Multiple major disease-associated clones of Legionella pneumophila have emerged recently and independently.

PubMed

David, Sophia; Rusniok, Christophe; Mentasti, Massimo; Gomez-Valero, Laura; Harris, Simon R; Lechat, Pierre; Lees, John; Ginevra, Christophe; Glaser, Philippe; Ma, Laurence; Bouchier, Christiane; Underwood, Anthony; Jarraud, Sophie; Harrison, Timothy G; Parkhill, Julian; Buchrieser, Carmen

2016-11-01

Legionella pneumophila is an environmental bacterium and the leading cause of Legionnaires' disease. Just five sequence types (ST), from more than 2000 currently described, cause nearly half of disease cases in northwest Europe. Here, we report the sequence and analyses of 364 L. pneumophila genomes, including 337 from the five disease-associated STs and 27 representative of the species diversity. Phylogenetic analyses revealed that the five STs have independent origins within a highly diverse species. The number of de novo mutations is extremely low with maximum pairwise single-nucleotide polymorphisms (SNPs) ranging from 19 (ST47) to 127 (ST1), which suggests emergences within the last century. Isolates sampled geographically far apart differ by only a few SNPs, demonstrating rapid dissemination. These five STs have been recombining recently, leading to a shared pool of allelic variants potentially contributing to their increased disease propensity. The oldest clone, ST1, has spread globally; between 1940 and 2000, four new clones have emerged in Europe, which show long-distance, rapid dispersal. That a large proportion of clinical cases is caused by recently emerged and internationally dispersed clones, linked by convergent evolution, is surprising for an environmental bacterium traditionally considered to be an opportunistic pathogen. To simultaneously explain recent emergence, rapid spread and increased disease association, we hypothesize that these STs have adapted to new man-made environmental niches, which may be linked by human infection and transmission. © 2016 David et al.; Published by Cold Spring Harbor Laboratory Press.

Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).

PubMed

Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco

2016-03-01

Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera:Culididae): developmental regulation and environmental response

USDA-ARS?s Scientific Manuscript database

The cDNA of a NADH dehydrogenase -ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus) taeniorhynchus Wiedemann has been cloned and sequenced. The full-length mRNA sequence (824 bp) of AetNDUFS8 encodes an open reading region of 651 bp (i.e., 217 amino acids). To detect whether ...

Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

PubMed

Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

2011-12-01

Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

Dogs cloned from adult somatic cells.

PubMed

Lee, Byeong Chun; Kim, Min Kyu; Jang, Goo; Oh, Hyun Ju; Yuda, Fibrianto; Kim, Hye Jin; Hossein, M Shamim; Shamim, M Hossein; Kim, Jung Ju; Kang, Sung Keun; Schatten, Gerald; Hwang, Woo Suk

2005-08-04

Several mammals--including sheep, mice, cows, goats, pigs, rabbits, cats, a mule, a horse and a litter of three rats--have been cloned by transfer of a nucleus from a somatic cell into an egg cell (oocyte) that has had its nucleus removed. This technology has not so far been successful in dogs because of the difficulty of maturing canine oocytes in vitro. Here we describe the cloning of two Afghan hounds by nuclear transfer from adult skin cells into oocytes that had matured in vivo. Together with detailed sequence information generated by the canine-genome project, the ability to clone dogs by somatic-cell nuclear transfer should help to determine genetic and environmental contributions to the diverse biological and behavioural traits associated with the many different canine breeds.

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Occurrence and Phylogenetic Diversity of Sphingomonas Strains in Soils Contaminated with Polycyclic Aromatic Hydrocarbons

PubMed Central

Leys, Natalie M. E. J.; Ryngaert, Annemie; Bastiaens, Leen; Verstraete, Willy; Top, Eva M.; Springael, Dirk

2004-01-01

Bacterial strains of the genus Sphingomonas are often isolated from contaminated soils for their ability to use polycyclic aromatic hydrocarbons (PAH) as the sole source of carbon and energy. The direct detection of Sphingomonas strains in contaminated soils, either indigenous or inoculated, is, as such, of interest for bioremediation purposes. In this study, a culture-independent PCR-based detection method using specific primers targeting the Sphingomonas 16S rRNA gene combined with denaturing gradient gel electrophoresis (DGGE) was developed to assess Sphingomonas diversity in PAH-contaminated soils. PCR using the new primer pair on a set of template DNAs of different bacterial genera showed that the method was selective for bacteria belonging to the family Sphingomonadaceae. Single-band DGGE profiles were obtained for most Sphingomonas strains tested. Strains belonging to the same species had identical DGGE fingerprints, and in most cases, these fingerprints were typical for one species. Inoculated strains could be detected at a cell concentration of 104 CFU g of soil−1. The analysis of Sphingomonas population structures of several PAH-contaminated soils by the new PCR-DGGE method revealed that soils containing the highest phenanthrene concentrations showed the lowest Sphingomonas diversity. Sequence analysis of cloned PCR products amplified from soil DNA revealed new 16S rRNA gene Sphingomonas sequences significantly different from sequences from known cultivated isolates (i.e., sequences from environmental clones grouped phylogenetically with other environmental clone sequences available on the web and that possibly originated from several potential new species). In conclusion, the newly designed Sphingomonas-specific PCR-DGGE detection technique successfully analyzed the Sphingomonas communities from polluted soils at the species level and revealed different Sphingomonas members not previously detected by culture-dependent detection techniques. PMID:15066784

Locating Sequence on FPC Maps and Selecting a Minimal Tiling Path

PubMed Central

Engler, Friedrich W.; Hatfield, James; Nelson, William; Soderlund, Carol A.

2003-01-01

This study discusses three software tools, the first two aid in integrating sequence with an FPC physical map and the third automatically selects a minimal tiling path given genomic draft sequence and BAC end sequences. The first tool, FSD (FPC Simulated Digest), takes a sequenced clone and adds it back to the map based on a fingerprint generated by an in silico digest of the clone. This allows verification of sequenced clone positions and the integration of sequenced clones that were not originally part of the FPC map. The second tool, BSS (Blast Some Sequence), takes a query sequence and positions it on the map based on sequence associated with the clones in the map. BSS has multiple uses as follows: (1) When the query is a file of marker sequences, they can be added as electronic markers. (2) When the query is draft sequence, the results of BSS can be used to close gaps in a sequenced clone or the physical map. (3) When the query is a sequenced clone and the target is BAC end sequences, one may select the next clone for sequencing using both sequence comparison results and map location. (4) When the query is whole-genome draft sequence and the target is BAC end sequences, the results can be used to select many clones for a minimal tiling path at once. The third tool, pickMTP, automates the majority of this last usage of BSS. Results are presented using the rice FPC map, BAC end sequences, and whole-genome shotgun from Syngenta. PMID:12915486

Archaeal Diversity in Waters from Deep South African Gold Mines

PubMed Central

Takai, Ken; Moser, Duane P.; DeFlaun, Mary; Onstott, Tullis C.; Fredrickson, James K.

2001-01-01

A culture-independent molecular analysis of archaeal communities in waters collected from deep South African gold mines was performed by performing a PCR-mediated terminal restriction fragment length polymorphism (T-RFLP) analysis of rRNA genes (rDNA) in conjunction with a sequencing analysis of archaeal rDNA clone libraries. The water samples used represented various environments, including deep fissure water, mine service water, and water from an overlying dolomite aquifer. T-RFLP analysis revealed that the ribotype distribution of archaea varied with the source of water. The archaeal communities in the deep gold mine environments exhibited great phylogenetic diversity; the majority of the members were most closely related to uncultivated species. Some archaeal rDNA clones obtained from mine service water and dolomite aquifer water samples were most closely related to environmental rDNA clones from surface soil (soil clones) and marine environments (marine group I [MGI]). Other clones exhibited intermediate phylogenetic affiliation between soil clones and MGI in the Crenarchaeota. Fissure water samples, derived from active or dormant geothermal environments, yielded archaeal sequences that exhibited novel phylogeny, including a novel lineage of Euryarchaeota. These results suggest that deep South African gold mines harbor novel archaeal communities distinct from those observed in other environments. Based on the phylogenetic analysis of archaeal strains and rDNA clones, including the newly discovered archaeal rDNA clones, the evolutionary relationship and the phylogenetic organization of the domain Archaea are reevaluated. PMID:11722932

Bacterial diversity in the active stage of a bioremediation system for mineral oil hydrocarbon-contaminated soils.

PubMed

Popp, Nicole; Schlömann, Michael; Mau, Margit

2006-11-01

Soils contaminated with mineral oil hydrocarbons are often cleaned in off-site bioremediation systems. In order to find out which bacteria are active during the degradation phase in such systems, the diversity of the active microflora in a degrading soil remediation system was investigated by small-subunit (SSU) rRNA analysis. Two sequential RNA extracts from one soil sample were generated by a procedure incorporating bead beating. Both extracts were analysed separately by generating individual SSU rDNA clone libraries from cDNA of the two extracts. The sequencing results showed moderate diversity. The two clone libraries were dominated by Gammaproteobacteria, especially Pseudomonas spp. Alphaproteobacteria and Betaproteobacteria were two other large groups in the clone libraries. Actinobacteria, Firmicutes, Bacteroidetes and Epsilonproteobacteria were detected in lower numbers. The obtained sequences were predominantly related to genera for which cultivated representatives have been described, but were often clustered together in the phylogenetic tree, and the sequences that were most similar were originally obtained from soils and not from pure cultures. Most of the dominant genera in the clone libraries, e.g. Pseudomonas, Acinetobacter, Sphingomonas, Acidovorax and Thiobacillus, had already been detected in (mineral oil hydrocarbon) contaminated environmental samples. The occurrence of the genera Zymomonas and Rhodoferax was novel in mineral oil hydrocarbon-contaminated soil.

Epidemiological information is key when interpreting whole genome sequence data – lessons learned from a large Legionella pneumophila outbreak in Warstein, Germany, 2013

PubMed Central

Petzold, Markus; Prior, Karola; Moran-Gilad, Jacob; Harmsen, Dag; Lück, Christian

2017-01-01

Introduction Whole genome sequencing (WGS) is increasingly used in Legionnaires’ disease (LD) outbreak investigations, owing to its higher resolution than sequence-based typing, the gold standard typing method for Legionella pneumophila, in the analysis of endemic strains. Recently, a gene-by-gene typing approach based on 1,521 core genes called core genome multilocus sequence typing (cgMLST) was described that enables a robust and standardised typing of L. pneumophila. Methods: We applied this cgMLST scheme to isolates obtained during the largest outbreak of LD reported so far in Germany. In this outbreak, the epidemic clone ST345 had been isolated from patients and four different environmental sources. In total 42 clinical and environmental isolates were retrospectively typed. Results: Epidemiologically unrelated ST345 isolates were clearly distinguishable from the epidemic clone. Remarkably, epidemic isolates split up into two distinct clusters, ST345-A and ST345-B, each respectively containing a mix of clinical and epidemiologically-related environmental samples. Discussion/conclusion: The outbreak was therefore likely caused by both variants of the single sequence type, which pre-existed in the environmental reservoirs. The two clusters differed by 40 alleles located in two neighbouring genomic regions of ca 42 and 26 kb. Additional analysis supported horizontal gene transfer of the two regions as responsible for the difference between the variants. Both regions comprise virulence genes and have previously been reported to be involved in recombination events. This corroborates the notion that genomic outbreak investigations should always take epidemiological information into consideration when making inferences. Overall, cgMLST proved helpful in disentangling the complex genomic epidemiology of the outbreak. PMID:29162202

Epidemiological information is key when interpreting whole genome sequence data - lessons learned from a large Legionella pneumophila outbreak in Warstein, Germany, 2013.

PubMed

Petzold, Markus; Prior, Karola; Moran-Gilad, Jacob; Harmsen, Dag; Lück, Christian

2017-11-01

IntroductionWhole genome sequencing (WGS) is increasingly used in Legionnaires' disease (LD) outbreak investigations, owing to its higher resolution than sequence-based typing, the gold standard typing method for Legionella pneumophila, in the analysis of endemic strains. Recently, a gene-by-gene typing approach based on 1,521 core genes called core genome multilocus sequence typing (cgMLST) was described that enables a robust and standardised typing of L. pneumophila . Methods : We applied this cgMLST scheme to isolates obtained during the largest outbreak of LD reported so far in Germany. In this outbreak, the epidemic clone ST345 had been isolated from patients and four different environmental sources. In total 42 clinical and environmental isolates were retrospectively typed. Results : Epidemiologically unrelated ST345 isolates were clearly distinguishable from the epidemic clone. Remarkably, epidemic isolates split up into two distinct clusters, ST345-A and ST345-B, each respectively containing a mix of clinical and epidemiologically-related environmental samples. Discussion/conclusion : The outbreak was therefore likely caused by both variants of the single sequence type, which pre-existed in the environmental reservoirs. The two clusters differed by 40 alleles located in two neighbouring genomic regions of ca 42 and 26 kb. Additional analysis supported horizontal gene transfer of the two regions as responsible for the difference between the variants. Both regions comprise virulence genes and have previously been reported to be involved in recombination events. This corroborates the notion that genomic outbreak investigations should always take epidemiological information into consideration when making inferences. Overall, cgMLST proved helpful in disentangling the complex genomic epidemiology of the outbreak.

Hybrid sequencing approach applied to human fecal metagenomic clone libraries revealed clones with potential biotechnological applications.

