with an incident light of 365 nm. The results showed that the oxidation efficiencies of Hg(0) for Ti400 and Ti500 were higher than those of Ti300 and Ti600. To enhance the photo-oxidation efficiency of Hg(0), Ti400 was selected to examine the wave lengths (λ) of 254 nm, 365 nm and visible light with various influent Hg(0) concentrations. The effects of irradiation strength and the presence of oxygen on the photo-oxidation efficiency of Hg(0) were further investigated, respectively. This study revealed that the wave length (λ) of 254 nm could promote the photo-oxidation efficiency of Hg(0) at 140 and 160 °C, while increasing the influent Hg(0) concentration and could enhance the photo-oxidation rate of Hg(0). However, the influence of 5% O2 present in the flue gas for the enhancement of Hg(0) oxidation was limited. Moreover, the intensity of the incident wave length of 365 nm and visible light were demonstrated to boost the photo-oxidation efficiency of Hg(0) effectively. PMID:25733397

  9. Robust optimization of well location to enhance hysteretical trapping of CO2: Assessment of various uncertainty quantification methods and utilization of mixed response surface surrogates

    NASA Astrophysics Data System (ADS)

    Babaei, Masoud; Pan, Indranil; Alkhatib, Ali


    The paper aims to solve a robust optimization problem (optimization in presence of uncertainty) for finding the optimal locations of a number of CO2 injection wells for geological sequestration of carbon dioxide in a saline aquifer. The parametric uncertainties are the interfacial tension between CO2 and aquifer brine, the Land's trapping coefficient and the boundary aquifer's absolute permeability. The spatial uncertainties are due to the channelized permeability field which exhibits a binary channel-non-channel system. The objective function of the optimization is the amount of residually trapped CO2 due to the hysteresis of the relative permeability curves. A risk-averse value derived from the cumulative density function of the distribution of the amount of trapped gas is chosen as the objective function value. In order to ensure that the uncertainties are effectively taken into account, Monte Carlo simulation and Polynomial Chaos Expansion (PCE)-based methods are used and compared with each other. For different cases of parametric and spatial uncertainties, the most accurate uncertainty quantification (UQ) method is chosen to be integrated within the optimization algorithm. While for parametric uncertainty cases of up to two uncertain variables, PCE-based methods computationally outperform Monte Carlo simulations, it is shown that for the multimodal distributions of the function of trapped gas occurring for the spatial uncertainty case, Monte Carlo simulations are more reliable than PCE-based UQ methods. For the discrete (integer) optimization problem, various mixed response surface surrogate models are tested and the robust optimization resulted in optimal CO2 injection well locations.

  10. Regulated tissue-specific alternative splicing of enhanced green fluorescent protein transgenes conferred by alpha-tropomyosin regulatory elements in transgenic mice.


    Ellis, Peter D; Smith, Christopher W J; Kemp, Paul


    The mutually exclusive exons 2 and 3 of alpha-tropomyosin (alphaTM) have been used as a model system for strictly regulated alternative splicing. Exon 2 inclusion is only observed at high levels in smooth muscle (SM) tissues, whereas striated muscle and non-muscle cells use predominantly exon 3. Experiments in cell culture have shown that exon 2 selection results from repression of exon 3 and that this repression is mediated by regulatory elements flanking exon 3. We have now tested the cell culture-derived model in transgenic mice. We show that by harnessing the intronic splicing regulatory elements, expression of an enhanced green fluorescent protein transgene with a constitutively active promoter can be restricted to SM cells. Splicing of both endogenous alphaTM and a series of transgenes carrying regulatory element mutations was analyzed by reverse transcriptasePCR. These studies indicated that although SM-rich tissues are equipped to regulate splicing of high levels of endogenous or transgene alphaTM RNA, other non-SM tissues such as spleen, which express lower amounts of alphaTM, also splice significant proportions of exon 2, and this splicing pattern can be recapitulated by transgenes expressed at low levels. We confirm the importance in vivo of the negatively acting regulatory elements for regulated skipping of exon 3. Moreover, we provide evidence that some of the regulatory factors responsible for exon 3 skipping appear to be titratable, with loss of regulated splicing sometimes being associated with high transgene expression levels. PMID:15194683

  11. Near-road enhancement and solubility of fine and coarse particulate matter trace elements near a major interstate in Detroit, Michigan

    NASA Astrophysics Data System (ADS)

    Oakes, Michelle M.; Burke, Janet M.; Norris, Gary A.; Kovalcik, Kasey D.; Pancras, J. Patrick; Landis, Matthew S.


    Communities near major roadways are disproportionately affected by traffic-related air pollution which can contribute to adverse health outcomes. The specific role of particulate matter (PM) from traffic sources is not fully understood due to complex emissions processes and physical/chemical properties of PM in the near-road environment. To investigate the spatial profile and water solubility of elemental PM species near a major roadway, filter-based measurements of fine (PM2.5) and coarse (PM10-2.5) PM were simultaneously collected at multiple distances (10 m, 100 m, and 300 m) from Interstate I-96 in Detroit, Michigan during September-November 2010. Filters were extracted in water, followed by a hot acid extraction, and analyzed by magnetic sector field high resolution inductively coupled plasma mass spectrometry (HR-ICPMS) to quantify water-soluble and acid-soluble trace elements for each PM size fraction. PM2.5 and PM10-2.5 species measured in the near-road samples included elements associated with traffic activity, local industrial sources, and regional pollution. Metals indicative of brake wear (Ba, Cu) were dramatically enriched near the roadway during downwind conditions (factor of 5 concentration increase), with the largest increase within 100 m of the roadway. Moderate near-roadway increases were observed for crustal elements and other traffic-related PM (Fe, Ca), and the lowest increases observed for regional PM species (S). Water solubility varied by PM species and size, and for PM2.5 included highly (S, K, Ca, Mg, Zn, Ba), moderately (Cu, Mn, Sb, Pb), and minimally (Fe, Ti) water-soluble species, with lower water solubility for most species in PM10-2.5. Results from this study indicate that water-soluble PM2.5 and PM10-2.5 metals, particularly from brake/tire wear, were enhanced in the near-roadway environment which may have human health implications.

  12. Identification and characterization of a functional retinoic acid/thyroid hormone-response element upstream of the human insulin gene enhancer.

    PubMed Central

    Clark, A R; Wilson, M E; London, N J; James, R F; Docherty, K


    A deletion analysis of the human insulin gene extending to 2 kb upstream of the transcription start site provided evidence of regulatory sequences located upstream of the insulin-linked polymorphic region (ILPR). Within this ILPR-distal region is a sequence (Ink, for insulin kilobase upstream) which contains three potential nuclear hormone-receptor half-sites, closely matching the consensus sequence AGGTCA. These sequences are arranged as a palindromic element with zero spacing over-lapping a direct repeat with 2 bp spacing. The Ink sequence was used in electrophoretic mobility-shift assays within nuclear extracts from COS-7 cells overexpressing the vitamin D, thyroid hormone or retinoic acid receptors, or from an insulin-expressing hamster cell line, HIT-T15. These studies suggest that the insulin-expressing cell line contains thyroid hormone and retinoic acid receptors at least, and that these receptors are able to recognize the Ink sequence. Three copies of the Ink sequence were placed upstream of the thymidine kinase promoter and firefly luciferase reporter gene. In COS-7 cells expressing the appropriate nuclear hormone receptor, this construct was responsive to both thyroid hormone (18-fold) and all-trans-retinoic acid (31-fold). In HIT-T15 cells the same construct responded to all-trans-retinoic acid, but not to thyroid hormone. Within the context of a 2 kb insulin gene fragment, the Ink sequence was shown to be activated by retinoic acid and by the retinoic acid receptor, but acted as a negative element in the presence of both retinoic acid and the retinoic acid receptor. Mutagenesis studies demonstrated that the palindromic sequence was important for the retinoic acid response, and for binding of complexes containing retinoic acid receptor. In human islets of Langerhans, retinoic acid was shown to stimulate insulin mRNA levels. These results demonstrate that a functional nuclear hormone-receptor-response element is located upstream of the human ILPR. As

  13. DIORAMA Location Type User's Guide

    SciTech Connect

    Terry, James Russell


    The purpose of this report is to present the current design and implementation of the DIORAMA location type object (LocationType) and to provide examples and use cases. The LocationType object is included in the diorama-app package in the diorama::types namespace. Abstractly, the object is intended to capture the full time history of the location of an object or reference point. For example, a location may be speci ed as a near-Earth orbit in terms of a two-line element set, in which case the location type is capable of propagating the orbit both forward and backward in time to provide a location for any given time. Alternatively, the location may be speci ed as a xed set of geodetic coordinates (latitude, longitude, and altitude), in which case the geodetic location of the object is expected to remain constant for all time. From an implementation perspective, the location type is de ned as a union of multiple independent objects defi ned in the DIORAMA tle library. Types presently included in the union are listed and described in subsections below, and all conversions or transformation between these location types are handled by utilities provided by the tle library with the exception of the \\special-values" location type.

  14. Invasive blue mussels threaten regional scale genetic diversity in mainland and remote offshore locations: the need for baseline data and enhanced protection in the Southern Ocean.


    Gardner, Jonathan P A; Zbawicka, Małgorzata; Westfall, Kristen M; Wenne, Roman


    Human-mediated biological transfers of species have substantially modified many ecosystems with profound environmental and economic consequences. However, in many cases, invasion events are very hard to identify because of the absence of an appropriate baseline of information for receiving sites/regions. In this study, use of high-resolution genetic markers (single nucleotide polymorphisms - SNPs) highlights the threat of introduced Northern Hemisphere blue mussels (Mytilus galloprovincialis) at a regional scale to Southern Hemisphere lineages of blue mussels via hybridization and introgression. Analysis of a multispecies SNP dataset reveals hotspots of invasive Northern Hemisphere blue mussels in some mainland New Zealand locations, as well as the existence of unique native lineages of blue mussels on remote oceanic islands in the Southern Ocean that are now threatened by invasive mussels. Samples collected from an oil rig that has moved between South Africa, Australia, and New Zealand were identified as invasive Northern Hemisphere mussels, revealing the relative ease with which such non-native species may be moved from region to region. In combination, our results highlight the existence of unique lineages of mussels (and by extension, presumably of other taxa) on remote offshore islands in the Southern Ocean, the need for more baseline data to help identify bioinvasion events, the ongoing threat of hybridization and introgression posed by invasive species, and the need for greater protection of some of the world's last great remote areas.

  15. The impact of enhanced atmospheric carbon dioxide on yield, proximate composition, elemental concentration, fatty acid and vitamin C contents of tomato (Lycopersicon esculentum).


    Khan, Ikhtiar; Azam, Andaleeb; Mahmood, Abid


    The global average temperature has witnessed a steady increase during the second half of the twentieth century and the trend is continuing. Carbon dioxide, a major green house gas is piling up in the atmosphere and besides causing global warming, is expected to alter the physico-chemical composition of plants. The objective of this work was to evaluate the hypothesis that increased CO(2) in the air is causing undesirable changes in the nutritional composition of tomato fruits. Two varieties of tomato (Lycopersicon esculentum) were grown in ambient (400 μmol mol(-1)) and elevated (1,000 μmol mol(-1)) concentration of CO(2) under controlled conditions. The fruits were harvested at premature and fully matured stages and analyzed for yield, proximate composition, elemental concentration, fatty acid, and vitamin C contents. The amount of carbohydrates increased significantly under the enhanced CO(2) conditions. The amount of crude protein and vitamin C, two important nutritional parameters, decreased substantially. Fatty acid content showed a mild decrease with a slight increase in crude fiber. Understandably, the effect of enhanced atmospheric CO(2) was more pronounced at the fully matured stage. Mineral contents of the fruit samples changed in an irregular fashion. Tomato fruit has been traditionally a source of vitamin C, under the experimental conditions, a negative impact of enhanced CO(2) on this source of vitamin C was observed. The nutritional quality of both varieties of tomato has altered under the CO(2) enriched atmosphere. PMID:22382378

  16. The impact of enhanced atmospheric carbon dioxide on yield, proximate composition, elemental concentration, fatty acid and vitamin C contents of tomato (Lycopersicon esculentum).


    Khan, Ikhtiar; Azam, Andaleeb; Mahmood, Abid


    The global average temperature has witnessed a steady increase during the second half of the twentieth century and the trend is continuing. Carbon dioxide, a major green house gas is piling up in the atmosphere and besides causing global warming, is expected to alter the physico-chemical composition of plants. The objective of this work was to evaluate the hypothesis that increased CO(2) in the air is causing undesirable changes in the nutritional composition of tomato fruits. Two varieties of tomato (Lycopersicon esculentum) were grown in ambient (400 μmol mol(-1)) and elevated (1,000 μmol mol(-1)) concentration of CO(2) under controlled conditions. The fruits were harvested at premature and fully matured stages and analyzed for yield, proximate composition, elemental concentration, fatty acid, and vitamin C contents. The amount of carbohydrates increased significantly under the enhanced CO(2) conditions. The amount of crude protein and vitamin C, two important nutritional parameters, decreased substantially. Fatty acid content showed a mild decrease with a slight increase in crude fiber. Understandably, the effect of enhanced atmospheric CO(2) was more pronounced at the fully matured stage. Mineral contents of the fruit samples changed in an irregular fashion. Tomato fruit has been traditionally a source of vitamin C, under the experimental conditions, a negative impact of enhanced CO(2) on this source of vitamin C was observed. The nutritional quality of both varieties of tomato has altered under the CO(2) enriched atmosphere.

  17. Chemically enhanced phytoextraction of risk elements from a contaminated agricultural soil using Zea mays and Triticum aestivum: performance and metal mobilization over a three year period.


    Neugschwandtner, Reinhard W; Tlustos, Pavel; Komárek, Michael; Száková, Jirina; Jakoubková, Lucie


    Enhanced phytoextraction using EDTA for the remediation of an agricultural soil contaminated with less mobile risk elements Cd and Pb originating from smelting activities in Príbram (Czech Republic) was assessed on the laboratory and the field scale. EDTA was applied to the first years crop Zea mays. Metal mobilization and metal uptake by the plants in the soil were monitored for two additional years when Triticum aestivum was planted. The application ofEDTA effectively increased water-soluble Cd and Pb concentrations in the soil. These concentrations decreased over time. Anyhow, increased concentrations could be still observed in the third experimental year indicating a low possibility of groundwater pollution after the addition of EDTA during and also after the enhanced phytoextraction process under prevailing climatic conditions. EDTA-applications caused phytotoxicity and thereby decreased biomass production and increased Cd and Pb uptake by the plants. Phytoextraction efficiency and phytoextraction potential were too low for Cd and Pb phytoextraction in the field in a reasonable time frame (as less than one-tenth of a percent of total Cd and Pb could be removed). This strongly indicates that EDTA-enhanced phytoextraction as implemented in this study is not a suitable remediation technique for risk metal contaminated soils.

  18. Determination of trace elements in high purity alumina powder by helium enhanced direct current glow discharge mass spectrometry

    NASA Astrophysics Data System (ADS)

    Jung, Sehoon; Kim, Sunhye; Hinrichs, Joachim


    Trace impurities in high purity alumina powder were determined by fast flow direct current glow discharge mass spectrometry (GD-MS). The non-conductive samples were prepared with high purity graphite powder and used as a sample binder and as a secondary cathode. To improve the sensitivity of the GD-MS analysis, helium was introduced as an additional glow discharge gas to argon plasma. The quantification results of the GD-MS measurement were calculated by external calibration with matrix matched certified reference materials. The GD-MS results for the determination of Na, Mg, Si, Ca, Ti, V, Cr, Fe, Cu, Zn and Ga in the alumina samples agreed well with the certified values of a reference material and the results of chemical analysis using wet sample digestion with inductively coupled plasma atomic emission spectrometry (ICP-AES) and inductively coupled plasma mass spectrometry (ICP-MS). The GD-MS analysis is a rapid analysis technique to determine trace elements in non-conductive alumina to below mg·kg- 1 levels.

  19. Oxidative mobilization of cerium and uranium and enhanced release of "immobile" high field strength elements from igneous rocks in the presence of the biogenic siderophore desferrioxamine B

    NASA Astrophysics Data System (ADS)

    Kraemer, Dennis; Kopf, Sebastian; Bau, Michael


    Polyvalent trace elements such as the high field strength elements (HFSE) are commonly considered rather immobile during low-temperature water-rock interaction. Hence, they have become diagnostic tools that are widely applied in geochemical studies. We present results of batch leaching experiments focused on the mobilization of certain HFSE (Y, Zr, Hf, Th, U and rare earth elements) from mafic, intermediate and felsic igneous rocks in the presence and absence, respectively, of the siderophore desferrioxamine B (DFOB). Our data show that DFOB strongly enhances the mobility of these trace elements during low-temperature water-rock interaction. The presence of DFOB produces two distinct features in the Rare Earths and Yttrium (REY) patterns of leaching solutions, regardless of the mineralogical and chemical composition or the texture of the rock type studied. Bulk rock-normalized REY patterns of leaching solutions with DFOB show (i) a very distinct positive Ce anomaly and (ii) depletion of La and other light REY relative to the middle REY, with a concave downward pattern between La and Sm. These features are not observed in experiments with hydrochloric acid, acetic acid or deionized water. In DFOB-bearing leaching solutions Ce and U are decoupled from and selectively enriched relative to light REY and Th, respectively, due to oxidation to Ce(IV) and U(VI). Oxidation of Ce3+ and U4+ is promoted by the significantly higher stability of the Ce(IV) and U(VI) DFOB complexes as compared to the Ce(III) and U(IV) DFOB complexes. This is similar to the relationship between the Ce(IV)- and Ce(III)-pentacarbonate complexes that cause positive Ce anomalies in alkaline lakes. However, while formation of Ce(IV) carbonate complexes is confined to alkaline environments, Ce(IV) DFOB complexes may produce positive Ce anomalies even in mildly acidic and near-neutral natural waters. Siderophore-promoted dissolution processes also significantly enhance mobility of other 'immobile' HFSE

  20. Finite element method for simulating coupled thermo-hydro-mechanical processes in discretely fractured porous media and application to enhanced geothermal reservoir analysis

    NASA Astrophysics Data System (ADS)

    Watanabe, N.; Wong, L.; Bloecher, G.; Cacace, M.; Kolditz, O.


    We present our recent development of the finite element method (FEM) for simulating coupled thermo-hydro-mechanical (THM) processes in discretely fractured porous media and an application to geothermal reservoir modeling for the research test site Gross Schoenebeck in Germany operated by the GFZ German Research Centre for Geosciences. Numerical analysis of multi-physics problems in fractured rocks is important for various geotechnical applications. In particular for enhanced geothermal reservoirs where induced fractures and possibly natural fault systems dominate the system behavior, explicit modeling of those characteristic fractures (i.e. discrete fracture models) is essential to get more detailed understanding of in-situ processes and reliable estimations of heat extraction from those deep reservoirs. However, as fractures are mechanical discontinuities, it is difficult to solve the problems using continuity based numerical methods such as the FEM. Currently, equivalent porous medium or multiple continuum model approaches are often only the way to model fractured rocks with the FEM. The authors have recently developed lower-dimensional interface elements (LIEs) for modeling mechanics-involved coupled processes with pre-existing fractures (Watanabe et al. 2012 IJNME). The method does not require any double nodes unlike conventional interface elements. Moreover, for coupled problems, the approach allows for the use of a single mesh for both mechanical and other related processes such as flow and transport. All the code developments have been carried out within the scientific open source project OpenGeoSys ( (Kolditz et al. 2012 EES). Using both traditional and new simulation techniques, a geothermal reservoir model for the research test site Gross Schoenebeck has been developed. Unstructured meshing of the complex faulted reservoir including both rock matrix and fracture elements has been conducted using recently developed automatic

  1. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements

    PubMed Central

    Misulovin, Ziva; Gause, Maria; Rickels, Ryan A; Shilatifard, Ali


    The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs). RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers. PMID:27662615

  2. ALU repeats in promoters are position-dependent co-response elements (coRE) that enhance or repress transcription by dimeric and monomeric progesterone receptors.


    Jacobsen, Britta M; Jambal, Purevsuren; Schittone, Stephanie A; Horwitz, Kathryn B


    We have conducted an in silico analysis of progesterone response elements (PRE) in progesterone receptor (PR) up-regulated promoters. Imperfect inverted repeats, direct repeats, and half-site PRE are widespread, not only in PR-regulated, but also in non-PR-regulated and random promoters. Few resemble the commonly used palindromic PRE with three nucleotide (nt) spacers. We speculated that PRE may be necessary but insufficient to control endogenous PR-dependent transcription. A search for PRE partners identified a highly conserved 234-nt sequence invariably located within 1-2 kb of transcription start sites. It resembles ALU repeats and contains binding sites for 11 transcription factors. The 234-nt sequence of the PR-regulated 8-oxoguanine DNA glycosylase promoter was cloned in the forward or reverse orientation in front of zero, one, or two inverted repeat PRE, and one or tandem PRE half-sites, driving luciferase. Under these conditions the 234-nt sequence functions as a co-response element (coRE). From the PRE or tandem half-sites, the reverse coRE is a strong activator of PR and glucocorticoid receptor-dependent transcription. The forward coRE is a powerful repressor. The prevalence of PRE half-sites in natural promoters suggested that PR monomers regulate transcription. Indeed, dimerization-domain mutant PR monomers were stronger transactivators than wild-type PR on PRE or tandem half-sites. This was repressed by the forward coRE. We propose that in natural promoters the coRE functions as a composite response element with imperfect PRE and half-sites to present variable, orientation-dependent transcription factors for interaction with nearby PR. PMID:19372234

  3. The effect of sulfide dissolved in silicate melts on enhancing the solubility of the Highly Siderophile Elements

    NASA Astrophysics Data System (ADS)

    O'Neill, H. S.


    There are large inconsistencies among experimental studies of Highly Siderophile Element (HSE) partitioning relations between silicates and metal or sulfide phases, which has usually been attributed to "micronuggets", a general term for sub-optical (approximately < 0.2 µm) particles or blobs of metal or sulfide in the silicate phase. But there have then been differences of opinion as to whether these micronuggets (and, sometimes, associated optical-sized metal or sulfide particles) should be viewed as contamination, or are produced by precipitation on quenching the experiment, which need to be included to recover true partitioning relations. Although quench precipitation is perhaps inevitable in experiments at extremely high temperatures and/or pressures, or with high loads of dissolved sulfide, it may be superimposed on the usual micronugget contamination. The problem is particularly acute in HSE sulfide-melt/silicate-melt partition coefficients, where results range over several orders of magnitude. Moreover, nearly all the reported results of directly determined sulfide-melt/silicate-melt partition coefficients are considerably lower than values calculated by combining metal/silicate-melt with metal/sulfide-melt partition coefficients. This discrepancy has been attributed to large effects of S dissolved as sulfide in the silicate melts on HSE solubilities. As such large effects are not expected from the thermodynamic modeling of sulfide solubilities in silicate melts, it has been proposed that HSEs dissolve in sulfide-containing silicate melts by forming HSE-S complexes. This idea has been tested by experiments that compare the solubilities of Ir, Re and Ru in a high-TiO2 silicate melt both with and without dissolved sulfide at 1400 to 1600ºC at atmospheric pressure. The high TiO2 suppresses micronuggets. Experiments were analysed by LA-ICP-MS, with detection limits approaching 2 ppb. For Ir, the results show that at fO2 low enough to enable measurable sulfide

  4. Lithium induces gene expression through lymphoid enhancer-binding factor/T-cell factor responsive element in rat PC12 cells.


    Bettini, Ezio; Magnani, Enrico; Terstappen, Georg C


    Lithium inhibits glycogen synthase kinase-3 (GSK-3), which leads to an increase of cytoplasmic beta-catenin levels. In some cell types, but not in others, activated beta-catenin interacts with members of the lymphoid enhancer-binding factor (LEF)/T-cell factor (TCF) family of transcription factors and induces gene expression. Lithium effect on LEF/TCF-mediated gene expression has never been evaluated in cells with a neuronal phenotype. We have constructed a LEF/TCF-dependent luciferase reporter gene to investigate lithium effects on transcription in PC12 cells. In transiently transfected PC12 cells, lithium induced a time-dependent increase in LEF/TCF-mediated luciferase activity. These results are consistent with the known inhibitory effects of lithium on GSK-3 and represent the first demonstration that a LEF/TCF responsive element also mediates lithium-induced gene expression in PC12 cells.

  5. Metal binding properties of the EPS produced by Halomonas sp. TG39 and its potential in enhancing trace element bioavailability to eukaryotic phytoplankton.


    Gutierrez, Tony; Biller, Dondra V; Shimmield, Tracy; Green, David H


    An emergent property of exopolysaccharides (EPS) produced by marine bacteria is their net negative charge, predominantly conferred by their high uronic acids content. Here, we investigated the EPS produced by an algal-associated marine bacterium, Halomonas sp. strain TG39, for its capacity to sequester trace metals and mediate their bioavailability to eukaryotic phytoplankton. Metal analysis of the purified EPS revealed that it contained high levels of K, Ca, Mg and several essential trace metals, including Zn, Cu, Fe and the metalloid Si. Desorption experiments with marine sediment showed that the EPS possessed a specific binding capacity for Ca, Si, Fe, Mn, Mg and Al. Depending on the ionic conditions, Fe was the third or fourth most highly-adsorbed metal out of 27 elements analyzed. Experiments employing Fe-limited synthetic ocean seawater showed that growth of the marine diatom Thalassiosira weissflogii (axenic strain) was enhanced when incubated in the presence of either purified EPS or EPS that had been pre-exposed to marine sediment, compared to non-EPS amended controls. This growth enhancement was attributed to the EPS binding and increasing the bioavailability of key trace metal elements, such as Fe(III). Since the bacterium used in this study was originally isolated from a marine micro-alga, this work highlights the possibility that bacterial associates of eukaryotic algae could be influencing the bioavailability of Fe(III) to phytoplankton via their production of polyanionic EPS. More widely, this work reinforces the potential importance of marine bacterial EPS in trace metal biogeochemical cycling.

