Sample records for enhancer element located

  1. System performance and performance enhancement relative to element position location errors for distributed linear antenna arrays

    NASA Astrophysics Data System (ADS)

    Adrian, Andrew

    For the most part, antenna phased arrays have traditionally been comprised of antenna elements that are very carefully and precisely placed in very periodic grid structures. Additionally, the relative positions of the elements to each other are typically mechanically fixed as best as possible. There is never an assumption the relative positions of the elements are a function of time or some random behavior. In fact, every array design is typically analyzed for necessary element position tolerances in order to meet necessary performance requirements such as directivity, beamwidth, sidelobe level, and beam scanning capability. Consider an antenna array that is composed of several radiating elements, but the position of each of the elements is not rigidly, mechanically fixed like a traditional array. This is not to say that the element placement structure is ignored or irrelevant, but each element is not always in its relative, desired location. Relative element positioning would be analogous to a flock of birds in flight or a swarm of insects. They tend to maintain a near fixed position with the group, but not always. In the antenna array analog, it would be desirable to maintain a fixed formation, but due to other random processes, it is not always possible to maintain perfect formation. This type of antenna array is referred to as a distributed antenna array. A distributed antenna array's inability to maintain perfect formation causes degradations in the antenna factor pattern of the array. Directivity, beamwidth, sidelobe level and beam pointing error are all adversely affected by element relative position error. This impact is studied as a function of element relative position error for linear antenna arrays. The study is performed over several nominal array element spacings, from lambda to lambda, several sidelobe levels (20 to 50 dB) and across multiple array illumination tapers. Knowing the variation in performance, work is also performed to utilize a minimum

  2. Functional dissection of an enhancer-like element located within the second intron of the human U2AF1L4 gene.


    Didych, D A; Smirnov, N A; Kotova, E S; Akopov, S B; Nikolaev, L G; Sverdlov, E D


    A detailed functional and evolutionary analysis of an enhancer element of the human genome (enhancer 12) located in the second intron of the U2AF1L4 gene, which we identified earlier, is presented. Overlapping fragments of the studied genome region were analyzed for enhancer activity, and the site responsible for the activity of this element was identified using transient transfections of HeLa cells. Comparison of the enhancer 12 sequence with orthologous sequences from seven primate species revealed the existence of evolutionarily conserved sequences within this element. One of the identified conservative regions is likely responsible for the enhancer activity and is able to specifically interact in vitro with proteins of HeLa cell nuclear extract. The ability of orthologous primate sequences to compete with enhancer 12 for binding with HeLa cell nuclear extract proteins and to enhance the activity of the reporter gene in transient transfection of HeLa cells is demonstrated. PMID:22022969

  3. Hypoxia-inducible nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene.

    PubMed Central

    Semenza, G L; Nejfelt, M K; Chi, S M; Antonarakis, S E


    Human erythropoietin gene expression in liver and kidney is inducible by anemia or hypoxia. DNase I-hypersensitive sites were identified 3' to the human erythropoietin gene in liver nuclei. A 256-base-pair region of 3' flanking sequence was shown by DNase I protection and electrophoretic mobility-shift assays to bind four or more different nuclear factors, at least two of which are induced by anemia in both liver and kidney, and the region functioned as a hypoxia-inducible enhancer in transient expression assays. These results provide insight into the molecular basis for the regulation of gene expression by a fundamental physiologic stimulus, hypoxia. Images PMID:2062846

  4. Arousal-Enhanced Location Memory for Pictures

    ERIC Educational Resources Information Center

    Mather, Mara; Nesmith, Kathryn


    Four experiments revealed arousal-enhanced location memory for pictures. After an incidental encoding task, participants were more likely to remember the locations of positive and negative arousing pictures than the locations of non-arousing pictures, indicating better binding of location to picture. This arousal-enhanced binding effect did not…

  5. Arousal-Enhanced Location Memory for Pictures

    PubMed Central

    Mather, Mara; Nesmith, Kathryn


    Four experiments revealed arousal-enhanced location memory for pictures. After an incidental encoding task, participants were more likely to remember the locations of positive and negative arousing pictures than the locations of non-arousing pictures, indicating better binding of location to picture. This arousal-enhanced binding effect did not have a cost for the binding of nearby pictures to their locations. Thus, arousal can enhance binding of an arousing picture’s content to its location without interfering with picture-location binding for nearby pictures. In addition, arousal-enhanced picture-location memory binding is not just a side effect of enhanced memory for the picture itself, as it occurs both when recognition memory is good and when it is poor. PMID:19190722

  6. A CAR-responsive enhancer element locating approximately 31 kb upstream in the 5'-flanking region of rat cytochrome P450 (CYP) 3A1 gene.


    Gamou, Toshie; Habano, Wataru; Terashima, Jun; Ozawa, Shogo


    Constitutive androstane receptor (CAR) is one of the principal regulators of hepatic cytochrome P450s (CYPs) 3A (CYP3A). cDNA-mediated expression of a mature rat CAR (rCAR) into rat hepatoma cells induced CYP3A1 and CYP2B mRNAs. Aberrant rCAR failed in these inductions. Three important human CYP3A4 regulatory elements (REs), proximal ER6 (proER6), xenobiotic responsive enhancer module (XREM) and constitutive liver enhancer module (CLEM), support constitutive and inducible expression of CYP3As mediated by CAR and pregnane X receptor (PXR). NHR-scan software predicted proER6, XREM and CLEM at -255 b, -8 kb and -11.5 kb, respectively of CYP3A4, but neither XREM nor CLEM was predicted in rat CYP3A. A luciferase reporter construct carrying a 5'-flanking sequence of CYP3A1 (-31,739 to -31,585 from its transcription initiation site) revealed important for the rCAR-dependent transactivation of CYP3A1. This region includes two putative binding motifs of nuclear receptors (DR4 and DR2), a putative hepatocyte nuclear factor-1 binding motif (HNF1), nuclear factor-kappa B binding motif (NFκB), activator protein 1 binding motif (AP-1), and ecotropic viral integration site 1 binding motif (Evi1). We hereby conclude DR4 and/or DR2 motifs being primarily responsible and HNF1 being synergistically functioning elements for the rCAR-mediated transcription of CYP3A1. PMID:25989892

  7. Enhancements to modal testing using finite elements

    NASA Astrophysics Data System (ADS)

    Jarvis, Brian

    In calculating the natural frequencies and mode shapes from a finite element analysis, there are generally many more degrees of freedom than can be handled for the eigensolution. A reduction process is employed to reduce the number to a master set and chosen so that the modes of interest are well defined. By choosing those freedoms where the inertia terms are high or the stiffness terms are low then an automatic procedure for selecting the best freedoms can be defined. For modal testing, these master freedoms also indicate the best transducer locations for optimum low order mode identification. Having carried out the modal test, the mode shapes obtained can be forced onto the finite element model giving greatly enhanced results. By examining terms in all mode shapes from the finite element model in the frequency range of interest, the best reference or excitation position can be found. An example of the use of this technique to study the modal properties of an aero-engine compressor blade is given.

  8. When Does Generation Enhance Memory for Location?

    ERIC Educational Resources Information Center

    Marsh, Elizabeth J.


    Generation is thought to enhance both item-specific and relational processing of generated targets as compared with read words (M. A. McDaniel & P. J. Waddill, 1990). Generation facilitates encoding of the cue-target relation and sometimes boosts encoding of relations across list items. Of interest is whether generation can also increase the…

  9. Enhancing Students' Socialization: Key Elements. ERIC Digest.

    ERIC Educational Resources Information Center

    Brophy, Jere

    Coping with students who display social adjustment problems can be frustrating. However, teachers can take actions toward minimizing classroom conflicts by socializing students into a classroom environment conducive to learning. Modeling prosocial behavior is the most basic element for enhancing student socialization. In situations in which…

  10. Adaptive memory: enhanced location memory after survival processing.


    Nairne, James S; Vanarsdall, Joshua E; Pandeirada, Josefa N S; Blunt, Janell R


    Two experiments investigated whether survival processing enhances memory for location. From an adaptive perspective, remembering that food has been located in a particular area, or that potential predators are likely to be found in a given territory, should increase the chances of subsequent survival. Participants were shown pictures of food or animals located at various positions on a computer screen. The task was to rate the ease of collecting the food or capturing the animals relative to a central fixation point. Surprise retention tests revealed that people remembered the locations of the items better when the collection or capturing task was described as relevant to survival. These data extend the generality of survival processing advantages to a new domain (location memory) by means of a task that does not involve rating the relevance of words to a scenario. PMID:22004268

  11. 49 CFR 236.560 - Contact element, mechanical trip type; location with respect to rail.

    Code of Federal Regulations, 2010 CFR


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Contact element, mechanical trip type; location... Instructions; Locomotives § 236.560 Contact element, mechanical trip type; location with respect to rail. Contact element of automatic train stop device of the mechanical trip type shall be maintained at a...

  12. Commissural Gain Control Enhances the Midbrain Representation of Sound Location

    PubMed Central

    Orton, Llwyd David; Papasavvas, Christoforos A.


    Accurate localization of sound sources is essential for survival behavior in many species. The inferior colliculi (ICs) are the first point in the auditory pathway where cues used to locate sounds, ie, interaural time differences (ITDs), interaural level differences (ILDs), and pinna spectral cues, are all represented in the same location. These cues are first extracted separately on each side of the midline in brainstem nuclei that project to the ICs. Because of this segregation, each IC predominantly represents stimuli in the contralateral hemifield. We tested the hypothesis that commissural connections between the ICs mediate gain control that enhances sound localization acuity. We recorded IC neurons sensitive to either ITDs or ILDs in anesthetized guinea pig, before, during, and following recovery from deactivation of the contralateral IC by cryoloop cooling or microdialysis of procaine. During deactivation, responses were rescaled by divisive gain change and additive shifts, which reduced the dynamic range of ITD and ILD response functions and the ability of neurons to signal changes in sound location. These data suggest that each IC exerts multiplicative gain control and subtractive shifts over the other IC that enhances the neural representation of sound location. Furthermore, this gain control operates in a similar manner on both ITD- and ILD-sensitive neurons, suggesting a shared mechanism operates across localization cues. Our findings reveal a novel dependence of sound localization on commissural processing. SIGNIFICANCE STATEMENT Sound localization, a fundamental process in hearing, is dependent on bilateral computations in the brainstem. How this information is transmitted from the brainstem to the auditory cortex, through several stages of processing, without loss of signal fidelity, is not clear. We show that the ability of neurons in the auditory midbrain to encode azimuthal sound location is dependent on gain control mediated by the commissure of

  13. Prediction of transposable element derived enhancers using chromatin modification profiles.


    Huda, Ahsan; Tyagi, Eishita; Mariño-Ramírez, Leonardo; Bowen, Nathan J; Jjingo, Daudi; Jordan, I King


    Experimentally characterized enhancer regions have previously been shown to display specific patterns of enrichment for several different histone modifications. We modelled these enhancer chromatin profiles in the human genome and used them to guide the search for novel enhancers derived from transposable element (TE) sequences. To do this, a computational approach was taken to analyze the genome-wide histone modification landscape characterized by the ENCODE project in two human hematopoietic cell types, GM12878 and K562. We predicted the locations of 2,107 and 1,448 TE-derived enhancers in the GM12878 and K562 cell lines respectively. A vast majority of these putative enhancers are unique to each cell line; only 3.5% of the TE-derived enhancers are shared between the two. We evaluated the functional effect of TE-derived enhancers by associating them with the cell-type specific expression of nearby genes, and found that the number of TE-derived enhancers is strongly positively correlated with the expression of nearby genes in each cell line. Furthermore, genes that are differentially expressed between the two cell lines also possess a divergent number of TE-derived enhancers in their vicinity. As such, genes that are up-regulated in the GM12878 cell line and down-regulated in K562 have significantly more TE-derived enhancers in their vicinity in the GM12878 cell line and vice versa. These data indicate that human TE-derived sequences are likely to be involved in regulating cell-type specific gene expression on a broad scale and suggest that the enhancer activity of TE-derived sequences is mediated by epigenetic regulatory mechanisms. PMID:22087331

  14. Finite element analysis enhancement of cryogenic testing

    NASA Astrophysics Data System (ADS)

    Thiem, Clare D.; Norton, Douglas A.


    Finite element analysis (FEA) of large space optics enhances cryogenic testing by providing an analytical method by which to ensure that a test article survives proposed testing. The analyses presented in this paper were concerned with determining the reliability of a half meter mirror in an environment where the exact environmental profile was unknown. FEA allows the interaction between the test object and the environment to be simulated to detect potential problems prior to actual testing. These analyses examined worse case scenerios related to cooling the mirror, its structural integrity for the proposed test environment, and deformation of the reflective surface. The FEA was conducted in-house on the System's Reliability Division's VAX 11-750 and Decstation 3100 using Engineering Mechanics Research Corporation's numerically integrated elements for systems analysis finite element software. The results of the analyses showed that it would take at least 48 hours to cool the mirror to its desired testing temperature. It was also determined that the proposed mirror mount would not cause critical concentrated thermal stresses that would fracture the mirror. FEA and actual measurements of the front reflective face were compared and good agreement between computer simulation and physical tests were seen. Space deployment of large optics requires lightweight mirrors which can perform under the harsh conditions of space. The physical characteristics of these mirrors must be well understood in order that their deployment and operation are successful. Evaluating design approaches by analytical simulation, like FEA, verifies the reliability and structural integrity of a space optic during design prior to prototyping and testing. Eliminating an optic's poor design early in its life saves money, materials, and human resources while ensuring performance.

  15. 20 CFR 655.537 - The fourth attestation element for locations in Alaska: Notice of filing.

    Code of Federal Regulations, 2010 CFR


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false The fourth attestation element for locations... fourth attestation element for locations in Alaska: Notice of filing. (a)(1) The employer shall attest... performed; (ii) Contract stevedoring companies which employ or intend to employ United States...

  16. Google Earth locations of USA and seafloor hydrothermal vents with associated rare earth element data

    DOE Data Explorer

    Andrew Fowler


    Google Earth .kmz files that contain the locations of geothermal wells and thermal springs in the USA, and seafloor hydrothermal vents that have associated rare earth element data. The file does not contain the actual data, the actual data is available through the GDR website in two tier 3 data sets entitled "Compilation of Rare Earth Element Analyses from US Geothermal Fields and Mid Ocean Ridge (MOR) Hydrothermal Vents" and "Rare earth element content of thermal fluids from Surprise Valley, California"

  17. Genome-wide identification of enhancer elements.


    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel


    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems. PMID:27389984

  18. A reciprocal space approach for locating symmetry elements in Patterson superposition maps

    SciTech Connect

    Hendrixson, T.


    A method for determining the location and possible existence of symmetry elements in Patterson superposition maps has been developed. A comparison of the original superposition map and a superposition map operated on by the symmetry element gives possible translations to the location of the symmetry element. A reciprocal space approach using structure factor-like quantities obtained from the Fourier transform of the superposition function is then used to determine the best'' location of the symmetry element. Constraints based upon the space group requirements are also used as a check on the locations. The locations of the symmetry elements are used to modify the Fourier transform coefficients of the superposition function to give an approximation of the structure factors, which are then refined using the EG relation. The analysis of several compounds using this method is presented. Reciprocal space techniques for locating multiple images in the superposition function are also presented, along with methods to remove the effect of multiple images in the Fourier transform coefficients of the superposition map. In addition, crystallographic studies of the extended chain structure of (NHC{sub 5}H{sub 5})SbI{sub 4} and of the twinning method of the orthorhombic form of the high-{Tc} superconductor YBa{sub 2}Cu{sub 3}O{sub 7-x} are presented. 54 refs.

  19. Spatial Attention Enhances Perceptual Processing of Single-Element Displays

    NASA Technical Reports Server (NTRS)

    Bacon, William; Johnston, James C.; Remington, Roger W.; Null, Cynthia H. (Technical Monitor)


    Shiu and Pashler (1993) reported that precueing masked, single-element displays had negligible effects on identification accuracy. They argued that spatial attention does not actually enhance stimulus perceptibility, but only reduces decision noise. Alternatively, such negative results may arise if cues are sub-optimal, or if masks place an insufficient premium on timely deployment of attention. We report results showing that valid cueing enhances processing of even single-element displays. Spatial attention does indeed enhance perceptual processes.

  20. Finite element models predict the location of microdamage in cancellous bone following uniaxial loading.


    Goff, M G; Lambers, F M; Sorna, R M; Keaveny, T M; Hernandez, C J


    High-resolution finite element models derived from micro-computed tomography images are often used to study the effects of trabecular microarchitecture and loading mode on tissue stress, but the degree to which existing finite element methods correctly predict the location of tissue failure is not well characterized. In the current study, we determined the relationship between the location of highly strained tissue, as determined from high-resolution finite element models, and the location of tissue microdamage, as determined from three-dimensional fluoroscopy imaging, which was performed after the microdamage was generated in-vitro by mechanical testing. Fourteen specimens of human vertebral cancellous bone were assessed (8 male donors, 2 female donors, 47-78 years of age). Regions of stained microdamage, were 50-75% more likely to form in highly strained tissue (principal strains exceeding 0.4%) than elsewhere, and generally the locations of the regions of microdamage were significantly correlated (p<0.05) with the locations of highly strained tissue. This spatial correlation was stronger for the largest regions of microdamage (≥1,000,000μm(3) in volume); 87% of large regions of microdamage were located near highly strained tissue. Together, these findings demonstrate that there is a strong correlation between regions of microdamage and regions of high strain in human cancellous bone, particularly for the biomechanically more important large instances of microdamage. PMID:26522622

  1. Modulation of tissue repair by regeneration enhancer elements.


    Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D


    How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs. PMID:27049946

  2. 20 CFR 655.535 - The second attestation element for locations in Alaska: Employment of United States longshore...

    Code of Federal Regulations, 2011 CFR


    ... 20 Employees' Benefits 3 2011-04-01 2011-04-01 false The second attestation element for locations... Alaska Exception § 655.535 The second attestation element for locations in Alaska: Employment of United States longshore workers. (a) The second attestation element shall be satisfied when the employer...

  3. 20 CFR 655.535 - The second attestation element for locations in Alaska: Employment of United States longshore...

    Code of Federal Regulations, 2012 CFR


    ... 20 Employees' Benefits 3 2012-04-01 2012-04-01 false The second attestation element for locations... Alaska Exception § 655.535 The second attestation element for locations in Alaska: Employment of United States longshore workers. (a) The second attestation element shall be satisfied when the employer...

  4. 20 CFR 655.535 - The second attestation element for locations in Alaska: Employment of United States longshore...

    Code of Federal Regulations, 2013 CFR


    ... 20 Employees' Benefits 3 2013-04-01 2013-04-01 false The second attestation element for locations... Alaska Exception § 655.535 The second attestation element for locations in Alaska: Employment of United States longshore workers. (a) The second attestation element shall be satisfied when the employer...

  5. 20 CFR 655.535 - The second attestation element for locations in Alaska: Employment of United States longshore...

    Code of Federal Regulations, 2014 CFR


    ... 20 Employees' Benefits 3 2014-04-01 2014-04-01 false The second attestation element for locations... Alaska Exception § 655.535 The second attestation element for locations in Alaska: Employment of United States longshore workers. (a) The second attestation element shall be satisfied when the employer...

  6. Location, Location, Location!

    ERIC Educational Resources Information Center

    Ramsdell, Kristin


    Of prime importance in real estate, location is also a key element in the appeal of romances. Popular geographic settings and historical periods sell, unpopular ones do not--not always with a logical explanation, as the author discovered when she conducted a survey on this topic last year. (Why, for example, are the French Revolution and the…

  7. An enhanced finite element technique for diffuse phase transition

    NASA Astrophysics Data System (ADS)

    Münch, I.; Krauß, M.


    We propose a finite element technique to enhance phase-field simulations. As adaptive p-method it and can be generally applied to finite element formulations. However, diffuse interfaces have non-linear gradients within regions typically smaller compared to the size of the overall model. Thus, enhanced field interpolation with higher polynomial functions on demand allows for coarser meshing or lower regularization length for the phase transition. Our method preserves continuity of finite elements and is particularly advantageous in the context of parallelized computing. An analytical solution for the evolution of a phase-field variable governed by the Allen-Cahn equation is used to define an error measure and to investigate the proposed method. Several examples demonstrate the capability of this finite element technique.

  8. Considering Affective Responses towards Environments for Enhancing Location Based Services

    NASA Astrophysics Data System (ADS)

    Huang, H.; Gartner, G.; Klettner, S.; Schmidt, M.


    A number of studies in the field of environmental psychology show that humans perceive and evaluate their surroundings affectively. Some places are experienced as unsafe, while some others as attractive and interesting. Experiences from daily life show that many of our daily behaviours and decision-making are often influenced by this kind of affective responses towards environments. Location based services (LBS) are often designed to assist and support people's behaviours and decision-making in space. In order to provide services with high usefulness (usability and utility), LBS should consider these kinds of affective responses towards environments. This paper reports on the results of a research project, which studies how people's affective responses towards environments can be modelled and acquired, as well as how LBS can benefit by considering these affective responses. As one of the most popular LBS applications, mobile pedestrian navigation systems are used as an example for illustration.

  9. Micro-PIXE analysis of trace element concentrations of natural rubies from different locations in Myanmar

    NASA Astrophysics Data System (ADS)

    Sanchez, J. L.; Osipowicz, T.; Tang, S. M.; Tay, T. S.; Win, T. T.


    The trace element concentrations found in geological samples can shed light on the formation process. In the case of gemstones, which might be of artificial or natural origin, there is also considerable interest in the development of methods that provide identification of the origin of a sample. For rubies, trace element concentrations present in natural samples were shown previously to be significant indicators of the region of origin [S.M. Tang et al., Appl. Spectr. 42 (1988) 44, and 43 (1989) 219]. Here we report the results of micro-PIXE analyses of trace element (Ti, V, Cr, Fe, Cu and Ga) concentrations of a large set ( n = 130) of natural rough rubies from nine locations in Myanmar (Burma). The resulting concentrations are subjected to statistical analysis. Six of the nine groups form clusters when the data base is evaluated using tree clustering and principal component analysis.

  10. Trace element fingerprinting of cockle (Cerastoderma edule) shells can reveal harvesting location in adjacent areas.


    Ricardo, Fernando; Génio, Luciana; Costa Leal, Miguel; Albuquerque, Rui; Queiroga, Henrique; Rosa, Rui; Calado, Ricardo


    Determining seafood geographic origin is critical for controlling its quality and safeguarding the interest of consumers. Here, we use trace element fingerprinting (TEF) of bivalve shells to discriminate the geographic origin of specimens. Barium (Ba), manganese (Mn), magnesium (Mg), strontium (Sr) and lead (Pb) were quantified in cockle shells (Cerastoderma edule) captured with two fishing methods (by hand and by hand-raking) and from five adjacent fishing locations within an estuarine system (Ria de Aveiro, Portugal). Results suggest no differences in TEF of cockle shells captured by hand or by hand-raking, thus confirming that metal rakes do not act as a potential source of metal contamination that could somehow bias TEF results. In contrast, significant differences were recorded among locations for all trace elements analysed. A Canonical Analysis of Principal Coordinates (CAP) revealed that 92% of the samples could be successfully classified according to their fishing location using TEF. We show that TEF can be an accurate, fast and reliable method to determine the geographic origin of bivalves, even among locations separated less than 1 km apart within the same estuarine system. Nonetheless, follow up studies are needed to determine if TEF can reliably discriminate between bivalves originating from different ecosystems. PMID:26149418

  11. Syringe filtration methods for examining dissolved and colloidal trace element distributions in remote field locations

    NASA Technical Reports Server (NTRS)

    Shiller, Alan M.


    It is well-established that sampling and sample processing can easily introduce contamination into dissolved trace element samples if precautions are not taken. However, work in remote locations sometimes precludes bringing bulky clean lab equipment into the field and likewise may make timely transport of samples to the lab for processing impossible. Straightforward syringe filtration methods are described here for collecting small quantities (15 mL) of 0.45- and 0.02-microm filtered river water in an uncontaminated manner. These filtration methods take advantage of recent advances in analytical capabilities that require only small amounts of waterfor analysis of a suite of dissolved trace elements. Filter clogging and solute rejection artifacts appear to be minimal, although some adsorption of metals and organics does affect the first approximately 10 mL of water passing through the filters. Overall the methods are clean, easy to use, and provide reproducible representations of the dissolved and colloidal fractions of trace elements in river waters. Furthermore, sample processing materials can be prepared well in advance in a clean lab and transported cleanly and compactly to the field. Application of these methods is illustrated with data from remote locations in the Rocky Mountains and along the Yukon River. Evidence from field flow fractionation suggests that the 0.02-microm filters may provide a practical cutoff to distinguish metals associated with small inorganic and organic complexes from those associated with silicate and oxide colloids.

  12. Disease-associated variants in different categories of disease located in distinct regulatory elements

    PubMed Central


    Background The invention of high throughput sequencing technologies has led to the discoveries of hundreds of thousands of genetic variants associated with thousands of human diseases. Many of these genetic variants are located outside the protein coding regions, and as such, it is challenging to interpret the function of these genetic variants by traditional genetic approaches. Recent genome-wide functional genomics studies, such as FANTOM5 and ENCODE have uncovered a large number of regulatory elements across hundreds of different tissues or cell lines in the human genome. These findings provide an opportunity to study the interaction between regulatory elements and disease-associated genetic variants. Identifying these diseased-related regulatory elements will shed light on understanding the mechanisms of how these variants regulate gene expression and ultimately result in disease formation and progression. Results In this study, we curated and categorized 27,558 Mendelian disease variants, 20,964 complex disease variants, 5,809 cancer predisposing germline variants, and 43,364 recurrent cancer somatic mutations. Compared against nine different types of regulatory regions from FANTOM5 and ENCODE projects, we found that different types of disease variants show distinctive propensity for particular regulatory elements. Mendelian disease variants and recurrent cancer somatic mutations are 22-fold and 10- fold significantly enriched in promoter regions respectively (q<0.001), compared with allele-frequency-matched genomic background. Separate from these two categories, cancer predisposing germline variants are 27-fold enriched in histone modification regions (q<0.001), 10-fold enriched in chromatin physical interaction regions (q<0.001), and 6-fold enriched in transcription promoters (q<0.001). Furthermore, Mendelian disease variants and recurrent cancer somatic mutations share very similar distribution across types of functional effects. We further found that

  13. DELTA: A Distal Enhancer Locating Tool Based on AdaBoost Algorithm and Shape Features of Chromatin Modifications

    PubMed Central

    Lu, Yiming; Qu, Wubin; Shan, Guangyu; Zhang, Chenggang


    Accurate identification of DNA regulatory elements becomes an urgent need in the post-genomic era. Recent genome-wide chromatin states mapping efforts revealed that DNA elements are associated with characteristic chromatin modification signatures, based on which several approaches have been developed to predict transcriptional enhancers. However, their practical application is limited by incomplete extraction of chromatin features and model inconsistency for predicting enhancers across different cell types. To address these issues, we define a set of non-redundant shape features of histone modifications, which shows high consistency across cell types and can greatly reduce the dimensionality of feature vectors. Integrating shape features with a machine-learning algorithm AdaBoost, we developed an enhancer predicting method, DELTA (Distal Enhancer Locating Tool based on AdaBoost). We show that DELTA significantly outperforms current enhancer prediction methods in prediction accuracy on different datasets and can predict enhancers in one cell type using models trained in other cell types without loss of accuracy. Overall, our study presents a novel framework for accurately identifying enhancers from epigenetic data across multiple cell types. PMID:26091399

  14. Failure location prediction by finite element analysis for an additive manufactured mandible implant.


    Huo, Jinxing; Dérand, Per; Rännar, Lars-Erik; Hirsch, Jan-Michaél; Gamstedt, E Kristofer


    In order to reconstruct a patient with a bone defect in the mandible, a porous scaffold attached to a plate, both in a titanium alloy, was designed and manufactured using additive manufacturing. Regrettably, the implant fractured in vivo several months after surgery. The aim of this study was to investigate the failure of the implant and show a way of predicting the mechanical properties of the implant before surgery. All computed tomography data of the patient were preprocessed to remove metallic artefacts with metal deletion technique before mandible geometry reconstruction. The three-dimensional geometry of the patient's mandible was also reconstructed, and the implant was fixed to the bone model with screws in Mimics medical imaging software. A finite element model was established from the assembly of the mandible and the implant to study stresses developed during mastication. The stress distribution in the load-bearing plate was computed, and the location of main stress concentration in the plate was determined. Comparison between the fracture region and the location of the stress concentration shows that finite element analysis could serve as a tool for optimizing the design of mandible implants. PMID:26227805

  15. Experimental and Computational Investigation of Lift-Enhancing Tabs on a Multi-Element Airfoil

    NASA Technical Reports Server (NTRS)

    Ashby, Dale L.


    An experimental and computational investigation of the effect of lift-enhancing tabs on a two-element airfoil has been conducted. The objective of the study was to develop an understanding of the flow physics associated with lift-enhancing tabs on a multi-element airfoil. An NACA 63(2)-215 ModB airfoil with a 30% chord fowler flap was tested in the NASA Ames 7- by 10-Foot Wind Tunnel. Lift-enhancing tabs of various heights were tested on both the main element and the flap for a variety of flap riggings. A combination of tabs located at the main element and flap trailing edges increased the airfoil lift coefficient by 11% relative to the highest lift coefficient achieved by any baseline configuration at an angle of attack of 0 deg, and C(sub 1max) was increased by 3%. Computations of the flow over the two-element airfoil were performed using the two-dimensional incompressible Navier-Stokes code INS2D-UP. The computed results predicted all of the trends observed in the experimental data quite well. In addition, a simple analytic model based on potential flow was developed to provide a more detailed understanding of how lift-enhancing tabs work. The tabs were modeled by a point vortex at the air-foil or flap trailing edge. Sensitivity relationships were derived which provide a mathematical basis for explaining the effects of lift-enhancing tabs on a multi-element airfoil. Results of the modeling effort indicate that the dominant effects of the tabs on the pressure distribution of each element of the airfoil can be captured with a potential flow model for cases with no flow separation.

  16. Elemental abundances of flaring solar plasma - Enhanced neon and sulfur

    NASA Technical Reports Server (NTRS)

    Schmelz, J. T.


    Elemental abundances of two flares observed with the SMM Flat Crystal Spectrometer are compared and contrasted. The first had a gradual rise and a slow decay, while the second was much more impulsive. Simultaneous spectra of seven bright soft X-ray resonance lines provide information over a broad temperature range and are available throughout both flares, making these events unique in the SMM data base. For the first flare, the plasma seemed to be characterized by coronal abundances but, for the second, the plasma composition could not be coronal, photospheric, or a linear combination of both. A good differential emission measure fit required enhanced neon such that Ne/O = 0.32 +/- 0.02, a value which is inconsistent with the current models of coronal abundances based on the elemental first-ionization potential. Similar values of enhanced neon are found for flaring plasma observed by the SMM gamma-ray spectrometer, in (He-3)-rich solar energetic particle events, and in the decay phase of several long duration soft X-ray events. Sulfur is also enhanced in the impulsive flare, but not as dramatically as neon. These events are compared with two models which attempt to explain the enhanced values of neon and sulfur.

  17. Enhanced associative memory for colour (but not shape or location) in synaesthesia.


    Pritchard, Jamie; Rothen, Nicolas; Coolbear, Daniel; Ward, Jamie


    People with grapheme-colour synaesthesia have been shown to have enhanced memory on a range of tasks using both stimuli that induce synaesthesia (e.g. words) and, more surprisingly, stimuli that do not (e.g. certain abstract visual stimuli). This study examines the latter by using multi-featured stimuli consisting of shape, colour and location conjunctions (e.g. shape A+colour A+location A; shape B+colour B+location B) presented in a recognition memory paradigm. This enables distractor items to be created in which one of these features is 'unbound' with respect to the others (e.g. shape A+colour B+location A; shape A+colour A+location C). Synaesthetes had higher recognition rates suggesting an enhanced ability to bind certain visual features together into memory. Importantly, synaesthetes' false alarm rates were lower only when colour was the unbound feature, not shape or location. We suggest that synaesthetes are "colour experts" and that enhanced perception can lead to enhanced memory in very specific ways; but, not for instance, an enhanced ability to form associations per se. The results support contemporary models that propose a continuum between perception and memory. PMID:23454796

  18. Harvest locations of goose barnacles can be successfully discriminated using trace elemental signatures.


    Albuquerque, Rui; Queiroga, Henrique; Swearer, Stephen E; Calado, Ricardo; Leandro, Sérgio M


    European Union regulations state that consumers must be rightfully informed about the provenance of fishery products to prevent fraudulent practices. However, mislabeling of the geographical origin is a common practice. It is therefore paramount to develop forensic methods that allow all players involved in the supply chain to accurately trace the origin of seafood. In this study, trace elemental signatures (TES) of the goose barnacle Pollicipes pollicipes, collected from ten sites along the Portuguese coast, were employed to discriminate individual's origin. Barium (Ba), boron (B), cadmium (Cd), chromium (Cr), lithium (Li), magnesium (Mg), manganese (Mn), phosphorous (P), lead (Pb), strontium (Sr) and zinc (Zn) - were quantified using Inductively Coupled Plasma-Mass Spectrometry (ICP-MS). Significant differences were recorded among locations for all elements. A regularized discriminant analysis (RDA) revealed that 83% of all individuals were correctly assigned. This study shows TES can be a reliable tool to confirm the geographic origin of goose barnacles at fine spatial resolution. Although additional studies are required to ascertain the reliability of TES on cooked specimens and the temporal stability of the signature, the approach holds great promise for the management of goose barnacles fisheries, enforcement of conservation policies and assurance in accurate labeling. PMID:27292413

  19. Harvest locations of goose barnacles can be successfully discriminated using trace elemental signatures

    PubMed Central

    Albuquerque, Rui; Queiroga, Henrique; Swearer, Stephen E.; Calado, Ricardo; Leandro, Sérgio M.


    European Union regulations state that consumers must be rightfully informed about the provenance of fishery products to prevent fraudulent practices. However, mislabeling of the geographical origin is a common practice. It is therefore paramount to develop forensic methods that allow all players involved in the supply chain to accurately trace the origin of seafood. In this study, trace elemental signatures (TES) of the goose barnacle Pollicipes pollicipes, collected from ten sites along the Portuguese coast, were employed to discriminate individual’s origin. Barium (Ba), boron (B), cadmium (Cd), chromium (Cr), lithium (Li), magnesium (Mg), manganese (Mn), phosphorous (P), lead (Pb), strontium (Sr) and zinc (Zn) - were quantified using Inductively Coupled Plasma−Mass Spectrometry (ICP-MS). Significant differences were recorded among locations for all elements. A regularized discriminant analysis (RDA) revealed that 83% of all individuals were correctly assigned. This study shows TES can be a reliable tool to confirm the geographic origin of goose barnacles at fine spatial resolution. Although additional studies are required to ascertain the reliability of TES on cooked specimens and the temporal stability of the signature, the approach holds great promise for the management of goose barnacles fisheries, enforcement of conservation policies and assurance in accurate labeling. PMID:27292413

  20. Multiple-element eddy current probes for enhanced inspection

    SciTech Connect

    Clark, W.G. Jr. )


    Eddy current inspection methods are widely used for the nondestructive evaluation (NDE) of tubular products. Specifically, the sensors and instrumentation are designed to detect and characterize changes in a material's electrical and magnetic properties produced by the presence of discontinuities. A recent major enhancement in eddy current inspection technology has been the development of computer interfacing for data collection, analysis, and display. This breakthrough has led to multiple-frequency testing, eddy current imaging, and automated data interpretation systems that significantly enhance both capabilities and reliability of the eddy current inspection. In addition to the clear advantages in data processing, computer interfacing also permits the design and creation of unique sensors that further enhance eddy current inspection capabilities. Perhaps the most promising area of computer interactive probe design is multiple element sensors. Westinghouse engineers and scientists have pioneered this area of probe development. This paper describes four unique probes that illustrate the advantages of computer interactive multiple element sensors for additional eddy current inspection options.

  1. The immunoglobulin kappa locus contains a second, stronger B-cell-specific enhancer which is located downstream of the constant region.

    PubMed Central

    Meyer, K B; Neuberger, M S


    The description of cell lines capable of transcribing immunoglobulin heavy or light chain genes in the apparent absence of an active enhancer has led us to look for novel enhancers in the immunoglobulin gene loci. Here we show that there is a second B-cell-specific enhancer in the mouse kappa locus and that this is located 9 kb downstream of C kappa. This enhancer is some 7-fold stronger than the kappa-intron enhancer and shows striking sequence homologies to the lymphotropic papovavirus, IgH and kappa-intron enhancers. The location of the kappa 3' enhancer between C kappa and the RS element means that it is deleted in some B cells that express lambda light chains. Images PMID:2507312

  2. Visual processing at goal and effector locations is dynamically enhanced during motor preparation.


    Mason, Luke; Linnell, Karina J; Davis, Rob; Van Velzen, José


    Previous theoretical and experimental works has shown that preparing to act causes enhanced perceptual processing at movement-relevant locations. Up until now, this has focused almost exclusively on the goal of an action, neglecting the role of the effector. We addressed this by measuring changes in visual processing across time during motor preparation at both goal and effector locations. We compared event related potentials (ERPs) elicited by task-irrelevant visual probe stimuli at both goal and effector locations during motor preparation. Participants were instructed to place their hands on two starting positions (effector locations) and an auditory tone instructed them to immediately move to one of two target buttons (goal locations). Probe stimuli were presented in the interval between the offset of the cue and the execution of the movement at either a goal or an effector location. Probes were presented randomly at either 100ms, 200ms or 300ms after the auditory cue. Analysis of the visual N1 ERP showed enhanced visual processing at moving vs. not-moving goal locations across all three SOAs. At effector locations, enhanced processing for the moving vs. not-moving effector was only observed during the middle (200ms) SOA. These results demonstrate, for the first time, simultaneous perceptual enhancement of goal and effector locations during motor preparation. We interpret these results as reflecting a temporally and spatially specific dynamic attentional map of the environment that adapts to maximise efficiency of movement by selectively weighting processing of multiple functional components of action in parallel. PMID:26032889

  3. Mutations in ash1 and trx enhance P-element-dependent silencing in Drosophila melanogaster.


    McCracken, Allen; Locke, John


    In Drosophila melanogaster, the mini-w(+) transgene in Pci is normally expressed throughout the adult eye; however, when other P or KP elements are present, a variegated-eye phenotype results, indicating random w(+) silencing during development called P-element-dependent silencing (PDS). Mutant Su(var)205 and Su(var)3-7 alleles act as haplo-suppressors/triplo-enhancers of this variegated phenotype, indicating that these heterochromatic modifiers act dose dependently in PDS. Previously, we recovered a spontaneous mutation of P{lacW}ci(Dplac) called P{lacW}ci(DplacE1) (E1) that variegated in the absence of P elements, presumably due to the insertion of an adjacent gypsy element. From a screen for genetic modifiers of E1 variegation, we describe here the isolation of five mutations in ash1 and three in trx that enhance the E1 variegated phenotype in a dose-dependent and cumulative manner. These mutant alleles enhance PDS at E1, and in E1/P{lacW}ci(Dplac), but suppress position effect variegation (PEV) at In(1)w(m)(4). This opposite action is consistent with a model where ASH1 and TRX mark transcriptionally active chromatin domains. If ASH1 or TRX function is lost or reduced, heterochromatin can spread into these domains creating a sink that diverts heterochromatic proteins from other variegating locations, which then may express a suppressed phenotype. PMID:27373142

  4. Experimental Study of Lift-Enhancing Tabs on a Two-Element Airfoil

    NASA Technical Reports Server (NTRS)

    Storms, Bruce L.; Ross, James C.


    The results of a wind-tunnel test are presented for a two-dimensional NASA 63(sub 2)-215 Mod B airfoil with a 30% chord single-slotted flap. The use of lift-enhancing tabs (similar to Gurney flaps) on the lower surface near the trailing edge of both elements was investigated on four nap configurations. A combination of vortex generators on the flap and lift-enhancing tabs was also investigated. Measurements of surface-pressure distributions and wake profiles were used to determine the aerodynamic performance of each configuration. By reducing flow separation on the flap, a lift-enhancing tab at the main-element trailing edge increased the maximum lift by 10.3% for the 42-deg flap case. The tab had a lesser effect at a moderate flap deflection (32 deg) and adversely affected the performance at the smallest flap deflection (22 deg). A tab located near the flap trailing edge produced an additional lift increment for all flap deflections. The application of vortex generators to the flap eliminated lift-curve hysteresis and reduced flow separation on two configurations with large flap deflections (greater than 40 deg). A maximum-lift coefficient of 3.32 (17% above the optimum baseline) was achieved with the combination of lift-enhancing tabs on both elements and vortex generators on the flap.

  5. Functional characterization of the GDEP promoter and three enhancer elements in retinoblastoma and prostate cell lines.


    Cross, D S; Burmester, J K


    GDEP (gene differentially expressed in prostate cancer aka. PCAN1), a newly discovered gene with remarkable tissue specificity, is a promising candidate for regulatory analysis because it exhibits a high level of expression that is limited to two tissues, the retina and the prostate. As these two tissues have different origins and disparate functions it is likely that the regulatory mechanisms responsible for expression are not shared in their entirety. In addition, both the retina and prostate are prime targets for gene therapy. To date there have been no functional studies of the GDEP promoter. Therefore to understand tissue-specific expression of GDEP we constructed promoter expression constructs. To further characterize functional regulatory regions within the GDEP gene, we investigated potential regulatory components for tissue-specific expression in the 40 kb intron of this gene. We have identified a 1.5 kb prostate-specific promoter from the proximal region of the GDEP gene. A smaller 0.5 kb promoter exhibited minimal activity in the retinoblastoma cell line Y79, but not in the prostate cells tested. In addition we have investigated three enhancer elements located in the 40 kb intron of the GDEP gene. We identified two enhancer elements that increase reporter gene expression in prostate cell line LNCaP and one additional enhancer element that increases expression in the Y79 cell line approximately 8-fold making it a strong retinal-specific enhancer. PMID:18188713

  6. Enhancement of the visibility of objects located below the surface of a scattering medium

    SciTech Connect

    Demos, Stavros


    Techniques are provided for enhancing the visibility of objects located below the surface of a scattering medium such as tissue, water and smoke. Examples of such an object include a vein located below the skin, a mine located below the surface of the sea and a human in a location covered by smoke. The enhancement of the image contrast of a subsurface structure is based on the utilization of structured illumination. In the specific application of this invention to image the veins in the arm or other part of the body, the issue of how to control the intensity of the image of a metal object (such as a needle) that must be inserted into the vein is also addressed.

  7. Dispersive Elements for Enhanced Laser Gyroscopy and Cavity Stabilization

    NASA Technical Reports Server (NTRS)

    Smith, David D.; Chang, Hongrok; Diels, J. C.


    We analyze the effect of a highly dispersive element placed inside a modulated optical cavity on the frequency and amplitude of the modulation to determine the conditions for cavity self-stabilization and enhanced gyroscopic sensitivity. We find an enhancement in the sensitivity of a laser gyroscope to rotation for normal dispersion, while anomalous dispersion can be used to self-stabilize an optical cavity. Our results indicate that atomic media, even coherent superpositions in multilevel atoms, are of limited use for these applications, because the amplitude and phase filters work against one another, i.e., decreasing the modulation frequency increases its amplitude and vice-versa. On the other hand, for optical resonators the dispersion reversal associated with critical coupling enables the amplitude and phase filters to work together. We find that for over-coupled resonators, the absorption and normal dispersion on-resonance increase the contrast and frequency of the beat-note, respectively, resulting in a substantial enhancement of the gyroscopic response. Under-coupled resonators can be used to stabilize the frequency of a laser cavity, but result in a concomitant increase in amplitude fluctuations. As a more ideal solution we propose the use of a variety of coupled-resonator-induced transparency that is accompanied by anomalous dispersion.

  8. Method of locating a leaking fuel element in a fast breeder power reactor


    Honekamp, John R.; Fryer, Richard M.


    Leaking fuel elements in a fast reactor are identified by measuring the ratio of .sup.134 Xe to .sup.133 Xe in the reactor cover gas following detection of a fuel element leak, this ratio being indicative of the power and burnup of the failed fuel element. This procedure can be used to identify leaking fuel elements in a power breeder reactor while continuing operation of the reactor since the ratio measured is that of the gases stored in the plenum of the failed fuel element. Thus, use of a cleanup system for the cover gas makes it possible to identify sequentially a multiplicity of leaking fuel elements without shutting the reactor down.

  9. Single-Shell Tanks Leak Integrity Elements/ SX Farm Leak Causes and Locations - 12127

    SciTech Connect

    Girardot, Crystal; Harlow, Don; Venetz, Theodore; Washenfelder, Dennis; Johnson, Jeremy


    Washington River Protection Solutions, LLC (WRPS) developed an enhanced single-shell tank (SST) integrity project in 2009. An expert panel on SST integrity was created to provide recommendations supporting the development of the project. One primary recommendation was to expand the leak assessment reports (substitute report or LD-1) to include leak causes and locations. The recommendation has been included in the M-045-91F Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) as one of four targets relating to SST leak integrity. The 241-SX Farm (SX Farm) tanks with leak losses were addressed on an individual tank basis as part of LD-1. Currently, 8 out of 23 SSTs that have been reported to having a liner leak are located in SX Farm. This percentage was the highest compared to other tank farms which is why SX Farm was analyzed first. The SX Farm is comprised of fifteen SSTs built 1953-1954. The tanks are arranged in rows of three tanks each, forming a cascade. Each of the SX Farm tanks has a nominal 1-million-gal storage capacity. Of the fifteen tanks in SX Farm, an assessment reported leak losses for the following tanks: 241-SX-107, 241-SX-108, 241-SX-109, 241-SX- 111, 241-SX-112, 241-SX-113, 241-SX-114 and 241-SX-115. The method used to identify leak location consisted of reviewing in-tank and ex-tank leak detection information. This provided the basic data identifying where and when the first leaks were detected. In-tank leak detection consisted of liquid level measurement that can be augmented with photographs which can provide an indication of the vertical leak location on the sidewall. Ex-tank leak detection for the leaking tanks consisted of soil radiation data from laterals and dry-wells near the tank. The in-tank and ex-tank leak detection can provide an indication of the possible leak location radially around and under the tank. Potential leak causes were determined using in-tank and ex-tank information that is not directly related to


    SciTech Connect



    Washington River Protection Solutions, LLC (WRPS) developed an enhanced single-shell tank (SST) integrity project in 2009. An expert panel on SST integrity was created to provide recommendations supporting the development of the project. One primary recommendation was to expand the leak assessment reports (substitute report or LD-1) to include leak causes and locations. The recommendation has been included in the M-045-9IF Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) as one of four targets relating to SST leak integrity. The 241-SX Farm (SX Farm) tanks with leak losses were addressed on an individual tank basis as part of LD-1. Currently, 8 out of 23 SSTs that have been reported to having a liner leak are located in SX Farm. This percentage was the highest compared to other tank farms which is why SX Farm was analyzed first. The SX Farm is comprised of fifteen SSTs built 1953-1954. The tanks are arranged in rows of three tanks each, forming a cascade. Each of the SX Farm tanks has a nominal I-million-gal storage capacity. Of the fifteen tanks in SX Farm, an assessment reported leak losses for the following tanks: 241-SX-107, 241-SX-108, 241-SX-109, 241-SX-111, 241-SX-112, 241-SX-113, 241-SX-114 and 241-SX-115. The method used to identify leak location consisted of reviewing in-tank and ex-tank leak detection information. This provided the basic data identifying where and when the first leaks were detected. In-tank leak detection consisted of liquid level measurement that can be augmented with photographs which can provide an indication of the vertical leak location on the sidewall. Ex-tank leak detection for the leaking tanks consisted of soil radiation data from laterals and drywells near the tank. The in-tank and ex-tank leak detection can provide an indication of the possible leak location radially around and under the tank. Potential leak causes were determined using in-tank and ex-tank information that is not directly related to

  11. Mutational analysis of a prokaryotic recombinational enhancer element with two functions.

    PubMed Central

    Hübner, P; Arber, W


    The site-specific DNA inversion system Cin encoded by the bacteriophage P1 consists of a recombinase, two inverted crossing-over sites and a recombinational enhancer. The latter approximately 75 bp long genetic element is bifunctional due to its location within the 5' part of the cin gene encoding the recombinase. In order to determine the essential nucleotides for each of its two biological functions we randomly mutated the recombinational enhancer sequence sis(P1) and analysed both functions of the mutants obtained. Three distinct regions of this sequence were found to be important for the enhancer activity. One of them occupies the middle third of the enhancer sequence and it can suffer a number of functionally neutral base substitutions, while others are detrimental. The other two regions occupy the two flanking thirds of the enhancer. They coincide with binding sites of the host-coded protein FIS (Factor for Inversion Stimulation) needed for efficient DNA inversion in vitro. These sequences appear to be highly evolved allowing only a few mutations without affecting either of the biological functions. Taking the effect of mutations within these FIS binding sites into account a consensus sequence for the interaction with FIS was compiled. This FIS consensus implies a palindromic structure for the recombinational enhancer. This is in line with the orientation independence of enhancer action with respect to the crossing-over sites. Images PMID:2656257

  12. The Canadian Geo-location Endeavour Using Isotopes and Trace Elements in Hair

    NASA Astrophysics Data System (ADS)

    Chartrand, Michelle M. G.; St-Jean, Gilles; Dalpe, Claude; Wojtyk, James


    The Canadian human hair provenance project has two main objectives: 1) to build a Canadian database of isotopes and trace elements from tap water and hair samples, and 2) to assess the extent of temporal effects on these samples. To address objective 1, a cross-Canada sampling campaign has been started to collect hair and tap water samples. In the past two years, our group has collected samples from the eastern part of Canada (Newfoundland, Nova Scotia, New Brunswick, Prince Edward Island, Quebec and Ontario). Water samples are divided into three groups - groundwater, surface water and bottled water. The GIS maps show the isotopic distribution of the tap water sources varies with latitude. Hair is analyzed for carbon (C), nitrogen (N) and hydrogen (H) isotopes. The C and N results show that in general, Canadians eat a typical diet showing a small isotopic variation. However, some cases will be presented which may explain why some people have C and N values outlying the collected sample average. In terms of H isotopes in human hair, GIS maps illustrate the distribution of this isotope in the eastern provinces of Canada. In some cases, a large variation in H was observed for the same locality with no significant difference in human activities and/or consumption. However, based on hair collected from across Canada from previous years, H isotopes in hair show a correlation to water collected from the same locality. To address objective 2, hair and tap water samples were collected at 4 month intervals (to represent different seasons in Canada) from several volunteers residing in two cities located in the province of Ontario (i.e. Sudbury and Ottawa) and one city from the province of Quebec (i.e. Montreal). For all isotopes measured, there was little variation observed over the course of the year in any individual from those small to medium-size cities. On-going sampling efforts will address if any variation may occur on a yearly basis.

  13. Effects and limitations of elemental sulphur applications for enhanced phytoextraction.


    Fässler, Erika; Stauffer, Werner; Gupta, Satish K; Schulin, Rainer


    The application of elemental sulphur (S) to heavy metal contaminated soils is a strategy to increase metal extraction by plants. Here, we examined to which degree the efficiency of phytoextraction could be enhanced by increasing the S application rate on afield where S had already been applied for 6 years. For this purpose, the field experiment was continued for another two years doubling the S application rate on half of the S treatment plots, while continuing application at the previous rate on the other half. Doubling the application rate significantly accelerated the dissolution of calcite and the decrease in soil pH and also increased cadmium (Cd) and zinc (Zn) uptake by sunflower and tobacco. But even in a best-case-scenario remediation of the site would still take more than a century. The results indicate that we reached the maximum potential of S application to enhance metal phytoextraction on the study site. Further decrease in pH by additional S applications would bear an excessive risk of decreasing yields and increasing metal leaching out of the root zone. PMID:22908636

  14. A purine-rich intronic element enhances alternative splicing of thyroid hormone receptor mRNA.

    PubMed Central

    Hastings, M L; Wilson, C M; Munroe, S H


    The mammalian thyroid hormone receptor gene c-erbAalpha gives rise to two mRNAs that code for distinct isoforms, TRalpha1 and TRalpha2, with antagonistic functions. Alternative processing of these mRNAs involves the mutually exclusive use of a TRalpha1-specific polyadenylation site or TRalpha2-specific 5' splice site. A previous investigation of TRalpha minigene expression defined a critical role for the TRalpha2 5' splice site in directing alternative processing. Mutational analysis reported here shows that purine residues within a highly conserved intronic element, SEa2, enhance splicing of TRalpha2 in vitro as well as in vivo. Although SEalpha2 is located within the intron of TRalpha2 mRNA, it activates splicing of a heterologous dsx pre-mRNA when located in the downstream exon. Competition with wild-type and mutant RNAs indicates that SEalpha2 functions by binding trans-acting factors in HeLa nuclear extract. Protein-RNA crosslinking identifies several proteins, including SF2/ASF and hnRNP H, that bind specifically to SEalpha2. SEalpha2 also includes an element resembling a 5' splice site consensus sequence that is critical for splicing enhancer activity. Mutations within this pseudo-5' splice site sequence have a dramatic effect on splicing and protein binding. Thus SEa2 and its associated factors are required for splicing of TRalpha2 pre-mRNA. PMID:11421362

  15. 20 CFR 655.536 - The third attestation element for locations in Alaska: No intention or design to influence...

    Code of Federal Regulations, 2011 CFR


    ... 20 Employees' Benefits 3 2011-04-01 2011-04-01 false The third attestation element for locations in Alaska: No intention or design to influence bargaining representative election. 655.536 Section... Alaska: No intention or design to influence bargaining representative election. (a) The employer...

  16. 20 CFR 655.536 - The third attestation element for locations in Alaska: No intention or design to influence...

    Code of Federal Regulations, 2010 CFR


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false The third attestation element for locations in Alaska: No intention or design to influence bargaining representative election. 655.536 Section... Alaska: No intention or design to influence bargaining representative election. (a) The employer...

  17. Two locations, two times, and the element set. [applicable to orbit determination of artificial satellites

    NASA Technical Reports Server (NTRS)

    Taff, L. G.; Randall, P. M. S.


    A robust analytical formulation is developed to apply classical initial orbital determination to artificial satellites whose locations are uncertain to about 1 cu km and separated in time by no more than 30 min. An analytical simplification reduces Gauss's method, iteration on the semilatus rectum, iteration on the true anomaly, and the Lambert-Euler technique, to the solution of a single equation in one unknown, instead of the usual coupled triplet of three equations in three unknowns. The method is demonstrated for all common artificial satellite orbits over a variety of time intervals between the two location vectors, and for a varied set of position and distance errors.

  18. Time elements for enhanced performance of the Dromo orbit propagator

    SciTech Connect

    Baù, Giulio; Bombardelli, Claudio E-mail:


    We propose two time elements for the orbit propagator named Dromo. One is linear and the other constant with respect to the independent variable, which coincides with the osculating true anomaly in the Keplerian motion. They are defined from a generalized Kepler's equation written for negative values of the total energy and, unlike the few existing time elements of this kind, are free of singularities. To our knowledge it is the first time that a constant time element is associated with a second-order Sundman time transformation. Numerical tests to assess the performance of the Dromo method equipped with a time element show the remarkable improvement in accuracy for the perturbed bounded motion around the Earth compared to the case in which the physical time is a state variable. Moreover, the method is competitive with and even better than other efficient sets of elements. Finally, we also derive a time element for a null and positive total energy.

  19. Integrated Nondestructive Evaluation and Finite Element Analysis Predicts Crack Location and Shape

    NASA Technical Reports Server (NTRS)

    Abdul-Azia, Ali; Baaklini, George Y.; Trudell, Jeffrey J.


    This study describes the finite-element analyses and the NDE modality undertaken on two flywheel rotors that were spun to burst speed. Computed tomography and dimensional measurements were used to nondestructively evaluate the rotors before and/or after they were spun to the first crack detection. Computed tomography data findings of two- and three-dimensional crack formation were used to conduct finite-element (FEA) and fracture mechanics analyses. A procedure to extend these analyses to estimate the life of these components is also outlined. NDE-FEA results for one of the rotors are presented in the figures. The stress results, which represent the radial stresses in the rim, clearly indicate that the maximum stress region is within the section defined by the computed tomography scan. Furthermore, the NDE data correlate well with the FEA results. In addition, the measurements reported show that the NDE and FEA data are in parallel.

  20. Elemental characterization of urban particulates at receptor locations in Abuja, north-central Nigeria

    NASA Astrophysics Data System (ADS)

    Abiye, Olawale Emmanuel; Obioh, Imoh B.; Ezeh, Godwin C.


    The rising population and increasing urban infrastructures of Abuja have led to increased pressure on the urban environment. Two decades after putting the city of Abuja to use, there is yet no information on the air quality status of the city. Hence, this study was conducted in order to assess the mass concentration and elemental characterization of airborne particulate matter in Abuja, north-central Nigeria. Sampling of PM2.5: aerodynamic diameter ≤2.5 μm and PM10: aerodynamic diameter ≤10 μm were carried out in five urban sites within the city from April, 2009 to May, 2010. "Gent" stacked filter unit sampler equipped with a double stage filters in series was employed for sample collection. Charged helium (4He+) Particle Induced X-ray Emission technique of 2500 keV particle energy and Genie 2000 software were used for spectra acquisition while elemental characterization was achieved using Gupixwin software in order to determine the concentration of eighteen elements (Si, S, K, Ca, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Cd, Sn, Ba, Ta and Pb). Mass concentrations range between 7-86 μg m-3 and 22-343 μg m-3 for PM2.5 and PM10 respectively. Crustal elements (Si, Ca, and Fe) were found to be predominant in PM10 than in PM2.5 fraction with very high values. Positive correlation r > 0.90 and r > 0.53 to 0.90 exist between metals (V, Co, Ni, Cd, Zn and Pb). PM2.5/PM10 mass ratios were well within the range specified by WHO for developing urban scenario.

  1. Optical signal processing of video surveillance for recognizing and measurement location railway infrastructure elements

    NASA Astrophysics Data System (ADS)

    Diyazitdinov, Rinat R.; Vasin, Nikolay N.


    Processing of optical signals, which are received from CCD sensors of video cameras, allows to extend the functionality of video surveillance systems. Traditional video surveillance systems are used for saving, transmitting and preprocessing of the video content from the controlled objects. Video signal processing by analytics systems allows to get more information about object's location and movement, the flow of technological processes and to measure other parameters. For example, the signal processing of video surveillance systems, installed on carriage-laboratories, are used for getting information about certain parameters of the railways. Two algorithms for video processing, allowing recognition of pedestrian crossings of the railways, as well as location measurement of the so-called "Anchor Marks" used to control the mechanical stresses of continuous welded rail track are described in this article. The algorithms are based on the principle of determining the region of interest (ROI), and then the analysis of the fragments inside this ROI.

  2. Baseline System Costs for 50.0 MW Enhanced Geothermal System -- A Function of: Working Fluid, Technology, and Location, Location, Location

    SciTech Connect

    Dunn, Paul; Selman, Nancy; Volpe, Anthony Della; Moss, Deborah; Mobley, Rick; Dickey, Halley; Unruh, Jeffery; Hitchcock, Chris; Tanguay, Jasmine; Butler, Steven; Stacey, Robert; Robertson-Tait, Ann; Pruess, Karsten; Gutoski, Greg; Fay, Jamie M.; Stitzer, John T.; Oglesby, Ken


    Substantial unexploited opportunity exists for the US, and the world, in Enhanced Geothermal Systems (EGS). As a result of US DOE investment, new drilling technology, new power generation equipment and cycles enable meaningful power production, in a compact and modular fashion; at lower and lower top side EGS working fluid temperatures and in a broader range of geologies and geographies. This cost analysis effort supports the expansion of Enhanced Geothermal Systems (EGS), furthering DOE strategic themes of energy security and sub goal of energy diversity; reducing the Nation's dependence on foreign oil while improving the environment.

  3. Quasi-optimal locations of piezo-elements on a rectangular plate

    NASA Astrophysics Data System (ADS)

    Koszewnik, Andrzej; Gosiewski, Zdzisław


    The optimal location of piezo-actuators and piezo-sensors for the vibration control of a rectangular plate with SFSF (Simply Supported - Free - Simply Supported - Free) boundary conditions is presented in the paper. Based on bending moments, Mx(x,y) and My(x,y), the modal control forces generated by the piezo-stripes are calculated for the first five mode shapes. Calculations are carried out for different locations of two piezo-strips directed along the X and Y axes. The obtained results are used to define performance indexes of modal control forces for the two considered directions of vibration. In a similar way the modal unit elongations of the piezo-sensors are calculated for two different orientations of the piezos on the plate. Based on these results the objective cost functions J_{ɛ - odd} and J_{ɛ - even} are defined separately for odd and even modes. The quasi-optimal locations of the piezo-actuators and piezo-sensors are determined by maximizing the proposed cost functions. After analytical and numerical investigations the process of the full model identification is carried out at the laboratory stand. A chirp signal is applied in the identification process. The rectangular plate is excited with the chirp force while output signals are measured by the piezo-sensors oriented in the perpendicular directions X and Y. In such a way two mathematical models are obtained to control the vibration of the plate separately for odd and even natural modes.-1

  4. True-3D Accentuating of Grids and Streets in Urban Topographic Maps Enhances Human Object Location Memory

    PubMed Central

    Edler, Dennis; Bestgen, Anne-Kathrin; Kuchinke, Lars; Dickmann, Frank


    Cognitive representations of learned map information are subject to systematic distortion errors. Map elements that divide a map surface into regions, such as content-related linear symbols (e.g. streets, rivers, railway systems) or additional artificial layers (coordinate grids), provide an orientation pattern that can help users to reduce distortions in their mental representations. In recent years, the television industry has started to establish True-3D (autostereoscopic) displays as mass media. These modern displays make it possible to watch dynamic and static images including depth illusions without additional devices, such as 3D glasses. In these images, visual details can be distributed over different positions along the depth axis. Some empirical studies of vision research provided first evidence that 3D stereoscopic content attracts higher attention and is processed faster. So far, the impact of True-3D accentuating has not yet been explored concerning spatial memory tasks and cartography. This paper reports the results of two empirical studies that focus on investigations whether True-3D accentuating of artificial, regular overlaying line features (i.e. grids) and content-related, irregular line features (i.e. highways and main streets) in official urban topographic maps (scale 1/10,000) further improves human object location memory performance. The memory performance is measured as both the percentage of correctly recalled object locations (hit rate) and the mean distances of correctly recalled objects (spatial accuracy). It is shown that the True-3D accentuating of grids (depth offset: 5 cm) significantly enhances the spatial accuracy of recalled map object locations, whereas the True-3D emphasis of streets significantly improves the hit rate of recalled map object locations. These results show the potential of True-3D displays for an improvement of the cognitive representation of learned cartographic information. PMID:25679208

  5. True-3D accentuating of grids and streets in urban topographic maps enhances human object location memory.


    Edler, Dennis; Bestgen, Anne-Kathrin; Kuchinke, Lars; Dickmann, Frank


    Cognitive representations of learned map information are subject to systematic distortion errors. Map elements that divide a map surface into regions, such as content-related linear symbols (e.g. streets, rivers, railway systems) or additional artificial layers (coordinate grids), provide an orientation pattern that can help users to reduce distortions in their mental representations. In recent years, the television industry has started to establish True-3D (autostereoscopic) displays as mass media. These modern displays make it possible to watch dynamic and static images including depth illusions without additional devices, such as 3D glasses. In these images, visual details can be distributed over different positions along the depth axis. Some empirical studies of vision research provided first evidence that 3D stereoscopic content attracts higher attention and is processed faster. So far, the impact of True-3D accentuating has not yet been explored concerning spatial memory tasks and cartography. This paper reports the results of two empirical studies that focus on investigations whether True-3D accentuating of artificial, regular overlaying line features (i.e. grids) and content-related, irregular line features (i.e. highways and main streets) in official urban topographic maps (scale 1/10,000) further improves human object location memory performance. The memory performance is measured as both the percentage of correctly recalled object locations (hit rate) and the mean distances of correctly recalled objects (spatial accuracy). It is shown that the True-3D accentuating of grids (depth offset: 5 cm) significantly enhances the spatial accuracy of recalled map object locations, whereas the True-3D emphasis of streets significantly improves the hit rate of recalled map object locations. These results show the potential of True-3D displays for an improvement of the cognitive representation of learned cartographic information. PMID:25679208

  6. Enhanced phytoextraction of germanium and rare earth elements - a rhizosphere-based approach

    NASA Astrophysics Data System (ADS)

    Wiche, Oliver


    Germanium (Ge) and rare earth elements (REEs) are economically valuable raw materials that have become an integral part of our modern high tech society. While most of these elements are not actually rare in terms of general amounts in the earth's crust, they are rarely found in sufficient abundances in single locations for their mining to be economically viable. The average concentration of Ge in soils is estimated at 1.6 μg g-1. The REEs comprise a group of 16 elements including La, the group of lanthanides and Y that are abundant in the earth crust with concentrations varying from 35 μg g-1 (La), 40 μg g-1 (Nd), 6 μg g-1 (Gd) and 3.5 μg g-1 (Er) to 0.5 μg g-1 in Tm. Thus, a promising chance to improve supply of these elements could be phytomining. Unfortunately, bioavailability of Ge and REEs in soils appears to be low, in particular in neutral or alkaline soils. A sequential dissolution analysis of 120 soil samples taken from the A-horizons of soils in the area of Freiberg (Saxony, Germany) revealed that only 0.2% of total Ge and about 0.5% of La, Nd, Gd and Er of bulk concentrations were easily accessible by leaching with NH4-acetate (pH 7). Most of the investigated elements were bound to Fe-/Mn-oxides and silicates and were therefore only poorly available for plant uptake. Here we report an environmentally friendly approach for enhanced phytoextraction of Ge and REEs from soils using mixed cultures of plant species with efficient mechanisms for the acquisition of nutrients in the rhizosphere. The rhizosphere is characterized as the zone in soil sourrounding a plant root that consists of a gradient in chemical, physical and biological soil properties driven by rhizodeposits like carboxylates and protons. Some species like white lupin (Lupinus albus) are able to excrete large amounts of organic acid anions(predominantly citrate and malate) and show a particularly high potential for the acidification of the rhizosphere. In our experiments, mixed cultures

  7. Relation between the location of elements in the periodic table and various organ-uptake rates.


    Ando, A; Ando, I; Hiraki, T; Hisada, K


    Fifty four elements and 65 radioactive compounds were examined to determine the organ uptake rates for rats 3, 24 and 48 h after i.v. injection of these compounds. They were prepared as carrier free nuclides, or containing a small amount of stable nuclide. Generally speaking, behaviors of K, Rb, Cs and Tl in all the organs were very similar to one another, but they differed from that of Na. Bivalent hard acids were avidly taken up into bone; therefore, uptake rates in soft tissues were very small. Hard acids of tri-, quadri- and pentavalence which were taken up into the soft tissue organs decreased more slowly from these organs than other ions. Soft acids such as Hg2+ were bound very firmly to the component in the kidney. Anions (with few exceptions), GeCl4 and SbCl3 were rapidly excreted in urine, so that the uptake rates in organs were low. PMID:2715001

  8. Identifier (ID) elements are not preferentially located to brain-specific genes: high ID element representation in other tissue-specific- and housekeeping genes of the rat.