PubMed

Džunková, Mária; D'Auria, Giuseppe; Pérez-Villarroya, David; Moya, Andrés

2012-01-01

Natural environments represent an incredible source of microbial genetic diversity. Discovery of novel biomolecules involves biotechnological methods that often require the design and implementation of biochemical assays to screen clone libraries. However, when an assay is applied to thousands of clones, one may eventually end up with very few positive clones which, in most of the cases, have to be "domesticated" for downstream characterization and application, and this makes screening both laborious and expensive. The negative clones, which are not considered by the selected assay, may also have biotechnological potential; however, unfortunately they would remain unexplored. Knowledge of the clone sequences provides important clues about potential biotechnological application of the clones in the library; however, the sequencing of clones one-by-one would be very time-consuming and expensive. In this study, we characterized the first metagenomic clone library from the feces of a healthy human volunteer, using a method based on 454 pyrosequencing coupled with a clone-by-clone Sanger end-sequencing. Instead of whole individual clone sequencing, we sequenced 358 clones in a pool. The medium-large insert (7-15 kb) cloning strategy allowed us to assemble these clones correctly, and to assign the clone ends to maintain the link between the position of a living clone in the library and the annotated contig from the 454 assembly. Finally, we found several open reading frames (ORFs) with previously described potential medical application. The proposed approach allows planning ad-hoc biochemical assays for the clones of interest, and the appropriate sub-cloning strategy for gene expression in suitable vectors/hosts.

Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples.

PubMed

Grant, Susan; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

2006-01-01

Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at -20 degrees C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Cloning, analysis and functional annotation of expressed sequence tags from the Earthworm Eisenia fetida

PubMed Central

Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping

2007-01-01

Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730

Patterns of microbial diversity along a salinity gradient in the Guerrero Negro solar saltern, Baja CA Sur, Mexico

PubMed Central

Dillon, Jesse G.; Carlin, Mark; Gutierrez, Abraham; Nguyen, Vivian; McLain, Nathan

2013-01-01

The goal of this study was to use environmental sequencing of 16S rRNA and bop genes to compare the diversity of planktonic bacteria and archaea across ponds with increasing salinity in the Exportadora de Sal (ESSA) evaporative saltern in Guerrero Negro, Baja CA S., Mexico. We hypothesized that diverse communities of heterotrophic bacteria and archaea would be found in the ESSA ponds, but that bacterial diversity would decrease relative to archaea at the highest salinities. Archaeal 16S rRNA diversity was higher in Ponds 11 and 12 (370 and 380 g l−1 total salts, respectively) compared to Pond 9 (180 g l−1 total salts). Both Pond 11 and 12 communities had high representation (47 and 45% of clones, respectively) by Haloquadratum walsbyi-like (99% similarity) lineages. The archaeal community in Pond 9 was dominated (79%) by a single uncultured phylotype with 99% similarity to sequences recovered from the Sfax saltern in Tunisia. This pattern was mirrored in bop gene diversity with greater numbers of highly supported phylotypes including many Haloquadratum-like sequences from the two highest salinity ponds. In Pond 9, most bop sequences, were not closely related to sequences in databases. Bacterial 16S rRNA diversity was higher than archaeal in both Pond 9 and Pond 12 samples, but not Pond 11, where a non-Salinibacter lineage within the Bacteroidetes >98% similar to environmental clones recovered from Lake Tuz in Turkey and a saltern in Chula Vista, CA was most abundant (69% of community). This OTU was also the most abundant in Pond 12, but only represented 14% of clones in the more diverse pond. The most abundant OTU in Pond 9 (33% of community) was 99% similar to an uncultured gammaproteobacterial clone from the Salton Sea. Results suggest that the communities of saltern bacteria and archaea vary even in ponds with similar salinity and further investigation into the ecology of diverse, uncultured halophile communities is warranted. PMID:24391633

Analysis of methylated patterns and quality-related genes in tobacco (Nicotiana tabacum) cultivars.

PubMed

Jiao, Junna; Jia, Yanlong; Lv, Zhuangwei; Sun, Chuanfei; Gao, Lijie; Yan, Xiaoxiao; Cui, Liusu; Tang, Zongxiang; Yan, Benju

2014-08-01

Methylation-sensitive amplified polymorphism was used in this study to investigate epigenetic information of four tobacco cultivars: Yunyan 85, NC89, K326, and Yunyan 87. The DNA fragments with methylated information were cloned by reamplified PCR and sequenced. The results of Blast alignments showed that the genes with methylation information included chitinase, nitrate reductase, chloroplast DNA, mitochondrial DNA, ornithine decarboxylase, ribulose carboxylase, and promoter sequences. Homologous comparison in three cloned gene sequences (nitrate reductase, ornithine decarboxylase, and ribulose decarboxylase) indicated that geographic factors had significant influence on the whole genome methylation. Introns also contained different information in different tobacco cultivars. These findings suggest that synthetic mechanisms for tobacco aromatic components could be affected by different environmental factors leading to variation of noncoding regions in the genome, which finally results in different fragrance and taste in different tobacco cultivars.

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples

PubMed Central

Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.

2011-01-01

The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Effects of cloning and root-tip size on observations of fungal ITS sequences from Picea glauca roots

Treesearch

Daniel L. Lindner; Mark T. Banik

2009-01-01

To better understand the effects of cloning on observations of fungal ITS sequences from Picea glauca (white spruce) roots two techniques were compared: (i) direct sequencing of fungal ITS regions from individual root tips without cloning and (ii) cloning and sequencing of fungal ITS regions from individual root tips. Effect of root tip size was...

DNA hypomethylation of individual sequences in aborted cloned bovine fetuses.

PubMed

Chen, Tao; Jiang, Yan; Zhang, Yan-Ling; Liu, Jing-He; Hou, Yi; Schatten, Heide; Chen, Da-Yuan; Sun, Qing-Yuan

2005-09-01

Cloned bovines have a much higher abortion rate than those derived in vivo. Available evidence indicates that inappropriate epigenetic reprogramming of donor nuclei is the primary cause of cloning failure. To gain a better understanding of the DNA methylation changes associated with the high abortion rate of cloned bovines, we examined the DNA methylation status of a repeated sequence (satellite I) and the promoter regions of two single-copy genes (interleukin 3/cytokeratin) in aborted cloned fetuses, aborted fetuses derived from artificial insemination (AI), cloned adults and AI adults by bisulfite sequencing and restriction enzyme analysis. Two of four aborted cloned fetuses show very low methylation levels in the two single-copy gene promoter regions. One of the two fetuses also showed undermethylated status in the satellite I sequence. The other two aborted cloned fetuses have similar methylation levels to those of aborted AI fetuses. However, no difference in methylation was observed between cloned adults and AI adults. Our results demonstrate for the first time the undermethylated status of individual sequences in aborted cloned fetuses. These findings suggest that aberrant DNA methylation may contribute to the developmental failure of cloned bovine fetuses.

Clone DB: an integrated NCBI resource for clone-associated data

PubMed Central

Schneider, Valerie A.; Chen, Hsiu-Chuan; Clausen, Cliff; Meric, Peter A.; Zhou, Zhigang; Bouk, Nathan; Husain, Nora; Maglott, Donna R.; Church, Deanna M.

2013-01-01

The National Center for Biotechnology Information (NCBI) Clone DB (http://www.ncbi.nlm.nih.gov/clone/) is an integrated resource providing information about and facilitating access to clones, which serve as valuable research reagents in many fields, including genome sequencing and variation analysis. Clone DB represents an expansion and replacement of the former NCBI Clone Registry and has records for genomic and cell-based libraries and clones representing more than 100 different eukaryotic taxa. Records provide details of library construction, associated sequences, map positions and information about resource distribution. Clone DB is indexed in the NCBI Entrez system and can be queried by fields that include organism, clone name, gene name and sequence identifier. Whenever possible, genomic clones are mapped to reference assemblies and their map positions provided in clone records. Clones mapping to specific genomic regions can also be searched for using the NCBI Clone Finder tool, which accepts queries based on sequence coordinates or features such as gene or transcript names. Clone DB makes reports of library, clone and placement data on its FTP site available for download. With Clone DB, users now have available to them a centralized resource that provides them with the tools they will need to make use of these important research reagents. PMID:23193260

Identification of Eukaryotic Open Reading Frames in Metagenomic cDNA Libraries Made from Environmental Samples†

PubMed Central

Grant, Susan; Grant, William D.; Cowan, Don A.; Jones, Brian E.; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

2006-01-01

Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at −20°C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes. PMID:16391035

Cancer systems biology in the genome sequencing era: part 1, dissecting and modeling of tumor clones and their networks.

PubMed

Wang, Edwin; Zou, Jinfeng; Zaman, Naif; Beitel, Lenore K; Trifiro, Mark; Paliouras, Miltiadis

2013-08-01

Recent tumor genome sequencing confirmed that one tumor often consists of multiple cell subpopulations (clones) which bear different, but related, genetic profiles such as mutation and copy number variation profiles. Thus far, one tumor has been viewed as a whole entity in cancer functional studies. With the advances of genome sequencing and computational analysis, we are able to quantify and computationally dissect clones from tumors, and then conduct clone-based analysis. Emerging technologies such as single-cell genome sequencing and RNA-Seq could profile tumor clones. Thus, we should reconsider how to conduct cancer systems biology studies in the genome sequencing era. We will outline new directions for conducting cancer systems biology by considering that genome sequencing technology can be used for dissecting, quantifying and genetically characterizing clones from tumors. Topics discussed in Part 1 of this review include computationally quantifying of tumor subpopulations; clone-based network modeling, cancer hallmark-based networks and their high-order rewiring principles and the principles of cell survival networks of fast-growing clones. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Construction of random sheared fosmid library from Chinese cabbage and its use for Brassica rapa genome sequencing project.

PubMed

Park, Tae-Ho; Park, Beom-Seok; Kim, Jin-A; Hong, Joon Ki; Jin, Mina; Seol, Young-Joo; Mun, Jeong-Hwan

2011-01-01

As a part of the Multinational Genome Sequencing Project of Brassica rapa, linkage group R9 and R3 were sequenced using a bacterial artificial chromosome (BAC) by BAC strategy. The current physical contigs are expected to cover approximately 90% euchromatins of both chromosomes. As the project progresses, BAC selection for sequence extension becomes more limited because BAC libraries are restriction enzyme-specific. To support the project, a random sheared fosmid library was constructed. The library consists of 97536 clones with average insert size of approximately 40 kb corresponding to seven genome equivalents, assuming a Chinese cabbage genome size of 550 Mb. The library was screened with primers designed at the end of sequences of nine points of scaffold gaps where BAC clones cannot be selected to extend the physical contigs. The selected positive clones were end-sequenced to check the overlap between the fosmid clones and the adjacent BAC clones. Nine fosmid clones were selected and fully sequenced. The sequences revealed two completed gap filling and seven sequence extensions, which can be used for further selection of BAC clones confirming that the fosmid library will facilitate the sequence completion of B. rapa. Copyright © 2011. Published by Elsevier Ltd.

Miniprimer PCR, a New Lens for Viewing the Microbial World▿ †

PubMed Central

Isenbarger, Thomas A.; Finney, Michael; Ríos-Velázquez, Carlos; Handelsman, Jo; Ruvkun, Gary

2008-01-01

Molecular methods based on the 16S rRNA gene sequence are used widely in microbial ecology to reveal the diversity of microbial populations in environmental samples. Here we show that a new PCR method using an engineered polymerase and 10-nucleotide “miniprimers” expands the scope of detectable sequences beyond those detected by standard methods using longer primers and Taq polymerase. After testing the method in silico to identify divergent ribosomal genes in previously cloned environmental sequences, we applied the method to soil and microbial mat samples, which revealed novel 16S rRNA gene sequences that would not have been detected with standard primers. Deeply divergent sequences were discovered with high frequency and included representatives that define two new division-level taxa, designated CR1 and CR2, suggesting that miniprimer PCR may reveal new dimensions of microbial diversity. PMID:18083877

Altamira cave Paleolithic paintings harbor partly unknown bacterial communities.

PubMed

Schabereiter-Gurtner, Claudia; Saiz-Jimenez, Cesareo; Piñar, Guadalupe; Lubitz, Werner; Rölleke, Sabine

2002-05-21

Since it has been reported that microorganisms can affect painting pigments, Paleolithic painting microbiology deserves attention. The present study is the first report on the bacterial colonization of the valuable Paleolithic paintings in the famous Altamira cave (Spain). One sample taken from a painting area in the Polychromes Hall was analyzed culture-independently. This was the first time microbiologists were allowed to take sample material directly from Altamira paintings. Identification methods included PCR amplification of 16S rRNA genes (16S rDNA) and community fingerprinting by denaturing gradient gel electrophoresis (DGGE). The applied approach gave insight into a great bacterial taxonomic diversity, and allowed the detection of unexpected and unknown bacteria with potential effects on the conservation of the painting. Regarding the number of 29 visible DGGE bands in the community fingerprint, the numbers of analyzed clones described about 72% of the phylogenetic diversity present in the sample. Thirty-eight percent of the sequences analyzed were phylogenetically most closely related to cultivated bacteria, while the majority (62%) were most closely related to environmental 16S rDNA clones. Bacteria identified in Altamira were related with sequence similarities between 84.8 and 99.4% to members of the cosmopolitan Proteobacteria (52.3%), to members of the Acidobacterium division (23.8%), Cytophaga/Flexibacter/Bacteroides phylum (9.5%), green non-sulfur bacteria (4.8%), Planctomycetales (4.8%) and Actinobacteria (4.8%). The high number of clones most closely related to environmental 16S rDNA clones showed the broad spectrum of unknown and yet to be cultivated bacteria in Altamira cave.

Progenitor “Mycobacterium canettii” clone responsible for lymph node tuberculosis epidemic, Djibouti.

PubMed

Blouin, Yann; Cazajous, Géraldine; Dehan, Céline; Soler, Charles; Vong, Rithy; Hassan, Mohamed Osman; Hauck, Yolande; Boulais, Christian; Andriamanantena, Dina; Martinaud, Christophe; Martin, Émilie; Pourcel, Christine; Vergnaud, Gilles

2014-01-01

“Mycobacterium canettii,” an opportunistic human pathogen living in an unknown environmental reservoir, is the progenitor species from which Mycobacterium tuberculosis emerged. Since its discovery in 1969, most of the ≈70 known M. canettii strains were isolated in the Republic of Djibouti, frequently from expatriate children and adults. We show here, by whole-genome sequencing, that most strains collected from February 2010 through March 2013, and associated with 2 outbreaks of lymph node tuberculosis in children, belong to a unique epidemic clone within M. canettii. Evolution of this clone, which has been recovered regularly since 1983, may mimic the birth of M. tuberculosis. Thus, recognizing this organism and identifying its reservoir are clinically important.