  6. Cloning of a DNA-binding protein that interacts with the ethylene-responsive enhancer element of the carnation GST1 gene.


    Maxson, J M; Woodson, W R


    Ethylene transcriptionally activates a glutathione S-transferase gene (GST1) at the onset of the senescence program in carnation (Dianthus caryophyllus L.) flower petals. A 126 bp region of the GST1 promoter sequence has been identified as an ethylene-responsive enhancer element (ERE). In this paper, we demonstrate the ability of nuclear proteins from senescing petals to recognize a 22 bp sequence within the ERE (ERE oligonucleotide). Mutation of the ERE oligonucleotide sequence significantly alters the strength of this nuclear protein-DNA association. The wild-type ERE oligonucleotide sequence was used to isolate a cDNA clone encoding a sequence-specific DNA binding protein. Nucleotide sequencing and deduced amino acid sequence analysis of this cDNA predicted a 32 kDa protein which we have designated carnation ethylene-responsive element-binding protein-1 (CEBP-1). The mRNA expression pattern of CEBP-1 suggests that it is not transcriptionally regulated by ethylene. The amino acid sequence homology of CEBP-1 with other plant nucleic acid binding proteins indicates a conserved nucleic acid binding domain. Within this domain are two highly conserved RNA-binding motifs, RNP-1 and RNP-2. An acidic region and a putative nuclear localization signal are also identified.

  7. A reporter promoter assay confirmed the role of a distal promoter NOBOX binding element in enhancing expression of GDF9 gene in buffalo oocytes.


    Roy, Bhaskar; Rajput, Sandeep; Raghav, Sarvesh; Kumar, Parveen; Verma, Arpana; Kumar, Sandeep; De, Sachinandan; Goswami, Surender Lal; Datta, Tirtha Kumar


    Growth differentiation factor 9 is primarily expressed in oocytes and plays a vital role in oocyte cumulus crosstalk. Earlier studies with buffalo oocytes revealed differential expression of this gene under different media stimulation conditions which, in turn, are correlated with the blastocyst yield. In this study, different germ cell specific cis elements including a NOBOX binding elements (NBE) and several E-boxes were identified at the 5' upstream region of buffalo GDF9 gene and their potential role in GDF9 expression was investigated. Transfecting oocytes with GDF9 promoter deletion constructs harbouring the NBE reporter gene revealed a 33% increase in GFP as well as the luciferase signal signifying its role in stimulating the minimal promoter activity of GDF9 in buffalo oocytes. Site directed mutation of core binding nucleotides at NBE at 1.8 kb upstream to TSS further confirmed its role for enhancing the basal transcriptional activity of GDF9 promoter in buffalo oocytes. Current work will provide important leads for understanding the role of GDF9 in oocytes competence and designing a more physiological IVF protocol in case of buffalo.

  8. Fate-mapping the mammalian hindbrain: segmental origins of vestibular projection neurons assessed using rhombomere-specific Hoxa2 enhancer elements in the mouse embryo.


    Pasqualetti, Massimo; Díaz, Carmen; Renaud, Jean-Sébastien; Rijli, Filippo M; Glover, Joel C


    As a step toward generating a fate map of identified neuron populations in the mammalian hindbrain, we assessed the contributions of individual rhombomeres to the vestibular nuclear complex, a major sensorimotor area that spans the entire rhombencephalon. Transgenic mice harboring either the lacZ or the enhanced green fluorescent protein reporter genes under the transcriptional control of rhombomere-specific Hoxa2 enhancer elements were used to visualize rhombomere-derived domains. We labeled functionally identifiable vestibular projection neuron groups retrogradely with conjugated dextran-amines at successive embryonic stages and obtained developmental fate maps through direct comparison with the rhombomere-derived domains in the same embryos. The fate maps show that each vestibular neuron group derives from a unique rostrocaudal domain that is relatively stable developmentally, suggesting that anteroposterior migration is not a major contributor to the rostrocaudal patterning of the vestibular system. Most of the groups are multisegmental in origin, and each rhombomere is fated to give rise to two or more vestibular projection neuron types, in a complex pattern that is not segmentally iterated. Comparison with studies in the chicken embryo shows that the rostrocaudal patterning of identified vestibular projection neuron groups is generally well conserved between avians and mammalians but that significant species-specific differences exist in the rostrocaudal limits of particular groups. This mammalian hindbrain fate map can be used as the basis for targeting genetic manipulation to specific subpopulations of vestibular projection neurons.

  9. Noise-immune cavity-enhanced analytical atomic spectrometry - NICE-AAS - A technique for detection of elements down to zeptogram amounts

    NASA Astrophysics Data System (ADS)

    Axner, Ove; Ehlers, Patrick; Hausmaninger, Thomas; Silander, Isak; Ma, Weiguang


    Noise-immune cavity-enhanced optical heterodyne molecular spectroscopy (NICE-OHMS) is a powerful technique for detection of molecular compounds in gas phase that is based on a combination of two important concepts: frequency modulation spectroscopy (FMS) for reduction of noise, and cavity enhancement, for prolongation of the interaction length between the light and the sample. Due to its unique properties, it has demonstrated unparalleled detection sensitivity when it comes to detection of molecular constituents in the gas phase. However, despite these, it has so far not been used for detection of atoms, i.e. for elemental analysis. The present work presents an assessment of the expected performance of Doppler-broadened (Db) NICE-OHMS for analytical atomic spectrometry, then referred to as noise-immune cavity-enhanced analytical atomic spectrometry (NICE-AAS). After a description of the basic principles of Db-NICE-OHMS, the modulation and detection conditions for optimum performance are identified. Based on a previous demonstrated detection sensitivity of Db-NICE-OHMS of 5 × 10- 12 cm- 1 Hz- 1/2 (corresponding to a single-pass absorbance of 7 × 10- 11 over 10 s), the expected limits of detection (LODs) of Hg and Na by NICE-AAS are estimated. Hg is assumed to be detected in gas phase directly while Na is considered to be atomized in a graphite furnace (GF) prior to detection. It is shown that in the absence of spectral interferences, contaminated sample compartments, and optical saturation, it should be feasible to detect Hg down to 10 zg/cm3 (10 fg/m3 or 10- 5 ng/m3), which corresponds to 25 atoms/cm3, and Na down to 0.5 zg (zg = zeptogram = 10- 21 g), representing 50 zg/mL (parts-per-sextillion, pps, 1:1021) in liquid solution (assuming a sample of 10 μL) or solely 15 atoms injected into the GF, respectively. These LODs are several orders of magnitude lower (better) than any previous laser-based absorption technique previously demonstrated under atmospheric

  10. Superheavy Elements

    NASA Astrophysics Data System (ADS)

    Hofmann, S.

    The nuclear shell model predicts that the next doubly magic shell closure beyond 208Pb is at a proton number Z=114, 120, or 126 and at a neutron number N=172 or 184. The outstanding aim of experimental investigations is the exploration of this region of spherical `SuperHeavy Elements' (SHEs). Experimental methods have been developed which allowed for the identification of new elements at production rates of one atom per month. Using cold fusion reactions which are based on lead and bismuth targets, relatively neutron-deficient isotopes of the elements from 107 to 113 were synthesized at GSI in Darmstadt, Germany, and/or at RIKEN in Wako, Japan. In hot fusion reactions of 48Ca projectiles with actinide targets more neutron-rich isotopes of the elements from 112 to 116 and even 118 were produced at the Flerov Laboratory of Nuclear Reactions (FLNR) at the Joint Institute for Nuclear Research (JINR) in Dubna, Russia. Recently, part of these data which represent the first identification of nuclei located on the predicted island of SHEs were confirmed in two independent experiments. The decay data reveal that for the heaviest elements, the dominant decay mode is α emission rather than fission. Decay properties as well as reaction cross-sections are compared with results of theoretical studies. Finally, plans are presented for the further development of the experimental set-up and the application of new techniques. At a higher sensitivity, the detailed exploration of the region of spherical SHEs will be in the center of interest of future experimental work. New data will certainly challenge theoretical studies on the mechanism of the synthesis, on the nuclear decay properties, and on the chemical behavior of these heaviest atoms at the limit of stability.

  11. GREAM: A Web Server to Short-List Potentially Important Genomic Repeat Elements Based on Over-/Under-Representation in Specific Chromosomal Locations, Such as the Gene Neighborhoods, within or across 17 Mammalian Species

    PubMed Central

    Chandrashekar, Darshan Shimoga; Dey, Poulami; Acharya, Kshitish K.


    Background Genome-wide repeat sequences, such as LINEs, SINEs and LTRs share a considerable part of the mammalian nuclear genomes. These repeat elements seem to be important for multiple functions including the regulation of transcription initiation, alternative splicing and DNA methylation. But it is not possible to study all repeats and, hence, it would help to short-list before exploring their potential functional significance via experimental studies and/or detailed in silico analyses. Result We developed the ‘Genomic Repeat Element Analyzer for Mammals’ (GREAM) for analysis, screening and selection of potentially important mammalian genomic repeats. This web-server offers many novel utilities. For example, this is the only tool that can reveal a categorized list of specific types of transposons, retro-transposons and other genome-wide repetitive elements that are statistically over-/under-represented in regions around a set of genes, such as those expressed differentially in a disease condition. The output displays the position and frequency of identified elements within the specified regions. In addition, GREAM offers two other types of analyses of genomic repeat sequences: a) enrichment within chromosomal region(s) of interest, and b) comparative distribution across the neighborhood of orthologous genes. GREAM successfully short-listed a repeat element (MER20) known to contain functional motifs. In other case studies, we could use GREAM to short-list repetitive elements in the azoospermia factor a (AZFa) region of the human Y chromosome and those around the genes associated with rat liver injury. GREAM could also identify five over-represented repeats around some of the human and mouse transcription factor coding genes that had conserved expression patterns across the two species. Conclusion GREAM has been developed to provide an impetus to research on the role of repetitive sequences in mammalian genomes by offering easy selection of more interesting

  12. Chicken beta B1-crystallin gene expression: presence of conserved functional polyomavirus enhancer-like and octamer binding-like promoter elements found in non-lens genes.

    PubMed Central

    Roth, H J; Das, G C; Piatigorsky, J


    Expression of the chicken beta B1-crystallin gene was examined. Northern (RNA) blot and primer extension analyses showed that while abundant in the lens, the beta B1 mRNA is absent from the liver, brain, heart, skeletal muscle, and fibroblasts of the chicken embryo, suggesting lens specificity. Promoter fragments ranging from 434 to 126 bp of 5'-flanking sequence (plus 30 bp of exon 1) of the beta B1 gene fused to the bacterial chloramphenicol acetyltransferase gene functioned much more efficiently in transfected embryonic chicken lens epithelial cells than in transfected primary muscle fibroblasts or HeLa cells. Transient expression of recombinant plasmids in cultured lens cells, DNase I footprinting, in vitro transcription in a HeLa cell extract, and gel mobility shift assays were used to identify putative functional promoter elements of the beta B1-crystallin gene. Sequence analysis revealed a number of potential regulatory elements between positions -126 and -53 of the beta B1 promoter, including two Sp1 sites, two octamer binding sequence-like sites (OL-1 and OL-2), and two polyomavirus enhancer-like sites (PL-1 and PL-2). Deletion and site-specific mutation experiments established the functional importance of PL-1 (-116 to -102), PL-2 (-90 to -76), and OL-2 (-75 to -68). DNase I footprinting using a lens or a HeLa cell nuclear extract and gel mobility shifts using a lens nuclear extract indicated the presence of putative lens transcription factors binding to these DNA sequences. Competition experiments provided evidence that PL-1 and PL-2 recognize the same or very similar factors, while OL-2 recognizes a different factor. Our data suggest that the same or closely related transcription factors found in many tissues are used for expression of the chicken beta B1-crystallin gene in the lens. Images PMID:1996106

  13. Multiple, conserved iron-responsive elements in the 3'-untranslated region of transferrin receptor mRNA enhance binding of iron regulatory protein 2.


    Erlitzki, Ronit; Long, Joanne C; Theil, Elizabeth C


    Synthesis of proteins for iron homeostasis is regulated by specific, combinatorial mRNA/protein interactions between RNA stem-loop structures (iron-responsive elements, IREs) and iron-regulatory proteins (IRP1 and IRP2), controlling either mRNA translation or stability. The transferrin receptor 3'-untranslated region (TfR-3'-UTR) mRNA is unique in having five IREs, linked by AU-rich elements. A C-bulge in the stem of each TfR-IRE folds into an IRE that has low IRP2 binding, whereas a loop/bulge in the stem of the ferritin-IRE allows equivalent IRP1 and IRP2 binding. Effects of multiple IRE interactions with IRP1 and IRP2 were compared between the native TfR-3'-UTR sequence (5xIRE) and RNA with only 3 or 2 IREs. We show 1) equivalent IRP1 and IRP2 binding to multiple TfR-IRE RNAs; 2) increased IRP-dependent nuclease resistance of 5xIRE compared with lower IRE copy-number RNAs; 3) distorted TfR-IRE helix structure within the context of 5xIRE, detected by Cu-(phen)(2) binding/cleavage, that coincides with ferritin-IRE conformation and enhanced IRP2 binding; and 4) variable IRP1 and IRP2 expression in human cells and during development (IRP2-mRNA predominated). Changes in TfR-IRE structure conferred by the full length TfR-3'-UTR mRNA explain in part evolutionary conservation of multiple IRE-RNA, which allows TfR mRNA stabilization and receptor synthesis when IRP activity varies, and ensures iron uptake for cell growth.

  14. Experiences with information locator services

    USGS Publications Warehouse

    Christian, E.


    Over the last few years, governments and other organizations have been using new technologies to create networked Information Locator Services that help people find information resources. These services not only enhance access to information, but also are designed to support fundamental information policy principles. This article relates experiences in developing and promoting services interoperable with the Global Information Locator Service standard that has now been adopted and promoted in many forums worldwide. The article describes sample implementations and touches on the strategic choices made in public policy, standards, and technology. Ten recommendations are offered for successful implementation of an Information Locator Service. Published by Elsevier Science Ltd. All rights reserved.

  15. An In-Depth Characterization of the Major Psoriasis Susceptibility Locus Identifies Candidate Susceptibility Alleles within an HLA-C Enhancer Element

    PubMed Central

    Clop, Alex; Bertoni, Anna; Spain, Sarah L.; Simpson, Michael A.; Pullabhatla, Venu; Tonda, Raul; Hundhausen, Christian; Di Meglio, Paola; De Jong, Pieter; Hayday, Adrian C.; Nestle, Frank O.; Barker, Jonathan N.; Bell, Robert J. A.; Capon, Francesca; Trembath, Richard C.


    Psoriasis is an immune-mediated skin disorder that is inherited as a complex genetic trait. Although genome-wide association scans (GWAS) have identified 36 disease susceptibility regions, more than 50% of the genetic variance can be attributed to a single Major Histocompatibility Complex (MHC) locus, known as PSORS1. Genetic studies indicate that HLA-C is the strongest PSORS1 candidate gene, since markers tagging HLA-Cw*0602 consistently generate the most significant association signals in GWAS. However, it is unclear whether HLA-Cw*0602 is itself the causal PSORS1 allele, especially as the role of SNPs that may affect its expression has not been investigated. Here, we have undertaken an in-depth molecular characterization of the PSORS1 interval, with a view to identifying regulatory variants that may contribute to disease susceptibility. By analysing high-density SNP data, we refined PSORS1 to a 179 kb region encompassing HLA-C and the neighbouring HCG27 pseudogene. We compared multiple MHC sequences spanning this refined locus and identified 144 candidate susceptibility variants, which are unique to chromosomes bearing HLA-Cw*0602. In parallel, we investigated the epigenetic profile of the critical PSORS1 interval and uncovered three enhancer elements likely to be active in T lymphocytes. Finally we showed that nine candidate susceptibility SNPs map within a HLA-C enhancer and that three of these variants co-localise with binding sites for immune-related transcription factors. These data indicate that SNPs affecting HLA-Cw*0602 expression are likely to contribute to psoriasis susceptibility and highlight the importance of integrating multiple experimental approaches in the investigation of complex genomic regions such as the MHC. PMID:23990973

  16. A fast algorithm for non-Newtonian flow. An enhanced particle-tracking finite element code for solving boundary-valve problems in viscoelastic flow

    NASA Astrophysics Data System (ADS)

    Malkus, David S.


    This project concerned the development of a new fast finite element algorithm to solve flow problems of non-Newtonian fluids such as solutions or melts of polymers. Many constitutive theories for such materials involve single integrals over the deformation history of the particle at the stress evaluation point; examples are the Doi-Edwards and Curtiss-Bird molecular theories and the BKZ family derived from continuum arguments. These theories are believed to be among the most accurate in describing non-Newtonian effects important to polymer process design, effects such as stress relaxation, shear thinning, and normal stress effects. This research developed an optimized version of the algorithm which would run a factor of two faster than the pilot algorithm on scalar machines and would be able to take full advantage of vectorization on machines. Significant progress was made in code vectorization; code enhancement and streamlining; adaptive memory quadrature; model problems for the High Weissenberg Number Problem; exactly incompressible projection; development of multimesh extrapolation procedures; and solution of problems of physical interest. A portable version of the code is in the final stages of benchmarking and testing. It interfaces with the widely used FIDAP fluid dynamics package.

  17. Epigenetically regulated miR-449a enhances hepatitis B virus replication by targeting cAMP-responsive element binding protein 5 and modulating hepatocytes phenotype

    PubMed Central

    Zhang, Xiaoyong; Liu, Hongyan; Xie, Zhanglian; Deng, Wangyu; Wu, Chunchen; Qin, Bo; Hou, Jinlin; Lu, Mengji


    Cellular microRNAs (miRNAs) are able to influence hepatitis B virus (HBV) replication directly by binding to HBV transcripts or indirectly by targeting cellular factors. Here, we investigate the effect of epigenetically regulated miR-449a on HBV replication and the underlying mechanisms. miR-449a expression was lower in human hepatocellular carcinoma (HCC) cells than in primary hepatocytes and could be induced by trichostatin A. Ectopic miR-449a expression in HCC cells strongly enhanced HBV replication, transcription, progeny virions secretion, and antigen expression in a dose-dependent manner. miR-449a directly targeted cAMP-responsive element binding protein 5 (CREB5), which in turn induced the expression of farnesoid X receptor α (FXRα), a transcription factor that facilitates HBV replication. CREB5 knockdown and overexpression demonstrated that it is a negative regulator of HBV replication. Additionally, miR-449a overexpression inhibited proliferation, caused cell cycle arrest, and promoted HCC cell differentiation. The results indicated that epigenetically regulated miR-449a targets CREB5 to increase FXRα expression, thereby promoting HBV replication and gene expression. Our findings provide a new understanding of the role of miRNAs in HBV replication. PMID:27138288

  18. The Chemical Abundances of Stars in the Halo (CASH) Project. III. A New Classification Scheme for Carbon-enhanced Metal-poor Stars with s-process Element Enhancement

    NASA Astrophysics Data System (ADS)

    Hollek, Julie K.; Frebel, Anna; Placco, Vinicius M.; Karakas, Amanda I.; Shetrone, Matthew; Sneden, Christopher; Christlieb, Norbert


    We present a detailed abundance analysis of 23 elements for a newly discovered carbon-enhanced metal-poor (CEMP) star, HE 0414-0343, from the Chemical Abundances of Stars in the Halo Project. Its spectroscopic stellar parameters are Teff = 4863 K, {log}g=1.25,\\ξ = 2.20 km s-1, and [Fe/H] = -2.24. Radial velocity measurements covering seven years indicate HE 0414-0343 to be a binary. HE 0414-0343 has {{[C/Fe]}}=1.44 and is strongly enhanced in neutron-capture elements but its abundances cannot be reproduced by a solar-type s-process pattern alone. Traditionally, it could be classified as a “CEMP-r/s” star. Based on abundance comparisons with asymptotic giant branch (AGB) star nucleosynthesis models, we suggest a new physically motivated origin and classification scheme for CEMP-s stars and the still poorly understood CEMP-r/s. The new scheme describes a continuous transition between these two so-far distinctly treated subgroups: CEMP-sA, CEMP-sB, and CEMP-sC. Possible causes for a continuous transition include the number of thermal pulses the AGB companion underwent, the effect of different AGB star masses on their nucleosynthetic yields, and physics that is not well approximated in 1D stellar models such as proton ingestion episodes and rotation. Based on a set of detailed AGB models, we suggest the abundance signature of HE 0414-0343 to have arisen from a >1.3 M⊙ mass AGB star and a late-time mass transfer that transformed HE 0414-0343 into a CEMP-sC star. We also find that the [Y/Ba] ratio well parametrizes the classification and can thus be used to easily classify any future such stars. Based on observations obtained with the Hobby-Eberly Telescope, which is a joint project of the University of Texas at Austin, the Pennsylvania State University, Stanford University, Ludwig-Maximilians-Universität München, and Georg-August-Universität Göttingen.

  19. Element by Element Abundances in Spheroidal Galaxies

    NASA Astrophysics Data System (ADS)

    Worthey, Guy; Serven, Jedidiah


    Element-by-element abundances will be derived from high quality long slit KPNO 4m spectra of nearby elliptical galaxies that span the range of velocity dispersion. Analysis of these spectra will give the abundances of 18 individual elements to bring to extragalactic astronomy the same luxurious situation now enjoyed only by stellar spectroscopists. These spectra will reveal the basic element ratio behavior as a function of galaxy velocity dispersion. For example, [Mg/Fe] is seen to be enhanced in large galaxies, but not small ones. We propose to expand our purview from 2 elements (Mg and Fe) to 18 elements. This, in turn, will tie directly to chemical evolution and chemical enrichment mechanisms. As a byproduct, we also decrease the stellar population age uncertainty by about a factor of ten from today's Balmer-metal index diagram techniques.

  20. A Fully-Coupled, Fully-Implicit, Finite Element Model for Solving Multiphase Fluid Flow, Heat Transport and Rock Deformation in Enhanced Geothermal Systems

    NASA Astrophysics Data System (ADS)

    Lu, C.; Deng, S.; Podgorney, R. K.; Huang, H.


    Reliable reservoir performance predictions of enhanced geothermal reservoir systems require accurate and robust modeling for the coupled thermal-hydrological-mechanical processes. Conventionally, in order to reduce computational cost, these types of problems are solved using operator splitting method, usually by sequentially coupling a subsurface flow and heat transport simulator with a solid mechanics simulator via input files. However, such operator splitting approaches are applicable only to loosely coupled problems and usually converge slowly. As in most enhanced geothermal systems (EGS), fluid flow, heat transport, and rock deformation are typically strongly nonlinearly coupled, an alternative is to solve the system of nonlinear partial differential equations that govern the system simultaneously using a fully coupled solution procedure for fluid flow, heat transport, and solid mechanics. This procedure solves for all solution variables (fluid pressure, temperature and rock displacement fields) simultaneously, which leads to one large nonlinear algebraic system that needs to be solved by a strongly convergent nonlinear solver. Development over the past 10 years in the area of physics-based conditioning, strongly convergent nonlinear solvers (such as Jacobian Free Newton methods) and efficient linear solvers (such as GMRES, AMG), makes such an approach competitive. In this presentation, we will introduce a continuum-scaled parallel physics-based, fully coupled, modeling tool for predicting the dynamics of fracture initiation and propagation, fluid flow, rock deformation, and heat transport in a single integrated code named FALCON (Fracturing And Liquid-steam CONvection). FALCON is built upon a parallel computing framework developed at Idaho National Laboratory (INL) for solving coupled systems of nonlinear equations with finite element method with unstructured and adaptively refined/coarsened grids. Currently, FALCON contains poro- and thermal- elastic models

  1. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factor 1, CCAAT/enhancer-binding protein alpha, liver activator protein, and D-element-binding protein.

    PubMed Central

    van Ooij, C; Snyder, R C; Paeper, B W; Duester, G


    The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113

  2. The location of protein S8 and surrounding elements of 16S rRNA in the 70S ribosome from combined use of directed hydroxyl radical probing and X-ray crystallography.

    PubMed Central

    Lancaster, L; Culver, G M; Yusupova, G Z; Cate, J H; Yusupov, M M; Noller, H F


    Ribosomal protein S8, which is essential for the assembly of the central domain of 16S rRNA, is one of the most thoroughly studied RNA-binding proteins. To map its surrounding RNA in the ribosome, we carried out directed hydroxyl radical probing of 16S rRNA using Fe(II) tethered to nine different positions on the surface of protein S8 in 70S ribosomes. Hydroxyl radical-induced cleavage was observed near the classical S8-binding site in the 620 stem, and flanking the other S8-footprinted regions of the central domain at the three-helix junction near position 650 and the 825 and 860 stems. In addition, cleavage near the 5' terminus of 16S rRNA, in the 300 region of its 5' domain, and in the 1070 region of its 3'-major domain provide information about the proximity to S8 of RNA elements not directly involved in its binding. These data, along with previous footprinting and crosslinking results, allowed positioning of protein S8 and its surrounding RNA elements in a 7.8-A map of the Thermus thermophilus 70S ribosome. The resulting model is in close agreement with the extensive body of data from previous studies using protein-protein and protein-RNA crosslinking, chemical and enzymatic footprinting, and genetics. PMID:10836793

  3. The location of protein S8 and surrounding elements of 16S rRNA in the 70S ribosome from combined use of directed hydroxyl radical probing and X-ray crystallography.