    Goldman, Andrés; Capoano, Carlos A; González-López, Evangelina; Geisinger, Adriana


    BC1 is a short non-coding RNA from rodents, which is transcribed by RNA pol III. Its RNA is highly abundant in the brain, where it exerts a post-transcriptional regulatory role in dendrites. Upon transcription, retroposition and insertion, BC1 gives rise to a subclass of short interspersed repetitive sequences (SINEs) named identifier (ID) elements. IDs can become integrated inside non-coding regions of RNA pol II transcription units, and - although challenged by a couple of reports - their preferential location to brain-specific genes has been long proposed. Furthermore, an additional, cis-regulatory role in the control of brain-specific pol II-directed transcripts has been suggested for these sequences. In this work we used Northern blot and in silico analyses to examine IDs' location among pol II transcription units in different tissues, and in housekeeping genes. ID sequences appeared distributed in a similar fashion within tissue-specific hnRNA populations of the brain, testis and liver, and within housekeeping primary transcripts as well. Moreover, when the lengths of the unprocessed transcripts were considered, ID representation was higher in housekeeping ones. On the other hand, ID elements appeared similarly distributed among the different gene regions, with the obvious exclusion of those sequences where strict constraints for proper gene expression exist. Altogether, the widespread distribution of ID elements in all the analyzed genes - including housekeeping - and in all gene regions, suggests a random location, raising questions about the specific cis-regulatory role of those sequences. PMID:24125954

  9. Prediction of coronary plaque location on arteries having myocardial bridge, using finite element models.


    Nikolić, Dalibor; Radović, Miloš; Aleksandrić, Srđan; Tomašević, Miloje; Filipović, Nenad


    This study was performed to evaluate the influences of the myocardial bridges on the plaque initializations and progression in the coronary arteries. The wall structure is changed due to the plaque presence, which could be the reason for multiple heart malfunctions. Using simplified parametric finite element model (FE model) of the coronary artery having myocardial bridge and analyzing different mechanical parameters from blood circulation through the artery (wall shear stress, oscillatory shear index, residence time), we investigated the prediction of "the best" position for plaque progression. We chose six patients from the angiography records and used data from DICOM images to generate FE models with our software tools for FE preprocessing, solving and post-processing. We found a good correlation between real positions of the plaque and the ones that we predicted to develop at the proximal part of the myocardial bridges with wall shear stress, oscillatory shear index and residence time. This computer model could be additional predictive tool for everyday clinical examination of the patient with myocardial bridge. PMID:25139775

  10. Isotopes and trace elements as geo-location markers for biosecurity: determining the origin of exotic pests.

    NASA Astrophysics Data System (ADS)

    Holder, Peter W.; Armstrong, Karen; Clough, Tim; Frew, Russell; van Hale, Robert; Baker, Joel A.; Millet, Marc-Alban


    Background. The benefits of accurate point of origin discrimination in biosecurity include achieving appropriate operational responses in exotic pest eradication and post-border incursion campaigns, and identifying risk pathways. Reading natural abundance biogeochemical markers via mass spectrometry methods is a powerful tool for tracing ecological pathways and provenance determination of agricultural products and items of forensic interest. However, the application of these methods to trace insects - man's most damaging competitors - has been underutilised to date and our understanding in this field is still in a phase of basic development. Stable isotope ratio analyses using δ2H, δ13C have given spatial resolution in the monarch butterfly, single host system in eastern North America. Subsequently, the same method was employed in an attempt to determine the origin of important biosecurity pests in New Zealand. However, the results were contentious as the accuracy and limitations of the method in a biosecurity application were unknown. Further investigation has shown the value of existing invertebrate stable isotope geo-location methodology (i.e., using only two light elements) is tenuous in the biosecurity context, where the sample sizes are usually only one or two insects, and the specimens are generally polyphagous and accidentally introduced, and so from an unknown and unpredictable place, point in time and host: The spatial distribution of 2H in New Zealand may not be reliable over insect life-span time-scales; and fractional variables are un-quantified and potentially overwhelm any New Zealand signal. Further, the geo-location value of 13C is uncertain, especially for polyphagous insects. Research aims. The internationally distributed Helicoverpa armigera [Noctuidae] is being used to examine the processes fundamental to the location-to-plant-to-insect biogeochemical profile imprinting in phytophagous insects, including the turn over of elements in adult

  11. East Asia Dust Source Location Using the Naval Research Laboratory's 1-km Dust Enhancement Product

    NASA Astrophysics Data System (ADS)

    Walker, A. L.; Curtis, C. A.; Miller, S. D.; Richardson, K.; Westphal, D. L.


    In the effort to predict dust storms and their effects on local, regional and global scales an often cited uncertainty is the precise location of dust sources. Many approaches have been used to identify major dust source regions in East Asia. These approaches include analysis of station data for frequency of dust storms, drifting dust, dusty day, wind speed, and PM10 total suspended particulates. Some approaches emphasize the location of land surface type (Gobi, sandy desert, and loess) and geomorphological setting/features (basins, plateaus, alluvial fans, dry rivers, or oases). Other approaches use remote sensing to locate areas of high dust activity using the Total Ozone Mapping Spectrometer Aerosol Index (TOMS AI) data, to correlate Normalized Difference Vegetation Index (NDVI) vegetation cover with dust storm frequency, or to track dust storm event origination by analyzing Moderate Resolution Imaging Spectroradiometer (MODIS) images. It is also customary for researchers to combine two or more of these approaches to identify dust source regions. In this paper we use a novel approach to locate dust sources in East Asia. Utilizing the Naval Research Laboratory's satellite derived 1-km Dust Enhancement Product (DEP) imagery we can readily distinguish elevated dust over land from other components of the scene and individual dust plumes are readily seen. The high resolution of the DEP allows the many small, eroding point sources (measuring 1-10s km across) that form individual plumes to be located. Five years (2007 - 2011) of East Asia DEP imagery have been analyzed. Dust source frequency plots will be shown highlighting the most active dust source areas in East Asia. Our results show the most active point sources are located along the slopes and around the rim of large basins. Within basins, on plateaus and in valleys point sources are concentrated in smaller depressions relative to the surrounding topography. Point sources are also associated with the action of

  12. Plastid Located WHIRLY1 Enhances the Responsiveness of Arabidopsis Seedlings Toward Abscisic Acid

    PubMed Central

    Isemer, Rena; Krause, Kirsten; Grabe, Nils; Kitahata, Nobutaka; Asami, Tadao; Krupinska, Karin


    WHIRLY1 is a protein that can be translocated from the plastids to the nucleus, making it an ideal candidate for communicating information between these two compartments. Mutants of Arabidopsis thaliana lacking WHIRLY1 (why1) were shown to have a reduced sensitivity toward salicylic acid (SA) and abscisic acid (ABA) during germination. Germination assays in the presence of abamine, an inhibitor of ABA biosynthesis, revealed that the effect of SA on germination was in fact caused by a concomitant stimulation of ABA biosynthesis. In order to distinguish whether the plastid or the nuclear isoform of WHIRLY1 is adjusting the responsiveness toward ABA, sequences encoding either the complete WHIRLY1 protein or a truncated form lacking the plastid transit peptide were overexpressed in the why1 mutant background. In plants overexpressing the full-length sequence, WHIRLY1 accumulated in both plastids and the nucleus, whereas in plants overexpressing the truncated sequence, WHIRLY1 accumulated exclusively in the nucleus. Seedlings containing recombinant WHIRLY1 in both compartments were hypersensitive toward ABA. In contrast, seedlings possessing only the nuclear form of WHIRLY1 were as insensitive toward ABA as the why1 mutants. ABA was furthermore shown to lower the rate of germination of wildtype seeds even in the presence of abamine which is known to inhibit the formation of xanthoxin, the plastid located precursor of ABA. From this we conclude that plastid located WHIRLY1 enhances the responsiveness of seeds toward ABA even when ABA is supplied exogenously. PMID:23269926

  13. Effects of electrode location on EHD-enhanced natural convection in an enclosure

    SciTech Connect

    Liu, K.S.; Lai, F.C.


    Numerical results are presented for natural convection in an enclosure under the influence of electric field. The geometry considered is a two-dimensional cavity with an aspect ratio of 5. The electrical field is generated by positive corona from an electrode wire charged with a high dc voltage. Three wire locations have been considered, which result in symmetric and non-symmetric electric fields. Numerical calculations have covered a wide range of parameters (i.e., V{sub o} = 12, 15 and 18 kV, 10{sup 3} {le} Ra {le} 10{sup 6}). In the presence of electric field, the flow and temperature fields may reach a steady, steady-periodic or non-periodic state. For low Rayleigh numbers, it is observed that the flow and temperature fields are basically oscillatory in nature. When the Rayleigh number is sufficiently increased, a steady state may be reached. Due to the oscillatory flows, there is a significant increase in heat transfer. It is found that heat transfer enhancement increases with the applied voltage but decreases with the Rayleigh number. In addition, it is found that heat transfer enhancement can be maximized by placing the electrode toward the leading edge of the heat transfer surface, that is, to perturb the thermal boundary layer as early as it begins to develop.

  14. A Collaborative Location Based Travel Recommendation System through Enhanced Rating Prediction for the Group of Users

    PubMed Central

    Ravi, Logesh; Vairavasundaram, Subramaniyaswamy


    Rapid growth of web and its applications has created a colossal importance for recommender systems. Being applied in various domains, recommender systems were designed to generate suggestions such as items or services based on user interests. Basically, recommender systems experience many issues which reflects dwindled effectiveness. Integrating powerful data management techniques to recommender systems can address such issues and the recommendations quality can be increased significantly. Recent research on recommender systems reveals an idea of utilizing social network data to enhance traditional recommender system with better prediction and improved accuracy. This paper expresses views on social network data based recommender systems by considering usage of various recommendation algorithms, functionalities of systems, different types of interfaces, filtering techniques, and artificial intelligence techniques. After examining the depths of objectives, methodologies, and data sources of the existing models, the paper helps anyone interested in the development of travel recommendation systems and facilitates future research direction. We have also proposed a location recommendation system based on social pertinent trust walker (SPTW) and compared the results with the existing baseline random walk models. Later, we have enhanced the SPTW model for group of users recommendations. The results obtained from the experiments have been presented. PMID:27069468

  15. Urban enhancement of PM10 bioaerosol tracers relative to background locations in the Midwestern United States

    NASA Astrophysics Data System (ADS)

    Rathnayake, Chathurika M.; Metwali, Nervana; Baker, Zach; Jayarathne, Thilina; Kostle, Pamela A.; Thorne, Peter S.; O'Shaughnessy, Patrick T.; Stone, Elizabeth A.


    Bioaerosols are well-known immune-active particles that exacerbate respiratory diseases. Human exposures to bioaerosols and their resultant health impacts depend on their ambient concentrations, seasonal and spatial variation, and copollutants, which are not yet widely characterized. In this study, chemical and biological tracers of bioaerosols were quantified in respirable particulate matter (PM10) collected at three urban and three background sites in the Midwestern United States across four seasons in 2012. Endotoxins from Gram-negative bacteria (and a few Gram-positive bacteria), water-soluble proteins, and tracers for fungal spores (fungal glucans, arabitol, and mannitol) were ubiquitous and showed significant seasonal variation and dependence on temperature. Fungal spores were elevated in spring and peaked in summer, following the seasonal growing cycle, while endotoxins peaked in autumn during the row crop harvesting season. Paired comparisons of bioaerosols in urban and background sites revealed significant urban enhancements in PM10, fungal glucans, endotoxins, and water-soluble proteins relative to background locations, such that urban populations have a greater outdoor exposure to bioaerosols. These bioaerosols contribute, in part, to the urban excesses in PM10. Higher bioaerosol mass fractions in urban areas relative to background sites indicate that urban areas serve as a source of bioaerosols. Similar urban enhancements in water-soluble calcium and its correlation with bioaerosol tracers point toward windblown soil as an important source of bioaerosols in urban areas.

  16. A Collaborative Location Based Travel Recommendation System through Enhanced Rating Prediction for the Group of Users.


    Ravi, Logesh; Vairavasundaram, Subramaniyaswamy


    Rapid growth of web and its applications has created a colossal importance for recommender systems. Being applied in various domains, recommender systems were designed to generate suggestions such as items or services based on user interests. Basically, recommender systems experience many issues which reflects dwindled effectiveness. Integrating powerful data management techniques to recommender systems can address such issues and the recommendations quality can be increased significantly. Recent research on recommender systems reveals an idea of utilizing social network data to enhance traditional recommender system with better prediction and improved accuracy. This paper expresses views on social network data based recommender systems by considering usage of various recommendation algorithms, functionalities of systems, different types of interfaces, filtering techniques, and artificial intelligence techniques. After examining the depths of objectives, methodologies, and data sources of the existing models, the paper helps anyone interested in the development of travel recommendation systems and facilitates future research direction. We have also proposed a location recommendation system based on social pertinent trust walker (SPTW) and compared the results with the existing baseline random walk models. Later, we have enhanced the SPTW model for group of users recommendations. The results obtained from the experiments have been presented. PMID:27069468

  17. AREsite2: an enhanced database for the comprehensive investigation of AU/GU/U-rich elements

    PubMed Central

    Fallmann, Jörg; Sedlyarov, Vitaly; Tanzer, Andrea; Kovarik, Pavel; Hofacker, Ivo L.


    AREsite2 represents an update for AREsite, an on-line resource for the investigation of AU-rich elements (ARE) in human and mouse mRNA 3′UTR sequences. The new updated and enhanced version allows detailed investigation of AU, GU and U-rich elements (ARE, GRE, URE) in the transcriptome of Homo sapiens, Mus musculus, Danio rerio, Caenorhabditis elegans and Drosophila melanogaster. It contains information on genomic location, genic context, RNA secondary structure context and conservation of annotated motifs. Improvements include annotation of motifs not only in 3′UTRs but in the whole gene body including introns, additional genomes, and locally stable secondary structures from genome wide scans. Furthermore, we include data from CLIP-Seq experiments in order to highlight motifs with validated protein interaction. Additionally, we provide a REST interface for experienced users to interact with the database in a semi-automated manner. The database is publicly available at: PMID:26602692

  18. Enhanced finite element scheme for vibrational and flow induced sound

    NASA Astrophysics Data System (ADS)

    Kaltenbacher, M.; Triebenbacher, S.; Wohlmuth, B.; Zörnre, S.


    The paper presents Finite Element (FE) methods for classical vibroacoustics as well as computational aeroacoustics. Therewith, we can handle different grid sizes in different regions and ensure a correct coupling at the interfaces by applying the Mortar FE method. Furthermore, we can fully take into account free radiation by a new Perfectly Matched Layer (PML) technique, which is stable even for long term computations. The applicability of our developed numerical methods will be demonstrated by simulation results of the human phonation.

  19. Levels and spatial distribution of airborne chemical elements in a heavy industrial area located in the north of Spain.


    Lage, J; Almeida, S M; Reis, M A; Chaves, P C; Ribeiro, T; Garcia, S; Faria, J P; Fernández, B G; Wolterbeek, H T


    The adverse health effects of airborne particles have been subjected to intense investigation in recent years; however, more studies on the chemical characterization of particles from pollution emissions are needed to (1) identify emission sources, (2) better understand the relative toxicity of particles, and (3) pinpoint more targeted emission control strategies and regulations. The main objective of this study was to assess the levels and spatial distribution of airborne chemical elements in a heavy industrial area located in the north of Spain. Instrumental and biomonitoring techniques were integrated and analytical methods for k0 instrumental neutron activation analysis and particle-induced x-ray emission were used to determine element content in aerosol filters and lichens. Results indicated that in general local industry contributed to the emissions of As, Sb, Cu, V, and Ni, which are associated with combustion processes. In addition, the steelwork emitted significant quantities of Fe and Mn and the cement factory was associated with Ca emissions. The spatial distribution of Zn and Al also indicated an important contribution of two industries located outside the studied area. PMID:25072718

  20. Simple Syringe Filtration Methods for Reliably Examining Dissolved and Colloidal Trace Element Distributions in Remote Field Locations

    NASA Astrophysics Data System (ADS)

    Shiller, A. M.


    Methods for obtaining reliable dissolved trace element samples frequently utilize clean labs, portable laminar flow benches, or other equipment not readily transportable to remote locations. In some cases unfiltered samples can be obtained in a remote location and transported back to a lab for filtration. However, this may not always be possible or desirable. Additionally, methods for obtaining information on colloidal composition are likewise frequently too cumbersome for remote locations as well as being time-consuming. For that reason I have examined clean methods for collecting samples filtered through 0.45 and 0.02 micron syringe filters. With this methodology, only small samples are collected (typically 15 mL). However, with the introduction of the latest generation of ICP-MS's and microflow nebulizers, sample requirements for elemental analysis are much lower than just a few years ago. Thus, a determination of a suite of first row transition elements is frequently readily obtainable with samples of less than 1 mL. To examine the "traditional" (<0.45 micron) dissolved phase, 25 mm diameter polypropylene syringe filters and all polyethylene/polypropylene syringes are utilized. Filters are pre-cleaned in the lab using 40 mL of approx. 1 M HCl followed by a clean water rinse. Syringes are pre-cleaned by leaching with hot 1 M HCl followed by a clean water rinse. Sample kits are packed in polyethylene bags for transport to the field. Results are similar to results obtained using 0.4 micron polycarbonate screen filters, though concentrations may differ somewhat depending on the extent of sample pre-rinsing of the filter. Using this method, a multi-year time series of dissolved metals in a remote Rocky Mountain stream has been obtained. To examine the effect of colloidal material on dissolved metal concentrations, 0.02 micron alumina syringe filters have been utilized. Other workers have previously used these filters for examining colloidal Fe distributions in lake

  1. The Chinese Hamster Dihydrofolate Reductase Replication Origin Beta Is Active at Multiple Ectopic Chromosomal Locations and Requires Specific DNA Sequence Elements for Activity

    PubMed Central

    Altman, Amy L.; Fanning, Ellen


    To identify cis-acting genetic elements essential for mammalian chromosomal DNA replication, a 5.8-kb fragment from the Chinese hamster dihydrofolate reductase (DHFR) locus containing the origin beta (ori-β) initiation region was stably transfected into random ectopic chromosomal locations in a hamster cell line lacking the endogenous DHFR locus. Initiation at ectopic ori-β in uncloned pools of transfected cells was measured using a competitive PCR-based nascent strand abundance assay and shown to mimic that at the endogenous ori-β region in Chinese hamster ovary K1 cells. Initiation activity of three ectopic ori-β deletion mutants was reduced, while the activity of another deletion mutant was enhanced. The results suggest that a 5.8-kb fragment of the DHFR ori-β region is sufficient to direct initiation and that specific DNA sequences in the ori-β region are required for efficient initiation activity. PMID:11158297

  2. Study of Co-Located and Distant Collaboration with Symbolic Support via a Haptics-Enhanced Virtual Reality Task

    ERIC Educational Resources Information Center

    Yeh, Shih-Ching; Hwang, Wu-Yuin; Wang, Jin-Liang; Zhan, Shi-Yi


    This study intends to investigate how multi-symbolic representations (text, digits, and colors) could effectively enhance the completion of co-located/distant collaborative work in a virtual reality context. Participants' perceptions and behaviors were also studied. A haptics-enhanced virtual reality task was developed to conduct…

  3. A family of transposable elements co-opted into developmental enhancers in the mouse neocortex

    PubMed Central

    Notwell, James H.; Chung, Tisha; Heavner, Whitney; Bejerano, Gill


    The neocortex is a mammalian-specific structure that is responsible for higher functions such as cognition, emotion, and perception. To gain insight into its evolution and the gene regulatory codes that pattern it, we studied the overlap of its active developmental enhancers with transposable element families and compared this overlap to uniformly shuffled enhancers. Here we show a striking enrichment of the MER130 repeat family among active enhancers in the mouse dorsal cerebral wall, which gives rise to the neocortex, at embryonic day 14.5 (E14.5). We show that MER130 instances preserve a common code of transcriptional regulatory logic, function as enhancers, and are adjacent to critical neocortical genes. MER130, a nonautonomous interspersed transposable element, originates in the tetrapod or possibly Sarcopterygii ancestor, which far predates the appearance of the neocortex. Our results show that MER130 elements were recruited, likely through their common regulatory logic, as neocortical enhancers. PMID:25806706

  4. Comparative Study of Antenna Elements for TDRSS Enhanced Multiple Access System

    NASA Technical Reports Server (NTRS)

    Kory, Carol L.; Lambert, Kevin; Acosta, Roberto; Nessel, James


    We compare three antennas, which are candidates for the TDRSS-Continuation enhanced MA array antenna elements. Measured and simulated data show very good agreement for all antenna elements. All of the antennas meet the specifications with the exception of the SBA isolation. However, improvements can likely be made with further design efforts.

  5. Fundamental elements of vector enhanced multivariance product representation

    NASA Astrophysics Data System (ADS)

    Kalay, Berfin; Demiralp, Metin


    A new version of High Dimensional Model Representation (HDMR) is presented in this work. Vector HDMR has been quite recently developed to deal with the decomposition of vector valued multivariate functions. It was an extension from scalars to vectors by possibly using matrix weights. However, that expansion is based on an ascending multivariance starting from a constant term via a set of appropriately imposed conditions which can be related to orthogonality in a conveniently chosen Hilbert space. This work adds more flexibility by introducing certain matrix valued univariate support functions. We assume weight matrices proportional to unit matrices. This work covers only the basic issues related to the fundamental elements of the new approach.

  6. Alpha-element enhancement in a lambda-CDM Universe

    NASA Astrophysics Data System (ADS)

    Gargiulo, I. D.; Muñoz Arancibia, A. M.; Cora, S. A.; Padilla, N.

    We study the chemical enrichment of elliptical galaxies using a semi-analytic model of galaxy formation combined with a cosmological N-body simula- tion of dark matter particles. In particular, we study the a-element abun- dances with respect to the iron content of galaxies. The main modification to the previous models (Cora 2006; Lagos et al. 2008; Tecce et al. 2010) was the implementation of a top heavy variable initial mass function with a theoretical basis (Weidner & Kroupa 2004, 2005, 2006; Weidner et al. 2011). We find that with a single initial mass function at all epochs the observed trend of [a/Fe] with the stellar mass of elliptical galaxies can be hardly reproduced. We propound that a top heavy integrated galactic mass function can be a plausible solution for this problem. FULL TEXT IN SPANISH

  7. Convective Enhancement of Icing Roughness Elements in Stagnation Region Flows

    NASA Technical Reports Server (NTRS)

    Hughes, Michael T.; McClain, Stephen T.; Vargas, Mario; Broeren, Andy


    To improve existing ice accretion simulation codes, more data regarding ice roughness and its effects on convective heat transfer are required. To build on existing research on this topic, this study used the Vertical Icing Studies Tunnel (VIST) at NASA Glenn Research to model realistic ice roughness in the stagnation region of a NACA 0012 airfoil. Using the VIST, a test plate representing the leading 2% chord of the airfoil was subjected to flows of 7.62 m/s (25 ft/s), 12.19 m/s (40 ft/s), and 16.76 m/s (55 ft/s). The test plate was fitted with 3 surfaces, each with a different representation of ice roughness: 1) a control surface with no ice roughness, 2) a surface with ice roughness with element height scaled by 10x and streamwise rough zone width from the stagnation point scaled by 10x, and 3) a surface with ice roughness with element height scaled by 10x and streamwise rough zone width from the stagnation point scaled by 25x. Temperature data from the tests were recorded using an infrared camera and thermocouples imbedded in the test plate. From the temperature data, a convective heat transfer coefficient map was created for each case. Additional testing was also performed to validate the VIST's flow quality. These tests included five-hole probe and hot-wire probe velocity traces to provide flow visualization and to study boundary layer formation on the various test surfaces. The knowledge gained during the experiments will help improve ice accretion codes by providing heat transfer coefficient validation data and by providing flow visualization data helping understand current and future experiments performed in the VIST.

  8. Modeling insights into the locations of density enhancements from the Enceladus water vapor jets

    NASA Astrophysics Data System (ADS)

    Hurley, Dana M.; Perry, Mark E.; Waite, J. Hunter


    Monte Carlo modeling of the vapor erupting from Enceladus' south polar region is presented to demonstrate the influence of physical characteristics of the emitted vapor on the distribution of particles at altitude. The modeled sources include localized jets and eruptions distributed along the surface features labeled "tiger stripes." The modeling reveals that density enhancements are displaced from the source location caused not only by the angle of emission but also by superposition of material from nearby sources. The altitude of the superposition is mass dependent and contributes to differences observed in the mass 28 and mass 44 channels of the Cassini Ion and Neutral Mass Spectrometer (INMS) during Enceladus encounters. INMS data are well modeled using only the tiger stripe sources; however, certain regions require additional sources to reproduce some features of the data. In particular, an excess source is required for 44 unified atomic mass unit (u) on the Saturn-facing hemisphere of Baghdad Sulcus. It is apparent in three parallel Cassini flybys. A relative decrease in the source rate is observed for mass 28 u for E14. The more diffuse nature of the 28 u INMS observations compared to the more collimated structure of the 44 u INMS observations is consistent with increased thermal spreading for low-mass constituents of the plume.

  9. Enhanced secondary organic aerosols during fog episodes over typical location in Indo-Gangetic region

    NASA Astrophysics Data System (ADS)

    Kaul, D. S.; Tripathi, S. N.; Gupta, T.


    This study examines the reason of enhanced SOA yield during foggy days and hypothesizes likely production of SOA through aqueous phase chemistry during fog episodes. PM1 samples were collected from January 16, 2010 to February 20, 2010 at Kanpur to study the secondary organic aerosol (SOA) production during clear and foggy days. Of the 180 samples collected, 56 were from foggy days. Micro-Pulse Lidar Network (MPLNET), a part of National Aeronautic Space Administration (NASA), was used for identification of fog duration. Organic Carbon (OC), Elemental Carbon (EC) and water soluble organic carbon analysis were carried out by a EC-OC analyzer and a TOC analyzer, respectively. Trace gases and solar flux measurement were carried out by gas analyzers and a pyranometer (a part of NASA), respectively to identify the photo-chemical activity. Meteorological data were measured by atmospheric weather station. SOA was estimated during foggy and clear days using tracer method. Enhanced SOA was observed during foggy days, production of SOA was highest in the afternoon and lower during morning and evening. Peak of OC/EC ratio during foggy days occurred earlier indicating role of aqueous phase chemistry in addition to gas-particle portioning which is the prevalent mechanism of SOA production during clear days. The possible contribution of biomass burning to SOA which could otherwise confound the SOA estimate during foggy days was also examined by biomass tracer, potassium ion. The influence of biomass to SOA during foggy days was found to be negligible. This is so because organic carbon from biomass origin is highly hygroscopic and is scavenged by the fog droplets. The lesser average concentration of water soluble organic carbon during foggy days support the scavenging and removal of the biomass originated organic carbon. Evaporation of individual fog and subsequent increase of OC/EC ratio further supported the aqueous phase production of SOA. The temperature and relative humidity

  10. A sequence homologous to kappa-deleting element is located 5 prime to the human J sub K locus

    SciTech Connect

    Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H. )


    The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kde accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.

  11. Conserved enhancer and silencer elements responsible for differential Adh transcription in Drosophila cell lines.

    PubMed Central

    Ayer, S; Benyajati, C


    The distal promoter of Adh is differentially expressed in Drosophila tissue culture cell lines. After transfection with an exogenous Adh gene, there was a specific increase in distal alcohol dehydrogenase (ADH) transcripts in ADH-expressing (ADH+) cells above the levels observed in transfected ADH-nonexpressing (ADH-) cells. We used deletion mutations and a comparative transient-expression assay to identify the cis-acting elements responsible for enhanced Adh distal transcription in ADH+ cells. DNA sequences controlling high levels of distal transcription were localized to a 15-base-pair (bp) region nearly 500 bp upstream of the distal RNA start site. In addition, a 61-bp negative cis-acting element was found upstream from and adjacent to the enhancer. When this silencer element was deleted, distal transcription increased only in the ADH+ cell line. These distant upstream elements must interact with the promoter elements, the Adf-1-binding site and the TATA box, as they only influenced transcription when at least one of these two positive distal promoter elements was present. Internal deletions targeted to the Adf-1-binding site or the TATA box reduced transcription in both cell types but did not affect the transcription initiation site. Distal transcription in transfected ADH- cells appears to be controlled primarily through these promoter elements and does not involve the upstream regulatory elements. Evolutionary conservation in distantly related Drosophila species suggests the importance of these upstream elements in correct developmental and tissue-specific expression of ADH. Images PMID:1694013

  12. A family of transposable elements co-opted into developmental enhancers in the mouse neocortex.


    Notwell, James H; Chung, Tisha; Heavner, Whitney; Bejerano, Gill


    The neocortex is a mammalian-specific structure that is responsible for higher functions such as cognition, emotion and perception. To gain insight into its evolution and the gene regulatory codes that pattern it, we studied the overlap of its active developmental enhancers with transposable element (TE) families and compared this overlap to uniformly shuffled enhancers. Here we show a striking enrichment of the MER130 repeat family among active enhancers in the mouse dorsal cerebral wall, which gives rise to the neocortex, at embryonic day 14.5. We show that MER130 instances preserve a common code of transcriptional regulatory logic, function as enhancers and are adjacent to critical neocortical genes. MER130, a nonautonomous interspersed TE, originates in the tetrapod or possibly Sarcopterygii ancestor, which far predates the appearance of the neocortex. Our results show that MER130 elements were recruited, likely through their common regulatory logic, as neocortical enhancers. PMID:25806706

  13. Elemental Fluorine-18 Gas: Enhanced Production and Availability

    SciTech Connect

    VanBrocklin, Henry F.


    The overall objective of this project was to develop an efficient, reproducible and reliable process for the preparation of fluorine-18 labeled fluorine gas ([¹⁸F]F₂) from readily available cyclotron-produced [¹⁸F]fluoride ion. The two step process entailed the production of [¹⁸F]fluoromethane with subsequent conversion to [¹⁸F]F₂ by electric discharge of [¹⁸F]fluoromethane in the presence of carrier nonradioactive F₂ gas. The specific goals of this project were i) to optimize the preparation of [¹⁸F]fluoromethane from [¹⁸F]fluoride ion; ii) to develop a prototype automated system for the production of [¹⁸F]F₂ from [¹⁸F]fluoride ion and iii) develop a compact user friendly automated system for the preparation of [¹⁸F]F₂ with initial synthesis of fluorine-18 labeled radiotracers. Over the last decade there has been an increased interest in the production of "non-standard" positron-emitting isotopes for the preparation of new radiotracers for a variety of applications including medical imaging and therapy. The increased availability of these isotopes from small biomedical cyclotrons has prompted their use in labeling radiotracers. In much the same way the production of [¹⁸F]F₂ gas has been known for several decades. However, access to [¹⁸F]F₂ gas has been limited to those laboratories with the means (e.g. F₂ targetry for the cyclotron) and the project-based need to work with [¹⁸F]F₂ gas. Relatively few laboratories, compared to those that produce [¹⁸F]fluoride ion on a daily basis, possess the capability to produce and use [¹⁸F]F₂ gas. A simplified, reliable system employing [¹⁸F]fluoride ion from cyclotron targetry systems that are already in place coupled with on-demand production of the [¹⁸F]F₂ gas would greatly enhance its availability. This would improve the availability of [¹⁸F]F₂ gas and promote further work with a valuable precursor. The major goals of the project were accomplished

  14. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.


    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  15. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V

    PubMed Central

    Pyle, Jay; Patel, Tejas; Merrill, Brianna; Nsokoshi, Chabu; McCall, Morgan; Proctor, Robert H.; Brown, Daren W.; Hammond, Thomas M.


    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny from an SkK × Spore killer-susceptible (SkS) cross to inherit the SkK allele. SkK has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an SkK × SkS mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of SkK to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to SkS genotypes, SkK genotypes have one extra gene within this region for a total of 42 genes. The additional gene in SkK genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1. The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed. PMID:27317777

  16. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V.


    Pyle, Jay; Patel, Tejas; Merrill, Brianna; Nsokoshi, Chabu; McCall, Morgan; Proctor, Robert H; Brown, Daren W; Hammond, Thomas M


    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (Sk(K)) that causes nearly all surviving meiotic progeny from an Sk(K) × Spore killer-susceptible (Sk(S)) cross to inherit the Sk(K) allele. Sk(K) has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an Sk(K) × Sk(S) mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of Sk(K) to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to Sk(S) genotypes, Sk(K) genotypes have one extra gene within this region for a total of 42 genes. The additional gene in Sk(K) genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1 The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed. PMID:27317777

  17. Androgen response element of the glycine N-methyltransferase gene is located in the coding region of its first exon.


    Lee, Cheng-Ming; Yen, Chia-Hung; Tzeng, Tsai-Yu; Huang, Yu-Zen; Chou, Kuan-Hsien; Chang, Tai-Jay; Arthur Chen, Yi-Ming


    Androgen plays an important role in the pathogenesis of PCa (prostate cancer). Previously, we identified GNMT (glycine N-methyltransferase) as a tumour susceptibility gene and characterized its promoter region. Besides, its enzymatic product-sarcosine has been recognized as a marker for prognosis of PCa. The goals of this study were to determine whether GNMT is regulated by androgen and to map its AREs (androgen response elements). Real-time PCR analyses showed that R1881, a synthetic AR (androgen receptor) agonist induced GNMT expression in AR-positive LNCaP cells, but not in AR-negative DU145 cells. In silico prediction showed that there are four putative AREs in GNMT-ARE1, ARE2 and ARE3 are located in the intron 1 and ARE4 is in the intron 2. Consensus ARE motif deduced from published AREs was used to identify the fifth ARE-ARE5 in the coding region of exon 1. Luciferase reporter assay found that only ARE5 mediated the transcriptional activation of R1881. ARE3 overlaps with a YY1 [Yin and Yang 1 (motif (CaCCATGTT, +1118/+1126)] that was further confirmed by antibody supershift and ChIP (chromatin immunoprecipitation) assays. EMSA (electrophoretic mobility shift assay) and ChIP assay confirmed that AR interacts with ARE5 in vitro and in vivo. In summary, GNMT is an AR-targeted gene with its functional ARE located at +19/+33 of the first exon. These results are valuable for the study of the influence of androgen on the gene expression of GNMT especially in the pathogenesis of cancer. PMID:23883094

  18. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.


    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  19. Hydrogen atom donor compounds as contrast enhancers for black-and-white photothermographic and thermographic elements


    Harring, Lori S.; Simpson, Sharon M.; Sansbury, Francis H.


    Hydrogen atom donor compounds are useful as contrast enhancers when used in combination with (i) hindered phenol developers, and (ii) trityl hydrazide and/or formyl-phenyl hydrazine co-developers, to produce ultra-high contrast black-and-white photothermographic and thermographic elements. The photothermographic and thermographic elements may be used as a photomask in a process where there is a subsequent exposure of an ultraviolet or short wavelength visible radiation-sensitive imageable medium.

  20. Seeing and Feeling for Self and Other: Proprioceptive Spatial Location Determines Multisensory Enhancement of Touch

    ERIC Educational Resources Information Center

    Cardini, Flavia; Haggard, Patrick; Ladavas, Elisabetta


    We have investigated the relation between visuo-tactile interactions and the self-other distinction. In the Visual Enhancement of Touch (VET) effect, non-informative vision of one's own hand improves tactile spatial perception. Previous studies suggested that looking at "another"person's hand could also enhance tactile perception, but did not…

  1. Activation of enhancer elements by the homeobox gene Cdx2 is cell line specific.

    PubMed Central

    Taylor, J K; Levy, T; Suh, E R; Traber, P G


    Cdx2 is a caudal-related homeodomain transcription factor that is expressed in complex patterns during mouse development and at high levels in the intestinal epithelium of adult mice. Cdx2 activates transcription of intestinal gene promoters containing specific binding sites. Moreover, Cdx2 has been shown to induce intestinal differentiation in cell lines. In this study, we show that Cdx2 is able to bind to two well defined enhancer elements in the HoxC8 gene. We then demonstrate that Cdx2 is able to activate transcription of heterologous promoters when its DNA binding element is placed in an enhancer context. Furthermore, the ability to activate enhancer elements is cell-line dependent. When the Cdx2 activation domain was linked to the Gal4 DNA binding domain, the chimeric protein was able to activate Gal4 enhancer constructs in an intestinal cell line, but was unable to activate transcription in NIH3T3 cells. These data suggest that there are cell-specific factors that allow the Cdx2 activation domain to function in the activation of enhancer elements. We hypothesize that either a co-activator protein or differential phosphorylation of the activation domain may be the mechanism for intestinal cell line-specific function of Cdx2 and possibly in other tissues in early development. PMID:9171078

  2. Genomic organization and evolution of immunoglobulin kappa gene enhancers and kappa deleting element in mammals

    PubMed Central

    Das, Sabyasachi; Nikolaidis, Nikolas; Nei, Masatoshi


    We have studied the genomic structure and evolutionary pattern of immunoglobulin kappa deleting element (KDE) and three kappa enhancers (KE5′, KE3′P, and KE3′D) in eleven mammalian genomic sequences. Our results show that the relative positions and the genomic organization of the KDE and the kappa enhancers are conserved in all mammals studied and have not been affected by the local rearrangements in the immunoglobulin kappa (IGK) light chain locus over a long evolutionary time (∼120 million years of mammalian evolution). Our observations suggest that the sequence motifs in these regulatory elements have been conserved by purifying selection to achieve proper regulation of the expression of the IGK light chain genes. The conservation of the three enhancers in all mammals indicates that these species may use similar mechanisms to regulate IGK gene expression. However, some activities of the IGK enhancers might have evolved in the eutherian lineage. The presence of the three IGK enhancers, KDE, and other recombining elements (REs) in all mammals (including platypus) suggest that these genomic elements were in place before the mammalian radiation. PMID:19560204

  3. A developmentally regulated Caulobacter flagellar promoter is activated by 3' enhancer and IHF binding elements.

    PubMed Central

    Gober, J W; Shapiro, L


    The transcription of a group of flagellar genes is temporally and spatially regulated during the Caulobacter crescentus cell cycle. These genes all share the same 5' cis-regulatory elements: a sigma 54 promoter, a binding site for integration host factor (IHF), and an enhancer sequence, known as the ftr element. We have partially purified the ftr-binding proteins, and we show that they require the same enhancer sequences for binding as are required for transcriptional activation. We have also partially purified the Caulobacter homolog of IHF and demonstrate that it can facilitate in vitro integrase-mediated lambda recombination. Using site-directed mutagenesis, we provide the first demonstration that natural enhancer sequences and IHF binding elements that reside 3' to the sigma 54 promoter of a bacterial gene, flaNQ, are required for transcription of the operon, in vivo. The IHF protein and the ftr-binding protein is primarily restricted to the predivisional cell, the cell type in which these promoters are transcribed. flaNQ promoter expression is localized to the swarmer pole of the predivisional cell, as are other flagellar promoters that possess these regulatory sequences 5' to the start site. The requirement for an IHF binding site and an ftr-enhancer element in spatially transcribed flagellar promoters indicates that a common mechanism may be responsible for both temporal and polar transcription. Images PMID:1392079

  4. A comparison of stress in cracked fibrous tissue specimens with varied crack location, loading, and orientation using finite element analysis.


    Peloquin, John M; Elliott, Dawn M


    Cracks in fibrous soft tissue, such as intervertebral disc annulus fibrosus and knee meniscus, cause pain and compromise joint mechanics. A crack concentrates stress at its tip, making further failure and crack extension (fracture) more likely. Ex vivo mechanical testing is an important tool for studying the loading conditions required for crack extension, but prior work has shown that it is difficult to reproduce crack extension. Most prior work used edge crack specimens in uniaxial tension, with the crack 90° to the edge of the specimen. This configuration does not necessarily represent the loading conditions that cause in vivo crack extension. To find a potentially better choice for experiments aiming to reproduce crack extension, we used finite element analysis to compare, in factorial combination, (1) center crack vs. edge crack location, (2) biaxial vs. uniaxial loading, and (3) crack-fiber angles ranging from 0° to 90°. The simulated material was annulus fibrosus fibrocartilage with a single fiber family. We hypothesized that one of the simulated test cases would produce a stronger stress concentration than the commonly used uniaxially loaded 90° crack-fiber angle edge crack case. Stress concentrations were compared between cases in terms of fiber-parallel stress (representing risk of fiber rupture), fiber-perpendicular stress (representing risk of matrix rupture), and fiber shear stress (representing risk of fiber sliding). Fiber-perpendicular stress and fiber shear stress concentrations were greatest in edge crack specimens (of any crack-fiber angle) and center crack specimens with a 90° crack-fiber angle. However, unless the crack is parallel to the fiber direction, these stress components alone are insufficient to cause crack opening and extension. Fiber-parallel stress concentrations were greatest in center crack specimens with a 45° crack-fiber angle, either biaxially or uniaxially loaded. We therefore recommend that the 45° center crack case be

  5. Analysis of organic and elemental carbon in heating and non-heating periods in four locations of Beijing.


    Sun, Fengbin; Lun, Xiaoxiu; Liu, Xuhui; Mo, Li; Li, Renna; Zhang, Hongxia; Chen, Jungang; Cao, Yingying; Shi, Fangtian; Yu, Xinxiao


    The concentrations of elemental carbon (EC) and organic carbon (OC) in PM2.5 atmospheric aerosol were measured at four different sites in Beijing: Beijing Olympic Forest Park (OF), Jiufeng National Forest Park (JF), Beijing Forestry University campus lawn (G), and roads near the Beijing Forestry University (S). The winter heating period concentrations were 30-45% higher than the spring non-heating period. Possible reasons for this could be the severe convective weather in spring due to the temperate monsoon, deposition of PM2.5 to plants in spring, stable atmospheric conditions in winter, and/or a greater number of sources of carbonaceous aerosols in winter. The proportion of total carbon (i.e. EC + OC) in PM2.5 in Beijing is high. The OC/EC value was 2.45 (OF) and 2.39 (JF) in winter and 1.6 (OF) and 1.43 (JF) in spring. These ratios and the high correlation of OC with EC in the winter samples indicate a strong primary source of OC. Eight carbon fractions from the four different sampling locations were analysed, and the OC1-4 values were found to vary considerably. In winter, the OC1 values from all four sites were higher than the spring values. Although there were differences at each site, the percentages of OC2, OC3, EC1-OP, and EC2 were the largest. Secondary organic carbon (SOC) formed during long-range transport from the emission sources to the monitoring sites, and the increase of OC2 and OC3 concentrations could be associated with SOC. PMID:26101900

  6. Identification of minute damage in composite bridge structures equipped with fiber optic sensors using the location of neutral axis and finite element analysis

    NASA Astrophysics Data System (ADS)

    Li, Xi; Glisic, Branko


    By definition, the neutral axis of a loaded composite beam structure is the curve along which the section experiences zero bending strain. When no axial loading is present, the location of the neutral axis passes through the centroid of stiffness of the beam cross-section. In the presence of damage, the centroid of stiffness, as well as the neutral axis, shift from the healthy position. The concept of neutral axis can be widely applied to all beam-like structures. According to literature, a change in location of the neutral axis can be associated with damage in the corresponding cross-section. In this paper, the movement of neutral axis near locations of minute damage in a composite bridge structure was studied using finite element analysis and experimental results. The finite element model was developed based on a physical scale model of a composite simply-supported structure with controlled minute damage in the reinforced concrete deck. The structure was equipped with long-gauge fiber optic strain and temperature sensors at a healthy reference location as well as two locations of damage. A total of 12 strain sensors were installed during construction and used to monitor the structure during various loading events. This paper aims to explain previous experimental results which showed that the observed positions of neutral axis near damage locations were higher than the predicted healthy locations in some loading events. Analysis has shown that finite element analysis has potential to simulate and explain the physical behavior of the test structure.

  7. Fluid rare earth element anlayses from geothermal wells located on the Reykjanes Peninsula, Iceland and Middle Valley seafloor hydrothermal system on the Juan de Fuca Ridge.

    DOE Data Explorer

    Andrew Fowler


    Results for fluid rare earth element analyses from four Reykjanes peninsula high-temperature geothermal fields. Data for fluids from hydrothermal vents located 2400 m below sea level from Middle Valley on the Juan de Fuca Ridge are also included. Data have been corrected for flashing. Samples preconcentrated using a chelating resin with IDA functional group (InertSep ME-1). Analyzed using an Element magnetic sector inductively coupled plasma mass spectrometry (ICP-MS).

  8. Horizontal Saccadic Eye Movements Enhance the Retrieval of Landmark Shape and Location Information

    ERIC Educational Resources Information Center

    Brunye, Tad T.; Mahoney, Caroline R.; Augustyn, Jason S.; Taylor, Holly A.


    Recent work has demonstrated that horizontal saccadic eye movements enhance verbal episodic memory retrieval, particularly in strongly right-handed individuals. The present experiments test three primary assumptions derived from this research. First, horizontal eye movements should facilitate episodic memory for both verbal and non-verbal…

  9. Enhanced Associative Memory for Colour (but Not Shape or Location) in Synaesthesia

    ERIC Educational Resources Information Center

    Pritchard, Jamie; Rothen, Nicolas; Coolbear, Daniel; Ward, Jamie


    People with grapheme-colour synaesthesia have been shown to have enhanced memory on a range of tasks using both stimuli that induce synaesthesia (e.g. words) and, more surprisingly, stimuli that do not (e.g. certain abstract visual stimuli). This study examines the latter by using multi-featured stimuli consisting of shape, colour and location…

  10. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences.

    PubMed Central

    Ch'ang, L Y; Yang, W K; Myer, F E; Yang, D M


    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenicol acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base-pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-bp inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs of the enhancer segment as well as the upstream LTR sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression. Further analyses using chimeric LTR constructs located the presence of a strong negative regulatory element within the region containing the 5' portion of the enhancer and the immediate upstream sequences in the MuLV-related LTRs. Images PMID:2542587

  11. A NURBS enhanced extended finite element approach for unfitted CAD analysis

    NASA Astrophysics Data System (ADS)

    Legrain, Grégory


    A NURBS enhanced extended finite element approach is proposed for the unfitted simulation of structures defined by means of CAD parametric surfaces. In contrast to classical X-FEM that uses levelsets to define the geometry of the computational domain, exact CAD description is considered here. Following the ideas developed in the context of the NURBS-enhanced finite element method, NURBS-enhanced subelements are defined to take into account the exact geometry of the interface inside an element. In addition, a high-order approximation is considered to allow for large elements compared to the size of the geometrical details (without loss of accuracy). Finally, a geometrically implicit/explicit approach is proposed for efficiency purpose in the context of fracture mechanics. In this paper, only 2D examples are considered: It is shown that optimal rates of convergence are obtained without the need to consider shape functions defined in the physical space. Moreover, thanks to the flexibility given by the Partition of Unity, it is possible to recover optimal convergence rates in the case of re-entrant corners, cracks and embedded material interfaces.

  12. Computational Analysis of Enhanced Magnetic Bioseparation in Microfluidic Systems with Flow-Invasive Magnetic Elements

    PubMed Central

    Khashan, S. A.; Alazzam, A.; Furlani, E. P.


    A microfluidic design is proposed for realizing greatly enhanced separation of magnetically-labeled bioparticles using integrated soft-magnetic elements. The elements are fixed and intersect the carrier fluid (flow-invasive) with their length transverse to the flow. They are magnetized using a bias field to produce a particle capture force. Multiple stair-step elements are used to provide efficient capture throughout the entire flow channel. This is in contrast to conventional systems wherein the elements are integrated into the walls of the channel, which restricts efficient capture to limited regions of the channel due to the short range nature of the magnetic force. This severely limits the channel size and hence throughput. Flow-invasive elements overcome this limitation and enable microfluidic bioseparation systems with superior scalability. This enhanced functionality is quantified for the first time using a computational model that accounts for the dominant mechanisms of particle transport including fully-coupled particle-fluid momentum transfer. PMID:24931437

  13. Optical detection enhancement in porous volumetric microfluidic capture elements using refractive index matching fluids.


    Wiederoder, M S; Peterken, L; Lu, A X; Rahmanian, O D; Raghavan, S R; DeVoe, D L


    Porous volumetric capture elements in microfluidic sensors are advantageous compared to planar capture surfaces due to higher reaction site density and decreased diffusion lengths that can reduce detection limits and total assay time. However a mismatch in refractive indices between the capture matrix and fluid within the porous interstices results in scattering of incident, reflected, or emitted light, significantly reducing the signal for optical detection. Here we demonstrate that perfusion of an index-matching fluid within a porous matrix minimizes scattering, thus enhancing optical signal by enabling the entire capture element volume to be probed. Signal enhancement is demonstrated for both fluorescence and absorbance detection, using porous polymer monoliths in a silica capillary and packed beds of glass beads within thermoplastic microchannels, respectively. Fluorescence signal was improved by a factor of 3.5× when measuring emission from a fluorescent compound attached directly to the polymer monolith, and up to 2.6× for a rapid 10 min direct immunoassay. When combining index matching with a silver enhancement step, a detection limit of 0.1 ng mL(-1) human IgG and a 5 log dynamic range was achieved. The demonstrated technique provides a simple method for enhancing optical sensitivity for a wide range of assays, enabling the full benefits of porous detection elements in miniaturized analytical systems to be realized. PMID:26160546

  14. Optical detection enhancement in porous volumetric microfluidic capture elements using refractive index matching fluids

    PubMed Central

    Wiederoder, M. S.; Peterken, L.; Lu, A. X.; Rahmanian, O. D.; Raghavan, S. R.; DeVoe, D. L.


    Porous volumetric capture elements in microfluidic sensors are advantageous compared to planar capture surfaces due to higher reaction site density and decreased diffusion lengths that can reduce detection limits and total assay time. However a mismatch in refractive indices between the capture matrix and fluid within the porous interstices results in scattering of incident, reflected, or emitted light, significantly reducing the signal for optical detection. Here we demonstrate that perfusion of an index-matching fluid within a porous matrix minimizes scattering, thus enhancing optical signal by enabling the entire capture element volume to be probed. Signal enhancement is demonstrated for both fluorescence and absorbance detection, using porous polymer monoliths in a silica capillary and packed beds of glass beads within thermoplastic microchannels, respectively. Fluorescence signal was improved by a factor of 3.5× when measuring emission from a fluorescent compound attached directly to the polymer monolith, and up to 2.6× for a rapid 10 min direct immunoassay. When combining index matching with a silver enhancement step, a detection limit of 0.1 ng/mL human IgG and a 5 log dynamic range was achieved. The demonstrated technique provides a simple method for enhancing optical sensitivity for a wide range of assays, enabling the full benefits of porous detection elements in miniaturized analytical systems to be realized. PMID:26160546

  15. Experimental and computational investigation of lift-enhancing tabs on a multi-element airfoil

    NASA Technical Reports Server (NTRS)

    Ashby, Dale


    An experimental and computational investigation of the effect of lift enhancing tabs on a two-element airfoil was conducted. The objective of the study was to develop an understanding of the flow physics associated with lift enhancing tabs on a multi-element airfoil. A NACA 63(sub 2)-215 ModB airfoil with a 30 percent chord Fowler flap was tested in the NASA Ames 7 by 10 foot wind tunnel. Lift enhancing tabs of various heights were tested on both the main element and the flap for a variety of flap riggings. Computations of the flow over the two-element airfoil were performed using the two-dimensional incompressible Navier-Stokes code INS2D-UP. The computer results predict all of the trends in the experimental data quite well. When the flow over the flap upper surface is attached, tabs mounted at the main element trailing edge (cove tabs) produce very little change in lift. At high flap deflections. however, the flow over the flap is separated and cove tabs produce large increases in lift and corresponding reductions in drag by eliminating the separated flow. Cove tabs permit high flap deflection angles to be achieved and reduce the sensitivity of the airfoil lift to the size of the flap gap. Tabs attached to the flap training edge (flap tabs) are effective at increasing lift without significantly increasing drag. A combination of a cove tab and a flap tab increased the airfoil lift coefficient by 11 percent relative to the highest lift tab coefficient achieved by any baseline configuration at an angle of attack of zero percent and the maximum lift coefficient was increased by more than 3 percent. A simple analytic model based on potential flow was developed to provide a more detailed understanding of how lift enhancing tabs work. The tabs were modeled by a point vortex at the training edge. Sensitivity relationships were derived which provide a mathematical basis for explaining the effects of lift enhancing tabs on a multi-element airfoil. Results of the modeling

  16. Estimation of site occupancy error due to statistical noise for the ratio ALCHEMI method[Atom Location by Channeling Enhanced Microanalysis

    SciTech Connect

    Hao, Y.L.; Yang, R.; Cui, Y.Y.; Li, D.


    The ALCHEMI (acronym for atom location by channeling enhanced microanalysis) method has been widely used to determine crystallographic site distributions of substitutional species within a host crystal. However, the error of site occupancy can not be easily determined for the ratio ALCHEMI method. The purpose of this paper is to present a detailed treatment of error due to statistical noise for the ratio ALCHEMI method, with specific reference to the site occupancy of alloying elements in TiAl. The formulae for calculating the site occupancy of alloying elements in an ordered phase derived by Spence and Taftoe and by Taftoe and Spence are first expressed in different forms. Then the path of error propagation in the calculation is described and the maximum error of site occupancies caused by statistical noise is estimated. Finally, the authors present experimental measurements of site occupancy made with representative elements that were known to occupy exclusively either the Ti or the Al sublattice sites in TiAl in order to test the reliability of the error-analysis method they described. The error due to delocalization interaction for the planar ALCHEMI method will also be discussed for the case of TiAl.

  17. Complex organization of promoter and enhancer elements regulate the tissue- and developmental stage-specific expression of the Drosophila melanogaster Gld gene.

    PubMed Central

    Keplinger, B L; Guo, X; Quine, J; Feng, Y; Cavener, D R


    The Drosophila melanogaster Gld gene has multiple and diverse developmental and physiological functions. We report herein that interactions among proximal promoter elements and a cluster of intronically located enhancers and silencers specify the complex regulation of Gld that underlies its diverse functions. Gld expression in nonreproductive tissues is largely determined by proximal promoter elements with the exception of the embryonic labium where Gld is activated by an enhancer within the first intron. A nuclear protein, GPAL, has been identified that binds the Gpal elements in the proximal promoter region. Regulation of Gld in the reproductive organs is particularly complex, involving interactions among the Gpal proximal promoter elements, a unique TATA box, three distinct enhancer types, and one or more silencer elements. The three somatic reproductive organ enhancers each activate expression in male and female pairs of reproductive organs. One of these pairs, the male ejaculatory duct and female oviduct, are known to be developmentally homologous. We report evidence that the other two pairs of organs are developmentally homologous as well. A comprehensive model to explain the full developmental regulation of Gld and its evolution is presented. PMID:11156990

  18. Drosophila transcriptional repressor protein that binds specifically to negative control elements in fat body enhancers.

    PubMed Central

    Falb, D; Maniatis, T


    Expression of the Drosophila melanogaster Adh gene in adults requires a fat body-specific enhancer called the Adh adult enhancer (AAE). We have identified a protein in Drosophila nuclear extracts that binds specifically to a site within the AAE (adult enhancer factor 1 [AEF-1]). In addition, we have shown that AEF-1 binds specifically to two other Drosophila fat body enhancers. Base substitutions in the AEF-1 binding site that disrupt AEF-1 binding in vitro result in a significant increase in the level of Adh expression in vivo. Thus, the AEF-1 binding site is a negative regulatory element within the AAE. A cDNA encoding the AEF-1 protein was isolated and shown to act as a repressor of the AAE in cotransfection studies. The AEF-1 protein contains four zinc fingers and an alanine-rich sequence. The latter motif is found in other eukaryotic proteins known to be transcriptional repressors. Images PMID:1508206

  19. Genome-wide analysis of the effects of location and number of stress response elements on gene expression in Saccharomyces cerevisiae.


    Yoshikawa, Katsunori; Furusawa, Chikara; Hirasawa, Takashi; Shimizu, Hiroshi


    We analyzed the effects of the location and number of stress response elements (STREs) on gene expression in Saccharomyces cerevisiae. Genes containing STRE between 51 and 300 bp upstream from translational start codon tended to be up-regulated and genes with multiple STREs exhibited higher up-regulation under stress conditions. PMID:19111649

  20. Geo-Located Tweets. Enhancing Mobility Maps and Capturing Cross-Border Movement.


    Blanford, Justine I; Huang, Zhuojie; Savelyev, Alexander; MacEachren, Alan M


    Capturing human movement patterns across political borders is difficult and this difficulty highlights the need to investigate alternative data streams. With the advent of smart phones and the ability to attach accurate coordinates to Twitter messages, users leave a geographic digital footprint of their movement when posting tweets. In this study we analyzed 10 months of geo-located tweets for Kenya and were able to capture movement of people at different temporal (daily to periodic) and spatial (local, national to international) scales. We were also able to capture both long and short distances travelled, highlighting regional connections and cross-border movement between Kenya and the surrounding countries. The findings from this study has broad implications for studying movement patterns and mapping inter/intra-region movement dynamics. PMID:26086772

  1. Geo-Located Tweets. Enhancing Mobility Maps and Capturing Cross-Border Movement

    PubMed Central

    Blanford, Justine I.; Huang, Zhuojie; Savelyev, Alexander; MacEachren, Alan M.


    Capturing human movement patterns across political borders is difficult and this difficulty highlights the need to investigate alternative data streams. With the advent of smart phones and the ability to attach accurate coordinates to Twitter messages, users leave a geographic digital footprint of their movement when posting tweets. In this study we analyzed 10 months of geo-located tweets for Kenya and were able to capture movement of people at different temporal (daily to periodic) and spatial (local, national to international) scales. We were also able to capture both long and short distances travelled, highlighting regional connections and cross-border movement between Kenya and the surrounding countries. The findings from this study has broad implications for studying movement patterns and mapping inter/intra-region movement dynamics. PMID:26086772

  2. A Distribution-class Locational Marginal Price (DLMP) Index for Enhanced Distribution Systems

    NASA Astrophysics Data System (ADS)

    Akinbode, Oluwaseyi Wemimo

    The smart grid initiative is the impetus behind changes that are expected to culminate into an enhanced distribution system with the communication and control infrastructure to support advanced distribution system applications and resources such as distributed generation, energy storage systems, and price responsive loads. This research proposes a distribution-class analog of the transmission LMP (DLMP) as an enabler of the advanced applications of the enhanced distribution system. The DLMP is envisioned as a control signal that can incentivize distribution system resources to behave optimally in a manner that benefits economic efficiency and system reliability and that can optimally couple the transmission and the distribution systems. The DLMP is calculated from a two-stage optimization problem; a transmission system OPF and a distribution system OPF. An iterative framework that ensures accurate representation of the distribution system's price sensitive resources for the transmission system problem and vice versa is developed and its convergence problem is discussed. As part of the DLMP calculation framework, a DCOPF formulation that endogenously captures the effect of real power losses is discussed. The formulation uses piecewise linear functions to approximate losses. This thesis explores, with theoretical proofs, the breakdown of the loss approximation technique when non-positive DLMPs/LMPs occur and discusses a mixed integer linear programming formulation that corrects the breakdown. The DLMP is numerically illustrated in traditional and enhanced distribution systems and its superiority to contemporary pricing mechanisms is demonstrated using price responsive loads. Results show that the impact of the inaccuracy of contemporary pricing schemes becomes significant as flexible resources increase. At high elasticity, aggregate load consumption deviated from the optimal consumption by up to about 45 percent when using a flat or time-of-use rate. Individual load

  3. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.


    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo


    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  4. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy

    PubMed Central

    Powell, Sara Kathleen; Rivera-Soto, Ricardo; Gray, Steven James


    Over the last five years, the number of clinical trials involving AAV (adeno-associated virus) and lentiviral vectors continue to increase by about 150 trials each year. For continued success, AAV and lentiviral expression cassettes need to be designed to meet each disease's specific needs. This review discusses how viral vector expression cassettes can be engineered with elements to enhance target specificity and increase transgene expression. The key differences relating to target specificity between ubiquitous and tissue-specific promoters are discussed, as well as how endogenous miRNAs and their target sequences have been used to restrict transgene expression. Specifically, relevant studies indicating how cis-acting elements such as introns, WPRE, polyadenylation signals, and the CMV enhancer are highlighted to show their utility for enhancing transgene expression in gene therapy applications. All discussion bears in mind that expression cassettes have space constraints. In conclusion, this review can serve as a menu of vector genome design elements and their cost in terms of space to thoughtfully engineer viral vectors for gene therapy. PMID:25636961

  5. Enhancing effect of marine oligotrophy on environmental concentrations of particle-reactive trace elements

    SciTech Connect

    Jeffree, R.A.; Szymczak, R.


    A biogeochemical model has been previously developed that explains the inverse and nonlinear relationship between Po-210 concentration in zooplankton and their biomass, under oligotrophic conditions in French Polynesia. In this study the model structure was reviewed to determine a set of biogeochemical behaviors of Po-210, proposed to be critical to its environmental enhancement under oligotrophy: this set was then used to identify 25 other elements with comparable behaviors to Po-210. Field investigation in the Timor Sea showed that four of these a priori identified elements, viz. Cd, Co, Pb, and Mn as well as Cr and Ni, showed elevated water concentrations with reduced particle removal rates in the euphotic zone, results that are consistent with those previously obtained for Po-210 and the proposed explanatory model. These findings point to the enhanced susceptibility to contamination with particle-reactive elements of oligotrophic marine systems, whose degree and geographic extent may be enhanced by projected increases in sea surface temperatures from global warming.

  6. Mechanism of the enhanced degradation of pentachlorophenol by ultrasound in the presence of elemental iron.


    Dai, Youzhi; Li, Fenfang; Ge, Fei; Zhu, Fei; Wu, Lanyan; Yang, Xiangzheng


    Ultrasound combined with elemental iron (US/Fe(0)) is effective in oxidizing organic contaminants in water. The sonolysis degradation of pentachlorophenol (PCP) was significantly enhanced by a factor of 4.2 with the addition of elemental iron, mainly via reaction with hydroxyl radicals (OH radicals), and the synergistic mechanism of the enhancement in the combined system was investigated. Experiments were performed with (1) sole ultrasonic treatment; (2) ultrasound in presence of iron; (3) ultrasound combined with copper powder as the same particle size as iron powder; (4) ultrasound in presence of Fe(II). It was observed that PCP degradation and OH radicals production were both enhanced in these combined methods, and the pitting on the sonicated iron surface was apparent. These results indicated that the rate enhancements in US/Fe(0) system were attributed to (1) the iron solid effect and the catalysis of Fe(II) produced from corroded-iron with promoting the production of OH radicals; (2) the increased surface area of iron particles by acoustic cavitation with promoting the adsorption process. PMID:16762499

  7. Whistler wave radiation from a pulsed loop antenna located in a cylindrical duct with enhanced plasma density

    SciTech Connect

    Kudrin, Alexander V.; Shkokova, Natalya M.; Ferencz, Orsolya E.; Zaboronkova, Tatyana M.


    Pulsed radiation from a loop antenna located in a cylindrical duct with enhanced plasma density is studied. The radiated energy and its distribution over the spatial and frequency spectra of the excited waves are derived and analyzed as functions of the antenna and duct parameters. Numerical results referring to the case where the frequency spectrum of the antenna current is concentrated in the whistler range are reported. It is shown that under ionospheric conditions, the presence of an artificial duct with enhanced density can lead to a significant increase in the energy radiated from a pulsed loop antenna compared with the case where the same source is immersed in the surrounding uniform magnetoplasma. The results obtained can be useful in planning active ionospheric experiments with pulsed electromagnetic sources operated in the presence of artificial field-aligned plasma density irregularities that are capable of guiding whistler waves.