Progenitor “Mycobacterium canettii” Clone Responsible for Lymph Node Tuberculosis Epidemic, Djibouti

PubMed Central

Blouin, Yann; Cazajous, Géraldine; Dehan, Céline; Soler, Charles; Vong, Rithy; Hassan, Mohamed Osman; Hauck, Yolande; Boulais, Christian; Andriamanantena, Dina; Martinaud, Christophe; Martin, Émilie; Pourcel, Christine

2014-01-01

“Mycobacterium canettii,” an opportunistic human pathogen living in an unknown environmental reservoir, is the progenitor species from which Mycobacterium tuberculosis emerged. Since its discovery in 1969, most of the ≈70 known M. canettii strains were isolated in the Republic of Djibouti, frequently from expatriate children and adults. We show here, by whole-genome sequencing, that most strains collected from February 2010 through March 2013, and associated with 2 outbreaks of lymph node tuberculosis in children, belong to a unique epidemic clone within M. canettii. Evolution of this clone, which has been recovered regularly since 1983, may mimic the birth of M. tuberculosis. Thus, recognizing this organism and identifying its reservoir are clinically important. PMID:24520560

TaqMan Real-Time PCR Assays To Assess Arbuscular Mycorrhizal Responses to Field Manipulation of Grassland Biodiversity: Effects of Soil Characteristics, Plant Species Richness, and Functional Traits▿ †

PubMed Central

König, Stephan; Wubet, Tesfaye; Dormann, Carsten F.; Hempel, Stefan; Renker, Carsten; Buscot, François

2010-01-01

Large-scale (temporal and/or spatial) molecular investigations of the diversity and distribution of arbuscular mycorrhizal fungi (AMF) require considerable sampling efforts and high-throughput analysis. To facilitate such efforts, we have developed a TaqMan real-time PCR assay to detect and identify AMF in environmental samples. First, we screened the diversity in clone libraries, generated by nested PCR, of the nuclear ribosomal DNA internal transcribed spacer (ITS) of AMF in environmental samples. We then generated probes and forward primers based on the detected sequences, enabling AMF sequence type-specific detection in TaqMan multiplex real-time PCR assays. In comparisons to conventional clone library screening and Sanger sequencing, the TaqMan assay approach provided similar accuracy but higher sensitivity with cost and time savings. The TaqMan assays were applied to analyze the AMF community composition within plots of a large-scale plant biodiversity manipulation experiment, the Jena Experiment, primarily designed to investigate the interactive effects of plant biodiversity on element cycling and trophic interactions. The results show that environmental variables hierarchically shape AMF communities and that the sequence type spectrum is strongly affected by previous land use and disturbance, which appears to favor disturbance-tolerant members of the genus Glomus. The AMF species richness of disturbance-associated communities can be largely explained by richness of plant species and plant functional groups, while plant productivity and soil parameters appear to have only weak effects on the AMF community. PMID:20418424

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

PubMed

Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

2011-09-01

The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid.

Bacterial diversity of siliciclastic sediments in a Thalassia testudinum meadow and the implications for Lucinisca nassula chemosymbiosis

NASA Astrophysics Data System (ADS)

Green-García, Angela M.; Engel, Annette Summers

2012-10-01

Despite the ecological and economic importance of Thalassia testudinum (turtle grass) meadows along the Caribbean and Gulf of Mexico coasts, and recognition that microbial activities are critical to plant growth and health, the bacterial diversity of these habitats has been poorly studied. Based on comparative analyses of 16S rRNA gene sequences from sediments in a T. testudinum meadow, 25 major taxonomic groups (excluding candidate divisions) were retrieved, including Alpha- Delta-, and Gamma-proteobacteria, Chloroflexi, Bacteroidetes, Acidobacteria, Spirochaetes, and Firmicutes. The distribution of bacterial groups was linked to a strongly hypoxic and sulfidic redox gradient. The diversity is potentially novel because phylogenetic affinities of sediment sequences compared to contextually annotated environmental clones from different habitats or to cultured representatives indicated approximately 41% were more closely related to each other than to sequences retrieved from these other habitats. Of all the relationships, very few (2.4%) were to cultured organisms, but 27% were to environmental clones retrieved from shallow marine shelf and coastal sediments or from mangroves, estuarine, or wetland sediments. Rare sequences were closely related to endosymbiont groups of Lucinisca nassula (Lucinidea: Bivalvia) hosts collected from the same meadow, which may indicate that the sediment is a potential reservoir for free-living symbionts. This study provides insight into the ecological and evolutionary relationships of the Thalassia-lucinid-bacteria system in tropical to sub-tropical regions.

Final progress report, Construction of a genome-wide highly characterized clone resource for genome sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nierman, William C.

At TIGR, the human Bacterial Artificial Chromosome (BAC) end sequencing and trimming were with an overall sequencing success rate of 65%. CalTech human BAC libraries A, B, C and D as well as Roswell Park Cancer Institute's library RPCI-11 were used. To date, we have generated >300,000 end sequences from >186,000 human BAC clones with an average read length {approx}460 bp for a total of 141 Mb covering {approx}4.7% of the genome. Over sixty percent of the clones have BAC end sequences (BESs) from both ends representing over five-fold coverage of the genome by the paired-end clones. The average phredmore » Q20 length is {approx}400 bp. This high accuracy makes our BESs match the human finished sequences with an average identity of 99% and a match length of 450 bp, and a frequency of one match per 12.8 kb contig sequence. Our sample tracking has ensured a clone tracking accuracy of >90%, which gives researchers a high confidence in (1) retrieving the right clone from the BA C libraries based on the sequence matches; and (2) building a minimum tiling path of sequence-ready clones across the genome and genome assembly scaffolds.« less

Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.

PubMed

Lam, Kathy N; Martens, Eric C; Charles, Trevor C

2018-01-01

Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be introduced into the gut microbe Bacteroides thetaiotaomicron to identify genes based on activity screening. Our results support the continuing development of genetically tractable systems to obtain information about gene function.

Microeukaryote Community Patterns along an O2/H2S Gradient in a Supersulfidic Anoxic Fjord (Framvaren, Norway)†

PubMed Central

Behnke, Anke; Bunge, John; Barger, Kathryn; Breiner, Hans-Werner; Alla, Victoria; Stoeck, Thorsten

2006-01-01

To resolve the fine-scale architecture of anoxic protistan communities, we conducted a cultivation-independent 18S rRNA survey in the superanoxic Framvaren Fjord in Norway. We generated three clone libraries along the steep O2/H2S gradient, using the multiple-primer approach. Of 1,100 clones analyzed, 753 proved to be high-quality protistan target sequences. These sequences were grouped into 92 phylotypes, which displayed high protistan diversity in the fjord (17 major eukaryotic phyla). Only a few were closely related to known taxa. Several sequences were dissimilar to all previously described sequences and occupied a basal position in the inferred phylogenies, suggesting that the sequences recovered were derived from novel, deeply divergent eukaryotes. We detected sequence clades with evolutionary importance (for example, clades in the euglenozoa) and clades that seem to be specifically adapted to anoxic environments, challenging the hypothesis that the global dispersal of protists is uniform. Moreover, with the detection of clones affiliated with jakobid flagellates, we present evidence that primitive descendants of early eukaryotes are present in this anoxic environment. To estimate sample coverage and phylotype richness, we used parametric and nonparametric statistical methods. The results show that although our data set is one of the largest published inventories, our sample missed a substantial proportion of the protistan diversity. Nevertheless, statistical and phylogenetic analyses of the three libraries revealed the fine-scale architecture of anoxic protistan communities, which may exhibit adaptation to different environmental conditions along the O2/H2S gradient. PMID:16672511

Inferring Higher Functional Information for RIKEN Mouse Full-Length cDNA Clones With FACTS

PubMed Central

Nagashima, Takeshi; Silva, Diego G.; Petrovsky, Nikolai; Socha, Luis A.; Suzuki, Harukazu; Saito, Rintaro; Kasukawa, Takeya; Kurochkin, Igor V.; Konagaya, Akihiko; Schönbach, Christian

2003-01-01

FACTS (Functional Association/Annotation of cDNA Clones from Text/Sequence Sources) is a semiautomated knowledge discovery and annotation system that integrates molecular function information derived from sequence analysis results (sequence inferred) with functional information extracted from text. Text-inferred information was extracted from keyword-based retrievals of MEDLINE abstracts and by matching of gene or protein names to OMIM, BIND, and DIP database entries. Using FACTS, we found that 47.5% of the 60,770 RIKEN mouse cDNA FANTOM2 clone annotations were informative for text searches. MEDLINE queries yielded molecular interaction-containing sentences for 23.1% of the clones. When disease MeSH and GO terms were matched with retrieved abstracts, 22.7% of clones were associated with potential diseases, and 32.5% with GO identifiers. A significant number (23.5%) of disease MeSH-associated clones were also found to have a hereditary disease association (OMIM Morbidmap). Inferred neoplastic and nervous system disease represented 49.6% and 36.0% of disease MeSH-associated clones, respectively. A comparison of sequence-based GO assignments with informative text-based GO assignments revealed that for 78.2% of clones, identical GO assignments were provided for that clone by either method, whereas for 21.8% of clones, the assignments differed. In contrast, for OMIM assignments, only 28.5% of clones had identical sequence-based and text-based OMIM assignments. Sequence, sentence, and term-based functional associations are included in the FACTS database (http://facts.gsc.riken.go.jp/), which permits results to be annotated and explored through web-accessible keyword and sequence search interfaces. The FACTS database will be a critical tool for investigating the functional complexity of the mouse transcriptome, cDNA-inferred interactome (molecular interactions), and pathome (pathologies). PMID:12819151

Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells.

PubMed

Yajima, Misako; Ikuta, Kazufumi; Kanda, Teru

2018-04-03

Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells

PubMed Central

Ikuta, Kazufumi; Kanda, Teru

2018-01-01

Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically. PMID:29614006

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

Prospecting Metagenomic Enzyme Subfamily Genes for DNA Family Shuffling by a Novel PCR-based Approach*

PubMed Central

Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong

2010-01-01

DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349

Genotyping of clinical and environmental multidrug resistant Enterococcus faecium strains.

PubMed

Shokoohizadeh, Leili; Mobarez, Ashraf Mohabati; Alebouyeh, Masoud; Zali, Mohammad Reza; Ranjbar, Reza

2017-01-01

Multidrug resistant (MDR) Enterococcus faecium is a nosocomial pathogen and clonal complex 17 (CC17) is the main genetic subpopulation of E. faecium in hospitals worldwide. There has thus far been no report of major E. faecium clones in Iranian hospitals. The present study analyzed strains of MDR E. faecium obtained from patients and the Intensive Care Unit environments using pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) to determine the antibiotic resistance patterns and genetic features of the dominant. clones of E. faecium. PFGE and MLST analysis revealed the presence of 17and 15 different subtypes, respectively. Of these, 18 (86%) isolates belonged toCC17. Most strains in this clonal complex harbored the esp gene and exhibited resistance to vancomycin, teicoplanin, ampicillin, ciprofloxacin, gentamicin, and erythromycin. The MLST results revealed 12 new sequence types (ST) for the first time. Approximately 50% of the STs were associated with ST203. Detection of E. faecium strains belonging to CC17 on medical equipment and in clinical specimens verified the circulation of high-risk MDR clones among the patients and in hospital environments in Iran.

Molecular Analysis of the Nitrate-Reducing Community from Unplanted and Maize-Planted Soils

PubMed Central

Philippot, Laurent; Piutti, Séverine; Martin-Laurent, Fabrice; Hallet, Stéphanie; Germon, Jean Claude

2002-01-01

Microorganisms that use nitrate as an alternative terminal electron acceptor play an important role in the global nitrogen cycle. The diversity of the nitrate-reducing community in soil and the influence of the maize roots on the structure of this community were studied. The narG gene encoding the membrane bound nitrate reductase was selected as a functional marker for the nitrate-reducing community. The use of narG is of special interest because the phylogeny of the narG gene closely reflects the 16S ribosomal DNA phylogeny. Therefore, targeting the narG gene provided for the first time a unique insight into the taxonomic composition of the nitrate-reducing community in planted and unplanted soils. The PCR-amplified narG fragments were cloned and analyzed by restriction fragment length polymorphism (RFLP). In all, 60 RFLP types represented by two or more clones were identified in addition to the 58 RFLP types represented by only one clone. At least one clone belonging to each RFLP type was then sequenced. Several of the obtained sequences were not related to the narG genes from cultivated bacteria, suggesting the existence of unidentified nitrate-reducing bacteria in the studied soil. However, environmental sequences were also related to NarG from many bacterial divisions, i.e., Actinobacteria and α, β, and γ Proteobacteria. The presence of the plant roots resulted in a shift in the structure of the nitrate-reducing community between the unplanted and planted soils. Sequencing of RFLP types dominant in the rhizosphere or present only in the rhizosphere revealed that they are related to NarG from the Actinobacteria in an astonishingly high proportion. PMID:12450836

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

[Archaeal community structure and diversity in Urumqi No. 10 cold sulfur spring analyzed by culture-independent approach].