    Lancaster, L; Culver, G M; Yusupova, G Z; Cate, J H; Yusupov, M M; Noller, H F


    Ribosomal protein S8, which is essential for the assembly of the central domain of 16S rRNA, is one of the most thoroughly studied RNA-binding proteins. To map its surrounding RNA in the ribosome, we carried out directed hydroxyl radical probing of 16S rRNA using Fe(II) tethered to nine different positions on the surface of protein S8 in 70S ribosomes. Hydroxyl radical-induced cleavage was observed near the classical S8-binding site in the 620 stem, and flanking the other S8-footprinted regions of the central domain at the three-helix junction near position 650 and the 825 and 860 stems. In addition, cleavage near the 5' terminus of 16S rRNA, in the 300 region of its 5' domain, and in the 1070 region of its 3'-major domain provide information about the proximity to S8 of RNA elements not directly involved in its binding. These data, along with previous footprinting and crosslinking results, allowed positioning of protein S8 and its surrounding RNA elements in a 7.8-A map of the Thermus thermophilus 70S ribosome. The resulting model is in close agreement with the extensive body of data from previous studies using protein-protein and protein-RNA crosslinking, chemical and enzymatic footprinting, and genetics.

  4. Long interspersed nucleotide acid element-1 ORF-1 protein promotes proliferation and invasion of human colorectal cancer LoVo cells through enhancing ETS-1 activity.


    Li, M Y; Zhu, M; Feng, F; Cai, F Y; Fan, K C; Jiang, H; Wang, Z Q; Linghu, E Q


    The human proto-oncogene long interspersed nucleotide acid element-1 (LINE-1) open reading frame-1 protein (ORF-1p) is involved in the progress of several cancers. The transcription factor ETS-1 can mediate the transcription of some downstream genes that play specific roles in the regulation of cancerous cell invasion and metastasis. In this study, the effects of LINE-1 ORF-1p on ETS-1 activity and on the proliferation and invasion of human colorectal cancer LoVo cells were investigated. Results showed that the overexpression of LINE-1 ORF-1p enhanced the transcription of ETS-1 downstream genes and increased their protein levels, and downregulation of the LINE-1 ORF-1p level by small interfering RNA (siRNA) reduced the transcriptional activation of ETS-1. In addition, overexpression of LINE-1 ORF-1p promoted LoVo cell proliferation and anchor-independent growth, and a knockdown of the LINE-1 protein level by siRNA reduced the proliferation and anchor-independent growth ability of LoVo cells. In vivo data revealed that LINE-1 ORF-1p overexpression increased LoVo tumor growth in nude mice, whereas the siRNA knockdown of endogenous LINE-1 ORF-1p expression decreased LoVo cell growth in nude mice. Therefore, LINE- 1 ORF-1p could promote LoVo cell proliferation and invasion both in vitro and in vivo, indicating that it might be a useful molecular target for the treatment of human colorectal cancer.

  5. Enhanced anaerobic digestion of food waste by trace metal elements supplementation and reduced metals dosage by green chelating agent [S, S]-EDDS via improving metals bioavailability.


    Zhang, Wanli; Zhang, Lei; Li, Aimin


    This study aimed at investigating the effects of trace metals on methane production from food waste and examining the feasibility of reducing metals dosage by ethylenediamine-N,N'-disuccinic acid (EDDS) via improving metals bioavailability. The results indicated that the effects of metal elements highly depended on the supplemental concentrations. Trace metals supplemented under moderate concentrations greatly enhanced the methane yield. However, the excessive supplementation of Fe (1000 mg/L) and Ni (50 mg/L) exhibited the obvious toxicity to methanogens. The combinations of trace metals exhibited remarkable synergistic effects. The supplementation of Fe (100 mg/L) + Co (1 mg/L) + Mo (5 mg/L) + Ni (5 mg/L) obtained the greatest methane yield of 504 mL/g VSadded and the highest increment of 35.5% compared to the reactor without metals supplementation (372 mL/g VSadded). The changes of metals speciation showed the reduction of metals bioavailability during anaerobic digestion, which might weaken the stimulative effects of trace metals. However, the addition of EDDS improved metals bioavailability for microbial uptake and stimulated the activity of methanogens, and therefore, strengthened the stimulative effects of metals on anaerobic digestion of food waste. The batch and semi-continuous experiments confirmed that the addition of EDDS (20 mg/L) bonded to trace metals prior to their supplementation could obtain a 50% reduction of optimal metals dosage. This study provided a feasible method to reduce trace metals dosage without the degeneration of process performance of anaerobic digestion.

  6. Location, Location, Location: Development of Spatiotemporal Sequence Learning in Infancy

    ERIC Educational Resources Information Center

    Kirkham, Natasha Z.; Slemmer, Jonathan A.; Richardson, Daniel C.; Johnson, Scott P.


    We investigated infants' sensitivity to spatiotemporal structure. In Experiment 1, circles appeared in a statistically defined spatial pattern. At test 11-month-olds, but not 8-month-olds, looked longer at a novel spatial sequence. Experiment 2 presented different color/shape stimuli, but only the location sequence was violated during test;…

  7. Tissue-specific control elements of the Thy-1 gene.

    PubMed Central

    Vidal, M; Morris, R; Grosveld, F; Spanopoulou, E


    We have exploited the structural homology, but different patterns of expression of the murine and human Thy-1 genes to map a number of tissue-specific enhancer elements in the genes. All of these are located downstream from the site of transcriptional initiation. The human gene contains separate elements which direct expression to the kidney or spleen epithelium. The murine gene lacks these elements but instead contains a thymocyte specific enhancer in the third intron. Developmentally-regulated expression in nerve cells is directed (at least in part) by an atypical element in the first intron. The latter is active on heterologous promoters, but is position and distance dependent. Images Fig. 2. Fig. 4. Fig. 5. Fig. 6. PMID:1968831

  8. Enhancing community partnerships during a public health emergency: the school-located vaccination clinics model in Kanawha County, WV during the 2009 influenza A (H1N1) pandemic.


    Gupta, Rahul


    Broad based community support is vital in developing a comprehensive national strategy to protect the public's health prior to, during and after a disaster such as pandemic influenza. When disaster strikes, the successful response is often dependent upon the degree of collaboration, coordination, and shared decision making occurring among a wide-ranging group of public and private stakeholders in the community. Since these preparedness and response activities must occur at a local level, the degree to which a certain community can become resilient after an event is directly dependent upon the success of the response activities. In order to protect its citizens, the Kanawha-Charleston Health Department (KCHD) led a comprehensive community based response to the 2009 Influenza A (H1N1) pandemic. By organizing a high level strategic team consisting of major community stakeholders, KCHD was able to develop broad based community support for its mitigation and countermeasure delivery strategies. The timely enhancement of the existing community partnerships enabled us to successfully conduct several response activities with local community support including school-located vaccination (SLV) clinics. We describe the process, results and challenges faced during our SLV clinics campaign which resulted in exceptionally high vaccination rates for school aged children compared to other jurisdictions across the nation. We also discuss how such partnerships can be sustained resulting in resilient communities and mention some strategies for those contemplating such partnerships in future public health emergency.

  9. Transcription regulation by distal enhancers: who's in the loop?


    Stadhouders, Ralph; van den Heuvel, Anita; Kolovos, Petros; Jorna, Ruud; Leslie, Kris; Grosveld, Frank; Soler, Eric


    Genome-wide chromatin profiling efforts have shown that enhancers are often located at large distances from gene promoters within the noncoding genome. Whereas enhancers can stimulate transcription initiation by communicating with promoters via chromatin looping mechanisms, we propose that enhancers may also stimulate transcription elongation by physical interactions with intronic elements. We review here recent findings derived from the study of the hematopoietic system.

  10. The Ages, Metallicities, and Alpha Element Enhancements of Globular Clusters in the Elliptical NGC 5128: A Homogeneous Spectroscopic Study with Gemini/Gemini Multi-Object Spectrograph

    NASA Astrophysics Data System (ADS)

    Woodley, Kristin A.; Harris, William E.; Puzia, Thomas H.; Gómez, Matías; Harris, Gretchen L. H.; Geisler, Doug


    We present new integrated light spectroscopy of globular clusters (GCs) in NGC 5128, a nearby giant elliptical galaxy less than 4 Mpc away, in order to measure radial velocities and derive ages, metallicities, and alpha-element abundance ratios. Using the Gemini South 8 meter telescope with the instrument Gemini Multi-Object Spectrograph, we obtained spectroscopy in the range of ~3400-5700 Å for 72 GCs with a signal-to-noise ratio greater than 30 Å-1 and we have also discovered 35 new GCs within NGC 5128 from our radial velocity measurements. We measured and compared the Lick indices from Hδ A through Fe5406 with the single stellar population models of Thomas et al. in order to derive age, metallicity, and [α/Fe] values. We also measure Lick indices for 41 Milky Way GCs from Puzia et al. and Schiavon et al. with the same methodology for direct comparison. Our results show that 68% of the NGC 5128 GCs have old ages (>8 Gyr), 14% have intermediate ages (5-8 Gyr), and 18% have young ages (<5 Gyr). However, when we look at the metallicity of the GCs as a function of age, we find 92% of metal-poor GCs and 56% of metal-rich GCs in NGC 5128 have ages >8 Gyr, indicating that the majority of both metallicity subpopulations of GCs formed earlier, with a significant population of young and metal-rich GCs forming later. Our metallicity distribution function generated directly from spectroscopic Lick indices is clearly bimodal, as is the color distribution of the same set of GCs. Thus, the metallicity bimodality is real and not an artifact of the color to metallicity conversion. However, the metallicity distribution function obtained from comparison with the single stellar population models is consistent with a unimodal, bimodal, or multimodal shape. The [α/Fe] values are supersolar with a mean value of 0.14 ± 0.04, indicating a fast formation timescale. However, the GCs in NGC 5128 are not as [α/Fe] enhanced as the Milky Way GCs also examined in this study. Our measured

  11. Locating Continuing Education Programs.

    ERIC Educational Resources Information Center

    Mason, Robert C.


    Emphasizes program location as an important component of the marketing plan for continuing education. Also discusses relations among program location and quality, costs, supportive services, and economies of scale. (CH)

  12. Cable-fault locator

    NASA Technical Reports Server (NTRS)

    Cason, R. L.; Mcstay, J. J.; Heymann, A. P., Sr.


    Inexpensive system automatically indicates location of short-circuited section of power cable. Monitor does not require that cable be disconnected from its power source or that test signals be applied. Instead, ground-current sensors are installed in manholes or at other selected locations along cable run. When fault occurs, sensors transmit information about fault location to control center. Repair crew can be sent to location and cable can be returned to service with minimum of downtime.

  13. Chemistry of superheavy elements.


    Schädel, Matthias


    The number of chemical elements has increased considerably in the last few decades. Most excitingly, these heaviest, man-made elements at the far-end of the Periodic Table are located in the area of the long-awaited superheavy elements. While physical techniques currently play a leading role in these discoveries, the chemistry of superheavy elements is now beginning to be developed. Advanced and very sensitive techniques allow the chemical properties of these elusive elements to be probed. Often, less than ten short-lived atoms, chemically separated one-atom-at-a-time, provide crucial information on basic chemical properties. These results place the architecture of the far-end of the Periodic Table on the test bench and probe the increasingly strong relativistic effects that influence the chemical properties there. This review is focused mainly on the experimental work on superheavy element chemistry. It contains a short contribution on relativistic theory, and some important historical and nuclear aspects.

  14. 40 CFR 141.703 - Sampling locations.

    Code of Federal Regulations, 2012 CFR


    ... 141.703 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Enhanced Treatment for Cryptosporidium Source Water Monitoring Requirements § 141.703 Sampling locations. (a) Systems required to conduct source water...

  15. It's elemental

    NASA Astrophysics Data System (ADS)

    The Periodic Table of the elements will now have to be updated. An international team of researchers has added element 110 to the Earth's armory of elements. Though short-lived—of the order of microseconds, element 110 bottoms out the list as the heaviest known element on the planet. Scientists at the Heavy Ion Research Center in Darmstadt, Germany, made the 110-proton element by colliding a lead isotope with nickel atoms. The element, which is yet to be named, has an atomic mass of 269.

  16. Efficient transcription from the rice tungro bacilliform virus promoter requires elements downstream of the transcription start site.

    PubMed Central

    Chen, G; Rothnie, H M; He, X; Hohn, T; Fütterer, J


    Elements downstream of the transcription start site enhance the activity of the rice tungro bacilliform virus (RTBV) promoter in protoplasts derived from cultured rice cells. This enhancer region was located to the first 90 nucleotides of the RTBV leader sequence. Within this region, at least two components which act together to enhance expression from the RTBV promoter could be identified. One is a position- and orientation-independent DNA element within a CT-rich region, and the other is a position-dependent element. Either element was found to be capable of acting independently on a heterologous promoter. The enhancer activity of the DNA element correlates with specific binding of nuclear proteins. Nuclear proteins also recognize an RNA transcript covering the first 90 nucleotides of the RTBV leader. PMID:8970962

  17. Determinants of first practice location

    PubMed Central

    Raghavan, Malathi; Fleisher, William; Downs, Allan; Martin, Bruce; Sandham, J. Dean


    their first practice location, regardless of graduates’ rating of the importance of being near family or friends. Graduates’ narratives provided insights into the complexities of choosing practice locations and enhanced the interpretive and theoretical validity of the study findings. More extensive studies involving all Canadian residents could further define the role residency location plays in physician practice location. PMID:23152474

  18. The business of deubiquitination – location, location, location

    PubMed Central

    Coyne, Erin S.; Wing, Simon S.


    A majority of proteins in the cell can be modified by ubiquitination, thereby altering their function or stability. This ubiquitination is controlled by both ubiquitinating and deubiquitinating enzymes (DUBs). The number of ubiquitin ligases exceeds that of DUBs by about eightfold, indicating that DUBs may have much broader substrate specificity. Despite this, DUBs have been shown to have quite specific physiological functions. This functional specificity is likely due to very precise regulation of activity arising from the sophisticated use of all mechanisms of enzyme regulation. In this commentary, we briefly review key features of DUBs with more emphasis on regulation. In particular, we focus on localization of the enzymes as a critical regulatory mechanism which when integrated with control of expression, substrate activation, allosteric regulation, and post-translational modifications results in precise spatial and temporal deubiquitination of proteins and therefore specific physiological functions. Identification of compounds that target the structural elements in DUBs that dictate localization may be a more promising approach to development of drugs with specificity of action than targeting the enzymatic activity, which for most DUBs is dependent on a thiol group that can react non-specifically with many compounds in large-scale screening. PMID:26918171

  19. Laser-assisted manufacturing of micro-optical volume elements for enhancing the amount of light absorbed by solar cells in photovoltaic modules

    NASA Astrophysics Data System (ADS)

    Peharz, Gerhard; Kuna, Ladislav; Leiner, Claude


    The laser-generation of micro-optical volume elements is a promising approach to decrease the optical shadowing of front side metal contacts of solar cells. Focusing a femtosecond laser beam into the volume of the encapsulation material causes a local modification its optical constants. Suchlike fabricated micro-optical elements can be used to decrease the optical shadowing of the front side metallization of c-Si solar cells. Test samples comprising of a sandwich structure of a glass sheet with metallic grid-lines, an Ethylene-vinyl acetate (EVA) encapsulant and another glass sheet were manufactured in order to investigate the optical performance of the volume optics. Transmission measurements show that the shadowing of the metalling grid-lines is substantially decreased by the micro-optical volume elements created in the EVA bulk right above the grid-fingers. A detailed investigation of the optical properties of these volume elements was performed: (i) experimentally on the basis of goniometric measurements, as well as (ii) theoretically by applying optical modelling and optimization procedures. This resulted in a better understanding of the effectiveness of the optical volume elements in decreasing the optical shadowing of metal grid lines on the active cell surfaces. Moreover, results of photovoltaic mini-modules with incorporated micro-optical volume elements are presented. Results of optical simulation and Laser Beam Induced Current (LBIC) experiments show that the losses due to the grid fingers can be reduced by about 50%, when using this fs-laser structuring approach for the fabrication of micro-optical volume elements in the EVA material.



    Hurford, W.J.; Gordon, R.B.; Johnson, W.A.


    A sandwich-type fuel element for a reactor is described. This fuel element has the shape of an elongated flat plate and includes a filler plate having a plurality of compartments therein in which the fuel material is located. The filler plate is clad on both sides with a thin cladding material which is secured to the filler plate only to completely enclose the fuel material in each compartment. (AEC)



    Wigner, E.P.; Szilard, L.; Creutz, E.C.


    These fuel elements are comprised of a homogeneous metallic uranium body completely enclosed and sealed in an aluminum cover. The uranium body and aluminum cover are bonded together by a layer of zinc located between them. The bonding layer serves to improve transfer of heat, provides an additional protection against corrosion of the uranium by the coolant, and also localizes any possible corrosion by preventing travel of corrosive material along the surface of the fuel element.

  2. Competitive inhibition and selectivity enhancement by Ca in the uptake of inorganic elements (Be, Na, Mg, K, Ca, Sc, Mn, Co, Zn, Se, Rb, Sr, Y, Zr, Ce, Pm, Gd, Hf) by carrot (Daucus carota cv. U.S. harumakigosun).


    Ozaki, Takuo; Ambe, Shizuko; Abe, Tomoko; Francis, Arokiasamy J


    We investigated the uptake of inorganic elements (Be, Na, Mg, K, Ca, Sc, Mn, Co, Zn, Se, Rb, Sr, Y, Zr, Ce, Pm, Gd, and Hf) and the effect of Ca on their uptake in carrots (Daucus carota cv. U.S. harumakigosun) by the radioactive multitracer technique. The experimental results suggested that Na, Mg, K, and Rb competed for the functional groups outside the cells in roots with Ca but not for the transporter-binding sites on the plasma membrane of the root cortex cells. In contrast, Y, Ce, Pm, and Gd competed with Ca for the transporters on the plasma membrane. The selectivity, which was defined as the value obtained by dividing the concentration ratio of an elemental pair, K/Na, Rb/Na, Be/Sr, and Mg/Sr, in the presence of 0.2 and 2 ppm Ca by that of the corresponding elemental pair in the absence of Ca in the solution was estimated. The selectivity of K and Rb in roots was increased in the presence of Ca. The selectivity of Be in roots was not affected, whereas the selectivity of Mg was increased by Ca. These observations suggest that the presence of Ca in the uptake solution enhances the selectivity in the uptake of metabolically important elements against unwanted elements. PMID:15695849

  3. Testing of Cis-Regulatory Elements by Targeted Transgene Integration in Zebrafish Using PhiC31 Integrase.


    Hadzhiev, Yavor; Miguel-Escalada, Irene; Balciunas, Darius; Müller, Ferenc


    Herein we present several strategies for testing the function of cis-regulatory elements using the PhiC31 integrase system. Firstly, we present two different strategies to analyze the activity of candidate enhancer elements. Targeted integration of candidate enhancers into the same genomic location circumvents the variability-associated random integration and position effects. This method is suitable for testing of candidate enhancers identified through computational or other analyses a priori. Secondly, we present methodology for targeted integration of BACs into the same genomic location(s). By using additional reporters integrated into a BAC, this enables experimental testing whether cis-regulatory elements are functional in the sequence inserted in the BAC. PMID:27464802

  4. Reversible micromachining locator


    Salzer, Leander J.; Foreman, Larry R.


    This invention provides a device which includes a locator, a kinematic mount positioned on a conventional tooling machine, a part carrier disposed on the locator and a retainer ring. The locator has disposed therein a plurality of steel balls, placed in an equidistant position circumferentially around the locator. The kinematic mount includes a plurality of magnets which are in registry with the steel balls on the locator. In operation, a blank part to be machined is placed between a surface of a locator and the retainer ring (fitting within the part carrier). When the locator (with a blank part to be machined) is coupled to the kinematic mount, the part is thus exposed for the desired machining process. Because the locator is removably attachable to the kinematic mount, it can easily be removed from the mount, reversed, and reinserted onto the mount for additional machining. Further, the locator can likewise be removed from the mount and placed onto another tooling machine having a properly aligned kinematic mount. Because of the unique design and use of magnetic forces of the present invention, positioning errors of less than 0.25 micrometer for each machining process can be achieved.

  5. Reversible micromachining locator


    Salzer, L.J.; Foreman, L.R.


    This invention provides a device which includes a locator, a kinematic mount positioned on a conventional tooling machine, a part carrier disposed on the locator and a retainer ring. The locator has disposed therein a plurality of steel balls, placed in an equidistant position circumferentially around the locator. The kinematic mount includes a plurality of magnets which are in registry with the steel balls on the locator. In operation, a blank part to be machined is placed between a surface of a locator and the retainer ring (fitting within the part carrier). When the locator (with a blank part to be machined) is coupled to the kinematic mount, the part is thus exposed for the desired machining process. Because the locator is removably attachable to the kinematic mount, it can easily be removed from the mount, reversed, and reinserted onto the mount for additional machining. Further, the locator can likewise be removed from the mount and placed onto another tooling machine having a properly aligned kinematic mount. Because of the unique design and use of magnetic forces of the present invention, positioning errors of less than 0.25 micrometer for each machining process can be achieved. 7 figs.

  6. Object locating system


    Novak, James L.; Petterson, Ben


    A sensing system locates an object by sensing the object's effect on electric fields. The object's effect on the mutual capacitance of electrode pairs varies according to the distance between the object and the electrodes. A single electrode pair can sense the distance from the object to the electrodes. Multiple electrode pairs can more precisely locate the object in one or more dimensions.

  7. Reversible micromachining locator


    Salzer, Leander J.; Foreman, Larry R.


    A locator with a part support is used to hold a part onto the kinematic mount of a tooling machine so that the part can be held in or replaced in exactly the same position relative to the cutting tool for machining different surfaces of the part or for performing different machining operations on the same or different surfaces of the part. The locator has disposed therein a plurality of steel balls placed at equidistant positions around the planar surface of the locator and the kinematic mount has a plurality of magnets which alternate with grooves which accommodate the portions of the steel balls projecting from the locator. The part support holds the part to be machined securely in place in the locator. The locator can be easily detached from the kinematic mount, turned over, and replaced onto the same kinematic mount or another kinematic mount on another tooling machine without removing the part to be machined from the locator so that there is no need to touch or reposition the part within the locator, thereby assuring exact replication of the position of the part in relation to the cutting tool on the tooling machine for each machining operation on the part.

  8. Cooperativity between the J and S elements of class II major histocompatibility complex genes as enhancers in normal and class II- negative patient and mutant B cell lines

    PubMed Central


    The class II major histocompatibility complex genes all contain in their proximal promoters three cis-elements called S, X, and Y that are conserved in both sequence and position, and a fourth element, J, conserved in sequence but not in position. J, X, and Y and, to some extent, S, have been shown to be functionally important in regulation of expression of these genes. In the present study, a protein factor that binds cooperatively to the S plus J elements of the promoter of the class II major histocompatibility complex gene DPA has been detected. Moreover, functional cooperativity between S and J in activation of the enhancerless -40 interferon-beta (-40 IFN-beta) promoter has been demonstrated. Finally, the latter assay appears to subdivide complementation group A of class II negative human B cell lines that includes both mutants generated in vitro and cells from patients with the bare lymphocyte syndrome (type II). In three of these cell lines, the enhancerless -40 IFN-beta promoter containing the S plus J elements was functionally active, while in the others it was inactive. PMID:7790817

  9. Tumor necrosis factor alpha induces proteins that bind specifically to kappa B-like enhancer elements and regulate interleukin 2 receptor alpha-chain gene expression in primary human T lymphocytes.

    PubMed Central

    Lowenthal, J W; Ballard, D W; Böhnlein, E; Greene, W C


    We have investigated the biochemical basis for the activation of interleukin 2 receptor alpha-subunit (IL-2R alpha) gene expression in primary human T lymphocytes by a cytokine (tumor necrosis factor alpha), a T-cell mitogen (phorbol 12-myristate 13-acetate), and the transactivator protein (Tax) from the type I human T-cell leukemia virus. Using in vivo transfection techniques specificially designed for these primary T cells in conjunction with in vitro gel retardation and DNA footprinting assays, we found that activation of the IL-2R alpha promoter by each of these agents involves the induction of nuclear proteins that specifically interact with a kappa B-like enhancer element (i.e., an element resembling the immunoglobulin kappa-chain enhancer sequence recognized by transcription factor NF-kappa B). DNA-protein crosslinking studies revealed that primary T cells express at least three different inducible DNA-binding proteins (50-55, 70-75, and 80-90 kDa) that specifically interact with this IL-2R alpha kappa B element. Images PMID:2494663

  10. Elemental ZOO

    NASA Astrophysics Data System (ADS)

    Helser, Terry L.


    This puzzle uses the symbols of 39 elements to spell the names of 25 animals found in zoos. Underlined spaces and the names of the elements serve as clues. To solve the puzzle, students must find the symbols that correspond to the elemental names and rearrange them into the animals' names.