  8. A small regulatory element from chromosome 19 enhances liver-specific gene expression

    PubMed Central

    Li, C; Hirsch, M; Carter, P; Asokan, A; Zhou, X; Wu, Z; Samulski, RJ


    Tissue-specific promoters for gene therapy are typically too big for adeno-associated virus (AAV) vectors; thus, the exploration of small effective non-viral regulatory elements is of particular interest. Wild-type AAV can specifically integrate into a region on human chromosome 19 termed AAVS1. Earlier work has determined that a 347 bp fragment (Chr19) of AAVS1 has promoter and transcriptional enhancer activities. In this study, we further characterized this genetic regulation and investigated its application to AAV gene therapy in vitro and in vivo. The Chr19 347 bp fragment was dissected into three regulatory elements in human embryonic kidney cells: (i) TATA-independent promoter activity distributed throughout the fragment regardless of orientation, (ii) an orientation-dependent insulator function near the 5′ end and (iii) a 107 bp enhancer region near the 3′ end. The small enhancer region, coupled to the mini-CMV promoter, was used to drive the expression of several reporters following transduction by AAV2. In vivo data demonstrated enhanced transgene expression from the Chr19-mini-CMV promoter cassette after tail vein injection primarily in the liver at levels comparable to the chicken β-actin promoter and higher than the liver-specific TTR promoter (>2-fold). However, we did not observe this increase after muscle injection, suggesting tissue-specific enhancement. All of the results support identification of a small DNA fragment (347 bp) from AAV Chr19 integration site capable of providing efficient and enhanced liver-specific transcription when used in recombinant AAV vectors. PMID:18701910

  9. A Modular Enhancer Is Differentially Regulated by GATA and NFAT Elements That Direct Different Tissue-Specific Patterns of Nucleosome Positioning and Inducible Chromatin Remodeling▿

    PubMed Central

    Bert, Andrew G.; Johnson, Brett V.; Baxter, Euan W.; Cockerill, Peter N.


    We investigated alternate mechanisms employed by enhancers to position and remodel nucleosomes and activate tissue-specific genes in divergent cell types. We demonstrated that the granulocyte-macrophage colony-stimulating factor (GM-CSF) gene enhancer is modular and recruits different sets of transcription factors in T cells and myeloid cells. The enhancer recruited distinct inducible tissue-specific enhanceosome-like complexes and directed nucleosomes to different positions in these cell types. In undifferentiated T cells, the enhancer was activated by inducible binding of two NFAT/AP-1 complexes which disrupted two specifically positioned nucleosomes (N1 and N2). In myeloid cells, the enhancer was remodeled by GATA factors which constitutively displaced an upstream nucleosome (N0) and cooperated with inducible AP-1 elements to activate transcription. In mast cells, which express both GATA-2 and NFAT, these two pathways combined to activate the enhancer and generate high-level gene expression. At least 5 kb of the GM-CSF locus was organized as an array of nucleosomes with fixed positions, but the enhancer adopted different nucleosome positions in T cells and mast cells. Furthermore, nucleosomes located between the enhancer and promoter were mobilized upon activation in an enhancer-dependent manner. These studies reveal that distinct tissue-specific mechanisms can be used either alternately or in combination to activate the same enhancer. PMID:17283044

  10. A meiotic drive element is located within a 130-kb region of chromosome V of the maize pathogen Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fungus Fusarium verticillioides is a pathogen of maize worldwide and produces carcinogenic mycotoxins known as fumonisins. Natural populations of the fungus harbor a meiotic drive element called Spore killer, abbreviated as FvSkK. Only FvSkK progeny survive in a cross between an FvSkK strain and...

  11. A meiotic drive element in the maize pathogen Fusarium verticillioides is located within a 102-kb region of chromosome V

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (SkK) that causes nearly all surviving meiotic progeny f...

  12. Enhanced signal processing algorithms for buried unexploded ordnance detection and location estimation with magnetometer and electromagnetic induction measurements

    SciTech Connect

    Witten, A.


    Enhanced signal processing algorithms have been developed for the detection and location of buried unexploded ordnance using magnetometry and electromagnetic induction (EMI) measurements. These signal processing algorithms are related to those used to image with geophysical diffraction tomography (GDT) employing wave-based measurements. The underlying relationship of GDT is the Generalized Projection Slice Theorem (GPST) that relates the spatial Fourier transform of acquired data to the spatial Fourier transform of subsurface inhomogeneities of one higher dimension. This relationship can be used to simulate data templates for known targets and, by virtue of the shift property of Fourier transforms, a data simulation need only be computed for one reference target location. All other target locations are generated by an appropriate phase shift. These data templates can be correlated with acquired data to determine the spatial distribution of probable target location. This approach to target detection and location estimation, referred to as a maximum likelihood estimation, can be used to produce an {open_quotes}image{close_quotes} of the likelihood of a specified target`s position. For non wave-based methods, the relationship between data and target characteristics is not strictly associated with Fourier transforms. In the case of magnetometry, the appropriate GPST requires a Fourier-Laplace transform of the target characteristics while the EMI GPST is based on an integral transform with a complex wavenumber. Nevertheless, the shift rule for integral transforms can be invoked to yield GPST`s for these tools and the associated computationally efficient maximum likelihood estimators. The EMI detection algorithm was applied to data acquired at a known underground storage tank site and the algorithms for both magnetometry and EMI were applied to data acquired at the Magnetic Range of the Naval EOD Tech Center in Indian Head, Maryland.

  13. Boundary element method applied to a gas-fired pin-fin-enhanced heat pipe

    SciTech Connect

    Andraka, C.E.; Knorovsky, G.A.; Drewien, C.A.


    The thermal conduction of a portion of an enhanced surface heat exchanger for a gas fired heat pipe solar receiver was modeled using the boundary element and finite element methods (BEM and FEM) to determine the effect of weld fillet size on performance of a stud welded pin fin. A process that could be utilized by others for designing the surface mesh on an object of interest, performing a conversion from the mesh into the input format utilized by the BEM code, obtaining output on the surface of the object, and displaying visual results was developed. It was determined that the weld fillet on the pin fin significantly enhanced the heat performance, improving the operating margin of the heat exchanger. The performance of the BEM program on the pin fin was measured (as computational time) and used as a performance comparison with the FEM model. Given similar surface element densities, the BEM method took longer to get a solution than the FEM method. The FEM method creates a sparse matrix that scales in storage and computation as the number of nodes (N), whereas the BEM method scales as N{sup 2} in storage and N{sup 3} in computation.

  14. 20 CFR 655.534 - The first attestation element for locations in Alaska: Bona fide request for dispatch of United...

    Code of Federal Regulations, 2010 CFR


    ... of Alaska. (1) Wherever two or more contract stevedoring companies have signed a joint collective... crewmembers to perform longshore work during the validity period of the attestation, the employer will make a... to make available workers to the particular location where the longshore work is to be performed....

  15. Oncogene regulation. An oncogenic super-enhancer formed through somatic mutation of a noncoding intergenic element.


    Mansour, Marc R; Abraham, Brian J; Anders, Lars; Berezovskaya, Alla; Gutierrez, Alejandro; Durbin, Adam D; Etchin, Julia; Lawton, Lee; Sallan, Stephen E; Silverman, Lewis B; Loh, Mignon L; Hunger, Stephen P; Sanda, Takaomi; Young, Richard A; Look, A Thomas


    In certain human cancers, the expression of critical oncogenes is driven from large regulatory elements, called super-enhancers, that recruit much of the cell's transcriptional apparatus and are defined by extensive acetylation of histone H3 lysine 27 (H3K27ac). In a subset of T-cell acute lymphoblastic leukemia (T-ALL) cases, we found that heterozygous somatic mutations are acquired that introduce binding motifs for the MYB transcription factor in a precise noncoding site, which creates a super-enhancer upstream of the TAL1 oncogene. MYB binds to this new site and recruits its H3K27 acetylase-binding partner CBP, as well as core components of a major leukemogenic transcriptional complex that contains RUNX1, GATA-3, and TAL1 itself. Additionally, most endogenous super-enhancers found in T-ALL cells are occupied by MYB and CBP, which suggests a general role for MYB in super-enhancer initiation. Thus, this study identifies a genetic mechanism responsible for the generation of oncogenic super-enhancers in malignant cells. PMID:25394790


    NASA Astrophysics Data System (ADS)

    McAlexander, W. I.; Rau, G. H.; Dobeck, L.; Spangler, L.


    A commercial instrument (Los Gatos Research, model 908-0003) utilizing Cavity Enhanced Laser Absorption Spectroscopy was deployed in 2009 at the ZERT carbon release site (Bozeman, MT) for real time measurement of above-ground CO2 concentration and isotope ratio (δ13C). An automated switching system sampled 13 different locations in the field, as well as two known references, over an 8 day period. Real-time Keeling plots were constructed showing distinct signatures of soil (-27.0 ‰) and fossil (-56.0 ‰) sources compared to background air (-8.2 ‰). Instrument performance gave 0.2 ‰ precision with only 100 seconds of averaging per inlet. Sequential sampling of the various inlets gave a temporal and physical mapping of the CO2 release plume that is difficult to obtain using more conventional techniques. The figures show the nature and quality of the data from one of the locations. Details concerning instrument performance, systematics, calibration, and data processing will be discussed. Fig1: Time chart of CO2 concentration and isotope ratio δ13C from one of 13 sample inlet locations at ZERT release field, July, 2009. Fig2: Keeling plot of data from Fig1 illustrating the two source mixing of soil (-27 ‰) and fossil (-56 ‰) CO2 with background air.

  17. Evidence for enhanced bioavailability of trace elements in the marine ecosystem of Deception Island, a volcano in Antarctica.


    Deheyn, Dimitri D; Gendreau, Philippe; Baldwin, Roberta J; Latz, Michael I


    This study assessed whether trace elements present at Deception Island, an active submarine volcano in the Antarctic Peninsula, show enhanced biological availability to the local marine community. Using a weak acid extraction method to dissolve organic material and leach associated but not constitutive trace elements of sediments, fifteen elements were measured from seafloor sediment, seawater particulates, and tissues of benthic (bivalves, brittlestars, sea urchins) and pelagic (demersal and pelagic fishes, krill) organisms collected in the flooded caldera. The highest element concentrations were associated with seafloor sediment, the lowest with seawater particulates and organism tissues. In the case of Ag and Se, concentrations were highest in organism tissue, indicating contamination through the food chain and biomagnification of those elements. The elements Al, Fe, Mn, Sr, Ti, and to a lesser extent Zn, were the most concentrated of the trace elements for all sample types. This indicates that the whole ecosystem of Deception Island is contaminated with trace elements from local geothermal activity, which is also reflected in the pattern of element contamination in organisms. Accordingly, element concentrations were higher in organisms collected at Deception Island compared to those from the neighboring non-active volcanic King George Island, suggesting that volcanic activity enhances bioavailability of trace elements to marine organisms. Trace element concentrations were highest in digestive tissue of organisms, suggesting that elements at Deception Island are incorporated into the marine food web mainly through a dietary route. PMID:15649525

  18. Dependence of radiation belt enhancements on the radial extent of Pc5 waves and the plasmapause location

    NASA Astrophysics Data System (ADS)

    Georgiou, M.; Daglis, I. A.; Zesta, E.; Balasis, G.; Katsavrias, C.; Mann, I. R.; Tsinganos, K.


    Low-energy electrons are accelerated to relativistic energies through different mechanisms, transporting them across their drift shells to the outer radiation belt. Among the different acceleration mechanisms, radial diffusion describes the result of ULF magnetic field pulsations resonantly interacting with radiation belt electrons. In this paper, the radial positioning of the relativistic electron population during 39 intense and moderate magnetic storms is examined against that of ULF Pc5 wave power and the plasmapause location. The relativistic electron population of the outer radiation belt appeared enhanced in the 2 - 6 MeV electron flux data from SAMPEX and in > 2 MeV electron flux data from the geosynchronous GOES satellites following 27 of the magnetic storms. We compared relativistic electrons observations with concurrent radial distribution of wave power enhancements at Pc5 frequencies as detected by the IMAGE and CARISMA magnetometer arrays, as well as by additional magnetic stations collaborating in SuperMAG. We discuss the growth and decay characteristics of Pc5 waves in association with the plasmapause location, determined from IMAGE EUV observations, as the controlling factor for wave power penetration deep into the magnetosphere. We show that, during magnetic storms characterized by increased post-storm fluxes, Pc5 wave power penetrates to L shells of 4 and lower. On the other hand, magnetic storms which were characterised by loss of electrons were related to low Pc5 wave activity, which was not intensified at low L shells. These observations provide support for the hypothesis that enhanced Pc5 wave activity deep into the magnetosphere during the main and recovery phase can discriminate between storms that result in increases of electron fluxes from those that do not. The work leading to this paper has received funding from the European Union's Seventh Framework Programme (FP7-SPACE-2011-1) under grant agreement no. 284520 for the MAARBLE

  19. Enhanced Low-Enriched Uranium Fuel Element for the Advanced Test Reactor

    SciTech Connect

    Pope, M. A.; DeHart, M. D.; Morrell, S. R.; Jamison, R. K.; Nef, E. C.; Nigg, D. W.


    Under the current US Department of Energy (DOE) policy and planning scenario, the Advanced Test Reactor (ATR) and its associated critical facility (ATRC) will be reconfigured to operate on low-enriched uranium (LEU) fuel. This effort has produced a conceptual design for an Enhanced LEU Fuel (ELF) element. This fuel features monolithic U-10Mo fuel foils and aluminum cladding separated by a thin zirconium barrier. As with previous iterations of the ELF design, radial power peaking is managed using different U-10Mo foil thicknesses in different plates of the element. The lead fuel element design, ELF Mk1A, features only three fuel meat thicknesses, a reduction from the previous iterations meant to simplify manufacturing. Evaluation of the ELF Mk1A fuel design against reactor performance requirements is ongoing, as are investigations of the impact of manufacturing uncertainty on safety margins. The element design has been evaluated in what are expected to be the most demanding design basis accident scenarios and has met all initial thermal-hydraulic criteria.

  20. New insights on the transcriptional regulation of CD69 gene through a potent enhancer located in the conserved non-coding sequence 2.


    Laguna, Teresa; Notario, Laura; Pippa, Raffaella; Fontela, Miguel G; Vázquez, Berta N; Maicas, Miren; Aguilera-Montilla, Noemí; Corbí, Ángel L; Odero, María D; Lauzurica, Pilar


    The CD69 type II C-type lectin is one of the earliest indicators of leukocyte activation acting in lymphocyte migration and cytokine secretion. CD69 expression in hematopoietic lineage undergoes rapid changes depending on the cell-lineage, the activation state or the localization of the cell where it is expressed, suggesting a complex and tightly controlled regulation. Here we provide new insights on the transcriptional regulation of CD69 gene in mammal species. Through in silico studies, we analyzed several regulatory features of the 4 upstream conserved non-coding sequences (CNS 1-4) previously described, confirming a major function of CNS2 in the transcriptional regulation of CD69. In addition, multiple transcription binding sites are identified in the CNS2 region by DNA cross-species conservation analysis. By functional approaches we defined a core region of 226bp located within CNS2 as the main enhancer element of CD69 transcription in the hematopoietic cells analyzed. By chromatin immunoprecipitation, binding of RUNX1 to the core-CNS2 was shown in a T cell line. In addition, we found an activating but not essential role of RUNX1 in CD69 gene transcription by site-directed mutagenesis and RNA silencing, probably through the interaction with this potent enhancer specifically in the hematopoietic lineage. In summary, in this study we contribute with new evidences to the landscape of the transcriptional regulation of the CD69 gene. PMID:25801305

  1. Viewing angle enhancement of an integral imaging display using Bragg mismatched reconstruction of holographic optical elements.


    Lee, Seungjae; Jang, Changwon; Cho, Jaebum; Yeom, Jiwoon; Jeong, Jinsoo; Lee, Byoungho


    Holographic-optical-element (HOE)-based integral imaging display can be applied to augmented reality. However, a narrow viewing angle is a bottleneck for commercialization. Here, we propose a method to enhance the viewing angle of the integral imaging display using Bragg mismatched reconstruction of HOEs. The viewing angle of the integral imaging display can be enlarged with two probe waves, which form two different viewing zones. The effect of Bragg mismatched reconstruction is analyzed with simulation and experiment. In order to show feasibility of the proposed method, a display experiment is demonstrated. PMID:26835963

  2. Interlaminar stress recovery near free edge using a layerwise element with enhanced strains

    SciTech Connect

    Moorthy, D.; Mitchell, J.A.; Reddy, J.N.


    In the analysis of composite laminates, when the primary concern is the global response, one may choose to model the laminate with layers of different mechanical properties as an effective layer with equivalent mechanical characteristics. A layerwise finite element with enhanced strains is developed for the study of interlaminar stresses near free edge of a laminate in bending. Interlaminar boundary of interest is modeled as an adhesive contact zone between the two halves of the laminate separated at the interface. Interlaminar stresses are then recovered from the contact load that satisfies the equilibrium of the laminate. The stresses recovered thus are compared with other stress recovery procedures.

  3. Identification of a T-cell-specific transcriptional enhancer located 3' of C gamma 1 in the murine T-cell receptor gamma locus.

    PubMed Central

    Spencer, D M; Hsiang, Y H; Goldman, J P; Raulet, D H


    A transcriptional enhancer element has been localized 3 kilobases 3' of the murine T-cell receptor C gamma 1 locus using a chloramphenicol acetyltransferase reporter gene construct. As a monomer the enhancer functions only in PEER gamma delta cells and Jurkat alpha beta cells of the T-cell lines tested. However, a tetramer of the enhancer functions in virtually all T-cell lines tested, including alpha beta T-cell lines, but not in other cell types. These results suggest that elements other than the enhancer are responsible for the failure of rearranged C gamma 1 genes to be expressed in alpha beta T cells. The enhancer has been localized to a 200-base-pair Rsa I restriction fragment, which contains sequence motifs similar to those found in the other T-cell receptor enhancers but not in the immunoglobulin enhancers. Images PMID:1992471

  4. Determination of Reduced Number and Suitable Locations of Fuzzy Logic Controlled Braking Resistors for Transient Stability Enhancement

    NASA Astrophysics Data System (ADS)

    Ali, Mohd. Hasan; Murata, Toshiaki; Tamura, Junji

    Braking resistor is known to be a very powerful tool for transient stability improvement in electric power systems. Usually, in a large power system braking resistors are placed at each generator terminal bus which requires a high installation as well as operation cost. Also, heavy computation is required for the controllers used for the switching of the resistors. From these viewpoints, this paper directs to the study of installation of reduced number of fuzzy logic controlled braking resistors at suitable locations for transient stability enhancement. Groups of coherent generators in the power system are determined. Then one braking resistor is installed in each of the coherent group and at each of the remaining generator terminal bus. Thus, the number of braking resistors is reduced and hence the installation and operation cost as well as computational burden for the controllers are minimized. The suitable location for the braking resistor in each coherent group of generators is determined according to the values of the transient stability index as calculated for a 3LG (Three-phase-to-ground) fault at the points near the generators of the coherent group without considering the braking resistors in the system. The effectiveness of the proposed method is demonstrated through EMTP simulations for the IEEJ West-10 machine model system.

  5. Analysis of Vertebral Bone Strength, Fracture Pattern, and Fracture Location: A Validation Study Using a Computed Tomography-Based Nonlinear Finite Element Analysis

    PubMed Central

    Imai, Kazuhiro


    Finite element analysis (FEA) is an advanced computer technique of structural stress analysis developed in engineering mechanics. Because the compressive behavior of vertebral bone shows nonlinear behavior, a nonlinear FEA should be utilized to analyze the clinical vertebral fracture. In this article, a computed tomography-based nonlinear FEA (CT/FEA) to analyze the vertebral bone strength, fracture pattern, and fracture location is introduced. The accuracy of the CT/FEA was validated by performing experimental mechanical testing with human cadaveric specimens. Vertebral bone strength and the minimum principal strain at the vertebral surface were accurately analyzed using the CT/FEA. The experimental fracture pattern and fracture location were also accurately simulated. Optimization of the element size was performed by assessing the accuracy of the CT/FEA, and the optimum element size was assumed to be 2 mm. It is expected that the CT/FEA will be valuable in analyzing vertebral fracture risk and assessing therapeutic effects on osteoporosis. PMID:26029476

  6. Conjugal Transfer of Polychlorinated Biphenyl/Biphenyl Degradation Genes in Acidovorax sp. Strain KKS102, Which Are Located on an Integrative and Conjugative Element

    PubMed Central

    Ishibashi, Yoko; Naganawa, Hideaki; Hirokawa, Satoshi; Atobe, Satomi; Nagata, Yuji; Tsuda, Masataka


    A polychlorinated biphenyl (PCB)/biphenyl degradation gene cluster in Acidovorax sp. strain KKS102, which is very similar to that in Tn4371 from Cupriavidus oxalaticus A5, was transferred to several proteobacterial strains by conjugation. The mobilized DNA fragment consisted of 61,807 bp and carried genes for mating-pair formation (mpf), DNA transfer (dtr), integrase (int), and replication-partition proteins (rep-parAB). In the transconjugants, transferred DNA was integrated at ATTGCATCAG or similar sequences. The circular-form integrative and conjugative element (ICE) was detected by PCR, and quantitative PCR analyses revealed that, in KKS102 cells, the ratio of the circular form to the integrated form was very low (approximately 10−5). The circular form was not detected in a mutant of the int gene, which was located at the extreme left and transcribed in the inward direction, and the level of int transcriptional activity was much higher in the circular form than in the integrated form. These findings clearly demonstrated that the genes for PCB/biphenyl degradation in KKS102 cells are located on an ICE, which was named ICEKKS1024677. Comparisons of similar ICE-like elements collected from the public database suggested that those of beta- and gammaproteobacteria were distinguishable from other ICE-like elements, including those in alphaproteobacteria, with respect to the gene composition and gene organization. PMID:22685277

  7. Analysis of vertebral bone strength, fracture pattern, and fracture location: a validation study using a computed tomography-based nonlinear finite element analysis.


    Imai, Kazuhiro


    Finite element analysis (FEA) is an advanced computer technique of structural stress analysis developed in engineering mechanics. Because the compressive behavior of vertebral bone shows nonlinear behavior, a nonlinear FEA should be utilized to analyze the clinical vertebral fracture. In this article, a computed tomography-based nonlinear FEA (CT/FEA) to analyze the vertebral bone strength, fracture pattern, and fracture location is introduced. The accuracy of the CT/FEA was validated by performing experimental mechanical testing with human cadaveric specimens. Vertebral bone strength and the minimum principal strain at the vertebral surface were accurately analyzed using the CT/FEA. The experimental fracture pattern and fracture location were also accurately simulated. Optimization of the element size was performed by assessing the accuracy of the CT/FEA, and the optimum element size was assumed to be 2 mm. It is expected that the CT/FEA will be valuable in analyzing vertebral fracture risk and assessing therapeutic effects on osteoporosis. PMID:26029476

  8. Distal apolipoprotein C-III regulatory elements F to J act as a general modular enhancer for proximal promoters that contain hormone response elements. Synergism between hepatic nuclear factor-4 molecules bound to the proximal promoter and distal enhancer sites.


    Kardassis, D; Tzameli, I; Hadzopoulou-Cladaras, M; Talianidis, I; Zannis, V


    Transient transfection assays have shown that the distal apoC-III promoter segments that contain the regulatory elements F to J enhance the strength of the tandemly linked proximal apoA-I promoter 5- to 13-fold in hepatic (HepG2) cells. Activation in intestinal (CaCo-2) cells to levels comparable to those obtained in HepG2 cells requires a larger apoA-I promoter sequence that extends to nucleotide -1500 as well as the presence of hepatic nuclear factor-4 (HNF-4). The distal apoC-III regulatory elements can also enhance 4- to 8-fold the strength of the heterologous apoB promoter in HepG2 and CaCo-2 cells. Finally, these elements in the presence of HNF-4 enhance 14.5- to 18.5-fold the strength of the minimal adenovirus major late promoter linked to two copies of the hormone response element (HRE) AID of apoA-I in both HepG2 and CaCo-2 cells. In vitro mutagenesis of the promoter/enhancer cluster established that the enhancer activity is lost by a mutation in the HRE present in the 3' end of the regulatory element I (-736 to -714) and is reduced significantly by point mutations or deletions in one or more of the regulatory elements F to J of the apoC-III enhancer. The enhancer activity also requires the HREs of the proximal apoA-I promoter. The apoC-III enhancer can also restore the activity of the proximal apoA-I and apoB promoters that have been inactivated by mutations in CCAAT/enhancers binding protein binding sites, indicating that C/EBP may not participate in the synergistic activation of the promoter/enhancer cluster. The findings suggest that the regulatory elements F to J of the apoC-III promoter act as a general modular enhancer that can potentiate the strength of proximal promoters that contain HREs. Such potentiation in the HepG2 cells can be accounted for by synergistic interactions between HNF-4 or other nuclear hormone receptors bound to the proximal and distal HREs and SP1 or other factors bound to the apoC-III enhancer. Additional factors may be

  9. Wall thickness measurement using resonant phenomena of circumferential Lamb waves generated by plural transducer elements located evenly on girth

    NASA Astrophysics Data System (ADS)

    Nishino, Hideo; Iwata, Kodai; Ishikawa, Masashi


    We present a novel method of measuring the pipe wall thickness using the resonance of the circumferential (C-) Lamb wave generated by a piezoelectric ring-shaped sensor (PS). The PS is a special device for an axially propagating torsional wave; however, the C-Lamb waves are generated simultaneously as spurious signals owing to the structure of the PS. Particularly under resonant conditions, the C-Lamb waves are dominantly generated, distorting the axially propagating wave. In this method, these troublesome spurious signals are used effectively for the measurement of the wall thickness under the PS location that is a dead zone of the PS itself. The method can compensate for its drawback, namely, the dead zone problem, without using additional instruments. In this study, the mechanisms of the generation and resonance of the C-Lamb waves were first explained. Secondly, the principle of the wall thickness estimation utilizing the resonance of the C-Lamb waves was proposed. Finally, experimental verifications were carried out. The estimated wall thicknesses agreed very well (maximum 1.5% error) with those measured by a micrometer caliper under suitable resonant conditions.

  10. S-S Synapsis during Class Switch Recombination Is Promoted by Distantly Located Transcriptional Elements and Activation-Induced Deaminase

    PubMed Central

    Wuerffel, Robert; Wang, Lili; Grigera, Fernando; Manis, John; Selsing, Erik; Perlot, Thomas; Alt, Frederick W.; Cogne, Michel; Pinaud, Eric; Kenter, Amy L.


    SUMMARY Molecular mechanisms underlying synapsis of activation-induced deaminase (AID)-targeted S regions during class switch recombination (CSR) are poorly understood. By using chromosome conformation capture techniques, we found that in B cells, the Eμ and 3′Eα enhancers were in close spatial proximity, forming a unique chromosomal loop configuration. B cell activation led to recruitment of the germline transcript (GLT) promoters to the Eμ:3′Eα complex in a cytokine-dependent fashion. This structure facilitated S-S synapsis because Sμ was proximal to Eμ and a downstream S region was corecruited with the targeted GLT promoter to Eμ:3′Eα. We propose that GLT promoter association with the Eμ:3′Eα complex creates an architectural scaffolding that promotes S-S synapsis during CSR and that these interactions are stabilized by AID. Thus, the S-S synaptosome is formed as a result of the self-organizing transcription system that regulates GLT expression and may serve to guard against spurious chromosomal translocations. PMID:17980632

  11. Functional Analysis of a Bacitracin Resistance Determinant Located on ICECp1, a Novel Tn916-Like Element from a Conjugative Plasmid in Clostridium perfringens

    PubMed Central

    Han, Xiaoyan; Du, Xiang-Dang; Southey, Luke; Bulach, Dieter M.; Seemann, Torsten; Yan, Xu-Xia; Bannam, Trudi L.


    Bacitracins are mixtures of structurally related cyclic polypeptides with antibiotic properties. They act by interfering with the biosynthesis of the bacterial cell wall. In this study, we analyzed an avian necrotic enteritis strain of Clostridium perfringens that was resistant to bacitracin and produced NetB toxin. We identified a bacitracin resistance locus that resembled a bacitracin resistance determinant from Enterococcus faecalis. It contained the structural genes bcrABD and a putative regulatory gene, bcrR. Mutagenesis studies provided evidence that both bcrA and bcrB are essential for bacitracin resistance, and that evidence was supported by the results of experiments in which the introduction of both the bcrA and bcrB genes into a bacitracin-susceptible C. perfringens strain was required to confer bacitracin resistance. The wild-type strain was shown to contain at least three large, putatively conjugative plasmids, and the bcrRABD locus was localized to an 89.7-kb plasmid, pJIR4150. This plasmid was experimentally shown to be conjugative and was sequenced. The sequence revealed that it also carries a tpeL toxin gene and is related to the pCW3 family of conjugative antibiotic resistance and toxin plasmids from C. perfringens. The bcr genes were located on a genetic element, ICECp1, which is related to the Tn916 family of integrative conjugative elements (ICEs). ICECp1 appears to be the first Tn916-like element shown to confer bacitracin resistance. In summary, we identified in a toxin-producing C. perfringens strain a novel mobile bacitracin resistance element which was experimentally shown to be essential for bacitracin resistance and is carried by a putative ICE located on a conjugative plasmid. PMID:26282424

  12. Functional analysis of a bacitracin resistance determinant located on ICECp1, a novel Tn916-like element from a conjugative plasmid in Clostridium perfringens.


    Han, Xiaoyan; Du, Xiang-Dang; Southey, Luke; Bulach, Dieter M; Seemann, Torsten; Yan, Xu-Xia; Bannam, Trudi L; Rood, Julian I


    Bacitracins are mixtures of structurally related cyclic polypeptides with antibiotic properties. They act by interfering with the biosynthesis of the bacterial cell wall. In this study, we analyzed an avian necrotic enteritis strain of Clostridium perfringens that was resistant to bacitracin and produced NetB toxin. We identified a bacitracin resistance locus that resembled a bacitracin resistance determinant from Enterococcus faecalis. It contained the structural genes bcrABD and a putative regulatory gene, bcrR. Mutagenesis studies provided evidence that both bcrA and bcrB are essential for bacitracin resistance, and that evidence was supported by the results of experiments in which the introduction of both the bcrA and bcrB genes into a bacitracin-susceptible C. perfringens strain was required to confer bacitracin resistance. The wild-type strain was shown to contain at least three large, putatively conjugative plasmids, and the bcrRABD locus was localized to an 89.7-kb plasmid, pJIR4150. This plasmid was experimentally shown to be conjugative and was sequenced. The sequence revealed that it also carries a tpeL toxin gene and is related to the pCW3 family of conjugative antibiotic resistance and toxin plasmids from C. perfringens. The bcr genes were located on a genetic element, ICECp1, which is related to the Tn916 family of integrative conjugative elements (ICEs). ICECp1 appears to be the first Tn916-like element shown to confer bacitracin resistance. In summary, we identified in a toxin-producing C. perfringens strain a novel mobile bacitracin resistance element which was experimentally shown to be essential for bacitracin resistance and is carried by a putative ICE located on a conjugative plasmid. PMID:26282424

  13. Nanoparticle-Functionalized Porous Polymer Monolith Detection Elements for Surface-Enhanced Raman Scattering

    PubMed Central

    Liu, Jikun; White, Ian; DeVoe, Don L.


    The use of porous polymer monoliths functionalized with silver nanoparticles is introduced in this work for high-sensitivity surface-enhanced Raman scattering (SERS) detection. Preparation of the SERS detection elements is a simple process comprising the synthesis of a discrete polymer monolith section within a silica capillary, followed by physically trapping silver nanoparticle aggregates within the monolith matrix. A SERS detection limit of 220 fmol for Rhodamine 6G (R6G) is demonstrated, with excellent signal stability over a 24 h period. The capability of the SERS-active monolith for label-free detection of biomolecules was demonstrated by measurements of bradykinin and cyctochrome c. The SERS-active monoliths can be readily integrated into miniaturized micro-total-analysis systems for on-line and label-free detection for a variety of biosensing, bioanalytical, and biomedical applications. PMID:21322579

  14. Crystal Structure of NFAT Bound to the HIV-1 LTR Tandem κB Enhancer Element

    SciTech Connect

    Bates, Darren L.; Barthel, Kristen K.B.; Wu, Yongqing; Kalhor, Reza; Stroud, James C.; Giffin, Michael J.; Chen, Lin


    Here, we have determined the crystal structure of the DNA binding domain of NFAT bound to the HIV-1 long terminal repeat (LTR) tandem {kappa}B enhancer element of 3.05 {angstrom} resolution. NFAT binds as a dimer to the upstream {kappa}B site (Core II), but as a monomer to the 3' end of the downstream {kappa}B site (Core I). The DNA shows a significant bend near the 5' end of Core I, where a lysine residue from NFAT bound to the 3' end of Core II inserts into the minor groove and seems to cause DNA bases to flip out. Consistent with this structural feature, the 5' end of Core I become hypersensitive to dimethylsulfate in the in vivo footprinting upon transcriptional activation of the HIV-1 LTR. Our studies provide a basis for futher investigating the functional mechanism of NFAT in HIV-1 transcription and replication.

  15. Antenna Gain Enhancement and Beamshaping using a Diffractive Optical Element (DOE) Lens

    NASA Astrophysics Data System (ADS)

    Torbitt, Christopher

    Dielectric and metamaterial lenses have been designed for gain enhancement and beam shaping. The motivation for this work came from a commercially available slotted waveguide antenna with a dielectric lens that shapes the beam and enhances the gain only in the azimuth plane. When two of these antennas, each with a dielectric lens, are stacked as an array to form the sum and difference patterns the elevation plane gain is low and the beam width too wide to be acceptable for radar applications. The objective of the present work is to design a diffractive optical element (DOE) lens for gain enhancement gain and beam shaping. As compared to other available lenses it is much thinner, lighter and easily machined. The DOE lens is made from rexolite which has a dielectric constant of 2.53. The DOE lens is composed of a series of zones which focus the light at a certain focal length. The phase is the same everywhere on each zone at the focal point. The phase difference between neighboring zones is 2pi, resulting in a constructive interference at the focus. These zones are able to focus the radiation from an antenna in order to enhance the gain and shape the beam. The design parameters include the lens diameter, number of zones, the center zone thickness for a particular frequency and refractive index of the dielectric material. A comprehensive study has been performed in CST Microwave Studio to illustrate the properties of the DOE lens. The focusing property for image formation is verified by a plane wave excitation. Lenses have been designed and tested at different frequencies and with varying design parameters. Gain enhancement and beam shaping are illustrated by modeling the DOE lens in CST and placing it in front of different antennas. This work presents lenses for 10GHz and 40GHz horn antennas, a 3GHz slotted waveguide antenna array, and a 10GHz microstrip patch arrays. Beam shaping and focusing is clearly illustrated for each type of antenna. It is seen that the size

  16. Optical and surface enhanced Raman scattering properties of Au nanoparticles embedded in and located on a carbonaceous matrix.


    Prakash, Jai; Kumar, Vinod; Kroon, R E; Asokan, K; Rigato, V; Chae, K H; Gautam, S; Swart, H C


    Au nanoparticles (NPs) on the surface and embedded in a matrix have been the subject of studies dealing with a variety of spectroscopic and sensing applications. Here, we report on low energy Ar ion induced evolution of the morphology of a thin Au film on a polyethylene terephthalate (PET) substrate along with thermodynamic interpretations, and corresponding unique surface plasmon resonance (SPR) and photoluminescence (PL) properties. These properties are linked to the variation of surface nanostructures and the surface enhanced Raman scattering (SERS) effect of methyl orange (MO) dye molecules adsorbed on the surface. Ion induced thermal spike and sputtering resulted in dewetting of the film with subsequent formation of spherical NPs. This was followed by embedding of the NPs in the modified PET due to the thermodynamic driving forces involved. The surface and interface morphologies were studied using atomic force microscopy and cross-sectional transmission electron microscopy. X-ray photoelectron spectroscopy was used to study the chemical changes in the system upon irradiation. The optical properties were studied by diffuse reflectance UV-Vis spectroscopy and PL using a 325 nm He-Cd laser. The red shift of the SPR absorption and the blue shift of the PL emission have been correlated with the surface morphology. The blue PL emission bands at around 3.0 eV are in good agreement with the literature with respect to the morphological changes and the blue shift is attributed to compressive strain on the embedded Au NPs. Enhancement of the SERS signals is observed and found to be correlated with the SPR response of the Au nanostructures. The SERS analyses indicate that MO molecules may be adsorbed with different orientations on these surfaces i.e. Au NPs located on the surface or embedded in the modified PET. These polymeric substrates modified by NPs can have a potential application in solid-state light emitting devices and can be applied in SERS based sensors for the

  17. Enhanced seamount location database for the western and central Pacific Ocean: Screening and cross-checking of 20 existing datasets

    NASA Astrophysics Data System (ADS)

    Allain, Valérie; Kerandel, Julie-Anne; Andréfouët, Serge; Magron, Franck; Clark, Malcolm; Kirby, David S.; Muller-Karger, Frank E.


    Seamounts are habitats of considerable interest in terms of conservation and biodiversity, and in terms of fisheries for bentho-pelagic and pelagic species. Twenty previously compiled datasets including seamount/underwater feature lists, bathymetric maps and emerged feature maps from different sources (ship-derived and satellite altimetry-derived) at different spatial scales (from individual cruise to worldwide satellite data) were gathered in order to compile an enhanced list of underwater features for parts of the western and central Pacific Ocean (WCPO). The KL04 dataset [Kitchingman, A., and Lai, S., 2004. Inferences on potential seamount locations from mid-resolution bathymetric data. Fisheries Centre Research Reports 12 (5), 7-12], listing seamount positions and depths as calculated from satellite altimetry-derived bathymetry, provided the baseline data for this study as it covered the entire region of interest and included summit depth information. All KL04 potential seamounts were cross-checked with other datasets to remove any atolls and islands that had been incorrectly classified as seamounts, to add seamounts undetected by KL04, to update the overall database (geolocation, depth, elevation, and name) and to compile a 12-class typology of the different types of underwater features. Of the 4626 potential seamounts identified in KL04, 719 were multiple identifications of the same large underwater features and 373 (10%) were actually emerged banks, atolls and islands, leaving 3534 actual underwater features. Conversely, 487 underwater features were documented in other datasets but not registered by KL04. The screening of all the potential WCPO seamounts produced a final list of 4021 underwater features with agreed upon position and information. This enhanced list should have many applications in oceanography, biodiversity conservation and studies of the influence of seamounts on pelagic ecosystems and fisheries.

  18. An enhanced Kurtogram method for fault diagnosis of rolling element bearings

    NASA Astrophysics Data System (ADS)

    Wang, Dong; Tse, Peter W.; Tsui, Kwok Leung


    The Kurtogram is based on the kurtosis of temporal signals that are filtered by the short-time Fourier transform (STFT), and has proved useful in the diagnosis of bearing faults. To extract transient impulsive signals more effectively, wavelet packet transform is regarded as an alternative method to STFT for signal decomposition. Although kurtosis based on temporal signals is effective under some conditions, its performance is low in the presence of a low signal-to-noise ratio and non-Gaussian noise. This paper proposes an enhanced Kurtogram, the major innovation of which is kurtosis values calculated based on the power spectrum of the envelope of the signals extracted from wavelet packet nodes at different depths. The power spectrum of the envelope of the signals defines the sparse representation of the signals and kurtosis measures the protrusion of the sparse representation. This enhanced Kurtogram helps to determine the location of resonant frequency bands for further demodulation with envelope analysis. The frequency signatures of the envelope signal can then be used to determine the type of fault that has affected a bearing by identifying its characteristic frequency. In many cases, discrete frequency noise always exists and may mask the weak bearing faults. It is usually preferable to remove such discrete frequency noise by using autoregressive filtering before the enhanced Kurtogram is performed. At last, we used a number of simulated bearing fault signals and three real bearing fault signals obtained from an experimental motor to validate the efficiency of these proposed modifications. The results show that both the proposed method and the enhanced Kurtogram are effective in the detection of various bearing faults.

  19. New water soluble phosphonate and polycarboxylate complexants for enhanced f element separations

    SciTech Connect

    Nash, K.L.; Rickert, P.G.; Lessmann, E.P.; Mendoza, M.D.; Feil, J.F.; Sullivan, J.C.


    While lipophilic extractant molecules and ion exchange polymeric materials are clearly essential to efficient separation of metal ions by solvent extraction or ion exchange, the most difficult separations often could not be accomplished without the use of water soluble complexants. This report focuses on recent developments in design, synthesis and characterization of phosphonic acid and polycarboxylic acid ligands for enhanced f element separations. Emphasis is on the basic solution chemistry and crystal structures of complexes of the f elements with selected amino-derivatives of methanediphosphonic acid and with tetrahydrofuran-2,3,4,5-tetracarboxylic acid. The former series of compounds exhibit high affinity for lanthanides and actinides in acidic solutions. The latter ligand exhibits an unusual (and very useful) ``anti-selectivity`` for uranyl ion in a solvent extraction process, which permits efficient separation of uranyl from more radioactive components of nuclear wastes. Most of the observed effects can be explained through examination of the structure of the ligand, and comparison of the spectroscopic and thermodynamic parameters for complexation of various metal ions.

  20. Contrast in air pollution components between major streets and background locations: Particulate matter mass, black carbon, elemental composition, nitrogen oxide and ultrafine particle number

    NASA Astrophysics Data System (ADS)

    Boogaard, Hanna; Kos, Gerard P. A.; Weijers, Ernie P.; Janssen, Nicole A. H.; Fischer, Paul H.; van der Zee, Saskia C.; de Hartog, Jeroen J.; Hoek, Gerard


    Policies to reduce outdoor air pollution concentrations are often assessed on the basis of the regulated pollutants. Whether these are the most appropriate components to assess the potential health benefits is questionable, as other health-relevant pollutants may be more strongly related to traffic. The aim of this study is to compare the contrast in concentration between major roads and (sub)urban background for a large range of pollutants and to analyze the magnitude of the measured difference in the street - background for major streets with different street configurations. Measurements of PM 10, PM 2.5, particle number concentrations (PNC), black carbon (BC), elemental composition of PM 10 and PM 2.5 and NO x were conducted simultaneously in eight major streets and nine (sub)urban background locations in the Netherlands. Measurements were done six times for a week during a six month period in 2008. High contrasts between busy streets and background locations in the same city were found for chromium, copper and iron (factor 2-3). These elements were especially present in the coarse fraction of PM. In addition, high contrasts were found for BC and NO x (factor 1.8), typically indicators of direct combustion emissions. The contrast for PNC was similar to BC. NO 2 contrast was lower (factor 1.5). The largest contrast was found for two street canyons and two streets with buildings at one side of the street only. The contrast between busy streets and urban background in NO 2 was less than the contrast found for BC, PNC and elements indicative of non-exhaust emissions, adding evidence that NO 2 is not representing (current) traffic well. The study supports a substantial role for non-exhaust emissions including brake- and tyre wear and road dust in addition to direct combustion emissions. Significant underestimation of disease burden may occur when relying too much on the regulated components.

  1. Principal Locations of Major-Ion, Trace-Element, Nitrate, and Escherichia coli Loading to Emigration Creek, Salt Lake County, Utah, October 2005

    USGS Publications Warehouse

    Kimball, Briant A.; Runkel, Robert L.; Walton-Day, Katherine


    Housing development and recreational activity in Emigration Canyon have increased substantially since 1980, perhaps causing an observed decrease in water quality of this northern Utah stream located near Salt Lake City. To identify reaches of the stream that contribute to water-quality degradation, a tracer-injection and synoptic-sampling study was done to quantify mass loading of major ions, trace elements, nitrate, and Escherichia coli (E. coli) to the stream. The resulting mass-loading profiles for major ions and trace elements indicate both geologic and anthropogenic inputs to the stream, principally from tributary and spring inflows to the stream at Brigham Fork, Burr Fork, Wagner Spring, Emigration Tunnel Spring, Blacksmith Hollow, and Killyon Canyon. The pattern of nitrate loading does not correspond to the major-ion and trace-element loading patterns. Nitrate levels in the stream did not exceed water-quality standards at the time of synoptic sampling. The majority of nitrate mass loading can be considered related to anthropogenic input, based on the field settings and trends in stable isotope ratios of nitrogen. The pattern of E. coli loading does not correspond to the major-ion, trace-element, or nitrate loading patterns. The majority of E. coli loading was related to anthropogenic sources based on field setting, but a considerable part of the loading also comes from possible animal sources in Killyon Canyon, in Perkins Flat, and in Rotary Park. In this late summer sampling, E. coli concentrations only exceeded water-quality standards in limited sections of the study reach. The mass-loading approach used in this study provides a means to design future studies and to evaluate the loading on a catchment scale.

  2. The enhanced locating performance of an integrated cross-correlation and genetic algorithm for radio monitoring systems.


    Chang, Yao-Tang; Wu, Chi-Lin; Cheng, Hsu-Chih


    The rapid development of wireless broadband communication technology has affected the location accuracy of worldwide radio monitoring stations that employ time-difference-of-arrival (TDOA) location technology. In this study, TDOA-based location technology was implemented in Taiwan for the first time according to International Telecommunications Union Radiocommunication (ITU-R) recommendations regarding monitoring and location applications. To improve location accuracy, various scenarios, such as a three-dimensional environment (considering an unequal locating antenna configuration), were investigated. Subsequently, the proposed integrated cross-correlation and genetic algorithm was evaluated in the metropolitan area of Tainan. The results indicated that the location accuracy at a circular error probability of 50% was less than 60 m when a multipath effect was present in the area. Moreover, compared with hyperbolic algorithms that have been applied in conventional TDOA-based location systems, the proposed algorithm yielded 17-fold and 19-fold improvements in the mean difference when the location position of the interference station was favorable and unfavorable, respectively. Hence, the various forms of radio interference, such as low transmission power, burst and weak signals, and metropolitan interference, was proved to be easily identified, located, and removed. PMID:24763254

  3. The Enhanced Locating Performance of an Integrated Cross-Correlation and Genetic Algorithm for Radio Monitoring Systems

    PubMed Central

    Chang, Yao-Tang; Wu, Chi-Lin; Cheng, Hsu-Chih


    The rapid development of wireless broadband communication technology has affected the location accuracy of worldwide radio monitoring stations that employ time-difference-of-arrival (TDOA) location technology. In this study, TDOA-based location technology was implemented in Taiwan for the first time according to International Telecommunications Union Radiocommunication (ITU-R) recommendations regarding monitoring and location applications. To improve location accuracy, various scenarios, such as a three-dimensional environment (considering an unequal locating antenna configuration), were investigated. Subsequently, the proposed integrated cross-correlation and genetic algorithm was evaluated in the metropolitan area of Tainan. The results indicated that the location accuracy at a circular error probability of 50% was less than 60 m when a multipath effect was present in the area. Moreover, compared with hyperbolic algorithms that have been applied in conventional TDOA-based location systems, the proposed algorithm yielded 17-fold and 19-fold improvements in the mean difference when the location position of the interference station was favorable and unfavorable, respectively. Hence, the various forms of radio interference, such as low transmission power, burst and weak signals, and metropolitan interference, was proved to be easily identified, located, and removed. PMID:24763254

  4. The first intron of the 4F2 heavy-chain gene contains a transcriptional enhancer element that binds multiple nuclear proteins

    SciTech Connect

    Karpinski, B.A.; Yang, L.H.; Cacheris, P.; Morle, G.D.; Leiden, J.M.


    The authors utilized the human 4F2 heavy-chain (4F2HC) gene as a model system to study the regulation of inducible gene expression during normal human T-cell activation. Previous studies have demonstrated that 4F2HC gene expression is induced during normal T-cell activation and that the activity of the gene is regulated, at least in part, by the interaction of a constitutively active 5'-flanking housekeeping promoter and a phorbol ester-responsive transcriptional attenuator element located in the exon 1-intron 1 region of the gene. They now report that 4F2HC intron 1 contains a transcriptional enhancer element which is active on a number of heterologous promoters in a variety of murine and human cells. This enhancer element has been mapped to a 187-base-pair RsaI-AluI fragment from 4F2HC intron 1. DNase I footprinting and gel mobility shift analyses demonstrated that this fragment contains two nuclear protein-binding sites (NF-4FA and NF-4FB) which flank a consensus binding site for the inducible AP-1 transcription factor. Deletion analysis showed that the NF-4FA, NF-4FB, and AP-1 sequences are each necessary for full enhancer activity. Murine 4F2HC intron 1 displayed enhancer activity similar to that of its human counterpart. Comparison of the sequences of human and murine 4F2HC intron 1s demonstrated that the NF-4FA, NF-4FB, and AP-1 sequence motifs have been highly conserved during mammalian evolution.

  5. Finite Element Method Simulations of the Near-Field Enhancement at the Vicinity of Fractal Rough Metallic Surfaces

    SciTech Connect

    Micic, Miodrag; Klymyshyn, Nicholas A.; Lu, H PETER.


    Near-field optical enhancement at metal surfaces and methods such as surface plasmon resonance (SPR), surface-enhanced Raman scattering (SERS), fluorescent quenching and enhancement, and various near-field scanning microscopies (NSOM) all depend on a metals surface properties, mainly on its morphology and SPR resonant frequency. We report on simulations of the influence of different surface morphologies on electromagnetic field enhancements at the rough surfaces of noble metals and also evaluate the optimal conditions for the generation of a surface-enhanced Raman signal of absorbed species on a metallic substrate. All simulations were performed with a classical electrodynamics approach using the full set of Maxwells equations, which were solved with the three-dimensional finite element method (FEM). Two different classes of surfaces where modeled using fractals, representing diffusion limited aggregation growth dendritic structures, such as one on the surface of electrodes, and second one representing the sponge-like structure used to model surfaces of particles with high porosity, such as metal coated catalyst supports. The simulations depict the high inhomogeneity of an enhanced electromagnetic field as both a field enhancement and field attenuation near the surface. While the diffusion limited aggregation dendritical fractals enhanced the near-field electromagnetic field, the sponge fractals significantly reduced the local electromagnetic field intensity. Moreover, the fractal orders of the fractal objects did not significantly alter the total enhancement, and the distribution of a near-field enhancement was essentially invariant to the changes in the angle of an incoming laser beam.

  6. Teacher Self-Efficacy Enhancement and School Location: Implication for Students' Achievement in Economics in Senior Secondary School in Ibadan, Oyo State, Nigeria

    ERIC Educational Resources Information Center

    Durowoju, Esther O.; Onuka, Adams O. U.


    The paper investigated the effect of teacher self-efficacy enhancement and school location on students' achievement in Economics in Senior Secondary School in Ibadan Metropolis of Oyo State, Nigeria. Three hypotheses were tested at 0.05 level of significance. Multi-stage sampling technique was adopted in the study. Four Local Government Areas (two…

  7. Glucose Enhances Basal or Melanocortin-Induced cAMP-Response Element Activity in Hypothalamic Cells.


    Breit, Andreas; Wicht, Kristina; Boekhoff, Ingrid; Glas, Evi; Lauffer, Lisa; Mückter, Harald; Gudermann, Thomas


    Melanocyte-stimulating hormone (MSH)-induced activation of the cAMP-response element (CRE) via the CRE-binding protein in hypothalamic cells promotes expression of TRH and thereby restricts food intake and increases energy expenditure. Glucose also induces central anorexigenic effects by acting on hypothalamic neurons, but the underlying mechanisms are not completely understood. It has been proposed that glucose activates the CRE-binding protein-regulated transcriptional coactivator 2 (CRTC-2) in hypothalamic neurons by inhibition of AMP-activated protein kinases (AMPKs), but whether glucose directly affects hypothalamic CRE activity has not yet been shown. Hence, we dissected effects of glucose on basal and MSH-induced CRE activation in terms of kinetics, affinity, and desensitization in murine, hypothalamic mHypoA-2/10-CRE cells that stably express a CRE-dependent reporter gene construct. Physiologically relevant increases in extracellular glucose enhanced basal or MSH-induced CRE-dependent gene transcription, whereas prolonged elevated glucose concentrations reduced the sensitivity of mHypoA-2/10-CRE cells towards glucose. Glucose also induced CRCT-2 translocation into the nucleus and the AMPK activator metformin decreased basal and glucose-induced CRE activity, suggesting a role for AMPK/CRTC-2 in glucose-induced CRE activation. Accordingly, small interfering RNA-induced down-regulation of CRTC-2 expression decreased glucose-induced CRE-dependent reporter activation. Of note, glucose also induced expression of TRH, suggesting that glucose might affect the hypothalamic-pituitary-thyroid axis via the regulation of hypothalamic CRE activity. These findings significantly advance our knowledge about the impact of glucose on hypothalamic signaling and suggest that TRH release might account for the central anorexigenic effects of glucose and could represent a new molecular link between hyperglycaemia and thyroid dysfunction. PMID:27144291

  8. A Novel Four-Node Quadrilateral Smoothing Element for Stress Enhancement and Error Estimation

    NASA Technical Reports Server (NTRS)

    Tessler, A.; Riggs, H. R.; Dambach, M.


    A four-node, quadrilateral smoothing element is developed based upon a penalized-discrete-least-squares variational formulation. The smoothing methodology recovers C1-continuous stresses, thus enabling effective a posteriori error estimation and automatic adaptive mesh refinement. The element formulation is originated with a five-node macro-element configuration consisting of four triangular anisoparametric smoothing elements in a cross-diagonal pattern. This element pattern enables a convenient closed-form solution for the degrees of freedom of the interior node, resulting from enforcing explicitly a set of natural edge-wise penalty constraints. The degree-of-freedom reduction scheme leads to a very efficient formulation of a four-node quadrilateral smoothing element without any compromise in robustness and accuracy of the smoothing analysis. The application examples include stress recovery and error estimation in adaptive mesh refinement solutions for an elasticity problem and an aerospace structural component.

  9. The influence of contact ratio and its location on the primary stability of cementless total hip arthroplasty: A finite element analysis.


    Reimeringer, M; Nuño, N


    Cementless hip stems are fixed to the surrounding bone by means of press-fit. To ensure a good press-fit, current surgical technique specifies an under-reaming of the bone cavity using successively larger broaches. Nevertheless, this surgical technique is inaccurate. Several studies show that the contact ratio (percentage of stem interface in contact with bone) achieved after surgery can vary between 20% and 95%. Therefore, this study aimed to investigate the influence of the contact ratio and its location on the primary stability of a cementless total hip arthroplasty using finite element analysis. A straight tapered femoral stem implanted in a composite bone was subjected to stair climbing. Micromotion of 7600 nodes at the stem-bone interface was computed for different configurations of contact ratios between 2% and 98%) along the hip stem. Considering the 15 configurations evaluated, the average micromotion ranges between 27μm and 54μm. The percentage of the porous interface of the stem having micromotion below 40μm that allows bone ingrowth range between 25-57%. The present numerical study shows that full contact (100%) between stem and bone is not necessary to obtain a good primary stability. The stem primary stability is influenced by both the contact ratio and its location. Several configurations with contact ratio lower than 100% and involving either the proximal or the cortical contact provide better primary stability than the full contact configuration. However, with contact ratio lower than 40%, the stem should be in contact with cortical bone to ensure a good primary stability. PMID:26920509

  10. Functional analysis of the Arabidopsis PLDZ2 promoter reveals an evolutionarily conserved low-Pi-responsive transcriptional enhancer element

    PubMed Central

    Oropeza-Aburto, Araceli; Cruz-Ramírez, Alfredo; Acevedo-Hernández, Gustavo J.; Pérez-Torres, Claudia-Anahí; Caballero-Pérez, Juan; Herrera-Estrella, Luis


    Plants have evolved a plethora of responses to cope with phosphate (Pi) deficiency, including the transcriptional activation of a large set of genes. Among Pi-responsive genes, the expression of the Arabidopsis phospholipase DZ2 (PLDZ2) is activated to participate in the degradation of phospholipids in roots in order to release Pi to support other cellular activities. A deletion analysis was performed to identify the regions determining the strength, tissue-specific expression, and Pi responsiveness of this regulatory region. This study also reports the identification and characterization of a transcriptional enhancer element that is present in the PLDZ2 promoter and able to confer Pi responsiveness to a minimal, inactive 35S promoter. This enhancer also shares the cytokinin and sucrose responsive properties observed for the intact PLDZ2 promoter. The EZ2 element contains two P1BS motifs, each of which is the DNA binding site of transcription factor PHR1. Mutation analysis showed that the P1BS motifs present in EZ2 are necessary but not sufficient for the enhancer function, revealing the importance of adjacent sequences. The structural organization of EZ2 is conserved in the orthologous genes of at least eight families of rosids, suggesting that architectural features such as the distance between the two P1BS motifs are also important for the regulatory properties of this enhancer element. PMID:22210906

  11. Transcription Enhancer Factor 1 Binds Multiple Muscle MEF2 and A/T-Rich Elements during Fast-to-Slow Skeletal Muscle Fiber Type Transitions

    PubMed Central

    Karasseva, Natalia; Tsika, Gretchen; Ji, Juan; Zhang, Aijing; Mao, Xiaoqing; Tsika, Richard


    In adult mouse skeletal muscle, β-myosin heavy chain (βMyHC) gene expression is primarily restricted to slow type I fibers; however, its expression can be induced in fast type II fibers in response to a sustained increase in load-bearing work (mechanical overload [MOV]). Our previous βMyHC transgenic and protein-DNA interaction studies have identified an A/T-rich element (βA/T-rich −269/−258) that is required for slow muscle expression and which potentiates MOV responsiveness of a 293-bp βMyHC promoter (β293wt). Despite the GATA/MEF2-like homology of this element, we found binding of two unknown proteins that were antigenically distinct from GATA and MEF2 isoforms. By using the βA/T-rich element as bait in a yeast one-hybrid screen of an MOV-plantaris cDNA library, we identified nominal transcription enhancer factor 1 (NTEF-1) as the specific βA/T-rich binding factor. Electrophoretic mobility shift assay analysis confirmed that NTEF-1 represents the enriched binding activity obtained only when the βA/T-rich element is reacted with MOV-plantaris nuclear extract. Moreover, we show that TEF proteins bind MEF2 elements located in the control region of a select set of muscle genes. In transient-coexpression assays using mouse C2C12 myotubes, TEF proteins transcriptionally activated a 293-bp βMyHC promoter devoid of any muscle CAT (MCAT) sites, as well as a minimal thymidine kinase promoter-luciferase reporter gene driven by three tandem copies of the desmin MEF2 or palindromic Mt elements or four tandem βA/T-rich elements. These novel findings suggest that in addition to exerting a regulatory effect by binding MCAT elements, TEF proteins likely contribute to regulation of skeletal, cardiac, and smooth muscle gene networks by binding select A/T-rich and MEF2 elements under basal and hypertrophic conditions. PMID:12861002

  12. Effects of size and location of regions of interest examined by use of contrast-enhanced ultrasonography on renal perfusion variables of dogs.


    Macrì, Francesco; Di Pietro, Simona; Liotta, Luigi; Piccionello, Angela Palumbo; Pugliese, Michela; De Majo, Massimo


    OBJECTIVE To determine effects of the size and location of regions of interest (ROIs) in the renal cortex of unsedated dogs on renal perfusion variables determined by use of contrast-enhanced ultrasonography (CEUS). ANIMALS 12 client-owned adult (1.5 to 2 years old) Labrador Retrievers (8 males and 4 females; mean ± SD body weight, 27 ± 1.6 kg). PROCEDURES Each dog received 2 bolus injections of sulfur hexafluoride during CEUS. Three small oval ROIs (area of each ROI, 0.11 cm(2)) located in a row with a distance of 1 mm between adjacent ROIs and 1 large oval ROI (area, 1 cm(2)) that encompassed the 3 smaller ROIs were manually drawn in the renal cortex. The ROIs were located at a depth of 1.5 to 2.0 cm in the near field of the renal cortex. Software analysis of time-intensity curves within each ROI was used to identify peak enhancement, time to peak enhancement, regional blood flow, and mean transit time. RESULTS The location and size of the ROIs of unsedated dogs did not cause significant differences in the mean values of the renal perfusion variables. CONCLUSIONS AND CLINICAL RELEVANCE The development of CEUS has provided a unique means for visually examining and quantifying tissue perfusion. Results of this study indicated that it was possible to use small or large ROIs during renal CEUS to evaluate renal perfusion in dogs. PMID:27463550

  13. A Mammalian Conserved Element Derived from SINE Displays Enhancer Properties Recapitulating Satb2 Expression in Early-Born Callosal Projection Neurons

    PubMed Central

    Nakanishi, Akiko; Sasaki, Takeshi; Yan, Kuo; Tarabykin, Victor; Vigier, Lisa; Sumiyama, Kenta; Hirakawa, Mika; Nishihara, Hidenori; Pierani, Alessandra; Okada, Norihiro


    Short interspersed repetitive elements (SINEs) are highly repeated sequences that account for a significant proportion of many eukaryotic genomes and are usually considered “junk DNA”. However, we previously discovered that many AmnSINE1 loci are evolutionarily conserved across mammalian genomes, suggesting that they may have acquired significant functions involved in controlling mammalian-specific traits. Notably, we identified the AS021 SINE locus, located 390 kbp upstream of Satb2. Using transgenic mice, we showed that this SINE displays specific enhancer activity in the developing cerebral cortex. The transcription factor Satb2 is expressed by cortical neurons extending axons through the corpus callosum and is a determinant of callosal versus subcortical projection. Mouse mutants reveal a crucial function for Sabt2 in corpus callosum formation. In this study, we compared the enhancer activity of the AS021 locus with Satb2 expression during telencephalic development in the mouse. First, we showed that the AS021 enhancer is specifically activated in early-born Satb2+ neurons. Second, we demonstrated that the activity of the AS021 enhancer recapitulates the expression of Satb2 at later embryonic and postnatal stages in deep-layer but not superficial-layer neurons, suggesting the possibility that the expression of Satb2 in these two subpopulations of cortical neurons is under genetically distinct transcriptional control. Third, we showed that the AS021 enhancer is activated in neurons projecting through the corpus callosum, as described for Satb2+ neurons. Notably, AS021 drives specific expression in axons crossing through the ventral (TAG1−/NPY+) portion of the corpus callosum, confirming that it is active in a subpopulation of callosal neurons. These data suggest that exaptation of the AS021 SINE locus might be involved in enhancement of Satb2 expression, leading to the establishment of interhemispheric communication via the corpus callosum, a eutherian

  14. Post-Training Intrahippocampal Inhibition of Class I Histone Deacetylases Enhances Long-Term Object-Location Memory

    ERIC Educational Resources Information Center

    Hawk, Joshua D.; Florian, Cedrick; Abel, Ted


    Long-term memory formation involves covalent modification of the histone proteins that package DNA. Reducing histone acetylation by mutating histone acetyltransferases impairs long-term memory, and enhancing histone acetylation by inhibiting histone deacetylases (HDACs) improves long-term memory. Previous studies using HDAC inhibitors to enhance…

  15. Evaluation of aircraft microwave data for locating zones for well stimulation and enhanced gas recovery. [Arkansas Arkoma Basin

    NASA Technical Reports Server (NTRS)

    Macdonald, H.; Waite, W.; Elachi, C.; Babcock, R.; Konig, R.; Gattis, J.; Borengasser, M.; Tolman, D.


    Imaging radar was evaluated as an adjunct to conventional petroleum exploration techniques, especially linear mapping. Linear features were mapped from several remote sensor data sources including stereo photography, enhanced LANDSAT imagery, SLAR radar imagery, enhanced SAR radar imagery, and SAR radar/LANDSAT combinations. Linear feature maps were compared with surface joint data, subsurface and geophysical data, and gas production in the Arkansas part of the Arkoma basin. The best LANDSAT enhanced product for linear detection was found to be a winter scene, band 7, uniform distribution stretch. Of the individual SAR data products, the VH (cross polarized) SAR radar mosaic provides for detection of most linears; however, none of the SAR enhancements is significantly better than the others. Radar/LANDSAT merges may provide better linear detection than a single sensor mapping mode, but because of operator variability, the results are inconclusive. Radar/LANDSAT combinations appear promising as an optimum linear mapping technique, if the advantages and disadvantages of each remote sensor are considered.

  16. A spatially weighted principal component analysis for multi-element geochemical data for mapping locations of felsic intrusions in the Gejiu mineral district of Yunnan, China

    NASA Astrophysics Data System (ADS)

    Cheng, Qiuming; Bonham-Carter, Greame; Wang, Wenlei; Zhang, Shengyuan; Li, Wenchang; Qinglin, Xia


    Principal component analysis (PCA) is frequently used in geosciences for information extraction. In many applications, masking PCA has been used to create subsets of samples or sub-areas to enhance the effect of the main objects of interest. In this paper we suggest how the representativeness of samples or pixels can be quantified using a fuzzy membership function based on fuzzy set theory. In this new method, the relative importance of pixels or samples can be taken into account using a multivariate statistical method such as PCA. A Fuzzy Masking PCA is proposed and implemented in GeoDAS GIS on the basis of a spatially weighted PCA (SWPCA). This paper introduces the mathematical treatment of the fuzzy masking PCA and follows a case study of identifying the locations of intrusive bodies from geochemical data in the Gejiu mineral district in Yunnan, China. Power-law functions based on the inverse distance from mapped felsic intrusions are applied as weighting functions in FMPCA. The results indicate that fuzzy mask PCA increases the signal-noise ratio of the component representing igneous intrusions and decreases the influence of sedimentary rocks. The areas delineated as potential areas for new intrusions (including buried intrusions) are valuable guides for Sn mineral prospecting.