PubMed

Li, Ping; Zeng, Jun; Zulipiya, Yunus; Gao, Xiaoqi; Dong, Xiuhuang; Xue, Juan; Lou, Kai

2013-03-04

We explored the composition and diversity of archaea in a cold sulfur spring water in Xinjiang earthquake fault zone. Environmental total DNA was extracted directly with enzymatic lysis method from a cold sulfur spring water. We constructed clone library of 16S rRNA gene amplified with archaeal-specific primers. A total of 115 positive clones were selected randomly from the library and identified by restriction length polymorphism (RFLP) with enzyme Alu I and Afa I. The unique RFLP patterns corresponded clones were selected for sequencing, BLAS alignment and constructing 16S rRNA gene phylogenetic tree. In total, 44 operational taxonomic units (OTUs) were determined from the library. BLAST and phylogenetic analysis indicated that these OTUs were affiliated with Euryarchaeota (94.78%) and Thaumarchaeota (4.35%). Only one Thaumarchaeotal clone was detected and most related to the genus Nitrosopumilus with 93% similarity. Euryarchaeotal clones were abundant and diverse. Of them, 42.61% of clones belonged to RC-V cluster; 13.91% of clones, 20.87% of clones were classified into LDS cluster and Methanomicrobiales respectively; 4.35% of clones had high similarity with ANME-1a-FW, which were involved in Anaerobic oxidation of methane (AOM). In addition, we also detected some (13.05%) unknown Euryarchaotal clones. Euryarchaeota in the environment were diverse, and possibly with a large fraction of potential novel species.

Whole-Genome Sequencing and Assembly with High-Throughput, Short-Read Technologies

PubMed Central

Sundquist, Andreas; Ronaghi, Mostafa; Tang, Haixu; Pevzner, Pavel; Batzoglou, Serafim

2007-01-01

While recently developed short-read sequencing technologies may dramatically reduce the sequencing cost and eventually achieve the $1000 goal for re-sequencing, their limitations prevent the de novo sequencing of eukaryotic genomes with the standard shotgun sequencing protocol. We present SHRAP (SHort Read Assembly Protocol), a sequencing protocol and assembly methodology that utilizes high-throughput short-read technologies. We describe a variation on hierarchical sequencing with two crucial differences: (1) we select a clone library from the genome randomly rather than as a tiling path and (2) we sample clones from the genome at high coverage and reads from the clones at low coverage. We assume that 200 bp read lengths with a 1% error rate and inexpensive random fragment cloning on whole mammalian genomes is feasible. Our assembly methodology is based on first ordering the clones and subsequently performing read assembly in three stages: (1) local assemblies of regions significantly smaller than a clone size, (2) clone-sized assemblies of the results of stage 1, and (3) chromosome-sized assemblies. By aggressively localizing the assembly problem during the first stage, our method succeeds in assembling short, unpaired reads sampled from repetitive genomes. We tested our assembler using simulated reads from D. melanogaster and human chromosomes 1, 11, and 21, and produced assemblies with large sets of contiguous sequence and a misassembly rate comparable to other draft assemblies. Tested on D. melanogaster and the entire human genome, our clone-ordering method produces accurate maps, thereby localizing fragment assembly and enabling the parallelization of the subsequent steps of our pipeline. Thus, we have demonstrated that truly inexpensive de novo sequencing of mammalian genomes will soon be possible with high-throughput, short-read technologies using our methodology. PMID:17534434

Preparation of fosmid libraries and functional metagenomic analysis of microbial community DNA.

PubMed

Martínez, Asunción; Osburne, Marcia S

2013-01-01

One of the most important challenges in contemporary microbial ecology is to assign a functional role to the large number of novel genes discovered through large-scale sequencing of natural microbial communities that lack similarity to genes of known function. Functional screening of metagenomic libraries, that is, screening environmental DNA clones for the ability to confer an activity of interest to a heterologous bacterial host, is a promising approach for bridging the gap between metagenomic DNA sequencing and functional characterization. Here, we describe methods for isolating environmental DNA and constructing metagenomic fosmid libraries, as well as methods for designing and implementing successful functional screens of such libraries. © 2013 Elsevier Inc. All rights reserved.

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

The Arsenic Resistance-Associated Listeria Genomic Island LGI2 Exhibits Sequence and Integration Site Diversity and a Propensity for Three Listeria monocytogenes Clones with Enhanced Virulence.

PubMed

Lee, Sangmi; Ward, Todd J; Jima, Dereje D; Parsons, Cameron; Kathariou, Sophia

2017-11-01

In the foodborne pathogen Listeria monocytogenes , arsenic resistance is encountered primarily in serotype 4b clones considered to have enhanced virulence and is associated with an arsenic resistance gene cluster within a 35-kb chromosomal region, Listeria genomic island 2 (LGI2). LGI2 was first identified in strain Scott A and includes genes putatively involved in arsenic and cadmium resistance, DNA integration, conjugation, and pathogenicity. However, the genomic localization and sequence content of LGI2 remain poorly characterized. Here we investigated 85 arsenic-resistant L. monocytogenes strains, mostly of serotype 4b. All but one of the 70 serotype 4b strains belonged to clonal complex 1 (CC1), CC2, and CC4, three major clones associated with enhanced virulence. PCR analysis suggested that 53 strains (62.4%) harbored an island highly similar to LGI2 of Scott A, frequently (42/53) in the same location as Scott A ( LMOf2365_2257 homolog). Random-primed PCR and whole-genome sequencing revealed seven novel insertion sites, mostly internal to chromosomal coding sequences, among strains harboring LGI2 outside the LMOf2365_2257 homolog. Interestingly, many CC1 strains harbored a noticeably diversified LGI2 (LGI2-1) in a unique location ( LMOf2365_0902 homolog) and with a novel additional gene. With few exceptions, the tested LGI2 genes were not detected in arsenic-resistant strains of serogroup 1/2, which instead often harbored a Tn 554 -associated arsenic resistance determinant not encountered in serotype 4b. These findings indicate that in L. monocytogenes , LGI2 has a propensity for certain serotype 4b clones, exhibits content diversity, and is highly promiscuous, suggesting an ability to mobilize various accessory genes into diverse chromosomal loci. IMPORTANCE Listeria monocytogenes is widely distributed in the environment and causes listeriosis, a foodborne disease with high mortality and morbidity. Arsenic and other heavy metals can powerfully shape the populations of human pathogens with pronounced environmental lifestyles such as L. monocytogenes Arsenic resistance is encountered primarily in certain serotype 4b clones considered to have enhanced virulence and is associated with a large chromosomal island, Listeria genomic island 2 (LGI2). LGI2 also harbors a cadmium resistance cassette and genes putatively involved in DNA integration, conjugation, and pathogenicity. Our findings indicate that LGI2 exhibits pronounced content plasticity and is capable of transferring various accessory genes into diverse chromosomal locations. LGI2 may serve as a paradigm on how exposure to a potent environmental toxicant such as arsenic may have dynamically selected for arsenic-resistant subpopulations in certain clones of L. monocytogenes which also contribute significantly to disease. Copyright © 2017 American Society for Microbiology.

Process of labeling specific chromosomes using recombinant repetitive DNA

DOEpatents

Moyzis, R.K.; Meyne, J.

1988-02-12

Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

Molecular characterization of the Serratia marcescens OmpF porin, and analysis of S. marcescens OmpF and OmpC osmoregulation.

PubMed

Hutsul, J A; Worobec, E

1997-08-01

Serratia marcescens is a nosocomial pathogen with a high incidence of beta-lactam resistance. Reduced amounts of outer-membrane porins have been correlated with increased resistance to beta-lactams but only one porin, OmpC, has been characterized at the molecular level. In this study we present the molecular characterization of a second porin, OmpF, and an analysis of the expression of S. marcescens porins in response to various environmental changes. Two porins were isolated from the outer membrane using urea-SDS-PAGE and the relative amounts were shown to be influenced by the osmolarity of the medium and the presence of salicylate. From a S. marcescens genomic DNA library an 8 kb EcoRI fragment was isolated that hybridized with an oligonucleotide encoding the published N-terminal amino acid sequence of the S. marcescens 41 kDa porin. A 41 kDa protein was detected in the outer membrane of Escherichia coli NM522 carrying the cloned S. marcescens DNA. The cloned gene was sequenced and shown to code for a protein that shared 60-70% identity with other known OmpF and OmpC sequences. The upstream DNA sequence of the S. marcescens gene was similar to the corresponding E. coli ompF sequence; however, a regulatory element important in repression of E. coli ompF at high osmolarity was absent. The cloned S. marcescens OmpF in E. coli increased in expression in conditions of high osmolarity. The potential involvement of micF in the observed osmoregulation of S. marcescens porins is discussed.

Metagenomics: Probing pollutant fate in natural and engineered ecosystems.

PubMed

Bouhajja, Emna; Agathos, Spiros N; George, Isabelle F

2016-12-01

Polluted environments are a reservoir of microbial species able to degrade or to convert pollutants to harmless compounds. The proper management of microbial resources requires a comprehensive characterization of their genetic pool to assess the fate of contaminants and increase the efficiency of bioremediation processes. Metagenomics offers appropriate tools to describe microbial communities in their whole complexity without lab-based cultivation of individual strains. After a decade of use of metagenomics to study microbiomes, the scientific community has made significant progress in this field. In this review, we survey the main steps of metagenomics applied to environments contaminated with organic compounds or heavy metals. We emphasize technical solutions proposed to overcome encountered obstacles. We then compare two metagenomic approaches, i.e. library-based targeted metagenomics and direct sequencing of metagenomes. In the former, environmental DNA is cloned inside a host, and then clones of interest are selected based on (i) their expression of biodegradative functions or (ii) sequence homology with probes and primers designed from relevant, already known sequences. The highest score for the discovery of novel genes and degradation pathways has been achieved so far by functional screening of large clone libraries. On the other hand, direct sequencing of metagenomes without a cloning step has been more often applied to polluted environments for characterization of the taxonomic and functional composition of microbial communities and their dynamics. In this case, the analysis has focused on 16S rRNA genes and marker genes of biodegradation. Advances in next generation sequencing and in bioinformatic analysis of sequencing data have opened up new opportunities for assessing the potential of biodegradation by microbes, but annotation of collected genes is still hampered by a limited number of available reference sequences in databases. Although metagenomics is still facing technical and computational challenges, our review of the recent literature highlights its value as an aid to efficiently monitor the clean-up of contaminated environments and develop successful strategies to mitigate the impact of pollutants on ecosystems. Copyright © 2016 Elsevier Inc. All rights reserved.

Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108

Treesearch

Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang

1999-01-01

A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...

Phylogeny, diversity and host specialization in the phylum Synergistetes with emphasis on strains and clones of human origin.

PubMed

Marchandin, Hélène; Damay, Audrey; Roudière, Laurent; Teyssier, Corinne; Zorgniotti, Isabelle; Dechaud, Hervé; Jean-Pierre, Hélène; Jumas-Bilak, Estelle

2010-03-01

Members of the phylum Synergistetes have been demonstrated in several environmental ecosystems and mammalian microflorae by culture-independent methods. In the past few years, the clinical relevance of some uncultivated phylotypes has been demonstrated in endodontic infections, and uncultured Synergistetes have been demonstrated in human mouth, gut and skin microbiota. However, Synergistetes are rarely cultured from human samples, and only 17 isolates are currently reported. Twelve members of Synergistetes isolated in the course of various infectious processes, including 3 Jonquetella anthropi, 2 Cloacibacillus evryensis, 2 Pyramidobacter piscolens and 5 unidentified strains, as well as 56 clones obtained by specific PCR from the normal vaginal microflora, were studied. 16S rRNA gene-based phylogeny showed that the clones were grouped into 3 clusters, corresponding to the genus Jonquetella, P. piscolens and one novel Synergistetes taxon. The presence and diversity of Synergistetes were reported for the first time in the vaginal microflora. Synergistetes were found in healthy patients, suggesting that they could play a functional role in human microflorae, but may also act as opportunistic pathogens. Studying the phylogenetic relationships between environmental and mammalian strains and clones revealed clearly delineated independent lineages according to the origin of the sequences. Copyright 2010 Elsevier Masson SAS. All rights reserved.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Normalization of environmental metagenomic DNA enhances the discovery of under-represented microbial community members.

PubMed

Ramond, J-B; Makhalanyane, T P; Tuffin, M I; Cowan, D A

2015-04-01

Normalization is a procedure classically employed to detect rare sequences in cellular expression profiles (i.e. cDNA libraries). Here, we present a normalization protocol involving the direct treatment of extracted environmental metagenomic DNA with S1 nuclease, referred to as normalization of metagenomic DNA: NmDNA. We demonstrate that NmDNA, prior to post hoc PCR-based experiments (16S rRNA gene T-RFLP fingerprinting and clone library), increased the diversity of sequences retrieved from environmental microbial communities by detection of rarer sequences. This approach could be used to enhance the resolution of detection of ecologically relevant rare members in environmental microbial assemblages and therefore is promising in enabling a better understanding of ecosystem functioning. This study is the first testing 'normalization' on environmental metagenomic DNA (mDNA). The aim of this procedure was to improve the identification of rare phylotypes in environmental communities. Using hypoliths as model systems, we present evidence that this post-mDNA extraction molecular procedure substantially enhances the detection of less common phylotypes and could even lead to the discovery of novel microbial genotypes within a given environment. © 2014 The Society for Applied Microbiology.

Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

PubMed

Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

Molecular characterization of viable Legionella spp. in cooling tower water samples by combined use of ethidium monoazide and PCR.

PubMed

Inoue, Hiroaki; Fujimura, Reiko; Agata, Kunio; Ohta, Hiroyuki

2015-01-01

Viable Legionella spp. in environmental water samples were characterized phylogenetically by a clone library analysis combining the use of ethidium monoazide and quantitative PCR. To examine the diversity of Legionella spp., six cooling tower water samples and three bath water samples were collected and analyzed. A total of 617 clones were analyzed for their 16S rRNA gene sequences and classified into 99 operational taxonomic units (OTUs). The majority of OTUs were not clustered with currently described Legionella spp., suggesting the wide diversity of not-yet-cultured Legionella groups harbored in cooling tower water environments.