  11. Direct mapping of nuclear shell effects in the heaviest elements.


    Minaya Ramirez, E; Ackermann, D; Blaum, K; Block, M; Droese, C; Düllmann, Ch E; Dworschak, M; Eibach, M; Eliseev, S; Haettner, E; Herfurth, F; Heßberger, F P; Hofmann, S; Ketelaer, J; Marx, G; Mazzocco, M; Nesterenko, D; Novikov, Yu N; Plaß, W R; Rodríguez, D; Scheidenberger, C; Schweikhard, L; Thirolf, P G; Weber, C


    Quantum-mechanical shell effects are expected to strongly enhance nuclear binding on an "island of stability" of superheavy elements. The predicted center at proton number Z = 114, 120, or 126 and neutron number N = 184 has been substantiated by the recent synthesis of new elements up to Z = 118. However, the location of the center and the extension of the island of stability remain vague. High-precision mass spectrometry allows the direct measurement of nuclear binding energies and thus the determination of the strength of shell effects. Here, we present such measurements for nobelium and lawrencium isotopes, which also pin down the deformed shell gap at N = 152.

  12. Direct mapping of nuclear shell effects in the heaviest elements.


    Minaya Ramirez, E; Ackermann, D; Blaum, K; Block, M; Droese, C; Düllmann, Ch E; Dworschak, M; Eibach, M; Eliseev, S; Haettner, E; Herfurth, F; Heßberger, F P; Hofmann, S; Ketelaer, J; Marx, G; Mazzocco, M; Nesterenko, D; Novikov, Yu N; Plaß, W R; Rodríguez, D; Scheidenberger, C; Schweikhard, L; Thirolf, P G; Weber, C


    Quantum-mechanical shell effects are expected to strongly enhance nuclear binding on an "island of stability" of superheavy elements. The predicted center at proton number Z = 114, 120, or 126 and neutron number N = 184 has been substantiated by the recent synthesis of new elements up to Z = 118. However, the location of the center and the extension of the island of stability remain vague. High-precision mass spectrometry allows the direct measurement of nuclear binding energies and thus the determination of the strength of shell effects. Here, we present such measurements for nobelium and lawrencium isotopes, which also pin down the deformed shell gap at N = 152. PMID:22878498

  13. Sensors Locate Radio Interference

    NASA Technical Reports Server (NTRS)


    After receiving a NASA Small Business Innovation Research (SBIR) contract from Kennedy Space Center, Soneticom Inc., based in West Melbourne, Florida, created algorithms for time difference of arrival and radio interferometry, which it used in its Lynx Location System (LLS) to locate electromagnetic interference that can disrupt radio communications. Soneticom is collaborating with the Federal Aviation Administration (FAA) to install and test the LLS at its field test center in New Jersey in preparation for deploying the LLS at commercial airports. The software collects data from each sensor in order to compute the location of the interfering emitter.

  14. Finite element simulation of a perturbed axial-symmetric whispering-gallery mode and its use for intensity enhancement with a nanoparticle coupled to a microtoroid.


    Kaplan, Alex; Tomes, Matthew; Carmon, Tal; Kozlov, Maxim; Cohen, Oren; Bartal, Guy; Schwefel, Harald G L


    We present an optical mode solver for a whispering gallery resonator coupled to an adjacent arbitrary shaped nano-particle that breaks the axial symmetry of the resonator. Such a hybrid resonator-nanoparticle is similar to what was recently used for bio-detection and for field enhancement. We demonstrate our solver by parametrically studying a toroid-nanoplasmonic device and get the optimal nano-plasmonic size for maximal enhancement. We investigate cases near a plasmonic resonance as well as far from a plasmonic resonance. Unlike common plasmons that typically benefit from working near their resonance, here working far from plasmonic resonance provides comparable performance. This is because the plasmonic resonance enhancement is accompanied by cavity quality degradation through plasmonic absorption.

  15. Substantial enhancement in intrinsic coercivity on M-type strontium hexaferrite through the increase in magneto-crystalline anisotropy by co-doping of group-V and alkali elements

    SciTech Connect

    Ahn, Kyunghan Ryu, Byungki; Korolev, Dmitry; Jae Kang, Young


    The effect of d{sup 1} impurity doping in Sr-hexaferrite (SrM) on the magnetic anisotropy is investigated. First-principles calculations revealed that group-V elements (V, Nb) are stabilized with co-doping of alkali elements. Na{sup 1+}/K{sup 1+} doping at Sr{sup 2+}-site is found to be critical to form the d{sup 1} impurities at Fe-site. Experimentally, Na–V doped SrM shows the intrinsic coercivity of ∼5.4 kOe, which is ∼300% enhancement compared to undoped SrM and comparable value to La–Co co-doped SrM. Finally, the spin-orbit coupling from non-vanishing angular momentum of d{sup 1} impurity in SrM should be a main factor for such a substantial improvement of intrinsic coercivity.

  16. Societal-Equity-Enhancing Criteria and Facility-Host Incentives Supporting Five Key Elements in the January 2012 Blue Ribbon Commission Report - 13015

    SciTech Connect

    Eriksson, Leif G.; Dials, George E.; George, Critz H.


    In February 2009, the Obama Administration announced it would abandon USA's only candidate SNF/HLW-disposal facility since 1987. In 2010, all related activities were stopped and the Blue Ribbon Commission on America's Nuclear Future was established 'to recommend a new strategy for managing the back end of the nuclear fuel cycle', which it did in January 2012, emphasizing eight key elements. However, Key Element 1, 'A new, consent-based approach to siting future nuclear facilities', is qualitative/indeterminate rather than quantitative/measurable. It is thus highly-susceptible to semantic permutations that could extend rather than, as intended, expedite the siting of future nuclear facilities unless it also defines: a) Whose consent is needed?; and b) What constitutes consent? The following 'generic', radiation-risk- and societal-equity-based criteria address these questions: 1. Identify areas affected by projected radiation and other health risks from: a. The proposed nuclear facility (facility stakeholders); and b. The related nuclear-materials-transportation routes (transportation stakeholders); then 2. Surround each stakeholder area with a buffer zone and use this enlarged foot print to identify: a. Stakeholder hosts; and b. Areas not hosting any stakeholder category (interested parties). 3. Define 'consent-based' as being at least 60 percent of the 'population' in the respective stakeholder category and apply this yardstick to both 'in favor' and 'against' votes. Although criteria 1 and 2 also need facility-based definitions to make Key Element 1 measurable, the described siting approach, augmented by related facility-host incentives, would expedite the schedule and reduce the cost for achieving Key Elements 4-6 and 8, politics permitting. (authors)

  17. Active control of multi-element rotor blade airfoils

    NASA Technical Reports Server (NTRS)

    Torok, Michael S. (Inventor); Moffitt, Robert C. (Inventor); Bagai, Ashish (Inventor)


    A multi-element rotor blade includes an individually controllable main element and fixed aerodynamic surface in an aerodynamically efficient location relative to the main element. The main element is controlled to locate the fixed aerodynamic surface in a position to increase lift and/or reduce drag upon the main element at various azimuthal positions during rotation.

  18. Object locating system


    Novak, J.L.; Petterson, B.


    A sensing system locates an object by sensing the object`s effect on electric fields. The object`s effect on the mutual capacitance of electrode pairs varies according to the distance between the object and the electrodes. A single electrode pair can sense the distance from the object to the electrodes. Multiple electrode pairs can more precisely locate the object in one or more dimensions. 12 figs.

  19. Lunar Impact Flash Locations

    NASA Technical Reports Server (NTRS)

    Moser, D. E.; Suggs, R. M.; Kupferschmidt, L.; Feldman, J.


    A bright impact flash detected by the NASA Lunar Impact Monitoring Program in March 2013 brought into focus the importance of determining the impact flash location. A process for locating the impact flash, and presumably its associated crater, was developed using commercially available software tools. The process was successfully applied to the March 2013 impact flash and put into production on an additional 300 impact flashes. The goal today: provide a description of the geolocation technique developed.

  20. Maps, codes, and sequence elements: can we predict the protein output from an alternatively spliced locus?


    Sharma, Shalini; Black, Douglas L


    Alternative splicing choices are governed by splicing regulatory protein interactions with splicing silencer and enhancer elements present in the pre-mRNA. However, the prediction of these choices from genomic sequence is difficult, in part because the regulators can act as either enhancers or silencers. A recent study describes how for a particular neuronal splicing regulatory protein, Nova, the location of its binding sites is highly predictive of the protein's effect on an exon's splicing.

  1. Identification of GATA2 and AP-1 activator elements within the enhancer VNTR occurring in intron 5 of the human SIRT3 gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Human SIRT3 gene contains an intronic VNTR enhancer. A T > C transition occurring in the second repeat of each VNTR allele implies the presence/absence of a putative GATA binding motif. A partially overlapping AP-1 site, not affected by the transition, was also identified. Aims of the present study ...

  2. Enhanced negative thermal expansion in La(1-x)Pr(x)Fe10.7Co0.8Si1.5 compounds by doping the magnetic rare-earth element praseodymium.


    Li, Wen; Huang, Rongjin; Wang, Wei; Tan, Jie; Zhao, Yuqiang; Li, Shaopeng; Huang, Chuanjun; Shen, Jun; Li, Laifeng


    Experiments have been performed to enhance negative thermal expansion (NTE) in the La(Fe,Co,Si)13-based compounds by optimizing the chemical composition, i.e., proper substitution of La by magnetic element Pr. It is found that increasing the absolute value of the average coefficient of thermal expansion (CTE) in the NTE temperature region (200-300 K) attributes to enhancement of the spontaneous magnetization and its growth rate with increasing Pr content. Typically, the average CTE of La(1-x)Pr(x)Fe10.7Co0.8Si1.5 with x = 0.5 reaches as large as -38.5 × 10(-6) K(-1) between 200 and 300 K (ΔT = 100 K), which is 18.5% larger than that of x = 0. The present results highlight the potential applications of La(Fe,Co,Si)13-based compounds with a larger NTE coefficient.

  3. Enhanced negative thermal expansion in La(1-x)Pr(x)Fe10.7Co0.8Si1.5 compounds by doping the magnetic rare-earth element praseodymium.


    Li, Wen; Huang, Rongjin; Wang, Wei; Tan, Jie; Zhao, Yuqiang; Li, Shaopeng; Huang, Chuanjun; Shen, Jun; Li, Laifeng


    Experiments have been performed to enhance negative thermal expansion (NTE) in the La(Fe,Co,Si)13-based compounds by optimizing the chemical composition, i.e., proper substitution of La by magnetic element Pr. It is found that increasing the absolute value of the average coefficient of thermal expansion (CTE) in the NTE temperature region (200-300 K) attributes to enhancement of the spontaneous magnetization and its growth rate with increasing Pr content. Typically, the average CTE of La(1-x)Pr(x)Fe10.7Co0.8Si1.5 with x = 0.5 reaches as large as -38.5 × 10(-6) K(-1) between 200 and 300 K (ΔT = 100 K), which is 18.5% larger than that of x = 0. The present results highlight the potential applications of La(Fe,Co,Si)13-based compounds with a larger NTE coefficient. PMID:24848739

  4. Catalase-Loaded TaOx Nanoshells as Bio-Nanoreactors Combining High-Z Element and Enzyme Delivery for Enhancing Radiotherapy.


    Song, Guosheng; Chen, Yuyan; Liang, Chao; Yi, Xuan; Liu, Jingjing; Sun, Xiaoqi; Shen, Sida; Yang, Kai; Liu, Zhuang


    A novel type of bio-nanoreactor with catalase loaded inside TaOx hollow nanoshells is fabricated via a mild one-step method. Such bio-nanoreactors could efficiently improve the tumor oxygenation by supplying oxygen via decomposition of endogenic H2 O2 in a tumor microenvironment, and thus synergistically enhance the efficacy of cancer radiotherapy by both depositing radiation energy within the tumor and overcoming hypoxia-induced radiotherapy resistance.

  5. Catalase-Loaded TaOx Nanoshells as Bio-Nanoreactors Combining High-Z Element and Enzyme Delivery for Enhancing Radiotherapy.


    Song, Guosheng; Chen, Yuyan; Liang, Chao; Yi, Xuan; Liu, Jingjing; Sun, Xiaoqi; Shen, Sida; Yang, Kai; Liu, Zhuang


    A novel type of bio-nanoreactor with catalase loaded inside TaOx hollow nanoshells is fabricated via a mild one-step method. Such bio-nanoreactors could efficiently improve the tumor oxygenation by supplying oxygen via decomposition of endogenic H2 O2 in a tumor microenvironment, and thus synergistically enhance the efficacy of cancer radiotherapy by both depositing radiation energy within the tumor and overcoming hypoxia-induced radiotherapy resistance. PMID:27275921

  6. Multiple elements in human beta-globin locus control region 5' HS 2 are involved in enhancer activity and position-independent, transgene expression.

    PubMed Central

    Caterina, J J; Ciavatta, D J; Donze, D; Behringer, R R; Townes, T M


    The human beta-globin Locus Control Region (LCR) has two important activities. First, the LCR opens a 200 kb chromosomal domain containing the human epsilon-, gamma- and beta-globin genes and, secondly, these sequences function as a powerful enhancer of epsilon-, gamma- and beta-globin gene expression. Erythroid-specific, DNase I hypersensitive sites (HS) mark sequences that are critical for LCR activity. Previous experiments demonstrated that a 1.9 kb fragment containing the 5' HS 2 site confers position-independent expression in transgenic mice and enhances human beta-globin gene expression 100-fold. Further analysis of this region demonstrates that multiple sequences are required for maximal enhancer activity; deletion of SP1, NF-E2, GATA-1 or USF binding sites significantly decrease beta-globin gene expression. In contrast, no single site is required for position-independent transgene expression; all mice with site-specific mutations in 5' HS 2 express human beta-globin mRNA regardless of the site of transgene integration. Apparently, multiple combinations of protein binding sites in 5' HS 2 are sufficient to prevent chromosomal position effects that inhibit transgene expression. PMID:8152905

  7. Locating Materials using Computer Database Technology

    ERIC Educational Resources Information Center

    Kissock, Craig; Lopez, A. A.


    Describes the development and contents of a computer database which helps social studies educators identify available curriculum materials. Materials can be located by using one or a combination of the following elements: Acquisition number, publisher, institution or sponsor, author, title, grade level, copyright date, cost, number of pages, and…

  8. Geostar - Navigation location system

    NASA Astrophysics Data System (ADS)

    Keyser, Donald A.

    The author describes the Radiodetermination Satellite Service (RDSS). The initial phase of the RDSS provides for a unique service enabling central offices and headquarters to obtain position-location information and receive short digital messages from mobile user terminals throughout the contiguous United States, southern Canada, and northern Mexico. The system employs a spread-spectrum, CDMA modulation technique allowing multiple customers to use the system simultaneously, without preassigned coordination with fellow users. Position location is currently determined by employing an existing radio determination receiver, such as Loran-C, GPS, or Transit, in the mobile user terminal. In the early 1990s position location will be determined at a central earth station by time-differential ranging of the user terminals via two or more geostationary satellites. A brief overview of the RDSS system architecture is presented with emphasis on the user terminal and its diverse applications.

  9. Marine cable location system

    SciTech Connect

    Zachariadis, R.G.


    An acoustic positioning system locates a marine cable at an exploration site, such cable employing a plurality of hydrophones at spaced-apart positions along the cable. A marine vessel measures water depth to the cable as the vessel passes over the cable and interrogates the hydrophones with sonar pulses along a slant range as the vessel travels in a parallel and horizontally offset path to the cable. The location of the hydrophones is determined from the recordings of water depth and slant range.

  10. Telemetry location error in a forested habitat

    USGS Publications Warehouse

    Chu, D.S.; Hoover, B.A.; Fuller, M.R.; Geissler, P.H.; Amlaner, Charles J.


    The error associated with locations estimated by radio-telemetry triangulation can be large and variable in a hardwood forest. We assessed the magnitude and cause of telemetry location errors in a mature hardwood forest by using a 4-element Yagi antenna and compass bearings toward four transmitters, from 21 receiving sites. The distance error from the azimuth intersection to known transmitter locations ranged from 0 to 9251 meters. Ninety-five percent of the estimated locations were within 16 to 1963 meters, and 50% were within 99 to 416 meters of actual locations. Angles with 20o of parallel had larger distance errors than other angles. While angle appeared most important, greater distances and the amount of vegetation between receivers and transmitters also contributed to distance error.

  11. Micro optical spatial and spectral elements (MOSSE)

    NASA Astrophysics Data System (ADS)

    Srinivasan, Pradeep; Yilmaz, Yigit O.; Johnson, Eric G.


    Interference transmission filters that have a defect layer incorporated photonic crystal structure provide a narrow transmission notch within a wide stop band. The location and width of transmission notch can be tuned by changing the thickness of the defect layer. In this paper, we propose and implement interference filters with defect layers patterned with diffractive optical elements. The spectral transmission is a function of the local defect layer thickness while the spatial transmission follows contours of equal optical thickness. The novel devices have multiplexed spectral and spatial transmission characteristics. Alternating layers of silicon oxide (SiOx) and silicon nitride (SixNy) were grown onto a clean silicon substrate using plasma enhanced chemical vapor deposition (PECVD). A thick defect layer of SiOx was grown and the wafer was removed from the growth chamber. The wafer was then patterned with charge 2, 8-level vortex structures on a GCA 6300 g-line stepper tool. The devices were interrogated with a collimated beam from a tunable laser source that operates from 1520 nm to 1630 nm. The spectral transmission was measured by separately illuminating each level of diffractive element and the spatial transmission was imaged on to a CCD camera. Spectral transmission peaks whose location varies as a function of level height were obtained. The spatial transmission profiles consist of triangular zones with wavelength dependent orientation. The elements have potential applications in hyper spectral imaging, pupil filtering, and engineered illumination systems.

  12. Elemental health

    SciTech Connect

    Tonneson, L.C.


    Trace elements used in nutritional supplements and vitamins are discussed in the article. Relevant studies are briefly cited regarding the health effects of selenium, chromium, germanium, silicon, zinc, magnesium, silver, manganese, ruthenium, lithium, and vanadium. The toxicity and food sources are listed for some of the elements. A brief summary is also provided of the nutritional supplements market.

  13. Location of Geothermal Resources

    SciTech Connect


    Geothermal resources, which utilize the heat of the earth, are located throughout the plant's crust. Those closer to the surface are most commonly used because geothermal drilling costs are currently prohibitive below depths of between 10,000 and 15,000 feet.

  14. Birefringent Stress Location Sensor

    NASA Astrophysics Data System (ADS)

    Franks, R. B.; Torruellas, W.; Youngquist, R. C.


    A new type of stress location sensor is discussed in which the FMCW technique is used to detect the difference in propagation time between two optical paths in an optical fiber due to stress induced modal coupling. Two versions of the system are included, and experimental results are presented for each system.


    EPA Science Inventory

    A simple method to locate changes in vegetation cover, which can be used to identify areas under stress. The method only requires inexpensive NDVI data. The use of remotely sensed data is far more cost-effective than field studies and can be performed more quickly. Local knowledg...

  16. Particle impact location detector

    NASA Technical Reports Server (NTRS)

    Auer, S. O.


    Detector includes delay lines connected to each detector surface strip. When several particles strike different strips simultaneously, pulses generated by each strip are time delayed by certain intervals. Delay time for each strip is known. By observing time delay in pulse, it is possible to locate strip that is struck by particle.

  17. The use of roving discs and orthogonal natural frequencies for crack identification and location in rotors

    NASA Astrophysics Data System (ADS)

    Haji, Zyad N.; Olutunde Oyadiji, S.


    A variety of approaches that have been developed for the identification and localisation of cracks in a rotor system, which exploit natural frequencies, require a finite element model to obtain the natural frequencies of the intact rotor as baseline data. In fact, such approaches can give erroneous results about the location and depth of a crack if an inaccurate finite element model is used to represent an uncracked model. A new approach for the identification and localisation of cracks in rotor systems, which does not require the use of the natural frequencies of an intact rotor as a baseline data, is presented in this paper. The approach, named orthogonal natural frequencies (ONFs), is based only on the natural frequencies of the non-rotating cracked rotor in the two lateral bending vibration x-z and y-z planes. The approach uses the cracked natural frequencies in the horizontal x-z plane as the reference data instead of the intact natural frequencies. Also, a roving disc is traversed along the rotor in order to enhance the dynamics of the rotor at the cracked locations. At each spatial location of the roving disc, the two ONFs of the rotor-disc system are determined from which the corresponding ONF ratio is computed. The ONF ratios are normalised by the maximum ONF ratio to obtain normalised orthogonal natural frequency curves (NONFCs). The non-rotating cracked rotor is simulated by the finite element method using the Bernoulli-Euler beam theory. The unique characteristics of the proposed approach are the sharp, notched peaks at the crack locations but rounded peaks at non-cracked locations. These features facilitate the unambiguous identification and locations of cracks in rotors. The effects of crack depth, crack location, and mass of a roving disc are investigated. The results show that the proposed method has a great potential in the identification and localisation of cracks in a non-rotating cracked rotor.

  18. Sequences upstream of the homologous cis-elements of the Adh adult enhancer of Drosophila are required for maximal levels of Adh gene transcription in adults of Scaptodrosophila lebanonensis.

    PubMed Central

    Papaceit, Montserrat; Orengo, Dorcas; Juan, Elvira


    The evolution of cis-regulatory elements is of particular interest for our understanding of the evolution of gene regulation. The Adh gene of Drosophilidae shows interspecific differences in tissue-specific expression and transcript levels during development. In Scaptodrosophila lebanonensis adults, the level of distal transcripts is maximal between the fourth and eighth day after eclosion and is around five times higher than that in D. melanogaster Adh(S). To examine whether these quantitative differences are regulated by sequences lying upstream of the distal promoter, we performed in vitro deletion mutagenesis of the Adh gene of S. lebanonensis, followed by P-element-mediated germ-line transformation. All constructs included, as a cotransgene, a modified Adh gene of D. melanogaster (dAdh) in a fixed position and orientation that acted as a chromosomal position control. Using this approach, we have identified a fragment of 1.5 kb in the 5' region, 830 bp upstream of the distal start site, which is required to achieve maximal levels of distal transcript in S. lebanonensis. The presence of this fragment produces a 3.5-fold higher level of distal mRNA (as determined by real time quantitative PCR) compared with the D. melanogaster dAdh cotransgene. This region contains the degenerated end of a minisatellite sequence expanding farther upstream and does not correspond to the Adh adult enhancer (AAE) of D. melanogaster. Indeed, the cis-regulatory elements of the AAE have been identified by phylogenetic footprinting within the region 830 bp upstream of the distal start site of S. lebanonensis. Furthermore, the deletions Delta-830 and Delta-2358 yield the same pattern of tissue-specific expression, indicating that all tissue-specific elements are contained within the region 830 bp upstream of the distal start site. PMID:15166155

  19. Interferometric locating system

    NASA Technical Reports Server (NTRS)

    Macdoran, P. F. (Inventor)


    A system is described for determining the position of a vehicle or other target that emits radio waves and which is of the type that senses the difference in time of arrival at spaced ground stations of signals from the vehicle to locate the vehicle on a set of intersecting hyperbolas. A network of four ground stations detects the radio emissions from the vehicle and by means of cross correlation derives the relative signal delay at the ground stations from which the vehicle position is deduced. Because the signal detection is by cross correlation, no knowledge of the emission is needed, which makes even unintentional radio noise emissions usable as a locator beacon. By positioning one of the four ground stations at an elevation significantly above the plane of the other three stations, a three dimensional fix on the vehicle is possible.

  20. Dipole Well Location


    The problem here is to model the three-dimensional response of an electromagnetic logging tool to a practical situation which is often encountered in oil and gas exploration. The DWELL code provide the electromagnetic fields on the axis of a borehole due to either an electric or a magnetic dipole located on the same axis. The borehole is cylindrical, and is located within a stratified formation in which the bedding planes are not horizontal. The anglemore » between the normal to the bedding planes and the axis of the borehole may assume any value, or in other words, the borehole axis may be tilted with respect to the bedding planes. Additionally, all of the formation layers may have invasive zones of drilling mud. The operating frequency of the source dipole(s) extends from a few Hertz to hundreds of Megahertz.« less

  1. Electric current locator


    King, Paul E.; Woodside, Charles Rigel


    The disclosure herein provides an apparatus for location of a quantity of current vectors in an electrical device, where the current vector has a known direction and a known relative magnitude to an input current supplied to the electrical device. Mathematical constants used in Biot-Savart superposition equations are determined for the electrical device, the orientation of the apparatus, and relative magnitude of the current vector and the input current, and the apparatus utilizes magnetic field sensors oriented to a sensing plane to provide current vector location based on the solution of the Biot-Savart superposition equations. Description of required orientations between the apparatus and the electrical device are disclosed and various methods of determining the mathematical constants are presented.

  2. Underwater hydrophone location survey

    NASA Technical Reports Server (NTRS)

    Cecil, Jack B.


    The Atlantic Undersea Test and Evaluation Center (AUTEC) is a U.S. Navy test range located on Andros Island, Bahamas, and a Division of the Naval Undersea Warfare Center (NUWC), Newport, RI. The Headquarters of AUTEC is located at a facility in West Palm Beach, FL. AUTEC's primary mission is to provide the U.S. Navy with a deep-water test and evaluation facility for making underwater acoustic measurements, testing and calibrating sonars, and providing accurate underwater, surface, and in-air tracking data on surface ships, submarines, aircraft, and weapon systems. Many of these programs are in support of Antisubmarine Warfare (ASW), undersea research and development programs, and Fleet assessment and operational readiness trials. Most tests conducted at AUTEC require precise underwater tracking (plus or minus 3 yards) of multiple acoustic signals emitted with the correct waveshape and repetition criteria from either a surface craft or underwater vehicle.

  3. Optimal Facility-Location

    PubMed Central

    Goldman, A. J.