  17. The upstream muscle-specific enhancer of the rat muscle creatine kinase gene is composed of multiple elements.

    PubMed Central

    Horlick, R A; Benfield, P A


    A series of constructs that links the rat muscle creatine kinase promoter to the bacterial chloramphenicol acetyltransferase gene was generated. These constructs were introduced into differentiating mouse C2C12 myogenic cells to localize sequences that are important for up-regulation of the creatine kinase gene during myogenic differentiation. A muscle-specific enhancer element responsible for induction of chloramphenicol acetyltransferase expression during myogenesis was localized to a 159-base-pair region from 1,031 to 1,190 base pairs upstream of the transcription start site. Analysis of transient expression experiments using promoters mutated by deletion indicated the presence of multiple functional domains within this muscle-specific regulatory element. A DNA fragment spanning this region was used in DNase I protection experiments. Nuclear extracts derived from C2 myotubes protected three regions (designated E1, E2, and E3) on this fragment from digestion, which indicated there may be three or more trans-acting factors that interact with the creatine kinase muscle enhancer. Gel retardation assays revealed that factors able to bind specifically to E1, E2, and E3 are present in a wide variety of tissues and cell types. Transient expression assays demonstrated that elements in regions E1 and E3, but not necessarily E2, are required for full enhancer activity. Images PMID:2761536

  18. Pauses enhance chunk recognition in song element strings by zebra finches.


    Spierings, Michelle; de Weger, Anouk; Ten Cate, Carel


    When learning a language, it is crucial to know which syllables of a continuous sound string belong together as words. Human infants achieve this by attending to pauses between words or to the co-occurrence of syllables. It is not only humans that can segment a continuous string. Songbirds learning their song tend to copy 'chunks' from one or more tutors' songs and combine these into their own song. In the tutor songs, these chunks are often separated by pauses and a high co-occurrence of elements, suggesting that these features affect chunking and song learning. We examined experimentally whether the presence of pauses and element co-occurrence affect the ability of adult zebra finches to discriminate strings of song elements. Using a go/no-go design, two groups of birds were trained to discriminate between two strings. In one group (Pause-group), pauses were inserted between co-occurring element triplets in the strings, and in the other group (No-pause group), both strings were continuous. After making a correct discrimination, an individual proceeded to a reversal training using string segments. Segments were element triplets consistent in co-occurrence, triplets that were partly consistent in composition and triplets consisting of elements that did not co-occur in the strings. The Pause-group was faster in discriminating between the two strings. This group also responded differently to consistent triplets in the reversal training, compared to inconsistent triplets. The No-pause group did not differentiate among the triplet types. These results indicate that pauses in strings of song elements aid song discrimination and memorization of co-occurring element groups. PMID:25771964

  19. Organic complexant-enhanced mobility of toxic elements in low-level wastes

    SciTech Connect

    Swanson, J.L.


    This paper describes the results obtained during the recent activities of a project whose objective is to determine how and to what extent organic complexants affect the mobility of toxic elements in subsurface groundwaters at commercial low-level waste disposal sites. Generic soil components (e.g., hydrous oxides, silica, clays) are being employed so that the results will be broadly applicable. Data have been obtained with two radionuclides (/sup 63/Ni and /sup 239/Pu) and one nonradioactive toxic element (Cd). Work with /sup 63/Ni has been emphasized; it was studied with five different generic soil components (hydrous ferric oxide, silica, titania, kaolinite, and montmorillonite) and five different complexants (EDTA, NTA, picolinate, citrate, and oxalate). EDTA was the complexant studied most extensively and hydrous ferric oxide, Fe/sub 2/O/sub 3/.xH/sub 2/O, was the most studied soil component. A wide diversity of effects of organic complexants on toxic elements sorption was observed. The effects vary not only among complexants, but also among toxic elements and among soil components. In some systems the complexant results in increased toxic element sorption (decreased mobility) while in other systems the complexant results in decreased toxic element sorption (increased mobility). 5 references, 5 figures, 2 tables.

  20. A proposed method for enhanced eigen-pair extraction using finite element methods: Theory and application

    NASA Technical Reports Server (NTRS)

    Jara-Almonte, J.; Mitchell, L. D.


    The paper covers two distinct parts: theory and application. The goal of this work was the reduction of model size with an increase in eigenvalue/vector accuracy. This method is ideal for the condensation of large truss- or beam-type structures. The theoretical approach involves the conversion of a continuum transfer matrix beam element into an 'Exact' dynamic stiffness element. This formulation is implemented in a finite element environment. This results in the need to solve a transcendental eigenvalue problem. Once the eigenvalue is determined the eigenvectors can be reconstructed with any desired spatial precision. No discretization limitations are imposed on the reconstruction. The results of such a combined finite element and transfer matrix formulation is a much smaller FEM eigenvalue problem. This formulation has the ability to extract higher eigenvalues as easily and as accurately as lower eigenvalues. Moreover, one can extract many more eigenvalues/vectors from the model than the number of degrees of freedom in the FEM formulation. Typically, the number of eigenvalues accurately extractable via the 'Exact' element method are at least 8 times the number of degrees of freedom. In contrast, the FEM usually extracts one accurate (within 5 percent) eigenvalue for each 3-4 degrees of freedom. The 'Exact' element results in a 20-30 improvement in the number of accurately extractable eigenvalues and eigenvectors.

  1. Accumulation of antimony and other potentially toxic elements in plants around a former antimony mine located in the Ribes Valley (Eastern Pyrenees)

    NASA Astrophysics Data System (ADS)

    Bech, Jaume; Corrales, Isabel; Duran, Paola; Roca, Núria; Tume, Pedro; Barceló, Juan; Poschenrieder, Charlotte


    Soil contamination by antimony is of increasing environmental concern due to the use of this amphoterous p-block element in many industrial applications such as flame retardant, electronics, alloys, rubber and textile industries. However, little is still known about the response of plants to antimony. Here we report on the accumulation of antimony and other potentially toxic elements (mainly As, Pb and Cu) in plants growing around a former antimony mine in the ribes Valley located in the Eastern Pyrenees (424078E, 4686100N alt. 1145 m.a.s.l) that was operating approximately between the years 1870 to 1960. The ore mineral veins are included in quartz gangue. The main ores were: Sulphides: Stibnite (Sb2S3), Pyrite (FeS2), Sphalerite (ZnS), Arsenopyrite (FeAs), Galenite (PbS), Chalcopyrite (CuFeS2), Tetrahydrite (Cu5Sb2S3). Sulphosals: Boulangerite (5PbS•2Sb2S3), Jamesonite (4PbS•FeS•3Sb2S3), Zinckenite (6PbS•7Sb2S3), Plagionite (5PbS•4Sb2S3), Bournonite PbCu (Sb,As)S3, Pyrargirite (Ag3SbS3). Soil and plant samples were taken at five locations with different levels of Sb, As, and polymetallic contamination. Both pseudototal (aqua regia soluble) and extractable (EDTA) concentrations of metals from sites with low (sites 1 and 2), moderate (site 3 and 4) and high (sites 5 and 6) pollutant burdens were studied. The range of agua regia and EDTA values in mgkg-1 is as follows: Sb 8-2904 and 0.88-44; As: 33-16186 and 3.2-167; Pb: 79-4794 and 49-397; Cu: 66-712 and 48-56 mg•kg-1, respectively). While sites 1 to 4 had alkaline soil pH (7.4-8.7), sites 5 and 6 were acidic with values of 6 and 4.6, respectively. Different herbaceous plant species (Poa annua, Echium vulgare, Sonchus asper, Barbera verna among others) at the low and moderately polluted sites were able to efficiently restrict Sb and As transport to shoots showing average concentration ranges between 5.5 and 23 mg/kg As and 1.21 mg/kg and 4.9 mg/kg Sb. However, at the highly polluted acidic sites (5 and

  2. Roles of fetal G gamma-globin promoter elements and the adult beta-globin 3' enhancer in the stage-specific expression of globin genes.


    Perez-Stable, C; Costantini, F


    The human fetal G gamma-globin and adult beta-globin genes are expressed in a tissue- and developmental stage-specific pattern in transgenic mice: the G gamma gene in embryonic cells and the beta gene in fetal and adult erythroid cells. Several of the cis-acting DNA sequences thought to be responsible for these patterns of expression are located 5' to the G gamma-globin gene and 3' to the beta-globin gene. To further define the locations and functional roles of these elements, we examined the effects of 5' truncations on the expression of the G gamma-globin gene, as well as the ability of G gamma-globin upstream sequences to alter the developmental regulation of a beta-globin gene, as well as the ability of G gamma-globin upstream sequences to alter the developmental regulation of a beta-globin gene. We found that sequences between -201 and -136 are essential for expression of the G gamma-globin gene, whereas those upstream of -201 have little effect on the level or tissue or stage specificity of G gamma-globin expression. The G gamma-globin upstream sequences from -201 to -136 were, furthermore, capable of activating a linked beta-globin gene in embryonic blood cells; however, a G gamma-globin fragment from -383 to -206 was similarly active in this assay, and the complete fragment from -383 to -136 was considerably more active than either of the smaller fragments, suggesting the presence of multiple cis-acting elements for embryonic blood cells. Our data also suggested the possibility of a negative regulatory element between -201 and -136. These results are discussed in relation to several DNA elements in the G gamma-globin upstream region, which have been shown to bind nuclear factors in erythroid cells. Finally, we observed that removal of the beta-globin 3'-flanking sequences, including the 3' enhancer, from the G gamma-globin upstream-beta-globin hybrid gene resulted in a 25-fold reduction in expression in embryonic blood cells. This suggests that the beta

  3. The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element

    PubMed Central

    Cichocki, Frank; Hanson, Rebecca J.; Lenvik, Todd; Pitt, Michelle; McCullar, Valarie; Li, Hongchuan; Anderson, Stephen K.


    The killer cell immunoglobulin-like receptor (KIR) repertoire of natural killer (NK) cells determines their ability to detect infected or transformed target cells. Although epigenetic mechanisms play a role in KIR gene expression, work in the mouse suggests that other regulatory elements may be involved at specific stages of NK-cell development. Here we report the effects of the transcription factor c-Myc on KIR expression. c-Myc directly binds to, and promotes transcription from, a distal element identified upstream of most KIR genes. Binding of endogenous c-Myc to the distal promoter element is significantly enhanced upon interleukin-15 (IL-15) stimulation in peripheral blood NK cells and correlates with an increase in KIR transcription. In addition, the overexpression of c-Myc during NK-cell development promotes transcription from the distal promoter element and contributes to the overall transcription of multiple KIR genes. Our data demonstrate the significance of the 5′ promoter element upstream of the conventional KIR promoter region and support a model whereby IL-15 stimulates c-Myc binding at the distal KIR promoter during NK-cell development to promote KIR transcription. This finding provides a direct link between NK-cell activation signals and KIR expression required for acquisition of effector function during NK-cell education. PMID:18987359

  4. Enhanced dispersion compensation capability of angular elements based on beam expansion.


    Du, Rui; Jiang, Runhua; Fu, Ling


    We demonstrate that beam size manipulation plays an important role in dispersion compensation. With expanded beam, the maximal negative group delay dispersion (GDD) provided by angular elements increases by an order of magnitude compared with original beam. Both calculation and experimental results show that a modest 2 x and 4 x expanded beams can improve dispersion compensation capability of prisms or acousto-optical deflectors: the restored minimal pulse width decreases by 50% and the corresponding distance between angular elements is shortened more than 70 cm. These findings will be helpful for designing dispersion compensation schemes for femtosecond pulse laser application systems such as multiphoton microscopy or laser micromachining. PMID:19770855

  5. From adjacent activation in Escherichia coli and DNA cyclization to eukaryotic enhancers: the elements of a puzzle

    PubMed Central

    Amouyal, Michèle


    Deoxyribonucleic acid cyclization, Escherichia coli lac repressor binding to two spaced lac operators and repression enhancement can be successfully used for a better understanding of the conditions required for interaction between eukaryotic enhancers and the machinery of transcription initiation. Chronologically, the DNA looping model has first accounted for the properties initially defining enhancers, i.e., independence of action with distance or orientation with respect to the start of transcription. It has also predicted enhancer activity or its disruption at short distance (site orientation, alignment between promoter and enhancer sites), with high-order complexes of protein, or with transcription factor concentrations close or different from the wild-type situation. In another step, histones have been introduced into the model to further adapt it to eukaryotes. They in fact favor DNA cyclization in vitro. The resulting DNA compaction might explain the difference counted in base pairs in the distance of action between eukaryotic transcription enhancers and prokaryotic repression enhancers. The lac looping system provides a potential tool for analysis of this discrepancy and of chromatin state directly in situ. Furthermore, as predicted by the model, the contribution of operators O2 and O3 to repression of the lac operon clearly depends on the lac repressor level in the cell and is prevented in strains overproducing lac repressor. By extension, gene regulation especially that linked to cell fate, should also depend on transcription factor levels, providing a potential tool for cellular therapy. In parallel, a new function of the O1–O3 loop completes the picture of lac repression. The O1–O3 loop would at the same time ensure high efficiency of repression, inducibility through the low-affinity sites and limitation of the level of repressor through self-repression of the lac repressor. Last, the DNA looping model can be successfully adapted to the enhancer

  6. Location, Location, Location: Where Do Location-Based Services Fit into Your Institution's Social Media Mix?

    ERIC Educational Resources Information Center

    Nekritz, Tim


    Foursquare is a location-based social networking service that allows users to share their location with friends. Some college administrators have been thinking about whether and how to take the leap into location-based services, which are also known as geosocial networking services. These platforms, which often incorporate gaming elements like…

  7. Heat Transfer Enhancement in a Solar Air Heater with Roughened Duct Having Arc-Shaped Elements as Roughness Element on the Absorber Plate

    NASA Astrophysics Data System (ADS)

    Singh, Anil Prakash; Goel, Varun; Vashishtha, Siddhartha; Kumar, Amit


    An experimental study has been carried out for the heat transfer and friction characteristics for arc shaped roughness element used in solar air heaters. Duct has an aspect ratio (W/H) of 11, relative roughness pitch (p/e) range of 4-16, relative roughness height (e/D) range of 0.027-0.045, Reynolds number ( Re) range of 2200-22,000 and arc angle (α) was kept constant at 60°. The effects of Re, relative roughness pitch (p/e) and relative roughness height (e/D) on heat transfer and friction factor have been discussed. The results obtained for Nusselt number and friction factor has been compared with smooth solar air heater to see the enhancement in heat transfer and friction factor and it is found out that considerable enhancement takes place in case of heat transfer as well as in friction factor. Correlations were also developed for Nusselt number and friction factor. Thermo-hydraulic performance parameter is also calculated for the same.

  8. Heat Transfer Enhancement in a Solar Air Heater with Roughened Duct Having Arc-Shaped Elements as Roughness Element on the Absorber Plate

    NASA Astrophysics Data System (ADS)

    Singh, Anil Prakash; Goel, Varun; Vashishtha, Siddhartha; Kumar, Amit


    An experimental study has been carried out for the heat transfer and friction characteristics for arc shaped roughness element used in solar air heaters. Duct has an aspect ratio (W/H) of 11, relative roughness pitch (p/e) range of 4-16, relative roughness height (e/D) range of 0.027-0.045, Reynolds number (Re) range of 2200-22,000 and arc angle (α) was kept constant at 60°. The effects of Re, relative roughness pitch (p/e) and relative roughness height (e/D) on heat transfer and friction factor have been discussed. The results obtained for Nusselt number and friction factor has been compared with smooth solar air heater to see the enhancement in heat transfer and friction factor and it is found out that considerable enhancement takes place in case of heat transfer as well as in friction factor. Correlations were also developed for Nusselt number and friction factor. Thermo-hydraulic performance parameter is also calculated for the same.

  9. Obchs: AN Effective Harmony Search Algorithm with Oppositionbased Chaos-Enhanced Initialization for Solving Uncapacitated Facility Location Problems

    NASA Astrophysics Data System (ADS)

    Heidari, A. A.; Kazemizade, O.; Abbaspour, R. A.


    In this paper, a continuous harmony search (HS) approach is investigated for tackling the Uncapacitated Facility Location (UFL) task. This article proposes an efficient modified HS-based optimizer to improve the performance of HS on complex spatial tasks like UFL problems. For this aim, opposition-based learning (OBL) and chaotic patterns are utilized. The proposed technique is examined against several UFL benchmark challenges in specialized literature. Then, the modified HS is substantiated in detail and compared to the basic HS and some other methods. The results showed that new opposition-based chaotic HS (OBCHS) algorithm not only can exploit better solutions competently but it is able to outperform HS in solving UFL problems.

  10. Common Elements Enhance or Retard Negative Patterning Discrimination Learning Depending on Modality of Stimuli

    ERIC Educational Resources Information Center

    Redhead, Edward S.; Curtis, Cheryl


    Human contingency learning studies were used to compare the predictions of configural and elemental theories. In two experiments, participants were required to learn which stimuli were associated with an increase in core temperature of a fictitious nuclear plant. Experiments investigated the rate at which a simple negative patterning…

  11. Surface-enhanced raman detection of 2,4-dinitrotoluene impurity vapor as a marker to locate landmines.


    Sylvia, J M; Janni, J A; Klein, J D; Spencer, K M


    Time, cost, and casualties associated with demining efforts underscore the need for improved detection techniques. Reduction in the number of false positives by directly detecting the explosive material, rather than casing material, is desirable. The desired field sensor must, at a minimum, demonstrate reproducibility, the necessary level of sensitivity, portability, instrumental stability, and fast system response times. Ideally, vibrational spectroscopic techniques have the potential to remove false positives, since every chemical has a unique bond structure. Herein, we demonstrate the capabilities of surface-enhanced Raman spectroscopy to detect the chemical vapor signature emanating from buried TNT-based landmines. We present reproducible results obtained from blind tests controlled by the Defense Advanced Research Projects Agency (DARPA) that demonstrate vapor detection of 2,4-dinitrotoluene at concentration levels of 5 ppb or less. The results presented used acquisition times of 30 s on a fieldable system and showed that SERS can be a significant improvement over current landmine detection methods. PMID:11128944

  12. Probabilistic cost-benefit analysis of enhanced safety features for strategic nuclear weapons at a representative location

    SciTech Connect

    Stephens, D.R.; Hall, C.H.; Holman, G.S.; Graham, K.F.; Harvey, T.F.; Serduke, F.J.D.


    We carried out a demonstration analysis of the value of developing and implementing enhanced safety features for nuclear weapons in the US stockpile. We modified an approach that the Nuclear Regulatory Commission (NRC) developed in response to a congressional directive that NRC assess the ``value-impact`` of regulatory actions for commercial nuclear power plants. Because improving weapon safety shares some basic objectives with NRC regulations, i.e., protecting public health and safety from the effects of accidents involving radioactive materials, we believe the NRC approach to be appropriate for evaluating weapons-safety cost-benefit issues. Impact analysis includes not only direct costs associated with retrofitting the weapon system, but also the expected costs (or economic risks) that are avoided by the action, i.e., the benefits.

  13. Enhanced detection of rolling element bearing fault based on stochastic resonance

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaofei; Hu, Niaoqing; Cheng, Zhe; Hu, Lei


    Early bearing faults can generate a series of weak impacts. All the influence factors in measurement may degrade the vibration signal. Currently, bearing fault enhanced detection method based on stochastic resonance(SR) is implemented by expensive computation and demands high sampling rate, which requires high quality software and hardware for fault diagnosis. In order to extract bearing characteristic frequencies component, SR normalized scale transform procedures are presented and a circuit module is designed based on parameter-tuning bistable SR. In the simulation test, discrete and analog sinusoidal signals under heavy noise are enhanced by SR normalized scale transform and circuit module respectively. Two bearing fault enhanced detection strategies are proposed. One is realized by pure computation with normalized scale transform for sampled vibration signal, and the other is carried out by designed SR hardware with circuit module for analog vibration signal directly. The first strategy is flexible for discrete signal processing, and the second strategy demands much lower sampling frequency and less computational cost. The application results of the two strategies on bearing inner race fault detection of a test rig show that the local signal to noise ratio of the characteristic components obtained by the proposed methods are enhanced by about 50% compared with the band pass envelope analysis for the bearing with weaker fault. In addition, helicopter transmission bearing fault detection validates the effectiveness of the enhanced detection strategy with hardware. The combination of SR normalized scale transform and circuit module can meet the need of different application fields or conditions, thus providing a practical scheme for enhanced detection of bearing fault.

  14. Characteristic element of matrix attachment region mediates vector attachment and enhances nerve growth factor expression in Chinese hamster ovary cells.


    Wang, X Y; Zhang, J H; Sun, Q L; Yao, Z Y; Deng, B G; Guo, W Y; Wang, L; Dong, W H; Wang, F; Zhao, C P; Wang, T Y


    Preliminary studies have suggested that a characteristic element of the matrix attachment region (MAR) in human interferon-β mediates the adhesion of vectors to Chinese hamster ovary (CHO) cells. In this study, we investigated if vector adhesion increased nerve growth factor (NGF) expression in CHO cells. The MAR characteristic element sequence of human interferon-β was inserted into the multiple-cloning site of the pEGFP-C1 vector. The target NGF gene was inserted upstream of the MAR characteristic element sequence to construct the MAR/NGF expression vector. The recombinant plasmid was transfected into CHO cells and stable monoclonal cells were selected using G418. NGF mRNA and protein expression was detected by reverse transcriptase-polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. Plasmid reduction experiments were used to determine the state of transfected plasmid in mammalian cells. The insertion of MAR into the vector increased NGF expression levels in CHO cells (1.93- fold) compared to the control. The recombinant plasmid expressing the MAR sequence was digested into a linear space vector. The inserted MAR and NGF sequences were consistent with those inserted into the plasmid before recombination. Therefore, we concluded that the MAR characteristic element mediates vector adhesion to CHO cells and enhances the stability and efficiency of the target gene expression. PMID:26345852

  15. Enhancing biogas production from vinasse in sugarcane biorefineries: Effects of urea and trace elements supplementation on process performance and stability.


    Janke, Leandro; Leite, Athaydes F; Batista, Karla; Silva, Witan; Nikolausz, Marcell; Nelles, Michael; Stinner, Walter


    In this study, the effects of nitrogen, phosphate and trace elements supplementation were investigated in a semi-continuously operated upflow anaerobic sludge blanket system to enhance process stability and biogas production from sugarcane vinasse. Phosphate in form of KH2PO4 induced volatile fatty acids accumulation possibly due to potassium inhibition of the methanogenesis. Although nitrogen in form of urea increased the reactor's alkalinity, the process was overloaded with an organic loading rate of 6.1gCODL(-1)d(-1) and a hydraulic retention time of 3.6days. However, by supplementing urea and trace elements a stable operation even at an organic loading rate of 9.6gCODL(-1)d(-1) and a hydraulic retention time of 2.5days was possible, resulting in 79% higher methane production rate with a stable specific methane production of 239mLgCOD(-1). PMID:26873284

  16. Unstructured finite element-based digital image correlation with enhanced management of quadrature and lens distortions

    NASA Astrophysics Data System (ADS)

    Pierré, J.-E.; Passieux, J.-C.; Périé, J.-N.; Bugarin, F.; Robert, L.


    Like subset-based methods, the very first finite element versions of digital image correlation were closely related to the regular structure of images, as they were based on regular quadrilateral elements corresponding to an integer number of pixels. The use of unstructured meshes, to exploit the full potential of FE-DIC in structural mechanics, is now widespread. Most of the time, the formulation, the quadrature and the definition of the region of interest still rely on the pixels grid. In this paper, a formulation in the physical coordinate system and not in the image frame is proposed for 2D digital image correlation. In addition to a more precise definition of the region of interest, it allows the use of a more accurate quadrature rule. It is also shown that lens distortions can be successfully taken into account directly with such a formalism.

  17. Enhancement of RIE: etched Diffractive Optical Elements surfaces by using Ion Beam Etching

    NASA Astrophysics Data System (ADS)

    Schmitt, J.; Bischoff, Ch.; Rädel, U.; Grau, M.; Wallrabe, U.; Völklein, F.


    Shaping of laser light intensities by using Diffractive Optical Elements allows the adaption of the incident light to its application. Fused silica is used where for example UV-light or high temperatures are mandatory. For high diffraction efficiency the quality of the etched surface areas is important. The investigation of different process parameters for Ion Beam and Reactive Ion Etching reveals that only Ion Beam Etching provides surfaces with optical quality. Measurements of the influence of the surface quality on the diffraction efficiencies prove that the surfaces generated by Reactive Ion Etching are not suitable. Due to the high selectivity of the process Reactive Ion Etching is nevertheless a reasonable choice for the fabrication of Diffractive Optical Elements. To improve the quality of the etched surfaces a post processing with Ion Beam Etching is developed. Simulations in MATLAB display that the angle dependent removal of the surface during the Ion Beam Etching causes a smoothing of the surface roughness. The positive influence of a post processing on the diffraction efficiency is outlined by measurements. The ion beam post processing leads to an increase of the etching depth. For the fabrication of high efficient Diffractive Optical Elements this has to be taken into account. The relation is investigated and transferred to the fabrication of four-level gratings. Diffraction efficiencies up to 78 % instead of the ideal 81 % underline the practicability of the developed post processing.

  18. Sonication enhances polyphenolic compounds, sugars, carotenoids and mineral elements of apple juice.


    Abid, Muhammad; Jabbar, Saqib; Wu, Tao; Hashim, Malik Muhammad; Hu, Bing; Lei, Shicheng; Zeng, Xiaoxiong


    A study was initiated with the objective of evaluating the effects of sonication treatment on quality characteristics of apple juice such as polyphenolic compounds (chlorogenic acid, caffeic acid, catechin, epicatechin and phloridzin), sugars (fructose, glucose and sucrose), mineral elements (Na, K, Ca, P, Mg, Cu and Zn), total carotenoids, total anthocyanins, viscosity and electrical conductivity. The fresh apple juice samples were sonicated for 0, 30 and 60 min at 20 °C (frequency 25 kHz and amplitude 70%), respectively. As results, the contents of polyphenolic compounds and sugars significantly increased (P<0.05) but the increases were more pronounced in juice samples sonicated for 30 min whereas, total carotenoids, mineral elements (Na, K and Ca) and viscosity significantly increased (P<0.05) in samples treated for 60 min sonication. Losses of some mineral elements (P, Mg and Cu) also occurred. Total anthocyanins, Zn and electrical conductivity did not undergo any change in the sonicated samples. Findings of the present study suggest that sonication technique may be applied to improve phytonutrients present naturally in apple juice. PMID:23835397

  19. Post-Zygotic and Inter-Individual Structural Genetic Variation in a Presumptive Enhancer Element of the Locus between the IL10Rβ and IFNAR1 Genes

    PubMed Central

    Prakash, Kancherla Reddy; Przerada, Szymon; Paprocka, Hanna; Zywicka, Anna; Westerman, Maxwell P.; Pedersen, Nancy L.; O'Hanlon, Terrance P.; Rider, Lisa G.; Miller, Frederick W.; Srutek, Ewa; Jankowski, Michal; Zegarski, Wojciech; Piotrowski, Arkadiusz; Absher, Devin; Dumanski, Jan P.


    Although historically considered as junk-DNA, tandemly repeated sequence motifs can affect human phenotype. For example, variable number tandem repeats (VNTR) with embedded enhancers have been shown to regulate gene transcription. The post-zygotic variation is the presence of genetically distinct populations of cells in an individual derived from a single zygote, and this is an understudied aspect of genome biology. We report somatically variable VNTR with sequence properties of an enhancer, located upstream of IFNAR1. Initially, SNP genotyping of 63 monozygotic twin pairs and multiple tissues from 21 breast cancer patients suggested a frequent post-zygotic mosaicism. The VNTR displayed a repeated 32 bp core motif in the center of the repeat, which was flanked by similar variable motifs. A total of 14 alleles were characterized based on combinations of segments, which showed post-zygotic and inter-individual variation, with up to 6 alleles in a single subject. Somatic variation occurred in ∼24% of cases. In this hypervariable region, we found a clustering of transcription factor binding sites with strongest sequence similarity to mouse Foxg1 transcription factor binding motif. This study describes a VNTR with sequence properties of an enhancer that displays post-zygotic and inter-individual genetic variation. This element is within a locus containing four related cytokine receptors: IFNAR2, IL10Rβ, IFNAR1 and IFNGR2, and we hypothesize that it might function in transcriptional regulation of several genes in this cluster. Our findings add another level of complexity to the variation among VNTR-based enhancers. Further work may unveil the normal function of this VNTR in transcriptional control and its possible involvement in diseases connected with these receptors, such as autoimmune conditions and cancer. PMID:24023707

  20. Enhancing light outcoupling of organic light-emitting devices by locating emitters around the second antinode of the reflective metal electrode

    NASA Astrophysics Data System (ADS)

    Lin, Chun-Liang; Cho, Ting-Yi; Chang, Chih-Hao; Wu, Chung-Chih


    Due to generally low conductivity and low carrier mobilities of organic materials, organic light-emitting devices (OLEDs) are typically optimized for light outcoupling by locating emitters around the first antinode of the metal electrode. In this letter, by utilizing device structures containing conductive doping, we investigate theoretically and experimentally the influences of the location of emitters relative to the metal electrode on OLED emission, and show that substantial enhancement in light outcoupling (1.2 times) or forward luminance (1.6 times) could be obtained by placing emitters around the second antinode instead of the first antinode. Depending on the detailed condition, the second-antinode device may also give more directed emission as often observed in strong-microcavity devices yet without suffering a color shift with viewing angles.

  1. A test for enhancement of cytotype regulation in Drosophila melanogaster by the transposase-encoding P element ∆2-3.


    Merriman, Peter J; Simmons, Michael J


    Transposable P elements are regulated in the germ line by piRNAs, which are small RNAs that associate with the Piwi class of proteins. This regulation, called the P cytotype, is enhanced by genetic interactions between P elements that are primary sources of these RNAs and other P elements. The enhanced regulation is thought to reflect amplification of the primary piRNAs by cleavage of mRNAs derived from the other P elements through a mechanism called the ping-pong cycle. We tested the transposase-encoding P element known as ∆2-3 for its ability to enhance cytotype regulation anchored in P elements inserted at the telomere of the left arm of the X chromosome (TP elements). The ∆2-3 P element lacks the intron between exons 2 and 3 in the structurally complete P element (CP). Unlike the CP element, it does not markedly enhance cytotype regulation anchored in TP elements, nor does it transmit transposase activity through the egg cytoplasm. However, mRNAs from both the CP and ∆2-3 elements are maternally deposited in embryos. These observations suggest that maternally transmitted CP mRNA enhances cytotype regulation by participating in the ping-pong cycle and that it encodes the P transposase in the embryonic germ line, whereas maternally transmitted ∆2-3 mRNA does not, possibly because it is not efficiently directed into the primordial embryonic germ line. Strong transposon regulation may, therefore, require ping-pong cycling with maternally inherited mRNAs in the embryo. PMID:23925475

  2. Maternal separation enhances object location memory and prevents exercise-induced MAPK/ERK signalling in adult Sprague-Dawley rats.


    Makena, Nokuthula; Bugarith, Kishor; Russell, Vivienne A


    Early life stress increases the risk of developing psychopathology accompanied by reduced cognitive function in later life. Maternal separation induces anxiety-like behaviours and is associated with impaired memory. On the other hand, exercise has been shown to diminish anxiety-like behaviours and improve cognitive function. The effects of maternal separation and exercise on anxiety, memory and hippocampal proteins were investigated in male Sprague-Dawley rats. Maternal separation produced anxiety-like behaviours which were reversed by exercise. Maternal separation also enhanced object location memory which was not affected by exercise. Exercise did, however, increase synaptophysin and phospho-extracellular signal-regulated kinase (p-ERK) in the hippocampus of non-separated rats and this effect was not observed in maternally separated rats. These findings show that maternal separation selectively enhanced n memory and prevented activation of the MAPK/ERK signalling pathway in the adult rat hippocampus. PMID:22476924

  3. Understanding the Importance of Context: A Qualitative Study of a Location-Based Exergame to Enhance School Childrens Physical Activity.


    Robertson, Judy; Jepson, Ruth; Macvean, Andrew; Gray, Stuart


    Many public health interventions are less effective than expected in 'real life settings', yet little work is undertaken to understand the reasons why. The effectiveness of complex public health interventions can often be traced back to a robust programme theory (how and why an intervention brings about a change in outcome(s)) and assumptions that are made about the context in which it is implemented. Understanding whether effectiveness (or lack thereof) is due to the intervention or the context is hugely helpful in decisions about whether to a) modify the intervention; b) modify the context; c) stop providing the intervention. Exergames-also known as Active Video Games or AVGS-are video games which use the player's bodily movements as input and have potential to increase physical activity in children. However, the results of a recent pilot randomised controlled trial (RCT) of a location-based exergame (FitQuest) in a school setting were inconclusive; no significant effect was detected for any of the outcome measures. The aim of this study was to explore whether the programme theory for FitQuest was correct with respect to how and why it would change children's perceptions of physical activity (PA) and exercise self-efficacy in the school setting. A further aim was to investigate the features of the school setting (context) that may impact on FitQuest's implementation and effectiveness. Qualitative data (gathered during the RCT) were gathered from interviews with teachers and children, and observation of sessions using FitQuest. Thematic analysis indicated that whilst children enjoyed playing the game, engaged with goal setting within the game context and undertook low to vigorous physical activity, there were significant contextual factors that prevented it from being played as often as intended. These included environmental factors (e.g. size of the playground), school factors (cancellations due to other activities), school technology policy (rules relating to

  4. Understanding the Importance of Context: A Qualitative Study of a Location-Based Exergame to Enhance School Childrens Physical Activity

    PubMed Central

    Jepson, Ruth; Macvean, Andrew; Gray, Stuart


    Many public health interventions are less effective than expected in ‘real life settings’, yet little work is undertaken to understand the reasons why. The effectiveness of complex public health interventions can often be traced back to a robust programme theory (how and why an intervention brings about a change in outcome(s)) and assumptions that are made about the context in which it is implemented. Understanding whether effectiveness (or lack thereof) is due to the intervention or the context is hugely helpful in decisions about whether to a) modify the intervention; b) modify the context; c) stop providing the intervention. Exergames–also known as Active Video Games or AVGS–are video games which use the player's bodily movements as input and have potential to increase physical activity in children. However, the results of a recent pilot randomised controlled trial (RCT) of a location-based exergame (FitQuest) in a school setting were inconclusive; no significant effect was detected for any of the outcome measures. The aim of this study was to explore whether the programme theory for FitQuest was correct with respect to how and why it would change children’s perceptions of physical activity (PA) and exercise self-efficacy in the school setting. A further aim was to investigate the features of the school setting (context) that may impact on FitQuest’s implementation and effectiveness. Qualitative data (gathered during the RCT) were gathered from interviews with teachers and children, and observation of sessions using FitQuest. Thematic analysis indicated that whilst children enjoyed playing the game, engaged with goal setting within the game context and undertook low to vigorous physical activity, there were significant contextual factors that prevented it from being played as often as intended. These included environmental factors (e.g. size of the playground), school factors (cancellations due to other activities), school technology policy (rules

  5. Application of an enhanced discrete element method to oil and gas drilling processes

    NASA Astrophysics Data System (ADS)

    Ubach, Pere Andreu; Arrufat, Ferran; Ring, Lev; Gandikota, Raju; Zárate, Francisco; Oñate, Eugenio


    The authors present results on the use of the discrete element method (DEM) for the simulation of drilling processes typical in the oil and gas exploration industry. The numerical method uses advanced DEM techniques using a local definition of the DEM parameters and combined FEM-DEM procedures. This paper presents a step-by-step procedure to build a DEM model for analysis of the soil region coupled to a FEM model for discretizing the drilling tool that reproduces the drilling mechanics of a particular drill bit. A parametric study has been performed to determine the model parameters in order to maintain accurate solutions with reduced computational cost.

  6. Enhancement of X-ray Energy Deposition via Heavy Element Sensitization in Biological Environments

    NASA Astrophysics Data System (ADS)

    Lim, Sara; Pradhan, Anil; Nahar, Sultana; Barth, Rolf


    Energy (dose) deposition by low vs. high energy x-rays (LEX & HEX), approximately E ~ 100 keV and E > 1 MeV respectively, was studied in biological matter sensitized with heavy elements (high-Z or HZ) to improve radiation therapy of cancer. Computations and simulations show that LEX interact favorably with HZ sensitizers by depositing more dose than HEX. LEX photons effectively photoionize deep inner electronic shells and release cell-killing Auger electrons near malignant cells embedded with HZ atoms. HEX photons predominantly Compton scatter with little interaction, even with HZ elements. Monte Carlo simulations show that in comparison to unsensitized tissue, LEX irradiation of HZ-sensitized models resulted in up to a factor of 2 increase in dose deposition relative to HEX. To validate the studies, in vitro experiments were performed using 2 distinct cancer cell types treated with Pt-based sensitizers, then irradiated with a LEX 160 KV x-ray source and a HEX 6 MV LINAC employed in radiation therapy. The experiments support numerical simulations, and demonstrate several factors lower survival of HZ-sensitized cells irradiated with LEX compared with HEX.

  7. RNA Folding Affects the Recruitment of SR Proteins by Mouse and Human Polypurinic Enhancer Elements in the Fibronectin EDA Exon

    PubMed Central

    Buratti, Emanuele; Muro, Andrés F.; Giombi, Maurizio; Gherbassi, Daniel; Iaconcig, Alessandra; Baralle, Francisco E.


    In humans, inclusion or exclusion of the fibronectin EDA exon is mainly regulated by a polypurinic enhancer element (exonic splicing enhancer [ESE]) and a nearby silencer element (exonic splicing silencer [ESS]). While human and mouse ESEs behave identically, mutations introduced into the homologous mouse ESS sequence result either in no change in splicing efficiency or in complete exclusion of the exon. Here, we show that this apparently contradictory behavior cannot be simply accounted for by a localized sequence variation between the two species. Rather, the nucleotide differences as a whole determine several changes in the respective RNA secondary structures. By comparing how the two different structures respond to homologous deletions in their putative ESS sequences, we show that changes in splicing behavior can be accounted for by a differential ESE display in the two RNAs. This is confirmed by RNA-protein interaction analysis of levels of SR protein binding to each exon. The immunoprecipitation patterns show the presence of complex multi-SR protein-RNA interactions that are lost with secondary-structure variations after the introduction of ESE and ESS variations. Taken together, our results demonstrate that the sequence context, in addition to the primary sequence identity, can heavily contribute to the making of functional units capable of influencing pre-mRNA splicing. PMID:14729981

  8. Fault feature extraction and enhancement of rolling element bearing in varying speed condition

    NASA Astrophysics Data System (ADS)

    Ming, A. B.; Zhang, W.; Qin, Z. Y.; Chu, F. L.


    In engineering applications, the variability of load usually varies the shaft speed, which further degrades the efficacy of the diagnostic method based on the hypothesis of constant speed analysis. Therefore, the investigation of the diagnostic method suitable for the varying speed condition is significant for the bearing fault diagnosis. In this instance, a novel fault feature extraction and enhancement procedure was proposed by the combination of the iterative envelope analysis and a low pass filtering operation in this paper. At first, based on the analytical model of the collected vibration signal, the envelope signal was theoretically calculated and the iterative envelope analysis was improved for the varying speed condition. Then, a feature enhancement procedure was performed by applying a low pass filter on the temporal envelope obtained by the iterative envelope analysis. Finally, the temporal envelope signal was transformed to the angular domain by the computed order tracking and the fault feature was extracted on the squared envelope spectrum. Simulations and experiments were used to validate the efficacy of the theoretical analysis and proposed procedure. It is shown that the computed order tracking method is recommended to be applied on the envelope of the signal in order to avoid the energy spreading and amplitude distortion. Compared with the feature enhancement method performed by the fast kurtogram and corresponding optimal band pass filtering, the proposed method can efficiently extract the fault character in the varying speed condition with less amplitude attenuation. Furthermore, do not involve the center frequency estimation, the proposed method is more concise for engineering applications.

  9. AGB nucleosynthesis at low metallicity: What can we learn from Carbon- and s-elements-enhanced metal-poor stars

    NASA Astrophysics Data System (ADS)

    Abate, C.; Pols, O. R.; Izzard, R. G.; Karakas, A. I.


    CEMP-s stars are very metal-poor stars with enhanced abundances of carbon and s-process elements. They form a significant proportion of the very metal-poor stars in the Galactic halo and are mostly observed in binary systems. This suggests that the observed chemical anomalies are due to mass accretion in the past from an asymptotic giant branch (AGB) star. Because CEMP-s stars have hardly evolved since their formation, the study of their observed abundances provides a way to probe our models of AGB nucleosynthesis at low metallicity. To this end we included in our binary evolution model the results of the latest models of AGB nucleosynthesis and we simulated a grid of 100 000 binary stars at metallicity Z = 0.0001 in a wide range of initial masses and separations. We compared our modelled stars with a sample of 60 CEMP-s stars from the SAGA database of metal-poor stars. For each observed CEMP-s star of the sample we found the modelled star that reproduces best the observed abundances. The result of this comparison is that we are able to reproduce simultaneously the observed abundance of the elements affected by AGB nucleosynthesis (e.g. C, Mg, s-elements) for about 60% of the stars in the sample.

  10. Folding of the natural hammerhead ribozyme is enhanced by interaction of auxiliary elements

    PubMed Central



    It has been shown that the activity of the hammerhead ribozyme at μM magnesium ion concentrations is markedly increased by the inclusion of loops in helices I and II. We have studied the effect of such loops on the magnesium ion-induced folding of the ribozyme, using fluorescence resonance energy transfer. We find that with the loops in place, folding into the active conformation occurs in a single step, in the μM range of magnesium ion concentration. Disruption of the loop–loop interaction leads to a reversion to two-step folding, with the second stage requiring mM concentrations of magnesium ion. Sodium ions also promote the folding of the natural form of the ribozyme at high concentrations, but the folding occurs as a two-stage process. The loops clearly act as important auxiliary elements in the function of the ribozyme, permitting folding to occur efficiently under physiological conditions. PMID:15100442

  11. The Use of Finite Element Analysis to Enhance Research and Clinical Practice in Orthopedics.


    Pfeiffer, Ferris M


    Finite element analysis (FEA) is a very powerful tool for the evaluation of biomechanics in orthopedics. Finite element (FE) simulations can effectively and efficiently evaluate thousands of variables (such as implant variation, surgical techniques, and various pathologies) to optimize design, screening, prediction, and treatment in orthopedics. Additionally, FEA can be used to retrospectively evaluate and troubleshoot complications or failures to prevent similar future occurrences. Finally, FE simulations are used to evaluate implants, procedures, and techniques in a time- and cost-effective manner. In this work, an overview of the development of FE models is provided and an example application is presented to simulate knee biomechanics for a specimen with medial meniscus insufficiency. FE models require the development of the geometry of interest, determination of the material properties of the tissues simulated, and an accurate application of a numerical solver to produce an accurate solution and representation of the field variables. The objectives of this work are to introduce the reader to the application of FEA in orthopedic analysis of the knee joint. A brief description of the model development process as well as a specific application to the investigation of knee joint stability in geometries with normal or compromised medial meniscal attachment is included. Significant increases in stretch of the anterior cruciate ligament were predicted in specimens with medial meniscus insufficiency (such behavior was confirmed in corresponding biomechanical testing). It can be concluded from this work that FE analysis of the knee can provide significant new information with which more effective clinical decisions can be made. PMID:26745731

  12. Migration of trace elements from basalt substrate to co-located vegetation (lichens and mosses) at the Wudalianchi volcanos, Northeast China

    NASA Astrophysics Data System (ADS)

    Bao, Yuan; Ju, Yiwen; Li, Boping; Sun, Yimin


    Vegetation (e.g., lichens and mosses) living on the basalt substrate have potential to accumulate trace elements in their tissues. Here, we analyze the trace elements in basalt (collected from major volcanic center to jet plate places, representing four different eruption phases) and adjacent lichens and mosses to assess their elemental source-receptor relation. The results indicate that As, Sr, Mo, Cd, and Ba are enriched in basalt, and depleted in lichens and mosses. However, Zn, Hg, and Pb are enriched in lichens and mosses and depleted in basalt. Moreover, with the increase of basalt age, Cr, Mn, Fe, Ni, and Cu are gradually enriched in lichen and moss, but gradually depleted in basalt. Compared with transition metals, large ion lithophiles, the platinum group, and rare earth elements, Cr, Co, Cu, Zn, and Os are more easily absorbed by No. 1 lichen. Specifically, S is highly assimilated in vegetation, with a highest value of 166, followed by I, C, Pb, Zn, and Hg. In addition, the hydrogen and oxygen isotopic compositions of water samples suggest that the surface water in the Wenbo area came from meteoric waters in summer with a high humidity, while the underground water in the Beiyaoquan area came from meteoric waters in winter with a low humidity.

  13. Enhanced focus steering abilities of multi-element therapeutic arrays operating in nonlinear regimes

    SciTech Connect

    Yuldashev, P. Ilyin, S.; Gavrilov, L.; Sapozhnikov, O.; Khokhlova, V.; Kreider, W.


    Steering abilities of a typical HIFU therapeutic array operated in linear and nonlinear regimes were compared using numerical simulation with the 3D Westervelt equation. The array included 256 elements of 1.2 MHz frequency and 6.6 mm diameter distributed in a quasi-random pattern over a spherical shell with a 130 mm aperture and a focal length of 120 mm. In the case of linear focusing, thermal effects are proportional to the intensity level and the criterion for safe array operation is that the intensity in the grating lobes should be less than 10% of the intensity in the main focus. In the case of nonlinear focusing, the heating effect is no longer proportional to intensity; therefore the heat deposition rate was chosen as the relevant metric, using the same 10% threshold for the secondary lobe in comparison with the focal maximum. When steering the focus, the same linearly predicted intensity level at the main focus was maintained by increasing the array power. Numerical simulations of the acoustic field were performed for nonlinear propagation both in water and in tissue. It was shown that for shock-forming conditions in the main focus, the steering range of safe electronic focusing is larger than that for linear propagation conditions. Nonlinear sonication regimes therefore can be used to enlarge tissue volumes that can be sonicated using electronic steering of the focus of HIFU arrays.

  14. Enhanced focus steering abilities of multi-element therapeutic arrays operating in nonlinear regimes

    NASA Astrophysics Data System (ADS)

    Yuldashev, P.; Ilyin, S.; Gavrilov, L.; Sapozhnikov, O.; Kreider, W.; Khokhlova, V.


    Steering abilities of a typical HIFU therapeutic array operated in linear and nonlinear regimes were compared using numerical simulation with the 3D Westervelt equation. The array included 256 elements of 1.2 MHz frequency and 6.6 mm diameter distributed in a quasi-random pattern over a spherical shell with a 130 mm aperture and a focal length of 120 mm. In the case of linear focusing, thermal effects are proportional to the intensity level and the criterion for safe array operation is that the intensity in the grating lobes should be less than 10% of the intensity in the main focus. In the case of nonlinear focusing, the heating effect is no longer proportional to intensity; therefore the heat deposition rate was chosen as the relevant metric, using the same 10% threshold for the secondary lobe in comparison with the focal maximum. When steering the focus, the same linearly predicted intensity level at the main focus was maintained by increasing the array power. Numerical simulations of the acoustic field were performed for nonlinear propagation both in water and in tissue. It was shown that for shock-forming conditions in the main focus, the steering range of safe electronic focusing is larger than that for linear propagation conditions. Nonlinear sonication regimes therefore can be used to enlarge tissue volumes that can be sonicated using electronic steering of the focus of HIFU arrays.

  15. Expression of zebrafish pax6b in pancreas is regulated by two enhancers containing highly conserved cis-elements bound by PDX1, PBX and PREP factors

    PubMed Central

    Delporte, François M; Pasque, Vincent; Devos, Nathalie; Manfroid, Isabelle; Voz, Marianne L; Motte, Patrick; Biemar, Frédéric; Martial, Joseph A; Peers, Bernard


    Background PAX6 is a transcription factor playing a crucial role in the development of the eye and in the differentiation of the pancreatic endocrine cells as well as of enteroendocrine cells. Studies on the mouse Pax6 gene have shown that sequences upstream from the P0 promoter are required for expression in the lens and the pancreas; but there remain discrepancies regarding the precise location of the pancreatic regulatory elements. Results Due to genome duplication in the evolution of ray-finned fishes, zebrafish has two pax6 genes, pax6a and pax6b. While both zebrafish pax6 genes are expressed in the developing eye and nervous system, only pax6b is expressed in the endocrine cells of the pancreas. To investigate the cause of this differential expression, we used a combination of in silico, in vivo and in vitro approaches. We show that the pax6b P0 promoter targets expression to endocrine pancreatic cells and also to enteroendocrine cells, retinal neurons and the telencephalon of transgenic zebrafish. Deletion analyses indicate that strong pancreatic expression of the pax6b gene relies on the combined action of two conserved regulatory enhancers, called regions A and C. By means of gel shift assays, we detected binding of the homeoproteins PDX1, PBX and PREP to several cis-elements of these regions. In constrast, regions A and C of the zebrafish pax6a gene are not active in the pancreas, this difference being attributable to sequence divergences within two cis-elements binding the pancreatic homeoprotein PDX1. Conclusion Our data indicate a conserved role of enhancers A and C in the pancreatic expression of pax6b and emphasize the importance of the homeoproteins PBX and PREP cooperating with PDX1, in activating pax6b expression in endocrine pancreatic cells. This study also provides a striking example of how adaptative evolution of gene regulatory sequences upon gene duplication progressively leads to subfunctionalization of the paralogous gene pair. PMID

  16. Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and enhancer, each of which contains steroid receptor response elements.

    PubMed Central

    Blanchard, K L; Acquaviva, A M; Galson, D L; Bunn, H F


    Transcription of the human erythropoietin (Epo) gene is stimulated by exposure to hypoxia and/or cobalt in whole animals and in Hep3B cells. We have systematically investigated the promoter and 3' enhancer elements necessary for this induction by transient transfection of Hep3B cells. We define a promoter region of 53 bp and an enhancer region of 43 bp that confer hypoxia and cobalt inducibility. Each element gives rise to a 6- to 10-fold induction alone. In combination they produce a 50-fold induction after stimulation, similar to the 50- to 100-fold induction of the endogenous Epo gene. Two areas of DNA sequence homology are present in these regions. We demonstrate specific DNA-protein interactions in the enhancer and the ability of the promoter element to compete with these interactions in electrophoretic mobility shift assays. DNase I footprinting and methylation interference data further refine the cis-acting element in the 43-bp enhancer to a short region containing a direct repeat of a steroid/thyroid hormone receptor response element half-site separated by a 2-bp gap. Two half-site consensus sequences are also present in the 53-bp promoter. Site-specific mutation of the half-site sequences in the enhancer destroys the functional activity of the enhancer. Images PMID:1448072

  17. Bioactive glass-derived trabecular coating: a smart solution for enhancing osteointegration of prosthetic elements.


    Vitale-Brovarone, Chiara; Baino, Francesco; Tallia, Francesca; Gervasio, Cristina; Verné, Enrica


    In this work, the use of foam-like glass-ceramic scaffolds as trabecular coatings on ceramic prosthetic devices to enhance implant osteointegration is proposed. The feasibility of this innovative device was explored in a simplified, flat geometry: glass-ceramic scaffolds, prepared by polymeric sponge replication and mimicking the trabecular architecture of cancellous bone, were joined to alumina square substrates by a dense glass coating (interlayer). The role played by different formulations of starting glasses was examined, with particular care to the effect on the mechanical properties and bioactivity of the final coating. Microindentations at the coating/substrate interface and tensile tests were performed to evaluate the bonding strength between the sample's components. In vitro bioactive behaviour was assessed by soaking in simulated body fluid and evaluating the apatite formation on the surface and inside the pores of the trabecular coating. The concepts disclosed in the present study can have a significant impact in the field of implantable devices, suggesting a valuable alternative to traditional, often invasive bone-prosthesis fixation. PMID:22532097

  18. Drosophila Immunity: Analysis of Larval Hemocytes by P-Element-Mediated Enhancer Trap

    PubMed Central

    Braun, A.; Lemaitre, B.; Lanot, R.; Zachary, D.; Meister, M.


    Our aim was to identify new genes involved in the cellular aspects of defense mechanisms of Drosophila, as well as in melanotic tumor formation processes that are linked to blood cell disregulation. We have screened 1341 enhancer detector fly lines for expression of the lacZ reporter gene in larval hemocytes at the end of the third instar. We have selected 21 lines in which we observed a reproducible lacZ expression in blood cells. These lines were classified according to the subsets of hemocytes in which lacZ was expressed, and we identified five lines that can be used as lamellocyte markers. Three lines were selected for further analysis. The first exhibited strong lacZ expression in all lamellocytes. The second expressed lacZ in plasmatocytes and lamellocytes, and exhibited a melanotic tumor phenotype in larvae homozygous for the insertion. A third line showed a striking insertion-linked phenotype of melanized lymph glands (the hematopoietic organ), which resulted in the total absence of circulating hemocytes in the mutant larvae. We anticipate that this mutation, which we named domino, will prove a useful tool in the analysis of the role of hemocytes during the various aspects of immune response and melanotic tumor formation. PMID:9335599

  19. The solar elemental abundances problem: Large enhancements in photoionization and bound-free opacity

    NASA Astrophysics Data System (ADS)

    Pradhan, A.; Nahar, S.


    Aimed at solving the outstanding problem of solar opacity and radiation transport, we report substantial photoabsorption in the high-energy regime due to atomic core photo-excitations not heretofore considered. In an extensive R-Matrix calculations of unprecedented complexity for an important iron ion Fe XVII, with a wave function expansion of 99 Fe XVIII core states from n <= 4 complexes (equivalent to 218 fine structure levels), we find: i) up to orders of magnitude enhancement in background photoionization cross sections, in addition to strongly peaked photo-excitation-of-core resonances not considered in current opacity models, and ii) demonstrate convergence with respect to successive core excitations. These findings may explain the ``higher-than-predicted'' monochromatic iron opacity measured recently at the Sandia Z-pinch fusion device at solar interior conditions. The findings will also impact the total atomic photoabsorption and radiation transport in laboratory and astrophysical plasmas, such as UV emission from host stars of extra-solar planets. Support: NSF, DOE, Ohio Supercomputer Center, Columbus, OH.

  20. Development and application of a new Silent reporter system to quantitate the activity of enhancer elements in the type II Collagen Gene.


    Ito, Kazuo; Shinomura, Tamayuki


    Type II collagen is a major component of cartilage, which provide structural stiffness to the tissue. As a sufficient amount of type II collagen is critical for maintaining the biomechanical properties of cartilage, its expression is tightly regulated in chondrocytes. Therefore, it is essential to elucidate in detail the transcriptional mechanism that controls expression of type II collagen, in particular by two enhancer elements we recently discovered. To systematically analyze and compare enhancer activities, we developed a novel reporter assay system that exploits site-specific integration of promoter and enhancer elements to activate a transcriptionally silent reporter gene. Using this system, we found that the enhancer elements have distinct characteristics, with one exhibiting additive effects and the other exhibiting synergistic effects when repeated in tandem. PMID:26992640

  1. Space bandwidth product enhancement of holographic display using high-order diffraction guided by holographic optical element.


    Li, Gang; Jeong, Jinsoo; Lee, Dukho; Yeom, Jiwoon; Jang, Changwon; Lee, Seungjae; Lee, Byoungho


    A space bandwidth product (SBP) enhancement method for holographic display using high-order diffraction of a spatial light modulator (SLM) is proposed. Among numerous high order diffraction terms, the plus-minus first and the zeroth are adopted and guided by holographic optical elements (HOEs) to an identical direction with the same intensity. By using a set of electro-shutters synchronized with corresponding order component, the system acts as if three SLMs are tiled in the horizontal direction. To confirm the feasibility of using HOE as the guiding optics for the system, several optical characteristics of the recording material are measured before using them. Furthermore, a computer generated hologram algorithm is proposed for compensating the wavefront distortion caused by use of the HOE. The demonstrated system achieves a three-fold increase in SBP of a single SLM. The results are verified experimentally. PMID:26831985

  2. Interfamilial recombination between viruses led to acquisition of a novel translation-enhancing RNA element that allows resistance breaking

    PubMed Central

    Miras, Manuel; Sempere, Raquel N.; Kraft, Jelena J.; Miller, W. Allen; Aranda, Miguel A.; Truniger, Veronica


    Summary Many plant viruses depend on functional RNA elements, called 3′-UTR cap-independent translation enhancers (3′-CITEs), for translation of their RNAs. In this manuscript we provide direct proof for the existing hypothesis that 3′-CITEs are modular and transferable by recombination in nature, and that this is associated with an advantage for the created virus. By characterizing a newly identified Melon necrotic spot virus (MNSV; Tombusviridae) isolate, which is able to overcome eukaryotic translation initiation factor 4E (eIF4E)-mediated resistance, we found that it contains a 55 nucleotide insertion in its 3′-UTR. We provide strong evidence that this insertion was acquired by interfamilial recombination with the 3′-UTR of an Asiatic Cucurbit aphid-borne yellows virus (CABYV; Luteoviridae). By constructing chimeric viruses, we showed that this recombined sequence is responsible for resistance breaking. Analysis of the translational efficiency of reporter constructs showed that this sequence functions as a novel 3′-CITE in both resistant and susceptible plants, being essential for translation control in resistant plants. In conclusion, we showed that a recombination event between two clearly identified viruses from different families led to the transfer of exactly the sequence corresponding to a functional RNA element, giving rise to a new isolate with the capacity to infect an otherwise non-susceptible host. PMID:24372390

  3. Post-buckled precompressed (PBP) elements: a new class of flight control actuators enhancing high-speed autonomous VTOL MAVs

    NASA Astrophysics Data System (ADS)

    Barrett, Ronald; McMurtry, Ross; Vos, Roelof; Tiso, Paolo; Breuker, Roeland D.


    This paper describes a new class of flight control actuators using Post-Buckled Precompressed (PBP) piezoelectric elements. These actuators are designed to produce significantly higher deflection and force levels than conventional piezoelectric actuator elements. Classical laminate plate theory (CLPT) models are shown to work very well in capturing the behavior of the free, unloaded elements. A new high transverse deflection model which employs nonlinear structural relations is shown to successfully predict the performance of the PBP actuators as they are exposed to higher and higher levels of axial force, which induces post buckling deflections. A proof-of-concept empennage assembly and actuator were fabricated using the principles of PBP actuation. A single grid-fin flight control effector was driven by a 3.5" (88.9mm) long piezoceramic bimorph PBP actuator. By using the PBP configuration, deflections were controllably magnified 4.5 times with excellent correlation between theory and experiment. Quasi-static bench testing showed deflection levels in excess of +/-6° at rates exceeding 15 Hz. The new solid state PBP actuator was shown to reduce the part count with respect to conventional servoactuators by an order of magnitude. Power consumption dropped from 24W to 100mW, weight was cut from 108g to 14g, slop went from 1.6° to 0.02° and current draw went from 5A to 1.4mA. The result was that the XQ-138 subscale UAV family experienced nearly a 4% reduction in operating empty weight via the switch from conventional to PBP actuators while in every other measure, gross performance was significantly enhanced.

  4. Detection of mercury ions using silver telluride nanoparticles as a substrate and recognition element through surface-enhanced Raman scattering

    PubMed Central

    Wang, Chia-Wei; Lin, Zong-Hong; Roy, Prathik; Chang, Huan-Tsung


    In this paper we unveil a new sensing strategy for sensitive and selective detection of Hg2+ through surface-enhanced Raman scattering (SERS) using Ag2Te nanoparticles (NPs) as a substrate and recognition element and rhodamine 6G (R6G) as a reporter. Ag2Te NPs prepared from tellurium dioxide and silver nitrate and hydrazine in aqueous solution containing sodium dodecyl sulfate at 90°C with an average size of 26.8 ± 4.1 nm (100 counts) have strong SERS activity. The Ag2Te substrate provides strong SERS signals of R6G with an enhancement factor of 3.6 × 105 at 1360 cm−1, which is comparable to Ag NPs. After interaction of Ag2Te NPs with Hg2+, some HgTe NPs are formed, leading to decreases in the SERS signal of R6G, mainly because HgTe NPs relative to Ag2Te NPs have weaker SERS activity. Under optimum conditions, this SERS approach using Ag2Te as substrates is selective for the detection of Hg2+, with a limit of detection of 3 nM and linearity over 10–150 nM. The practicality of this approach has been validated for the determination of the concentrations of spiked Hg2+ in a pond water sample. PMID:24790948

  5. Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element

    PubMed Central

    Wang, Lizheng; Wang, Zixuan; Zhang, Fangfang; Zhu, Rui; Bi, Jinpeng; Wu, Jiaxin; Zhang, Haihong; Wu, Hui; Kong, Wei; Yu, Bin; Yu, Xianghui


    Adeno-associated virus (AAV) vectors have been utilized extensively in gene therapy and gene function studies, as strong transgene expression is a prerequisite for positive outcomes. AAV8 was reported as the most efficient AAV serotype for transduction of the liver, brain and muscle compared with other serotypes. However, AAV8-mediated transduction of human hepatocytes is rather poor with approximately 20-fold lower efficiency compared with that of mouse hepatocytes. Therefore, we applied the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) to enhance AAV8-mediated transgene expression driven by a combination promoter (CAG promoter) with a CMV-IE enhancer and chicken beta-actin promoter for a more efficient viral vector. Transgene expression from recombinant AAV8 (rAAV8) vectors harboring a red fluorescent protein (RFP) reporter gene with or without WPRE were evaluated in vitro and in vivo. The results demonstrated that WPRE improved AAV8-mediated RFP expression in different cell lines with clear increases of transgene expression in the liver, brain or muscle of animals. The findings of this study will help to substantially reduce the quantity of viral particles that must be injected in order to reach a therapeutic level of transgene expression in gene therapy. Consequently, such dose reductions may lessen the potential risks associated with high doses of viral vectors. PMID:27076785

  6. Kinetics and mechanism of the enhanced reductive degradation of nitrobenzene by elemental iron in the presence of ultrasound

    SciTech Connect

    Hung, H.M.; Ling, F.H.; Hoffmann, M.R.


    Sonolysis, reduction by elemental iron (Fe{sup 0}), and a combination of the two processes were used to facilitate the degradation of nitrobenzene (NB) and aniline (AN) in water. The rates of reduction of nitrobenzene by Fe{sup 0} are enhanced in the presence of ultrasound. The first-order rate constant, K{sub US}, for nitrobenzene degradation by ultrasound is 1.8 x 10{sup {minus}3} min{sup {minus}1}, while in the presence of Fe{sup 0}, the rate was found to be substantially faster. The observation of similar degradation rates for aniline in each system suggests that the sonication process was not affected by the presence of Fe{sup 0}. The observed rate enhancements for the degradation of nitrobenzene can be attributed primarily to the continuous cleaning and chemical activation of the Fe{sup 0} surfaces by acoustic cavitation and to accelerated mass transport rates of reactants, intermediates, and products between the solution phase and the Fe{sup 0} surface. The relative concentrations of nitrosobenzene and aniline, the principal reaction intermediates generated by Fe{sup 0} reduction, are altered substantially in the presence of ultrasound.

  7. SOX2 Co-Occupies Distal Enhancer Elements with Distinct POU Factors in ESCs and NPCs to Specify Cell State

    PubMed Central

    Lodato, Michael A.; Cheng, Albert W.; Thai, Kevin K.; Fraenkel, Ernest; Jaenisch, Rudolf; Boyer, Laurie A.


    SOX2 is a master regulator of both pluripotent embryonic stem cells (ESCs) and multipotent neural progenitor cells (NPCs); however, we currently lack a detailed understanding of how SOX2 controls these distinct stem cell populations. Here we show by genome-wide analysis that, while SOX2 bound to a distinct set of gene promoters in ESCs and NPCs, the majority of regions coincided with unique distal enhancer elements, important cis-acting regulators of tissue-specific gene expression programs. Notably, SOX2 bound the same consensus DNA motif in both cell types, suggesting that additional factors contribute to target specificity. We found that, similar to its association with OCT4 (Pou5f1) in ESCs, the related POU family member BRN2 (Pou3f2) co-occupied a large set of putative distal enhancers with SOX2 in NPCs. Forced expression of BRN2 in ESCs led to functional recruitment of SOX2 to a subset of NPC-specific targets and to precocious differentiation toward a neural-like state. Further analysis of the bound sequences revealed differences in the distances of SOX and POU peaks in the two cell types and identified motifs for additional transcription factors. Together, these data suggest that SOX2 controls a larger network of genes than previously anticipated through binding of distal enhancers and that transitions in POU partner factors may control tissue-specific transcriptional programs. Our findings have important implications for understanding lineage specification and somatic cell reprogramming, where SOX2, OCT4, and BRN2 have been shown to be key factors. PMID:23437007

  8. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs.


    Glinsky, Gennadi V


    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals' genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  9. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.


    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  10. Investigation of the effects of cell model and subcellular location of gold nanoparticles on nuclear dose enhancement factors using Monte Carlo simulation

    SciTech Connect

    Cai, Zhongli; Chattopadhyay, Niladri; Kwon, Yongkyu Luke; Pignol, Jean-Philippe; Lechtman, Eli; Reilly, Raymond M.


    Purpose: The authors’ aims were to model how various factors influence radiation dose enhancement by gold nanoparticles (AuNPs) and to propose a new modeling approach to the dose enhancement factor (DEF).Methods: The authors used Monte Carlo N-particle (MCNP 5) computer code to simulate photon and electron transport in cells. The authors modeled human breast cancer cells as a single cell, a monolayer, or a cluster of cells. Different numbers of 5, 30, or 50 nm AuNPs were placed in the extracellular space, on the cell surface, in the cytoplasm, or in the nucleus. Photon sources examined in the simulation included nine monoenergetic x-rays (10–100 keV), an x-ray beam (100 kVp), and {sup 125}I and {sup 103}Pd brachytherapy seeds. Both nuclear and cellular dose enhancement factors (NDEFs, CDEFs) were calculated. The ability of these metrics to predict the experimental DEF based on the clonogenic survival of MDA-MB-361 human breast cancer cells exposed to AuNPs and x-rays were compared.Results: NDEFs show a strong dependence on photon energies with peaks at 15, 30/40, and 90 keV. Cell model and subcellular location of AuNPs influence the peak position and value of NDEF. NDEFs decrease in the order of AuNPs in the nucleus, cytoplasm, cell membrane, and extracellular space. NDEFs also decrease in the order of AuNPs in a cell cluster, monolayer, and single cell if the photon energy is larger than 20 keV. NDEFs depend linearly on the number of AuNPs per cell. Similar trends were observed for CDEFs. NDEFs using the monolayer cell model were more predictive than either single cell or cluster cell models of the DEFs experimentally derived from the clonogenic survival of cells cultured as a monolayer. The amount of AuNPs required to double the prescribed dose in terms of mg Au/g tissue decreases as the size of AuNPs increases, especially when AuNPs are in the nucleus and the cytoplasm. For 40 keV x-rays and a cluster of cells, to double the prescribed x-ray dose (NDEF = 2

  11. Structured RNA upstream of insect cap distal iron responsive elements enhances iron regulatory protein-mediated control of translation.