Molecular Characterization of Viable Legionella spp. in Cooling Tower Water Samples by Combined Use of Ethidium Monoazide and PCR

PubMed Central

Inoue, Hiroaki; Fujimura, Reiko; Agata, Kunio; Ohta, Hiroyuki

2015-01-01

Viable Legionella spp. in environmental water samples were characterized phylogenetically by a clone library analysis combining the use of ethidium monoazide and quantitative PCR. To examine the diversity of Legionella spp., six cooling tower water samples and three bath water samples were collected and analyzed. A total of 617 clones were analyzed for their 16S rRNA gene sequences and classified into 99 operational taxonomic units (OTUs). The majority of OTUs were not clustered with currently described Legionella spp., suggesting the wide diversity of not-yet-cultured Legionella groups harbored in cooling tower water environments. PMID:25736979

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Mapping neurofibromatosis 1 homologous loci by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Viskochil, D.; Breidenbach, H.H.; Cawthon, R.

Neurofibromatosis 1 maps to chromosome band 17q11.2 and the NF1 gene is comprised of 59 exons that span approximately 335 kb of genomic DNA. In order to further analyze the structure of NF1 from exons 2 through 27b, we isolated a number of cosmid and bacteriophage P-1 genomic clones using NF1-exon probes under high-stringency hybridization conditions. Using tagged, intron-based primers and DNA from various clones as a template, we PCR-amplified and sequenced individual NF1 exons. The exon sequences in PCR products from several genomic clones differed from the exon sequence derived from cloned NF1 cDNAs. Clones with variant sequences weremore » mapped by fluorescence in situ hybridization under high-stringency conditions. Three clones mapped to chromosome band 15q11.2, one mapped to 14q11.2, one mapped to both 2q14.1-14.3 and 14q11.2, one mapped to 2q33-34, and one mapped to both 18q11.2 and 21q21. Even though some PCR-product sequences retained proper splice junctions and open reading frames, we have yet to identify cDNAs that correspond to the variant exon sequences. We are now sequencing clones that map to NF1-homologous loci in order to develop discriminating primer pairs for the exclusive amplification of NF1-specific sequences in our efforts to develop a comprehensive NF1 mutation screen using genomic DNA as template. The role of NF1-homologous sequences may play in neurofibromatosis 1 is not clear.« less

Taxonomic and functional assignment of cloned sequences from high Andean forest soil metagenome.

PubMed

Montaña, José Salvador; Jiménez, Diego Javier; Hernández, Mónica; Angel, Tatiana; Baena, Sandra

2012-02-01

Total metagenomic DNA was isolated from high Andean forest soil and subjected to taxonomical and functional composition analyses by means of clone library generation and sequencing. The obtained yield of 1.7 μg of DNA/g of soil was used to construct a metagenomic library of approximately 20,000 clones (in the plasmid p-Bluescript II SK+) with an average insert size of 4 Kb, covering 80 Mb of the total metagenomic DNA. Metagenomic sequences near the plasmid cloning site were sequenced and them trimmed and assembled, obtaining 299 reads and 31 contigs (0.3 Mb). Taxonomic assignment of total sequences was performed by BLASTX, resulting in 68.8, 44.8 and 24.5% classification into taxonomic groups using the metagenomic RAST server v2.0, WebCARMA v1.0 online system and MetaGenome Analyzer v3.8 software, respectively. Most clone sequences were classified as Bacteria belonging to phlya Actinobacteria, Proteobacteria and Acidobacteria. Among the most represented orders were Actinomycetales (34% average), Rhizobiales, Burkholderiales and Myxococcales and with a greater number of sequences in the genus Mycobacterium (7% average), Frankia, Streptomyces and Bradyrhizobium. The vast majority of sequences were associated with the metabolism of carbohydrates, proteins, lipids and catalytic functions, such as phosphatases, glycosyltransferases, dehydrogenases, methyltransferases, dehydratases and epoxide hydrolases. In this study we compared different methods of taxonomic and functional assignment of metagenomic clone sequences to evaluate microbial diversity in an unexplored soil ecosystem, searching for putative enzymes of biotechnological interest and generating important information for further functional screening of clone libraries.

Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

PubMed

Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

1978-11-16

Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

Chromosome specific repetitive DNA sequences

DOEpatents

Moyzis, Robert K.; Meyne, Julianne

1991-01-01

A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

PubMed

Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

1996-08-01

DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server

PubMed Central

Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J

2006-01-01

Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563

Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

PubMed Central

2011-01-01

Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965

Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

PubMed Central

Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

Host-associated bacterial taxa from Chlorobi, Chloroflexi, GN02, Synergistetes, SR1, TM7, and WPS-2 Phyla/candidate divisions

PubMed Central

Camanocha, Anuj; Dewhirst, Floyd E.

2014-01-01

Background and objective In addition to the well-known phyla Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, Spirochaetes, Fusobacteria, Tenericutes, and Chylamydiae, the oral microbiomes of mammals contain species from the lesser-known phyla or candidate divisions, including Synergistetes, TM7, Chlorobi, Chloroflexi, GN02, SR1, and WPS-2. The objectives of this study were to create phyla-selective 16S rDNA PCR primer pairs, create selective 16S rDNA clone libraries, identify novel oral taxa, and update canine and human oral microbiome databases. Design 16S rRNA gene sequences for members of the lesser-known phyla were downloaded from GenBank and Greengenes databases and aligned with sequences in our RNA databases. Primers with potential phylum level selectivity were designed heuristically with the goal of producing nearly full-length 16S rDNA amplicons. The specificity of primer pairs was examined by making clone libraries from PCR amplicons and determining phyla identity by BLASTN analysis. Results Phylum-selective primer pairs were identified that allowed construction of clone libraries with 96–100% specificity for each of the lesser-known phyla. From these clone libraries, seven human and two canine novel oral taxa were identified and added to their respective taxonomic databases. For each phylum, genome sequences closest to human oral taxa were identified and added to the Human Oral Microbiome Database to facilitate metagenomic, transcriptomic, and proteomic studies that involve tiling sequences to the most closely related taxon. While examining ribosomal operons in lesser-known phyla from single-cell genomes and metagenomes, we identified a novel rRNA operon order (23S-5S-16S) in three SR1 genomes and the splitting of the 23S rRNA gene by an I-CeuI-like homing endonuclease in a WPS-2 genome. Conclusions This study developed useful primer pairs for making phylum-selective 16S rRNA clone libraries. Phylum-specific libraries were shown to be useful for identifying previously unrecognized taxa in lesser-known phyla and would be useful for future environmental and host-associated studies. PMID:25317252

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

Method for introducing unidirectional nested deletions

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

2001-01-01

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

PubMed

Duyk, G M; Kim, S W; Myers, R M; Cox, D R

1990-11-01

Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons.

Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

PubMed Central

Duyk, G M; Kim, S W; Myers, R M; Cox, D R

1990-01-01

Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons. PMID:2247475

Exploiting long read sequencing technologies to establish high quality highly contiguous pig reference genome assemblies

USDA-ARS?s Scientific Manuscript database

The current pig reference genome sequence (Sscrofa10.2) was established using Sanger sequencing and following the clone-by-clone hierarchical shotgun sequencing approach used in the public human genome project. However, as sequence coverage was low (4-6x) the resulting assembly was only of draft qua...

PyClone: statistical inference of clonal population structure in cancer.

PubMed

Roth, Andrew; Khattra, Jaswinder; Yap, Damian; Wan, Adrian; Laks, Emma; Biele, Justina; Ha, Gavin; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2014-04-01

We introduce PyClone, a statistical model for inference of clonal population structures in cancers. PyClone is a Bayesian clustering method for grouping sets of deeply sequenced somatic mutations into putative clonal clusters while estimating their cellular prevalences and accounting for allelic imbalances introduced by segmental copy-number changes and normal-cell contamination. Single-cell sequencing validation demonstrates PyClone's accuracy.

Endolithic diversity of microorganisms on sandstone and implications for biogenic weathering

NASA Astrophysics Data System (ADS)

Hallmann, C.; Friedenberger, H.; Hoppert, M.

2012-04-01

Molecular methods allow a comprehensive view on uncultured microbial communities in dimension stone. In the presented study, we focus on depth profiles of microbial colonization in sandstones with different porosity and overall durability. All sandstones were taken from quarries where they were exposed to the environment for several years. Approximately 0.1 g of material from the stone surface, from 5 mm and from 30 mm depths was taken under sterile conditions and subjected to analysis of microbial DNA and culturing experiments. In particular, DNA was extracted from the material, the phylogenetic marker gene of eukaryotic organisms (18S rDNA) was amplified and used for generation of clone libraries, which were then analysed by sequencing. "Roter Wesersandstein" was just colonized at the material surface, predominantly with algal and fungal microorganisms. No environmental DNA could be isolated from depth profiles. From "Nebraer Sandstein" with high pore size (shown by thin sections), environmental DNA from depths down to 3 cm could be retrieved. Though the uppermost layer is dominated by microalgae (as concluded from the retrieved clones), the percentage of algal clones from 5 mm and 30 mm depths drop to 10 % of all clones. There, apart from filamentous fungi, moss clones clearly dominate the microbial community. At a depth of 30 mm, 70-80 % of the retrieved clones match to various mosses (Bryophyta). Though mosses do not form layers on the stone surfaces, moss rhizoids or protonemata must be abundant as endoliths inside the stone material. It is reasonable to assume that the rhizoids may contribute to an increase in pore size by active penetration of the clastic material, even though colonization of the surface by mosses is not obvious. This feature may imply stronger impact of stone decay induced by endolithic growth of bryophytes than hitherto observed.

Unique microbial community in drilling fluids from Chinese continental scientific drilling

USGS Publications Warehouse

Zhang, Gengxin; Dong, Hailiang; Jiang, Hongchen; Xu, Zhiqin; Eberl, Dennis D.

2006-01-01

Circulating drilling fluid is often regarded as a contamination source in investigations of subsurface microbiology. However, it also provides an opportunity to sample geological fluids at depth and to study contained microbial communities. During our study of deep subsurface microbiology of the Chinese Continental Scientific Deep drilling project, we collected 6 drilling fluid samples from a borehole from 2290 to 3350 m below the land surface. Microbial communities in these samples were characterized with cultivation-dependent and -independent techniques. Characterization of 16S rRNA genes indicated that the bacterial clone sequences related to Firmicutes became progressively dominant with increasing depth. Most sequences were related to anaerobic, thermophilic, halophilic or alkaliphilic bacteria. These habitats were consistent with the measured geochemical characteristics of the drilling fluids that have incorporated geological fluids and partly reflected the in-situ conditions. Several clone types were closely related to Thermoanaerobacter ethanolicus, Caldicellulosiruptor lactoaceticus, and Anaerobranca gottschalkii, an anaerobic metal-reducer, an extreme thermophile, and an anaerobic chemoorganotroph, respectively, with an optimal growth temperature of 50–68°C. Seven anaerobic, thermophilic Fe(III)-reducing bacterial isolates were obtained and they were capable of reducing iron oxide and clay minerals to produce siderite, vivianite, and illite. The archaeal diversity was low. Most archaeal sequences were not related to any known cultivated species, but rather to environmental clone sequences recovered from subsurface environments. We infer that the detected microbes were derived from geological fluids at depth and their growth habitats reflected the deep subsurface conditions. These findings have important implications for microbial survival and their ecological functions in the deep subsurface.

Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

PubMed

He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

2004-09-01

Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

Development of a swine-specific fecal pollution marker based on host differences in methanogen mcrA genes.

PubMed

Ufnar, Jennifer A; Ufnar, David F; Wang, Shiao Y; Ellender, R D

2007-08-01

The goal of this study was to evaluate methanogen diversity in animal hosts to develop a swine-specific archaeal molecular marker for fecal source tracking in surface waters. Phylogenetic analysis of swine mcrA sequences compared to mcrA sequences from the feces of five animals (cow, deer, sheep, horse, and chicken) and sewage showed four distinct swine clusters, with three swine-specific clades. From this analysis, six sequences were chosen for molecular marker development and initial testing. Only one mcrA sequence (P23-2) showed specificity for swine and therefore was used for environmental testing. PCR primers for the P23-2 clone mcrA sequence were developed and evaluated for swine specificity. The P23-2 primers amplified products in P23-2 plasmid DNA (100%), pig feces (84%), and swine waste lagoon surface water samples (100%) but did not amplify a product in 47 bacterial and archaeal stock cultures and 477 environmental bacterial isolates and sewage and water samples from a bovine waste lagoon and a polluted creek. Amplification was observed in only one sheep sample out of 260 human and nonswine animal fecal samples. Sequencing of PCR products from pig feces demonstrated 100% similarity to pig mcrA sequence from clone P23-2. The minimal amount of DNA required for the detection was 1 pg for P23-2 plasmid, 1 ng for pig feces, 50 ng for swine waste lagoon surface water, 1 ng for sow waste influent, and 10 ng for lagoon sludge samples. Lower detection limits of 10(-6) g of wet pig feces in 500 ml of phosphate-buffered saline and 10(-4) g of lagoon waste in estuarine water were established for the P23-2 marker. This study was the first to utilize methanogens for the development of a swine-specific fecal contamination marker.

Development of a Swine-Specific Fecal Pollution Marker Based on Host Differences in Methanogen mcrA Genes▿

PubMed Central

Ufnar, Jennifer A.; Ufnar, David F.; Wang, Shiao Y.; Ellender, R. D.