    Dr. Christoph Witzgall, the honoree of this Symposium, can count among his many contributions to applied mathematics and mathematical operations research a body of widely-recognized work on the optimal location of facilities. The present paper offers to non-specialists a sketch of that field and its evolution, with emphasis on areas most closely related to Witzgall’s research at NBS/NIST. PMID:27274920

  4. Ammonia Leak Locator Study

    NASA Technical Reports Server (NTRS)

    Dodge, Franklin T.; Wuest, Martin P.; Deffenbaugh, Danny M.


    The thermal control system of International Space Station Alpha will use liquid ammonia as the heat exchange fluid. It is expected that small leaks (of the order perhaps of one pound of ammonia per day) may develop in the lines transporting the ammonia to the various facilities as well as in the heat exchange equipment. Such leaks must be detected and located before the supply of ammonia becomes critically low. For that reason, NASA-JSC has a program underway to evaluate instruments that can detect and locate ultra-small concentrations of ammonia in a high vacuum environment. To be useful, the instrument must be portable and small enough that an astronaut can easily handle it during extravehicular activity. An additional complication in the design of the instrument is that the environment immediately surrounding ISSA will contain small concentrations of many other gases from venting of onboard experiments as well as from other kinds of leaks. These other vapors include water, cabin air, CO2, CO, argon, N2, and ethylene glycol. Altogether, this local environment might have a pressure of the order of 10(exp -7) to 10(exp -6) torr. Southwest Research Institute (SwRI) was contracted by NASA-JSC to provide support to NASA-JSC and its prime contractors in evaluating ammonia-location instruments and to make a preliminary trade study of the advantages and limitations of potential instruments. The present effort builds upon an earlier SwRI study to evaluate ammonia leak detection instruments [Jolly and Deffenbaugh]. The objectives of the present effort include: (1) Estimate the characteristics of representative ammonia leaks; (2) Evaluate the baseline instrument in the light of the estimated ammonia leak characteristics; (3) Propose alternative instrument concepts; and (4) Conduct a trade study of the proposed alternative concepts and recommend promising instruments. The baseline leak-location instrument selected by NASA-JSC was an ion gauge.

  5. Magnetic Location Indicator

    NASA Technical Reports Server (NTRS)

    Stegman, Thomas W.


    Ferrofluidic device indicates point of highest magnetic-flux density in workspace. Consists of bubble of ferrofluid in immiscible liquid carrier in clear plastic case. Used in flat block or tube. Axes of centering circle on flat-block version used to mark location of maximum flux density when bubble in circle. Device used to find point on wall corresponding to known point on opposite side of wall.

  6. Coso MT Site Locations

    SciTech Connect

    Doug Blankenship


    This data includes the locations of the MT data collected in and around the Coso Geothermal field that covered the West Flank area. These are the data that the 3D MT models were created from that were discussed in Phase 1 of the West Flank FORGE project. The projected coordinate system is NAD 1927 State Plane California IV FIPS 0404 and the Projection is Lambert Conformal Conic. Units are in feet.

  7. Superheavy Elements

    ERIC Educational Resources Information Center

    Tsang, Chin Fu


    Discusses the possibility of creating elements with an atomic number of around 114. Describes the underlying physics responsible for the limited extent of the periodic table and enumerates problems that must be overcome in creating a superheavy nucleus. (GS)

  8. Elemental Education.

    ERIC Educational Resources Information Center

    Daniel, Esther Gnanamalar Sarojini; Saat, Rohaida Mohd.


    Introduces a learning module integrating three disciplines--physics, chemistry, and biology--and based on four elements: carbon, oxygen, hydrogen, and silicon. Includes atomic model and silicon-based life activities. (YDS)

  9. Identifying Liver Cancer-Related Enhancer SNPs by Integrating GWAS and Histone Modification ChIP-seq Data

    PubMed Central

    Hu, Yang; Wu, Xiaoliang; Ma, Rui


    Many disease-related single nucleotide polymorphisms (SNPs) have been inferred from genome-wide association studies (GWAS) in recent years. Numerous studies have shown that some SNPs located in protein-coding regions are associated with numerous diseases by affecting gene expression. However, in noncoding regions, the mechanism of how SNPs contribute to disease susceptibility remains unclear. Enhancer elements are functional segments of DNA located in noncoding regions that play an important role in regulating gene expression. The SNPs located in enhancer elements may affect gene expression and lead to disease. We presented a method for identifying liver cancer-related enhancer SNPs through integrating GWAS and histone modification ChIP-seq data. We identified 22 liver cancer-related enhancer SNPs, 9 of which were regulatory SNPs involved in distal transcriptional regulation. The results highlight that these enhancer SNPs may play important roles in liver cancer. PMID:27429976

  10. Identifying Liver Cancer-Related Enhancer SNPs by Integrating GWAS and Histone Modification ChIP-seq Data.


    Zhang, Tianjiao; Hu, Yang; Wu, Xiaoliang; Ma, Rui; Jiang, Qinghua; Wang, Yadong


    Many disease-related single nucleotide polymorphisms (SNPs) have been inferred from genome-wide association studies (GWAS) in recent years. Numerous studies have shown that some SNPs located in protein-coding regions are associated with numerous diseases by affecting gene expression. However, in noncoding regions, the mechanism of how SNPs contribute to disease susceptibility remains unclear. Enhancer elements are functional segments of DNA located in noncoding regions that play an important role in regulating gene expression. The SNPs located in enhancer elements may affect gene expression and lead to disease. We presented a method for identifying liver cancer-related enhancer SNPs through integrating GWAS and histone modification ChIP-seq data. We identified 22 liver cancer-related enhancer SNPs, 9 of which were regulatory SNPs involved in distal transcriptional regulation. The results highlight that these enhancer SNPs may play important roles in liver cancer. PMID:27429976

  11. Facile synthesis of ternary Ag/AgBr-Ag2CO3 hybrids with enhanced photocatalytic removal of elemental mercury driven by visible light.


    Zhang, Anchao; Zhang, Lixiang; Lu, Hao; Chen, Guoyan; Liu, Zhichao; Xiang, Jun; Sun, Lushi


    A novel technique for photocatalytic removal of elemental mercury (Hg(0)) using visible-light-driven Ag/AgBr-Ag2CO3 hybrids was proposed. The ternary Ag/AgBr-Ag2CO3 hybrids were synthesized by a simple modified co-precipitation method and characterized by N2 adsorption-desorption, scanning electron microscope (SEM), X-ray diffraction (XRD), UV-vis diffused reflectance spectroscopy (DRS), X-ray photoelectron spectroscopy (XPS) and electron spin resonance (ESR) techniques. The effects of AgBr content, fluorescent lamp (FSL) irradiation, solution temperature, SO2 and NO on Hg(0) removal were investigated in detail. Furthermore, a possible reaction mechanism for higher Hg(0) removal was proposed, and the simultaneous removal of Hg(0), SO2 and NO was studied. The results showed that a high efficiency of Hg(0) removal was obtained by using Ag/AgBr-Ag2CO3 hybrids under fluorescent lamp irradiation. The AgBr content, FSL irradiation, solution temperature, and SO2 all exhibited significant effects on Hg(0) removal, while NO had slight effect on Hg(0) removal. The addition of Ca(OH)2 demonstrated a little impact on Hg(0) removal and could significantly improve the SO2-resistance performance of Ag/AgBr(0.7)-Ag2CO3 hybrid. The characterization results exhibited that hydroxyl radical (OH), superoxide radical (O2(-)), hole (h(+)), and Br(0), were reactive species responsible for removing Hg(0), and the h(+) played a key role in Hg(0) removal. PMID:27135702

  12. Deterministic and Probabilistic Creep and Creep Rupture Enhancement to CARES/Creep: Multiaxial Creep Life Prediction of Ceramic Structures Using Continuum Damage Mechanics and the Finite Element Method

    NASA Technical Reports Server (NTRS)

    Jadaan, Osama M.; Powers, Lynn M.; Gyekenyesi, John P.


    High temperature and long duration applications of monolithic ceramics can place their failure mode in the creep rupture regime. A previous model advanced by the authors described a methodology by which the creep rupture life of a loaded component can be predicted. That model was based on the life fraction damage accumulation rule in association with the modified Monkman-Grant creep ripture criterion However, that model did not take into account the deteriorating state of the material due to creep damage (e.g., cavitation) as time elapsed. In addition, the material creep parameters used in that life prediction methodology, were based on uniaxial creep curves displaying primary and secondary creep behavior, with no tertiary regime. The objective of this paper is to present a creep life prediction methodology based on a modified form of the Kachanov-Rabotnov continuum damage mechanics (CDM) theory. In this theory, the uniaxial creep rate is described in terms of stress, temperature, time, and the current state of material damage. This scalar damage state parameter is basically an abstract measure of the current state of material damage due to creep deformation. The damage rate is assumed to vary with stress, temperature, time, and the current state of damage itself. Multiaxial creep and creep rupture formulations of the CDM approach are presented in this paper. Parameter estimation methodologies based on nonlinear regression analysis are also described for both, isothermal constant stress states and anisothermal variable stress conditions This creep life prediction methodology was preliminarily added to the integrated design code CARES/Creep (Ceramics Analysis and Reliability Evaluation of Structures/Creep), which is a postprocessor program to commercially available finite element analysis (FEA) packages. Two examples, showing comparisons between experimental and predicted creep lives of ceramic specimens, are used to demonstrate the viability of this methodology and

  13. Solid solution alloy nanoparticles of immiscible Pd and Ru elements neighboring on Rh: changeover of the thermodynamic behavior for hydrogen storage and enhanced CO-oxidizing ability.


    Kusada, Kohei; Kobayashi, Hirokazu; Ikeda, Ryuichi; Kubota, Yoshiki; Takata, Masaki; Toh, Shoichi; Yamamoto, Tomokazu; Matsumura, Syo; Sumi, Naoya; Sato, Katsutoshi; Nagaoka, Katsutoshi; Kitagawa, Hiroshi


    Pd(x)Ru(1-x) solid solution alloy nanoparticles were successfully synthesized over the whole composition range through a chemical reduction method, although Ru and Pd are immiscible at the atomic level in the bulk state. From the XRD measurement, it was found that the dominant structure of Pd(x)Ru(1-x) changes from fcc to hcp with increasing Ru content. The structures of Pd(x)Ru(1-x) nanoparticles in the Pd composition range of 30-70% consisted of both solid solution fcc and hcp structures, and both phases coexist in a single particle. In addition, the reaction of hydrogen with the Pd(x)Ru(1-x) nanoparticles changed from exothermic to endothermic as the Ru content increased. Furthermore, the prepared Pd(x)Ru(1-x) nanoparticles demonstrated enhanced CO-oxidizing catalytic activity; Pd0.5Ru0.5 nanoparticles exhibit the highest catalytic activity. This activity is much higher than that of the practically used CO-oxidizing catalyst Ru and that of the neighboring Rh, between Ru and Pd.

  14. Identification of an osteoclast transcription factor that binds to the human T cell leukemia virus type I-long terminal repeat enhancer element.


    Inoue, D; Santiago, P; Horne, W C; Baron, R


    Transgenic mice expressing human T cell leukemia virus type I (HTLV-I)-tax under the control of HTLV-I-long terminal repeat (LTR) promoter develop skeletal abnormalities with high bone turnover and myelofibrosis. In these animals, Tax is highly expressed in bone with a pattern of expression restricted to osteoclasts and spindle-shaped cells within the endosteal myelofibrosis. To test the hypothesis that lineage-specific transcription factors promote transgene expression from the HTLV-I-LTR in osteoclasts, we first examined tax expression in transgenic bone marrow cultures. Expression was dependent on 1alpha,25-dihydroxycholecalciferol and coincided with tartrate-resistant acid phosphatase (TRAP) expression, a marker of osteoclast differentiation. Furthermore, Tax was expressed in vitronectin receptor-positive mononuclear precursors as well as in mature osteoclast-like cells (OCLs). Consistent with our hypothesis, electrophoretic mobility shift assays revealed the presence of an OCL nuclear factor (NFOC-1) that binds to the LTR 21-base pair direct repeat, a region critical for the promoter activity. This binding is further enhanced by Tax. Since NFOC-1 is absent in macrophages and conserved in osteoclasts among species including human, such a factor may play a role in lineage determination and/or in expression of the differentiated osteoclast phenotype.

  15. Sonar Locator Systems

    NASA Technical Reports Server (NTRS)


    An underwater locator device called a Pinger is attached to an airplane's flight recorder for recovery in case of a crash. Burnett Electronics Pinger Model 512 resulted from a Burnett Electronics Laboratory, Inc./Langley Research Center contract for development of a search system for underwater mines. The Pinger's battery-powered transmitter is activated when immersed in water, and sends multidirectional signals for up to 500 hours. When a surface receiver picks up the signal, a diver can retrieve the pinger and the attached airplane flight recorder. Other pingers are used to track whales, mark underwater discoveries and assist oil drilling vessels.

  16. Location of Planet X

    SciTech Connect

    Harrington, R.S.


    Observed positions of Uranus and Neptune along with residuals in right ascension and declination are used to constrain the location of a postulated tenth planet. The residuals are converted into residuals in ecliptic longitude and latitude. The results are then combined into seasonal normal points, producing average geocentric residuals spaced slightly more than a year apart that are assumed to represent the equivalent heliocentric average residuals for the observed oppositions. Such a planet is found to most likely reside in the region of Scorpius, with considerably less likelihood that it is in Taurus. 8 references.

  17. Huntington's disease gene located.


    Kolata, G


    Investigators have found a restriction enzyme marker, a piece of DNA that can be located with recombinant DNA techniques, that is so close to the Huntington's disease gene that its presence can be used as an indicator for that gene. If this marker is used as a diagnostic test for Huntington's disease, people at risk for getting the disease will be able to learn whether or not they will in fact develop the disease. The ability to predict the inevitable onset of this progressive, degenerative disease raises ethical questions about counseling, screening, and disclosure of risk status to patients and family members.

  18. CREB (cAMP response element binding protein) and C/EBPalpha (CCAAT/enhancer binding protein) are required for the superstimulation of phosphoenolpyruvate carboxykinase gene transcription by adenoviral E1a and cAMP.

    PubMed Central

    Routes, J M; Colton, L A; Ryan, S; Klemm, D J


    In the present study, we observed superstimulated levels of cAMP-stimulated transcription from the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter in cells infected with wild-type adenovirus expressing 12 S and 13 S E1a proteins, or in cells expressing 13 S E1a alone. cAMP-stimulated transcription was inhibited in cells expressing only 12 S E1a, but slightly elevated in cells expressing E1a proteins with mutations in conserved regions 1 or 2, leading us to conclude that the superstimulation was mediated by conserved region 3 of 13 S E1a. E1a failed to enhance cAMP-stimulated transcription from promoters containing mutations that abolish binding by cAMP response element binding protein (CREB) or CCAAT/enhancer binding proteins (C/EBPs). This result was supported by experiments in which expression of dominant-negative CREB and/or C/EBP proteins repressed E1a- and cAMP-stimulated transcription from the PEPCK gene promoter. In reconstitution experiments using a Gal4-responsive promoter, E1a enhanced cAMP-stimulated transcription when chimaeric Gal4-CREB and Gal4-C/EBPalpha were co-expressed. Phosphorylation of CREB on serine-133 was stimulated in cells treated with dibutyryl cAMP, whereas phosphorylation of C/EBPalpha was increased by E1a expression. Our data support a model in which cAMP agonists increase CREB activity and stimulate PEPCK gene transcription, a process that is enhanced by E1a through the phosphorylation of C/EBPalpha. PMID:11085926

  19. Nuclear fuel element


    Zocher, Roy W.


    A nuclear fuel element and a method of manufacturing the element. The fuel element is comprised of a metal primary container and a fuel pellet which is located inside it and which is often fragmented. The primary container is subjected to elevated pressure and temperature to deform the container such that the container conforms to the fuel pellet, that is, such that the container is in substantial contact with the surface of the pellet. This conformance eliminates clearances which permit rubbing together of fuel pellet fragments and rubbing of fuel pellet fragments against the container, thus reducing the amount of dust inside the fuel container and the amount of dust which may escape in the event of container breach. Also, as a result of the inventive method, fuel pellet fragments tend to adhere to one another to form a coherent non-fragmented mass; this reduces the tendency of a fragment to pierce the container in the event of impact.

  20. Resonance in the Mouse Tibia as a Predictor of Frequencies and Locations of Loading-Induced Bone Formation

    PubMed Central

    Zhao, Liming; Dodge, Todd; Nemani, Arun; Yokota, Hiroki


    To enhance new bone formation for the treating of patients with osteopenia and osteoporosis, various mechanical loading regimens have been developed. Although a wide spectrum of loading frequencies is proposed in those regimens, a potential linkage between loading frequencies and locations of loading-induced bone formation is not well understood. In this study, we addressed a question: Does mechanical resonance play a role in frequency dependent bone formation? If so, can the locations of enhanced bone formation be predicted through the modes of vibration? Our hypothesis is that mechanical loads applied at a frequency near the resonant frequencies enhance bone formation, specifically in areas that experience high principal strains. To test the hypothesis, we conducted axial tibia loading using low, medium, or high frequency to the mouse tibia, as well as finite element analysis. The experimental data demonstrated dependence of the maximum bone formation on location and frequency of loading. Samples loaded with the low frequency waveform exhibited peak enhancement of bone formation in the proximal tibia, while the high frequency waveform offered the greatest enhancement in the midshaft and distal sections. Furthermore, the observed dependence on loading frequencies was correlated to the principal strains in the first five resonance modes at 8.0 to 42.9 Hz. Collectively, the results suggest that resonance is a contributor to the frequencies and locations of maximum bone formation. Further investigation of the observed effects of resonance may lead to the prescribing of personalized mechanical loading treatments. PMID:23575747



    Macleish, K.G.


    ABS>This patent presents a method for locating a ground in a d-c circult having a number of parallel branches connected across a d-c source or generator. The complete method comprises the steps of locating the ground with reference to the mildpoint of the parallel branches by connecting a potentiometer across the terminals of the circuit and connecting the slider of the potentiometer to ground through a current indicating instrument, adjusting the slider to right or left of the mildpoint so as to cause the instrument to indicate zero, connecting the terminal of the network which is farthest from the ground as thus indicated by the potentiometer to ground through a condenser, impressing a ripple voltage on the circuit, and then measuring the ripple voltage at the midpoint of each parallel branch to find the branch in which is the lowest value of ripple voltage, and then measuring the distribution of the ripple voltage along this branch to determine the point at which the ripple voltage drops off to zero or substantially zero due to the existence of a ground. The invention has particular application where a circuit ground is present which will disappear if the normal circuit voltage is removed.

  2. High resolution 2D-NMR studies indicating complete assignments and conformational characteristics of the NF-kappa B binding enhancer element of HIV-LTR.


    Singh, M P; Fregeau, N L; Pon, R T; Lown, J W


    The asymmetrical DNA duplex [5'd(AAGGGACTTTCC)].[5'-d(GGAAAGTCCCTT)] has been studied by one- and two-dimensional NMR techniques. The sequence is comprised of the actual 10 base-pair long binding site for the transcription factor NF-kappa B in the enhancer sequence of the long term repeat (LTR) region of HIV and SIV types of retroviruses associated with the AIDS syndrome. Two additional A.T base-pairs are also included on one end for an added interest in the 12-bp duplex sequence with a pseudo dyad-symmetric disposition of the oligopurine and oligopyrimidine segments, as it appears in the HIV-1 genome. Phase-sensitive two-dimensional spectra (NOESY, ROESY, COSY and TOCSY) were obtained at three different temperatures (5, 15 and 25 degrees C) for a complete assignment of the non-exchangeable protons by tracing through sequence specific intra- and internucleotide connectivities. 2D-NOESY spectra were also acquired in aqueous (90% H2O-D2O) solutions, with two different methods of water signal suppression, to assign the exchangeable protons from specific NOE correlations. Adenine H2 protons were assigned by the use of NOE correlations and from T1 relaxation time measurements. The general spectral features and semi-quantitative interproton distance estimates indicate a B-DNA type conformation. However, some distinctly unusual features associated with the nucleotides at and immediately adjacent to both the 5'-and 3'-ends of AAA/TTT and GGG/CCC segments were noted. The complete assignments, and the observed characteristics, will be of significant value in studying the complexes of this transcriptionally active DNA domain with the protein and other rationally designed DNA binding agents.

  3. [The Effect of Transcription on Enhancer Activity in Drosophila melanogaster].


    Erokhin, M M; Davydova, A I; Lomaev, D V; Georgiev, P G; Chetverina, D A


    In higher eukaryotes, the level of gene transcription is under the control of DNA regulatory elements, such as promoter, from which transcription is initiated with the participation of RNA polymerase II and general transcription factors, as well as the enhancer, which increase the rate of transcription with the involvement of activator proteins and cofactors. It was demonstrated that enhancers are often located in the transcribed regions of the genome. We showed earlier that transcription negatively affected the activity of enhancers in Drosophila in model transgenic systems. In this study, we tested the effect of the distance between the leading promoter, enhancer, and target promoter on the inhibitory effect of transcriptions of different strengths. It was demonstrated that the negative effect of transcription remained, but weakened with increased distance between the leading promoter and enhancer and with decreased distance between the enhancer and target promoter. Thus, transcription can modulate the activity of enhancers by controlling its maximum level.



    Bean, R.W.


    A ceramic fuel element for a nuclear reactor that has improved structural stability as well as improved cooling and fission product retention characteristics is presented. The fuel element includes a plurality of stacked hollow ceramic moderator blocks arranged along a tubular raetallic shroud that encloses a series of axially apertured moderator cylinders spaced inwardly of the shroud. A plurality of ceramic nuclear fuel rods are arranged in the annular space between the shroud and cylinders of moderator and appropriate support means and means for directing gas coolant through the annular space are also provided. (AEC)

  5. Pregnancy of unknown location.


    Schuneman, Margaret; Von Wald, Tiffany; Hansen, Keith


    The development of highly sensitive and accurate human chorionic gonadotropin assays as well as the improvement of vaginal ultrasound have allowed for the early detection of pregnancy and have reduced the morbidity and mortality associated with ectopic gestations. One of the byproducts of this increased sensitivity is pregnancy of unknown location (PUL), a term which is used to describe pregnancy in a woman with a positive pregnancy test but no signs of intrauterine or extrauterine pregnancy. A PUL can include an early intrauterine pregnancy, a failing intrauterine/extrauterine pregnancy or ectopic pregnancy. Modern medical management has improved the diagnosis and treatment of early pregnancy and pregnancy loss. In the hemodynamically stable patient with PUL, expectant management has been shown to be safe and allows for confirmatory studies before proceeding with therapy.

  6. Quantum Image Location

    NASA Astrophysics Data System (ADS)

    Jiang, Nan; Dang, Yijie; Zhao, Na


    Quantum image processing has been a hot topic as a consequence of the development of quantum computation. Many quantum image processing algorithms have been proposed, whose efficiency are theoretically higher than their corresponding classical algorithms. However, most of the quantum schemes do not consider the problem of measurement. If users want to get the results, they must measure the final state many times to get all the pixels' values. Moreover, executing the algorithm one time, users can only measure the final state one time. In order to measure it many times, users must execute the algorithms many times. If the measurement process is taken into account, whether or not the algorithms are really efficient needs to be reconsidered. In this paper, we try to solve the problem of measurement and give a quantum image location algorithm. This scheme modifies the probability of pixels to make the target pixel to be measured with higher probability. Furthermore, it only has linear complexity.

  7. Enhanced performance of a three-zone simulated moving bed chromatography for separation of succinic acid and lactic acid by simultaneous use of port-location rearrangement and partial-feeding.


    Mun, Sungyong


    The performance of a three-zone simulated moving bed (SMB) chromatographic process for separation of succinic acid and lactic acid has been improved to a certain extent in previous researches by applying either a partial-feeding (PF) or a port-location rearrangement (PR) to its operation. To make a further improvement, the strategy of applying both PF and PR simultaneously to the three-zone SMB operation was proposed in this study. The results from both equilibrium-theory analysis and detailed simulation proved that the proposed strategy, which was called PF-PR in this article, had the benefit of a synergy between the individual merits of PF and PR in the three-zone SMB performance. As a consequence, the PF-PR mode could surpass the PF and the PR modes by a wide margin and the classical mode by a dramatic margin in the aspects of separation performance and throughput.

  8. Statement of significance, site location graphic, mantle elevation, section through ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Statement of significance, site location graphic, mantle elevation, section through decorative wall element, and terra cotta details - Boston Architectural College, Terra Cotta Mantel, 951 Boylston Street, Boston, Suffolk County, MA

  9. Element Research.

    ERIC Educational Resources Information Center

    Herald, Christine


    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  10. Mercury, elemental

    Integrated Risk Information System (IRIS)

    Mercury , elemental ; CASRN 7439 - 97 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinoge

  11. Cobalt processing - flask positioner location sensing system

    SciTech Connect

    Braun, P.F.


    Canada deuterium uranium (CANDU) reactors offer unique opportunities for economical production of /sup 60/Co in the adjuster rods used for xenon override and maximization of core output. Cobalt is effectively a by-product in CANDU reactors with the standards stainless steel adjuster rods replaced with cobalt adjuster rods. The Flask Positioner unit is a part of the cobalt adjuster element processing system (CAEPS) equipment which is used for removing irradiated cobalt adjuster elements from the reactor and safely transporting them to the irradiated fuel bay, where they are dismantled and prepared for shipment. The flask positioner equipment is similar to a crane, carries the CAEPS flask and locates it in an accurate position concentric with any adjuster site centerline. This enables the required operations for safe transfer of the irradiated adjuster element into the flask. The positioner is located above the reactivity mechanism deck. The CAEPS system has been made operational on several CANDU reactors. The location sensing system has been demonstrated to work very satisfactorily on all installations.