    Nichol, Helen; Winzerling, Joy


    Iron regulatory protein (IRP) blocks ribosomal assembly by binding to an iron responsive element (IRE) located proximal (<60 nts) to the mRNA cap, thereby repressing translation. Constructs with IREs located 60-100 nts from the cap permit ribosomal assembly but the ribosomes pause at IRE/IRP complexes resulting in partial repression of translation. However, insect ferritin mRNAs have cap-distal IREs located 90-156 nts from the cap. Because iron can be toxic, it seems unlikely that insects would be unable to fully regulate ferritin synthesis at the level of translation. Calpodes ferritin consists of two subunits, S and G. In vitro translation of Calpodes ferritin and IRP1 from fat body mRNA yields only G subunits suggesting that IRP1 more efficiently represses translation of the S subunit than the G. When repression is removed by the addition of IRE competitor RNA, the synthesis of both subunits is greatly increased. S and G ferritin mRNAs have identical IREs in similar far cap-distal positions. While both ferritin mRNAs are predicted to have stem-loops between the IRE and the RNA cap, in general insect S mRNAs have more cap-proximal RNA structure than G mRNAs. Therefore, we examined the effect of upstream secondary structure on ribosomal assembly onto S ferritin mRNA constructs using sucrose gradient analysis of translation initiation complexes. We found no evidence for ribosomal assembly on wild type Calpodes S ferritin mRNA in the presence of IRP1 while constructs lacking the wild type secondary structure showed ribosomal pausing. Constructs with wild type secondary structure preceded by an unstructured upstream leader assemble ribosomes in the presence or absence of IRP1. Sequence and RNA folding analyses of other insect ferritins with cap-distal IREs failed to identify any common sequences or IRE-like structures that might bind to IRP1 with lower affinity or to another RNA binding protein. We propose that stem-loops upstream from the IRE act like pleats that

  12. The developmental activation of the chicken lysozyme locus in transgenic mice requires the interaction of a subset of enhancer elements with the promoter.

    PubMed Central

    Huber, M C; Jägle, U; Krüger, G; Bonifer, C


    The complete chicken lysozyme locus is expressed in a position independent fashion in macrophages of transgenic mice and forms the identical chromatin structure as observed with the endogenous gene in chicken cells. Individual lysozyme cis -regulatory elements reorganize their chromatin structure at different developmental stages. Accordingly, their activities are developmentally regulated, indicating a differential role of these elements in locus activation. We have shown previously that a subset of enhancer elements and the promoter are sufficient to activate transcription of the chicken lysozyme gene at the correct developmental stage. Here, we analyzed to which grade the developmentally controlled chromatin reorganizing capacity of cis -regulatory elements in the 5'-region of the chicken lysozyme locus is dependent on promoter elements, and we examined whether the lysozyme locus carries a dominant chromatin reorganizing element. To this end we generated transgenic mouse lines carrying constructs with a deletion of the lysozyme promoter. Expression of the transgene in macrophages is abolished, however, the chromatin reorganizing ability of the cis -regulatory elements is differentially impaired. Some cis -elements require the interaction with the promoter to stabilize transcription factor complexes detectable as DNase I hypersensitive sites in chromatin, whereas other elements reorganize their chromatin structure autonomously. PMID:9224598

  13. Activation of Sterol-response Element-binding Proteins (SREBP) in Alveolar Type II Cells Enhances Lipogenesis Causing Pulmonary Lipotoxicity*

    PubMed Central

    Plantier, Laurent; Besnard, Valérie; Xu, Yan; Ikegami, Machiko; Wert, Susan E.; Hunt, Alan N.; Postle, Anthony D.; Whitsett, Jeffrey A.


    Pulmonary inflammation is associated with altered lipid synthesis and clearance related to diabetes, obesity, and various inherited metabolic disorders. In many tissues, lipogenesis is regulated at the transcriptional level by the activity of sterol-response element-binding proteins (SREBP). The role of SREBP activation in the regulation of lipid metabolism in the lung was assessed in mice in which both Insig1 and Insig2 genes, encoding proteins that bind and inhibit SREBPs in the endoplasmic reticulum, were deleted in alveolar type 2 cells. Although deletion of either Insig1 or Insig2 did not alter SREBP activity or lipid homeostasis, deletion of both genes (Insig1/2Δ/Δ mice) activated SREBP1, causing marked accumulation of lipids that consisted primarily of cholesterol esters and triglycerides in type 2 epithelial cells and alveolar macrophages. Neutral lipids accumulated in type 2 cells in association with the increase in mRNAs regulating fatty acid, cholesterol synthesis, and inflammation. Although bronchoalveolar lavage fluid phosphatidylcholine was modestly decreased, lung phospholipid content and lung function were maintained. Insig1/2Δ/Δ mice developed lung inflammation and airspace abnormalities associated with the accumulation of lipids in alveolar type 2 cells, alveolar macrophages, and within alveolar spaces. Deletion of Insig1/2 activated SREBP-enhancing lipogenesis in respiratory epithelial cells resulting in lipotoxicity-related lung inflammation and tissue remodeling. PMID:22267724

  14. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    SciTech Connect

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li . E-mail:; Li Junfa . E-mail:


    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning.

  15. Rolling element bearing defect detection using the generalized synchrosqueezing transform guided by time-frequency ridge enhancement.


    Li, Chuan; Sanchez, Vinicio; Zurita, Grover; Cerrada Lozada, Mariela; Cabrera, Diego


    Healthy rolling element bearings are vital guarantees for safe operation of the rotating machinery. Time-frequency (TF) signal analysis is an effective tool to detect bearing defects under time-varying shaft speed condition. However, it is a challenging work dealing with defective characteristic frequency and rotation frequency simultaneously without a tachometer. For this reason, a technique using the generalized synchrosqueezing transform (GST) guided by enhanced TF ridge extraction is suggested to detect the existence of the bearing defects. The low frequency band and the resonance band are first chopped from the Fourier spectrum of the bearing vibration measurements. The TF information of the lower band component and the resonance band envelope are represented using short-time Fourier transform, where the TF ridge are extracted by harmonic summation search and ridge candidate fusion operations. The inverse of the extracted TF ridge is subsequently used to guide the GST mapping the chirped TF representation to the constant one. The rectified TF pictures are then synchrosqueezed as sharper spectra where the rotation frequency and the defective characteristic frequency can be identified, respectively. Both simulated and experimental signals were used to evaluate the present technique. The results validate the effectiveness of the suggested technique for the bearing defect detection. PMID:26542359

  16. Elemental analysis by surface-enhanced Laser-Induced Breakdown Spectroscopy combined with liquid-liquid microextraction

    NASA Astrophysics Data System (ADS)

    Aguirre, M. A.; Legnaioli, S.; Almodóvar, F.; Hidalgo, M.; Palleschi, V.; Canals, A.


    In this work, the possibility of using Laser-Induced Breakdown Spectrometry (LIBS) combined with liquid-liquid microextraction techniques is evaluated as a simple and fast method for trace elemental analysis. Two different strategies for LIBS analysis of manganese contained in microdroplets of extraction solvent (Triton X-114) are studied: (i) analysis by direct laser irradiation of microdroplets; and (ii) analysis by laser irradiation of microdroplets dried on metallic substrates (surface-enhanced LIBS — SENLIBS). Experiments were carried out using synthetic samples with different concentrations of manganese in a 10% w/w Triton X-114 matrix. The analysis by direct laser irradiation of microdroplets showed low precision, sensitivity and poor linearity across the concentration range evaluated (R2 < 0.95). On the other hand, the SENLIBS method of analysis improved the sensitivity, the precision and the linearity of the calibration curve with respect to the direct analysis of microdroplets. In comparison with experimental results obtained by direct analysis, SENLIBS also allowed several replicate measurements to be carried out in a single microdroplet. The limit of detection obtained was 6 μg g- 1 of Mn.

  17. The Government Information Locator Service: Origins and Potential.

    ERIC Educational Resources Information Center

    Adams, Margaret O'Neill; Thibodeau, Sharon Gibbs


    Discusses the origins and development of the Government Information Locator Service (GILS) initiative as well as expectations for its implementation. In addition, it considers the contributions of the National Archives and Records Administration in establishing descriptive standards for GILS data elements to enhance public access. (Author/LRW)

  18. Eldercare Locator


    ... page content Skip Navigation Department of Health and Human Services Your Browser ... Welcome to the Eldercare Locator, a public service of the U.S. Administration on Aging connecting you to services for older ...

  19. A modular system of DNA enhancer elements mediates tissue-specific activation of transcription by high dietary zinc in C. elegans

    PubMed Central

    Roh, Hyun Cheol; Dimitrov, Ivan; Deshmukh, Krupa; Zhao, Guoyan; Warnhoff, Kurt; Cabrera, Daniel; Tsai, Wendy; Kornfeld, Kerry


    Zinc is essential for biological systems, and aberrant zinc metabolism is implicated in a broad range of human diseases. To maintain homeostasis in response to fluctuating levels of dietary zinc, animals regulate gene expression; however, mechanisms that mediate the transcriptional response to fluctuating levels of zinc have not been fully defined. Here, we identified DNA enhancer elements that mediate intestine-specific transcriptional activation in response to high levels of dietary zinc in C. elegans. Using bioinformatics, we characterized an evolutionarily conserved enhancer element present in multiple zinc-inducible genes, the high zinc activation (HZA) element. The HZA was consistently adjacent to a GATA element that mediates expression in intestinal cells. Functional studies using transgenic animals demonstrated that this modular system of DNA enhancers mediates tissue-specific transcriptional activation in response to high levels of dietary zinc. We used this information to search the genome and successfully identified novel zinc-inducible genes. To characterize the mechanism of enhancer function, we demonstrated that the GATA transcription factor ELT-2 and the mediator subunit MDT-15 are necessary for zinc-responsive transcriptional activation. These findings define new mechanisms of zinc homeostasis and tissue-specific regulation of transcription. PMID:25552416


    SciTech Connect

    Hansen, Terese; Andersen, Johannes; Nordstroem, Birgitta; Buchhave, Lars A.; Beers, Timothy C. E-mail: E-mail:


    A few rare halo giants in the range [Fe/H] {approx_equal} -2.9 {+-} 0.3 exhibit r-process element abundances that vary as a group by factors up to [r/Fe] {approx}80, relative to those of the iron peak and below. Yet, the astrophysical production site of these r-process elements remains unclear. We report initial results from four years of monitoring the radial velocities of 17 r-process-enhanced metal-poor giants to detect and characterize binaries in this sample. We find three (possibly four) spectroscopic binaries with orbital periods and eccentricities that are indistinguishable from those of Population I binaries with giant primaries, and which exhibit no signs that the secondary components have passed through the asymptotic giant branch stage of evolution or exploded as supernovae. The other 14 stars in our sample appear to be single-including the prototypical r-process-element-enhanced star CS 22892-052, which is also enhanced in carbon, but not in s-process elements. We conclude that the r-process (and potentially carbon) enhancement of these stars was not a local event due to mass transfer or winds from a binary companion, but was imprinted on the natal molecular clouds of these (single and binary) stars by an external source. These stars are thus spectacular chemical tracers of the inhomogeneous nature of the early Galactic halo system.

  1. Pectobacterium atrosepticum and Pectobacterium carotovorum Harbor Distinct, Independently Acquired Integrative and Conjugative Elements Encoding Coronafacic Acid that Enhance Virulence on Potato Stems.


    Panda, Preetinanda; Vanga, Bhanupratap R; Lu, Ashley; Fiers, Mark; Fineran, Peter C; Butler, Ruth; Armstrong, Karen; Ronson, Clive W; Pitman, Andrew R


    Integrative and conjugative elements (ICEs) play a central role in the evolution of bacterial virulence, their transmission between bacteria often leading to the acquisition of virulence factors that alter host range or aggressiveness. Much is known about the functions of the virulence determinants that ICEs harbor, but little is understood about the cryptic effects of ICEs on their host cell. In this study, the importance of horizontally acquired island 2 (HAI2), an ICE in the genome of Pectobacterium atrosepticum SCRI1043, was studied using a strain in which the entire ICE had been removed by CRISPR-Cas-mediated genome editing. HAI2 encodes coronafacic acid, a virulence factor that enhances blackleg disease of potato stems caused by P. atrosepticum SCRI1043. As expected, deletion of HAI2 resulted in reduced blackleg symptoms in potato stems. A subsequent screen for HAI2-related ICEs in other strains of the Pectobacterium genus revealed their ubiquitous nature in P. atrosepticum. Yet, HAI2-related ICEs were only detected in the genomes of a few P. carotovorum strains. These strains were notable as blackleg causing strains belonging to two different subspecies of P. carotovorum. Sequence analysis of the ICEs in different strains of both P. atrosepticum and P. carotovorum confirmed that they were diverse and were present in different locations on the genomes of their bacterial host, suggesting that the cfa cluster was probably acquired independently on a number of occasions via chromosomal insertion of related ICEs. Excision assays also demonstrated that the ICEs in both P. atrosepticum and P. carotovorum are mobilized from the host chromosome. Thus, the future spread of these ICEs via lateral gene transfer might contribute to an increase in the prevalence of blackleg-causing strains of P. carotovorum. PMID:27065965

  2. Pectobacterium atrosepticum and Pectobacterium carotovorum Harbor Distinct, Independently Acquired Integrative and Conjugative Elements Encoding Coronafacic Acid that Enhance Virulence on Potato Stems

    PubMed Central

    Panda, Preetinanda; Vanga, Bhanupratap R.; Lu, Ashley; Fiers, Mark; Fineran, Peter C.; Butler, Ruth; Armstrong, Karen; Ronson, Clive W.; Pitman, Andrew R.


    Integrative and conjugative elements (ICEs) play a central role in the evolution of bacterial virulence, their transmission between bacteria often leading to the acquisition of virulence factors that alter host range or aggressiveness. Much is known about the functions of the virulence determinants that ICEs harbor, but little is understood about the cryptic effects of ICEs on their host cell. In this study, the importance of horizontally acquired island 2 (HAI2), an ICE in the genome of Pectobacterium atrosepticum SCRI1043, was studied using a strain in which the entire ICE had been removed by CRISPR-Cas-mediated genome editing. HAI2 encodes coronafacic acid, a virulence factor that enhances blackleg disease of potato stems caused by P. atrosepticum SCRI1043. As expected, deletion of HAI2 resulted in reduced blackleg symptoms in potato stems. A subsequent screen for HAI2-related ICEs in other strains of the Pectobacterium genus revealed their ubiquitous nature in P. atrosepticum. Yet, HAI2-related ICEs were only detected in the genomes of a few P. carotovorum strains. These strains were notable as blackleg causing strains belonging to two different subspecies of P. carotovorum. Sequence analysis of the ICEs in different strains of both P. atrosepticum and P. carotovorum confirmed that they were diverse and were present in different locations on the genomes of their bacterial host, suggesting that the cfa cluster was probably acquired independently on a number of occasions via chromosomal insertion of related ICEs. Excision assays also demonstrated that the ICEs in both P. atrosepticum and P. carotovorum are mobilized from the host chromosome. Thus, the future spread of these ICEs via lateral gene transfer might contribute to an increase in the prevalence of blackleg-causing strains of P. carotovorum. PMID:27065965

  3. Expression of human LINE-1 elements in enhanced by isochromosome 12p; evidence from testicular germ cell tumors and the Pallister-Killian syndrome

    SciTech Connect

    Swergold, D.


    Expression of the human LINE-1 (L1Hs) transposable element is restricted to a narrow range of cell types. Specific expression of either endogenous elements or transfected recombinant elements has been reported primarily in tumors and cell lines of germ cell origin, including the NTera2D1, 2102EP, and JEG3 cell lines. These tumors and cell lines often contain one or more copies of isochromosome 12p, or translocations of 12p. Another human condition, the Pallister-Killian syndrome, is also characterized by the mosaic presence of an isochromosome 12p in patient`s cells. M28, a previously described somatic hybrid cell line, contains a human isochromosone 12p derived from fibroblasts of a patient with Pallister-Killian syndrome in a mouse LMTK-background. I asked whether the M28 cell line would exhibit enhanced expression of endogenous or transfected L1Hs elements. Expression of transfected recombinant L1Hs elements was 10-20 fold higher in M28 than in LMTK-cells. Expression of L1Hs elements was not increased in the GM10868A somatic cell hybrid line which contains a complete human chromosome 12 in a Chinese Hamster Ovary background. Somatic cell hybrid lines containing various human chromosomes in a LMTK-background also exhibited no enhanced L1Hs expression. P40, the protein encoded by the L1Hs first open reading frame, was detected in NTera2D1 but not in non-transfected M28 cells. Preliminary promoter deletion experiments indicate that similar, but non-identical regions of the L1Hs 5{prime} UTR, contribute to high level expression in the NTera2D1 and the M28 cell lines. These data suggest that the enhanced expression of human LINE-1 elements in tumors of germ cell origin is due in part to the presence of the isochromosome 12p.

  4. Differential dimerization of variants linked to enhanced S-Cone Sensitivity Syndrome (ESCS) located in the NR2E3 ligand-binding domain

    PubMed Central

    von Alpen, Désirée; Tran, H. Viet; Guex, Nicolas; Venturini, Giulia; Munier, Francis L.; Schorderet, Daniel F.; Haider, Neena B.; Escher, Pascal


    NR2E3 encodes the photoreceptor-specific nuclear hormone receptor that acts as a repressor of cone-specific gene expression in rod photoreceptors, and as an activator of several rod-specific genes. Recessive variants located in the ligand-binding domain (LBD) of NR2E3 cause enhanced short wavelength sensitive- (S-) cone syndrome (ESCS), a retinal degeneration characterized by an excess of Scones and non-functional rods. We analyzed the dimerization properties of NR2E3 and the effect of disease-causing LBD missense variants by bioluminescence resonance energy transfer (BRET2) protein interaction assays. Homodimerization was not affected in presence of p.A256V, p.R039G, p.R311Q and p.R334G variants, but abolished in presence of p.L263P, p.L336P, p.L353V, p.R385P and p.M407K variants. Homology modeling predicted structural changes induced by NR2E3 LBD variants. NR2E3 LBD variants did not affect interaction with CRX, but with NRL and rev-erbα/NR1D1. CRX and NRL heterodimerized more efficiently together, than did either with NR2E3. NR2E3 did not heterodimerize with TLX/NR2E1 and RXRα/NR2C1. The identification of a new compound heterozygous patient with detectable rod function, who expressed solely the p.A256V variant protein, suggests a correlation between LBD variants able to form functional NR2E3 dimers and atypical mild forms of ESCS with residual rod function. PMID:25703721

  5. FEM (finite element method) thermal modeling and thermal hydraulic performance of an enhanced thermal conductivity UO2/BeO composite fuel

    SciTech Connect

    Zhou, Wenzhong


    An enhanced thermal conductivity UO2-BeO composite nuclear fuel was studied. A methodology to generate ANSYS (an engineering simulation software) FEM (Finite Element Method) thermal models of enhanced thermal conductivity oxide nuclear fuels was developed. The results showed significant increase in the fuel thermal conductivities and have good agreement with the measured ones. The reactor performance analysis showed that the decrease in centerline temperature was 250-350K for the UO2-BeO composite fuel, and thus we can improve nuclear reactors' performance and safety, and high-level radioactive waste generation.

  6. Differentiation-Coupled Induction of Human Cytomegalovirus Replication by Union of the Major Enhancer Retinoic Acid, Cyclic AMP, and NF-κB Response Elements

    PubMed Central

    Yuan, Jinxiang; Li, Ming; Torres, Yasaira Rodriguez; Galle, Courtney S.


    ABSTRACT Triggers and regulatory pathways that effectively link human cytomegalovirus (HCMV) major immediate early (MIE) latent-lytic switch activation with progeny production are incompletely understood. In the quiescently infected human NTera2 cell model of primitive neural stem cells, we found that costimulation with vasoactive intestinal peptide (V) and phorbol ester (P) synergistically activated viral infection, but this effect waned over time. Coupling retinoic acid (R), an inducer of neuronal differentiation, to VP pulse stimulation attenuated the decline in viral activity and promoted the spread of the active infection through concentric layers of neighboring cells as cellular differentiation progressed. R stimulation alone was unable to activate the infection. The MIE enhancer cis-regulatory mechanisms responsible for this result were characterized by a strategy of combinatorial mutagenesis of five cis-acting element types (retinoic acid receptor binding elements [RARE], cyclic AMP [cAMP] response elements [CRE], NF-κB binding sites [kB], serum response element, and ETS/ELK-1 binding site) and multiple methods of assessment. We found that the CRE and kB combination sets the preinduction enhancer tone, is the major initiator and amplifier of RVP-induced MIE gene expression, and cooperates with RARE during cellular differentiation to enhance viral spread. In predifferentiated NTera2, we also found that the CRE-kB combination functions as initiator and amplifier of unstimulated HCMV MIE gene expression and cooperatively interacts with RARE to enhance viral spread. We conclude that RVP-stimulated signaling cascades and cellular differentiation operate through the enhancer CRE-kB-RARE core in strengthening induction of HCMV MIE gene expression in linkage with viral propagation. IMPORTANCE Cytomegalovirus-seropositive persons commonly lack detectable levels of cytomegalovirus replication, even when profoundly immunocompromised. In a human NTera2 cell model of

  7. Organic complexant-enhanced mobility of toxic elements in low-level wastes. Annual report, July 1983-June 1984

    SciTech Connect

    Swanson, J.L.


    This report describes the initial results obtained in a project whose objective is to determine how and to what extent organic complexants affect the mobility of toxic elements in subsurface groundwaters at commercial low-level waste disposal sites. Generic soil components (e.g., hydrous oxides, silica, clays) are being employed so that the results will be broadly applicable. Organic complexants used in the nuclear industry are being emphasized. Data have been obtained with two radioactive (/sup 63/Ni and /sup 239/Pu) and one nonradioactive toxic element (Cd). Work with /sup 63/Ni has been emphasized; it was studied with five different generic soil components (hydrous ferric oxide, silica, titania, kaolinite, and montmorillonite) and five different complexants (EDTA, NTA, picolinate, citrate, and oxalate). EDTA was the complexant studied most extensively and hydrous ferric oxide was the most studied soil component. A wide diversity of effects of organic complexants on toxic elements sorption was observed. The effects vary not only among complexants, but also among toxic elements and among soil components. In some systems the complexant results in increased toxic element sorption (decreased mobility) while in other systems the complexant results in decreased toxic element sorption (increased mobility). 16 references, 14 figures, 5 tables.

  8. Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development

    PubMed Central

    Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia


    Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

  9. Enhancement of the excitation efficiency of a torsional wave PPM EMAT array for pipe inspection by optimizing the element number of the array based on 3-D FEM.


    Wang, Yugang; Wu, Xinjun; Sun, Pengfei; Li, Jian


    Electromagnetic acoustic transducers (EMATs) can generate non-dispersive T(0,1) mode guided waves in a metallic pipe for nondestructive testing (NDT) by using a periodic permanent magnet (PPM) EMAT circular array. In order to enhance the excitation efficiency of the sensor, the effects of varying the number of elements of the array on the excitation efficiency is studied in this paper. The transduction process of the PPM EMAT array is studied based on 3-D finite element method (FEM). The passing signal amplitude of the torsional wave is obtained to represent the excitation efficiency of the sensor. Models with different numbers of elements are established and the results are compared to obtain an optimal element number. The simulation result is verified by experiments. It is shown that after optimization, the amplitudes of both the passing signal and defect signal with the optimal element number are increased by 29%, which verifies the feasibility of this optimal method. The essence of the optimization is to find the best match between the static magnetic field and the eddy current field in a limited circumferential space to obtain the maximum circumferential Lorentz force. PMID:25654722

  10. Enhancement of the Excitation Efficiency of a Torsional Wave PPM EMAT Array for Pipe Inspection by Optimizing the Element Number of the Array Based on 3-D FEM

    PubMed Central

    Wang, Yugang; Wu, Xinjun; Sun, Pengfei; Li, Jian


    Electromagnetic acoustic transducers (EMATs) can generate non-dispersive T(0,1) mode guided waves in a metallic pipe for nondestructive testing (NDT) by using a periodic permanent magnet (PPM) EMAT circular array. In order to enhance the excitation efficiency of the sensor, the effects of varying the number of elements of the array on the excitation efficiency is studied in this paper. The transduction process of the PPM EMAT array is studied based on 3-D finite element method (FEM). The passing signal amplitude of the torsional wave is obtained to represent the excitation efficiency of the sensor. Models with different numbers of elements are established and the results are compared to obtain an optimal element number. The simulation result is verified by experiments. It is shown that after optimization, the amplitudes of both the passing signal and defect signal with the optimal element number are increased by 29%, which verifies the feasibility of this optimal method. The essence of the optimization is to find the best match between the static magnetic field and the eddy current field in a limited circumferential space to obtain the maximum circumferential Lorentz force. PMID:25654722

  11. Evaluation of Dietary Supplement Contamination by Xenobiotic and Essential Elements Using Microwave-Enhanced Sample Digestion and Inductively Coupled Plasma-Mass Spectrometry.


    Zinn, Gregory M; Rahman, G M Mizanur; Faber, Scott; Wolle, Mesay Mulugeta; Pamuku, Matt; Kingston, H M Skip


    Dietary supplements were analyzed by evaluating the elemental content in six widely consumed products manufactured by four well-known companies. The elements included the neurotoxic and carcinogenic elements cadmium, mercury, aluminum, lead, arsenic, and antimony, as well as the essential elements zinc, selenium, chromium, iron, and copper, which were often not listed as ingredients on the product labels. Contamination from either xenobiotic or essential elements was found in all samples analyzed. The samples were prepared using US Environmental Protection Agency (EPA) Method 3052, microwave-enhanced digestion. The resulting digests were analyzed by Inductively Coupled Plasma-Mass Spectrometry based on EPA Method 6020B. The analytical protocols were validated by analyzing a multivitamin standard reference material, the National Institute of Standards and Technology Standard Reference Material 3280. The application of EPA standard methods demonstrated their utility in making accurate and precise measurements in complex matrices with multiple ingredients and excipients. In the future, the use of these methods could provide a uniform quality assurance protocol that can be implemented along with other industry guidelines to improve the production of dietary supplements. PMID:25730528

  12. Effects of a low severity prescribed fire on water-soluble elements in ash from a cork oak (Quercus suber) forest located in the northeast of the Iberian Peninsula

    USGS Publications Warehouse

    Pereira, P.; beda, X.; Martin, D.; Mataix-Solera, J.; Guerrero, C.


    Wildfire is the major disturbance in Mediterranean forests. Prescribed fire can be an alternative to reduce the amount of fuel and hence decrease the wildfire risk. However the effects of prescribed fire must be studied, especially on ash properties, because ash is an important nutrient source for ecosystem recovery. The aim of this study is to determine the effects of a low severity prescribed fire on water-soluble elements in ash including pH, electrical conductivity (EC), calcium (Ca), magnesium (Mg), sodium (Na), potassium (K), aluminum (Al), manganese (Mn), iron (Fe), zinc (Zn), silica (SiO2) and total sulphur (TS). A prescribed fire was conducted in a cork oak (Quercus suber) (Q.S) forest located in the northeast part of the Iberian Peninsula. Samples were collected from a flat plot of 40??70m mainly composed of Q.S and Quercus robur (Q.R) trees. In order to understand the effects of the prescribed fire on the soluble elements in ash, we conducted our data analysis on three data groups: all samples, only Q.S samples and only Q.R samples. All three sample groups exhibited a significant increase in pH, EC (p<0.001), water-soluble Ca, Mg, Na, SiO2 and TS and a decrease in water-soluble Mn, Fe and Zn. Differences were identified between oak species for water-soluble K, Al and Fe. In Q.S samples we registered a significant increase in the first two elements p<0.001 and p<0.01, respectively, and a non-significant impact in the third, at p<0.05. In Q.R data we identified a non-significant impact on water-soluble K and Al and a significant decrease in water-soluble Fe (p<0.05). These differences are probably due to vegetation characteristics and burn severity. The fire induced a higher variability in the ash soluble elements, especially in Q.S samples, that at some points burned with higher severity. The increase of pH, EC, Ca, Mg, Na and K will improve soil fertility, mainly in the study area where soils are acidic. The application of this low severity prescribed

  13. Effects of a low severity prescribed fire on water-soluble elements in ash from a cork oak (Quercus suber) forest located in the northeast of the Iberian Peninsula.


    Pereira, Paulo; Ubeda, Xavier; Martin, Deborah; Mataix-Solera, Jorge; Guerrero, César


    Wildfire is the major disturbance in Mediterranean forests. Prescribed fire can be an alternative to reduce the amount of fuel and hence decrease the wildfire risk. However the effects of prescribed fire must be studied, especially on ash properties, because ash is an important nutrient source for ecosystem recovery. The aim of this study is to determine the effects of a low severity prescribed fire on water-soluble elements in ash including pH, electrical conductivity (EC), calcium (Ca), magnesium (Mg), sodium (Na), potassium (K), aluminum (Al), manganese (Mn), iron (Fe), zinc (Zn), silica (SiO(2)) and total sulphur (TS). A prescribed fire was conducted in a cork oak (Quercus suber) (Q.S) forest located in the northeast part of the Iberian Peninsula. Samples were collected from a flat plot of 40×70m mainly composed of Q.S and Quercus robur (Q.R) trees. In order to understand the effects of the prescribed fire on the soluble elements in ash, we conducted our data analysis on three data groups: all samples, only Q.S samples and only Q.R samples. All three sample groups exhibited a significant increase in pH, EC (p<0.001), water-soluble Ca, Mg, Na, SiO(2) and TS and a decrease in water-soluble Mn, Fe and Zn. Differences were identified between oak species for water-soluble K, Al and Fe. In Q.S samples we registered a significant increase in the first two elements p<0.001 and p<0.01, respectively, and a non-significant impact in the third, at p<0.05. In Q.R data we identified a non-significant impact on water-soluble K and Al and a significant decrease in water-soluble Fe (p<0.05). These differences are probably due to vegetation characteristics and burn severity. The fire induced a higher variability in the ash soluble elements, especially in Q.S samples, that at some points burned with higher severity. The increase of pH, EC, Ca, Mg, Na and K will improve soil fertility, mainly in the study area where soils are acidic. The application of this low severity

  14. Purification of the pets factor. A nuclear protein that binds to the inducible TG-rich element of the human immunodeficiency virus type 2 enhancer.


    Fu, G K; Markovitz, D M


    The peri-ets (pets) site is a TG-rich element found immediately adjacent to two binding sites for the ets family member Elf-1 in the human immunodeficiency virus type 2 (HIV-2) enhancer. Enhancer activation in response to T cell stimulation by phorbol myristate acetate, phytohemagglutinin, soluble or cross-linked antibodies to the T cell receptor, or antigen is mediated through this site in conjunction with its two adjacent Elf-1 binding sites, PuB1 and PuB2, and a kappaB site. Site-specific mutation of the pets element significantly reduces inducible activation of this enhancer but does not affect its transactivation by HIV-2 tat or other viral transactivators. Similar TG-rich sequences adjacent to ets-binding sites have also been found to be functionally important in the human T-cell leukemia virus type I and murine Moloney leukemia virus enhancers. As the cellular factor binding to the pets site plays a significant role in regulating the HIV-2 enhancer in both T cells and monocytes, we have purified this protein from bovine spleens and demonstrate that it is 43 kDa in size. In addition, using glycerol gradient centrifugation, Southwestern blotting, electrophoretic mobility shift assays employing purified protein eluted from a gel, and a new in solution UV cross-linking competitive assay, we show that the dominant protein binding to the pets site is 43 kDa in size. These results indicate that a nuclear protein of 43 kDa binds specifically to the pets site of the HIV-2 enhancer and may mediate transcriptional activation of this important human pathogen in response to T cell stimulation. As retroviruses generally expropriate important human regulatory proteins for their own use, the 43-kDa pets factor is also likely to play a significant role in signal transduction in T cells and in other cellular processes. PMID:8702655

  15. Developmental activation of the lysozyme gene in chicken macrophage cells is linked to core histone acetylation at its enhancer elements.


    Myers, Fiona A; Lefevre, Pascal; Mantouvalou, Evangelia; Bruce, Kimberley; Lacroix, Claire; Bonifer, Constanze; Thorne, Alan W; Crane-Robinson, Colyn


    Native chromatin IP assays were used to define changes in core histone acetylation at the lysozyme locus during developmental maturation of chicken macrophages and stimulation to high-level expression by lipo-polysaccharide. In pluripotent precursors the lysozyme gene (Lys) is inactive and there is no acetylation of core histones at the gene, its promoter or at the upstream cis-control elements. In myeloblasts, where there is a very low level of Lys expression, H4 acetylation appears at the cis-control elements but not at the Lys gene or its promoter: neither H3 nor H2B become significantly acetylated in myeloblasts. In mature macrophages, Lys expression increases 5-fold: H4, H2B and H2A.Z are all acetylated at the cis-control elements but H3 remains unacetylated except at the -2.4 S silencer. Stimulation with LPS increases Lys expression a further 10-fold: this is accompanied by a rise in H3 acetylation throughout the cis-control elements; H4 and H2B acetylation remain substantial but acetylation at the Lys gene and its promoter remains low. Acetylation is thus concentrated at the cis-control elements, not at the Lys gene or its immediate promoter. H4 acetylation precedes H3 acetylation during development and H3 acetylation is most directly linked to high-level Lys expression. PMID:16914441

  16. Enhancer/Suppressor mutator (En/Spm)-like transposable elements of cassava (Manihot esculenta) are transcriptionally inactive.


    Gbadegesin, M A; Beeching, J R


    Transposable elements contribute to the size, structure, variation, and diversity of the genome and have major effects on gene function. Sequencing projects have revealed the diversity of transposable elements in many organisms and have shown that they constitute a high percentage of the genome. PCR-based techniques using degenerate primers designed from conserved enzyme domains of transposable elements can provide quick and extensive surveys, making study of diversity and abundance and their applications possible in species where full genome sequence data are not yet available. We studied cassava (Manihot esculenta) En/Spm-like transposons (Meens) with regard to genomic distribution, sequence diversity and methylation status. Cassava transposase fragments characteristic of En/Spm-like transposons were isolated, cloned and characterized. Sequence analysis showed that cassava En/Spm-like elements are highly conserved, with overall identity in the range of 68-98%. Southern hybridization supports the presence of multiple copies of En/Spm-like transposons integrated in the genome of all cassava cultivars that we tested. Hybridization patterns of HpaII- and MspI-digested cassava genomic DNA revealed highly methylated sequences. There were no clear differences in hybridization pattern between the cultivars. We did not detect RNA transcripts of Meens by Northern procedures. We examined the possibility of recent transposition activities of the cassava En/Spm-like elements. PMID:20449796

  17. Design and technical evaluation of an enhanced location-awareness service enabler for spatial disorientation management of elderly with mild cognitive impairment.


    Moreno, Pedro A; Hernando, M Elena; Gómez, Enrique J


    The progressive ageing of population has turned the mild cognitive impairment (MCI) into a prevalent disease suffered by elderly. Consequently, the spatial disorientation has become a significant problem for older people and their caregivers. The ambient-assisted living applications are offering location-based services for empowering elderly to go outside and encouraging a greater independence. Therefore, this paper describes the design and technical evaluation of a location-awareness service enabler aimed at supporting and managing probable wandering situations of a person with MCI. Through the presence capabilities of the IP multimedia subsystem (IMS) architecture, the service will alert patient's contacts if a hazardous situation is detected depending on his location. Furthermore, information about the older person's security areas has been included in the user profile managed by IMS. In doing so, the service enabler introduced contribute to "context-awareness" paradigm allowing the adaptation and personalization of services depending on user's context and specific conditions or preferences. PMID:25486651


    SciTech Connect

    Aoki, Wako; Beers, Timothy C.; Honda, Satoshi; Carollo, Daniela E-mail: beers@pa.msu.ed E-mail:


    We report the discovery of a cool metal-poor, main-sequence star exhibiting large excesses of r-process elements. This star is one of the two newly discovered cool subdwarfs (effective temperatures of 5000 K) with extremely low metallicity ([Fe/H] < -3) identified from follow-up high-resolution spectroscopy of metal-poor candidates from the Sloan Digital Sky Survey. SDSS J2357-0052 has [Fe/H] = -3.4 and [Eu/Fe] = +1.9, and exhibits a scaled solar r-process abundance pattern of heavy neutron-capture elements. This is the first example of an extremely metal-poor, main-sequence star showing large excesses of r-process elements; all previous examples of the large r-process-enhancement phenomena have been associated with metal-poor giants. The metallicity of this object is the lowest, and the excess of Eu ([Eu/Fe]) is the highest, among the r-process-enhanced stars found so far. We consider possible scenarios to account for the detection of such a star and discuss techniques to enable searches for similar stars in the future.

  19. Organic acid enhanced soil risk element (Cd, Pb and Zn) leaching and secondary bioconcentration in water lettuce (Pistia stratiotes L.) in the rhizofiltration process.


    Veseý, Tomás; Tlustos, Pavel; Száková, Jirina


    The use of natural chelates to enhance risk element mobility combined with rhizofiltration by free floating macrophytes have not been thoroughly studied in recent years. The aim of this study was to investigate the efficiency of organic acids in soil by conducting flushing experiments to enhance the mobility of Cd, Pb, and Zn from soil to solution. In addition, the bioaccumulation of Cd, Pb, and Zn, in water lettuce (Pistia stratiotes L.) will be studied as they affect the biomass in the rhizofiltration process. The results revealed that citric and tartaric acids mobilised the highest amount of all risk elements. In comparison to control, citric acid mobilised 71%, 181%, and 112% of Cd, Pb, and Zn while tartaric acid mobilised 70%, 155%, and 135% of Cd, Pb, and Zn respectively. The bioconcentration factor was approximately 2-5 times higher for juvenile plants than mature plants for all treatments as well as for both parts (leaves and roots). The risk element translocation into aerial parts decreased with increased time. Juvenile and mature plants proved a high accumulation potential and a 3 week growth period was observed as a sufficient time period to remove more than 80% of Cd, Pb, and Zn. PMID:22567715

  20. Sensor systems for precise location of depleted uranium in soil and for enhancing the recovery of both zero valence and uranium oxides

    SciTech Connect

    Etheridge, J.A.; Monts, D.L.; Su, Y.; Waggoner, C.A.


    Depleted uranium (DU) has been the primary material used for the past two decades by the US military in armor piercing rounds. Domestic firing ranges that have been used for DU training purposes are located around the country and vary with regard to soil type, depth of vadose zone, and extent of contamination with other types of projectiles. A project is underway to develop a set of sensor systems to locate expended DU rounds and to process soil and debris to recover the material. Reactivity of zero valence DU material, even in dry sandy soils, results in rapid oxidation and diffusion of uranium minerals within the soil column. Detection techniques must be robust for both metallic and uranyl species. Radiological sensor techniques including both gamma spectroscopy and prompt gamma neutron analysis are being used in conjunction with electromagnetic imaging to locate the DU for excavation. Detection limits for both zero valence DU (ZVDU) and oxidized material will be discussed. Applicability of active and passive optical methods, such as spectral imaging and fluorescence spectroscopy, will be discussed as aids for achieving clean soil margins while excavating DU materials. Instrumentation selection for controlling processing equipment used to separate ZVDU and uranyl species from contaminated soil and debris will also be discussed. Preliminary findings for use of sodium iodide detectors and multichannel analyzer software are discussed for locating 25 and 105 mm DU penetrators. Optimum detector height of 15 cm (six inches) and detection depths up to 15 cm are discussed. A comparison of detector response of the Geonics EM61 MKII electromagnetic induction unit for DU and ferrous materials is reported. Difficulty of locating small DU penetrators using the one meter detection coil and differences in detector response for target orientation relative to the detection coil are reported. (authors)

  1. A new global approach using a network of piezoelectric elements and energy redistribution for enhanced vibration damping of smart structure

    NASA Astrophysics Data System (ADS)

    Wu, Dan; Guyomar, Daniel; Richard, Claude


    A new global approach for improved vibration damping of smart structure, based on global energy redistribution by means of a network of piezoelectric elements is proposed. It is basically using semi-active Synchronized Switch Damping technique. SSD technique relies on a cumulative build-up of the voltage resulting from the continuous switching and it was shown that the performance is strongly related to this voltage. The increase of the piezoelectric voltage results in improvement of the damping performance. External voltage sources or improved switching sequences were previously designed to increase this voltage in the case of single piezoelectric element structure configurations. This paper deals with extended structure with many embedded piezoelectric elements. The proposed strategy consist of using an electric network made with non-linear component and switches in order to set up and control a low-loss energy transfer from source piezoelements extracting the vibration energy of the structure and oriented toward a given piezoelement in order to increase its operative energy for improving a given mode damping. This paper presents simulation of a clamped plate with four piezoelectric elements implemented in the Matlab/SimulinkTM environment and SimscapeTM library. The various simulation cases show the relationship between the damping performance on a given targeted mode and the established power flow. SSDD and SSDT are two proposed original networks. Performances are compared to the SSDI baseline. A damping increase of 18dB can be obtained even with a weakly coupled piezoelectric element in the multi-sine excitation case. This result proves the importance of new global non-linear multi-actuator strategies for improved vibration damping of extended smart structure.

  2. FORTRAN codes to implement enhanced local wave number technique to determine the depth and location and shape of the causative source using magnetic anomaly

    NASA Astrophysics Data System (ADS)

    Agarwal, B. N. P.; Srivastava, Shalivahan


    The total field magnetic anomaly is analyzed to compute the depth and location and geometry of the causative source using two FORTRAN source codes, viz., FRCON1D and ELW. No assumption on the nature of source geometry, susceptibility contrast, etc. has been made. The source geometry is estimated by computing the structural index from previously determined depth and location. A detailed procedure is outlined for using these codes through a theoretical anomaly. The suppression of high-frequency noise in the observed data is tackled by designing a box-car window with cosine termination. The termination criterion is based on the peak position of the derivative operator computed for a pre-assumed depth of a shallow source below which the target is situated. The applicability of these codes has been demonstrated by analyzing a total field aeromagnetic anomaly of the Matheson area of northern Ontario, Canada.

  3. Gata4 expression in lateral mesoderm is downstream of BMP4 and isactivated directly by Forkhead and GATA transcription factors through adistal enhancer element

    SciTech Connect

    Rojas, Anabel; De Val, Sarah; Heidt, Analeah B.; Xu, Shan-Mei; Bristow, James; Black, Brian L.


    The GATA family of zinc-finger transcription factors plays key roles in the specification and differentiation of multiple cell types during development. GATA4 is an early regulator of gene expression during the development of endoderm and mesoderm, and genetic studies in mice have demonstrated that GATA4 is required for embryonic development.Despite the importance of GATA4 in tissue specification and differentiation, the mechanisms by which Gata4 expression is activated and the transcription factor pathways upstream of GATA4 remain largely undefined. To identify transcriptional regulators of Gata4 in the mouse,we screened conserved noncoding sequences from the mouse Gata4 gene for enhancer activity in transgenic embryos. Here, we define the regulation of a distal enhancer element from Gata4 that is sufficient to direct expression throughout the lateral mesoderm, beginning at 7.5 days of mouse embryonic development. The activity of this enhancer is initially broad but eventually becomes restricted to the mesenchyme surrounding the liver. We demonstrate that the function of this enhancer in transgenic embryos is dependent upon highly conserved Forkhead and GATA transcription factor binding sites, which are bound by FOXF1 and GATA4,respectively. Furthermore, the activity of the Gata4 lateral mesoderm enhancer is attenuated by the BMP antagonist Noggin, and the enhancer is not activated in Bmp4-null embryos. Thus, these studies establish that Gata4 is a direct transcriptional target of Forkhead and GATA transcription factors in the lateral mesoderm, and demonstrate that Gata4lateral mesoderm enhancer activation requires BMP4, supporting a model in which GATA4 serves as a downstream effector of BMP signaling in the lateral mesoderm.

  4. P Element Regulatory Products Enhance Zeste(1) Repression of a P[white(duplicated)] Transgene in Drosophila Melanogaster

    PubMed Central

    Coen, D.


    Drosophila P element mobilization is subject to a complex array of regulatory mechanisms. A fruitful approach to study them is the use of insertion mutations whose expression is influenced by P regulation. In the present report, it is shown that P element somatic products may influence the expression of an unrelated gene inserted in a P transposon. The P[w(d1)9.3]19DE transgene carries an in vitro modified white gene harboring a duplication of the 5' regulatory sequences. Expression of this transgene is repressed in a P background. No maternal effect is detected and repression can be relieved as soon as P chromosomes are replaced by M ones. The amplitude of repression is correlated to the P transposase activity of the individuals examined. Repression appears to be exerted by somatic products of complete autonomous P elements or of in vitro modified P elements lacking the capacity to express the fourth P exon. The P repression of P[w(d1)9.3]19DE is strongly dependent on the insertion site of this transgene. This P repression effect occurs only in the presence of the zeste(1) allele and is suppressed by Su(z)2 mutations. No qualitative differences of transcription pattern are observed between white(+) and P[w(d1)9.3]19DE in any backgrounds. P repression acts to reduce the amount of the major white transcript. This suggests that P regulatory products may act through cis-interactions at a distance of over 3 kb. PMID:1963871

  5. Identification of QTLs that enhance the nutritional value of rice grain and limit accumulation of undesirable elements such as arsenic

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Research into the mineral contents of cereal grains and vegetables is motivated by interest in improving their nutritional value. Biofortification refers to natural enhancement of grain/food products through traditional breeding. Since this approach does not require genetic engineering, it is acce...

  6. Plasmon Mapping in Metallic Nanostructures and its Application to Single Molecule Surface Enhanced Raman Scattering: Imaging Electromagnetic Hot-Spots and Analyte Location

    SciTech Connect

    Camden, Jon P


    A major component of this proposal is to elucidate the connection between optical and electron excitation of plasmon modes in metallic nanostructures. These accomplishments are reported: developed a routine protocol for obtaining spatially resolved, low energy EELS spectra, and resonance Rayleigh scattering spectra from the same nanostructures.; correlated optical scattering spectra and plasmon maps obtained using STEM/EELS.; and imaged electromagnetic hot spots responsible for single-molecule surface-enhanced Raman scattering (SMSERS).

  7. Simulation of the enhancement factor from an individual 3D hemisphere-on-post field emitter by using finite elements method.


    Roveri, D S; Sant'Anna, G M; Bertan, H H; Mologni, J F; Alves, M A R; Braga, E S


    This paper presents a 3D computational framework for evaluating electrostatic properties of a single field emitter characterized by the hemisphere-on-post geometry. Numerical simulations employed the finite elements method by using Ansys-Maxwell software. Extensive parametric simulations were focused on the threshold distance from which the emitter field enhancement factor (γ) becomes independent from the anode-substrate gap (G). This investigation allowed demonstrating that the ratio between G and the emitter height (h) is a reliable reference for a broad range of emitter dimensions; furthermore, results permitted establishing G/h ≥ 2.2 as the threshold condition for setting the anode without affecting γ. PMID:26555324

  8. Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element.


    Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R; Jauch, Ralf


    Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6-DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit. PMID:25286939

  9. The atomic-scale mechanism for the enhanced glass-forming-ability of a Cu-Zr based bulk metallic glass with minor element additions

    PubMed Central

    Wang, Q.; Liu, C. T.; Yang, Y.; Liu, J. B.; Dong, Y. D.; Lu, J.


    It is known that the glass forming-ability (GFA) of bulk metallic glasses (BMGs) can be greatly enhanced via minor element additions. However, direct evidence has been lacking to reveal its structural origin despite different theories hitherto proposed. Through the high-resolution transmission-electron-microscopy (HRTEM) analysis, here we show that the content of local crystal-like orders increases significantly in a Cu-Zr-Al BMG after a 2-at% Y addition. Contrasting the previous studies, our current results indicate that the formation of crystal-like order at the atomic scale plays an important role in enhancing the GFA of the Cu-Zr-Al base BMG. PMID:24721927

  10. Effects of enhanced UV-B radiation on the distribution of mineral elements in soybean (Glycine max) seedlings.


    Peng, Qi; Zhou, Qing


    In order to understand the effect of ultraviolet-B (UV-B) radiation on plant, the accumulated amount of dry matter and the distribution of the mineral elements in the different organs of soybean seedlings treated with UV-B radiation were investigated using the inductively coupled plasma-atomic emission spectrometry (ICP-AES). The results indicated that the accumulated amount of dry matter in root, stem and leaf of soybean seedlings treated with UV-B radiation during the stress and recovery period was lower than that of the control soybean. Moreover, the content of macroelements in the root, stem and leaf of soybean seedlings during the stress period and recovery period were decreased comparing with that of the control soybean. The change in the contents of microelements depended on the intensity of UV-B radiation, the organs of soybean and the treating period. Finally, the results from the stepwise regression analysis indicated that the content of specific microelements also affected the accumulation of dry matter in the soybean seedlings treated with UV-B radiation comparing with the contents of macroelements in the control soybean. The relationship between the contents of mineral elements and the accumulation of dry matter depended on the intensity of UV-B radiation and the organs of soybean. These results demonstrated that UV-B radiation induced the change in the distribution of mineral elements in root, stem and leaf, leading to the decrease in the accumulation of dry matter and then the inhibition of soybean growth. It was a possible effect mechanism of UV-B radiation on plant. PMID:20036413

  11. Enhancing the Contrast of ApoB to Locate the Surface Components in the 3D Density Map of Human LDL

    PubMed Central

    Liu, Yuhang; Atkinson, David


    A 26Å resolution map of the structure of human LDL was obtained from cryo-EM and single particle image reconstruction. The structure showed a discoidal shaped LDL particle with high-density regions mainly distributed at the edge of the particle and low-density regions at the flat surface that covers the core region. To determine the chemical components that correspond to these density regions and to delineate the distribution of protein and phospholipid located at the particle surface at the resolution of the map, we used Mono-Sulfo-NHS-Undecagold labeling to increase preferentially the contrast of the apoB protein component on the LDL particle. In the 3D maps from the image reconstruction of the undecagold labeled LDL particles, the high-density region from the undecagold label was distributed mainly at the edge of the particle and lower density regions were found at the flat surfaces that cover the neutral lipid core. This suggests that apoB mainly encircles LDL at the edge of the particle and the phospholipid monolayers are located at the flat surfaces, which are parallel to the cholesterol ester layers in the core and may interact with the core lipid layers through the acyl-chains. PMID:21029740

  12. The Mitochondrion-Located Protein OsB12D1 Enhances Flooding Tolerance during Seed Germination and Early Seedling Growth in Rice

    PubMed Central

    He, Dongli; Zhang, Hui; Yang, Pingfang


    B12D belongs to a function unknown subgroup of the Balem (Barley aleurone and embryo) proteins. In our previous work on rice seed germination, we identified a B12D-like protein encoded by LOC_Os7g41350 (named OsB12D1). OsB12D1 pertains to an ancient protein family with an amino acid sequence highly conserved from moss to angiosperms. Among the six OsB12Ds, OsB12D1 is one of the major transcripts and is primarily expressed in germinating seed and root. Bioinformatics analyses indicated that OsB12D1 is an anoxic or submergence resistance-related gene. RT-PCR results showed OsB12D1 is induced remarkably in the coleoptiles or roots by flooding during seed germination and early seedling growth. The OsB12D1-overexpressed rice seeds could protrude radicles in 8 cm deep water, further exhibiting significant flooding tolerance compared to the wild type. Moreover, this tolerance was not affected by the gibberellin biosynthesis inhibitor paclobutrazol. OsB12D1 was identified in the mitochondrion by subcellular localization analysis and possibly enhances electron transport through mediating Fe and oxygen availability under flooded conditions. This work indicated that OsB12D1 is a promising gene that can help to enhance rice seedling establishment in farming practices, especially for direct seeding. PMID:25089878

  13. Intravenous low-grade endometrial stromal sarcoma with intracardiac extension: A CASE OF inaccurate tumor location on contrast-enhanced computed tomography

    PubMed Central



    We herein report a case of low-grade endometrial stromal sarcoma with intracardiac extension in a 58-year-old woman with a uterine tumor with intravascular involvement. The tumor was suspected preoperatively to be an endometrial stromal sarcoma by magnetic resonance imaging. The extent of intravascular involvement was determined to be below the level of the renal veins on preoperative contrast-enhanced computed tomography (CT). However, perioperative echography revealed that the tumor extended to the right atrium. An emergency cardiotomy with extracorporeal circulation was required. The risk of tumor embolism was reduced through transection of the inferior vena cava, but the tumor was difficult to remove completely. Postoperative hormonal therapy reduced the size of the residual tumor and no recurrence was detected for 1 year. The preoperative contrast-enhanced CT was unable to detect the free-floating intravascular tumor. This case illustrates a limitation of CT and indicates that accurate determination of the tumor extent for planning a surgical strategy in similar cases should be performed using multiple imaging methods. PMID:26893856

  14. The Steroid Hormone 20-Hydroxyecdysone Enhances Gene Transcription through the cAMP Response Element-binding Protein (CREB) Signaling Pathway.


    Jing, Yu-Pu; Wang, Di; Han, Xiao-Lin; Dong, Du-Juan; Wang, Jin-Xing; Zhao, Xiao-Fan


    Animal steroid hormones regulate gene transcription through genomic pathways by binding to nuclear receptors. These steroid hormones also rapidly increase intracellular calcium and cyclic adenosine monophosphate (cAMP) levels and activate the protein kinase C (PKC) and protein kinase A (PKA) nongenomic pathways. However, the function and mechanism of the nongenomic pathways of the steroid hormones are unclear, and the relationship between the PKC and PKA pathways is also unclear. We propose that the steroid hormone 20-hydroxyecdysone (20E) activates the PKA pathway to enhance 20E-induced gene transcription in the lepidopteran insect Helicoverpa armigera The expression of the catalytic subunit 1 of PKA (PKAC1) increased during metamorphosis, and PKAC1 knockdown blocked pupation and repressed 20E-responsive gene expression. 20E regulated PKAC1 phosphorylation at threonine 200 and nuclear translocation through an ecdysone-responsive G-protein-coupled receptor 2. PKAC1 induced cAMP response element-binding protein (CREB) phosphorylation at serine 143, which bound to the cAMP response element on DNA to enhance 20E-responsive gene transcription. Through ecdysone-responsive G-protein-coupled receptor 2, 20E increased cAMP levels, which induced CREB PKA phosphorylation and 20E-responsive gene expression. This study demonstrates that the PKA/CREB pathway tightly and critically regulates 20E-induced gene transcription as well as its relationship with the 20E-induced PKC pathway. PMID:27129227

  15. Robust optimization of well location to enhance hysteretical trapping of CO2: Assessment of various uncertainty quantification methods and utilization of mixed response surface surrogates

    NASA Astrophysics Data System (ADS)

    Babaei, Masoud; Pan, Indranil; Alkhatib, Ali


    The paper aims to solve a robust optimization problem (optimization in presence of uncertainty) for finding the optimal locations of a number of CO2 injection wells for geological sequestration of carbon dioxide in a saline aquifer. The parametric uncertainties are the interfacial tension between CO2 and aquifer brine, the Land's trapping coefficient and the boundary aquifer's absolute permeability. The spatial uncertainties are due to the channelized permeability field which exhibits a binary channel-non-channel system. The objective function of the optimization is the amount of residually trapped CO2 due to the hysteresis of the relative permeability curves. A risk-averse value derived from the cumulative density function of the distribution of the amount of trapped gas is chosen as the objective function value. In order to ensure that the uncertainties are effectively taken into account, Monte Carlo simulation and Polynomial Chaos Expansion (PCE)-based methods are used and compared with each other. For different cases of parametric and spatial uncertainties, the most accurate uncertainty quantification (UQ) method is chosen to be integrated within the optimization algorithm. While for parametric uncertainty cases of up to two uncertain variables, PCE-based methods computationally outperform Monte Carlo simulations, it is shown that for the multimodal distributions of the function of trapped gas occurring for the spatial uncertainty case, Monte Carlo simulations are more reliable than PCE-based UQ methods. For the discrete (integer) optimization problem, various mixed response surface surrogate models are tested and the robust optimization resulted in optimal CO2 injection well locations.

  16. Electrically small, near-field resonant parasitic (NFRP) antennas augmented with passive and active circuit elements to enhance their functionality

    NASA Astrophysics Data System (ADS)

    Zhu, Ning

    Metamaterials have drawn considerable attention because they can exhibit epsilon-negative (ENG) and/or mu-negative (MNG) properties, which in turn can lead to exotic physical effects that can enable interesting, practical applications. For instance, ENG and MNG properties can be engineered to yield double negative (DNG) properties, such as a negative index of refraction, which leads to flat lenses. Similarly, their extreme versions enable cloaking effects. Inspired by such metamaterial properties, a promising methodology has been developed to design electrically small antennas (ESAs). These ESAs use unit cells of metamaterials as their near-field resonant parasitic (NFRP) elements. This new metamaterial-inspired antenna miniaturization method is extended in this dissertation by augmenting the antenna designs with circuits. A rectifying circuit augmentation is used to achieve electrically small, high efficiency rectenna systems. Rectennas are the enabling components of power harvesting and wireless power transmission systems. Electrically small, integrated rectennas have become popular and in demand for several wireless applications including sensor networks and bio-implanted devices. Four global positioning system (GPS) L1 frequency (1.5754 GHz) rectenna systems were designed, fabricated and measured: three resistor-loaded and one supercapacitor-loaded. The simulated and measured results will be described; good agreement between them was obtained. The NFRP ESAs are also augmented with active, non-Foster elements in order to overcome the physical limits of the impedance bandwidth of passive ESA systems. Unlike conventional active external matching network approaches, the non-Foster components are incorporated directly into the NFRP element of the ESA. Three 300 MHz non-Foster circuit-augmented broadband, ESA systems were demonstrated: an Egyptian axe monopole (EAM) antenna, an Egyptian axe dipole (EAD) antenna, and a protractor antenna. The simulated and measured

  17. Enhanced photocatalytic oxidation of gaseous elemental mercury by TiO2 in a high temperature environment.


    Shen, Huazhen; Ie, Iau-Ren; Yuan, Chung-Shin; Hung, Chung-Hsuang; Chen, Wei-Hsiang; Luo, Jinjing; Jen, Yi-Hsiu


    The photo-oxidation of Hg(0) in a lab-scale reactor by titanium dioxide (TiO2) coated on the surface of glass beads was investigated at high temperatures. TiO2 was calcinated at four different temperatures of 300 °C, 400 °C, 500 °C and 600 °C (noted as Ti300, Ti400, Ti500 and Ti600) and characterized for its physicochemical properties. The calcinated TiO2 coating on the glass beads was then tested to compare the photo-oxidation efficiencies of Hg(0) with an incident light of 365 nm. The results showed that the oxidation efficiencies of Hg(0) for Ti400 and Ti500 were higher than those of Ti300 and Ti600. To enhance the photo-oxidation efficiency of Hg(0), Ti400 was selected to examine the wave lengths (λ) of 254 nm, 365 nm and visible light with various influent Hg(0) concentrations. The effects of irradiation strength and the presence of oxygen on the photo-oxidation efficiency of Hg(0) were further investigated, respectively. This study revealed that the wave length (λ) of 254 nm could promote the photo-oxidation efficiency of Hg(0) at 140 and 160 °C, while increasing the influent Hg(0) concentration and could enhance the photo-oxidation rate of Hg(0). However, the influence of 5% O2 present in the flue gas for the enhancement of Hg(0) oxidation was limited. Moreover, the intensity of the incident wave length of 365 nm and visible light were demonstrated to boost the photo-oxidation efficiency of Hg(0) effectively. PMID:25733397

  18. Sensitive determinations of Cu, Pb, Cd, and Cr elements in aqueous solutions using chemical replacement combined with surface-enhanced laser-induced breakdown spectroscopy.


    Yang, X Y; Hao, Z Q; Li, C M; Li, J M; Yi, R X; Shen, M; Li, K H; Guo, L B; Li, X Y; Lu, Y F; Zeng, X Y


    In this study, chemical replacement combined with surface-enhanced laser-induced breakdown spectroscopy (CR-SENLIBS) was for the first time applied to improve the detection sensitivities of trace heavy metal elements in aqueous solutions. Utilizing chemical replacement effect, heavy metal ions in aqueous solution were enriched on the magnesium alloy surface as a solid replacement layer through reacting with the high chemical activity metallic magnesium (Mg) within 1 minute. Unitary and mixed solutions with Cu, Pb, Cd, and Cr elements were prepared to construct calibration curves, respectively. The CR-SENLIBS showed a much better detection sensitivity and accuracy for both unitary and mixed solutions. The coefficients of determination R2 of the calibration curves were above 0.96, and the LoDs were of the same order of magnitude, i.e., in the range of 0.016-0.386 μg/mL for the unitary solution, and in the range of 0.025-0.420 μg/mL for the mixed solution. These results show that CR-SENLIBS is a feasible method for improving the detection sensitivity of trace element in liquid sample, which definitely provides a way for wider application of LIBS in water quality monitoring. PMID:27410358

  19. Postproliferative transcription of the rat osteocalcin gene is reflected by vitamin D-responsive developmental modifications in protein-DNA interactions at basal and enhancer promoter elements.

    PubMed Central

    Owen, T A; Bortell, R; Shalhoub, V; Heinrichs, A; Stein, J L; Stein, G S; Lian, J B


    In the osteocalcin (OC) gene promoter, both independent positive and negative regulatory elements, as well as others with contiguous [TATA/glucocorticoid-responsive elements (GRE)] or overlapping [TATA/GRE, vitamin D-responsive enhancer elements (VDRE)/AP-1, and OC box/AP-1] domains, are sites for modifications in protein-DNA interactions. In the present studies, we have examined nuclear protein extracts from fetal rat calvarial cells that undergo a developmental sequence of bone cell differentiation. Our results demonstrate modifications in protein-DNA interactions that relate to the developmental stages of the osteoblast and support developmental regulation of OC gene transcription. Basal expression of the OC gene is associated with sequence-specific protein-DNA interactions at the OC box, VDRE, and TATA/GRE box. Distinct differences are observed in proliferating osteoblasts, where the OC gene is not transcribed compared to postproliferative, differentiated osteoblasts that transcribe the OC gene. Furthermore, the protein-DNA complexes that reflect hormonal control are also developmentally regulated, mediating both the transcriptionally active and repressed states of the OC gene. For example, in proliferating osteoblasts, a vitamin D receptor-antibody-sensitive complex is formed that is different from the DNA binding complex induced by vitamin D postproliferatively when the OC gene is transcribed. Mutational analysis of the steroid hormone binding domain and the overlapping AP-1 site at the VDRE supports mutually exclusive occupancy by Fos-Jun heterodimers and vitamin D receptor. Such protein-DNA interactions at the VDRE are consistent with repression of competency for vitamin D-mediated transcriptional enhancement in proliferating osteoblasts expressing high levels of Fos and Jun. Images PMID:8381969

  20. Invasive blue mussels threaten regional scale genetic diversity in mainland and remote offshore locations: the need for baseline data and enhanced protection in the Southern Ocean.


    Gardner, Jonathan P A; Zbawicka, Małgorzata; Westfall, Kristen M; Wenne, Roman


    Human-mediated biological transfers of species have substantially modified many ecosystems with profound environmental and economic consequences. However, in many cases, invasion events are very hard to identify because of the absence of an appropriate baseline of information for receiving sites/regions. In this study, use of high-resolution genetic markers (single nucleotide polymorphisms - SNPs) highlights the threat of introduced Northern Hemisphere blue mussels (Mytilus galloprovincialis) at a regional scale to Southern Hemisphere lineages of blue mussels via hybridization and introgression. Analysis of a multispecies SNP dataset reveals hotspots of invasive Northern Hemisphere blue mussels in some mainland New Zealand locations, as well as the existence of unique native lineages of blue mussels on remote oceanic islands in the Southern Ocean that are now threatened by invasive mussels. Samples collected from an oil rig that has moved between South Africa, Australia, and New Zealand were identified as invasive Northern Hemisphere mussels, revealing the relative ease with which such non-native species may be moved from region to region. In combination, our results highlight the existence of unique lineages of mussels (and by extension, presumably of other taxa) on remote offshore islands in the Southern Ocean, the need for more baseline data to help identify bioinvasion events, the ongoing threat of hybridization and introgression posed by invasive species, and the need for greater protection of some of the world's last great remote areas. PMID:27124277

  1. Regulated tissue-specific alternative splicing of enhanced green fluorescent protein transgenes conferred by alpha-tropomyosin regulatory elements in transgenic mice.