2007-01-01

The goal of this study was to evaluate methanogen diversity in animal hosts to develop a swine-specific archaeal molecular marker for fecal source tracking in surface waters. Phylogenetic analysis of swine mcrA sequences compared to mcrA sequences from the feces of five animals (cow, deer, sheep, horse, and chicken) and sewage showed four distinct swine clusters, with three swine-specific clades. From this analysis, six sequences were chosen for molecular marker development and initial testing. Only one mcrA sequence (P23-2) showed specificity for swine and therefore was used for environmental testing. PCR primers for the P23-2 clone mcrA sequence were developed and evaluated for swine specificity. The P23-2 primers amplified products in P23-2 plasmid DNA (100%), pig feces (84%), and swine waste lagoon surface water samples (100%) but did not amplify a product in 47 bacterial and archaeal stock cultures and 477 environmental bacterial isolates and sewage and water samples from a bovine waste lagoon and a polluted creek. Amplification was observed in only one sheep sample out of 260 human and nonswine animal fecal samples. Sequencing of PCR products from pig feces demonstrated 100% similarity to pig mcrA sequence from clone P23-2. The minimal amount of DNA required for the detection was 1 pg for P23-2 plasmid, 1 ng for pig feces, 50 ng for swine waste lagoon surface water, 1 ng for sow waste influent, and 10 ng for lagoon sludge samples. Lower detection limits of 10−6 g of wet pig feces in 500 ml of phosphate-buffered saline and 10−4 g of lagoon waste in estuarine water were established for the P23-2 marker. This study was the first to utilize methanogens for the development of a swine-specific fecal contamination marker. PMID:17586669

(New hosts and vectors for genome cloning)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

[New hosts and vectors for genome cloning]. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Chalcone isomerase cDNA cloning and mRNA induction by fungal elicitor, wounding and infection

PubMed Central

Mehdy, Mona C.; Lamb, Christopher J.

1987-01-01

The environmentally regulated synthesis of phenylpropanoid natural products was studied by examining the expression of the gene encoding chalcone isomerase (CHI). This enzyme catalyzes a step common to the synthesis of flavonoid pigments and isoflavonoid phytoalexins. A λgt11 library was constructed using mRNA from cell cultures of bean (Phaseolus vulgaris L.) treated with fungal elicitor. Two positive clones were obtained by screening 105 recombinants with an antiserum to purified bean CHI. The identity of the cloned sequences was confirmed by hybrid-select translation and the production of antigenic polypeptides from transcripts synthesized in vitro. Addition of elicitor to cell cultures resulted in the rapid accumulation of CHI mRNA, with maximum levels achieved 3–4 h after elicitation. CHI mRNA also accumulated during the natural infection of hypocotyls with the fungal pathogen Colletotrichum lindemuthianum, and in mechanically wounded hypocotyls. The kinetics of accumulation of CHI mRNA in response to these environmental signals were strikingly similar to those of mRNAs encoding two other phenylpropanoid pathway enzymes, phenylalanine ammonialyase and chalcone synthase. In contrast to the multi-gene families encoding these two enzymes, chalcone isomerase is encoded by a single gene which is regulated by several environmental stimuli. ImagesFig. 2.Fig. 3.Fig. 4.Fig. 5.Fig. 6.Fig. 9. PMID:16453768

Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

PubMed Central

Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

1998-01-01

The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

Isolation and sequence analysis of the wheat B genome subtelomeric DNA.

PubMed

Salina, Elena A; Sergeeva, Ekaterina M; Adonina, Irina G; Shcherban, Andrey B; Afonnikov, Dmitry A; Belcram, Harry; Huneau, Cecile; Chalhoub, Boulos

2009-09-05

Telomeric and subtelomeric regions are essential for genome stability and regular chromosome replication. In this work, we have characterized the wheat BAC (bacterial artificial chromosome) clones containing Spelt1 and Spelt52 sequences, which belong to the subtelomeric repeats of the B/G genomes of wheats and Aegilops species from the section Sitopsis. The BAC library from Triticum aestivum cv. Renan was screened using Spelt1 and Spelt52 as probes. Nine positive clones were isolated; of them, clone 2050O8 was localized mainly to the distal parts of wheat chromosomes by in situ hybridization. The distribution of the other clones indicated the presence of different types of repetitive sequences in BACs. Use of different approaches allowed us to prove that seven of the nine isolated clones belonged to the subtelomeric chromosomal regions. Clone 2050O8 was sequenced and its sequence of 119,737 bp was annotated. It is composed of 33% transposable elements (TEs), 8.2% Spelt52 (namely, the subfamily Spelt52.2) and five non-TE-related genes. DNA transposons are predominant, making up 24.6% of the entire BAC clone, whereas retroelements account for 8.4% of the clone length. The full-length CACTA transposon Caspar covers 11,666 bp, encoding a transposase and CTG-2 proteins, and this transposon accounts for 40% of the DNA transposons. The in situ hybridization data for 2050O8 derived subclones in combination with the BLAST search against wheat mapped ESTs (expressed sequence tags) suggest that clone 2050O8 is located in the terminal bin 4BL-10 (0.95-1.0). Additionally, four of the predicted 2050O8 genes showed significant homology to four putative orthologous rice genes in the distal part of rice chromosome 3S and confirm the synteny to wheat 4BL. Satellite DNA sequences from the subtelomeric regions of diploid wheat progenitor can be used for selecting the BAC clones from the corresponding regions of hexaploid wheat chromosomes. It has been demonstrated for the first time that Spelt52 sequences were involved in the evolution of terminal regions of common wheat chromosomes. Our research provides new insights into the microcollinearity in the terminal regions of wheat chromosomes 4BL and rice chromosome 3S.

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

Identification of a receptor-like protein kinase gene rapidly induced by abscisic acid, dehydration, high salt, and cold treatments in Arabidopsis thaliana.

PubMed Central

Hong, S W; Jon, J H; Kwak, J M; Nam, H G

1997-01-01

A cDNA clone for a receptor-like protein kinase gene (RPK1) was isolated from Arabidopsis thaliana. The clone is 1952 bp long with 1623 bp of an open reading frame encoding a peptide of 540 amino acids. The deduced peptide (RPK1) contains four distinctive domains characteristic of receptor kinases: (a) a putative amino-terminal signal sequence domain; (b) a domain with five extracellular leucine-rich repeat sequences; (c) a membrane-spanning domain; and (d) a cytoplasmic protein kinase domain that contains all of the 11 subdomains conserved among protein kinases. The RPK1 gene is expressed in flowers, stems, leaves, and roots. Expression of the RPK1 gene is induced within 1 h after treatment with abscisic acid (ABA). The gene is also rapidly induced by several environmental stresses such as dehydration, high salt, and low temperature, suggesting that the gene is involved in a general stress response. The dehydration-induced expression is not impaired in aba-1, abi1-1, abi2-1, and abi3-1 mutants, suggesting that the dehydration-induced expression of the RPK1 gene is ABA-independent. A possible role of this gene in the signal transduction pathway of ABA and the environmental stresses is discussed. PMID:9112773

Bacterial community analysis of swine manure treated with autothermal thermophilic aerobic digestion.

PubMed

Han, Il; Congeevaram, Shankar; Ki, Dong-Won; Oh, Byoung-Taek; Park, Joonhong

2011-02-01

Due to the environmental problems associated with disposal of livestock sludge, many stabilization studies emphasizing on the sludge volume reduction were performed. However, little is known about the microbial risk present in sludge and its stabilized products. This study microbiologically explored the effects of anaerobic lagoon fermentation (ALF) and autothermal thermophilic aerobic digestion (ATAD) on pathogen-related risk of raw swine manure by using culture-independent 16S rDNA cloning and sequencing methods. In raw swine manure, clones closely related to pathogens such as Dialister pneumosintes, Erysipelothrix rhusiopathiae, Succinivibrioan dextrinosolvens, and Schineria sp. were detected. Meanwhile, in the mesophilic ALF-treated swine manure, bacterial community clones closely related to pathogens such as Schineria sp. and Succinivibrio dextrinosolvens were still detected. Interestingly, the ATAD treatment resulted in no detection of clones closely related to pathogens in the stabilized thermophilic bacterial community, with the predominance of novel Clostridia class populations. These findings support the superiority of ATAD in selectively reducing potential human and animal pathogens compared to ALF, which is a typical manure stabilization method used in livestock farms.

Bacterial diversity characterization in petroleum samples from Brazilian reservoirs

PubMed Central

de Oliveira, Valéria Maia; Sette, Lara Durães; Simioni, Karen Christina Marques; dos Santos Neto, Eugênio Vaz

2008-01-01

This study aimed at evaluating potential differences among the bacterial communities from formation water and oil samples originated from biodegraded and non-biodegraded Brazilian petroleum reservoirs by using a PCR-DGGE based approach. Environmental DNA was isolated and used in PCR reactions with bacterial primers, followed by separation of 16S rDNA fragments in the DGGE. PCR products were also cloned and sequenced, aiming at the taxonomic affiliation of the community members. The fingerprints obtained allowed the direct comparison among the bacterial communities from oil samples presenting distinct degrees of biodegradation, as well as between the communities of formation water and oil sample from the non-biodegraded reservoir. Very similar DGGE band profiles were observed for all samples, and the diversity of the predominant bacterial phylotypes was shown to be low. Cloning and sequencing results revealed major differences between formation water and oil samples from the non-biodegraded reservoir. Bacillus sp. and Halanaerobium sp. were shown to be the predominant components of the bacterial community from the formation water sample, whereas the oil sample also included Alicyclobacillus acidoterrestris, Rhodococcus sp., Streptomyces sp. and Acidithiobacillus ferrooxidans. The PCR-DGGE technique, combined with cloning and sequencing of PCR products, revealed the presence of taxonomic groups not found previously in these samples when using cultivation-based methods and 16S rRNA gene library assembly, confirming the need of a polyphasic study in order to improve the knowledge of the extent of microbial diversity in such extreme environments. PMID:24031244

Improved serial analysis of V1 ribosomal sequence tags (SARST-V1) provides a rapid, comprehensive, sequence-based characterization of bacterial diversity and community composition.

PubMed

Yu, Zhongtang; Yu, Marie; Morrison, Mark

2006-04-01

Serial analysis of ribosomal sequence tags (SARST) is a recently developed technology that can generate large 16S rRNA gene (rrs) sequence data sets from microbiomes, but there are numerous enzymatic and purification steps required to construct the ribosomal sequence tag (RST) clone libraries. We report here an improved SARST method, which still targets the V1 hypervariable region of rrs genes, but reduces the number of enzymes, oligonucleotides, reagents, and technical steps needed to produce the RST clone libraries. The new method, hereafter referred to as SARST-V1, was used to examine the eubacterial diversity present in community DNA recovered from the microbiome resident in the ovine rumen. The 190 sequenced clones contained 1055 RSTs and no less than 236 unique phylotypes (based on > or = 95% sequence identity) that were assigned to eight different eubacterial phyla. Rarefaction and monomolecular curve analyses predicted that the complete RST clone library contains 99% of the 353 unique phylotypes predicted to exist in this microbiome. When compared with ribosomal intergenic spacer analysis (RISA) of the same community DNA sample, as well as a compilation of nine previously published conventional rrs clone libraries prepared from the same type of samples, the RST clone library provided a more comprehensive characterization of the eubacterial diversity present in rumen microbiomes. As such, SARST-V1 should be a useful tool applicable to comprehensive examination of diversity and composition in microbiomes and offers an affordable, sequence-based method for diversity analysis.

Genetic diversity of small eukaryotes in lakes differing by their trophic status.

PubMed

Lefranc, Marie; Thénot, Aurélie; Lepère, Cécile; Debroas, Didier

2005-10-01

Small eukaryotes, cells with a diameter of less than 5 mum, are fundamental components of lacustrine planktonic systems. In this study, small-eukaryote diversity was determined by sequencing cloned 18S rRNA genes in three libraries from lakes of differing trophic status in the Massif Central, France: the oligotrophic Lake Godivelle, the oligomesotrophic Lake Pavin, and the eutrophic Lake Aydat. This analysis shows that the least diversified library was in the eutrophic lake (12 operational taxonomic units [OTUs]) and the most diversified was in the oligomesotrophic lake (26 OTUs). Certain groups were present in at least two ecosystems, while the others were specific to one lake on the sampling date. Cryptophyta, Chrysophyceae, and the strictly heterotrophic eukaryotes, Ciliophora and fungi, were identified in the three libraries. Among the small eukaryotes found only in two lakes, Choanoflagellida and environmental sequences (LKM11) were not detected in the eutrophic system whereas Cercozoa were confined to the oligomesotrophic and eutrophic lakes. Three OTUs, linked to the Perkinsozoa, were detected only in the Aydat library, where they represented 60% of the clones of the library. Chlorophyta and Haptophyta lineages were represented by a single clone and were present only in Godivelle and Pavin, respectively. Of the 127 clones studied, classical pigmented organisms (autotrophs and mixotrophs) represented only a low proportion regardless of the library's origin. This study shows that the small-eukaryote community composition may differ as a function of trophic status; certain lineages could be detected only in a single ecosystem.

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

[New hosts and vectors for genome cloning]. Progress report, 1990--1991

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Isolation of mini- and microsatellite loci from chromosome 19 library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prosnyak, M.I.; Belajeva, O.V.; Polukarova, L.G.

Mini- and microsatellite sequences are abundant in the human genome and are very useful as genetic markers. We report the isolation of a panel of clones containing marker sequences from chromosome 19. We screened 10,000 clones from the chromosome 19 cosmid library for the presence of di-(CA)n, tri-(TCC)n, (CAC)n microsatellites and M13-like minisatellite sequences. For this we have used synthetic oligonucleotides and polynucleotides, including micro- (CA, TCC, CAC) and minisatellite (M13 core) sequences. Preliminary results indicated that the chromosome 19 cosmid library contained both human and hamster clones. In order to identify human sequences from this library we have developedmore » the technique of colony and blot hybridization with Alu-PCR, L1-PCR and B1-PCR probes. Dozens of clones have been selected, some of which were analyzed by conventional Southern blot analysis and non-radioactive in situ hybridization of chromosomes. Highly informative markers derived from these clones will be used for physical and genetic mapping of chromosome 19.« less

Rich bacterial assemblages from Maritime Antarctica (Potter Cove, South Shetlands) reveal several kinds of endemic and undescribed phylotypes.