  12. Object Locating System

    NASA Technical Reports Server (NTRS)

    Arndt, G. Dickey (Inventor); Carl, James R. (Inventor)


    A portable system is provided that is operational for determining, with three dimensional resolution, the position of a buried object or approximately positioned object that may move in space or air or gas. The system has a plurality of receivers for detecting the signal front a target antenna and measuring the phase thereof with respect to a reference signal. The relative permittivity and conductivity of the medium in which the object is located is used along with the measured phase signal to determine a distance between the object and each of the plurality of receivers. Knowing these distances. an iteration technique is provided for solving equations simultaneously to provide position coordinates. The system may also be used for tracking movement of an object within close range of the system by sampling and recording subsequent position of the object. A dipole target antenna. when positioned adjacent to a buried object, may be energized using a separate transmitter which couples energy to the target antenna through the medium. The target antenna then preferably resonates at a different frequency, such as a second harmonic of the transmitter frequency.

  13. AOTV bow shock location

    NASA Technical Reports Server (NTRS)

    Desautel, D.


    Hypersonic bow-shock location and geometry are of central importance to the aerodynamics and aerothermodynamics of aeroassisted orbital transfer vehicles (AOTVs), but they are difficult to predict for a given vehicle configuration. This paper reports experimental measurements of shock standoff distance for the 70 deg cone AOTV configuration in shock-tunnel-test flows at Mach numbers of 3.8 to 7.9 and for angles of attack from 0 deg to 20 deg. The controlling parameter for hypersonic bow-shock standoff distance (for a given forebody shape) is the mean normal-shock density ratio. Values for this parameter in the tests reported are in the same range as those of the drag-brake AOTV perigee regime. Results for standoff distance are compared with those previously reported in the literature for this AOTV configuration. It is concluded that the AOTV shock standoff distance for the conical configuration, based on frustrum (base) radius, is equivalent to that of a sphere with a radius about 35 percent greater than that of the cone; the distance is, therefore, much less than reported in previous studies. Some reasons for the discrepancies between the present and previous are advanced. The smaller standoff distance determined here implies there will be less radiative heat transfer than was previously expected.

  14. Teaching Business Shops and Stores' Locations through Field Studies

    ERIC Educational Resources Information Center

    Yang, Daihu; Wang, Ziying; Wu, Xianliang; Fu, Wenru


    Location, where geographic elements interwork spatially and dynamically, has been one of the enduring themes in geographic studies. There are a number of location theories to explain why things are located where they are. Alfred Weber's location theory stresses that the least cost of delivering products is a key factor in location selection,…



    Fortescue, P.; Zumwalt, L.R.


    A fuel element was developed for a gas cooled nuclear reactor. The element is constructed in the form of a compacted fuel slug including carbides of fissionable material in some cases with a breeder material carbide and a moderator which slug is disposed in a canning jacket of relatively impermeable moderator material. Such canned fuel slugs are disposed in an elongated shell of moderator having greater gas permeability than the canning material wherefore application of reduced pressure to the space therebetween causes gas diffusing through the exterior shell to sweep fission products from the system. Integral fission product traps and/or exterior traps as well as a fission product monitoring system may be employed therewith. (AEC)

  16. Identification and Characterization of a Gene stp17 Located on the Linear Plasmid pBSSB1 as an Enhanced Gene of Growth and Motility in Salmonella enterica Serovar Typhi

    PubMed Central

    Zhang, Haifang; Zhu, Yunxia; Xie, Xiaofang; Wang, Min; Du, Hong; Xu, Shungao; Zhang, Ying; Gong, Mingyu; Ni, Bin; Xu, Huaxi; Huang, Xinxiang


    The linear plasmid pBSSB1 mediates the flagellar phase variation in H:z66 positive Salmonella enterica serovar Typhi (S. Typhi). The gene named stp17 (S. Typhi plasmid number 17 gene) is located on pBSSB1 and encodes the protein STP17. The expression pattern at the protein-level and function of STP17 remains unknown. In this study, the recombinant protein STP17His6 was expressed, purified and used to prepare the polyclonal anti-STP17 antibody. We detected protein-level expression of stp17 in S. Typhi and further investigated the protein expression characteristics of stp17 in different growth phases by western blot analysis. The effects of STP17 on bacterial growth and motility were analyzed. In addition, the structure of STP17 was predicted and the active site of STP17 was identified by site-directed mutagenesis. The results showed that STP17 was expressed stably in the wild type strain of S. Typhi. STP17 expression at the protein level peaks when cultures reach an OD600 value of 1.2. The growth rate and motility of the Δstp17 strain were significantly decreased compared with the wild type strain (P < 0.05) and this phenotype was restored in the stp17 complementary strain. Moreover, the growth rate and motility of the stp17 over-expression strain was greater than the wild type strain. STP17 contains nine Helix segments, six Stand segments and some Coil segments in the secondary structural level. The top-ranked 3-D structure of STP17 predicted by I-TASSER contains a putative ATPase domain and the amino acid residues of GLY16, GLY19, LYS20, ASN133, LYS157, and LYS158 may be the active site residues of STP17. Finally, STP17 was able to catalyze the ATP to ADP reaction, suggesting that STP17 may be an ATPase. To our knowledge, this is the first report describing the protein expression characteristics of STP17 in S. Typhi, showing that STP17 promotes bacterial growth and motility, which may be associated with its potential ATPase activity. PMID:27761429

  17. Chemistry of the superheavy elements.


    Schädel, Matthias


    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models.

  18. Chemistry of the superheavy elements.


    Schädel, Matthias


    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. PMID:25666065

  19. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2010 CFR


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false FLEP elements. 230.35 Section... FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP funds... through the following elements: (1) Development and implementation of educational programs; (2)...

  20. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2011 CFR


    ... 36 Parks, Forests, and Public Property 2 2011-07-01 2011-07-01 false FLEP elements. 230.35 Section... FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP funds... through the following elements: (1) Development and implementation of educational programs; (2)...

  1. Multiple widely spaced elements determine the efficiency with which a distal cistron is expressed from the polycistronic pregenomic RNA of figwort mosaic caulimovirus.


    Edskes, H K; Kiernan, J M; Shepherd, R J


    The polycistronic expression mechanism of the plant pararetrovirus figwort mosaic caulimovirus (FMV) depends upon cis-acting elements present in its pregenomic RNA and a trans-acting protein (P6) which is expressed from a monocistronic subgenomic RNA. Using transient expression of FMV-derived polycistronic reporter constructs in Nicotiana edwardsonii cell suspension protoplasts, we further analyzed the cis-acting elements involved in polycistronic expression. A cis-acting element located within the first 74 nucleotides of the 7,954-nucleotide pregenomic RNA appears to be essential for P6 to transactivate expression of an internal cistron. Expression of this internal cistron, in the presence of P6, is greatly enhanced by the combined presence of two cis-acting elements located at the 3' end of the polycistronic RNA. Surprisingly, deletion of the most upstream of these two 3' cis-acting elements exposed a negative-acting element located internally on the polycistronic RNA, at the 3' end of open reading frame I. The action of both this negative-acting internal element and the positive-acting 3' elements is more pronounced when the large 5' untranslated leader region is present. This indicates that the 5' untranslated leader region is central to regulation of the FMV gene expression mechanism. Although a limited set of elements suffices to direct polycistronic expression in this eukaryotic system, a complex interplay between elements is involved in the spatial regulation of the genes present on the pregenomic RNA of FMV.

  2. Proteins bound at adjacent DNA elements act synergistically to regulate human proenkephalin cAMP inducible transcription.

    PubMed Central

    Comb, M; Mermod, N; Hyman, S E; Pearlberg, J; Ross, M E; Goodman, H M


    Synthesis of the endogenous opioid precursor, proenkephalin, is regulated by neurotransmitters and membrane depolarization. These events act through second messenger dependent signal transduction pathways via a short inducible DNA enhancer to regulate transcription of the proenkephalin gene. Two DNA elements located within this enhancer are essential for the transcriptional response to cAMP and phorbol ester. Inactivation of either element by mutation or by alteration of their stereospecific alignment eliminates inducible enhancer activity. The promoter distal element, ENKCRE-1, in the absence of a functional adjacent ENKCRE-2 element, has no inherent capacity to activate transcription. However, in the presence of a functional ENKCRE-2 element, this element synergistically augments cAMP and phorbol ester inducible transcription. The promoter proximal element, ENKCRE-2, is essential for both basal and regulated enhancer function. Four different protein factors found in HeLa cell nuclear extracts bind in vitro to the enhancer region. ENKTF-1, a novel enhancer binding protein, binds to the DNA region encompassing ENKCRE-1. The transcription factors AP-1 and AP-4 bind to overlapping sites spanning ENKCRE-2, and a fourth transcription factor, AP-2, binds to a site immediately downstream of ENKCRE-2. The binding of ENKTF-1 to mutant ENKCRE-1 sequences in vitro correlates with the in vivo inducibility of the mutant elements suggesting that ENKTF-1 acts in combination with factors that recognize the ENKCRE-2 domain to regulate cAMP inducible transcription. Together, the two DNA elements, ENKCRE-1 and ENKCRE-2 and the protein factors with which they interact, play a critical role in the transduction and reception of signals transmitted from cell surface receptors to the proenkephalin nuclear transcription complex. Images PMID:2850173



    Howard, R.C.; Bokros, J.C.


    A fueled matrlx eontnwinlng uncomblned carbon is deslgned for use in graphlte-moderated gas-cooled reactors designed for operatlon at temperatures (about 1500 deg F) at which conventional metallic cladding would ordlnarily undergo undesired carburization or physical degeneratlon. - The invention comprlses, broadly a fuel body containlng uncombined earbon, clad with a nickel alloy contalning over about 28 percent by' weight copper in the preferred embodlment. Thls element ls supporirted in the passageways in close tolerance with the walls of unclad graphite moderator materlal. (AEC)

  4. Elimination of the Yeast Rad6 Ubiquitin Conjugase Enhances Base-Pair Transitions and G.c -> T.a Transversions as Well as Transposition of the Ty Element: Implications for the Control of Spontaneous Mutation

    PubMed Central

    Kang, X.; Yadao, F.; Gietz, R. D.; Kunz, B. A.


    The RAD6 gene of the yeast Saccharomyces cerevisiae encodes an enzyme that conjugates ubiquitin to other proteins. Defects in RAD6 confer a mutator phenotype due, in part, to an increased rate of transposition of the yeast Ty element. To further delineate the role of protein ubiquitination in the control of spontaneous mutagenesis in yeast, we have characterized 202 mutations that arose spontaneously in the SUP4-o gene carried on a centromere vector in a RAD6 deletion strain. The resulting mutational spectrum was compared to that for 354 spontaneous SUP4-o mutations isolated in the isogenic wild-type parent. This comparison revealed that the rad6 mutator enhanced the rate of single base-pair substitution, as well as Ty insertion, but did not affect the rates of the other mutational classes detected. Relative to the wild-type parent, Ty inserted at considerably more SUP4-o positions in the rad6 strain with a significantly smaller fraction detected at a transposition hotspot. These findings suggest that, in addition to the rate of transposition, protein ubiquitination might influence the target site specificity of Ty insertion. The increase in the substitution rate accounted for approximately 90% of the rad6 mutator effect but only the two transitions and the G.C -> T.A transversion were enhanced. Analysis of the distribution of these events within SUP4-o suggested that the site specificity of the substitutions was influenced by DNA sequence context. Transformation of heteroduplex plasmid DNAs into the two strains demonstrated that the rad6 mutator did not reduce the efficiency of correcting mismatches that could give rise to the transitions or transversion nor did it bias restoration of the mismatches to the incorrect base-pairs. These results are discussed in relation to possible mechanisms that might link ubiquitination of proteins to spontaneous mutation rates. PMID:1311695

  5. Method for detecting an element


    Blackwood, Larry G.; Reber, Edward L.; Rohde, Kenneth W.


    A method for detecting an element is disclosed and which includes the steps of providing a gamma-ray spectrum which depicts, at least in part, a test region having boundaries, and which has a small amount of the element to be detected; providing a calculation which detects the small amount of the element to be detected; and providing a moving window and performing the calculation within the moving window, and over a range of possible window boundaries within the test region to determine the location of the optimal test region within the gamma-ray spectrum.

  6. Singular plastic element: NASTRAN implementation and application

    NASA Technical Reports Server (NTRS)

    Hussain, M. A.; Pu, S. L.; Lorensen, W. E.


    The elastic and plastic singularities near a crack tip are obtained from higher order isoparametric elements. This is simply accomplished by collapsing the quadrilateral element into the triangular element and by judicious choice of adjacent mid-side nodes. Specifically for the cubic element the elastic singularity is obtained by placing the mid-side nodes adjacent to the crack tip at 1/9th and 4/9th locations. The plastic singularity is constructed using the sliding node concept. These elements have been implemented in NASTRAN as user dummy elements.



    Breden, C.R.; Schultz, A.B.


    A reactor core formed of bundles of parallel fuel elements in the form of ribbons is patented. The fuel ribbons are twisted about their axes so as to have contact with one another at regions spaced lengthwise of the ribbons and to be out of contact with one another at locations between these spaced regions. The contact between the ribbons is sufficient to allow them to be held together in a stable bundle in a containing tube without intermediate support, while permitting enough space between the ribbon for coolant flowing.

  8. FFTF Asbestos Location Tracking Program

    SciTech Connect

    Reynolds, J.A.


    An Asbestos Location Tracking Program was prepared to list, locate, and determine Asbestos content and to provide baseline {open_quotes}good faith{close_quotes} for yearly condition inspections for the FFTF Plant and buildings and grounds.

  9. Aged garlic extract enhances heme oxygenase-1 and glutamate-cysteine ligase modifier subunit expression via the nuclear factor erythroid 2-related factor 2-antioxidant response element signaling pathway in human endothelial cells.


    Hiramatsu, Kei; Tsuneyoshi, Tadamitsu; Ogawa, Takahiro; Morihara, Naoaki


    The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway defends cells against oxidative stress and regulates the cellular redox balance. Activation of this pathway induces a variety of antioxidant enzymes, resulting in the protection of our bodies against oxidative damage. It has been reported that aged garlic extract (AGE), a garlic preparation that is rich in water-soluble cysteinyl moieties, reduces oxidative stress and helps to ameliorate of cardiovascular, renal and hepatic diseases. We hypothesized that AGE enhances the expression of antioxidant enzymes via the Nrf2-ARE pathway in human umbilical vein endothelial cells in culture. Gene expression of antioxidant enzymes was measured using real-time polymerase chain reaction. Nuclear accumulation of Nrf2 and antioxidant enzymes expression were evaluated using western blotting analyses. We found that AGE promoted the accumulation of Nrf2 into the nucleus in a time- and dose-dependent manner and increased the gene expression and polypeptide level of heme oxygenase-1 (HO-1) and glutamate-cysteine ligase modifier subunit (GCLM). Moreover, the effect of AGE in elevating the gene expression of HO-1 and GCLM was found to be mediated via Nrf2 activation in human umbilical vein endothelial cells. Taken together, these observations suggest that AGE induces the expression of HO-1 and GCLM, which are antioxidant enzymes, via activation of the Nrf2-ARE signaling pathway. PMID:26507778

  10. Spring loaded locator pin assembly


    Groll, Todd A.; White, James P.


    This invention deals with spring loaded locator pins. Locator pins are sometimes referred to as captured pins. This is a mechanism which locks two items together with the pin that is spring loaded so that it drops into a locator hole on the work piece.

  11. Spring loaded locator pin assembly


    Groll, T.A.; White, J.P.


    This invention deals with spring loaded locator pins. Locator pins are sometimes referred to as captured pins. This is a mechanism which locks two items together with the pin that is spring loaded so that it drops into a locator hole on the work piece. 5 figs.

  12. Impact-Locator Sensor Panels

    NASA Technical Reports Server (NTRS)

    Christiansen, Eric L.; Byers, Terry; Gibbons, Frank


    Electronic sensor systems for detecting and locating impacts of rapidly moving particles on spacecraft have been invented. Systems of this type could also be useful on Earth in settings in which the occurrence of impacts and/or the locations of impacts are not immediately obvious and there are requirements to detect and quickly locate impacts to prevent or minimize damage.

  13. Finite Element Analysis Code


    MAPVAR-KD is designed to transfer solution results from one finite element mesh to another. MAPVAR-KD draws heavily from the structure and coding of MERLIN II, but it employs a new finite element data base, EXODUS II, and offers enhanced speed and new capabilities not available in MERLIN II. In keeping with the MERLIN II documentation, the computational algorithms used in MAPVAR-KD are described. User instructions are presented. Example problems are included to demonstrate the operationmore » of the code and the effects of various input options. MAPVAR-KD is a modification of MAPVAR in which the search algorithm was replaced by a kd-tree-based search for better performance on large problems.« less

  14. Carbon Nanotube Memory Elements

    SciTech Connect

    Meunier, Vincent; Sumpter, Bobby G


    Carbon nanotubes are among the most cited prototypical materials for nanoelectronics and information storage devices, a dominant position that originates from their intrinsic structural and electronic properties. In this chapter we review the developments in memory elements that directly exploit the unique properties of carbon nanotubes. Fundamental operational principles and characteristics are examined for the different types of carbon nanotube-based memory devices along with the current status of experimental fabrication and scalability. These include memory elements based on carbon nanotube field-effect transistors (CNFET), nanoelectromechanical systems (NEMS), and electromigration. Many of these devices show tremendous promise for providing enhanced densities, lower power requirements, more efficient read/write processes, and non-volatility of data.

  15. Finite Element Analysis Code

    SciTech Connect

    Sjaardema, G.; Wellman, G.; Gartling, D.


    MAPVAR-KD is designed to transfer solution results from one finite element mesh to another. MAPVAR-KD draws heavily from the structure and coding of MERLIN II, but it employs a new finite element data base, EXODUS II, and offers enhanced speed and new capabilities not available in MERLIN II. In keeping with the MERLIN II documentation, the computational algorithms used in MAPVAR-KD are described. User instructions are presented. Example problems are included to demonstrate the operation of the code and the effects of various input options. MAPVAR-KD is a modification of MAPVAR in which the search algorithm was replaced by a kd-tree-based search for better performance on large problems.

  16. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.


    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  17. Enhancer scanning to locate regulatory regions in genomic loci

    PubMed Central

    Buckley, Melissa; Gjyshi, Anxhela; Mendoza-Fandiño, Gustavo; Baskin, Rebekah; Carvalho, Renato S.; Carvalho, Marcelo A.; Woods, Nicholas T.; Monteiro, Alvaro N.A.


    The present protocol provides a rapid, streamlined and scalable strategy to systematically scan genomic regions for the presence of transcriptional regulatory regions active in a specific cell type. It creates genomic tiles spanning a region of interest that are subsequently cloned by recombination into a luciferase reporter vector containing the Simian Virus 40 promoter. Tiling clones are transfected into specific cell types to test for the presence of transcriptional regulatory regions. The protocol includes testing of different SNP (single nucleotide polymorphism) alleles to determine their effect on regulatory activity. This procedure provides a systematic framework to identify candidate functional SNPs within a locus during functional analysis of genome-wide association studies. This protocol adapts and combines previous well-established molecular biology methods to provide a streamlined strategy, based on automated primer design and recombinational cloning to rapidly go from a genomic locus to a set of candidate functional SNPs in eight weeks. PMID:26658467

  18. Automated detection and location of indications in eddy current signals


    Brudnoy, David M.; Oppenlander, Jane E.; Levy, Arthur J.


    A computer implemented information extraction process that locates and identifies eddy current signal features in digital point-ordered signals, signals representing data from inspection of test materials, by enhancing the signal features relative to signal noise, detecting features of the signals, verifying the location of the signal features that can be known in advance, and outputting information about the identity and location of all detected signal features.

  19. [Rare locations of hydatid disease].


    Tocchi, A; Mazzoni, G; Lepre, L; Liotta, G; Costa, G; Maggiolini, F; Miccini, M


    The authors report their experience with uncommon hydatid cyst locations. Between 1970 and 1995 a total of 16 patients suffering from hydatid cysts located in various organs other than liver and lungs were observed. There were 7 women and 9 men with a mean of 53.3 years. In 10 cases uncommon locations were found to be isolated and in 6 associated to contemporary or previously treated hepatic cystic disease. Pathogenesis of these uncommon locations, whether being primary or secondary, as well as specific items of diagnosis and surgery are discussed.

  20. Linking Microbial Phylogeny to Metabolic Activity at the Single-Cell Level by Using Enhanced Element Labeling-Catalyzed Reporter Deposition Fluorescence In Situ Hybridization (EL-FISH) and NanoSIMS▿ †

    PubMed Central

    Behrens, Sebastian; Lösekann, Tina; Pett-Ridge, Jennifer; Weber, Peter K.; Ng, Wing-On; Stevenson, Bradley S.; Hutcheon, Ian D.; Relman, David A.; Spormann, Alfred M.


    To examine phylogenetic identity and metabolic activity of individual cells in complex microbial communities, we developed a method which combines rRNA-based in situ hybridization with stable isotope imaging based on nanometer-scale secondary-ion mass spectrometry (NanoSIMS). Fluorine or bromine atoms were introduced into cells via 16S rRNA-targeted probes, which enabled phylogenetic identification of individual cells by NanoSIMS imaging. To overcome the natural fluorine and bromine backgrounds, we modified the current catalyzed reporter deposition fluorescence in situ hybridization (FISH) technique by using halogen-containing fluorescently labeled tyramides as substrates for the enzymatic tyramide deposition. Thereby, we obtained an enhanced element labeling of microbial cells by FISH (EL-FISH). The relative cellular abundance of fluorine or bromine after EL-FISH exceeded natural background concentrations by up to 180-fold and allowed us to distinguish target from non-target cells in NanoSIMS fluorine or bromine images. The method was optimized on single cells of axenic Escherichia coli and Vibrio cholerae cultures. EL-FISH/NanoSIMS was then applied to study interrelationships in a dual-species consortium consisting of a filamentous cyanobacterium and a heterotrophic alphaproteobacterium. We also evaluated the method on complex microbial aggregates obtained from human oral biofilms. In both samples, we found evidence for metabolic interactions by visualizing the fate of substrates labeled with 13C-carbon and 15N-nitrogen, while individual cells were identified simultaneously by halogen labeling via EL-FISH. Our novel approach will facilitate further studies of the ecophysiology of known and uncultured microorganisms in complex environments and communities. PMID:18359832

  1. A unique chromatin signature uncovers early developmental enhancers in humans.


    Rada-Iglesias, Alvaro; Bajpai, Ruchi; Swigut, Tomek; Brugmann, Samantha A; Flynn, Ryan A; Wysocka, Joanna


    Cell-fate transitions involve the integration of genomic information encoded by regulatory elements, such as enhancers, with the cellular environment. However, identification of genomic sequences that control human embryonic development represents a formidable challenge. Here we show that in human embryonic stem cells (hESCs), unique chromatin signatures identify two distinct classes of genomic elements, both of which are marked by the presence of chromatin regulators p300 and BRG1, monomethylation of histone H3 at lysine 4 (H3K4me1), and low nucleosomal density. In addition, elements of the first class are distinguished by the acetylation of histone H3 at lysine 27 (H3K27ac), overlap with previously characterized hESC enhancers, and are located proximally to genes expressed in hESCs and the epiblast. In contrast, elements of the second class, which we term 'poised enhancers', are distinguished by the absence of H3K27ac, enrichment of histone H3 lysine 27 trimethylation (H3K27me3), and are linked to genes inactive in hESCs and instead are involved in orchestrating early steps in embryogenesis, such as gastrulation, mesoderm formation and neurulation. Consistent with the poised identity, during differentiation of hESCs to neuroepithelium, a neuroectoderm-specific subset of poised enhancers acquires a chromatin signature associated with active enhancers. When assayed in zebrafish embryos, poised enhancers are able to direct cell-type and stage-specific expression characteristic of their proximal developmental gene, even in the absence of sequence conservation in the fish genome. Our data demonstrate that early developmental enhancers are epigenetically pre-marked in hESCs and indicate an unappreciated role of H3K27me3 at distal regulatory elements. Moreover, the wealth of new regulatory sequences identified here provides an invaluable resource for studies and isolation of transient, rare cell populations representing early stages of human embryogenesis.

  2. An enhancer activates the pig lactase phlorizin hydrolase promoter in intestinal cells.


    Troelsen, Jesper T; Mitchelmore, Cathy; Olsen, Jørgen


    Lactase phlorizin hydrolase is a small intestinal-specific brush border protein commonly used as a specific marker of differentiated enterocytes. A number of transcription factors involved in the enterocyte-specific expression of lactase phlorizin hydrolase have been identified. An upstream regulatory region, which we have named the "LPH enhancer", located at position -894 to -798 in the porcine lactase phlorizin hydrolase gene, is necessary for high differentiation-dependent LPH expression in intestinal cells. The LPH enhancer was studied by mutation analysis, transfection experiments and electrophoretical mobility shift assays. The LPH enhancer is active in intestinal cells (Caco-2) and not in non-intestinal cells (HeLa). The LPH enhancer is only able to enhance expression when it is located in front of an intestinal-specific promoter such as the lactase phlorizin hydrolase promoter or the sucrase-isomaltase promoter. In front of an SV40-derived promoter the LPH enhancer has no stimulatory effect. In addition to the lack of promoter-promiscuity, the LPH enhancer is not a classical enhancer in the sense that it is not orientation-independent and it cannot function when located 3' of a reporter gene. The LPH enhancer contains at least three cis-elements (at -894 to -880, -880 to -875 and -833 to -814) with functional importance for the LPH enhancer activity.