    Ellis, Peter D; Smith, Christopher W J; Kemp, Paul


    The mutually exclusive exons 2 and 3 of alpha-tropomyosin (alphaTM) have been used as a model system for strictly regulated alternative splicing. Exon 2 inclusion is only observed at high levels in smooth muscle (SM) tissues, whereas striated muscle and non-muscle cells use predominantly exon 3. Experiments in cell culture have shown that exon 2 selection results from repression of exon 3 and that this repression is mediated by regulatory elements flanking exon 3. We have now tested the cell culture-derived model in transgenic mice. We show that by harnessing the intronic splicing regulatory elements, expression of an enhanced green fluorescent protein transgene with a constitutively active promoter can be restricted to SM cells. Splicing of both endogenous alphaTM and a series of transgenes carrying regulatory element mutations was analyzed by reverse transcriptasePCR. These studies indicated that although SM-rich tissues are equipped to regulate splicing of high levels of endogenous or transgene alphaTM RNA, other non-SM tissues such as spleen, which express lower amounts of alphaTM, also splice significant proportions of exon 2, and this splicing pattern can be recapitulated by transgenes expressed at low levels. We confirm the importance in vivo of the negatively acting regulatory elements for regulated skipping of exon 3. Moreover, we provide evidence that some of the regulatory factors responsible for exon 3 skipping appear to be titratable, with loss of regulated splicing sometimes being associated with high transgene expression levels. PMID:15194683

  2. DIORAMA Location Type User's Guide

    SciTech Connect

    Terry, James Russell


    The purpose of this report is to present the current design and implementation of the DIORAMA location type object (LocationType) and to provide examples and use cases. The LocationType object is included in the diorama-app package in the diorama::types namespace. Abstractly, the object is intended to capture the full time history of the location of an object or reference point. For example, a location may be speci ed as a near-Earth orbit in terms of a two-line element set, in which case the location type is capable of propagating the orbit both forward and backward in time to provide a location for any given time. Alternatively, the location may be speci ed as a xed set of geodetic coordinates (latitude, longitude, and altitude), in which case the geodetic location of the object is expected to remain constant for all time. From an implementation perspective, the location type is de ned as a union of multiple independent objects defi ned in the DIORAMA tle library. Types presently included in the union are listed and described in subsections below, and all conversions or transformation between these location types are handled by utilities provided by the tle library with the exception of the \\special-values" location type.

  3. The impact of enhanced atmospheric carbon dioxide on yield, proximate composition, elemental concentration, fatty acid and vitamin C contents of tomato (Lycopersicon esculentum).


    Khan, Ikhtiar; Azam, Andaleeb; Mahmood, Abid


    The global average temperature has witnessed a steady increase during the second half of the twentieth century and the trend is continuing. Carbon dioxide, a major green house gas is piling up in the atmosphere and besides causing global warming, is expected to alter the physico-chemical composition of plants. The objective of this work was to evaluate the hypothesis that increased CO(2) in the air is causing undesirable changes in the nutritional composition of tomato fruits. Two varieties of tomato (Lycopersicon esculentum) were grown in ambient (400 μmol mol(-1)) and elevated (1,000 μmol mol(-1)) concentration of CO(2) under controlled conditions. The fruits were harvested at premature and fully matured stages and analyzed for yield, proximate composition, elemental concentration, fatty acid, and vitamin C contents. The amount of carbohydrates increased significantly under the enhanced CO(2) conditions. The amount of crude protein and vitamin C, two important nutritional parameters, decreased substantially. Fatty acid content showed a mild decrease with a slight increase in crude fiber. Understandably, the effect of enhanced atmospheric CO(2) was more pronounced at the fully matured stage. Mineral contents of the fruit samples changed in an irregular fashion. Tomato fruit has been traditionally a source of vitamin C, under the experimental conditions, a negative impact of enhanced CO(2) on this source of vitamin C was observed. The nutritional quality of both varieties of tomato has altered under the CO(2) enriched atmosphere. PMID:22382378

  4. Identification and characterization of a functional retinoic acid/thyroid hormone-response element upstream of the human insulin gene enhancer.

    PubMed Central

    Clark, A R; Wilson, M E; London, N J; James, R F; Docherty, K


    A deletion analysis of the human insulin gene extending to 2 kb upstream of the transcription start site provided evidence of regulatory sequences located upstream of the insulin-linked polymorphic region (ILPR). Within this ILPR-distal region is a sequence (Ink, for insulin kilobase upstream) which contains three potential nuclear hormone-receptor half-sites, closely matching the consensus sequence AGGTCA. These sequences are arranged as a palindromic element with zero spacing over-lapping a direct repeat with 2 bp spacing. The Ink sequence was used in electrophoretic mobility-shift assays within nuclear extracts from COS-7 cells overexpressing the vitamin D, thyroid hormone or retinoic acid receptors, or from an insulin-expressing hamster cell line, HIT-T15. These studies suggest that the insulin-expressing cell line contains thyroid hormone and retinoic acid receptors at least, and that these receptors are able to recognize the Ink sequence. Three copies of the Ink sequence were placed upstream of the thymidine kinase promoter and firefly luciferase reporter gene. In COS-7 cells expressing the appropriate nuclear hormone receptor, this construct was responsive to both thyroid hormone (18-fold) and all-trans-retinoic acid (31-fold). In HIT-T15 cells the same construct responded to all-trans-retinoic acid, but not to thyroid hormone. Within the context of a 2 kb insulin gene fragment, the Ink sequence was shown to be activated by retinoic acid and by the retinoic acid receptor, but acted as a negative element in the presence of both retinoic acid and the retinoic acid receptor. Mutagenesis studies demonstrated that the palindromic sequence was important for the retinoic acid response, and for binding of complexes containing retinoic acid receptor. In human islets of Langerhans, retinoic acid was shown to stimulate insulin mRNA levels. These results demonstrate that a functional nuclear hormone-receptor-response element is located upstream of the human ILPR. As

  5. Determination of trace elements in high purity alumina powder by helium enhanced direct current glow discharge mass spectrometry

    NASA Astrophysics Data System (ADS)

    Jung, Sehoon; Kim, Sunhye; Hinrichs, Joachim


    Trace impurities in high purity alumina powder were determined by fast flow direct current glow discharge mass spectrometry (GD-MS). The non-conductive samples were prepared with high purity graphite powder and used as a sample binder and as a secondary cathode. To improve the sensitivity of the GD-MS analysis, helium was introduced as an additional glow discharge gas to argon plasma. The quantification results of the GD-MS measurement were calculated by external calibration with matrix matched certified reference materials. The GD-MS results for the determination of Na, Mg, Si, Ca, Ti, V, Cr, Fe, Cu, Zn and Ga in the alumina samples agreed well with the certified values of a reference material and the results of chemical analysis using wet sample digestion with inductively coupled plasma atomic emission spectrometry (ICP-AES) and inductively coupled plasma mass spectrometry (ICP-MS). The GD-MS analysis is a rapid analysis technique to determine trace elements in non-conductive alumina to below mg·kg- 1 levels.

  6. Oxidative mobilization of cerium and uranium and enhanced release of "immobile" high field strength elements from igneous rocks in the presence of the biogenic siderophore desferrioxamine B

    NASA Astrophysics Data System (ADS)

    Kraemer, Dennis; Kopf, Sebastian; Bau, Michael


    Polyvalent trace elements such as the high field strength elements (HFSE) are commonly considered rather immobile during low-temperature water-rock interaction. Hence, they have become diagnostic tools that are widely applied in geochemical studies. We present results of batch leaching experiments focused on the mobilization of certain HFSE (Y, Zr, Hf, Th, U and rare earth elements) from mafic, intermediate and felsic igneous rocks in the presence and absence, respectively, of the siderophore desferrioxamine B (DFOB). Our data show that DFOB strongly enhances the mobility of these trace elements during low-temperature water-rock interaction. The presence of DFOB produces two distinct features in the Rare Earths and Yttrium (REY) patterns of leaching solutions, regardless of the mineralogical and chemical composition or the texture of the rock type studied. Bulk rock-normalized REY patterns of leaching solutions with DFOB show (i) a very distinct positive Ce anomaly and (ii) depletion of La and other light REY relative to the middle REY, with a concave downward pattern between La and Sm. These features are not observed in experiments with hydrochloric acid, acetic acid or deionized water. In DFOB-bearing leaching solutions Ce and U are decoupled from and selectively enriched relative to light REY and Th, respectively, due to oxidation to Ce(IV) and U(VI). Oxidation of Ce3+ and U4+ is promoted by the significantly higher stability of the Ce(IV) and U(VI) DFOB complexes as compared to the Ce(III) and U(IV) DFOB complexes. This is similar to the relationship between the Ce(IV)- and Ce(III)-pentacarbonate complexes that cause positive Ce anomalies in alkaline lakes. However, while formation of Ce(IV) carbonate complexes is confined to alkaline environments, Ce(IV) DFOB complexes may produce positive Ce anomalies even in mildly acidic and near-neutral natural waters. Siderophore-promoted dissolution processes also significantly enhance mobility of other 'immobile' HFSE

  7. Finite element method for simulating coupled thermo-hydro-mechanical processes in discretely fractured porous media and application to enhanced geothermal reservoir analysis

    NASA Astrophysics Data System (ADS)

    Watanabe, N.; Wong, L.; Bloecher, G.; Cacace, M.; Kolditz, O.


    We present our recent development of the finite element method (FEM) for simulating coupled thermo-hydro-mechanical (THM) processes in discretely fractured porous media and an application to geothermal reservoir modeling for the research test site Gross Schoenebeck in Germany operated by the GFZ German Research Centre for Geosciences. Numerical analysis of multi-physics problems in fractured rocks is important for various geotechnical applications. In particular for enhanced geothermal reservoirs where induced fractures and possibly natural fault systems dominate the system behavior, explicit modeling of those characteristic fractures (i.e. discrete fracture models) is essential to get more detailed understanding of in-situ processes and reliable estimations of heat extraction from those deep reservoirs. However, as fractures are mechanical discontinuities, it is difficult to solve the problems using continuity based numerical methods such as the FEM. Currently, equivalent porous medium or multiple continuum model approaches are often only the way to model fractured rocks with the FEM. The authors have recently developed lower-dimensional interface elements (LIEs) for modeling mechanics-involved coupled processes with pre-existing fractures (Watanabe et al. 2012 IJNME). The method does not require any double nodes unlike conventional interface elements. Moreover, for coupled problems, the approach allows for the use of a single mesh for both mechanical and other related processes such as flow and transport. All the code developments have been carried out within the scientific open source project OpenGeoSys ( (Kolditz et al. 2012 EES). Using both traditional and new simulation techniques, a geothermal reservoir model for the research test site Gross Schoenebeck has been developed. Unstructured meshing of the complex faulted reservoir including both rock matrix and fracture elements has been conducted using recently developed automatic

  8. PU.1 is regulated by NF-kappaB through a novel binding site in a 17 kb upstream enhancer element.


    Bonadies, N; Neururer, Ch; Steege, A; Vallabhapurapu, S; Pabst, T; Mueller, B U


    The majority of patients with acute myeloid leukemia (AML) still die of their disease, and novel therapeutic concepts are needed. Timely expression of the hematopoietic master regulator PU.1 is crucial for normal development of myeloid and lymphoid cells. Targeted disruption of an upstream regulatory element (URE) located several kb upstream in the PU.1 promoter decreases PU.1 expression thereby inducing AML in mice. In addition, suppression of PU.1 has been observed in specific subtypes of human AML. Here, we identified nuclear factor-kappaB (NF-kappaB) to activate PU.1 expression through a novel site within the URE. We found sequence variations of this particular NF-kappaB site in 4 of 120 AML patients. These variant NF-kappaB sequences failed to mediate activation of PU.1. Moreover, the synergistic activation of PU.1 together with CEBPB through these variant sequences was also lost. Finally, AML patients with such variant sequences had suppressed PU.1 mRNA expression. This study suggests that changes of a single base pair in a distal element critically affect the regulation of the tumor suppressor gene PU.1 thereby contributing to the development of AML. PMID:19966852

  9. The effect of sulfide dissolved in silicate melts on enhancing the solubility of the Highly Siderophile Elements

    NASA Astrophysics Data System (ADS)

    O'Neill, H. S.


    There are large inconsistencies among experimental studies of Highly Siderophile Element (HSE) partitioning relations between silicates and metal or sulfide phases, which has usually been attributed to "micronuggets", a general term for sub-optical (approximately < 0.2 µm) particles or blobs of metal or sulfide in the silicate phase. But there have then been differences of opinion as to whether these micronuggets (and, sometimes, associated optical-sized metal or sulfide particles) should be viewed as contamination, or are produced by precipitation on quenching the experiment, which need to be included to recover true partitioning relations. Although quench precipitation is perhaps inevitable in experiments at extremely high temperatures and/or pressures, or with high loads of dissolved sulfide, it may be superimposed on the usual micronugget contamination. The problem is particularly acute in HSE sulfide-melt/silicate-melt partition coefficients, where results range over several orders of magnitude. Moreover, nearly all the reported results of directly determined sulfide-melt/silicate-melt partition coefficients are considerably lower than values calculated by combining metal/silicate-melt with metal/sulfide-melt partition coefficients. This discrepancy has been attributed to large effects of S dissolved as sulfide in the silicate melts on HSE solubilities. As such large effects are not expected from the thermodynamic modeling of sulfide solubilities in silicate melts, it has been proposed that HSEs dissolve in sulfide-containing silicate melts by forming HSE-S complexes. This idea has been tested by experiments that compare the solubilities of Ir, Re and Ru in a high-TiO2 silicate melt both with and without dissolved sulfide at 1400 to 1600ºC at atmospheric pressure. The high TiO2 suppresses micronuggets. Experiments were analysed by LA-ICP-MS, with detection limits approaching 2 ppb. For Ir, the results show that at fO2 low enough to enable measurable sulfide

  10. ALU repeats in promoters are position-dependent co-response elements (coRE) that enhance or repress transcription by dimeric and monomeric progesterone receptors.


    Jacobsen, Britta M; Jambal, Purevsuren; Schittone, Stephanie A; Horwitz, Kathryn B


    We have conducted an in silico analysis of progesterone response elements (PRE) in progesterone receptor (PR) up-regulated promoters. Imperfect inverted repeats, direct repeats, and half-site PRE are widespread, not only in PR-regulated, but also in non-PR-regulated and random promoters. Few resemble the commonly used palindromic PRE with three nucleotide (nt) spacers. We speculated that PRE may be necessary but insufficient to control endogenous PR-dependent transcription. A search for PRE partners identified a highly conserved 234-nt sequence invariably located within 1-2 kb of transcription start sites. It resembles ALU repeats and contains binding sites for 11 transcription factors. The 234-nt sequence of the PR-regulated 8-oxoguanine DNA glycosylase promoter was cloned in the forward or reverse orientation in front of zero, one, or two inverted repeat PRE, and one or tandem PRE half-sites, driving luciferase. Under these conditions the 234-nt sequence functions as a co-response element (coRE). From the PRE or tandem half-sites, the reverse coRE is a strong activator of PR and glucocorticoid receptor-dependent transcription. The forward coRE is a powerful repressor. The prevalence of PRE half-sites in natural promoters suggested that PR monomers regulate transcription. Indeed, dimerization-domain mutant PR monomers were stronger transactivators than wild-type PR on PRE or tandem half-sites. This was repressed by the forward coRE. We propose that in natural promoters the coRE functions as a composite response element with imperfect PRE and half-sites to present variable, orientation-dependent transcription factors for interaction with nearby PR. PMID:19372234

  11. A zinc-responsive factor interacts with a metal-regulated enhancer element (MRE) of the mouse metallothionein-I gene.

    PubMed Central

    Westin, G; Schaffner, W


    Heavy metal ions are effective inducers of metallothionein gene transcription. The metal response is dependent on short DNA motifs, so-called MREs (metal responsive elements) that occur in multiple copies in the promoter region of these genes. We have analysed an MRE of the mouse metallothionein-I gene (MREd) and we demonstrate that this can function over long distances as a bona fide metal ion-inducible enhancer. The transcription factor Sp1 and a zinc-inducible factor, designated MTF-1, bind to the MREd enhancer in vitro. The combined use of MREd mutants in a transient assay in HeLa cells and a competition band shift assay show that the zinc-inducible formation of the MTF-1/DNA complex in vitro correlates with zinc-inducible transcription in vivo. A chemical methylation interference assay revealed remarkably similar but non-identical guanine interference patterns for the MTF-1 and Sp1 complexes, which may mean that MTF-1 is related to the Sp1 factor. Images PMID:3208749

  12. Noise-immune cavity-enhanced analytical atomic spectrometry - NICE-AAS - A technique for detection of elements down to zeptogram amounts

    NASA Astrophysics Data System (ADS)

    Axner, Ove; Ehlers, Patrick; Hausmaninger, Thomas; Silander, Isak; Ma, Weiguang


    Noise-immune cavity-enhanced optical heterodyne molecular spectroscopy (NICE-OHMS) is a powerful technique for detection of molecular compounds in gas phase that is based on a combination of two important concepts: frequency modulation spectroscopy (FMS) for reduction of noise, and cavity enhancement, for prolongation of the interaction length between the light and the sample. Due to its unique properties, it has demonstrated unparalleled detection sensitivity when it comes to detection of molecular constituents in the gas phase. However, despite these, it has so far not been used for detection of atoms, i.e. for elemental analysis. The present work presents an assessment of the expected performance of Doppler-broadened (Db) NICE-OHMS for analytical atomic spectrometry, then referred to as noise-immune cavity-enhanced analytical atomic spectrometry (NICE-AAS). After a description of the basic principles of Db-NICE-OHMS, the modulation and detection conditions for optimum performance are identified. Based on a previous demonstrated detection sensitivity of Db-NICE-OHMS of 5 × 10- 12 cm- 1 Hz- 1/2 (corresponding to a single-pass absorbance of 7 × 10- 11 over 10 s), the expected limits of detection (LODs) of Hg and Na by NICE-AAS are estimated. Hg is assumed to be detected in gas phase directly while Na is considered to be atomized in a graphite furnace (GF) prior to detection. It is shown that in the absence of spectral interferences, contaminated sample compartments, and optical saturation, it should be feasible to detect Hg down to 10 zg/cm3 (10 fg/m3 or 10- 5 ng/m3), which corresponds to 25 atoms/cm3, and Na down to 0.5 zg (zg = zeptogram = 10- 21 g), representing 50 zg/mL (parts-per-sextillion, pps, 1:1021) in liquid solution (assuming a sample of 10 μL) or solely 15 atoms injected into the GF, respectively. These LODs are several orders of magnitude lower (better) than any previous laser-based absorption technique previously demonstrated under atmospheric

  13. Codon optimization and woodchuck hepatitis virus posttranscriptional regulatory element enhance the immune responses of DNA vaccines against infectious bursal disease virus in chickens.


    Li, Kai; Gao, Li; Gao, Honglei; Qi, Xiaole; Gao, Yulong; Qin, Liting; Wang, Yongqiang; Wang, Xiaomei


    The present study was undertaken to evaluate the protective efficacy of DNA vaccines against infectious bursal disease virus (IBDV) in chickens and to determine whether codon optimization and the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) could improve the immunogenicity of the DNA vaccines. The VP2, VP243 and codon-optimized VP243 genes of IBDV were cloned into pCAGGS vector, and designated as pCAGVP2, pCAGVP243 and pCAGoptiVP243, respectively. Plasmids pCAGWVP243 and pCAGWoptiVP243 carrying the WPRE elements were also constructed as DNA vaccines. To evaluate vaccine efficacy, 2-week-old chickens were injected intramuscularly with the constructed plasmids twice at 2-week intervals and challenged with very virulent IBDV 2 weeks post-boost. Plasmid pCAGVP243 induced better immune responses than pCAGVP2. Chickens immunized with pCAGoptiVP243 and pCAGWVP243 had higher levels of antibody titers, lymphoproliferation responses and cytokine production compared with pCAGVP243. Furthermore, plasmid pCAGWoptiVP243 induced the highest levels of immune responses among the groups. After challenged, DNA vaccines pCAGVP2, pCAGVP243, pCAGoptiVP243, pCAGWVP243 and pCAGWoptiVP243 conferred protection for 33%, 60%, 80%, 87% and 100% of chickens, respectively, as evidenced by the absence of clinical signs, mortality, and bursal atrophy. These results indicate that codon optimization and WPRE could enhance the protective efficacy of DNA vaccines against IBDV and these two approaches could work together synergistically in a single DNA vaccine. PMID:23631937

  14. Experiences with information locator services

    USGS Publications Warehouse

    Christian, E.


    Over the last few years, governments and other organizations have been using new technologies to create networked Information Locator Services that help people find information resources. These services not only enhance access to information, but also are designed to support fundamental information policy principles. This article relates experiences in developing and promoting services interoperable with the Global Information Locator Service standard that has now been adopted and promoted in many forums worldwide. The article describes sample implementations and touches on the strategic choices made in public policy, standards, and technology. Ten recommendations are offered for successful implementation of an Information Locator Service. Published by Elsevier Science Ltd. All rights reserved.

  15. GREAM: A Web Server to Short-List Potentially Important Genomic Repeat Elements Based on Over-/Under-Representation in Specific Chromosomal Locations, Such as the Gene Neighborhoods, within or across 17 Mammalian Species

    PubMed Central

    Chandrashekar, Darshan Shimoga; Dey, Poulami; Acharya, Kshitish K.


    Background Genome-wide repeat sequences, such as LINEs, SINEs and LTRs share a considerable part of the mammalian nuclear genomes. These repeat elements seem to be important for multiple functions including the regulation of transcription initiation, alternative splicing and DNA methylation. But it is not possible to study all repeats and, hence, it would help to short-list before exploring their potential functional significance via experimental studies and/or detailed in silico analyses. Result We developed the ‘Genomic Repeat Element Analyzer for Mammals’ (GREAM) for analysis, screening and selection of potentially important mammalian genomic repeats. This web-server offers many novel utilities. For example, this is the only tool that can reveal a categorized list of specific types of transposons, retro-transposons and other genome-wide repetitive elements that are statistically over-/under-represented in regions around a set of genes, such as those expressed differentially in a disease condition. The output displays the position and frequency of identified elements within the specified regions. In addition, GREAM offers two other types of analyses of genomic repeat sequences: a) enrichment within chromosomal region(s) of interest, and b) comparative distribution across the neighborhood of orthologous genes. GREAM successfully short-listed a repeat element (MER20) known to contain functional motifs. In other case studies, we could use GREAM to short-list repetitive elements in the azoospermia factor a (AZFa) region of the human Y chromosome and those around the genes associated with rat liver injury. GREAM could also identify five over-represented repeats around some of the human and mouse transcription factor coding genes that had conserved expression patterns across the two species. Conclusion GREAM has been developed to provide an impetus to research on the role of repetitive sequences in mammalian genomes by offering easy selection of more interesting

  16. Superheavy Elements

    NASA Astrophysics Data System (ADS)

    Hofmann, S.

    The nuclear shell model predicts that the next doubly magic shell closure beyond 208Pb is at a proton number Z=114, 120, or 126 and at a neutron number N=172 or 184. The outstanding aim of experimental investigations is the exploration of this region of spherical `SuperHeavy Elements' (SHEs). Experimental methods have been developed which allowed for the identification of new elements at production rates of one atom per month. Using cold fusion reactions which are based on lead and bismuth targets, relatively neutron-deficient isotopes of the elements from 107 to 113 were synthesized at GSI in Darmstadt, Germany, and/or at RIKEN in Wako, Japan. In hot fusion reactions of 48Ca projectiles with actinide targets more neutron-rich isotopes of the elements from 112 to 116 and even 118 were produced at the Flerov Laboratory of Nuclear Reactions (FLNR) at the Joint Institute for Nuclear Research (JINR) in Dubna, Russia. Recently, part of these data which represent the first identification of nuclei located on the predicted island of SHEs were confirmed in two independent experiments. The decay data reveal that for the heaviest elements, the dominant decay mode is α emission rather than fission. Decay properties as well as reaction cross-sections are compared with results of theoretical studies. Finally, plans are presented for the further development of the experimental set-up and the application of new techniques. At a higher sensitivity, the detailed exploration of the region of spherical SHEs will be in the center of interest of future experimental work. New data will certainly challenge theoretical studies on the mechanism of the synthesis, on the nuclear decay properties, and on the chemical behavior of these heaviest atoms at the limit of stability.

  17. An In-Depth Characterization of the Major Psoriasis Susceptibility Locus Identifies Candidate Susceptibility Alleles within an HLA-C Enhancer Element

    PubMed Central

    Clop, Alex; Bertoni, Anna; Spain, Sarah L.; Simpson, Michael A.; Pullabhatla, Venu; Tonda, Raul; Hundhausen, Christian; Di Meglio, Paola; De Jong, Pieter; Hayday, Adrian C.; Nestle, Frank O.; Barker, Jonathan N.; Bell, Robert J. A.; Capon, Francesca; Trembath, Richard C.


    Psoriasis is an immune-mediated skin disorder that is inherited as a complex genetic trait. Although genome-wide association scans (GWAS) have identified 36 disease susceptibility regions, more than 50% of the genetic variance can be attributed to a single Major Histocompatibility Complex (MHC) locus, known as PSORS1. Genetic studies indicate that HLA-C is the strongest PSORS1 candidate gene, since markers tagging HLA-Cw*0602 consistently generate the most significant association signals in GWAS. However, it is unclear whether HLA-Cw*0602 is itself the causal PSORS1 allele, especially as the role of SNPs that may affect its expression has not been investigated. Here, we have undertaken an in-depth molecular characterization of the PSORS1 interval, with a view to identifying regulatory variants that may contribute to disease susceptibility. By analysing high-density SNP data, we refined PSORS1 to a 179 kb region encompassing HLA-C and the neighbouring HCG27 pseudogene. We compared multiple MHC sequences spanning this refined locus and identified 144 candidate susceptibility variants, which are unique to chromosomes bearing HLA-Cw*0602. In parallel, we investigated the epigenetic profile of the critical PSORS1 interval and uncovered three enhancer elements likely to be active in T lymphocytes. Finally we showed that nine candidate susceptibility SNPs map within a HLA-C enhancer and that three of these variants co-localise with binding sites for immune-related transcription factors. These data indicate that SNPs affecting HLA-Cw*0602 expression are likely to contribute to psoriasis susceptibility and highlight the importance of integrating multiple experimental approaches in the investigation of complex genomic regions such as the MHC. PMID:23990973

  18. The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.


    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y


    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. PMID:23856420

  19. The Upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia

    PubMed Central

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D.; Mansfield, Brian C.; Chou, Janice Y.


    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. PMID:23856420

  20. Immunogenetic influences on acquisition of HIV-1 infection: consensus findings from two African cohorts point to an enhancer element in IL19 (1q32.2).


    Li, X; Zhang, K; Pajewski, N M; Brill, I; Prentice, H A; Shrestha, S; Kilembe, W; Karita, E; Allen, S; Hunter, E; Kaslow, R A; Tang, J


    Numerous reports have suggested that immunogenetic factors may influence human immunodeficiency virus (HIV)-1 acquisition, yet replicated findings that translate between study cohorts remain elusive. Our work aimed to test several hypotheses about genetic variants within the IL10-IL24 gene cluster that encodes interleukin (IL)-10, IL-19, IL-20 and IL-24. In aggregated data from 515 Rwandans and 762 Zambians with up to 12 years of follow-up, 190 single-nucleotide polymorphisms passed quality control procedures. When HIV-1-exposed seronegative subjects (n=486) were compared with newly seroconverted individuals (n=313) and seroprevalent subjects (n=478) who were already infected at enrollment, rs12407485 (G>A) in IL19 showed a robust association signal in adjusted logistic regression models (odds ratio=0.64, P=1.7 × 10(-4) and q=0.033). Sensitivity analyses demonstrated that (i) results from both cohorts and subgroups within each cohort were highly consistent; (ii) verification of HIV-1 infection status after enrollment was critical; and (iii) supporting evidence was readily obtained from Cox proportional hazards models. Data from public databases indicate that rs12407485 is part of an enhancer element for three transcription factors. Overall, these findings suggest that molecular features at the IL19 locus may modestly alter the establishment of HIV-1 infection. PMID:25633979

  1. Epigenetically regulated miR-449a enhances hepatitis B virus replication by targeting cAMP-responsive element binding protein 5 and modulating hepatocytes phenotype

    PubMed Central

    Zhang, Xiaoyong; Liu, Hongyan; Xie, Zhanglian; Deng, Wangyu; Wu, Chunchen; Qin, Bo; Hou, Jinlin; Lu, Mengji


    Cellular microRNAs (miRNAs) are able to influence hepatitis B virus (HBV) replication directly by binding to HBV transcripts or indirectly by targeting cellular factors. Here, we investigate the effect of epigenetically regulated miR-449a on HBV replication and the underlying mechanisms. miR-449a expression was lower in human hepatocellular carcinoma (HCC) cells than in primary hepatocytes and could be induced by trichostatin A. Ectopic miR-449a expression in HCC cells strongly enhanced HBV replication, transcription, progeny virions secretion, and antigen expression in a dose-dependent manner. miR-449a directly targeted cAMP-responsive element binding protein 5 (CREB5), which in turn induced the expression of farnesoid X receptor α (FXRα), a transcription factor that facilitates HBV replication. CREB5 knockdown and overexpression demonstrated that it is a negative regulator of HBV replication. Additionally, miR-449a overexpression inhibited proliferation, caused cell cycle arrest, and promoted HCC cell differentiation. The results indicated that epigenetically regulated miR-449a targets CREB5 to increase FXRα expression, thereby promoting HBV replication and gene expression. Our findings provide a new understanding of the role of miRNAs in HBV replication. PMID:27138288

  2. Characterization of novel promoter and enhancer elements of the mouse homologue of the Dent disease gene, CLCN5, implicated in X-linked hereditary nephrolithiasis.


    Tanaka, K; Fisher, S E; Craig, I W


    The murine homologue of the human chloride channel gene, CLCN5, defects in which are responsible for Dent disease, has been cloned and characterized. We isolated the entire coding region of mouse Clcn5 cDNA and approximately 45 kb of genomic sequence embracing the gene. To study its transcriptional control, the 5' upstream sequences of the mouse Clcn5 gene were cloned into a luciferase reporter vector. Deletion analysis of 1.5 kb of the 5' flanking sequence defined an active promoter region within 128 bp of the putative transcription start site, which is associated with a TATA motif but lacks a CAAT consensus. Within this sequence, there is a motif with homology to a purine-rich sequence responsible for the kidney-specific promoter activity of the rat CLC-K1 gene, another member of the chloride-channel gene family expressed in kidney. An enhancer element that confers a 10- to 20-fold increase in the promoter activity of the mouse Clcn5 gene was found within the first intron. The organization of the human CLCN5 and mouse Clcn5 gene structures is highly conserved, and the sequence of the murine protein is 98% similar to that of human, with its highest expression seen in the kidney. This study thus provides the first identification of the transcriptional control region of, and the basis for an understanding of the regulatory mechanism that controls, this kidney-specific, chloride-channel gene. PMID:10373326

  3. The Chemical Abundances of Stars in the Halo (CASH) Project. III. A New Classification Scheme for Carbon-enhanced Metal-poor Stars with s-process Element Enhancement

    NASA Astrophysics Data System (ADS)

    Hollek, Julie K.; Frebel, Anna; Placco, Vinicius M.; Karakas, Amanda I.; Shetrone, Matthew; Sneden, Christopher; Christlieb, Norbert


    We present a detailed abundance analysis of 23 elements for a newly discovered carbon-enhanced metal-poor (CEMP) star, HE 0414-0343, from the Chemical Abundances of Stars in the Halo Project. Its spectroscopic stellar parameters are Teff = 4863 K, {log}g=1.25,\\ξ = 2.20 km s-1, and [Fe/H] = -2.24. Radial velocity measurements covering seven years indicate HE 0414-0343 to be a binary. HE 0414-0343 has {{[C/Fe]}}=1.44 and is strongly enhanced in neutron-capture elements but its abundances cannot be reproduced by a solar-type s-process pattern alone. Traditionally, it could be classified as a “CEMP-r/s” star. Based on abundance comparisons with asymptotic giant branch (AGB) star nucleosynthesis models, we suggest a new physically motivated origin and classification scheme for CEMP-s stars and the still poorly understood CEMP-r/s. The new scheme describes a continuous transition between these two so-far distinctly treated subgroups: CEMP-sA, CEMP-sB, and CEMP-sC. Possible causes for a continuous transition include the number of thermal pulses the AGB companion underwent, the effect of different AGB star masses on their nucleosynthetic yields, and physics that is not well approximated in 1D stellar models such as proton ingestion episodes and rotation. Based on a set of detailed AGB models, we suggest the abundance signature of HE 0414-0343 to have arisen from a >1.3 M⊙ mass AGB star and a late-time mass transfer that transformed HE 0414-0343 into a CEMP-sC star. We also find that the [Y/Ba] ratio well parametrizes the classification and can thus be used to easily classify any future such stars. Based on observations obtained with the Hobby-Eberly Telescope, which is a joint project of the University of Texas at Austin, the Pennsylvania State University, Stanford University, Ludwig-Maximilians-Universität München, and Georg-August-Universität Göttingen.

  4. Phosphorylation by casein kinase 1 regulates tonicity-induced osmotic response element-binding protein/tonicity enhancer-binding protein nucleocytoplasmic trafficking.


    Xu, SongXiao; Wong, Catherine C L; Tong, Edith H Y; Chung, Stephen S M; Yates, John R; Yin, YiBing; Ko, Ben C B


    The osmotic response element-binding protein (OREBP), also known as tonicity enhancer-binding protein (TonEBP) or NFAT5, is the only known osmo-sensitive transcription factor that mediates cellular adaptations to extracellular hypertonic stress. Although it is well documented that the subcellular localization and transactivation activity of OREBP/TonEBP are tightly regulated by extracellular tonicity, the molecular mechanisms involved remain elusive. Here we show that nucleocytoplasmic trafficking of OREBP/TonEBP is regulated by the dual phosphorylation of Ser-155 and Ser-158. Alanine scanning mutagenesis revealed that Ser-155 is an essential residue that regulates OREBP/TonEBP nucleocytoplasmic trafficking. Tandem mass spectrometry revealed that Ser-155 and Ser-158 of OREBP/TonEBP are both phosphorylated in living cells under hypotonic conditions. In vitro phosphorylation assays further suggest that phosphorylation of the two serine residues proceeds in a hierarchical manner with phosphorylation of Ser-155 priming the phosphorylation of Ser-158 and that these phosphorylations are essential for nucleocytoplasmic trafficking of the transcription factor. Finally, we have shown that the pharmacological inhibition of casein kinase 1 (CK1) abolishes the phosphorylation of Ser-158 and impedes OREBP/TonEBP nuclear export and that recombinant CK1 phosphorylates Ser-158. Knockdown of CK1alpha1L, a novel isoform of CK1, inhibits hypotonicity-induced OREBP/TonEBP nuclear export. Together these data highlight the importance of Ser-155 and Ser-158 in the nucleocytoplasmic trafficking of OREBP/TonEBP and indicate that CK1 plays a major role in regulating this process. PMID:18411282

  5. Phosphorylation by Casein Kinase 1 Regulates Tonicity-induced Osmotic Response Element-binding Protein/Tonicity Enhancer-binding Protein Nucleocytoplasmic Trafficking*

    PubMed Central

    Xu, SongXiao; Wong, Catherine C. L.; Tong, Edith H. Y.; Chung, Stephen S. M.; Yates, John R.; Yin, YiBing; Ko, Ben C. B.


    The osmotic response element-binding protein (OREBP), also known as tonicity enhancer-binding protein (TonEBP) or NFAT5, is the only known osmo-sensitive transcription factor that mediates cellular adaptations to extracellular hypertonic stress. Although it is well documented that the subcellular localization and transactivation activity of OREBP/TonEBP are tightly regulated by extracellular tonicity, the molecular mechanisms involved remain elusive. Here we show that nucleocytoplasmic trafficking of OREBP/TonEBP is regulated by the dual phosphorylation of Ser-155 and Ser-158. Alanine scanning mutagenesis revealed that Ser-155 is an essential residue that regulates OREBP/TonEBP nucleocytoplasmic trafficking. Tandem mass spectrometry revealed that Ser-155 and Ser-158 of OREBP/TonEBP are both phosphorylated in living cells under hypotonic conditions. In vitro phosphorylation assays further suggest that phosphorylation of the two serine residues proceeds in a hierarchical manner with phosphorylation of Ser-155 priming the phosphorylation of Ser-158 and that these phosphorylations are essential for nucleocytoplasmic trafficking of the transcription factor. Finally, we have shown that the pharmacological inhibition of casein kinase 1 (CK1) abolishes the phosphorylation of Ser-158 and impedes OREBP/TonEBP nuclear export and that recombinant CK1 phosphorylates Ser-158. Knockdown of CK1α1L, a novel isoform of CK1, inhibits hypotonicity-induced OREBP/TonEBP nuclear export. Together these data highlight the importance of Ser-155 and Ser-158 in the nucleocytoplasmic trafficking of OREBP/TonEBP and indicate that CK1 plays a major role in regulating this process. PMID:18411282

  6. Location, Location, Location: Development of Spatiotemporal Sequence Learning in Infancy

    ERIC Educational Resources Information Center

    Kirkham, Natasha Z.; Slemmer, Jonathan A.; Richardson, Daniel C.; Johnson, Scott P.


    We investigated infants' sensitivity to spatiotemporal structure. In Experiment 1, circles appeared in a statistically defined spatial pattern. At test 11-month-olds, but not 8-month-olds, looked longer at a novel spatial sequence. Experiment 2 presented different color/shape stimuli, but only the location sequence was violated during test;…

  7. The location of protein S8 and surrounding elements of 16S rRNA in the 70S ribosome from combined use of directed hydroxyl radical probing and X-ray crystallography.

    PubMed Central

    Lancaster, L; Culver, G M; Yusupova, G Z; Cate, J H; Yusupov, M M; Noller, H F


    Ribosomal protein S8, which is essential for the assembly of the central domain of 16S rRNA, is one of the most thoroughly studied RNA-binding proteins. To map its surrounding RNA in the ribosome, we carried out directed hydroxyl radical probing of 16S rRNA using Fe(II) tethered to nine different positions on the surface of protein S8 in 70S ribosomes. Hydroxyl radical-induced cleavage was observed near the classical S8-binding site in the 620 stem, and flanking the other S8-footprinted regions of the central domain at the three-helix junction near position 650 and the 825 and 860 stems. In addition, cleavage near the 5' terminus of 16S rRNA, in the 300 region of its 5' domain, and in the 1070 region of its 3'-major domain provide information about the proximity to S8 of RNA elements not directly involved in its binding. These data, along with previous footprinting and crosslinking results, allowed positioning of protein S8 and its surrounding RNA elements in a 7.8-A map of the Thermus thermophilus 70S ribosome. The resulting model is in close agreement with the extensive body of data from previous studies using protein-protein and protein-RNA crosslinking, chemical and enzymatic footprinting, and genetics. PMID:10836793

  8. Tissue-specific control elements of the Thy-1 gene.

    PubMed Central

    Vidal, M; Morris, R; Grosveld, F; Spanopoulou, E


    We have exploited the structural homology, but different patterns of expression of the murine and human Thy-1 genes to map a number of tissue-specific enhancer elements in the genes. All of these are located downstream from the site of transcriptional initiation. The human gene contains separate elements which direct expression to the kidney or spleen epithelium. The murine gene lacks these elements but instead contains a thymocyte specific enhancer in the third intron. Developmentally-regulated expression in nerve cells is directed (at least in part) by an atypical element in the first intron. The latter is active on heterologous promoters, but is position and distance dependent. Images Fig. 2. Fig. 4. Fig. 5. Fig. 6. PMID:1968831

  9. The Ages, Metallicities, and Alpha Element Enhancements of Globular Clusters in the Elliptical NGC 5128: A Homogeneous Spectroscopic Study with Gemini/Gemini Multi-Object Spectrograph

    NASA Astrophysics Data System (ADS)

    Woodley, Kristin A.; Harris, William E.; Puzia, Thomas H.; Gómez, Matías; Harris, Gretchen L. H.; Geisler, Doug


    We present new integrated light spectroscopy of globular clusters (GCs) in NGC 5128, a nearby giant elliptical galaxy less than 4 Mpc away, in order to measure radial velocities and derive ages, metallicities, and alpha-element abundance ratios. Using the Gemini South 8 meter telescope with the instrument Gemini Multi-Object Spectrograph, we obtained spectroscopy in the range of ~3400-5700 Å for 72 GCs with a signal-to-noise ratio greater than 30 Å-1 and we have also discovered 35 new GCs within NGC 5128 from our radial velocity measurements. We measured and compared the Lick indices from Hδ A through Fe5406 with the single stellar population models of Thomas et al. in order to derive age, metallicity, and [α/Fe] values. We also measure Lick indices for 41 Milky Way GCs from Puzia et al. and Schiavon et al. with the same methodology for direct comparison. Our results show that 68% of the NGC 5128 GCs have old ages (>8 Gyr), 14% have intermediate ages (5-8 Gyr), and 18% have young ages (<5 Gyr). However, when we look at the metallicity of the GCs as a function of age, we find 92% of metal-poor GCs and 56% of metal-rich GCs in NGC 5128 have ages >8 Gyr, indicating that the majority of both metallicity subpopulations of GCs formed earlier, with a significant population of young and metal-rich GCs forming later. Our metallicity distribution function generated directly from spectroscopic Lick indices is clearly bimodal, as is the color distribution of the same set of GCs. Thus, the metallicity bimodality is real and not an artifact of the color to metallicity conversion. However, the metallicity distribution function obtained from comparison with the single stellar population models is consistent with a unimodal, bimodal, or multimodal shape. The [α/Fe] values are supersolar with a mean value of 0.14 ± 0.04, indicating a fast formation timescale. However, the GCs in NGC 5128 are not as [α/Fe] enhanced as the Milky Way GCs also examined in this study. Our measured

  10. Cable-fault locator

    NASA Technical Reports Server (NTRS)

    Cason, R. L.; Mcstay, J. J.; Heymann, A. P., Sr.


    Inexpensive system automatically indicates location of short-circuited section of power cable. Monitor does not require that cable be disconnected from its power source or that test signals be applied. Instead, ground-current sensors are installed in manholes or at other selected locations along cable run. When fault occurs, sensors transmit information about fault location to control center. Repair crew can be sent to location and cable can be returned to service with minimum of downtime.

  11. 40 CFR 141.703 - Sampling locations.

    Code of Federal Regulations, 2013 CFR


    ... 141.703 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Enhanced Treatment for Cryptosporidium Source Water Monitoring Requirements § 141.703 Sampling locations. (a) Systems required to conduct source water...

  12. 40 CFR 141.703 - Sampling locations.

    Code of Federal Regulations, 2012 CFR


    ... 141.703 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Enhanced Treatment for Cryptosporidium Source Water Monitoring Requirements § 141.703 Sampling locations. (a) Systems required to conduct source water...

  13. 40 CFR 141.703 - Sampling locations.

    Code of Federal Regulations, 2014 CFR


    ... 141.703 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Enhanced Treatment for Cryptosporidium Source Water Monitoring Requirements § 141.703 Sampling locations. (a) Systems required to conduct source water...

  14. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.


    Suyama, Mikita; Lathe, Warren C; Bork, Peer


    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions. PMID:16182294

  15. Enhancement in statistical and image analysis for in situ µSXRF studies of elemental distribution and co-localization, using Dioscorea balcanica

    PubMed Central

    Dučić, Tanja; Borchert, Manuela; Savić, Aleksandar; Kalauzi, Aleksandar; Mitrović, Aleksandra; Radotić, Ksenija


    Synchrotron-based X-ray microfluorescence (µSXRF) is an analytical method suitable for in situ investigation of the distribution of micronutrient and macronutrient elements in several-micrometres-thick unstained biological samples, e.g. single cells and tissues. Elements are mapped and quantified at sub-p.p.m. concentrations. In this study the quantity, distribution and grouping/co-localization of various elements have been identified in straight and twisted internodes of the stems of the monocotyledonous climber D. balcanica Košanin. Three different statistical methods were employed to analyse the macro­nutrient and micronutrient distributions and co-localization. Macronutrient elements (K, P, Ca, Cl) are distributed homogeneously in both straight and twisted internodes. Micronutrient elements are mostly grouped in the vasculature and in the sclerenchyma cell layer. In addition, co-localization of micronutrient elements is much more prominent in twisted than in straight internodes. These image analyses and statistical methods provided very similar outcomes and could be applied to various types of biological samples imaged by µSXRF. PMID:23412492

  16. The business of deubiquitination – location, location, location

    PubMed Central

    Coyne, Erin S.; Wing, Simon S.


    A majority of proteins in the cell can be modified by ubiquitination, thereby altering their function or stability. This ubiquitination is controlled by both ubiquitinating and deubiquitinating enzymes (DUBs). The number of ubiquitin ligases exceeds that of DUBs by about eightfold, indicating that DUBs may have much broader substrate specificity. Despite this, DUBs have been shown to have quite specific physiological functions. This functional specificity is likely due to very precise regulation of activity arising from the sophisticated use of all mechanisms of enzyme regulation. In this commentary, we briefly review key features of DUBs with more emphasis on regulation. In particular, we focus on localization of the enzymes as a critical regulatory mechanism which when integrated with control of expression, substrate activation, allosteric regulation, and post-translational modifications results in precise spatial and temporal deubiquitination of proteins and therefore specific physiological functions. Identification of compounds that target the structural elements in DUBs that dictate localization may be a more promising approach to development of drugs with specificity of action than targeting the enzymatic activity, which for most DUBs is dependent on a thiol group that can react non-specifically with many compounds in large-scale screening. PMID:26918171

  17. It's elemental

    NASA Astrophysics Data System (ADS)

    The Periodic Table of the elements will now have to be updated. An international team of researchers has added element 110 to the Earth's armory of elements. Though short-lived—of the order of microseconds, element 110 bottoms out the list as the heaviest known element on the planet. Scientists at the Heavy Ion Research Center in Darmstadt, Germany, made the 110-proton element by colliding a lead isotope with nickel atoms. The element, which is yet to be named, has an atomic mass of 269.

  18. Laser-assisted manufacturing of micro-optical volume elements for enhancing the amount of light absorbed by solar cells in photovoltaic modules

    NASA Astrophysics Data System (ADS)

    Peharz, Gerhard; Kuna, Ladislav; Leiner, Claude


    The laser-generation of micro-optical volume elements is a promising approach to decrease the optical shadowing of front side metal contacts of solar cells. Focusing a femtosecond laser beam into the volume of the encapsulation material causes a local modification its optical constants. Suchlike fabricated micro-optical elements can be used to decrease the optical shadowing of the front side metallization of c-Si solar cells. Test samples comprising of a sandwich structure of a glass sheet with metallic grid-lines, an Ethylene-vinyl acetate (EVA) encapsulant and another glass sheet were manufactured in order to investigate the optical performance of the volume optics. Transmission measurements show that the shadowing of the metalling grid-lines is substantially decreased by the micro-optical volume elements created in the EVA bulk right above the grid-fingers. A detailed investigation of the optical properties of these volume elements was performed: (i) experimentally on the basis of goniometric measurements, as well as (ii) theoretically by applying optical modelling and optimization procedures. This resulted in a better understanding of the effectiveness of the optical volume elements in decreasing the optical shadowing of metal grid lines on the active cell surfaces. Moreover, results of photovoltaic mini-modules with incorporated micro-optical volume elements are presented. Results of optical simulation and Laser Beam Induced Current (LBIC) experiments show that the losses due to the grid fingers can be reduced by about 50%, when using this fs-laser structuring approach for the fabrication of micro-optical volume elements in the EVA material.

  19. Sarsat location algorithms

    NASA Astrophysics Data System (ADS)

    Nardi, Jerry

    The Satellite Aided Search and Rescue (Sarsat) is designed to detect and locate distress beacons using satellite receivers. Algorithms used for calculating the positions of 406 MHz beacons and 121.5/243 MHz beacons are presented. The techniques for matching, resolving and averaging calculated locations from multiple satellite passes are also described along with results pertaining to single pass and multiple pass location estimate accuracy.

  20. Reversible micromachining locator


    Salzer, Leander J.; Foreman, Larry R.


    This invention provides a device which includes a locator, a kinematic mount positioned on a conventional tooling machine, a part carrier disposed on the locator and a retainer ring. The locator has disposed therein a plurality of steel balls, placed in an equidistant position circumferentially around the locator. The kinematic mount includes a plurality of magnets which are in registry with the steel balls on the locator. In operation, a blank part to be machined is placed between a surface of a locator and the retainer ring (fitting within the part carrier). When the locator (with a blank part to be machined) is coupled to the kinematic mount, the part is thus exposed for the desired machining process. Because the locator is removably attachable to the kinematic mount, it can easily be removed from the mount, reversed, and reinserted onto the mount for additional machining. Further, the locator can likewise be removed from the mount and placed onto another tooling machine having a properly aligned kinematic mount. Because of the unique design and use of magnetic forces of the present invention, positioning errors of less than 0.25 micrometer for each machining process can be achieved.

  1. Reversible micromachining locator


    Salzer, L.J.; Foreman, L.R.


    This invention provides a device which includes a locator, a kinematic mount positioned on a conventional tooling machine, a part carrier disposed on the locator and a retainer ring. The locator has disposed therein a plurality of steel balls, placed in an equidistant position circumferentially around the locator. The kinematic mount includes a plurality of magnets which are in registry with the steel balls on the locator. In operation, a blank part to be machined is placed between a surface of a locator and the retainer ring (fitting within the part carrier). When the locator (with a blank part to be machined) is coupled to the kinematic mount, the part is thus exposed for the desired machining process. Because the locator is removably attachable to the kinematic mount, it can easily be removed from the mount, reversed, and reinserted onto the mount for additional machining. Further, the locator can likewise be removed from the mount and placed onto another tooling machine having a properly aligned kinematic mount. Because of the unique design and use of magnetic forces of the present invention, positioning errors of less than 0.25 micrometer for each machining process can be achieved. 7 figs.



    Hurford, W.J.; Gordon, R.B.; Johnson, W.A.


    A sandwich-type fuel element for a reactor is described. This fuel element has the shape of an elongated flat plate and includes a filler plate having a plurality of compartments therein in which the fuel material is located. The filler plate is clad on both sides with a thin cladding material which is secured to the filler plate only to completely enclose the fuel material in each compartment. (AEC)



    Wigner, E.P.; Szilard, L.; Creutz, E.C.


    These fuel elements are comprised of a homogeneous metallic uranium body completely enclosed and sealed in an aluminum cover. The uranium body and aluminum cover are bonded together by a layer of zinc located between them. The bonding layer serves to improve transfer of heat, provides an additional protection against corrosion of the uranium by the coolant, and also localizes any possible corrosion by preventing travel of corrosive material along the surface of the fuel element.

  4. Location Bias of Identifiers in Clinical Narratives

    PubMed Central

    Hanauer, David A; Mei, Qiaozhu; Malin, Bradley; Zheng, Kai


    Scrubbing identifying information from narrative clinical documents is a critical first step to preparing the data for secondary use purposes, such as translational research. Evidence suggests that the differential distribution of protected health information (PHI) in clinical documents could be used as additional features to improve the performance of automated de-identification algorithms or toolkits. However, there has been little investigation into the extent to which such phenomena transpires in practice. To empirically assess this issue, we identified the location of PHI in 140,000 clinical notes from an electronic health record system and characterized the distribution as a function of location in a document. In addition, we calculated the ‘word proximity’ of nearby PHI elements to determine their co-occurrence rates. The PHI elements were found to have non-random distribution patterns. Location within a document and proximity between PHI elements might therefore be used to help de-identification systems better label PHI. PMID:24551358

  5. Object locating system


    Novak, James L.; Petterson, Ben


    A sensing system locates an object by sensing the object's effect on electric fields. The object's effect on the mutual capacitance of electrode pairs varies according to the distance between the object and the electrodes. A single electrode pair can sense the distance from the object to the electrodes. Multiple electrode pairs can more precisely locate the object in one or more dimensions.

  6. Reversible micromachining locator

    SciTech Connect

    Salzer, Leander J.; Foreman, Larry R.


    A locator with a part support is used to hold a part onto the kinematic mount of a tooling machine so that the part can be held in or replaced in exactly the same position relative to the cutting tool for machining different surfaces of the part or for performing different machining operations on the same or different surfaces of the part. The locator has disposed therein a plurality of steel balls placed at equidistant positions around the planar surface of the locator and the kinematic mount has a plurality of magnets which alternate with grooves which accommodate the portions of the steel balls projecting from the locator. The part support holds the part to be machined securely in place in the locator. The locator can be easily detached from the kinematic mount, turned over, and replaced onto the same kinematic mount or another kinematic mount on another tooling machine without removing the part to be machined from the locator so that there is no need to touch or reposition the part within the locator, thereby assuring exact replication of the position of the part in relation to the cutting tool on the tooling machine for each machining operation on the part.

  7. Acoustic emission source location

    NASA Astrophysics Data System (ADS)

    Promboon, Yajai

    The objective of the research program was development of reliable source location techniques. The study comprised two phases. First, the research focused on development of source location methods for homogeneous plates. The specimens used in the program were steel railroad tank cars. Source location methods were developed and demonstrated for empty and water filled tanks. The second phase of the research was an exploratory study of source location method for fiber reinforced composites. Theoretical analysis and experimental measurement of wave propagation were carried out. This data provided the basis for development of a method using the intersection of the group velocity curves for the first three wave propagation modes. Simplex optimization was used to calculate the location of the source. Additional source location methods have been investigated and critically examined. Emphasis has been placed on evaluating different methods for determining the time of arrival of a wave. The behavior of wave in a water filled tank was studied and source location methods suitable for use in this situation have been examined through experiment and theory. Particular attention is paid to the problem caused by leaky Lamb waves. A preliminary study into the use of neural networks for source location in fiber reinforced composites was included in the research program. A preliminary neural network model and the results from training and testing data are reported.

  8. The selection and function of cell type-specific enhancers.


    Heinz, Sven; Romanoski, Casey E; Benner, Christopher; Glass, Christopher K


    The human body contains several hundred cell types, all of which share the same genome. In metazoans, much of the regulatory code that drives cell type-specific gene expression is located in distal elements called enhancers. Although mammalian genomes contain millions of potential enhancers, only a small subset of them is active in a given cell type. Cell type-specific enhancer selection involves the binding of lineage-determining transcription factors that prime enhancers. Signal-dependent transcription factors bind to primed enhancers, which enables these broadly expressed factors to regulate gene expression in a cell type-specific manner. The expression of genes that specify cell type identity and function is associated with densely spaced clusters of active enhancers known as super-enhancers. The functions of enhancers and super-enhancers are influenced by, and affect, higher-order genomic organization. PMID:25650801

  9. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sha...

  10. Analysis of two P-element enhancer-trap insertion lines that show expression in the giant fibre neuron of Drosophila melanogaster.


    Allen, M J; Drummond, J A; Sweetman, D J; Moffat, K G


    The giant fibre system (GFS) of Drosophila is a simple neural circuit that mediates escape responses in adult flies. Here we report the initial characterization of two genes that are preferentially expressed in the GFS. Two P-element insertion lines, carrying the GAL4 transcriptional activator, were identified that exhibited pronounced expression in elements of the GFS and relatively low levels elsewhere within the adult central nervous system. Genomic DNA flanking the P-element insertion site was recovered from each of these lines, sequenced, and nearby transcripts identified and confirmed to exhibit GFS expression by in situ hybridization. This analysis revealed that these P-elements were in previously characterized genes. Line P[GAL4]-A307 has an insert in the gene short stop for which we have identified a novel transcript, while line P[GAL4]-141 has an insert in the transcription factor ken and barbie. Here we show that ken and barbie mutants have defects in escape behaviour, behavioural responses to visual stimuli and synaptic functions in the GFS. We have therefore revealed a neural role for a transcription factor that previously had no implicated neural function. PMID:16879616

  11. An AP-1 binding site in the enhancer/core element of the HIV-1 promoter controls the ability of HIV-1 to establish latent infection.


    Duverger, Alexandra; Wolschendorf, Frank; Zhang, Mingce; Wagner, Fredric; Hatcher, Brandon; Jones, Jennifer; Cron, Randall Q; van der Sluis, Renee M; Jeeninga, Rienk E; Berkhout, Ben; Kutsch, Olaf


    Following integration, HIV-1 in most cases produces active infection events; however, in some rare instances, latent infection events are established. The latter have major clinical implications, as latent infection allows the virus to persist despite antiretroviral therapy. Both the cellular factors and the viral elements that potentially determine whether HIV-1 establishes active or latent infection events remain largely elusive. We detail here the contribution of different long terminal repeat (LTR) sequences for the establishment of latent HIV-1 infection. Using a panel of full-length replication-competent virus constructs that reflect naturally occurring differences of HIV-1 subtype-specific LTRs and targeted LTR mutants, we found the primary ability of HIV-1 to establish latent infection in this system to be controlled by a four-nucleotide (nt) AP-1 element just upstream of the NF-κB element in the viral promoter. Deletion of this AP-1 site mostly deprived HIV-1 of the ability to establish latent HIV-1 infection. Extension of this site to a 7-nt AP-1 sequence massively promoted latency establishment, suggesting that this promoter region represents a latency establishment element (LEE). Given that these minimal changes in a transcription factor binding site affect latency establishment to such large extent, our data support the notion that HIV-1 latency is a transcription factor restriction phenomenon. PMID:23236059

  12. An AP-1 Binding Site in the Enhancer/Core Element of the HIV-1 Promoter Controls the Ability of HIV-1 To Establish Latent Infection

    PubMed Central

    Duverger, Alexandra; Wolschendorf, Frank; Zhang, Mingce; Wagner, Fredric; Hatcher, Brandon; Jones, Jennifer; Cron, Randall Q.; van der Sluis, Renee M.; Jeeninga, Rienk E.; Berkhout, Ben


    Following integration, HIV-1 in most cases produces active infection events; however, in some rare instances, latent infection events are established. The latter have major clinical implications, as latent infection allows the virus to persist despite antiretroviral therapy. Both the cellular factors and the viral elements that potentially determine whether HIV-1 establishes active or latent infection events remain largely elusive. We detail here the contribution of different long terminal repeat (LTR) sequences for the establishment of latent HIV-1 infection. Using a panel of full-length replication-competent virus constructs that reflect naturally occurring differences of HIV-1 subtype-specific LTRs and targeted LTR mutants, we found the primary ability of HIV-1 to establish latent infection in this system to be controlled by a four-nucleotide (nt) AP-1 element just upstream of the NF-κB element in the viral promoter. Deletion of this AP-1 site mostly deprived HIV-1 of the ability to establish latent HIV-1 infection. Extension of this site to a 7-nt AP-1 sequence massively promoted latency establishment, suggesting that this promoter region represents a latency establishment element (LEE). Given that these minimal changes in a transcription factor binding site affect latency establishment to such large extent, our data support the notion that HIV-1 latency is a transcription factor restriction phenomenon. PMID:23236059

  13. Sensors Locate Radio Interference

    NASA Technical Reports Server (NTRS)


    After receiving a NASA Small Business Innovation Research (SBIR) contract from Kennedy Space Center, Soneticom Inc., based in West Melbourne, Florida, created algorithms for time difference of arrival and radio interferometry, which it used in its Lynx Location System (LLS) to locate electromagnetic interference that can disrupt radio communications. Soneticom is collaborating with the Federal Aviation Administration (FAA) to install and test the LLS at its field test center in New Jersey in preparation for deploying the LLS at commercial airports. The software collects data from each sensor in order to compute the location of the interfering emitter.

  14. Substantial enhancement in intrinsic coercivity on M-type strontium hexaferrite through the increase in magneto-crystalline anisotropy by co-doping of group-V and alkali elements

    SciTech Connect

    Ahn, Kyunghan Ryu, Byungki; Korolev, Dmitry; Jae Kang, Young


    The effect of d{sup 1} impurity doping in Sr-hexaferrite (SrM) on the magnetic anisotropy is investigated. First-principles calculations revealed that group-V elements (V, Nb) are stabilized with co-doping of alkali elements. Na{sup 1+}/K{sup 1+} doping at Sr{sup 2+}-site is found to be critical to form the d{sup 1} impurities at Fe-site. Experimentally, Na–V doped SrM shows the intrinsic coercivity of ∼5.4 kOe, which is ∼300% enhancement compared to undoped SrM and comparable value to La–Co co-doped SrM. Finally, the spin-orbit coupling from non-vanishing angular momentum of d{sup 1} impurity in SrM should be a main factor for such a substantial improvement of intrinsic coercivity.

  15. Societal-Equity-Enhancing Criteria and Facility-Host Incentives Supporting Five Key Elements in the January 2012 Blue Ribbon Commission Report - 13015

    SciTech Connect

    Eriksson, Leif G.; Dials, George E.; George, Critz H.


    In February 2009, the Obama Administration announced it would abandon USA's only candidate SNF/HLW-disposal facility since 1987. In 2010, all related activities were stopped and the Blue Ribbon Commission on America's Nuclear Future was established 'to recommend a new strategy for managing the back end of the nuclear fuel cycle', which it did in January 2012, emphasizing eight key elements. However, Key Element 1, 'A new, consent-based approach to siting future nuclear facilities', is qualitative/indeterminate rather than quantitative/measurable. It is thus highly-susceptible to semantic permutations that could extend rather than, as intended, expedite the siting of future nuclear facilities unless it also defines: a) Whose consent is needed?; and b) What constitutes consent? The following 'generic', radiation-risk- and societal-equity-based criteria address these questions: 1. Identify areas affected by projected radiation and other health risks from: a. The proposed nuclear facility (facility stakeholders); and b. The related nuclear-materials-transportation routes (transportation stakeholders); then 2. Surround each stakeholder area with a buffer zone and use this enlarged foot print to identify: a. Stakeholder hosts; and b. Areas not hosting any stakeholder category (interested parties). 3. Define 'consent-based' as being at least 60 percent of the 'population' in the respective stakeholder category and apply this yardstick to both 'in favor' and 'against' votes. Although criteria 1 and 2 also need facility-based definitions to make Key Element 1 measurable, the described siting approach, augmented by related facility-host incentives, would expedite the schedule and reduce the cost for achieving Key Elements 4-6 and 8, politics permitting. (authors)

  16. Lunar Impact Flash Locations

    NASA Technical Reports Server (NTRS)

    Moser, D. E.; Suggs, R. M.; Kupferschmidt, L.; Feldman, J.


    A bright impact flash detected by the NASA Lunar Impact Monitoring Program in March 2013 brought into focus the importance of determining the impact flash location. A process for locating the impact flash, and presumably its associated crater, was developed using commercially available software tools. The process was successfully applied to the March 2013 impact flash and put into production on an additional 300 impact flashes. The goal today: provide a description of the geolocation technique developed.

  17. Infrared horizon locator

    NASA Technical Reports Server (NTRS)

    Jalink, A., Jr. (Inventor)


    A precise method and apparatus for locating the earth's infrared horizon from space that is independent of season and latitude is described. First and second integrations of the earth's radiance profile are made from space to earth with the second delayed with respect to the first. The second integration is multiplied by a predetermined constant R and then compared with the first integration. When the two are equal the horizon is located.

  18. Object locating system


    Novak, J.L.; Petterson, B.


    A sensing system locates an object by sensing the object`s effect on electric fields. The object`s effect on the mutual capacitance of electrode pairs varies according to the distance between the object and the electrodes. A single electrode pair can sense the distance from the object to the electrodes. Multiple electrode pairs can more precisely locate the object in one or more dimensions. 12 figs.

  19. DEC2-E4BP4 Heterodimer Represses the Transcriptional Enhancer Activity of the EE Element in the Per2 Promoter.


    Tanoue, Shintaro; Fujimoto, Katsumi; Myung, Jihwan; Hatanaka, Fumiyuki; Kato, Yukio; Takumi, Toru


    The circadian oscillation of clock gene expression in mammals is based on the interconnected transcriptional/translational feedback loops of Period (Per) and Bmal1. The Per feedback loop initiates transcription through direct binding of the BMAL1-CLOCK (NPAS2) heterodimer to the E-box of the Per2 promoter region. Negative feedback of PER protein on this promoter subsequently represses transcription. Other circadian transcription regulators, particularly E4BP4 and DEC2, regulate the amplitude and phase of Per2 expression rhythms. Moreover, a direct repeat of E-box-like (EE) elements in the Per2 promoter is required for its cell-autonomous circadian rhythm. However, the detailed mechanism for repression of the two core sequences of the EE element in the Per2 promoter region is unknown. Here, we show that E4BP4 binds to the Per2 EE element with DEC2 to repress transcription and identify the DEC2-E4BP4 heterodimer as a key repressor of the tightly interlocked Per2 feedback loop in the mammalian circadian oscillator. Our results suggest an additional modulatory mechanism for tuning of the phase of cell-autonomous Per2 gene expression cycling. PMID:26257703

  20. DEC2–E4BP4 Heterodimer Represses the Transcriptional Enhancer Activity of the EE Element in the Per2 Promoter

    PubMed Central

    Tanoue, Shintaro; Fujimoto, Katsumi; Myung, Jihwan; Hatanaka, Fumiyuki; Kato, Yukio; Takumi, Toru


    The circadian oscillation of clock gene expression in mammals is based on the interconnected transcriptional/translational feedback loops of Period (Per) and Bmal1. The Per feedback loop initiates transcription through direct binding of the BMAL1–CLOCK (NPAS2) heterodimer to the E-box of the Per2 promoter region. Negative feedback of PER protein on this promoter subsequently represses transcription. Other circadian transcription regulators, particularly E4BP4 and DEC2, regulate the amplitude and phase of Per2 expression rhythms. Moreover, a direct repeat of E-box-like (EE) elements in the Per2 promoter is required for its cell-autonomous circadian rhythm. However, the detailed mechanism for repression of the two core sequences of the EE element in the Per2 promoter region is unknown. Here, we show that E4BP4 binds to the Per2 EE element with DEC2 to repress transcription and identify the DEC2–E4BP4 heterodimer as a key repressor of the tightly interlocked Per2 feedback loop in the mammalian circadian oscillator. Our results suggest an additional modulatory mechanism for tuning of the phase of cell-autonomous Per2 gene expression cycling. PMID:26257703

  1. Genetic and field management strategies to enhance the nutritional value of rice grains and limit accumulation of undesirable elements such as arsenic

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enhancing the nutritional value of rice grains is of particular interest because rice is a primary dietary component for more than half of the world’s population, and is a primary source of nutrients in many underdeveloped countries. Because rice can be grown under both flooded and unflooded field ...