PubMed

Landone Vescovo, Ignacio A; Golemba, Marcelo D; Di Lello, Federico A; Culasso, Andrés C A; Levin, Gustavo; Ruberto, Lucas; Mac Cormack, Walter P; López, José L

2014-01-01

Bacterial richness in maritime Antarctica has been poorly described to date. Phylogenetic affiliation of seawater free-living microbial assemblages was studied from three locations near the Argentinean Jubany Station during two Antarctic summers. Sixty 16S RNA cloned sequences were phylogenetically affiliated to Alphaproteobacteria (30/60 clones), Gammaproteobacteria(19/60 clones), Betaproteobacteria and Cytophaga-Flavobacteriia-Bacteroides (CFB), which were (2/60) and (3/60) respectively. Furthermore, six out of 60 clones could not be classified. Both, Alphaproteobacteria and Gammaproteobacteria, showed several endemic and previously undescribed sequences. Moreover, the absence of Cyanobacteria sequences in our samples is remarkable. In conclusion, we are reporting a rich sequence assemblage composed of widely divergent isolates among themselves and distant from the most closely related sequences currently deposited in data banks. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Use of whole-genome sequencing to trace, control and characterize the regional expansion of extended-spectrum β-lactamase producing ST15 Klebsiella pneumoniae.

PubMed

Zhou, Kai; Lokate, Mariette; Deurenberg, Ruud H; Tepper, Marga; Arends, Jan P; Raangs, Erwin G C; Lo-Ten-Foe, Jerome; Grundmann, Hajo; Rossen, John W A; Friedrich, Alexander W

2016-02-11

The study describes the transmission of a CTX-M-15-producing ST15 Klebsiella pneumoniae between patients treated in a single center and the subsequent inter-institutional spread by patient referral occurring between May 2012 and September 2013. A suspected epidemiological link between clinical K. pneumoniae isolates was supported by patient contact tracing and genomic phylogenetic analysis from May to November 2012. By May 2013, a patient treated in three institutions in two cities was involved in an expanding cluster caused by this high-risk clone (HiRiC) (local expansion, CTX-M-15 producing, and containing hypervirulence factors). A clone-specific multiplex PCR was developed for patient screening by which another patient was identified in September 2013. Genomic phylogenetic analysis including published ST15 genomes revealed a close homology with isolates previously found in the USA. Environmental contamination and lack of consistent patient screening were identified as being responsible for the clone dissemination. The investigation addresses the advantages of whole-genome sequencing in the early detection of HiRiC with a high propensity of nosocomial transmission and prolonged circulation in the regional patient population. Our study suggests the necessity for inter-institutional/regional collaboration for infection/outbreak management of K. pneumoniae HiRiCs.

Seasonal variation in detection of bacterial DNA in arthritic stifle joints of dogs with cranial cruciate ligament rupture using PCR amplification of the 16S rRNA gene.

PubMed

Muir, Peter; Fox, Robin; Wu, Qiang; Baker, Theresa A; Zitzer, Nina C; Hudson, Alan P; Manley, Paul A; Schaefer, Susan L; Hao, Zhengling

2010-02-24

An underappreciated cause and effect relationship between environmental bacteria and arthritis may exist. Previously, we found that stifle arthritis in dogs was associated with the presence of environmental bacteria within synovium. Cranial cruciate ligament rupture (CCLR) is often associated with stifle arthritis in dogs. We now wished to determine whether seasonal variation in detection of bacterial material may exist in affected dogs, and to also conduct analyses of both synovium and synovial fluid. We also wished to analyze a larger clone library of the 16S rRNA gene to further understanding of the microbial population in the canine stifle. Synovial biopsies were obtained from 117 affected dogs from January to December 2006. Using PCR, synovium and synovial fluid were tested for Borrelia burgdorferi and Stenotrophomonas maltophilia DNA. Broad-ranging 16S rRNA primers were also used and PCR products were cloned and sequenced for bacterial identification. Overall, 41% of arthritic canine stifle joints contained bacterial DNA. Detection of bacterial DNA in synovial fluid samples was increased, when compared with synovium (p<0.01). Detection rates were highest in the winter and spring and lowest in the summer period, suggesting environmental factors influence the risk of translocation to the stifle. Organisms detected were predominately Gram's negative Proteobacteria, particularly the orders Rhizobiales (32.8% of clones) and Burkholderiales (20.0% of clones), usually as part of a polymicrobial population. PCR-positivity was inversely correlated with severity of arthritis assessed radiographically and with dog age. Bacterial translocation to the canine stifle may be associated with changes to the indoor environment. Copyright 2009 Elsevier B.V. All rights reserved.

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

PubMed

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-07-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data

PubMed Central

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-01-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users. PMID:20501601

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

PubMed

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

DTIC Science & Technology

1987-10-13

after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

PubMed Central

Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

2011-01-01

Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

Cloning, sequencing and characterization of lipase genes from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase (lip) and lipase-specific foldase (lif) genes of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans NRRL B-2649 were cloned using primers based on consensus sequences, followed by PCR-based genome walking. Sequence analyses showed a putative Lip gene-product (...

Targeted mutagenesis of dengue virus type 2 replicon RNA by yeast in vivo recombination.

PubMed

Manzano, Mark; Padmanabhan, Radhakrishnan

2014-01-01

The use of cDNA infectious clones or subgenomic replicons is indispensable in studying flavivirus biology. Mutating nucleotides or amino acid residues gives important clues to their function in the viral life cycle. However, a major challenge to the establishment of a reverse genetics system for flaviviruses is the instability of their nucleotide sequences in Escherichia coli. Thus, direct cloning using conventional restriction enzyme-based procedures usually leads to unwanted rearrangements of the construct. In this chapter, we discuss a cloning strategy that bypasses traditional cloning procedures. We take advantage of the observations from previous studies that (1) unstable sequences in bacteria can be cloned in eukaryotic systems and (2) Saccharomyces cerevisiae has a well-studied genetics system to introduce sequences using homologous recombination. We describe a protocol to perform targeted mutagenesis in a subgenomic dengue virus 2 replicon. Our method makes use of homologous recombination in yeast using a linearized replicon and a PCR product containing the desired mutation. Constructs derived from this method can be propagated in E. coli with improved stability. Thus, yeast in vivo recombination provides an excellent strategy to genetically engineer flavivirus infectious clones or replicons because this system is compatible with inherently unstable sequences of flaviviruses and is not restricted by the limitations of traditional cloning procedures.

Nitrous Oxide Reductase (nosZ) Gene Fragments Differ between Native and Cultivated Michigan Soils

PubMed Central

Stres, Blaž; Mahne, Ivan; Avguštin, Gorazd; Tiedje, James M.

2004-01-01

The effect of standard agricultural management on the genetic heterogeneity of nitrous oxide reductase (nosZ) fragments from denitrifying prokaryotes in native and cultivated soil was explored. Thirty-six soil cores were composited from each of the two soil management conditions. nosZ gene fragments were amplified from triplicate samples, and PCR products were cloned and screened by restriction fragment length polymorphism (RFLP). The total nosZ RFLP profiles increased in similarity with soil sample size until triplicate 3-g samples produced visually identical RFLP profiles for each treatment. Large differences in total nosZ profiles were observed between the native and cultivated soils. The fragments representing major groups of clones encountered at least twice and four randomly selected clones with unique RFLP patterns were sequenced to verify nosZ identity. The sequence diversity of nosZ clones from the cultivated field was higher, and only eight patterns were found in clone libraries from both soils among the 182 distinct nosZ RFLP patterns identified from the two soils. A group of clones that comprised 32% of all clones dominated the gene library of native soil, whereas many minor groups were observed in the gene library of cultivated soil. The 95% confidence intervals of the Chao1 nonparametric richness estimator for nosZ RFLP data did not overlap, indicating that the levels of species richness are significantly different in the two soils, the cultivated soil having higher diversity. Phylogenetic analysis of deduced amino acid sequences grouped the majority of nosZ clones into an interleaved Michigan soil cluster whose cultured members are α-Proteobacteria. Only four nosZ sequences from cultivated soil and one from the native soil were related to sequences found in γ-Proteobacteria. Sequences from the native field formed a distinct, closely related cluster (Dmean = 0.16) containing 91.6% of the native clones. Clones from the cultivated field were more distantly related to each other (Dmean = 0.26), and 65% were found outside of the cluster from the native soil, further indicating a difference in the two communities. Overall, there appears to be a relationship between use and richness, diversity, and the phylogenetic position of nosZ sequences, indicating that agricultural use of soil caused a shift to a more diverse denitrifying community. PMID:14711656

Comparative genomics of Lupinus angustifolius gene-rich regions: BAC library exploration, genetic mapping and cytogenetics

PubMed Central

2013-01-01

Background The narrow-leafed lupin, Lupinus angustifolius L., is a grain legume species with a relatively compact genome. The species has 2n = 40 chromosomes and its genome size is 960 Mbp/1C. During the last decade, L. angustifolius genomic studies have achieved several milestones, such as molecular-marker development, linkage maps, and bacterial artificial chromosome (BAC) libraries. Here, these resources were integratively used to identify and sequence two gene-rich regions (GRRs) of the genome. Results The genome was screened with a probe representing the sequence of a microsatellite fragment length polymorphism (MFLP) marker linked to Phomopsis stem blight resistance. BAC clones selected by hybridization were subjected to restriction fingerprinting and contig assembly, and 232 BAC-ends were sequenced and annotated. BAC fluorescence in situ hybridization (BAC-FISH) identified eight single-locus clones. Based on physical mapping, cytogenetic localization, and BAC-end annotation, five clones were chosen for sequencing. Within the sequences of clones that hybridized in FISH to a single-locus, two large GRRs were identified. The GRRs showed strong and conserved synteny to Glycine max duplicated genome regions, illustrated by both identical gene order and parallel orientation. In contrast, in the clones with dispersed FISH signals, more than one-third of sequences were transposable elements. Sequenced, single-locus clones were used to develop 12 genetic markers, increasing the number of L. angustifolius chromosomes linked to appropriate linkage groups by five pairs. Conclusions In general, probes originating from MFLP sequences can assist genome screening and gene discovery. However, such probes are not useful for positional cloning, because they tend to hybridize to numerous loci. GRRs identified in L. angustifolius contained a low number of interspersed repeats and had a high level of synteny to the genome of the model legume G. max. Our results showed that not only was the gene nucleotide sequence conserved between soybean and lupin GRRs, but the order and orientation of particular genes in syntenic blocks was homologous, as well. These findings will be valuable to the forthcoming sequencing of the lupin genome. PMID:23379841

The cDNA sequence of a neutral horseradish peroxidase.

PubMed

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

Identification of antigen-specific human monoclonal antibodies using high-throughput sequencing of the antibody repertoire.

PubMed

Liu, Ju; Li, Ruihua; Liu, Kun; Li, Liangliang; Zai, Xiaodong; Chi, Xiangyang; Fu, Ling; Xu, Junjie; Chen, Wei

2016-04-22

High-throughput sequencing of the antibody repertoire provides a large number of antibody variable region sequences that can be used to generate human monoclonal antibodies. However, current screening methods for identifying antigen-specific antibodies are inefficient. In the present study, we developed an antibody clone screening strategy based on clone dynamics and relative frequency, and used it to identify antigen-specific human monoclonal antibodies. Enzyme-linked immunosorbent assay showed that at least 52% of putative positive immunoglobulin heavy chains composed antigen-specific antibodies. Combining information on dynamics and relative frequency improved identification of positive clones and elimination of negative clones. and increase the credibility of putative positive clones. Therefore the screening strategy could simplify the subsequent experimental screening and may facilitate the generation of antigen-specific antibodies. Copyright © 2016 Elsevier Inc. All rights reserved.

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)

NASA Astrophysics Data System (ADS)

Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui

1998-03-01

The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.

Diverse Dengue Type 2 Virus Populations Contain Recombinant and Both Parental Viruses in a Single Mosquito Host

PubMed Central

Craig, Scott; Thu, Hlaing Myat; Lowry, Kym; Wang, Xiao-fang; Holmes, Edward C.; Aaskov, John

2003-01-01

Envelope (E) protein genes sampled from populations of dengue 2 (DEN-2) virus in individual Aedes aegypti mosquitoes and in serum from dengue patients were copied to cDNA, cloned, and sequenced. The nucleotide sequences of the E genes in more than 70% of the clones differed from the consensus sequence for the corresponding virus population at up to 11 sites, and 24 of the 94 clones contained at least one stop codon. Virus populations recovered up to 2 years apart yielded clones with similar polymorphisms in the E gene. For one mosquito, the clones obtained fell into two genotypes. One group of sequences was closely related to those of viruses recovered from dengue patients in the same locality (Yangon, Myanmar) since 1995 and were classified as Asian 1 genotype. The second group were Cosmopolitan genotype viruses which were also circulating in Yangon in 2000 and which were related to DEN-2 viruses sampled from southern China in 1999. Finally, one clone was identified as a recombinant genome composed of portions of these two “parental” genotypes. This is the first report of recombinant and parental dengue viruses in a single host. PMID:12634407

Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

PubMed

Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

2017-12-01

We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

Russell body inducing threshold depends on the variable domain sequences of individual human IgG clones and the cellular protein homeostasis.

PubMed

Stoops, Janelle; Byrd, Samantha; Hasegawa, Haruki

2012-10-01

Russell bodies are intracellular aggregates of immunoglobulins. Although the mechanism of Russell body biogenesis has been extensively studied by using truncated mutant heavy chains, the importance of the variable domain sequences in this process and in immunoglobulin biosynthesis remains largely unknown. Using a panel of structurally and functionally normal human immunoglobulin Gs, we show that individual immunoglobulin G clones possess distinctive Russell body inducing propensities that can surface differently under normal and abnormal cellular conditions. Russell body inducing predisposition unique to each immunoglobulin G clone was corroborated by the intrinsic physicochemical properties encoded in the heavy chain variable domain/light chain variable domain sequence combinations that define each immunoglobulin G clone. While the sequence based intrinsic factors predispose certain immunoglobulin G clones to be more prone to induce Russell bodies, extrinsic factors such as stressful cell culture conditions also play roles in unmasking Russell body propensity from immunoglobulin G clones that are normally refractory to developing Russell bodies. By taking advantage of heterologous expression systems, we dissected the roles of individual subunit chains in Russell body formation and examined the effect of non-cognate subunit chain pair co-expression on Russell body forming propensity. The results suggest that the properties embedded in the variable domain of individual light chain clones and their compatibility with the partnering heavy chain variable domain sequences underscore the efficiency of immunoglobulin G biosynthesis, the threshold for Russell body induction, and the level of immunoglobulin G secretion. We propose that an interplay between the unique properties encoded in variable domain sequences and the state of protein homeostasis determines whether an immunoglobulin G expressing cell will develop the Russell body phenotype in a dynamic cellular setting. Copyright © 2012 Elsevier B.V. All rights reserved.