  3. Pan-information Location Map

    NASA Astrophysics Data System (ADS)

    Zhu, X. Y.; Guo, W.; Huang, L.; Hu, T.; Gao, W. X.


    A huge amount of information, including geographic, environmental, socio-economic, personal and social network information, has been generated from diverse sources. Most of this information exists separately and is disorderly even if some of it is about the same person, feature, phenomenon or event. Users generally need to collect related information from different sources and then utilize them in applications. An automatic mechanism, therefore, for establishing a connection between potentially-related information will profoundly expand the usefulness of this huge body of information. A connection tie is semantic location describing semantically concepts and attributes of locations as well as relationships between locations, since 80% of information contains some kind of geographic reference but not all of geographic reference has explicit geographic coordinates. Semantic location is an orthogonal form of location representation which can be represented as domain ontology or UML format. Semantic location associates various kinds of information about a same object to provide timely information services according to users' demands, habits, preferences and applications. Based on this idea, a Pan-Information Location Map (PILM) is proposed as a new-style 4D map to associates semantic location-based information dynamically to organize and consolidate the locality and characteristics of corresponding features and events, and delivers on-demand information with a User-Adaptive Smart Display (UASD).

  4. Mobile Alternative Fueling Station Locator

    SciTech Connect

    Not Available


    The Department of Energy's Alternative Fueling Station Locator is available on-the-go via cell phones, BlackBerrys, or other personal handheld devices. The mobile locator allows users to find the five closest biodiesel, electricity, E85, hydrogen, natural gas, and propane fueling sites using Google technology.

  5. Locating Information within Extended Hypermedia

    ERIC Educational Resources Information Center

    Cromley, Jennifer G.; Azevedo, Roger


    New literacies researchers have identified a core set of strategies for locating information, one of which is "reading a Web page to locate information that might be present there" (Leu et al. in: Rush, Eakle, Berger (eds) "Secondary school reading and writing: What research reveals for classroom practices," 2007, p. 46). Do middle-school, high…

  6. Precision zero-home locator


    Stone, William J.


    A zero-home locator includes a fixed phototransistor switch and a moveable actuator including two symmetrical, opposed wedges, each wedge defining a point at which switching occurs. The zero-home location is the average of the positions of the points defined by the wedges.

  7. Cold War Geopolitics: Embassy Locations.

    ERIC Educational Resources Information Center

    Vogeler, Ingolf


    Asserts that the geopolitics of the Cold War can be illustrated by the diplomatic ties among countries, particularly the superpowers and their respective allies. Describes a classroom project in which global patterns of embassy locations are examined and compared. Includes five maps and a chart indicating types of embassy locations. (CFR)

  8. Merging of intersecting triangulations for finite element modeling.


    Cebral, J R; Löhner, R; Choyke, P L; Yim, P J


    Surface mesh generation over intersecting triangulations is a problem common to many branches of biomechanics. A new strategy for merging intersecting triangulations is described. The basis of the method is that object surfaces are represented as the zero-level iso-surface of the distance-to-surface function defined on a background grid. Thus, the triangulation of intersecting objects reduces to the extraction of an iso-surface from an unstructured grid. In a first step, a regular background mesh is constructed. For each point of the background grid, the closest distance to the surface of each object is computed. Background points are then classified as external or internal by checking the direction of the surface normal at the closest location and assigned a positive or negative distance, respectively. Finally, the zero-level iso-surface is constructed. This is the final triangulation of the intersecting objects. The overall accuracy is enhanced by adaptive refinement of the background grid elements. The resulting surface models are used as support surfaces to generate three-dimensional grids for finite element analysis. The algorithms are demonstrated by merging arterial branches independently reconstructed from contrast-enhanced magnetic resonance images and by adding extra features such as vascular stents. Although the methodology is presented in the context of finite element analysis of blood flow, the algorithms are general and can be applied in other areas as well. PMID:11470121

  9. Computational Approaches for Mining GRO-Seq Data to Identify and Characterize Active Enhancers.


    Nagari, Anusha; Murakami, Shino; Malladi, Venkat S; Kraus, W Lee


    Transcriptional enhancers are DNA regulatory elements that are bound by transcription factors and act to positively regulate the expression of nearby or distally located target genes. Enhancers have many features that have been discovered using genomic analyses. Recent studies have shown that active enhancers recruit RNA polymerase II (Pol II) and are transcribed, producing enhancer RNAs (eRNAs). GRO-seq, a method for identifying the location and orientation of all actively transcribing RNA polymerases across the genome, is a powerful approach for monitoring nascent enhancer transcription. Furthermore, the unique pattern of enhancer transcription can be used to identify enhancers in the absence of any information about the underlying transcription factors. Here, we describe the computational approaches required to identify and analyze active enhancers using GRO-seq data, including data pre-processing, alignment, and transcript calling. In addition, we describe protocols and computational pipelines for mining GRO-seq data to identify active enhancers, as well as known transcription factor binding sites that are transcribed. Furthermore, we discuss approaches for integrating GRO-seq-based enhancer data with other genomic data, including target gene expression and function. Finally, we describe molecular biology assays that can be used to confirm and explore further the function of enhancers that have been identified using genomic assays. Together, these approaches should allow the user to identify and explore the features and biological functions of new cell type-specific enhancers. PMID:27662874

  10. Conserved boundary elements from the Hox complex of mosquito, Anopheles gambiae.


    Ahanger, Sajad H; Srinivasan, Arumugam; Vasanthi, Dasari; Shouche, Yogesh S; Mishra, Rakesh K


    The conservation of hox genes as well as their genomic organization across the phyla suggests that this system of anterior-posterior axis formation arose early during evolution and has come under strong selection pressure. Studies in the split Hox cluster of Drosophila have shown that proper expression of hox genes is dependent on chromatin domain boundaries that prevent inappropriate interactions among different types of cis-regulatory elements. To investigate whether boundary function and their role in regulation of hox genes is conserved in insects with intact Hox clusters, we used an algorithm to locate potential boundary elements in the Hox complex of mosquito, Anopheles gambiae. Several potential boundary elements were identified that could be tested for their functional conservation. Comparative analysis revealed that like Drosophila, the bithorax region in A. gambiae contains an extensive array of boundaries and enhancers organized into domains. We analysed a subset of candidate boundary elements and show that they function as enhancer blockers in Drosophila. The functional conservation of boundary elements from mosquito in fly suggests that regulation of hox genes involving chromatin domain boundaries is an evolutionary conserved mechanism and points to an important role of such elements in key developmentally regulated loci.

  11. Rearrangement of Upstream Regulatory Elements Leads to Ectopic Expression of the Drosophila Mulleri Adh-2 Gene

    PubMed Central

    Falb, D.; Fischer, J.; Maniatis, T.


    The Adh-2 gene of Drosophila mulleri is expressed in the larval fat body and the adult fat body and hindgut, and a 1500-bp element located 2-3 kb upstream of the Adh-2 promoter is necessary for maximal levels of transcription. Previous work demonstrated that deletion of sequences between this upstream element and the Adh-2 promoter results in Adh-2 gene expression in a novel larval tissue, the middle midgut. In this study we show that the upstream element possesses all of the characteristics of a transcriptional enhancer: its activity is independent of orientation, it acts on a heterologous promoter, and it functions at various positions both 5' and 3' to the Adh-2 gene. Full enhancer function can be localized to a 750-bp element, although other regions possess some redundant activity. The ectopic expression pattern is dependent on the proximity of at least two sequence elements. Thus, tissue-specific transcription can involve complex proximity-dependent interactions among combinations of regulatory elements. PMID:1459428

  12. Location-assured, multifactor authentication on smartphones via LTE communication

    NASA Astrophysics Data System (ADS)

    Kuseler, Torben; Lami, Ihsan A.; Al-Assam, Hisham


    With the added security provided by LTE, geographical location has become an important factor for authentication to enhance the security of remote client authentication during mCommerce applications using Smartphones. Tight combination of geographical location with classic authentication factors like PINs/Biometrics in a real-time, remote verification scheme over the LTE layer connection assures the authenticator about the client itself (via PIN/biometric) as well as the client's current location, thus defines the important aspects of "who", "when", and "where" of the authentication attempt without eaves dropping or man on the middle attacks. To securely integrate location as an authentication factor into the remote authentication scheme, client's location must be verified independently, i.e. the authenticator should not solely rely on the location determined on and reported by the client's Smartphone. The latest wireless data communication technology for mobile phones (4G LTE, Long-Term Evolution), recently being rolled out in various networks, can be employed to enhance this location-factor requirement of independent location verification. LTE's Control Plane LBS provisions, when integrated with user-based authentication and independent source of localisation factors ensures secure efficient, continuous location tracking of the Smartphone. This feature can be performed during normal operation of the LTE-based communication between client and network operator resulting in the authenticator being able to verify the client's claimed location more securely and accurately. Trials and experiments show that such algorithm implementation is viable for nowadays Smartphone-based banking via LTE communication.

  13. GE intelligent personal radiation locator system

    NASA Astrophysics Data System (ADS)

    Yanoff, Brian D.; Du, Yanfeng; Dixon, Walter V., III; Rao, Naresh K.; Li, Wen; Claus, Bernhard; Topka, Terry; Moore, Branden; Gordon, Jeffrey S.


    The GE Intelligent Personal Radiation Locator (IPRL) system consists of multiple hand held radiation detectors and a base station. Each mobile unit has a CZT Compton camera radiation detector and can identify isotopes and determine the direction from which the radiation is detected. Using GPS and internal orientation sensors, the system continuously transforms all directional data into real-world coordinates. Detected radiation is wirelessly transmitted to the base station for system-wide analysis and situational awareness. Data can also be exchanged wirelessly between peers to enhance the overall detection efficiency of the system. The key design features and performance characteristics of the GE IPRL system are described.

  14. Cytotype regulation by telomeric P elements in Drosophila melanogaster: interactions with P elements from M' strains.


    Simmons, Michael J; Niemi, Jarad B; Ryzek, Don-Felix; Lamour, Cecile; Goodman, Joseph W; Kraszkiewicz, Wojciech; Wolff, Ryan


    P strains of Drosophila are distinguished from M strains by having P elements in their genomes and also by having the P cytotype, a maternally inherited condition that strongly represses P-element-induced hybrid dysgenesis. The P cytotype is associated with P elements inserted near the left telomere of the X chromosome. Repression by the telomeric P elements TP5 and TP6 is significantly enhanced when these elements are crossed into M' strains, which, like P strains, carry P elements, but have little or no ability to repress dysgenesis. The telomeric and M' P elements must coexist in females for this enhanced repression ability to develop. However, once established, it is transmitted maternally to the immediate offspring independently of the telomeric P elements themselves. Females that carry a telomeric P element but that do not carry M' P elements may also transmit an ability to repress dysgenesis to their offspring independently of the telomeric P element. Cytotype regulation therefore involves a maternally transmissible product of telomeric P elements that can interact synergistically with products from paternally inherited M' P elements. This synergism between TP and M' P elements also appears to persist for at least one generation after the TP has been removed from the genotype. PMID:17565961

  15. Bayesian Mulitple-Event Location


    Bayesloc is a statistical model of the multiple seismic location system, including event hypocenters, corrections to model-based travel time predictions, assessments precision for measurement phase arrival times, and phase lavels which indicate phase ray path.

  16. Overexpression of human selenoprotein H in neuronal cells enhances mitochondrial biogenesis and function through activation of protein kinase A, protein kinase B, and cyclic adenosine monophosphate response element-binding protein pathway.


    Mehta, Suresh L; Mendelev, Natalia; Kumari, Santosh; Andy Li, P


    Mitochondrial biogenesis is activated by nuclear encoded transcription co-activator peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α), which is regulated by several upstream factors including protein kinase A and Akt/protein kinase B. We have previously shown that selenoprotein H enhances the levels of nuclear regulators for mitochondrial biogenesis, increases mitochondrial mass and improves mitochondrial respiratory rate, under physiological condition. Furthermore, overexpression of selenoprotein H protects neuronal HT22 cells from ultraviolet B irradiation-induced cell damage by lowering reactive oxygen species production, and inhibiting activation of caspase-3 and -9, as well as p53. The objective of this study is to identify the cell signaling pathways by which selenoprotein H initiates mitochondrial biogenesis. We first confirmed our previous observation that selenoprotein H transfected HT22 cells increased the protein levels of nuclear-encoded mitochondrial biogenesis factors, peroxisome proliferator-activated receptor γ coactivator-1α, nuclear respiratory factor 1 and mitochondrial transcription factor A. We then observed that total and phosphorylation of protein kinase A, Akt/protein kinase B and cyclic adenosine monophosphate response element-binding protein (CREB) were significantly increased in selenoprotein H transfected cells compared to vector transfected HT22 cells. To verify whether the observed stimulating effects on mitochondrial biogenesis pathways are caused by selenoprotein H and mediated through CREB, we knocked down selenoprotein H mRNA level using siRNA and inhibited CREB with napthol AS-E phosphate in selenoprotein H transfected cells and repeated the measurements of the aforementioned biomarkers. Our results revealed that silencing of selenoprotein H not only decreased the protein levels of PGC-1α, nuclear respiratory factor 1 and mitochondrial transcription factor A, but also decreased the total and

  17. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2012 CFR


    ... 36 Parks, Forests, and Public Property 2 2012-07-01 2012-07-01 false FLEP elements. 230.35 Section 230.35 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE STATE AND PRIVATE FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP...

  18. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2014 CFR


    ... 36 Parks, Forests, and Public Property 2 2014-07-01 2014-07-01 false FLEP elements. 230.35 Section 230.35 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE STATE AND PRIVATE FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP...

  19. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2013 CFR


    ... 36 Parks, Forests, and Public Property 2 2013-07-01 2013-07-01 false FLEP elements. 230.35 Section 230.35 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE STATE AND PRIVATE FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP...

  20. Finite element formulations for compressible flows

    NASA Technical Reports Server (NTRS)

    Tezduyar, Tayfun E.


    Researchers started their studies on the development and application of computational methods for compressible flows. Particular attention was given to proper numerical treatment of sharp layers occurring in such problems and to general mesh generation capabilities for intricate computational geometries. Mainly finite element methods enhanced with several state-of-the art techniques (such as the streamline-upwind/Petrov-Galerkin, discontinuity capturing, adaptive implicit-explicit, and trouped element-by-element approximate factorization schemes) were employed.

  1. Improved integrated sniper location system

    NASA Astrophysics Data System (ADS)

    Figler, Burton D.; Spera, Timothy J.


    In July of 1995, Lockheed Martin IR Imaging Systems, of Lexington, Massachusetts began the development of an integrated sniper location system for the Defense Advanced Research Projects Agency and for the Department of the Navy's Naval Command Control & Ocean Surveillance Center, RDTE Division in San Diego, California. The I-SLS integrates acoustic and uncooled infrared sensing technologies to provide an affordable and highly effective sniper detection and location capability. This system, its performance and results from field tests at Camp Pendleton, California, in October 1996 were described in a paper presented at the November 1996 SPIE Photonics East Symposium1 on Enabling Technologies for Law Enforcement and Security. The I-SLS combines an acoustic warning system with an uncooled infrared warning system. The acoustic warning system has been developed by SenTech, Inc., of Lexington, Massachusetts. This acoustic warning system provides sniper detection and coarse location information based upon the muzzle blast of the sniper's weapon and/or upon the shock wave produced by the sniper's bullet, if the bullet is supersonic. The uncooled infrared warning system provides sniper detection and fine location information based upon the weapon's muzzle flash. In addition, the uncooled infrared warning system can provide thermal imagery that can be used to accurately locate and identify the sniper. Combining these two technologies improves detection probability, reduces false alarm rate and increases utility. In the two years since the last report of the integrated sniper location system, improvements have been made and a second field demonstration was planned. In this paper, we describe the integrated sniper location system modifications in preparation for the new field demonstration. In addition, fundamental improvements in the uncooled infrared sensor technology continue to be made. These improvements include higher sensitivity (lower minimum resolvable temperature

  2. Locating the LCROSS Impact Craters

    NASA Technical Reports Server (NTRS)

    Marshall, William; Shirley, Mark; Moratto, Zachary; Colaprete, Anthony; Neumann, Gregory A.; Smith, David E.; Hensley, Scott; Wilson, Barbara; Slade, Martin; Kennedy, Brian; Gurrola, Eric; Harcke, Leif


    The Lunar CRater Observations and Sensing Satellite (LCROSS) mission impacted a spent Centaur rocket stage into a permanently shadowed region near the lunar south pole. The Sheperding Spacecraft (SSC) separated approx. 9 hours before impact and performed a small braking maneuver in order to observe the Centaur impact plume, looking for evidence of water and other volatiles, before impacting itself. This paper describes the registration of imagery of the LCROSS impact region from the mid- and near-infrared cameras onboard the SSC, as well as from the Goldstone radar. We compare the Centaur impact features, positively identified in the first two, and with a consistent feature in the third, which are interpreted as a 20 m diameter crater surrounded by a 160 m diameter ejecta region. The images are registered to Lunar Reconnaisance Orbiter (LRO) topographical data which allows determination of the impact location. This location is compared with the impact location derived from ground-based tracking and propagation of the spacecraft's trajectory and with locations derived from two hybrid imagery/trajectory methods. The four methods give a weighted average Centaur impact location of -84.6796 deg, -48.7093 deg, with a 1s uncertainty of 115 m along latitude, and 44 m along longitude, just 146 m from the target impact site. Meanwhile, the trajectory-derived SSC impact location is -84.719 deg, -49.61 deg, with a 1 alpha uncertainty of 3 m along the Earth vector and 75 m orthogonal to that, 766 m from the target location and 2.803 km south-west of the Centaur impact. We also detail the Centaur impact angle and SSC instrument pointing errors. Six high-level LCROSS mission requirements are shown to be met by wide margins. We hope that these results facilitate further analyses of the LCROSS experiment data and follow-up observations of the impact region

  3. Industrial Location Research Studies: Reports 9-16.

    ERIC Educational Resources Information Center

    Fantus Co., Inc., New York, NY.

    Eight studies identify, examine, and evaluate significant elements of industry-location decisions as they relate directly or indirectly to public investment policies and activities that may be considered as economic growth stimulants for the Appalachian region. Examined in the document are the chlor-alkali industry; the manufacturing of trucks,…

  4. No Sex Differences in Spatial Location Memory for Abstract Designs

    ERIC Educational Resources Information Center

    Rahman, Qazi; Bakare, Monsurat; Serinsu, Ceydan


    Previous research has demonstrated a female advantage, albeit imperfectly, on tests of object location memory where object identity information is readily available. However, spatial and visual elements are often confounded in the experimental tasks used. Here spatial and visual memory performance was compared in 30 men and 30 women by presenting…

  5. Artificial Neural Network for Location Estimation in Wireless Communication Systems

    PubMed Central

    Chen, Chien-Sheng


    In a wireless communication system, wireless location is the technique used to estimate the location of a mobile station (MS). To enhance the accuracy of MS location prediction, we propose a novel algorithm that utilizes time of arrival (TOA) measurements and the angle of arrival (AOA) information to locate MS when three base stations (BSs) are available. Artificial neural networks (ANN) are widely used techniques in various areas to overcome the problem of exclusive and nonlinear relationships. When the MS is heard by only three BSs, the proposed algorithm utilizes the intersections of three TOA circles (and the AOA line), based on various neural networks, to estimate the MS location in non-line-of-sight (NLOS) environments. Simulations were conducted to evaluate the performance of the algorithm for different NLOS error distributions. The numerical analysis and simulation results show that the proposed algorithms can obtain more precise location estimation under different NLOS environments. PMID:22736978

  6. Fracture Capabilities in Grizzly with the extended Finite Element Method (X-FEM)

    SciTech Connect

    Dolbow, John; Zhang, Ziyu; Spencer, Benjamin; Jiang, Wen


    Efforts are underway to develop fracture mechanics capabilities in the Grizzly code to enable it to be used to perform deterministic fracture assessments of degraded reactor pressure vessels (RPVs). A capability was previously developed to calculate three-dimensional interaction- integrals to extract mixed-mode stress-intensity factors. This capability requires the use of a finite element mesh that conforms to the crack geometry. The eXtended Finite Element Method (X-FEM) provides a means to represent a crack geometry without explicitly fitting the finite element mesh to it. This is effected by enhancing the element kinematics to represent jump discontinuities at arbitrary locations inside of the element, as well as the incorporation of asymptotic near-tip fields to better capture crack singularities. In this work, use of only the discontinuous enrichment functions was examined to see how accurate stress intensity factors could still be calculated. This report documents the following work to enhance Grizzly’s engineering fracture capabilities by introducing arbitrary jump discontinuities for prescribed crack geometries; X-FEM Mesh Cutting in 3D: to enhance the kinematics of elements that are intersected by arbitrary crack geometries, a mesh cutting algorithm was implemented in Grizzly. The algorithm introduces new virtual nodes and creates partial elements, and then creates a new mesh connectivity; Interaction Integral Modifications: the existing code for evaluating the interaction integral in Grizzly was based on the assumption of a mesh that was fitted to the crack geometry. Modifications were made to allow for the possibility of a crack front that passes arbitrarily through the mesh; and Benchmarking for 3D Fracture: the new capabilities were benchmarked against mixed-mode three-dimensional fracture problems with known analytical solutions.

  7. Wireless Damage Location Sensing System

    NASA Technical Reports Server (NTRS)

    Woodard, Stanley E. (Inventor); Taylor, Bryant Douglas (Inventor)


    A wireless damage location sensing system uses a geometric-patterned wireless sensor that resonates in the presence of a time-varying magnetic field to generate a harmonic response that will experience a change when the sensor experiences a change in its geometric pattern. The sensing system also includes a magnetic field response recorder for wirelessly transmitting the time-varying magnetic field and for wirelessly detecting the harmonic response. The sensing system compares the actual harmonic response to a plurality of predetermined harmonic responses. Each predetermined harmonic response is associated with a severing of the sensor at a corresponding known location thereof so that a match between the actual harmonic response and one of the predetermined harmonic responses defines the known location of the severing that is associated therewith.

  8. A Satellite Interference Location System

    NASA Astrophysics Data System (ADS)

    Smith, William Whitfield, Jr.


    This dissertation describes the design and development of a system for inferring the position of terrestrial satellite uplink stations using existing domestic satellites with minimal disruption to normal satellite operation. Two methods are presented by which a quantity measured at a terrestrial receiving site is mapped into a curve of possible uplink locations on the Earth's surface. One method involves measuring differential time delays of a single uplink signal observed through two adjacent spacecraft. Another method uses a short baseline interferometer composed of the two cross-polarized and spatially separated antenna feeds aboard an affected satellite. A unique location or two dimensional solution is obtained by employing an appropriate combination of the two presented methods. A system for measurement of the required differential delays and phases is described in addition to the experimental work performed to demonstrate the feasibility of these location methods.

  9. Neuroanatomical correlates of locative prepositions.


    Tranel, Daniel; Kemmerer, David


    Very little research has explored which neural systems may be important for retrieving the meanings of locative prepositions (e.g., in, on, around). To begin to address this knowledge gap, we conducted a lesion study in which we tested the hypothesis that processing the meanings of locative prepositions depends on neural structures in the left inferior prefrontal cortex and left inferior parietal cortex. Seventy-eight subjects with focal, stable lesions to various parts of the telencephalon and a comparison group of 60 normal participants were studied with tasks that require production, comprehension, and semantic analysis of locative prepositions. In support of our hypothesis, we found that in subjects with impaired knowledge of locative prepositions, the highest region of lesion overlap was in the left frontal operculum and the left supramarginal gyrus, and in the white matter subjacent to these two areas. In a second study, focused on six subjects who had pervasive defects for locative preposition knowledge, we confirmed that such defects were associated specifically with damage to the posterior left frontal operculum, white matter subjacent to this region, and white matter underneath the inferior parietal operculum. These subjects did not have basic impairments in spatial processing or working memory, and they had relatively well-preserved processing of conceptual knowledge for actions and various categories of concrete entities (e.g., persons, animals, tools). All six subjects, however, had defects in naming actions, and some of them also had defective naming of some categories of concrete entities. Overall, the findings converge nicely with recent results from functional imaging approaches, and with classic studies from the aphasia-based literature, and suggest that the left inferior prefrontal and left inferior parietal regions have crucial-albeit not exclusive-roles in processing knowledge associated with locative prepositions. PMID:21038229

  10. Why do electromagnetic pulses enhance bone growth?


    Bowen, Samuel P; Mancini, Jay D; Fessatidis, Vassilios; Grabiner, Mark


    The excitation probability of substrate molecules involved in the production of growth factors influencing the division of chondrocytes in the growth layer of bone under the influence of pulsed electromagnetic fields is studied theoretically in a quantum mechanical model calculation. In this model matrix elements and anti-bonding energy levels are assumed known and the dynamics of the interaction with pulsed electromagnetic fields is derived. The derivation makes it clear that continuous pulsing or large driving currents can overwhelm local diffusive transport to the growth plane resulting in a loss of its enhancement properties. Optimal locations within a pair of Helmholtz coils for enhancement of bone growth are also investigated and found to be close to the coils. The work presented here is believed to be the first derivation in a model calculation of a physical basis for the effects of pulsed electromagnetic fields on bone growth and fusion.