  2. Identification of GATA2 and AP-1 activator elements within the enhancer VNTR occurring in intron 5 of the human SIRT3 gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Human SIRT3 gene contains an intronic VNTR enhancer. A T > C transition occurring in the second repeat of each VNTR allele implies the presence/absence of a putative GATA binding motif. A partially overlapping AP-1 site, not affected by the transition, was also identified. Aims of the present study ...

  3. Active control of multi-element rotor blade airfoils

    NASA Technical Reports Server (NTRS)

    Torok, Michael S. (Inventor); Moffitt, Robert C. (Inventor); Bagai, Ashish (Inventor)


    A multi-element rotor blade includes an individually controllable main element and fixed aerodynamic surface in an aerodynamically efficient location relative to the main element. The main element is controlled to locate the fixed aerodynamic surface in a position to increase lift and/or reduce drag upon the main element at various azimuthal positions during rotation.

  4. Enhanced negative thermal expansion in La(1-x)Pr(x)Fe10.7Co0.8Si1.5 compounds by doping the magnetic rare-earth element praseodymium.


    Li, Wen; Huang, Rongjin; Wang, Wei; Tan, Jie; Zhao, Yuqiang; Li, Shaopeng; Huang, Chuanjun; Shen, Jun; Li, Laifeng


    Experiments have been performed to enhance negative thermal expansion (NTE) in the La(Fe,Co,Si)13-based compounds by optimizing the chemical composition, i.e., proper substitution of La by magnetic element Pr. It is found that increasing the absolute value of the average coefficient of thermal expansion (CTE) in the NTE temperature region (200-300 K) attributes to enhancement of the spontaneous magnetization and its growth rate with increasing Pr content. Typically, the average CTE of La(1-x)Pr(x)Fe10.7Co0.8Si1.5 with x = 0.5 reaches as large as -38.5 × 10(-6) K(-1) between 200 and 300 K (ΔT = 100 K), which is 18.5% larger than that of x = 0. The present results highlight the potential applications of La(Fe,Co,Si)13-based compounds with a larger NTE coefficient. PMID:24848739


    EPA Science Inventory

    EPA's Radiation Protection Division works to address hazards posed by technologically enhanced naturally occurring radioactive materials (TENORM). As one part of EPA's efforts to characterize risk from TENORM sources and to identify where TENORM problems exist, we have been inve...

  6. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.


    Itzhaki, H; Maxson, J M; Woodson, W R


    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene. PMID:8090746

  7. Enhanced flow injection leaching of rocks by focused microwave heating with in-line monitoring of released elements by inductively coupled plasma mass spectrometry.


    Silva, Milithza; Kyser, Kurt; Beauchemin, Diane


    A focused microwave digestion system was used to heat a mini-column of sample of crushed rock (hematite) during its successive leaching by repeated 250-microL injections of water, HNO(3) 1%, 10% and 30% (v/v). The mini-column was connected to the nebulizer of an inductively coupled plasma mass spectrometry instrument, which allowed a continuous monitoring of the progressive release of elements by a given leaching reagent. Quantitation of the accessible fraction of Mg, V, Cr, Mn, Co, Ni, Cu, Zn, Mo, Sb and Pb was done by calibration using 250-microL injections of standard solutions prepared in the leaching reagent matrices. Total digestion of the sample residue was also done to verify mass balance. With the exception of Mg, V and Co, where the same total amount was released with or without microwave heating, an increased release resulted from focused microwave heating, by up to an order of magnitude. Furthermore, mass balance was verified for more elements using microwave heating, presumably because of a lower relative proportion of spectroscopic interference as a result of an increased release of analytes. Using microwave energy in general resulted in the dissolution of additional phases, as evidenced by significantly different (208)Pb/(206)Pb ratios as well as the increased release of elements with milder reagents. In fact, in the case of Pb, leaching with 30% HNO(3) was no longer necessary as all the Pb was released in the first three leaching reagents. Microwave heating could therefore be used advantageously in on-line leaching for exploration geochemistry and environmental monitoring. PMID:17386636

  8. Capacitive system detects and locates fluid leaks

    NASA Technical Reports Server (NTRS)


    Electronic monitoring system automatically detects and locates minute leaks in seams of large fluid storage tanks and pipelines covered with thermal insulation. The system uses a capacitive tape-sensing element that is adhesively bonded over seams where fluid leaks are likely to occur.

  9. Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

    PubMed Central

    Haidar, M A; Henning, D; Busch, H


    Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription. Images PMID:1754393

  10. Marine cable location system

    SciTech Connect

    Zachariadis, R.G.


    An acoustic positioning system locates a marine cable at an exploration site, such cable employing a plurality of hydrophones at spaced-apart positions along the cable. A marine vessel measures water depth to the cable as the vessel passes over the cable and interrogates the hydrophones with sonar pulses along a slant range as the vessel travels in a parallel and horizontally offset path to the cable. The location of the hydrophones is determined from the recordings of water depth and slant range.

  11. Cable fault locator research

    NASA Astrophysics Data System (ADS)

    Cole, C. A.; Honey, S. K.; Petro, J. P.; Phillips, A. C.


    Cable fault location and the construction of four field test units are discussed. Swept frequency sounding of mine cables with RF signals was the technique most thoroughly investigated. The swept frequency technique is supplemented with a form of moving target indication to provide a method for locating the position of a technician along a cable and relative to a suspected fault. Separate, more limited investigations involved high voltage time domain reflectometry and acoustical probing of mine cables. Particular areas of research included microprocessor-based control of the swept frequency system, a microprocessor based fast Fourier transform for spectral analysis, and RF synthesizers.

  12. RFI emitter location techniques

    NASA Technical Reports Server (NTRS)

    Rao, B. L. J.


    The possibility is discussed of using Doppler techniques for determining the location of ground based emitters causing radio frequency interference with low orbiting satellites. An error analysis indicates that it is possible to find the emitter location within an error range of 2 n.mi. The parameters which determine the required satellite receiver characteristic are discussed briefly along with the non-real time signal processing which may by used in obtaining the Doppler curve. Finally, the required characteristics of the satellite antenna are analyzed.

  13. Telemetry location error in a forested habitat

    USGS Publications Warehouse

    Chu, D.S.; Hoover, B.A.; Fuller, M.R.; Geissler, P.H.


    The error associated with locations estimated by radio-telemetry triangulation can be large and variable in a hardwood forest. We assessed the magnitude and cause of telemetry location errors in a mature hardwood forest by using a 4-element Yagi antenna and compass bearings toward four transmitters, from 21 receiving sites. The distance error from the azimuth intersection to known transmitter locations ranged from 0 to 9251 meters. Ninety-five percent of the estimated locations were within 16 to 1963 meters, and 50% were within 99 to 416 meters of actual locations. Angles with 20o of parallel had larger distance errors than other angles. While angle appeared most important, greater distances and the amount of vegetation between receivers and transmitters also contributed to distance error.

  14. Particle impact location detector

    NASA Technical Reports Server (NTRS)

    Auer, S. O.


    Detector includes delay lines connected to each detector surface strip. When several particles strike different strips simultaneously, pulses generated by each strip are time delayed by certain intervals. Delay time for each strip is known. By observing time delay in pulse, it is possible to locate strip that is struck by particle.


    EPA Science Inventory

    A simple method to locate changes in vegetation cover, which can be used to identify areas under stress. The method only requires inexpensive NDVI data. The use of remotely sensed data is far more cost-effective than field studies and can be performed more quickly. Local knowledg...

  16. Location of Spirit's Home

    NASA Technical Reports Server (NTRS)


    This image shows where Earth would set on the martian horizon from the perspective of the Mars Exploration Rover Spirit if it were facing northwest atop its lander at Gusev Crater. Earth cannot be seen in this image, but engineers have mapped its location. This image mosaic was taken by the hazard-identification camera onboard Spirit.

  17. Improvement of efficiency of piezoelectric element attached to beam based on mechanical impedance matching

    NASA Astrophysics Data System (ADS)

    Yamada, Keisuke; Matsuhisa, Hiroshi; Utsuno, Hideo


    This paper describes new methods that improve the efficiency of a piezoelectric element attached to a beam based on mechanical impedance matching. Piezoelectric elements are often used to suppress bending vibration. They are also used as sensors or energy-harvesting sources. In such cases, the piezoelectric element is usually bonded onto the host structure by an adhesive bond. The efficiency of the piezoelectric element depends on the bonding location. When the efficiency is insufficient despite a good location, the size or number of piezoelectric elements is increased. However, the efficiency of the piezoelectric element is usually insufficient even if these methods are applied. In order to enhance the efficiency of the piezoelectric elements without using active methods, this paper proposes a mechanical impedance matching method that uses spacers or tuning for the size of the piezoelectric element. Because the attached piezoelectric element and host structure in this region behave as springs in parallel to the bending deformation, the stored strain energy in the piezoelectric element is maximized under the condition that their spring constants match. The proposed methods were theoretically investigated with consideration for the effects of the bonding layer, spacers, and host structure. The optimum conditions for the proposed methods were theoretically formulated, and the effectiveness of the proposed methods and theoretical analysis was verified through simulations and experiments.

  18. The use of roving discs and orthogonal natural frequencies for crack identification and location in rotors

    NASA Astrophysics Data System (ADS)

    Haji, Zyad N.; Olutunde Oyadiji, S.


    A variety of approaches that have been developed for the identification and localisation of cracks in a rotor system, which exploit natural frequencies, require a finite element model to obtain the natural frequencies of the intact rotor as baseline data. In fact, such approaches can give erroneous results about the location and depth of a crack if an inaccurate finite element model is used to represent an uncracked model. A new approach for the identification and localisation of cracks in rotor systems, which does not require the use of the natural frequencies of an intact rotor as a baseline data, is presented in this paper. The approach, named orthogonal natural frequencies (ONFs), is based only on the natural frequencies of the non-rotating cracked rotor in the two lateral bending vibration x-z and y-z planes. The approach uses the cracked natural frequencies in the horizontal x-z plane as the reference data instead of the intact natural frequencies. Also, a roving disc is traversed along the rotor in order to enhance the dynamics of the rotor at the cracked locations. At each spatial location of the roving disc, the two ONFs of the rotor-disc system are determined from which the corresponding ONF ratio is computed. The ONF ratios are normalised by the maximum ONF ratio to obtain normalised orthogonal natural frequency curves (NONFCs). The non-rotating cracked rotor is simulated by the finite element method using the Bernoulli-Euler beam theory. The unique characteristics of the proposed approach are the sharp, notched peaks at the crack locations but rounded peaks at non-cracked locations. These features facilitate the unambiguous identification and locations of cracks in rotors. The effects of crack depth, crack location, and mass of a roving disc are investigated. The results show that the proposed method has a great potential in the identification and localisation of cracks in a non-rotating cracked rotor.

  19. Enhanced translation by Nucleolin via G-rich elements in coding and non-coding regions of target mRNAs

    PubMed Central

    Abdelmohsen, Kotb; Tominaga, Kumiko; Lee, Eun Kyung; Srikantan, Subramanya; Kang, Min-Ju; Kim, Mihee M.; Selimyan, Roza; Martindale, Jennifer L.; Yang, Xiaoling; Carrier, France; Zhan, Ming; Becker, Kevin G.; Gorospe, Myriam


    RNA-binding proteins (RBPs) regulate gene expression at many post-transcriptional levels, including mRNA stability and translation. The RBP nucleolin, with four RNA-recognition motifs, has been implicated in cell proliferation, carcinogenesis and viral infection. However, the subset of nucleolin target mRNAs and the influence of nucleolin on their expression had not been studied at a transcriptome-wide level. Here, we globally identified nucleolin target transcripts, many of which encoded cell growth- and cancer-related proteins, and used them to find a signature motif on nucleolin target mRNAs. Surprisingly, this motif was very rich in G residues and was not only found in the 3′-untranslated region (UTR), but also in the coding region (CR) and 5′-UTR. Nucleolin enhanced the translation of mRNAs bearing the G-rich motif, since silencing nucleolin did not change target mRNA stability, but decreased the size of polysomes forming on target transcripts and lowered the abundance of the encoded proteins. In summary, nucleolin binds G-rich sequences in the CR and UTRs of target mRNAs, many of which encode cancer proteins, and enhances their translation. PMID:21737422

  20. Enhanced translation by Nucleolin via G-rich elements in coding and non-coding regions of target mRNAs.


    Abdelmohsen, Kotb; Tominaga, Kumiko; Lee, Eun Kyung; Srikantan, Subramanya; Kang, Min-Ju; Kim, Mihee M; Selimyan, Roza; Martindale, Jennifer L; Yang, Xiaoling; Carrier, France; Zhan, Ming; Becker, Kevin G; Gorospe, Myriam


    RNA-binding proteins (RBPs) regulate gene expression at many post-transcriptional levels, including mRNA stability and translation. The RBP nucleolin, with four RNA-recognition motifs, has been implicated in cell proliferation, carcinogenesis and viral infection. However, the subset of nucleolin target mRNAs and the influence of nucleolin on their expression had not been studied at a transcriptome-wide level. Here, we globally identified nucleolin target transcripts, many of which encoded cell growth- and cancer-related proteins, and used them to find a signature motif on nucleolin target mRNAs. Surprisingly, this motif was very rich in G residues and was not only found in the 3'-untranslated region (UTR), but also in the coding region (CR) and 5'-UTR. Nucleolin enhanced the translation of mRNAs bearing the G-rich motif, since silencing nucleolin did not change target mRNA stability, but decreased the size of polysomes forming on target transcripts and lowered the abundance of the encoded proteins. In summary, nucleolin binds G-rich sequences in the CR and UTRs of target mRNAs, many of which encode cancer proteins, and enhances their translation. PMID:21737422

  1. Substance Abuse Treatment Facility Locator


    ... Health Services Locator Buprenorphine Physician Locator Find a Facility in Your State To locate the drug and ... Service . Privacy Policy . Home | About the Locator | Find Facilities Near You | Find Facilities by City, County, State ...

  2. Elemental health

    SciTech Connect

    Tonneson, L.C.


    Trace elements used in nutritional supplements and vitamins are discussed in the article. Relevant studies are briefly cited regarding the health effects of selenium, chromium, germanium, silicon, zinc, magnesium, silver, manganese, ruthenium, lithium, and vanadium. The toxicity and food sources are listed for some of the elements. A brief summary is also provided of the nutritional supplements market.

  3. Discovery of the heaviest elements.


    Heßberger, Fritz P


    The search for new superheavy elements (SHEs) is at present one of the most exciting adventures in nuclear physics. Thanks to enhanced experimental techniques, the synthesis of elements Z=113 to 118 in reactions using (48)Ca projectiles and targets made of isotopes of the elements neptunium to californium has been claimed. Discovery of the elements Z=114 (named flerovium) and Z=116 (named livermorium) has been accepted by the IUPAC. The others are waiting. The situation for element 113 is particular; here claims on discovery come from groups from RIKEN, Wako, Saitama, Japan and FLNR-JINR, Dubna, Russia. PMID:23335329

  4. Identifying Liver Cancer-Related Enhancer SNPs by Integrating GWAS and Histone Modification ChIP-seq Data

    PubMed Central

    Hu, Yang; Wu, Xiaoliang; Ma, Rui


    Many disease-related single nucleotide polymorphisms (SNPs) have been inferred from genome-wide association studies (GWAS) in recent years. Numerous studies have shown that some SNPs located in protein-coding regions are associated with numerous diseases by affecting gene expression. However, in noncoding regions, the mechanism of how SNPs contribute to disease susceptibility remains unclear. Enhancer elements are functional segments of DNA located in noncoding regions that play an important role in regulating gene expression. The SNPs located in enhancer elements may affect gene expression and lead to disease. We presented a method for identifying liver cancer-related enhancer SNPs through integrating GWAS and histone modification ChIP-seq data. We identified 22 liver cancer-related enhancer SNPs, 9 of which were regulatory SNPs involved in distal transcriptional regulation. The results highlight that these enhancer SNPs may play important roles in liver cancer. PMID:27429976

  5. Identifying Liver Cancer-Related Enhancer SNPs by Integrating GWAS and Histone Modification ChIP-seq Data.


    Zhang, Tianjiao; Hu, Yang; Wu, Xiaoliang; Ma, Rui; Jiang, Qinghua; Wang, Yadong


    Many disease-related single nucleotide polymorphisms (SNPs) have been inferred from genome-wide association studies (GWAS) in recent years. Numerous studies have shown that some SNPs located in protein-coding regions are associated with numerous diseases by affecting gene expression. However, in noncoding regions, the mechanism of how SNPs contribute to disease susceptibility remains unclear. Enhancer elements are functional segments of DNA located in noncoding regions that play an important role in regulating gene expression. The SNPs located in enhancer elements may affect gene expression and lead to disease. We presented a method for identifying liver cancer-related enhancer SNPs through integrating GWAS and histone modification ChIP-seq data. We identified 22 liver cancer-related enhancer SNPs, 9 of which were regulatory SNPs involved in distal transcriptional regulation. The results highlight that these enhancer SNPs may play important roles in liver cancer. PMID:27429976

  6. Dipole Well Location


    The problem here is to model the three-dimensional response of an electromagnetic logging tool to a practical situation which is often encountered in oil and gas exploration. The DWELL code provide the electromagnetic fields on the axis of a borehole due to either an electric or a magnetic dipole located on the same axis. The borehole is cylindrical, and is located within a stratified formation in which the bedding planes are not horizontal. The anglemore » between the normal to the bedding planes and the axis of the borehole may assume any value, or in other words, the borehole axis may be tilted with respect to the bedding planes. Additionally, all of the formation layers may have invasive zones of drilling mud. The operating frequency of the source dipole(s) extends from a few Hertz to hundreds of Megahertz.« less

  7. Electric current locator


    King, Paul E.; Woodside, Charles Rigel


    The disclosure herein provides an apparatus for location of a quantity of current vectors in an electrical device, where the current vector has a known direction and a known relative magnitude to an input current supplied to the electrical device. Mathematical constants used in Biot-Savart superposition equations are determined for the electrical device, the orientation of the apparatus, and relative magnitude of the current vector and the input current, and the apparatus utilizes magnetic field sensors oriented to a sensing plane to provide current vector location based on the solution of the Biot-Savart superposition equations. Description of required orientations between the apparatus and the electrical device are disclosed and various methods of determining the mathematical constants are presented.

  8. Dipole Well Location

    SciTech Connect

    Newman, Gregory


    The problem here is to model the three-dimensional response of an electromagnetic logging tool to a practical situation which is often encountered in oil and gas exploration. The DWELL code provide the electromagnetic fields on the axis of a borehole due to either an electric or a magnetic dipole located on the same axis. The borehole is cylindrical, and is located within a stratified formation in which the bedding planes are not horizontal. The angle between the normal to the bedding planes and the axis of the borehole may assume any value, or in other words, the borehole axis may be tilted with respect to the bedding planes. Additionally, all of the formation layers may have invasive zones of drilling mud. The operating frequency of the source dipole(s) extends from a few Hertz to hundreds of Megahertz.

  9. Underwater hydrophone location survey

    NASA Technical Reports Server (NTRS)

    Cecil, Jack B.


    The Atlantic Undersea Test and Evaluation Center (AUTEC) is a U.S. Navy test range located on Andros Island, Bahamas, and a Division of the Naval Undersea Warfare Center (NUWC), Newport, RI. The Headquarters of AUTEC is located at a facility in West Palm Beach, FL. AUTEC's primary mission is to provide the U.S. Navy with a deep-water test and evaluation facility for making underwater acoustic measurements, testing and calibrating sonars, and providing accurate underwater, surface, and in-air tracking data on surface ships, submarines, aircraft, and weapon systems. Many of these programs are in support of Antisubmarine Warfare (ASW), undersea research and development programs, and Fleet assessment and operational readiness trials. Most tests conducted at AUTEC require precise underwater tracking (plus or minus 3 yards) of multiple acoustic signals emitted with the correct waveshape and repetition criteria from either a surface craft or underwater vehicle.

  10. Marine cable location system

    SciTech Connect

    Ottsen, H.; Barker, Th.


    An acoustic positioning system for locating a marine cable at an exploration site employs a plurality of acoustic transponders, each having a characteristic frequency, at spaced-apart positions along the cable. A marine vessel measures the depth to the transponders as the vessel passes over the cable and measures the slant range from the vessel to each of the acoustic transponders as the vessel travels in a parallel and horizontally offset path to the cable.

  11. Magnetic Location Indicator

    NASA Technical Reports Server (NTRS)

    Stegman, Thomas W.


    Ferrofluidic device indicates point of highest magnetic-flux density in workspace. Consists of bubble of ferrofluid in immiscible liquid carrier in clear plastic case. Used in flat block or tube. Axes of centering circle on flat-block version used to mark location of maximum flux density when bubble in circle. Device used to find point on wall corresponding to known point on opposite side of wall.

  12. Ammonia Leak Locator Study

    NASA Technical Reports Server (NTRS)

    Dodge, Franklin T.; Wuest, Martin P.; Deffenbaugh, Danny M.


    The thermal control system of International Space Station Alpha will use liquid ammonia as the heat exchange fluid. It is expected that small leaks (of the order perhaps of one pound of ammonia per day) may develop in the lines transporting the ammonia to the various facilities as well as in the heat exchange equipment. Such leaks must be detected and located before the supply of ammonia becomes critically low. For that reason, NASA-JSC has a program underway to evaluate instruments that can detect and locate ultra-small concentrations of ammonia in a high vacuum environment. To be useful, the instrument must be portable and small enough that an astronaut can easily handle it during extravehicular activity. An additional complication in the design of the instrument is that the environment immediately surrounding ISSA will contain small concentrations of many other gases from venting of onboard experiments as well as from other kinds of leaks. These other vapors include water, cabin air, CO2, CO, argon, N2, and ethylene glycol. Altogether, this local environment might have a pressure of the order of 10(exp -7) to 10(exp -6) torr. Southwest Research Institute (SwRI) was contracted by NASA-JSC to provide support to NASA-JSC and its prime contractors in evaluating ammonia-location instruments and to make a preliminary trade study of the advantages and limitations of potential instruments. The present effort builds upon an earlier SwRI study to evaluate ammonia leak detection instruments [Jolly and Deffenbaugh]. The objectives of the present effort include: (1) Estimate the characteristics of representative ammonia leaks; (2) Evaluate the baseline instrument in the light of the estimated ammonia leak characteristics; (3) Propose alternative instrument concepts; and (4) Conduct a trade study of the proposed alternative concepts and recommend promising instruments. The baseline leak-location instrument selected by NASA-JSC was an ion gauge.

  13. Transcription of T cell receptor beta-chain genes is controlled by a downstream regulatory element.

    PubMed Central

    Krimpenfort, P; de Jong, R; Uematsu, Y; Dembic, Z; Ryser, S; von Boehmer, H; Steinmetz, M; Berns, A


    To characterize cis-acting elements controlling the expression of T cell receptor beta-chains we generated a number of transgenic mouse lines harboring a rearranged T cell receptor beta-chain with different extensions of 5' and 3' flanking sequences. Transcriptional analysis of transgenic mice carrying these clones showed that sequences located downstream of the polyadenylation signal of the C beta 2 region are indispensable for expression in transgenic mice. The sequences conferring enhancer activity in this fragment were further defined by transient CAT assays. Strong enhancer activity was found to reside in a 550 bp fragment located 5 kb downstream from C beta 2. The nucleotide sequence of this fragment revealed a number of oligonucleotide motifs characteristic for enhancer elements. Images PMID:3396541

  14. Sodium Phenylbutyrate Enhances Astrocytic Neurotrophin Synthesis via Protein Kinase C (PKC)-mediated Activation of cAMP-response Element-binding Protein (CREB)

    PubMed Central

    Corbett, Grant T.; Roy, Avik; Pahan, Kalipada


    Neurotrophins, such as brain-derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3), are believed to be genuine molecular mediators of neuronal growth and homeostatic synapse activity. However, levels of these neurotrophic factors decrease in different brain regions of patients with Alzheimer disease (AD). Induction of astrocytic neurotrophin synthesis is a poorly understood phenomenon but represents a plausible therapeutic target because neuronal neurotrophin production is aberrant in AD and other neurodegenerative diseases. Here, we delineate that sodium phenylbutyrate (NaPB), a Food and Drug Administration-approved oral medication for hyperammonemia, induces astrocytic BDNF and NT-3 expression via the protein kinase C (PKC)-cAMP-response element-binding protein (CREB) pathway. NaPB treatment increased the direct association between PKC and CREB followed by phosphorylation of CREB (Ser133) and induction of DNA binding and transcriptional activation of CREB. Up-regulation of markers for synaptic function and plasticity in cultured hippocampal neurons by NaPB-treated astroglial supernatants and its abrogation by anti-TrkB blocking antibody suggest that NaPB-induced astroglial neurotrophins are functionally active. Moreover, oral administration of NaPB increased the levels of BDNF and NT-3 in the CNS and improved spatial learning and memory in a mouse model of AD. Our results highlight a novel neurotrophic property of NaPB that may be used to augment neurotrophins in the CNS and improve synaptic function in disease states such as AD. PMID:23404502

  15. Identification of a functional estrogen-responsive enhancer element in the promoter 2 of PRDM2 gene in breast cancer cell lines.


    Abbondanza, Ciro; De Rosa, Caterina; D'Arcangelo, Andrea; Pacifico, Marianna; Spizuoco, Clorinda; Piluso, Giulio; Di Zazzo, Erika; Gazzerro, Patrizia; Medici, Nicola; Moncharmont, Bruno; Puca, Giovanni Alfredo


    The retinoblastoma protein-interacting zinc-finger (RIZ) gene, also known as PRDM2, encodes two protein products, RIZ1 and RIZ2, differing for the presence of a 202 aa domain, called PR domain, at the N-terminus of the RIZ1 molecule. While the histone H3 K9 methyltransferase activity of RIZ1 is associated with the negative control of cell proliferation, no information is currently available on either expression regulation of the RIZ2 form or on its biological activity. RIZ proteins act as ER co-activators and promote optimal estrogen response in female reproductive tissues. In estrogen-responsive cells, 17-β estradiol modulates RIZ gene expression producing a shift in the balanced expression of the two forms. Here, we demonstrate that an estrogen-responsive element (ERE) within the RIZ promoter 2 is regulated in a ligand-specific manner by ERα, through both the AF1 and AF2 domains. The pattern of ERα binding, histone H4 acetylation, and histone H3 cyclical methylation of lysine 9 was comparable to other estrogen-regulated promoters. Association of topoisomerase IIβ with the RIZ promoter 2 confirmed the transcriptional activation induced by estrogen. We hypothesize that RIZ2, acting as a negative regulator of RIZ1 function, mediates the proliferative effect of estrogen through regulation of survival and differentiation gene expression. PMID:21503890

  16. Enhancement of photoacoustic tomography by ultrasonic computed tomography based on optical excitation of elements of a full-ring transducer array

    PubMed Central

    Xia, Jun; Huang, Chao; Maslov, Konstantin; Anastasio, Mark A.; Wang, Lihong V.


    Photoacoustic computed tomography (PACT) is a hybrid technique that combines optical excitation and ultrasonic detection to provide high resolution images in deep tissues. In the image reconstruction, a constant speed of sound (SOS) is normally assumed. This assumption, however, is often not strictly satisfied in deep tissue imaging, due to acoustic heterogeneities within the object and between the object and coupling medium. If these heterogeneities are not accounted for, they will cause distortions and artifacts in the reconstructed images. In this paper, we incorporated ultrasonic computed tomography (USCT), which measures the SOS distribution within the object, into our full-ring array PACT system. Without the need for ultrasonic transmitting electronics, USCT was performed using the same laser beam as for PACT measurement. By scanning the laser beam on the array surface, we can sequentially fire different elements. As a first demonstration of the system, we studied the effect of acoustic heterogeneities on photoacoustic vascular imaging. We verified that constant SOS is a reasonable approximation when the SOS variation is small. When the variation is large, distortion will be observed in the periphery of the object, especially in the tangential direction. PMID:24104670

  17. An interferon gamma-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes.

    PubMed Central

    Driggers, P H; Ennist, D L; Gleason, S L; Mak, W H; Marks, M S; Levi, B Z; Flanagan, J R; Appella, E; Ozato, K


    Interferons (IFNs) induce transcription of major histocompatibility complex (MHC) class I genes through the conserved IFN consensus sequence (ICS) that contains an IFN response motif shared by many IFN-regulated genes. By screening mouse lambda ZAP expression libraries with the ICS as a probe, we isolated a cDNA clone encoding a protein that binds the ICS, designated ICSBP. Protein blot analysis with labeled oligonucleotide probes showed that ICSBP binds not only the MHC class I ICS but also IFN response motifs of many IFN-regulated genes, as well as a virus-inducible element of the IFN-beta gene. The ICSBP cDNA encodes 424 amino acids and a long 3' untranslated sequence. The N-terminal 115 amino acids correspond to a putative DNA-binding domain and show significant sequence similarity with other cloned IFN response factors (IRF-1 and IRF-2). Because of the structural similarity and shared binding specificity, we conclude that ICSBP is a third member of the IRF gene family, presumably playing a role in IFN- and virus-mediated regulation of many genes. Although IRF-1 and IRF-2 share some similarity in their C-terminal regions, ICSBP shows no similarity to IRF-1 or IRF-2 in this region, suggesting that it is more distantly related. We show that ICSBP mRNA is expressed predominantly in lymphoid tissues and is inducible preferentially by IFN-gamma. The induction by IFN-gamma appears to be predominant in lymphocytes and macrophages, implying that ICSBP plays a regulatory role in cells of the immune system. The presence of multiple factors that bind common IFN response motifs may partly account for the complexity and diversity of IFN action as well as IFN-regulated gene expression. Images PMID:2111015

  18. Phorbol ester treatment to mice inhibits DNA binding of the TCDD inducible nuclear dioxin-receptor to Cyp1A1 enhancer elements

    SciTech Connect

    Okino, S.T.; Tukey, R.H. )


    The treatment of C57BL/6 mice with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) results in transcriptional activation of the Cyp1A1 and Cyp1A2 genes. Quantitation of mRNA levels and transcription rates demonstrate that post-transcriptional mechanisms are not involved in TCDD induction of the Cyp1A genes. The induction of the Cyp1A genes by TCDD occurs following ligand binding to the dioxin-receptor and accumulation of the ligand-receptor complex in the nucleus. The administration of the tumor promoting agent 12-O-tetradecanoylphorbol-13-acetate (TPA) before or in combination with the administration of TCDD inhibits transcriptional activation of the Cyp1A genes. To analyze the mechanism of this inhibition, methods were developed to determine if the DNA binding potential of the nuclear dioxin-receptor was impaired. Using an oligonucleotide covering the Cyp1A1 xenobiotic responsive element (XRE), gel retardation assays demonstrated that within 1 hour, TCDD induces a nuclear DNA binding protein. This bonding is completely inhibited when incubated with excess XRE. Transcriptional increases in the Cyp1A1 and Cyp1A2 gene follow the appearance of the nuclear dioxin-receptor. When TPA is administered together with TCDD, the ligand dependent accumulation of the nuclear dioxin-receptor is abolished. Similar results are observed if TPA is administered prior to treatment with TCDD. These results indicate that TPA inhibits TCDD induced activation of the Cyp1A genes through a receptor mediated mechanism.

  19. Facile synthesis of ternary Ag/AgBr-Ag2CO3 hybrids with enhanced photocatalytic removal of elemental mercury driven by visible light.


    Zhang, Anchao; Zhang, Lixiang; Lu, Hao; Chen, Guoyan; Liu, Zhichao; Xiang, Jun; Sun, Lushi


    A novel technique for photocatalytic removal of elemental mercury (Hg(0)) using visible-light-driven Ag/AgBr-Ag2CO3 hybrids was proposed. The ternary Ag/AgBr-Ag2CO3 hybrids were synthesized by a simple modified co-precipitation method and characterized by N2 adsorption-desorption, scanning electron microscope (SEM), X-ray diffraction (XRD), UV-vis diffused reflectance spectroscopy (DRS), X-ray photoelectron spectroscopy (XPS) and electron spin resonance (ESR) techniques. The effects of AgBr content, fluorescent lamp (FSL) irradiation, solution temperature, SO2 and NO on Hg(0) removal were investigated in detail. Furthermore, a possible reaction mechanism for higher Hg(0) removal was proposed, and the simultaneous removal of Hg(0), SO2 and NO was studied. The results showed that a high efficiency of Hg(0) removal was obtained by using Ag/AgBr-Ag2CO3 hybrids under fluorescent lamp irradiation. The AgBr content, FSL irradiation, solution temperature, and SO2 all exhibited significant effects on Hg(0) removal, while NO had slight effect on Hg(0) removal. The addition of Ca(OH)2 demonstrated a little impact on Hg(0) removal and could significantly improve the SO2-resistance performance of Ag/AgBr(0.7)-Ag2CO3 hybrid. The characterization results exhibited that hydroxyl radical (OH), superoxide radical (O2(-)), hole (h(+)), and Br(0), were reactive species responsible for removing Hg(0), and the h(+) played a key role in Hg(0) removal. PMID:27135702

  20. Deterministic and Probabilistic Creep and Creep Rupture Enhancement to CARES/Creep: Multiaxial Creep Life Prediction of Ceramic Structures Using Continuum Damage Mechanics and the Finite Element Method

    NASA Technical Reports Server (NTRS)

    Jadaan, Osama M.; Powers, Lynn M.; Gyekenyesi, John P.


    High temperature and long duration applications of monolithic ceramics can place their failure mode in the creep rupture regime. A previous model advanced by the authors described a methodology by which the creep rupture life of a loaded component can be predicted. That model was based on the life fraction damage accumulation rule in association with the modified Monkman-Grant creep ripture criterion However, that model did not take into account the deteriorating state of the material due to creep damage (e.g., cavitation) as time elapsed. In addition, the material creep parameters used in that life prediction methodology, were based on uniaxial creep curves displaying primary and secondary creep behavior, with no tertiary regime. The objective of this paper is to present a creep life prediction methodology based on a modified form of the Kachanov-Rabotnov continuum damage mechanics (CDM) theory. In this theory, the uniaxial creep rate is described in terms of stress, temperature, time, and the current state of material damage. This scalar damage state parameter is basically an abstract measure of the current state of material damage due to creep deformation. The damage rate is assumed to vary with stress, temperature, time, and the current state of damage itself. Multiaxial creep and creep rupture formulations of the CDM approach are presented in this paper. Parameter estimation methodologies based on nonlinear regression analysis are also described for both, isothermal constant stress states and anisothermal variable stress conditions This creep life prediction methodology was preliminarily added to the integrated design code CARES/Creep (Ceramics Analysis and Reliability Evaluation of Structures/Creep), which is a postprocessor program to commercially available finite element analysis (FEA) packages. Two examples, showing comparisons between experimental and predicted creep lives of ceramic specimens, are used to demonstrate the viability of this methodology and

  1. Elemental Education.

    ERIC Educational Resources Information Center

    Daniel, Esther Gnanamalar Sarojini; Saat, Rohaida Mohd.


    Introduces a learning module integrating three disciplines--physics, chemistry, and biology--and based on four elements: carbon, oxygen, hydrogen, and silicon. Includes atomic model and silicon-based life activities. (YDS)

  2. Superheavy Elements

    ERIC Educational Resources Information Center

    Tsang, Chin Fu


    Discusses the possibility of creating elements with an atomic number of around 114. Describes the underlying physics responsible for the limited extent of the periodic table and enumerates problems that must be overcome in creating a superheavy nucleus. (GS)

  3. CREB (cAMP response element binding protein) and C/EBPalpha (CCAAT/enhancer binding protein) are required for the superstimulation of phosphoenolpyruvate carboxykinase gene transcription by adenoviral E1a and cAMP.

    PubMed Central

    Routes, J M; Colton, L A; Ryan, S; Klemm, D J


    In the present study, we observed superstimulated levels of cAMP-stimulated transcription from the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter in cells infected with wild-type adenovirus expressing 12 S and 13 S E1a proteins, or in cells expressing 13 S E1a alone. cAMP-stimulated transcription was inhibited in cells expressing only 12 S E1a, but slightly elevated in cells expressing E1a proteins with mutations in conserved regions 1 or 2, leading us to conclude that the superstimulation was mediated by conserved region 3 of 13 S E1a. E1a failed to enhance cAMP-stimulated transcription from promoters containing mutations that abolish binding by cAMP response element binding protein (CREB) or CCAAT/enhancer binding proteins (C/EBPs). This result was supported by experiments in which expression of dominant-negative CREB and/or C/EBP proteins repressed E1a- and cAMP-stimulated transcription from the PEPCK gene promoter. In reconstitution experiments using a Gal4-responsive promoter, E1a enhanced cAMP-stimulated transcription when chimaeric Gal4-CREB and Gal4-C/EBPalpha were co-expressed. Phosphorylation of CREB on serine-133 was stimulated in cells treated with dibutyryl cAMP, whereas phosphorylation of C/EBPalpha was increased by E1a expression. Our data support a model in which cAMP agonists increase CREB activity and stimulate PEPCK gene transcription, a process that is enhanced by E1a through the phosphorylation of C/EBPalpha. PMID:11085926

  4. Sonar Locator Systems

    NASA Technical Reports Server (NTRS)


    An underwater locator device called a Pinger is attached to an airplane's flight recorder for recovery in case of a crash. Burnett Electronics Pinger Model 512 resulted from a Burnett Electronics Laboratory, Inc./Langley Research Center contract for development of a search system for underwater mines. The Pinger's battery-powered transmitter is activated when immersed in water, and sends multidirectional signals for up to 500 hours. When a surface receiver picks up the signal, a diver can retrieve the pinger and the attached airplane flight recorder. Other pingers are used to track whales, mark underwater discoveries and assist oil drilling vessels.

  5. Location of Planet X

    SciTech Connect

    Harrington, R.S.


    Observed positions of Uranus and Neptune along with residuals in right ascension and declination are used to constrain the location of a postulated tenth planet. The residuals are converted into residuals in ecliptic longitude and latitude. The results are then combined into seasonal normal points, producing average geocentric residuals spaced slightly more than a year apart that are assumed to represent the equivalent heliocentric average residuals for the observed oppositions. Such a planet is found to most likely reside in the region of Scorpius, with considerably less likelihood that it is in Taurus. 8 references.



    Macleish, K.G.


    ABS>This patent presents a method for locating a ground in a d-c circult having a number of parallel branches connected across a d-c source or generator. The complete method comprises the steps of locating the ground with reference to the mildpoint of the parallel branches by connecting a potentiometer across the terminals of the circuit and connecting the slider of the potentiometer to ground through a current indicating instrument, adjusting the slider to right or left of the mildpoint so as to cause the instrument to indicate zero, connecting the terminal of the network which is farthest from the ground as thus indicated by the potentiometer to ground through a condenser, impressing a ripple voltage on the circuit, and then measuring the ripple voltage at the midpoint of each parallel branch to find the branch in which is the lowest value of ripple voltage, and then measuring the distribution of the ripple voltage along this branch to determine the point at which the ripple voltage drops off to zero or substantially zero due to the existence of a ground. The invention has particular application where a circuit ground is present which will disappear if the normal circuit voltage is removed.

  7. Report of the workshop on enhancing methods for locating, accessing, and integrating population and environmental data related to marine resources in Alaska. Held in Anchorage, Alaska on April 5-7, 1994. Final report

    SciTech Connect

    Hoover-Miller, A.


    Many federal and state agencies and private institutions have conducted and are conducting research related to Alaska`s living marine resources. Data from this research are not being stored in a central repository and there is no convenient means for scientists and managers to locate and access it. Recent advances in computer technology could help overcome this problem. To examine the possibilities created by such advances, the Marine Mammal Commission sponsored a workshop in Anchorage, Alaska on 5-7 April 1994. Discussions during and following the workshop lead to recommendations, described in this report, on ways to improve knowledge of and communication among users regarding the existence, nature, and availability of potentially useful data.

  8. Evolution of anterior Hox regulatory elements among chordates

    PubMed Central


    Background The Hox family of transcription factors has a fundamental role in segmentation pathways and axial patterning of embryonic development and their clustered organization is linked with the regulatory mechanisms governing their coordinated expression along embryonic axes. Among chordates, of particular interest are the Hox paralogous genes in groups 1-4 since their expression is coupled to the control of regional identity in the anterior nervous system, where the highest structural diversity is observed. Results To investigate the degree of conservation in cis-regulatory components that form the basis of Hox expression in the anterior nervous system, we have used assays for transcriptional activity in ascidians and vertebrates to compare and contrast regulatory potential. We identified four regulatory sequences located near the CiHox1, CiHox2 and CiHox4 genes of the ascidian Ciona intestinalis which direct neural specific domains of expression. Using functional assays in Ciona and vertebrate embryos in combination with sequence analyses of enhancer fragments located in similar positions adjacent to Hox paralogy group genes, we compared the activity of these four Ciona cis-elements with a series of neural specific enhancers from the amphioxus Hox1-3 genes and from mouse Hox paralogous groups 1-4. Conclusions This analysis revealed that Kreisler and Krox20 dependent enhancers critical in segmental regulation of the hindbrain appear to be specific for the vertebrate lineage. In contrast, neural enhancers that function as Hox response elements through the action of Hox/Pbx binding motifs have been conserved during chordate evolution. The functional assays reveal that these Hox response cis-elements are recognized by the regulatory components of different and extant species. Together, our results indicate that during chordate evolution, cis-elements dependent upon Hox/Pbx regulatory complexes, are responsible for key aspects of segmental Hox expression in neural

  9. Nuclear fuel element


    Zocher, Roy W.


    A nuclear fuel element and a method of manufacturing the element. The fuel element is comprised of a metal primary container and a fuel pellet which is located inside it and which is often fragmented. The primary container is subjected to elevated pressure and temperature to deform the container such that the container conforms to the fuel pellet, that is, such that the container is in substantial contact with the surface of the pellet. This conformance eliminates clearances which permit rubbing together of fuel pellet fragments and rubbing of fuel pellet fragments against the container, thus reducing the amount of dust inside the fuel container and the amount of dust which may escape in the event of container breach. Also, as a result of the inventive method, fuel pellet fragments tend to adhere to one another to form a coherent non-fragmented mass; this reduces the tendency of a fragment to pierce the container in the event of impact.

  10. Evolution of the Human Immunodeficiency Virus Type 1 Long Terminal Repeat Promoter by Conversion of an NF-κB Enhancer Element into a GABP Binding Site

    PubMed Central

    Verhoef, Koen; Sanders, Rogier W.; Fontaine, Veronique; Kitajima, Shigetaka; Berkhout, Ben


    Human immunodeficiency virus type 1 (HIV-1) transcription is regulated by the viral Tat protein and cellular factors, of which the concentration and activity may depend on the cell type. Viral long terminal repeat (LTR) promoter sequences are therefore optimized to suit the specific nuclear environment of the target host cell. In long-term cultures of a Tat-defective, poorly replicating HIV-1 mutant, we selected for a faster-replicating virus with a 1-nucleotide deletion in the upstream copy of two highly conserved NF-κB binding sites. The variant enhancer sequence demonstrated a severe loss of NF-κB binding in protein binding assays. Interestingly, we observed a new binding activity that is specific for the variant NF-κB sequence and is present in the nuclear extract of unstimulated cells that lack NF-κB. These results suggest that inactivation of the NF-κB site coincides with binding of another transcription factor. Fine mapping of the sequence requirements for binding of this factor revealed a core sequence similar to that of Ets binding sites, and supershift assays with antibodies demonstrated the involvement of the GABP transcription factor. Transient transfection experiments with LTR-chloramphenicol acetyltransferase constructs indicated that the variant LTR promoter is specifically inhibited by GABP in the absence of Tat, but this promoter was dramatically more responsive to Tat than the wild-type LTR. Introduction of this GABP site into the LAI virus yielded a specific gain of fitness in SupT1 cells, which contain little NF-κB protein. These results suggest that GABP potentiates Tat-mediated activation of LTR transcription and viral replication in some cell types. Conversion of an NF-κB into a GABP binding site is likely to have occurred also during the worldwide spread of HIV-1, as we noticed the same LTR modification in subtype E isolates from Thailand. This typical LTR promoter configuration may provide these viruses with unique biological

  11. Enhancer Analysis

    NASA Astrophysics Data System (ADS)

    Uchikawa, Masanori; Takemoto, Tatsuya

    During embryonic development, genes are expressed under a strict spatial and temporal order in cells and tissues. This regulation is governed by regulatory regions in the genome, usually identified as enhancers (Kondoh, 2008). The identification and mapping of a set of enhancers allow clarification of essential regulatory elements involved in the enhancer action and their interacting protein factors. Enhancer analysis also determines upstream signaling cascades that regulate interacting protein factors. If the regulatory regions do not function properly, spatio-temporal order of the gene expression will be disrupted, and this may cause abnormal development and dis eases (Kleinjan & van Heyningen, 2005; Sabherwal et al., 2007). Thus, identifica tion of the regulatory regions provides an important entry point to clarify regulatory mechanisms underlying embryonic development.

  12. Groth Deep Locations Image

    NASA Technical Reports Server (NTRS)


    NASA's Galaxy Evolution Explorer photographed this ultraviolet color blowup of the Groth Deep Image on June 22 and June 23, 2003. Hundreds of galaxies are detected in this portion of the image, and the faint red galaxies are believed to be 6 billion light years away. The white boxes show the location of these distant galaxies, of which more than a 100 can be detected in this image. NASA astronomers expect to detect 10,000 such galaxies after extrapolating to the full image at a deeper exposure level.

    The Galaxy Evolution Explorer mission is led by the California Institute of Technology, which is also responsible for the science operations and data analysis. NASA's Jet Propulsion Laboratory, Pasadena, Calif., a division of Caltech, manages the mission and built the science instrument. The mission was developed under NASA's Explorers Program, managed by the Goddard Space Flight Center, Greenbelt, Md. The mission's international partners include South Korea and France.

  13. Statement of significance, site location graphic, mantle elevation, section through ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Statement of significance, site location graphic, mantle elevation, section through decorative wall element, and terra cotta details - Boston Architectural College, Terra Cotta Mantel, 951 Boylston Street, Boston, Suffolk County, MA



    Bean, R.W.


    A ceramic fuel element for a nuclear reactor that has improved structural stability as well as improved cooling and fission product retention characteristics is presented. The fuel element includes a plurality of stacked hollow ceramic moderator blocks arranged along a tubular raetallic shroud that encloses a series of axially apertured moderator cylinders spaced inwardly of the shroud. A plurality of ceramic nuclear fuel rods are arranged in the annular space between the shroud and cylinders of moderator and appropriate support means and means for directing gas coolant through the annular space are also provided. (AEC)

  15. Cobalt processing - flask positioner location sensing system

    SciTech Connect

    Braun, P.F.


    Canada deuterium uranium (CANDU) reactors offer unique opportunities for economical production of /sup 60/Co in the adjuster rods used for xenon override and maximization of core output. Cobalt is effectively a by-product in CANDU reactors with the standards stainless steel adjuster rods replaced with cobalt adjuster rods. The Flask Positioner unit is a part of the cobalt adjuster element processing system (CAEPS) equipment which is used for removing irradiated cobalt adjuster elements from the reactor and safely transporting them to the irradiated fuel bay, where they are dismantled and prepared for shipment. The flask positioner equipment is similar to a crane, carries the CAEPS flask and locates it in an accurate position concentric with any adjuster site centerline. This enables the required operations for safe transfer of the irradiated adjuster element into the flask. The positioner is located above the reactivity mechanism deck. The CAEPS system has been made operational on several CANDU reactors. The location sensing system has been demonstrated to work very satisfactorily on all installations.

  16. Object Locating System

    NASA Technical Reports Server (NTRS)

    Arndt, G. Dickey (Inventor); Carl, James R. (Inventor)


    A portable system is provided that is operational for determining, with three dimensional resolution, the position of a buried object or approximately positioned object that may move in space or air or gas. The system has a plurality of receivers for detecting the signal front a target antenna and measuring the phase thereof with respect to a reference signal. The relative permittivity and conductivity of the medium in which the object is located is used along with the measured phase signal to determine a distance between the object and each of the plurality of receivers. Knowing these distances. an iteration technique is provided for solving equations simultaneously to provide position coordinates. The system may also be used for tracking movement of an object within close range of the system by sampling and recording subsequent position of the object. A dipole target antenna. when positioned adjacent to a buried object, may be energized using a separate transmitter which couples energy to the target antenna through the medium. The target antenna then preferably resonates at a different frequency, such as a second harmonic of the transmitter frequency.

  17. Submerged marine streamer locator

    SciTech Connect

    Roberts, F.A.


    An apparatus is described for use in determining relative to known geographic locations on a sea floor the position of a moving submerged marine seismic streamer while being towed through the sea by an exploration vessel, which comprises: spaced apart acoustic receivers and at least one acoustic transducer-receiver carried by the streamer. The transducer-receiver is capable of emitting acoustic command signals when triggered by means controllable from the moving vessel and the receivers are capable of receiving and distinguishing distinctly different acoustic frequencies to transmit distinguishable signals responsive thereto along the streamer to recording means on the vessel; at least three sea floor transponders spatially displaced from each other at known positions relative to the sea floor and each of the transponders being capable of responding to a single acoustic command signal from the transducer-receiver in the moving streamer while being towed by the vessel. Each of the transponders emits signals of a distinctly different frequency; and means for recording the time interval from initiation of a command signal from the streamer transducer to the receipt of each signal relayed along the streamer from each of the receivers in response to the signals from the transponders. In this way, the distance of each of the streamer receivers from each of the known positions of the transponders may be calculated.

  18. AOTV bow shock location

    NASA Technical Reports Server (NTRS)

    Desautel, D.


    Hypersonic bow-shock location and geometry are of central importance to the aerodynamics and aerothermodynamics of aeroassisted orbital transfer vehicles (AOTVs), but they are difficult to predict for a given vehicle configuration. This paper reports experimental measurements of shock standoff distance for the 70 deg cone AOTV configuration in shock-tunnel-test flows at Mach numbers of 3.8 to 7.9 and for angles of attack from 0 deg to 20 deg. The controlling parameter for hypersonic bow-shock standoff distance (for a given forebody shape) is the mean normal-shock density ratio. Values for this parameter in the tests reported are in the same range as those of the drag-brake AOTV perigee regime. Results for standoff distance are compared with those previously reported in the literature for this AOTV configuration. It is concluded that the AOTV shock standoff distance for the conical configuration, based on frustrum (base) radius, is equivalent to that of a sphere with a radius about 35 percent greater than that of the cone; the distance is, therefore, much less than reported in previous studies. Some reasons for the discrepancies between the present and previous are advanced. The smaller standoff distance determined here implies there will be less radiative heat transfer than was previously expected.

  19. Element Research.

    ERIC Educational Resources Information Center

    Herald, Christine


    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  20. Mercury, elemental

    Integrated Risk Information System (IRIS)

    Mercury , elemental ; CASRN 7439 - 97 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinoge

  1. Teaching Business Shops and Stores' Locations through Field Studies

    ERIC Educational Resources Information Center

    Yang, Daihu; Wang, Ziying; Wu, Xianliang; Fu, Wenru


    Location, where geographic elements interwork spatially and dynamically, has been one of the enduring themes in geographic studies. There are a number of location theories to explain why things are located where they are. Alfred Weber's location theory stresses that the least cost of delivering products is a key factor in location selection,…

  2. Transfer of location-specific control to untrained locations.


    Weidler, Blaire J; Bugg, Julie M


    Recent research highlights a seemingly flexible and automatic form of cognitive control that is triggered by potent contextual cues, as exemplified by the location-specific proportion congruence effect--reduced compatibility effects in locations associated with a high as compared to low likelihood of conflict. We investigated just how flexible location-specific control is by examining whether novel locations effectively cue control for congruency-unbiased stimuli. In two experiments, biased (mostly compatible or mostly incompatible) training stimuli appeared in distinct locations. During a final block, unbiased (50% compatible) stimuli appeared in novel untrained locations spatially linked to biased locations. The flanker compatibly effect was reduced for unbiased stimuli in novel locations linked to a mostly incompatible compared to a mostly compatible location, indicating transfer. Transfer was observed when stimuli appeared along a linear function (Experiment 1) or in rings of a bullseye (Experiment 2). The novel transfer effects imply that location-specific control is more flexible than previously reported and further counter the complex stimulus-response learning account of location-specific proportion congruence effects. We propose that the representation and retrieval of control settings in untrained locations may depend on environmental support and the presentation of stimuli in novel locations that fall within the same categories of space as trained locations. PMID:26800157

  3. Elemental evidence

    NASA Astrophysics Data System (ADS)

    Carlowicz, Michael

    He set out to prove that ocean sediments contain elevated levels of the rare element iridium because of the natural weathering of the continents. Instead, what Ariel Anbar found was new evidence that a meteorite may have had a role in the mass extinctions that marked the end of the Cretaceous era.By studying the geochemical properties of iridium, Anbar, a professor of earth and environmental sciences and chemistry at the University of Rochester, found that the residence time—a measure of the rate at which an element settles out of water into sediments—of iridium in ocean water is 2000 to 20,000 years. That finding suggests that a large deposit of iridium could have lingered in the world's oceans long enough to explain the thickness of the iridium-rich sediment layers at the K-T boundary.



    Fortescue, P.; Zumwalt, L.R.


    A fuel element was developed for a gas cooled nuclear reactor. The element is constructed in the form of a compacted fuel slug including carbides of fissionable material in some cases with a breeder material carbide and a moderator which slug is disposed in a canning jacket of relatively impermeable moderator material. Such canned fuel slugs are disposed in an elongated shell of moderator having greater gas permeability than the canning material wherefore application of reduced pressure to the space therebetween causes gas diffusing through the exterior shell to sweep fission products from the system. Integral fission product traps and/or exterior traps as well as a fission product monitoring system may be employed therewith. (AEC)

  5. p300/cAMP-response-element-binding-protein ('CREB')-binding protein (CBP) modulates co-operation between myocyte enhancer factor 2A (MEF2A) and thyroid hormone receptor-retinoid X receptor.

    PubMed Central

    De Luca, Antonio; Severino, Anna; De Paolis, Paola; Cottone, Giuliano; De Luca, Luca; De Falco, Maria; Porcellini, Antonio; Volpe, Massimo; Condorelli, Gianluigi


    Thyroid hormone receptors (TRs) and members of the myocyte enhancer factor 2 (MEF2) family are involved in the regulation of muscle-specific gene expression during myogenesis. Physical interaction between these two factors is required to synergistically activate gene transcription. p300/cAMP-response-element-binding-protein ('CREB')-binding protein (CBP) interacting with transcription factors is able to increase their activity on target gene promoters. We investigated the role of p300 in regulating the TR-MEF2A complex. To this end, we mapped the regions of these proteins involved in physical interactions and we evaluated the expression of a chloramphenicol acetyltransferase (CAT) reporter gene in U2OS cells under control of the alpha-myosin heavy chain promoter containing the thyroid hormone response element (TRE). Our results suggested a role of p300/CBP in mediating the transactivation effects of the TR-retenoid X receptor (RxR)-MEF2A complex. Our findings showed that the same C-terminal portion of p300 binds the N-terminal domains of both TR and MEF2A, and our in vivo studies demonstrated that TR, MEF2A and p300 form a ternary complex. Moreover, by the use of CAT assays, we demonstrated that adenovirus E1A inhibits activation of transcription by TR-RxR-MEF2A-p300 but not by TR-RxR-MEF2A. Our data suggested that p300 can bind and modulate the activity of TR-RxR-MEF2A at TRE. In addition, it is speculated that p300 might modulate the activity of the TR-RxR-MEF2A complex by recruiting a hypothetical endogenous inhibitor which may act like adenovirus E1A. PMID:12371907


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. SITE MAP HIGHLIGHTING SIGNIFICANT BUILDINGS AND SHOWING LOCATION LOCATION OF OUTPATIENT CLINIC ADDITION - U.S. Veterans Administration Medical Center, 600 South Seventieth Street, Lincoln, Lancaster County, NE

  7. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2011 CFR


    ... 36 Parks, Forests, and Public Property 2 2011-07-01 2011-07-01 false FLEP elements. 230.35 Section... FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP funds... through the following elements: (1) Development and implementation of educational programs; (2)...

  8. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2014 CFR


    ... 36 Parks, Forests, and Public Property 2 2014-07-01 2014-07-01 false FLEP elements. 230.35 Section... FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP funds... through the following elements: (1) Development and implementation of educational programs; (2)...

  9. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2013 CFR


    ... 36 Parks, Forests, and Public Property 2 2013-07-01 2013-07-01 false FLEP elements. 230.35 Section... FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP funds... through the following elements: (1) Development and implementation of educational programs; (2)...

  10. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2010 CFR


    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false FLEP elements. 230.35 Section... FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP funds... through the following elements: (1) Development and implementation of educational programs; (2)...

  11. 36 CFR 230.35 - FLEP elements.

    Code of Federal Regulations, 2012 CFR


    ... 36 Parks, Forests, and Public Property 2 2012-07-01 2012-07-01 false FLEP elements. 230.35 Section... FORESTRY ASSISTANCE Forest Land Enhancement Program § 230.35 FLEP elements. (a) States may use FLEP funds... through the following elements: (1) Development and implementation of educational programs; (2)...

  12. Chemistry of the superheavy elements.


    Schädel, Matthias


    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. PMID:25666065

  13. Multiple widely spaced elements determine the efficiency with which a distal cistron is expressed from the polycistronic pregenomic RNA of figwort mosaic caulimovirus.


    Edskes, H K; Kiernan, J M; Shepherd, R J


    The polycistronic expression mechanism of the plant pararetrovirus figwort mosaic caulimovirus (FMV) depends upon cis-acting elements present in its pregenomic RNA and a trans-acting protein (P6) which is expressed from a monocistronic subgenomic RNA. Using transient expression of FMV-derived polycistronic reporter constructs in Nicotiana edwardsonii cell suspension protoplasts, we further analyzed the cis-acting elements involved in polycistronic expression. A cis-acting element located within the first 74 nucleotides of the 7,954-nucleotide pregenomic RNA appears to be essential for P6 to transactivate expression of an internal cistron. Expression of this internal cistron, in the presence of P6, is greatly enhanced by the combined presence of two cis-acting elements located at the 3' end of the polycistronic RNA. Surprisingly, deletion of the most upstream of these two 3' cis-acting elements exposed a negative-acting element located internally on the polycistronic RNA, at the 3' end of open reading frame I. The action of both this negative-acting internal element and the positive-acting 3' elements is more pronounced when the large 5' untranslated leader region is present. This indicates that the 5' untranslated leader region is central to regulation of the FMV gene expression mechanism. Although a limited set of elements suffices to direct polycistronic expression in this eukaryotic system, a complex interplay between elements is involved in the spatial regulation of the genes present on the pregenomic RNA of FMV. PMID:8995683

  14. Updating finite element dynamic models using an element-by-element sensitivity methodology

    NASA Astrophysics Data System (ADS)

    Farhat, Charbel; Hemez, Francois M.


    A sensitivity-based methodology for improving the finite element model of a given structure using test modal data and a few sensors is presented. The proposed method searches for both the location and sources of the mass and stiffness errors and does not interfere with the theory behind the finite element model while correcting these errors. The updating algorithm is derived from the unconstrained minimization of the squared L sub 2 norms of the modal dynamic residuals via an iterative two-step staggered procedure. At each iteration, the measured mode shapes are first expanded assuming that the model is error free, then the model parameters are corrected assuming that the expanded mode shapes are exact. The numerical algorithm is implemented in an element-by-element fashion and is capable of 'zooming' on the detected error locations. Several simulation examples which demonstate the potential of the proposed methodology are discussed.



    Howard, R.C.; Bokros, J.C.


    A fueled matrlx eontnwinlng uncomblned carbon is deslgned for use in graphlte-moderated gas-cooled reactors designed for operatlon at temperatures (about 1500 deg F) at which conventional metallic cladding would ordlnarily undergo undesired carburization or physical degeneratlon. - The invention comprlses, broadly a fuel body containlng uncombined earbon, clad with a nickel alloy contalning over about 28 percent by' weight copper in the preferred embodlment. Thls element ls supporirted in the passageways in close tolerance with the walls of unclad graphite moderator materlal. (AEC)

  16. FFTF Asbestos Location Tracking Program

    SciTech Connect

    Reynolds, J.A.


    An Asbestos Location Tracking Program was prepared to list, locate, and determine Asbestos content and to provide baseline {open_quotes}good faith{close_quotes} for yearly condition inspections for the FFTF Plant and buildings and grounds.

  17. Aged garlic extract enhances heme oxygenase-1 and glutamate-cysteine ligase modifier subunit expression via the nuclear factor erythroid 2-related factor 2-antioxidant response element signaling pathway in human endothelial cells.


    Hiramatsu, Kei; Tsuneyoshi, Tadamitsu; Ogawa, Takahiro; Morihara, Naoaki


    The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway defends cells against oxidative stress and regulates the cellular redox balance. Activation of this pathway induces a variety of antioxidant enzymes, resulting in the protection of our bodies against oxidative damage. It has been reported that aged garlic extract (AGE), a garlic preparation that is rich in water-soluble cysteinyl moieties, reduces oxidative stress and helps to ameliorate of cardiovascular, renal and hepatic diseases. We hypothesized that AGE enhances the expression of antioxidant enzymes via the Nrf2-ARE pathway in human umbilical vein endothelial cells in culture. Gene expression of antioxidant enzymes was measured using real-time polymerase chain reaction. Nuclear accumulation of Nrf2 and antioxidant enzymes expression were evaluated using western blotting analyses. We found that AGE promoted the accumulation of Nrf2 into the nucleus in a time- and dose-dependent manner and increased the gene expression and polypeptide level of heme oxygenase-1 (HO-1) and glutamate-cysteine ligase modifier subunit (GCLM). Moreover, the effect of AGE in elevating the gene expression of HO-1 and GCLM was found to be mediated via Nrf2 activation in human umbilical vein endothelial cells. Taken together, these observations suggest that AGE induces the expression of HO-1 and GCLM, which are antioxidant enzymes, via activation of the Nrf2-ARE signaling pathway. PMID:26507778

  18. Method for detecting an element


    Blackwood, Larry G.; Reber, Edward L.; Rohde, Kenneth W.


    A method for detecting an element is disclosed and which includes the steps of providing a gamma-ray spectrum which depicts, at least in part, a test region having boundaries, and which has a small amount of the element to be detected; providing a calculation which detects the small amount of the element to be detected; and providing a moving window and performing the calculation within the moving window, and over a range of possible window boundaries within the test region to determine the location of the optimal test region within the gamma-ray spectrum.

  19. Impact-Locator Sensor Panels

    NASA Technical Reports Server (NTRS)

    Christiansen, Eric L.; Byers, Terry; Gibbons, Frank


    Electronic sensor systems for detecting and locating impacts of rapidly moving particles on spacecraft have been invented. Systems of this type could also be useful on Earth in settings in which the occurrence of impacts and/or the locations of impacts are not immediately obvious and there are requirements to detect and quickly locate impacts to prevent or minimize damage.

  20. Spring loaded locator pin assembly


    Groll, T.A.; White, J.P.


    This invention deals with spring loaded locator pins. Locator pins are sometimes referred to as captured pins. This is a mechanism which locks two items together with the pin that is spring loaded so that it drops into a locator hole on the work piece. 5 figs.

  1. Spring loaded locator pin assembly


    Groll, Todd A.; White, James P.


    This invention deals with spring loaded locator pins. Locator pins are sometimes referred to as captured pins. This is a mechanism which locks two items together with the pin that is spring loaded so that it drops into a locator hole on the work piece.


    EPA Science Inventory

    GRTS locational data for nonpoint source projects. GRTS locations are coded onto route.drain (Transport and Coastline Reach) feature of NHD to create Point Events and Linear Events. GRTS locations are coded onto region.rch (Waterbody Reach) feature of NHD to create NHD Waterbody ...


    EPA Science Inventory

    Beach locational data for BEACH Act. Beach locations are coded onto route.drain (Transport and Coastline Reach) feature of NHD to create Point Events and Linear Events. Beach locations are coded onto region.rch (Waterbody Reach) feature of NHD to create NHD Waterbody Shapefiles...

  4. Finite Element Analysis Code


    MAPVAR-KD is designed to transfer solution results from one finite element mesh to another. MAPVAR-KD draws heavily from the structure and coding of MERLIN II, but it employs a new finite element data base, EXODUS II, and offers enhanced speed and new capabilities not available in MERLIN II. In keeping with the MERLIN II documentation, the computational algorithms used in MAPVAR-KD are described. User instructions are presented. Example problems are included to demonstrate the operationmore » of the code and the effects of various input options. MAPVAR-KD is a modification of MAPVAR in which the search algorithm was replaced by a kd-tree-based search for better performance on large problems.« less

  5. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.


    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  6. Location-based Web Search

    NASA Astrophysics Data System (ADS)

    Ahlers, Dirk; Boll, Susanne

    In recent years, the relation of Web information to a physical location has gained much attention. However, Web content today often carries only an implicit relation to a location. In this chapter, we present a novel location-based search engine that automatically derives spatial context from unstructured Web resources and allows for location-based search: our focused crawler applies heuristics to crawl and analyze Web pages that have a high probability of carrying a spatial relation to a certain region or place; the location extractor identifies the actual location information from the pages; our indexer assigns a geo-context to the pages and makes them available for a later spatial Web search. We illustrate the usage of our spatial Web search for location-based applications that provide information not only right-in-time but also right-on-the-spot.

  7. Aspectual Features of the Verb and the Relative Position of the Locatives

    ERIC Educational Resources Information Center

    Chen, Chung-yu


    Fundamental functional differences between preverbal and postverbal locatives in Mandarin Chinese are explored. The syntactic behaviors of the verbs are discussed in the context of compatibilities with locatives containing the element "zai." (Author/SW)

  8. Enhancer scanning to locate regulatory regions in genomic loci.


    Buckley, Melissa; Gjyshi, Anxhela; Mendoza-Fandiño, Gustavo; Baskin, Rebekah; Carvalho, Renato S; Carvalho, Marcelo A; Woods, Nicholas T; Monteiro, Alvaro N A


    This protocol provides a rapid, streamlined and scalable strategy to systematically scan genomic regions for the presence of transcriptional regulatory regions that are active in a specific cell type. It creates genomic tiles spanning a region of interest that are subsequently cloned by recombination into a luciferase reporter vector containing the simian virus 40 promoter. Tiling clones are transfected into specific cell types to test for the presence of transcriptional regulatory regions. The protocol includes testing of different single-nucleotide polymorphism (SNP) alleles to determine their effect on regulatory activity. This procedure provides a systematic framework for identifying candidate functional SNPs within a locus during functional analysis of genome-wide association studies. This protocol adapts and combines previous well-established molecular biology methods to provide a streamlined strategy, based on automated primer design and recombinational cloning, allowing one to rapidly go from a genomic locus to a set of candidate functional SNPs in 8 weeks. PMID:26658467

  9. Enhancer scanning to locate regulatory regions in genomic loci

    PubMed Central

    Buckley, Melissa; Gjyshi, Anxhela; Mendoza-Fandiño, Gustavo; Baskin, Rebekah; Carvalho, Renato S.; Carvalho, Marcelo A.; Woods, Nicholas T.; Monteiro, Alvaro N.A.


    The present protocol provides a rapid, streamlined and scalable strategy to systematically scan genomic regions for the presence of transcriptional regulatory regions active in a specific cell type. It creates genomic tiles spanning a region of interest that are subsequently cloned by recombination into a luciferase reporter vector containing the Simian Virus 40 promoter. Tiling clones are transfected into specific cell types to test for the presence of transcriptional regulatory regions. The protocol includes testing of different SNP (single nucleotide polymorphism) alleles to determine their effect on regulatory activity. This procedure provides a systematic framework to identify candidate functional SNPs within a locus during functional analysis of genome-wide association studies. This protocol adapts and combines previous well-established molecular biology methods to provide a streamlined strategy, based on automated primer design and recombinational cloning to rapidly go from a genomic locus to a set of candidate functional SNPs in eight weeks. PMID:26658467

  10. Experiments for locating damaged truss members in a truss structure

    NASA Technical Reports Server (NTRS)

    Mcgowan, Paul E.; Smith, Suzanne W.; Javeed, Mehzad


    Locating damaged truss members in large space structures will involve a combination of sensing and diagnostic techniques. Methods developed for damage location require experimental verification prior to on-orbit applications. To this end, a series of experiments for locating damaged members using a generic, ten bay truss structure were conducted. A 'damaged' member is a member which has been removed entirely. Previously developed identification methods are used in conjunction with the experimental data to locate damage. Preliminary results to date are included, and indicate that mode selection and sensor location are important issues for location performance. A number of experimental data sets representing various damage configurations were compiled using the ten bay truss. The experimental data and the corresponding finite element analysis models are available to researchers for verification of various methods of structure identification and damage location.

  11. Automated detection and location of indications in eddy current signals


    Brudnoy, David M.; Oppenlander, Jane E.; Levy, Arthur J.


    A computer implemented information extraction process that locates and identifies eddy current signal features in digital point-ordered signals, signals representing data from inspection of test materials, by enhancing the signal features relative to signal noise, detecting features of the signals, verifying the location of the signal features that can be known in advance, and outputting information about the identity and location of all detected signal features.

  12. Automated Detection and Location of Indications in Eddy Current Signals

    SciTech Connect

    Brudnoy, David M.; Oppenlander, Jane E.; Levy, Arthur J.


    A computer implemented information extraction process that locates and identifies eddy current signal features in digital point-ordered signals, said signals representing data from inspection of test materials, by enhancing the signal features relative to signal noise, detecting features of the signals, verifying the location of the signal features that can be known in advance, and outputting information about the identity and location of all detected signal features.


    EPA Science Inventory

    Permit Compliance System (PCS) pipe schedule and facility locations indexed to the National Hydrography Dataset (NHD). PCS pipe schedule and facility locations are coded onto route.drain (Transport and Coastline Reach) feature of NHD to create Point Events. PCS pipe schedule an...

  14. Arsenic induces NAD(P)H-quinone oxidoreductase I by disrupting the Nrf2 x Keap1 x Cul3 complex and recruiting Nrf2 x Maf to the antioxidant response element enhancer.


    He, Xiaoqing; Chen, Michael G; Lin, Gary X; Ma, Qiang


    The ubiquitous toxic metalloid arsenic elicits pleiotropic adverse and adaptive responses in mammalian species. The biological targets of arsenic are largely unknown at present. We analyzed the signaling pathway for induction of detoxification gene NAD(P)H-quinone oxidoreductase (Nqo1) by arsenic. Genetic and biochemical evidence revealed that induction required cap 'n' collar basic leucine zipper transcription factor Nrf2 and the antioxidant response element (ARE) of Nqo1. Arsenic stabilized Nrf2 protein, extending the t(1/2) of Nrf2 from 21 to 200 min by inhibiting the Keap1 x Cul3-dependent ubiquitination and proteasomal turnover of Nrf2. Arsenic markedly inhibited the ubiquitination of Nrf2 but did not disrupt the Nrf2 x Keap1 x Cul3 association in the cytoplasm. In the nucleus, arsenic, but not phenolic antioxidant tert-butylhydroquinone, dissociated Nrf2 from Keap1 and Cul3 followed by dimerization of Nrf2 with a Maf protein (Maf G/Maf K). Chromatin immunoprecipitation demonstrated that Nrf2 and Maf associated with the endogenous Nqo1 ARE enhancer constitutively. Arsenic substantially increased the ARE occupancy by Nrf2 and Maf. In addition, Keap1 was shown to be ubiquitinated in the cytoplasm and deubiquitinated in the nucleus in the presence of arsenic without changing the protein level, implicating nuclear-cytoplasmic recycling of Keap1. Our data reveal that arsenic activates the Nrf2/Keap1 signaling pathway through a distinct mechanism from that by antioxidants and suggest an "on-switch" model of Nqo1 transcription in which the binding of Nrf2 x Maf to ARE controls both the basal and inducible expression of Nqo1. PMID:16785233

  15. Identification of a stage selector element in the human gamma-globin gene promoter that fosters preferential interaction with the 5' HS2 enhancer when in competition with the beta-promoter.


    Jane, S M; Ney, P A; Vanin, E F; Gumucio, D L; Nienhuis, A W


    The erythroid-specific enhancer within hypersensitivity site 2 (HS2) of the human beta-globin locus control region is required for high level globin gene expression. We investigated interaction between HS2 and the gamma- and beta-promoters using reporter constructs in transient assays in human erythroleukemia (K562) cells. The beta-promoter, usually silent in K562 cells, was activated by HS2. This activity was abolished when a gamma-promoter was linked in cis. Analysis of truncation mutants suggested that sequences conveying the competitive advantage of the gamma-promoter for HS2 included those between positions -53 and -35 relative to the transcriptional start site. This sequence, when used to replace the corresponding region of the beta-promoter, increased beta-promoter activity 10-fold when linked to HS2. The modified beta-promoter was also capable of competing with a gamma-promoter modified internally in the -53 to -35 region, when the two promoters were linked to HS2 in a single plasmid. The corresponding sequences from the Galago gamma-promoter, a species which lacks fetal gamma-gene expression, were inactive in analogous assays. We have identified and partially purified a nuclear protein found in human (fetal stage) erythroleukemia cells, but present in much lower concentration in murine (adult stage) erythroleukemia cells, that binds the -53 to -35 sequence of the gamma-promoter. We speculate that this region of the gamma-promoter functions as a stage selector element in the regulation of hemoglobin switching in humans. PMID:1639067

  16. Linking Microbial Phylogeny to Metabolic Activity at the Single-Cell Level by Using Enhanced Element Labeling-Catalyzed Reporter Deposition Fluorescence In Situ Hybridization (EL-FISH) and NanoSIMS▿ †

    PubMed Central

    Behrens, Sebastian; Lösekann, Tina; Pett-Ridge, Jennifer; Weber, Peter K.; Ng, Wing-On; Stevenson, Bradley S.; Hutcheon, Ian D.; Relman, David A.; Spormann, Alfred M.


    To examine phylogenetic identity and metabolic activity of individual cells in complex microbial communities, we developed a method which combines rRNA-based in situ hybridization with stable isotope imaging based on nanometer-scale secondary-ion mass spectrometry (NanoSIMS). Fluorine or bromine atoms were introduced into cells via 16S rRNA-targeted probes, which enabled phylogenetic identification of individual cells by NanoSIMS imaging. To overcome the natural fluorine and bromine backgrounds, we modified the current catalyzed reporter deposition fluorescence in situ hybridization (FISH) technique by using halogen-containing fluorescently labeled tyramides as substrates for the enzymatic tyramide deposition. Thereby, we obtained an enhanced element labeling of microbial cells by FISH (EL-FISH). The relative cellular abundance of fluorine or bromine after EL-FISH exceeded natural background concentrations by up to 180-fold and allowed us to distinguish target from non-target cells in NanoSIMS fluorine or bromine images. The method was optimized on single cells of axenic Escherichia coli and Vibrio cholerae cultures. EL-FISH/NanoSIMS was then applied to study interrelationships in a dual-species consortium consisting of a filamentous cyanobacterium and a heterotrophic alphaproteobacterium. We also evaluated the method on complex microbial aggregates obtained from human oral biofilms. In both samples, we found evidence for metabolic interactions by visualizing the fate of substrates labeled with 13C-carbon and 15N-nitrogen, while individual cells were identified simultaneously by halogen labeling via EL-FISH. Our novel approach will facilitate further studies of the ecophysiology of known and uncultured microorganisms in complex environments and communities. PMID:18359832

  17. Close sequence comparisons are sufficient to identify human cis-regulatory elements.


    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M; Couronne, Olivier; Pennacchio, Len A


    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons. To address this problem, we identified evolutionarily conserved noncoding regions in primate, mammalian, and more distant comparisons using a uniform approach (Gumby) that facilitates unbiased assessment of the impact of evolutionary distance on predictive power. We benchmarked computational predictions against previously identified cis-regulatory elements at diverse genomic loci and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using an in vivo enhancer assay in transgenic mice. Human regulatory elements were identified with acceptable sensitivity (53%-80%) and true-positive rate (27%-67%) by comparison with one to five other eutherian mammals or six other simian primates. More distant comparisons (marsupial, avian, amphibian, and fish) failed to identify many of the empirically defined functional noncoding elements. Our results highlight the practical utility of close sequence comparisons, and the loss of sensitivity entailed by more distant comparisons. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole-genome comparative analysis that explains most of the observations from empirical benchmarking. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for in vivo testing at embryonic time points. PMID:16769978


    EPA Science Inventory

    Data includes locations of facilities from which pollutants are discharged. The epapoints.tar.gz file is a gzipped tar file of 14 Arc/Info export files and text documents. The .txt files define the attributes located in the INFO point coverage files. Projections are defined in...

  19. Pan-information Location Map

    NASA Astrophysics Data System (ADS)

    Zhu, X. Y.; Guo, W.; Huang, L.; Hu, T.; Gao, W. X.


    A huge amount of information, including geographic, environmental, socio-economic, personal and social network information, has been generated from diverse sources. Most of this information exists separately and is disorderly even if some of it is about the same person, feature, phenomenon or event. Users generally need to collect related information from different sources and then utilize them in applications. An automatic mechanism, therefore, for establishing a connection between potentially-related information will profoundly expand the usefulness of this huge body of information. A connection tie is semantic location describing semantically concepts and attributes of locations as well as relationships between locations, since 80% of information contains some kind of geographic reference but not all of geographic reference has explicit geographic coordinates. Semantic location is an orthogonal form of location representation which can be represented as domain ontology or UML format. Semantic location associates various kinds of information about a same object to provide timely information services according to users' demands, habits, preferences and applications. Based on this idea, a Pan-Information Location Map (PILM) is proposed as a new-style 4D map to associates semantic location-based information dynamically to organize and consolidate the locality and characteristics of corresponding features and events, and delivers on-demand information with a User-Adaptive Smart Display (UASD).

  20. Experiences with Information Locator Services.

    ERIC Educational Resources Information Center

    Christian, Eliot


    Relates experiences in developing and promoting services interoperable with the Global Information Locator Service (GILS) standard. Describes sample implementations and touches on the strategic choices made in public policy, standards, and technology. Offers 10 recommendations for successful implementation of an Information Locator Service. (AEF)

  1. Cold War Geopolitics: Embassy Locations.

    ERIC Educational Resources Information Center

    Vogeler, Ingolf


    Asserts that the geopolitics of the Cold War can be illustrated by the diplomatic ties among countries, particularly the superpowers and their respective allies. Describes a classroom project in which global patterns of embassy locations are examined and compared. Includes five maps and a chart indicating types of embassy locations. (CFR)

  2. Precision zero-home locator


    Stone, W.J.


    A zero-home locator includes a fixed phototransistor switch and a moveable actuator including two symmetrical, opposed wedges, each wedge defining a point at which switching occurs. The zero-home location is the average of the positions of the points defined by the wedges.

  3. Mobile Alternative Fueling Station Locator

    SciTech Connect

    Not Available


    The Department of Energy's Alternative Fueling Station Locator is available on-the-go via cell phones, BlackBerrys, or other personal handheld devices. The mobile locator allows users to find the five closest biodiesel, electricity, E85, hydrogen, natural gas, and propane fueling sites using Google technology.

  4. Precision zero-home locator


    Stone, William J.


    A zero-home locator includes a fixed phototransistor switch and a moveable actuator including two symmetrical, opposed wedges, each wedge defining a point at which switching occurs. The zero-home location is the average of the positions of the points defined by the wedges.

  5. Locating Information within Extended Hypermedia

    ERIC Educational Resources Information Center

    Cromley, Jennifer G.; Azevedo, Roger


    New literacies researchers have identified a core set of strategies for locating information, one of which is "reading a Web page to locate information that might be present there" (Leu et al. in: Rush, Eakle, Berger (eds) "Secondary school reading and writing: What research reveals for classroom practices," 2007, p. 46). Do middle-school, high…

  6. LLNL Location and Detection Research

    SciTech Connect

    Myers, S C; Harris, D B; Anderson, M L; Walter, W R; Flanagan, M P; Ryall, F


    We present two LLNL research projects in the topical areas of location and detection. The first project assesses epicenter accuracy using a multiple-event location algorithm, and the second project employs waveform subspace Correlation to detect and identify events at Fennoscandian mines. Accurately located seismic events are the bases of location calibration. A well-characterized set of calibration events enables new Earth model development, empirical calibration, and validation of models. In a recent study, Bondar et al. (2003) develop network coverage criteria for assessing the accuracy of event locations that are determined using single-event, linearized inversion methods. These criteria are conservative and are meant for application to large bulletins where emphasis is on catalog completeness and any given event location may be improved through detailed analysis or application of advanced algorithms. Relative event location techniques are touted as advancements that may improve absolute location accuracy by (1) ensuring an internally consistent dataset, (2) constraining a subset of events to known locations, and (3) taking advantage of station and event correlation structure. Here we present the preliminary phase of this work in which we use Nevada Test Site (NTS) nuclear explosions, with known locations, to test the effect of travel-time model accuracy on relative location accuracy. Like previous studies, we find that the reference velocity-model and relative-location accuracy are highly correlated. We also find that metrics based on travel-time residual of relocated events are not a reliable for assessing either velocity-model or relative-location accuracy. In the topical area of detection, we develop specialized correlation (subspace) detectors for the principal mines surrounding the ARCES station located in the European Arctic. Our objective is to provide efficient screens for explosions occurring in the mines of the Kola Peninsula (Kovdor, Zapolyarny

  7. Regional location in western China

    SciTech Connect

    Cogbill, A.H.; Steck, L.K.


    Accurately locating seismic events in western China using only regional seismic stations is a challenge. Not only is the number of seismic stations available for locating events small, but most stations available to researchers are often over 10{degree} distant. Here the authors describe the relocation, using regional stations, of both nuclear and earthquake sources near the Lop Nor test site in western China. For such relocations, they used the Earthquake Data Reports provided by the US Geological Survey (USGS) for the reported travel times. Such reports provide a listing of all phases reported to the USGS from stations throughout the world, including many stations in the People`s Republic of China. LocSAT was used as the location code. The authors systematically relocated each event int his study several times, using fewer and fewer stations at reach relocation, with the farther stations being eliminated at each step. They found that location accuracy, judged by comparing solutions from few stations to the solution provided using all available stations, remained good typically until fewer than seven stations remained.With a good station distribution, location accuracy remained surprisingly good (within 7 km) using as few as 3 stations. Because these relocations were computed without good station corrections and without source-specific station corrections (that is, path corrections), they believe that such regional locations can be substantially improved, largely using static station corrections and source-specific station corrections, at least in the Lop nor area, where sources have known locations. Elsewhere in China, one must rely upon known locations of regionally-recorded explosions. Locating such sources is clearly one of the major problems to be overcome before one can provide event locations with any assurance from regional stations.

  8. Location of foot arteries using infrared images

    NASA Astrophysics Data System (ADS)

    Villasenor-Mora, Carlos; González-Vega, Arturo; Martín Osmany Falcón, Antonio; Benítez Ferro, Jesús Francisco Guillemo; Córdova Fraga, Teodoro


    In this work are presented the results of localization of foot arteries, in a young group of participants by using infrared thermal images, these are the dorsal, posterior tibial and anterior tibial arteries. No inclusion criteria were considered, that causes that no strong statistical data about the influence of the age in the arterial localization. It was achieved to solve the confusion when veins present a heat distribution similar to the artery and in the position of this. it contributes to enhance the rate of location of arteries. In general it is possible to say that the use of infrared thermal images is a good technique to find the foot arteries and can be applied in its characterization in a future. The procedure proposed is a non-invasive technique, and in certain fashion does not requires specialized personnel to achieve locate the arteries. It is portable, safe, and relatively economical.

  9. Location-assured, multifactor authentication on smartphones via LTE communication

    NASA Astrophysics Data System (ADS)

    Kuseler, Torben; Lami, Ihsan A.; Al-Assam, Hisham


    With the added security provided by LTE, geographical location has become an important factor for authentication to enhance the security of remote client authentication during mCommerce applications using Smartphones. Tight combination of geographical location with classic authentication factors like PINs/Biometrics in a real-time, remote verification scheme over the LTE layer connection assures the authenticator about the client itself (via PIN/biometric) as well as the client's current location, thus defines the important aspects of "who", "when", and "where" of the authentication attempt without eaves dropping or man on the middle attacks. To securely integrate location as an authentication factor into the remote authentication scheme, client's location must be verified independently, i.e. the authenticator should not solely rely on the location determined on and reported by the client's Smartphone. The latest wireless data communication technology for mobile phones (4G LTE, Long-Term Evolution), recently being rolled out in various networks, can be employed to enhance this location-factor requirement of independent location verification. LTE's Control Plane LBS provisions, when integrated with user-based authentication and independent source of localisation factors ensures secure efficient, continuous location tracking of the Smartphone. This feature can be performed during normal operation of the LTE-based communication between client and network operator resulting in the authenticator being able to verify the client's claimed location more securely and accurately. Trials and experiments show that such algorithm implementation is viable for nowadays Smartphone-based banking via LTE communication.

  10. Harnessing mobile genetic elements to explore gene regulation.


    Shakes, Leighcraft A; Wolf, Hope M; Norford, Derek C; Grant, Delores J; Chatterjee, Pradeep K


    Sequences that regulate expression of a gene in cis but are located at large distances along the DNA from the gene, as found with most developmentally regulated genes in higher vertebrates, are difficult to identify if those sequences are not conserved across species. Mutating suspected gene-regulatory sequences to alter expression then becomes a hit-or-miss affair. The relaxed specificity of transposon insertions offers an opportunity to develop alternate strategies, to scan in an unbiased manner, pieces of chromosomal DNA cloned in BACs for transcription enhancing elements. This article illustrates how insertions of Tn10 with enhancer-traps into BAC DNA containing the gene, and its germ-line expression in zebrafish, have identified distal regulatory elements functionally. Transposition of Tn10 first introduces the enhancer-trap with a loxP site randomly into BAC DNA. Cre-recombination between the inserted loxP and the loxP endogenous to a BAC-end positions the enhancer-trap to the newly created truncated end of BAC DNA. The procedure generates a library of integration-ready enhancer-trap BACs with progressive truncations from an end in a single experiment. Individual enhancer-trap BACs from the library can be evaluated functionally in zebrafish or mice. Furthermore, the ability to readily alter sequences in a small transposon plasmid containing a regulatory domain of the gene allows re-introduction of altered parts of a BAC back into itself. It serves as a useful strategy to functionally dissect multiple discontinuous regulatory domains of a gene quickly. These methodologies have been successfully used in identifying novel regulatory domains of the Amyloid Precursor Protein (appb) gene in zebrafish, and provided important clues for regulation of the gene in humans. PMID:25054085

  11. Merging of intersecting triangulations for finite element modeling.


    Cebral, J R; Löhner, R; Choyke, P L; Yim, P J


    Surface mesh generation over intersecting triangulations is a problem common to many branches of biomechanics. A new strategy for merging intersecting triangulations is described. The basis of the method is that object surfaces are represented as the zero-level iso-surface of the distance-to-surface function defined on a background grid. Thus, the triangulation of intersecting objects reduces to the extraction of an iso-surface from an unstructured grid. In a first step, a regular background mesh is constructed. For each point of the background grid, the closest distance to the surface of each object is computed. Background points are then classified as external or internal by checking the direction of the surface normal at the closest location and assigned a positive or negative distance, respectively. Finally, the zero-level iso-surface is constructed. This is the final triangulation of the intersecting objects. The overall accuracy is enhanced by adaptive refinement of the background grid elements. The resulting surface models are used as support surfaces to generate three-dimensional grids for finite element analysis. The algorithms are demonstrated by merging arterial branches independently reconstructed from contrast-enhanced magnetic resonance images and by adding extra features such as vascular stents. Although the methodology is presented in the context of finite element analysis of blood flow, the algorithms are general and can be applied in other areas as well. PMID:11470121

  12. Lift enhancing tabs for airfoils

    NASA Technical Reports Server (NTRS)

    Ross, James C. (Inventor)


    A tab deployable from the trailing edge of a main airfoil element forces flow onto a following airfoil element, such as a flap, to keep the flow attached and thus enhance lift. For aircraft wings with high lift systems that include leading edge slats, the slats may also be provided with tabs to turn the flow onto the following main element.

  13. Point Source Location Sensitivity Analysis

    NASA Astrophysics Data System (ADS)

    Cox, J. Allen


    This paper presents the results of an analysis of point source location accuracy and sensitivity as a function of focal plane geometry, optical blur spot, and location algorithm. Five specific blur spots are treated: gaussian, diffraction-limited circular aperture with and without central obscuration (obscured and clear bessinc, respectively), diffraction-limited rectangular aperture, and a pill box distribution. For each blur spot, location accuracies are calculated for square, rectangular, and hexagonal detector shapes of equal area. The rectangular detectors are arranged on a hexagonal lattice. The two location algorithms consist of standard and generalized centroid techniques. Hexagonal detector arrays are shown to give the best performance under a wide range of conditions.

  14. Mental Health Treatment Program Locator


    ... County or Zip By Name Other Links State Mental Health Agencies Frequently Asked Questions Links Comments or Questions ... a Facility in Your State To locate the mental health treatment programs nearest you, find your State on ...

  15. Bayesian Mulitple-Event Location


    Bayesloc is a statistical model of the multiple seismic location system, including event hypocenters, corrections to model-based travel time predictions, assessments precision for measurement phase arrival times, and phase lavels which indicate phase ray path.

  16. Locating the LCROSS Impact Craters

    NASA Technical Reports Server (NTRS)

    Marshall, William; Shirley, Mark; Moratto, Zachary; Colaprete, Anthony; Neumann, Gregory A.; Smith, David E.; Hensley, Scott; Wilson, Barbara; Slade, Martin; Kennedy, Brian; Gurrola, Eric; Harcke, Leif


    The Lunar CRater Observations and Sensing Satellite (LCROSS) mission impacted a spent Centaur rocket stage into a permanently shadowed region near the lunar south pole. The Sheperding Spacecraft (SSC) separated approx. 9 hours before impact and performed a small braking maneuver in order to observe the Centaur impact plume, looking for evidence of water and other volatiles, before impacting itself. This paper describes the registration of imagery of the LCROSS impact region from the mid- and near-infrared cameras onboard the SSC, as well as from the Goldstone radar. We compare the Centaur impact features, positively identified in the first two, and with a consistent feature in the third, which are interpreted as a 20 m diameter crater surrounded by a 160 m diameter ejecta region. The images are registered to Lunar Reconnaisance Orbiter (LRO) topographical data which allows determination of the impact location. This location is compared with the impact location derived from ground-based tracking and propagation of the spacecraft's trajectory and with locations derived from two hybrid imagery/trajectory methods. The four methods give a weighted average Centaur impact location of -84.6796 deg, -48.7093 deg, with a 1s uncertainty of 115 m along latitude, and 44 m along longitude, just 146 m from the target impact site. Meanwhile, the trajectory-derived SSC impact location is -84.719 deg, -49.61 deg, with a 1 alpha uncertainty of 3 m along the Earth vector and 75 m orthogonal to that, 766 m from the target location and 2.803 km south-west of the Centaur impact. We also detail the Centaur impact angle and SSC instrument pointing errors. Six high-level LCROSS mission requirements are shown to be met by wide margins. We hope that these results facilitate further analyses of the LCROSS experiment data and follow-up observations of the impact region

  17. DEEP: a general computational framework for predicting enhancers

    PubMed Central

    Kleftogiannis, Dimitrios; Kalnis, Panos; Bajic, Vladimir B.


    Transcription regulation in multicellular eukaryotes is orchestrated by a number of DNA functional elements located at gene regulatory regions. Some regulatory regions (e.g. enhancers) are located far away from the gene they affect. Identification of distal regulatory elements is a challenge for the bioinformatics research. Although existing methodologies increased the number of computationally predicted enhancers, performance inconsistency of computational models across different cell-lines, class imbalance within the learning sets and ad hoc rules for selecting enhancer candidates for supervised learning, are some key questions that require further examination. In this study we developed DEEP, a novel ensemble prediction framework. DEEP integrates three components with diverse characteristics that streamline the analysis of enhancer's properties in a great variety of cellular conditions. In our method we train many individual classification models that we combine to classify DNA regions as enhancers or non-enhancers. DEEP uses features derived from histone modification marks or attributes coming from sequence characteristics. Experimental results indicate that DEEP performs better than four state-of-the-art methods on the ENCODE data. We report the first computational enhancer prediction results on FANTOM5 data where DEEP achieves 90.2% accuracy and 90% geometric mean (GM) of specificity and sensitivity across 36 different tissues. We further present results derived using in vivo-derived enhancer data from VISTA database. DEEP-VISTA, when tested on an independent test set, achieved GM of 80.1% and accuracy of 89.64%. DEEP framework is publicly available at PMID:25378307

  18. Boosting transcription by transcription: enhancer-associated transcripts.


    Darrow, Emily M; Chadwick, Brian P


    Enhancers are traditionally viewed as DNA sequences located some distance from a promoter that act in cis and in an orientation-independent fashion to increase utilization of specific promoters and thereby regulate gene expression. Much progress has been made over the last decade toward understanding how these distant elements interact with target promoters, but how transcription is enhanced remains an object of active inquiry. Recent reports convey the prevalence and diversity of enhancer transcription and transcripts and support both as key factors with mechanistically distinct, but not mutually exclusive roles in enhancer function. Decoupling the causes and effects of transcription on the local chromatin landscape and understanding the role of enhancer transcripts in the context of long-range interactions are challenges that require additional attention. In this review, we focus on the possible functions of enhancer transcription by highlighting several recent enhancer RNA papers and, within the context of other enhancer studies, speculate on the role of enhancer transcription in regulating differential gene expression. PMID:24178450

  19. Artificial neural network for location estimation in wireless communication systems.


    Chen, Chien-Sheng


    In a wireless communication system, wireless location is the technique used to estimate the location of a mobile station (MS). To enhance the accuracy of MS location prediction, we propose a novel algorithm that utilizes time of arrival (TOA) measurements and the angle of arrival (AOA) information to locate MS when three base stations (BSs) are available. Artificial neural networks (ANN) are widely used techniques in various areas to overcome the problem of exclusive and nonlinear relationships. When the MS is heard by only three BSs, the proposed algorithm utilizes the intersections of three TOA circles (and the AOA line), based on various neural networks, to estimate the MS location in non-line-of-sight (NLOS) environments. Simulations were conducted to evaluate the performance of the algorithm for different NLOS error distributions. The numerical analysis and simulation results show that the proposed algorithms can obtain more precise location estimation under different NLOS environments. PMID:22736978

  20. URLs: Uniform Resource Locators or Unreliable Resource Locators.

    ERIC Educational Resources Information Center

    Germain, Carol Anne


    This research studies the accessibility of 64 URLs (Uniform Resource Locators) cited in 31 academic journal articles. Discusses the role of citations as scholarly links and examines results of this longitudinal study that found an increasing decline in the availability of URL citations to World Wide Web sties. (Contains 22 references.) (Author/LRW)

  1. Wireless Damage Location Sensing System

    NASA Technical Reports Server (NTRS)

    Woodard, Stanley E. (Inventor); Taylor, Bryant Douglas (Inventor)


    A wireless damage location sensing system uses a geometric-patterned wireless sensor that resonates in the presence of a time-varying magnetic field to generate a harmonic response that will experience a change when the sensor experiences a change in its geometric pattern. The sensing system also includes a magnetic field response recorder for wirelessly transmitting the time-varying magnetic field and for wirelessly detecting the harmonic response. The sensing system compares the actual harmonic response to a plurality of predetermined harmonic responses. Each predetermined harmonic response is associated with a severing of the sensor at a corresponding known location thereof so that a match between the actual harmonic response and one of the predetermined harmonic responses defines the known location of the severing that is associated therewith.

  2. Industrial Location Research Studies: Reports 9-16.

    ERIC Educational Resources Information Center

    Fantus Co., Inc., New York, NY.

    Eight studies identify, examine, and evaluate significant elements of industry-location decisions as they relate directly or indirectly to public investment policies and activities that may be considered as economic growth stimulants for the Appalachian region. Examined in the document are the chlor-alkali industry; the manufacturing of trucks,…

  3. No Sex Differences in Spatial Location Memory for Abstract Designs

    ERIC Educational Resources Information Center

    Rahman, Qazi; Bakare, Monsurat; Serinsu, Ceydan


    Previous research has demonstrated a female advantage, albeit imperfectly, on tests of object location memory where object identity information is readily available. However, spatial and visual elements are often confounded in the experimental tasks used. Here spatial and visual memory performance was compared in 30 men and 30 women by presenting…

  4. 78 FR 46560 - Pipeline Safety: Class Location Requirements

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...PHMSA is seeking public comment on whether applying the integrity management program (IMP) requirements, or elements of IMP, to areas beyond current high consequence areas (HCAs) would mitigate the need for class location requirements for gas transmission pipelines. Section 5 of the Pipeline Safety, Regulatory Certainty, and Job Creation Act of 2011 requires the Secretary of Transportation to......

  5. Fracture Capabilities in Grizzly with the extended Finite Element Method (X-FEM)

    SciTech Connect

    Dolbow, John; Zhang, Ziyu; Spencer, Benjamin; Jiang, Wen


    Efforts are underway to develop fracture mechanics capabilities in the Grizzly code to enable it to be used to perform deterministic fracture assessments of degraded reactor pressure vessels (RPVs). A capability was previously developed to calculate three-dimensional interaction- integrals to extract mixed-mode stress-intensity factors. This capability requires the use of a finite element mesh that conforms to the crack geometry. The eXtended Finite Element Method (X-FEM) provides a means to represent a crack geometry without explicitly fitting the finite element mesh to it. This is effected by enhancing the element kinematics to represent jump discontinuities at arbitrary locations inside of the element, as well as the incorporation of asymptotic near-tip fields to better capture crack singularities. In this work, use of only the discontinuous enrichment functions was examined to see how accurate stress intensity factors could still be calculated. This report documents the following work to enhance Grizzly’s engineering fracture capabilities by introducing arbitrary jump discontinuities for prescribed crack geometries; X-FEM Mesh Cutting in 3D: to enhance the kinematics of elements that are intersected by arbitrary crack geometries, a mesh cutting algorithm was implemented in Grizzly. The algorithm introduces new virtual nodes and creates partial elements, and then creates a new mesh connectivity; Interaction Integral Modifications: the existing code for evaluating the interaction integral in Grizzly was based on the assumption of a mesh that was fitted to the crack geometry. Modifications were made to allow for the possibility of a crack front that passes arbitrarily through the mesh; and Benchmarking for 3D Fracture: the new capabilities were benchmarked against mixed-mode three-dimensional fracture problems with known analytical solutions.

  6. Apparatus including a plurality of spaced transformers for locating short circuits in cables

    NASA Technical Reports Server (NTRS)

    Cason, R. L.; Mcstay, J. J. (Inventor)


    A cable fault locator is described for sensing faults such as short circuits in power cables. The apparatus includes a plurality of current transformers strategically located along a cable. Trigger circuits are connected to each of the current transformers for placing a resistor in series with a resistive element responsive to an abnormally high current flowing through that portion of the cable. By measuring the voltage drop across the resistive element, the location of the fault can be determined.

  7. Discriminative prediction of mammalian enhancers from DNA sequence

    PubMed Central

    Lee, Dongwon; Karchin, Rachel; Beer, Michael A.


    Accurately predicting regulatory sequences and enhancers in entire genomes is an important but difficult problem, especially in large vertebrate genomes. With the advent of ChIP-seq technology, experimental detection of genome-wide EP300/CREBBP bound regions provides a powerful platform to develop predictive tools for regulatory sequences and to study their sequence properties. Here, we develop a support vector machine (SVM) framework which can accurately identify EP300-bound enhancers using only genomic sequence and an unbiased set of general sequence features. Moreover, we find that the predictive sequence features identified by the SVM classifier reveal biologically relevant sequence elements enriched in the enhancers, but we also identify other features that are significantly depleted in enhancers. The predictive sequence features are evolutionarily conserved and spatially clustered, providing further support of their functional significance. Although our SVM is trained on experimental data, we also predict novel enhancers and show that these putative enhancers are significantly enriched in both ChIP-seq signal and DNase I hypersensitivity signal in the mouse brain and are located near relevant genes. Finally, we present results of comparisons between other EP300/CREBBP data sets using our SVM and uncover sequence elements enriched and/or depleted in the different classes of enhancers. Many of these sequence features play a role in specifying tissue-specific or developmental-stage-specific enhancer activity, but our results indicate that some features operate in a general or tissue-independent manner. In addition to providing a high confidence list of enhancer targets for subsequent experimental investigation, these results contribute to our understanding of the general sequence structure of vertebrate enhancers. PMID:21875935

  8. Carbon Enhanced Stars in the Sloan Digital Sky Survery

    NASA Astrophysics Data System (ADS)

    Keeling, Chloe; Wilhelm, R. J.


    Carbon-enhanced stars are excellent probes of the nucleosynthesis history of the universe. The existence of carbon-enhanced stars that also show enhancement of s-process elements, such as barium, suggest that enhancements are initially produced in asymptotic giant branch stars which overflow their Roche lobes and deposit processed elements on to a lower mass binary companion. This process is also one mechanism for producing binary mass transfer, blue stragglers (BS). A second is mass transfer from a first ascent red giant companion. It is therefore expected that some percentage of BS stars (those produced from AGB companions) will show both carbon and barium enhancements. For this study we have chosen SDSS stars in the temperature range of 6000 K ≤ T_eff ≤7000 K. This range samples the halo main-sequence turn-off (MSTO) and BS stars just blueward of MSTO. We make use of measurements of the CH G-band strength, located at ~4330 Å, to estimate the stellar carbon abundance. To measure the G-band strength we use the S magnitude index, optimized by Martell et al. (2008). We run the same index measurements on a grid of synthetic spectra with Teff, Log(g), [Fe/H] and various carbon enhancements. Using the observed S-index and spectral parameters from Segue Stellar Parameter Pipeline, we compare to our calibration grid and determine the carbon abundance. We will present our carbon abundance results along with a rough estimate of barium from our index method and a classification into three broad groups, 1) No enhancement in Ba or C, 2) C enhancement and no Ba enhancement, and 3) C and Ba enhancement. We will present preliminary results on the percentages of each category for both the MSTO and BS stars.

  9. Communication interference/jamming and propagation analysis system and its application to radio location

    NASA Astrophysics Data System (ADS)

    Kuzucu, H.


    Modern defense systems depend on comprehensive surveillance capability. The ability to detect and locate the radio signals is a major element of a surveillance system. With the increasing need for more mobile surveillance systems in conjunction with the rapid deployment of forces and the advent of technology allowing more enhanced use of small aperture systems, tactical direction finding (DF) and radiolocation systems will have to be operated in diverse operational conditions. A quick assessment of the error levels expected and the evaluation of the reliability of the fixes on the targeted areas bears crucial importance to the effectiveness of the missions relying on DF data. This paper presents a sophisticated, graphics workstation based computer tool developed for the system level analysis of radio communication systems and describes its use in radiolocation applications for realizing such accurate and realistic assessments with substantial money and time savings.

  10. Real-time Enhanced Vision System

    NASA Technical Reports Server (NTRS)

    Hines, Glenn D.; Rahman, Zia-Ur; Jobson, Daniel J.; Woodell, Glenn A.; Harrah, Steven D.


    Flying in poor visibility conditions, such as rain, snow, fog or haze, is inherently dangerous. However these conditions can occur at nearly any location, so inevitably pilots must successfully navigate through them. At NASA Langley Research Center (LaRC), under support of the Aviation Safety and Security Program Office and the Systems Engineering Directorate, we are developing an Enhanced Vision System (EVS) that combines image enhancement and synthetic vision elements to assist pilots flying through adverse weather conditions. This system uses a combination of forward-looking infrared and visible sensors for data acquisition. A core function of the system is to enhance and fuse the sensor data in order to increase the information content and quality of the captured imagery. These operations must be performed in real-time for the pilot to use while flying. For image enhancement, we are using the LaRC patented Retinex algorithm since it performs exceptionally well for improving low-contrast range imagery typically seen during poor visibility conditions. In general, real-time operation of the Retinex requires specialized hardware. To date, we have successfully implemented a single-sensor real-time version of the Retinex on several different Digital Signal Processor (DSP) platforms. In this paper we give an overview of the EVS and its performance requirements for real-time enhancement and fusion and we discuss our current real-time Retinex implementations on DSPs.

  11. Real-time enhanced vision system

    NASA Astrophysics Data System (ADS)

    Hines, Glenn D.; Rahman, Zia-ur; Jobson, Daniel J.; Woodell, Glenn A.; Harrah, Steven D.


    Flying in poor visibility conditions, such as rain, snow, fog or haze, is inherently dangerous. However these conditions can occur at nearly any location, so inevitably pilots must successfully navigate through them. At NASA Langley Research Center (LaRC), under support of the Aviation Safety and Security Program Office and the Systems Engineering Directorate, we are developing an Enhanced Vision System (EVS) that combines image enhancement and synthetic vision elements to assist pilots flying through adverse weather conditions. This system uses a combination of forward-looking infrared and visible sensors for data acquisition. A core function of the system is to enhance and fuse the sensor data in order to increase the information content and quality of the captured imagery. These operations must be performed in real-time for the pilot to use while flying. For image enhancement, we are using the LaRC patented Retinex algorithm since it performs exceptionally well for improving low-contrast range imagery typically seen during poor visibility poor visibility conditions. In general, real-time operation of the Retinex requires specialized hardware. To date, we have successfully implemented a single-sensor real-time version of the Retinex on several different Digital Signal Processor (DSP) platforms. In this paper we give an overview of the EVS and its performance requirements for real-time enhancement and fusion and we discuss our current real-time Retinex implementations on DSPs.

  12. Predictors of Rural Practice Location

    ERIC Educational Resources Information Center

    Kegel-Flom, Penelope


    Attitudes toward the urban environment and place of origin were found to be the best predictors of an optometrist's practice location. Findings of this study imply that optometry students most likely to enter rural practice can be objectively identified early in their training and that the predictive equation presented may be useful in the…

  13. Negative Geography: Locating Things Elsewhere.

    ERIC Educational Resources Information Center

    Stoddard, Robert H.

    The phenomenon of negative geography--the assertion that any location is better than the one selected--is discussed and ways in which this approach differs from traditional geography methodology are analyzed. Case studies of two citizens' groups which protested the relocation of a city mission and halfway house in their neighborhoods illustrate…

  14. Source Identification and Location Techniques

    NASA Technical Reports Server (NTRS)

    Weir, Donald; Bridges, James; Agboola, Femi; Dougherty, Robert


    Mr. Weir presented source location results obtained from an engine test as part of the Engine Validation of Noise Reduction Concepts program. Two types of microphone arrays were used in this program to determine the jet noise source distribution for the exhaust from a 4.3 bypass ratio turbofan engine. One was a linear array of 16 microphones located on a 25 ft. sideline and the other was a 103 microphone 3-D "cage" array in the near field of the jet. Data were obtained from a baseline nozzle and from numerous nozzle configuration using chevrons and/or tabs to reduce the jet noise. Mr. Weir presented data from two configurations: the baseline nozzle and a nozzle configuration with chevrons on both the core and bypass nozzles. This chevron configuration had achieved a jet noise reduction of 4 EPNdB in small scale tests conducted at the Glenn Research Center. IR imaging showed that the chevrons produced significant improvements in mixing and greatly reduced the length of the jet potential core. Comparison of source location data from the 1-D phased array showed a shift of the noise sources towards the nozzle and clear reductions of the sources due to the noise reduction devices. Data from the 3-D array showed a single source at a frequency of 125 Hz. located several diameters downstream from the nozzle exit. At 250 and 400 Hz., multiple sources, periodically spaced, appeared to exist downstream of the nozzle. The trend of source location moving toward the nozzle exit with increasing frequency was also observed. The 3-D array data also showed a reduction in source strength with the addition of chevrons. The overall trend of source location with frequency was compared for the two arrays and with classical experience. Similar trends were observed. Although overall trends with frequency and addition of suppression devices were consistent between the data from the 1-D and the 3-D arrays, a comparison of the details of the inferred source locations did show differences. A

  15. Earthquake location in island arcs

    USGS Publications Warehouse

    Engdahl, E.R.; Dewey, J.W.; Fujita, K.


    A comprehensive data set of selected teleseismic P-wave arrivals and local-network P- and S-wave arrivals from large earthquakes occurring at all depths within a small section of the central Aleutians is used to examine the general problem of earthquake location in island arcs. Reference hypocenters for this special data set are determined for shallow earthquakes from local-network data and for deep earthquakes from combined local and teleseismic data by joint inversion for structure and location. The high-velocity lithospheric slab beneath the central Aleutians may displace hypocenters that are located using spherically symmetric Earth models; the amount of displacement depends on the position of the earthquakes with respect to the slab and on whether local or teleseismic data are used to locate the earthquakes. Hypocenters for trench and intermediate-depth events appear to be minimally biased by the effects of slab structure on rays to teleseismic stations. However, locations of intermediate-depth events based on only local data are systematically displaced southwards, the magnitude of the displacement being proportional to depth. Shallow-focus events along the main thrust zone, although well located using only local-network data, are severely shifted northwards and deeper, with displacements as large as 50 km, by slab effects on teleseismic travel times. Hypocenters determined by a method that utilizes seismic ray tracing through a three-dimensional velocity model of the subduction zone, derived by thermal modeling, are compared to results obtained by the method of joint hypocenter determination (JHD) that formally assumes a laterally homogeneous velocity model over the source region and treats all raypath anomalies as constant station corrections to the travel-time curve. The ray-tracing method has the theoretical advantage that it accounts for variations in travel-time anomalies within a group of events distributed over a sizable region of a dipping, high

  16. Spectroscopic measurements of element abundances in the solar corona: Variations on the FIP theme

    NASA Technical Reports Server (NTRS)

    Saba, J. L. R.


    Solar wind and solar energetic particle (SEP) data yield systematic differences between elemental abundances in the corona and in the photosphere related to the first ionization potential (FIP) of the elements: low-FIP elements are preferentially enhanced relative to high-FIP elements by about a factor of four. Spectroscopic studies of the inner corona show that such a pattern may apply on average but not in detail for coronal loops: substantial abundance differences occur between different types of coronal structures, and variations have been found from flare to flare, from one active region to another, and over time in the same region; further, in some flares, anomalies such as enhanced Ne:O ratios, distinctly at odds with the FIP pattern, show that a competing element selection mechanism sometimes operates. Details of the observed abundance variability -- such as the magnitude of the variations, the relevant temporal and spatial scales, and correlations with other properties of the given coronal structure -- may give important clues to the processes which supply and heat the corona, or they may reflect the changing physical conditions or locations where those processes take place. However, many such details remain to be established definitively. At present, abundance variability is primarily a major complication to data analysis and interpretation. However, once it is better understood, it may provide a new diagnostic tool for probing the lower layers of the solar atmosphere.

  17. Enhancer Malfunction in Cancer

    PubMed Central

    Herz, Hans-Martin; Hu, Deqing; Shilatifard, Ali


    Why certain point mutations in a general transcription factor are associated with specific forms of cancer has been a major question in cancer biology. Enhancers are DNA regulatory elements that are major regulators of tissue-specific gene expression. Recent studies suggest that enhancer malfunction through point mutations in either regulatory elements or factors modulating enhancer-promoter communication could be the cause of tissue-specific cancer development. In this Perspective, we will discuss recent findings in the identification of cancer-related enhancer mutations and the role of Drosophila Trr and its human homologs, the MLL3 and MLL4/COMPASS-like complexes, as enhancer histone H3 lysine 4 (H3K4) monomethyltransferases functioning in enhancer-promoter communication. Recent genome-wide studies in the cataloging of somatic mutations in cancer have identified mutations in intergenic sequences encoding regulatory elements, and in MLL3 and MLL4 in both hematological malignancies and solid tumors. We propose that cancer-associated mutations in MLL3 and MLL4 exert their properties through the malfunction of Trr/MLL3/MLL4-dependent enhancers. PMID:24656127

  18. Nuclear breeder reactor fuel element with silicon carbide getter


    Christiansen, David W.; Karnesky, Richard A.


    An improved cesium getter 28 is provided in a breeder reactor fuel element or pin in the form of an extended surface area, low density element formed in one embodiment as a helically wound foil 30 located with silicon carbide, and located at the upper end of the fertile material upper blanket 20.

  19. c-Ha-ras gene bidirectional promoter expressed in vitro: location and regulation.

    PubMed Central

    Lowndes, N F; Paul, J; Wu, J; Allan, M


    Increased transcriptional activity of the c-Ha-ras gene product is correlated with induction of several important human tumor types. For this reason, we have investigated the nature of the c-Ha-ras promoter and the factors that regulate its expression. Using S1 and primer extension analysis of c-Ha-ras RNA from EJ cells, we have identified 18 initiation sites within an upstream exon (exon -1) whose 3' end (the donor splice site [D]) is located 1,105 base pairs (bp) upstream of the ATG codon. The furthest-upstream initiation site is located -191 bp relative to D, and the furthest downstream is located -16 bp relative to D. Transient expression assays, in which a series of mutants spanning this region were ligated to a promoterless chloramphenicol acetyltransferase vector, functionally confirmed the position and extent of this promoter. Mutational analysis further located a 47-bp element located between -243 and -196 relative to D that up-regulated transcriptional activity of the promoter region by 20- to 40-fold. This region contained both a GC box known to bind SP1 and a CCAAT box. Insertion of a simian virus 40 enhancer 5' to the promoter up-regulated transcription from each initiation site by approximately 10- to 20-fold. We have also localized, both by chloramphenicol acetyltransferase assay and by S1 analysis, a strong promoter operating in the direction opposite that of the gene and originating immediately 5' to the 47-bp regulatory region. The reverse promoter was found to have nine initiation sites between -248 and -278 relative to D. Images PMID:2674682

  20. Exaptation of Transposable Elements into Novel Cis-Regulatory Elements: Is the Evidence Always Strong?

    PubMed Central

    de Souza, Flávio S.J.; Franchini, Lucía F.; Rubinstein, Marcelo


    Transposable elements (TEs) are mobile genetic sequences that can jump around the genome from one location to another, behaving as genomic parasites. TEs have been particularly effective in colonizing mammalian genomes, and such heavy TE load is expected to have conditioned genome evolution. Indeed, studies conducted both at the gene and genome levels have uncovered TE insertions that seem to have been co-opted—or exapted—by providing transcription factor binding sites (TFBSs) that serve as promoters and enhancers, leading to the hypothesis that TE exaptation is a major factor in the evolution of gene regulation. Here, we critically review the evidence for exaptation of TE-derived sequences as TFBSs, promoters, enhancers, and silencers/insulators both at the gene and genome levels. We classify the functional impact attributed to TE insertions into four categories of increasing complexity and argue that so far very few studies have conclusively demonstrated exaptation of TEs as transcriptional regulatory regions. We also contend that many genome-wide studies dealing with TE exaptation in recent lineages of mammals are still inconclusive and that the hypothesis of rapid transcriptional regulatory rewiring mediated by TE mobilization must be taken with caution. Finally, we suggest experimental approaches that may help attributing higher-order functions to candidate exapted TEs. PMID:23486611

  1. Regional Location Calibration in Asia

    NASA Astrophysics Data System (ADS)

    Steck, L. K.; Hartse, H.; Aprea, C.; Franks, J.; Velasco, A.; Randall, G.; Bradley, C.; Begnaud, M.; Aguilar-Chang, J.


    This paper presents a spectrum of issues and efforts involved in improving seismic location performance worldwide. Our efforts are largely designed around providing validated, rigorously calibrated travel times, azimuths, and slownesses along with accurate error estimates. To do so entails a significant effort that includes data mining, data integration, database management, developing optimal 1-, 2-, and 3-D Earth models, using the Earth models to predict wave propagation, developing corrections and errors for travel times, azimuths, and slownesses, and validation of all products. Results presented here will focus on Asia. For the region around station MAKZ in north-central Asia we have looked at several tens of published 1-D velocity models. For each model, travel time calculations were performed, predictions for P and S arrivals were established, and the predicted times were compared to the observed. We will present best-fit models for tectonic provinces out to regional distances from MAKZ. Previous work has shown that Non-stationary Modified Bayesian Kriging of travel time residuals successfully improves regional seismic event location, and this method is being extended to calculate corrections for azimuth and slowness. The ability to krig over 3-D Earth models is also being implemented. In order to produce the most useful corrections, we require accurate ground truth. For this we are continuing efforts to create a location database consisting of the best available seismic event locations and the most accurate and precise travel times. Building this database relies on participation from universities, other NNSA laboratories, and contacts in private industry. Through the kriging procedure we are able to stabilize location algorithms, but the ultimate usefulness of the corrections themselves is directly related to the quality of the ground truth from which the corrections are derived. Indeed, epicentral mislocations from EvLoc using travel time correction

  2. Rolling-Element Bearings

    NASA Technical Reports Server (NTRS)

    Hamrock, B. J.; Anderson, W. J.


    Rolling element bearings are a precision, yet simple, machine element of great utility. A brief history of rolling element bearings is reviewed and the type of rolling element bearings, their geometry and kinematics, as well as the materials they are made from and the manufacturing processes they involve are described. Unloaded and unlubricated rolling element bearings, loaded but unlubricated rolling element bearings and loaded and lubricated rolling element bearings are considered. The recognition and understanding of elastohydrodynamic lubrication covered, represents one of the major development in rolling element bearings.

  3. Low exchange element for nuclear reactor


    Brogli, Rudolf H.; Shamasunder, Bangalore I.; Seth, Shivaji S.


    A flow exchange element is presented which lowers temperature gradients in fuel elements and reduces maximum local temperature within high temperature gas-cooled reactors. The flow exchange element is inserted within a column of fuel elements where it serves to redirect coolant flow. Coolant which has been flowing in a hotter region of the column is redirected to a cooler region, and coolant which has been flowing in the cooler region of the column is redirected to the hotter region. The safety, efficiency, and longevity of the high temperature gas-cooled reactor is thereby enhanced.

  4. It's All about Location, Location, Location: Children's Memory for the "Where'' of Personally Experienced Events

    ERIC Educational Resources Information Center

    Bauer, Patricia J.; Doydum, Ayzit O.; Pathman, Thanujeni; Larkina, Marina; Guler, O. Evren; Burch, Melissa


    Episodic memory is defined as the ability to recall specific past events located in a particular time and place. Over the preschool and into the school years, there are clear developmental changes in memory for when events took place. In contrast, little is known about developmental changes in memory for where events were experienced. In the…

  5. Location, Location, Location: How Would a High-Performing Charter School Network Fare in Different States?

    ERIC Educational Resources Information Center

    Lozier, Chris; Rotherham, Andrew J.


    In this paper the authors do not examine different operating strategies for charter schools or analyze the impact of their often educationally intensive models on finance. Instead, because public charter schools are funded predominantly by public dollars, they simply ask what impact location--and its associated variances in public funding and the…

  6. Cholesterol's location in lipid bilayers


    Marquardt, Drew; Kučerka, Norbert; Wassall, Stephen R.; Harroun, Thad A.; Katsaras, John


    It is well known that cholesterol modifies the physical properties of lipid bilayers. For example, the much studied liquid-ordered Lo phase contains rapidly diffusing lipids with their acyl chains in the all trans configuration, similar to gel phase bilayers. Moreover, the Lo phase is commonly associated with cholesterol-enriched lipid rafts, which are thought to serve as platforms for signaling proteins in the plasma membrane. Cholesterol's location in lipid bilayers has been studied extensively, and it has been shown – at least in some bilayers – to align differently from its canonical upright orientation, where its hydroxyl group is in themore » vicinity of the lipid–water interface. In this study we review recent works describing cholesterol's location in different model membrane systems with emphasis on results obtained from scattering, spectroscopic and molecular dynamics studies.« less

  7. Antarctic Meteorite Location Map Series

    NASA Technical Reports Server (NTRS)

    Schutt, John (Editor); Fessler, Brian (Editor); Cassidy, William (Editor)


    Antarctica has been a prolific source of meteorites since meteorite concentrations were discovered in 1969. The Antarctic Search For Meteorites (ANSMET) project has been active over much of the Trans-Antarctic Mountain Range. The first ANSMET expedition (a joint U.S.-Japanese effort) discovered what turned out to be a significant concentration of meteorites at the Allan Hills in Victoria Land. Later reconnaissance in this region resulted in the discovery of meteorite concentrations on icefields to the west of the Allan Hills, at Reckling Moraine, and Elephant Moraine. Antarctic meteorite location maps (reduced versions) of the Allan Hills main, near western, middle western, and far western icefields and the Elephant Moraine icefield are presented. Other Antarctic meteorite location maps for the specimens found by the ANSMET project are being prepared.

  8. Cholesterol's location in lipid bilayers.


    Marquardt, Drew; Kučerka, Norbert; Wassall, Stephen R; Harroun, Thad A; Katsaras, John


    It is well known that cholesterol modifies the physical properties of lipid bilayers. For example, the much studied liquid-ordered Lo phase contains rapidly diffusing lipids with their acyl chains in the all trans configuration, similar to gel phase bilayers. Moreover, the Lo phase is commonly associated with cholesterol-enriched lipid rafts, which are thought to serve as platforms for signaling proteins in the plasma membrane. Cholesterol's location in lipid bilayers has been studied extensively, and it has been shown - at least in some bilayers - to align differently from its canonical upright orientation, where its hydroxyl group is in the vicinity of the lipid-water interface. In this article we review recent works describing cholesterol's location in different model membrane systems with emphasis on results obtained from scattering, spectroscopic and molecular dynamics studies. PMID:27056099

  9. Fatigue-Crack-Tip Locator

    NASA Technical Reports Server (NTRS)

    Namkung, Min; Clendenin, C. Gerald; Wincheski, Buzz; Fulton, James P.; Todhunter, Ronald G.; Simpson, John W.


    Fatigue-testing system includes automated subsystem continuously tracking location of fatigue-crack tip in metal or other highly electrically conductive specimen. Fatigue-crack-tip-locating subsystem also searches specimen to find initial fatigue crack and its tip and to trace out hidden fatigue cracks and other flaws inside specimen. Subsystem operates under overall control of personal computer, which also controls load frame applying prescribed cyclic stresses to specimen. Electromagnetic flaw detector based on eddy-current principle scanned over surface of specimen. Flaw detector described in "Electromagnetic Flaw Detector Is Easier To Use" (LAR-15046). System provides automated control and monitoring of fatigue experiments, saving time for researchers and enabling experiments to run unattended 24 hours a day. All information on crack-tip trajectories and rates of growth of cracks recorded automatically, so researchers have access to more information.

  10. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters

    PubMed Central

    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N


    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and “delivering” remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  11. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters.


    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N


    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and "delivering" remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  12. Computer Model Locates Environmental Hazards

    NASA Technical Reports Server (NTRS)


    Catherine Huybrechts Burton founded San Francisco-based Endpoint Environmental (2E) LLC in 2005 while she was a student intern and project manager at Ames Research Center with NASA's DEVELOP program. The 2E team created the Tire Identification from Reflectance model, which algorithmically processes satellite images using turnkey technology to retain only the darkest parts of an image. This model allows 2E to locate piles of rubber tires, which often are stockpiled illegally and cause hazardous environmental conditions and fires.

  13. Unusually located primary hydatid cysts

    PubMed Central

    Aksakal, Nihat; Kement, Metin; Okkabaz, Nuri; Altuntaş, Yunus Emre; Öncel, Mustafa


    The hydatid disease caused by Echinococcus granulosus is an endemic parasitic disease affecting several Mediterranean countries. Echinococcal cysts are mostly located in the liver and the lung, but the disease can be detected anywhere in the body. In this study, we present uncommon extrahepatic localizations of primary hydatid disease. Patients who were operated on for hydatid disease or cystic lesions, which were later diagnosed as hydatid disease, between 2004 and 2010 were retrieved retrospectively. Patients with lesions localized outside the liver and the lung were enrolled in the study. Eight patients with extrahepatic primary hydatid disease were treated surgically at our clinic. The cysts were located in the scapular region, spleen, pancreas, lumbosacral region and gluteal muscle. Surgical techniques were partial or total cystectomy with or without tube drainage. Splenectomy was performed for splenic hydatid disease and partial pericystectomy, Roux-en-Y cystojejunostomy, cholecystectomy and T-tube drainage for pancreatic hydatid disease. There were no complications or mortality in the postoperative period. Hydatid cyst should be considered in the differential diagnosis of cystic lesions, especially in endemic areas. Surgical technique should be planned according to the location of the cyst. PMID:27436938

  14. Duodenal Neuroendocrine Tumors: Location Matters!


    Sheikh, Mohd Raashid; Osman, Houssam; Cheek, Susannah; Hunter, Shanee; Jeyarajah, Dhiresh Rohan


    Duodenal neuroendocrine tumors (NETs) are rare. Historically, when feasible a less aggressive surgical approach is considered. The aim of this study was to identify factors associated with prognosis and the necessity for more aggressive surgical procedures. All patients who underwent surgery for duodenal NETs between September 2005 and June 2014 were identified retrospectively. Data collected included clinical presentation, operative findings, and histopathological data. Eighteen patients underwent surgical management for duodenal NETs. Two patients underwent transduodenal excision (11%), two patients had partial duodenal resection (11%), two patients had antrectomy including 1st part of duodenum (D1) resection (33%), and eight underwent pancreaticoduodenectomy [PD (44%)]. On analysis, 2nd part of duodenum (D2) location was the most common site of duodenal NETs (n = 9, 50%). The odds of having a PD were 10 times higher when the lesion was in D2 location. The odds of having a positive lymph node are nine times higher when the lesion is in D2 region. The odds of having a positive lymph node are three times higher when lesion is greater than T1. D2 location of NETs is associated with higher odds of lymph node positivity and need for more extensive procedures like PD. PMID:27215716

  15. Discrete Element Modeling

    SciTech Connect

    Morris, J; Johnson, S


    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  16. Locating buildings in aerial photos

    NASA Technical Reports Server (NTRS)

    Green, James S.


    Algorithms and techniques for use in the identification and location of large buildings in digitized copies of aerial photographs are developed and tested. The building data would be used in the simulation of objects located in the vicinity of an airport that may be detected by aircraft radar. Two distinct approaches are considered. Most building footprints are rectangular in form. The first approach studied is to search for right-angled corners that characterize rectangular objects and then to connect these corners to complete the building. This problem is difficult because many nonbuilding objects, such as street corners, parking lots, and ballparks often have well defined corners which are often difficult to distinguish from rooftops. Furthermore, rooftops come in a number of shapes, sizes, shadings, and textures which also limit the discrimination task. The strategy used linear sequences of different samples to detect straight edge segments at multiple angles and to determine when these segments meet at approximately right-angles with respect to each other. This technique is effective in locating corners. The test image used has a fairly rectangular block pattern oriented about thirty degrees clockwise from a vertical alignment, and the overall measurement data reflect this. However, this technique does not discriminate between buildings and other objects at an operationally suitable rate. In addition, since multiple paths are tested for each image pixel, this is a time consuming task. The process can be speeded up by preprocessing the image to locate the more optimal sampling paths. The second approach is to rely on a human operator to identify and select the building objects and then to have the computer determine the outline and location of the selected structures. When presented with a copy of a digitized aerial photograph, the operator uses a mouse and cursor to select a target building. After a button on the mouse is pressed, with the cursor fully within

  17. Identifying pollutant source directions using multiple analysis methods at a rural location in New York

    NASA Astrophysics Data System (ADS)

    Bae, Min-Suk; Schwab, James J.; Chen, Wei-Nai; Lin, Chuan-Yao; Rattigan, Oliver V.; Demerjian, Kenneth L.


    We identify the directionality of sources contributing to observed pollutant concentrations at a rural site through the use of the analysis methods of Conditional Probability Function (CPF) and the Source Direction Probability (SDP). Input data consists of hourly averaged PM 2.5 mass, Organic Mass (OM) from Organic Carbon (OC), optical Elemental Carbon (optical EC), SO 2, CO, NOy, O 3 concentrations and metrological data from Pinnacle State Park site in rural New York State for the period of Dec 2004 to Dec 2008. These measured pollutants are coupled with on-site wind data to identify the directionality of the sources; which are then compared to known stationary source locations from the EPA Air Data web site. Although the CPF plot of the O 3 showed no distinct directionality source area, the Pinnacle State Park site was frequently impacted by plumes of relatively high PM 2.5 mass, SO 2, CO, NOy, optical EC and OM concentrations. Further analysis of the enhanced pollution occurrence frequency from the eastern sector revealed two peaks in the time-of-day distribution of elevated CO, NOy, and optical EC, which provides additional information on the sources. This contrasts with the enhanced pollution occurrence frequency from the south for CO, OM, and optical EC, which shows a single morning peak in its time-of-day distribution and indicates a somewhat more distant, but common source for these carbon-containing pollutants. PM 2.5 mass corresponds to the source areas related to emission facilities listed in the EPA Emissions Inventory, which is further confirmed by correlation and analysis of aerosol optical depth (AOD) data from Moderate-resolution Imaging Spectrometer (MODIS) on board Terra and Aqua satellites. We present evidence that most of the high pollution episodes likely arise from emission sources located several hundred kilometers from the site, indicating mid-long range transport of pollutants to this location.

  18. Elements of Film.

    ERIC Educational Resources Information Center

    Bobker, Lee R.

    A film is the successful combination of two distinct groups of elements: (1) the technical elements by which the film is made (camera, lighting, sound and editing) and (2) the esthetic elements that transform the craft into an art. This book attempts to combine the study of these elements by providing technical information about the process of…

  19. Organic Elemental Analysis.

    ERIC Educational Resources Information Center

    Ma, T. S.; Wang, C. Y.


    Presents a literature review on methods used to analyze organic elements. Topic areas include methods for: (1) analyzing carbon, hydrogen, and nitrogen; (2) analyzing oxygen, sulfur, and halogens; (3) analyzing other elements; (4) simultaneously determining several elements; and (5) determing trace elements. (JN)

  20. Enhancer-like long-range transcriptional activation by λ CI-mediated DNA looping.


    Cui, Lun; Murchland, Iain; Shearwin, Keith E; Dodd, Ian B


    How distant enhancer elements regulate the assembly of a transcription complex at a promoter remains poorly understood. Here, we use long-range gene regulation by the bacteriophage λ CI protein as a powerful system to examine this process in vivo. A 2.3-kb DNA loop, formed by CI bridging its binding sites at OR and OL, is known already to enhance repression at the lysogenic promoter PRM, located at OR. Here, we show that CI looping also activates PRM by allowing the C-terminal domain of the α subunit of the RNA polymerase bound at PRM to contact a DNA site adjacent to the distal CI sites at OL. Our results establish OL as a multifaceted enhancer element, able to activate transcription from long distances independently of orientation and position. We develop a physicochemical model of our in vivo data and use it to show that the observed activation is consistent with a simple recruitment mechanism, where the α-C-terminal domain to DNA contact need only provide ∼2.7 kcal/mol of additional binding energy for RNA polymerase. Structural modeling of this complete enhancer-promoter complex reveals how the contact is achieved and regulated, and suggests that distal enhancer elements, once appropriately positioned at the promoter, can function in essentially the same way as proximal promoter elements. PMID:23382214