  11. Enhancer choice in cis and in trans in Drosophila melanogaster: role of the promoter.

    PubMed Central

    Morris, James R; Petrov, Dmitri A; Lee, Anne M; Wu, Chao-Ting


    Eukaryotic enhancers act over very long distances, yet still show remarkable specificity for their own promoter. To better understand mechanisms underlying this enhancer-promoter specificity, we used transvection to analyze enhancer choice between two promoters, one located in cis to the enhancer and the other in trans to the enhancer, at the yellow gene of Drosophila melanogaster. Previously, we demonstrated that enhancers at yellow prefer to act on the cis-linked promoter, but that mutation of core promoter elements in the cis-linked promoter releases enhancers to act in trans. Here, we address the mechanism by which these elements affect enhancer choice. We consider and explicitly test three models that are based on promoter competency, promoter pairing, and promoter identity. Through targeted gene replacement of the endogenous yellow gene, we show that competency of the cis-linked promoter is a key parameter in the cis-trans choice of an enhancer. In fact, complete replacement of the yellow promoter with both TATA-containing and TATA-less heterologous promoters maintains enhancer action in cis. PMID:15342512

  12. Nuclear breeder reactor fuel element with silicon carbide getter


    Christiansen, David W.; Karnesky, Richard A.


    An improved cesium getter 28 is provided in a breeder reactor fuel element or pin in the form of an extended surface area, low density element formed in one embodiment as a helically wound foil 30 located with silicon carbide, and located at the upper end of the fertile material upper blanket 20.


    EPA Science Inventory

    Many water distribution systems in this country are almost 100 years old. About 26 percent of piping in these systems is made of unlined cast iron or steel and is in poor condition. Many methods that locate leaks in these pipes are time-consuming, costly, disruptive to operations...

  14. Earthquake location in island arcs

    USGS Publications Warehouse

    Engdahl, E.R.; Dewey, J.W.; Fujita, K.


    A comprehensive data set of selected teleseismic P-wave arrivals and local-network P- and S-wave arrivals from large earthquakes occurring at all depths within a small section of the central Aleutians is used to examine the general problem of earthquake location in island arcs. Reference hypocenters for this special data set are determined for shallow earthquakes from local-network data and for deep earthquakes from combined local and teleseismic data by joint inversion for structure and location. The high-velocity lithospheric slab beneath the central Aleutians may displace hypocenters that are located using spherically symmetric Earth models; the amount of displacement depends on the position of the earthquakes with respect to the slab and on whether local or teleseismic data are used to locate the earthquakes. Hypocenters for trench and intermediate-depth events appear to be minimally biased by the effects of slab structure on rays to teleseismic stations. However, locations of intermediate-depth events based on only local data are systematically displaced southwards, the magnitude of the displacement being proportional to depth. Shallow-focus events along the main thrust zone, although well located using only local-network data, are severely shifted northwards and deeper, with displacements as large as 50 km, by slab effects on teleseismic travel times. Hypocenters determined by a method that utilizes seismic ray tracing through a three-dimensional velocity model of the subduction zone, derived by thermal modeling, are compared to results obtained by the method of joint hypocenter determination (JHD) that formally assumes a laterally homogeneous velocity model over the source region and treats all raypath anomalies as constant station corrections to the travel-time curve. The ray-tracing method has the theoretical advantage that it accounts for variations in travel-time anomalies within a group of events distributed over a sizable region of a dipping, high

  15. Communication interference/jamming and propagation analysis system and its application to radio location

    NASA Astrophysics Data System (ADS)

    Kuzucu, H.


    Modern defense systems depend on comprehensive surveillance capability. The ability to detect and locate the radio signals is a major element of a surveillance system. With the increasing need for more mobile surveillance systems in conjunction with the rapid deployment of forces and the advent of technology allowing more enhanced use of small aperture systems, tactical direction finding (DF) and radiolocation systems will have to be operated in diverse operational conditions. A quick assessment of the error levels expected and the evaluation of the reliability of the fixes on the targeted areas bears crucial importance to the effectiveness of the missions relying on DF data. This paper presents a sophisticated, graphics workstation based computer tool developed for the system level analysis of radio communication systems and describes its use in radiolocation applications for realizing such accurate and realistic assessments with substantial money and time savings.

  16. Rolling-Element Bearings

    NASA Technical Reports Server (NTRS)

    Hamrock, B. J.; Anderson, W. J.


    Rolling element bearings are a precision, yet simple, machine element of great utility. A brief history of rolling element bearings is reviewed and the type of rolling element bearings, their geometry and kinematics, as well as the materials they are made from and the manufacturing processes they involve are described. Unloaded and unlubricated rolling element bearings, loaded but unlubricated rolling element bearings and loaded and lubricated rolling element bearings are considered. The recognition and understanding of elastohydrodynamic lubrication covered, represents one of the major development in rolling element bearings.

  17. Epochal trace elements and evolution.


    Pfeiffer, C C; Braverman, E R


    The use of some trace elements by plants and animals during the evolutionary process has resulted in epochal changes. Noteworthy is the fact that plants (but not animals) needed boron in order to grow stems and roots as they left the seas and became anchored on land. Iodine is plentiful in sea water but rare on land. Therefore, the iodination of tyrosine provided an iodine transport mechanism which allowed for the metamorphosis and the development of warm bloodedness--a great evolutionary advantage. Zinc from clay was needed for the formation of the first primitive nucleic acids and, later, the presence of zinc in the retina provide the enhanced night vision of the nocturnal predators--a natural advantage. Hence, boron, iodine and zinc can be termed epochal trace elements. Inquiry should be directed towards the possible roles of other trace elements, which may have been epochal in evolution. PMID:7136960

  18. Apo CIII gene transcription is regulated by a cytokine inducible NF-kappa B element.

    PubMed Central

    Gruber, P J; Torres-Rosado, A; Wolak, M L; Leff, T


    Overproduction of Apo CIII causes elevated plasma triglyceride levels in transgenic animals and is associated with hypertriglyceridemia in humans. The regulation of apo CIII production is likely to play an important role in controlling plasma triglyceride levels. As an initial step in determining the role of transcriptional regulation in the production of apo CIII and in triglyceride metabolism, we have begun to characterize the activity of specific transcriptional regulatory elements in the CIII promoter. In the current study, we have identified and characterized an NF-kappa B regulatory element located 150 nucleotides upstream from the transcriptional start site of the apo CIII gene. Purified NF-kappa B, as well as an NF-kappa B protein in HepG2 cell nuclear extracts, bound specifically to this sequence element. The hepatic protein was induced by phorbol ester (PMA), and reacted with antibodies to the p50 and p65 subunits of NF-kappa B. The NF-kappa B element conferred PMA and IL1-beta inducible transcriptional activity to a heterologous promoter/reporter construct when transfected into HepG2 cells. Analysis of the full length CIII promoter demonstrated that the inducible activity of the NF-kappa B element was suppressed by sequences in the apo CIII enhancer element located approximately 500 nucleotides upstream of the NF-kappa B binding site. A deletion removing the enhancer restored the PMA inducible activity of the NF-kappa B binding site. These results indicate that apo CIII gene expression is regulated by NF-kappa B, and suggest that apo CIII production may be modulated by cellular signals, like inflammatory cytokines, that activate NF-kB. Images PMID:8036173

  19. Low exchange element for nuclear reactor


    Brogli, Rudolf H.; Shamasunder, Bangalore I.; Seth, Shivaji S.


    A flow exchange element is presented which lowers temperature gradients in fuel elements and reduces maximum local temperature within high temperature gas-cooled reactors. The flow exchange element is inserted within a column of fuel elements where it serves to redirect coolant flow. Coolant which has been flowing in a hotter region of the column is redirected to a cooler region, and coolant which has been flowing in the cooler region of the column is redirected to the hotter region. The safety, efficiency, and longevity of the high temperature gas-cooled reactor is thereby enhanced.

  20. Discrete Element Modeling

    SciTech Connect

    Morris, J; Johnson, S


    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  1. Carbon Enhanced Stars in the Sloan Digital Sky Survery

    NASA Astrophysics Data System (ADS)

    Keeling, Chloe; Wilhelm, R. J.


    Carbon-enhanced stars are excellent probes of the nucleosynthesis history of the universe. The existence of carbon-enhanced stars that also show enhancement of s-process elements, such as barium, suggest that enhancements are initially produced in asymptotic giant branch stars which overflow their Roche lobes and deposit processed elements on to a lower mass binary companion. This process is also one mechanism for producing binary mass transfer, blue stragglers (BS). A second is mass transfer from a first ascent red giant companion. It is therefore expected that some percentage of BS stars (those produced from AGB companions) will show both carbon and barium enhancements. For this study we have chosen SDSS stars in the temperature range of 6000 K ≤ T_eff ≤7000 K. This range samples the halo main-sequence turn-off (MSTO) and BS stars just blueward of MSTO. We make use of measurements of the CH G-band strength, located at ~4330 Å, to estimate the stellar carbon abundance. To measure the G-band strength we use the S magnitude index, optimized by Martell et al. (2008). We run the same index measurements on a grid of synthetic spectra with Teff, Log(g), [Fe/H] and various carbon enhancements. Using the observed S-index and spectral parameters from Segue Stellar Parameter Pipeline, we compare to our calibration grid and determine the carbon abundance. We will present our carbon abundance results along with a rough estimate of barium from our index method and a classification into three broad groups, 1) No enhancement in Ba or C, 2) C enhancement and no Ba enhancement, and 3) C and Ba enhancement. We will present preliminary results on the percentages of each category for both the MSTO and BS stars.

  2. Real-time enhanced vision system

    NASA Astrophysics Data System (ADS)

    Hines, Glenn D.; Rahman, Zia-ur; Jobson, Daniel J.; Woodell, Glenn A.; Harrah, Steven D.


    Flying in poor visibility conditions, such as rain, snow, fog or haze, is inherently dangerous. However these conditions can occur at nearly any location, so inevitably pilots must successfully navigate through them. At NASA Langley Research Center (LaRC), under support of the Aviation Safety and Security Program Office and the Systems Engineering Directorate, we are developing an Enhanced Vision System (EVS) that combines image enhancement and synthetic vision elements to assist pilots flying through adverse weather conditions. This system uses a combination of forward-looking infrared and visible sensors for data acquisition. A core function of the system is to enhance and fuse the sensor data in order to increase the information content and quality of the captured imagery. These operations must be performed in real-time for the pilot to use while flying. For image enhancement, we are using the LaRC patented Retinex algorithm since it performs exceptionally well for improving low-contrast range imagery typically seen during poor visibility poor visibility conditions. In general, real-time operation of the Retinex requires specialized hardware. To date, we have successfully implemented a single-sensor real-time version of the Retinex on several different Digital Signal Processor (DSP) platforms. In this paper we give an overview of the EVS and its performance requirements for real-time enhancement and fusion and we discuss our current real-time Retinex implementations on DSPs.

  3. Real-time Enhanced Vision System

    NASA Technical Reports Server (NTRS)

    Hines, Glenn D.; Rahman, Zia-Ur; Jobson, Daniel J.; Woodell, Glenn A.; Harrah, Steven D.


    Flying in poor visibility conditions, such as rain, snow, fog or haze, is inherently dangerous. However these conditions can occur at nearly any location, so inevitably pilots must successfully navigate through them. At NASA Langley Research Center (LaRC), under support of the Aviation Safety and Security Program Office and the Systems Engineering Directorate, we are developing an Enhanced Vision System (EVS) that combines image enhancement and synthetic vision elements to assist pilots flying through adverse weather conditions. This system uses a combination of forward-looking infrared and visible sensors for data acquisition. A core function of the system is to enhance and fuse the sensor data in order to increase the information content and quality of the captured imagery. These operations must be performed in real-time for the pilot to use while flying. For image enhancement, we are using the LaRC patented Retinex algorithm since it performs exceptionally well for improving low-contrast range imagery typically seen during poor visibility conditions. In general, real-time operation of the Retinex requires specialized hardware. To date, we have successfully implemented a single-sensor real-time version of the Retinex on several different Digital Signal Processor (DSP) platforms. In this paper we give an overview of the EVS and its performance requirements for real-time enhancement and fusion and we discuss our current real-time Retinex implementations on DSPs.

  4. Comparison of hexahedral and tetrahedral elements in finite element analysis of the foot and footwear.


    Tadepalli, Srinivas C; Erdemir, Ahmet; Cavanagh, Peter R


    Finite element analysis has been widely used in the field of foot and footwear biomechanics to determine plantar pressures as well as stresses and strains within soft tissue and footwear materials. When dealing with anatomical structures such as the foot, hexahedral mesh generation accounts for most of the model development time due to geometric complexities imposed by branching and embedded structures. Tetrahedral meshing, which can be more easily automated, has been the approach of choice to date in foot and footwear biomechanics. Here we use the nonlinear finite element program Abaqus (Simulia, Providence, RI) to examine the advantages and disadvantages of tetrahedral and hexahedral elements under compression and shear loading, material incompressibility, and frictional contact conditions, which are commonly seen in foot and footwear biomechanics. This study demonstrated that for a range of simulation conditions, hybrid hexahedral elements (Abaqus C3D8H) consistently performed well while hybrid linear tetrahedral elements (Abaqus C3D4H) performed poorly. On the other hand, enhanced quadratic tetrahedral elements with improved stress visualization (Abaqus C3D10I) performed as well as the hybrid hexahedral elements in terms of contact pressure and contact shear stress predictions. Although the enhanced quadratic tetrahedral element simulations were computationally expensive compared to hexahedral element simulations in both barefoot and footwear conditions, the enhanced quadratic tetrahedral element formulation seems to be very promising for foot and footwear applications as a result of decreased labor and expedited model development, all related to facilitated mesh generation.

  5. Location, Location, Location: How Would a High-Performing Charter School Network Fare in Different States?

    ERIC Educational Resources Information Center

    Lozier, Chris; Rotherham, Andrew J.


    In this paper the authors do not examine different operating strategies for charter schools or analyze the impact of their often educationally intensive models on finance. Instead, because public charter schools are funded predominantly by public dollars, they simply ask what impact location--and its associated variances in public funding and the…

  6. It's All about Location, Location, Location: Children's Memory for the "Where'' of Personally Experienced Events

    ERIC Educational Resources Information Center

    Bauer, Patricia J.; Doydum, Ayzit O.; Pathman, Thanujeni; Larkina, Marina; Guler, O. Evren; Burch, Melissa


    Episodic memory is defined as the ability to recall specific past events located in a particular time and place. Over the preschool and into the school years, there are clear developmental changes in memory for when events took place. In contrast, little is known about developmental changes in memory for where events were experienced. In the…

  7. Antarctic Meteorite Location Map Series

    NASA Technical Reports Server (NTRS)

    Schutt, John (Editor); Fessler, Brian (Editor); Cassidy, William (Editor)


    Antarctica has been a prolific source of meteorites since meteorite concentrations were discovered in 1969. The Antarctic Search For Meteorites (ANSMET) project has been active over much of the Trans-Antarctic Mountain Range. The first ANSMET expedition (a joint U.S.-Japanese effort) discovered what turned out to be a significant concentration of meteorites at the Allan Hills in Victoria Land. Later reconnaissance in this region resulted in the discovery of meteorite concentrations on icefields to the west of the Allan Hills, at Reckling Moraine, and Elephant Moraine. Antarctic meteorite location maps (reduced versions) of the Allan Hills main, near western, middle western, and far western icefields and the Elephant Moraine icefield are presented. Other Antarctic meteorite location maps for the specimens found by the ANSMET project are being prepared.

  8. Cholesterol's location in lipid bilayers


    Marquardt, Drew; Kučerka, Norbert; Wassall, Stephen R.; Harroun, Thad A.; Katsaras, John


    It is well known that cholesterol modifies the physical properties of lipid bilayers. For example, the much studied liquid-ordered Lo phase contains rapidly diffusing lipids with their acyl chains in the all trans configuration, similar to gel phase bilayers. Moreover, the Lo phase is commonly associated with cholesterol-enriched lipid rafts, which are thought to serve as platforms for signaling proteins in the plasma membrane. Cholesterol's location in lipid bilayers has been studied extensively, and it has been shown – at least in some bilayers – to align differently from its canonical upright orientation, where its hydroxyl group is in themore » vicinity of the lipid–water interface. In this study we review recent works describing cholesterol's location in different model membrane systems with emphasis on results obtained from scattering, spectroscopic and molecular dynamics studies.« less

  9. Location Privacy in RFID Applications

    NASA Astrophysics Data System (ADS)

    Sadeghi, Ahmad-Reza; Visconti, Ivan; Wachsmann, Christian

    RFID-enabled systems allow fully automatic wireless identification of objects and are rapidly becoming a pervasive technology with various applications. However, despite their benefits, RFID-based systems also pose challenging risks, in particular concerning user privacy. Indeed, improvident use of RFID can disclose sensitive information about users and their locations allowing detailed user profiles. Hence, it is crucial to identify and to enforce appropriate security and privacy requirements of RFID applications (that are also compliant to legislation). This chapter first discusses security and privacy requirements for RFID-enabled systems, focusing in particular on location privacy issues. Then it explores the advances in RFID applications, stressing the security and privacy shortcomings of existing proposals. Finally, it presents new promising directions for privacy-preserving RFID systems, where as a case study we focus electronic tickets (e-tickets) for public transportation.

  10. Computer Model Locates Environmental Hazards

    NASA Technical Reports Server (NTRS)


    Catherine Huybrechts Burton founded San Francisco-based Endpoint Environmental (2E) LLC in 2005 while she was a student intern and project manager at Ames Research Center with NASA's DEVELOP program. The 2E team created the Tire Identification from Reflectance model, which algorithmically processes satellite images using turnkey technology to retain only the darkest parts of an image. This model allows 2E to locate piles of rubber tires, which often are stockpiled illegally and cause hazardous environmental conditions and fires.

  11. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters.


    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N


    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and "delivering" remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  12. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters

    PubMed Central

    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N


    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and “delivering” remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development.

  13. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters

    PubMed Central

    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N


    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and “delivering” remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  14. Elements of Film.

    ERIC Educational Resources Information Center

    Bobker, Lee R.

    A film is the successful combination of two distinct groups of elements: (1) the technical elements by which the film is made (camera, lighting, sound and editing) and (2) the esthetic elements that transform the craft into an art. This book attempts to combine the study of these elements by providing technical information about the process of…

  15. Organic Elemental Analysis.

    ERIC Educational Resources Information Center

    Ma, T. S.; Wang, C. Y.


    Presents a literature review on methods used to analyze organic elements. Topic areas include methods for: (1) analyzing carbon, hydrogen, and nitrogen; (2) analyzing oxygen, sulfur, and halogens; (3) analyzing other elements; (4) simultaneously determining several elements; and (5) determing trace elements. (JN)

  16. Locating buildings in aerial photos

    NASA Technical Reports Server (NTRS)

    Green, James S.


    Algorithms and techniques for use in the identification and location of large buildings in digitized copies of aerial photographs are developed and tested. The building data would be used in the simulation of objects located in the vicinity of an airport that may be detected by aircraft radar. Two distinct approaches are considered. Most building footprints are rectangular in form. The first approach studied is to search for right-angled corners that characterize rectangular objects and then to connect these corners to complete the building. This problem is difficult because many nonbuilding objects, such as street corners, parking lots, and ballparks often have well defined corners which are often difficult to distinguish from rooftops. Furthermore, rooftops come in a number of shapes, sizes, shadings, and textures which also limit the discrimination task. The strategy used linear sequences of different samples to detect straight edge segments at multiple angles and to determine when these segments meet at approximately right-angles with respect to each other. This technique is effective in locating corners. The test image used has a fairly rectangular block pattern oriented about thirty degrees clockwise from a vertical alignment, and the overall measurement data reflect this. However, this technique does not discriminate between buildings and other objects at an operationally suitable rate. In addition, since multiple paths are tested for each image pixel, this is a time consuming task. The process can be speeded up by preprocessing the image to locate the more optimal sampling paths. The second approach is to rely on a human operator to identify and select the building objects and then to have the computer determine the outline and location of the selected structures. When presented with a copy of a digitized aerial photograph, the operator uses a mouse and cursor to select a target building. After a button on the mouse is pressed, with the cursor fully within

  17. CEGA—a catalog of conserved elements from genomic alignments

    PubMed Central

    Dousse, Aline; Junier, Thomas; Zdobnov, Evgeny M.


    By identifying genomic sequence regions conserved among several species, comparative genomics offers opportunities to discover putatively functional elements without any prior knowledge of what these functions might be. Comparative analyses across mammals estimated 4–5% of the human genome to be functionally constrained, a much larger fraction than the 1–2% occupied by annotated protein-coding or RNA genes. Such functionally constrained yet unannotated regions have been referred to as conserved non-coding sequences (CNCs) or ultra-conserved elements (UCEs), which remain largely uncharacterized but probably form a highly heterogeneous group of elements including enhancers, promoters, motifs, and others. To facilitate the study of such CNCs/UCEs, we present our resource of Conserved Elements from Genomic Alignments (CEGA), accessible from Harnessing the power of multiple species comparisons to detect genomic elements under purifying selection, CEGA provides a comprehensive set of CNCs identified at different radiations along the vertebrate lineage. Evolutionary constraint is identified using threshold-free phylogenetic modeling of unbiased and sensitive global alignments of genomic synteny blocks identified using protein orthology. We identified CNCs independently for five vertebrate clades, each referring to a different last common ancestor and therefore to an overlapping but varying set of CNCs with 24 488 in vertebrates, 241 575 in amniotes, 709 743 in Eutheria, 642 701 in Boreoeutheria and 612 364 in Euarchontoglires, spanning from 6 Mbp in vertebrates to 119 Mbp in Euarchontoglires. The dynamic CEGA web interface displays alignments, genomic locations, as well as biologically relevant data to help prioritize and select CNCs of interest for further functional investigations. PMID:26527719

  18. CEGA--a catalog of conserved elements from genomic alignments.


    Dousse, Aline; Junier, Thomas; Zdobnov, Evgeny M


    By identifying genomic sequence regions conserved among several species, comparative genomics offers opportunities to discover putatively functional elements without any prior knowledge of what these functions might be. Comparative analyses across mammals estimated 4-5% of the human genome to be functionally constrained, a much larger fraction than the 1-2% occupied by annotated protein-coding or RNA genes. Such functionally constrained yet unannotated regions have been referred to as conserved non-coding sequences (CNCs) or ultra-conserved elements (UCEs), which remain largely uncharacterized but probably form a highly heterogeneous group of elements including enhancers, promoters, motifs, and others. To facilitate the study of such CNCs/UCEs, we present our resource of Conserved Elements from Genomic Alignments (CEGA), accessible from Harnessing the power of multiple species comparisons to detect genomic elements under purifying selection, CEGA provides a comprehensive set of CNCs identified at different radiations along the vertebrate lineage. Evolutionary constraint is identified using threshold-free phylogenetic modeling of unbiased and sensitive global alignments of genomic synteny blocks identified using protein orthology. We identified CNCs independently for five vertebrate clades, each referring to a different last common ancestor and therefore to an overlapping but varying set of CNCs with 24 488 in vertebrates, 241 575 in amniotes, 709 743 in Eutheria, 642 701 in Boreoeutheria and 612 364 in Euarchontoglires, spanning from 6 Mbp in vertebrates to 119 Mbp in Euarchontoglires. The dynamic CEGA web interface displays alignments, genomic locations, as well as biologically relevant data to help prioritize and select CNCs of interest for further functional investigations.

  19. Analysis of enhancer function of the HS-40 core sequence of the human alpha-globin cluster.

    PubMed Central

    Chen, H; Lowrey, C H; Stamatoyannopoulos, G


    HS-40 is the major regulatory element of the human alpha-globin locus, located 40 kb upstream of the zeta-globin gene. To test for potential interactions between HS-40 and the beta- or the gamma-globin gene promoters in stable transfection assays, the HS-40 core sequence was cloned upstream of either the beta promoter or the gamma promoter driving the neomycin phosphotransferase gene and enhancer activity was measured using a colony assay. In K562 or in MEL cells, enhancer activity of HS-40 was higher than that of the individual core sequences of the DNase I hypersensitive sites (HS) of the beta-globin locus control region (LCR), and approximately 60% of the enhancer activity of a 2.5 kb microLCR, which contains the core elements of DNase I hypersensitive sites 1-4. In contrast to the synergistic interaction between the DNase I hypersensitive sites of beta locus LCR, combination of HS-40 with these DNase I hypersensitive sites failed to display cooperativity in K562 cells and inhibited enhancer function in MEL cells. Inhibition of enhancer function was also observed when two copies of the HS-40 were arranged tandemly. We conclude that the core element of HS-40 (i) is a powerful enhancer of gamma- and beta-globin gene expression, (ii) in contrast to other classical enhancers, acts best as a single copy, (iii) does not cooperate with the regulatory elements of the beta-globin locus control region. PMID:9207043

  20. A simple gamma spectrometry method for evaluating the burnup of MTR-type HEU fuel elements

    NASA Astrophysics Data System (ADS)

    Makmal, T.; Aviv, O.; Gilad, E.


    A simple method for the evaluation of the burnup of a materials testing reactor (MTR) fuel element by gamma spectrometry is presented. The method was applied to a highly enriched uranium MTR nuclear fuel element that was irradiated in a 5 MW pool-type research reactor for a total period of 34 years. The experimental approach is based on in-situ measurements of the MTR fuel element in the reactor pool by a portable high-purity germanium detector located in a gamma cell. To corroborate the method, analytical calculations (based on the irradiation history of the fuel element) and computer simulations using a dedicated fuel cycle burnup code ORIGEN2 were performed. The burnup of the MTR fuel element was found to be 52.4±8.8%, which is in good agreement with the analytical calculations and the computer simulations. The method presented here is suitable for research reactors with either a regular or an irregular irradiation regime and for reactors with limited infrastructure and/or resources. In addition, its simplicity and the enhanced safety it confers may render this method suitable for IAEA inspectors in fuel element burnup assessments during on-site inspections.