Phylogenetic position of parabasalid symbionts from the termite Calotermes flavicollis based on small subunit rRNA sequences.

PubMed

Gerbod, D; Edgcomb, V P; Noël, C; Delgado-Viscogliosi, P; Viscogliosi, E

2000-09-01

Small subunit rDNA genes were amplified by polymerase chain reaction using specific primers from mixed-population DNA obtained from the whole hindgut of the termite Calotermes flavicollis. Comparative sequence analysis of the clones revealed two kinds of sequences that were both from parabasalid symbionts. In a molecular tree inferred by distance, parsimony and likelihood methods, and including 27 parabasalid sequences retrieved from the data bases, the sequences of the group II (clones Cf5 and Cf6) were closely related to the Devescovinidae/Calonymphidae species and thus were assigned to the Devescovinidae Foaina. The sequence of the group I (clone Cf1) emerged within the Trichomonadinae and strongly clustered with Tetratrichomonas gallinarum. On the basis of morphological data, the Monocercomonadidae Hexamastix termitis might be the most likely origin of this sequence.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimelman, Aya; Levy, Asaf; Sberro, Hila

In the process of clone-based genome sequencing, initial assemblies frequently contain cloning gaps that can be resolved using cloning-independent methods, but the reason for their occurrence is largely unknown. By analyzing 9,328,693 sequencing clones from 393 microbial genomes we systematically mapped more than 15,000 genes residing in cloning gaps and experimentally showed that their expression products are toxic to the Escherichia coli host. A subset of these toxic sequences was further evaluated through a series of functional assays exploring the mechanisms of their toxicity. Among these genes our assays revealed novel toxins and restriction enzymes, and new classes of smallmore » non-coding toxic RNAs that reproducibly inhibit E. coli growth. Further analyses also revealed abundant, short toxic DNA fragments that were predicted to suppress E. coli growth by interacting with the replication initiator dnaA. Our results show that cloning gaps, once considered the result of technical problems, actually serve as a rich source for the discovery of biotechnologically valuable functions, and suggest new modes of antimicrobial interventions.« less

SSHscreen and SSHdb, generic software for microarray based gene discovery: application to the stress response in cowpea

PubMed Central

2010-01-01

Background Suppression subtractive hybridization is a popular technique for gene discovery from non-model organisms without an annotated genome sequence, such as cowpea (Vigna unguiculata (L.) Walp). We aimed to use this method to enrich for genes expressed during drought stress in a drought tolerant cowpea line. However, current methods were inefficient in screening libraries and management of the sequence data, and thus there was a need to develop software tools to facilitate the process. Results Forward and reverse cDNA libraries enriched for cowpea drought response genes were screened on microarrays, and the R software package SSHscreen 2.0.1 was developed (i) to normalize the data effectively using spike-in control spot normalization, and (ii) to select clones for sequencing based on the calculation of enrichment ratios with associated statistics. Enrichment ratio 3 values for each clone showed that 62% of the forward library and 34% of the reverse library clones were significantly differentially expressed by drought stress (adjusted p value < 0.05). Enrichment ratio 2 calculations showed that > 88% of the clones in both libraries were derived from rare transcripts in the original tester samples, thus supporting the notion that suppression subtractive hybridization enriches for rare transcripts. A set of 118 clones were chosen for sequencing, and drought-induced cowpea genes were identified, the most interesting encoding a late embryogenesis abundant Lea5 protein, a glutathione S-transferase, a thaumatin, a universal stress protein, and a wound induced protein. A lipid transfer protein and several components of photosynthesis were down-regulated by the drought stress. Reverse transcriptase quantitative PCR confirmed the enrichment ratio values for the selected cowpea genes. SSHdb, a web-accessible database, was developed to manage the clone sequences and combine the SSHscreen data with sequence annotations derived from BLAST and Blast2GO. The self-BLAST function within SSHdb grouped redundant clones together and illustrated that the SSHscreen plots are a useful tool for choosing anonymous clones for sequencing, since redundant clones cluster together on the enrichment ratio plots. Conclusions We developed the SSHscreen-SSHdb software pipeline, which greatly facilitates gene discovery using suppression subtractive hybridization by improving the selection of clones for sequencing after screening the library on a small number of microarrays. Annotation of the sequence information and collaboration was further enhanced through a web-based SSHdb database, and we illustrated this through identification of drought responsive genes from cowpea, which can now be investigated in gene function studies. SSH is a popular and powerful gene discovery tool, and therefore this pipeline will have application for gene discovery in any biological system, particularly non-model organisms. SSHscreen 2.0.1 and a link to SSHdb are available from http://microarray.up.ac.za/SSHscreen. PMID:20359330

Diversity and community structure of cyanobacteria and other microbes in recycling irrigation reservoirs.

PubMed

Kong, Ping; Richardson, Patricia; Hong, Chuanxue

2017-01-01

Recycling irrigation reservoirs (RIRs) are emerging aquatic environments of global significance to crop production, water conservation and environmental sustainability. This study characterized the diversity and population structure of cyanobacteria and other detected microbes in water samples from eight RIRs and one adjacent runoff-free stream at three ornamental crop nurseries in eastern (VA1 and VA3) and central (VA2) Virginia after cloning and sequencing the 16S rRNA gene targeting cyanobacteria and chloroplast of eukaryotic phytoplankton. VA1 and VA2 utilize a multi-reservoir recycling irrigation system with runoff channeled to a sedimentation reservoir which then overflows into transition and retention reservoirs where water was pumped for irrigation. VA3 has a single sedimentation reservoir which was also used for irrigation. A total of 208 operational taxonomic units (OTU) were identified from clone libraries of the water samples. Among them, 53 OTUs (358 clones) were cyanobacteria comprising at least 12 genera dominated by Synechococcus species; 59 OTUs (387 clones) were eukaryotic phytoplankton including green algae and diatoms; and 96 were other bacteria (111 clones). Overall, cyanobacteria were dominant in sedimentation reservoirs, while eukaryotic phytoplankton and other bacteria were dominant in transition/retention reservoirs and the stream, respectively. These results are direct evidence demonstrating the negative impact of nutrient-rich horticultural runoff, if not contained, on natural water resources. They also help in understanding the dynamics of water quality in RIRs and have practical implications. Although both single- and multi-reservoir recycling irrigation systems reduce the environmental footprint of horticultural production, the former is expected to have more cyanobacterial blooming, and consequently water quality issues, than the latter. Thus, a multi-reservoir recycling irrigation system should be preferred where feasible.

Diversity and community structure of cyanobacteria and other microbes in recycling irrigation reservoirs

PubMed Central

Kong, Ping; Richardson, Patricia; Hong, Chuanxue

2017-01-01

Recycling irrigation reservoirs (RIRs) are emerging aquatic environments of global significance to crop production, water conservation and environmental sustainability. This study characterized the diversity and population structure of cyanobacteria and other detected microbes in water samples from eight RIRs and one adjacent runoff-free stream at three ornamental crop nurseries in eastern (VA1 and VA3) and central (VA2) Virginia after cloning and sequencing the 16S rRNA gene targeting cyanobacteria and chloroplast of eukaryotic phytoplankton. VA1 and VA2 utilize a multi-reservoir recycling irrigation system with runoff channeled to a sedimentation reservoir which then overflows into transition and retention reservoirs where water was pumped for irrigation. VA3 has a single sedimentation reservoir which was also used for irrigation. A total of 208 operational taxonomic units (OTU) were identified from clone libraries of the water samples. Among them, 53 OTUs (358 clones) were cyanobacteria comprising at least 12 genera dominated by Synechococcus species; 59 OTUs (387 clones) were eukaryotic phytoplankton including green algae and diatoms; and 96 were other bacteria (111 clones). Overall, cyanobacteria were dominant in sedimentation reservoirs, while eukaryotic phytoplankton and other bacteria were dominant in transition/retention reservoirs and the stream, respectively. These results are direct evidence demonstrating the negative impact of nutrient-rich horticultural runoff, if not contained, on natural water resources. They also help in understanding the dynamics of water quality in RIRs and have practical implications. Although both single- and multi-reservoir recycling irrigation systems reduce the environmental footprint of horticultural production, the former is expected to have more cyanobacterial blooming, and consequently water quality issues, than the latter. Thus, a multi-reservoir recycling irrigation system should be preferred where feasible. PMID:28301562

Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

PubMed Central

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Construction of the BAC Library of Small Abalone (Haliotis diversicolor) for Gene Screening and Genome Characterization.

PubMed

Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng

2016-02-01

The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

Metatranscriptomics of Soil Eukaryotic Communities.

PubMed

Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2016-01-01

Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Construction, Characterization, and Preliminary BAC-End Sequence Analysis of a Bacterial Artificial Chromosome Library of the Tea Plant (Camellia sinensis)

PubMed Central

Lin, Jinke; Kudrna, Dave; Wing, Rod A.

2011-01-01

We describe the construction and characterization of a publicly available BAC library for the tea plant, Camellia sinensis. Using modified methods, the library was constructed with the aim of developing public molecular resources to advance tea plant genomics research. The library consists of a total of 401,280 clones with an average insert size of 135 kb, providing an approximate coverage of 13.5 haploid genome equivalents. No empty vector clones were observed in a random sampling of 576 BAC clones. Further analysis of 182 BAC-end sequences from randomly selected clones revealed a GC content of 40.35% and low chloroplast and mitochondrial contamination. Repetitive sequence analyses indicated that LTR retrotransposons were the most predominant sequence class (86.93%–87.24%), followed by DNA retrotransposons (11.16%–11.69%). Additionally, we found 25 simple sequence repeats (SSRs) that could potentially be used as genetic markers. PMID:21234344

Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

PubMed

Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

1996-02-01

A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

PubMed Central

2009-01-01

Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

PubMed

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.

Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis

DOEpatents

Ingram, Lonnie O.; Conway, Tyrrell

1992-01-01

The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.

[Cloning and sequence analysis of recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit and Actinobacillus actinomycetemcomitans fimbria associative protein].

PubMed

Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang

2005-02-01

To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.

Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

PubMed

Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

2004-06-15

The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

Microbial Communities in the Surface Mucopolysaccharide Layer and the Black Band Microbial Mat of Black Band-Diseased Siderastrea siderea

PubMed Central

Sekar, Raju; Mills, DeEtta K.; Remily, Elizabeth R.; Voss, Joshua D.; Richardson, Laurie L.

2006-01-01

Microbial community profiles and species composition associated with two black band-diseased colonies of the coral Siderastrea siderea were studied by 16S rRNA-targeted gene cloning, sequencing, and amplicon-length heterogeneity PCR (LH-PCR). Bacterial communities associated with the surface mucopolysaccharide layer (SML) of apparently healthy tissues of the infected colonies, together with samples of the black band disease (BBD) infections, were analyzed using the same techniques for comparison. Gene sequences, ranging from 424 to 1,537 bp, were retrieved from all positive clones (n = 43 to 48) in each of the four clone libraries generated and used for comparative sequence analysis. In addition to LH-PCR community profiling, all of the clone sequences were aligned with LH-PCR primer sequences, and the theoretical lengths of the amplicons were determined. Results revealed that the community profiles were significantly different between BBD and SML samples. The SML samples were dominated by γ-proteobacteria (53 to 64%), followed by β-proteobacteria (18 to 21%) and α-proteobacteria (5 to 11%). In contrast, both BBD clone libraries were dominated by α-proteobacteria (58 to 87%), followed by verrucomicrobia (2 to 10%) and 0 to 6% each of δ-proteobacteria, bacteroidetes, firmicutes, and cyanobacteria. Alphaproteobacterial sequence types related to the bacteria associated with toxin-producing dinoflagellates were observed in BBD clone libraries but were not found in the SML libraries. Similarly, sequences affiliated with the family Desulfobacteraceae and toxin-producing cyanobacteria, both believed to be involved in BBD pathogenesis, were found only in BBD libraries. These data provide evidence for an association of numerous toxin-producing heterotrophic microorganisms with BBD of corals. PMID:16957217

Characterization of mutagen-activated cellular oncogenes that confer anchorage independence to human fibroblasts and tumorigenicity to NIH 3T3 cells: Sequence analysis of an enzymatically amplified mutant HRAS allele

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stevens, C.W.; Manoharan, T.H.; Fahl, W.E.

1988-06-01

Treatment of diploid human fibroblasts with an alkylating mutagen has been shown to induce stable, anchorage-independent cell populations at frequencies consistent with an activating mutation. After treatment of human foreskin fibroblasts with the mutagen benzo({alpha})pyrene ({plus minus})anti-7,8-dihydrodiol 9,10-epoxide and selection in soft agar, 17 anchorage-independent clones were isolated and expanded, and their cellular DNA was used to cotransfect NIH 3T3 cells along with pSV2neo. DNA from 11 of the 17 clones induced multiple NIH 3T3 cell tumors in recipient nude mice. Southern blot analyses showed the presence of human Alu repetitive sequences in all of the NIH 3T3 tumor cellmore » DNAs. Intact, human HRAS sequences were observed in 2 of the 11 tumor groups, whereas no hybridization was detected when human KRAS or NRAS probes were used. Slow-migrating ras p21 proteins, consistent with codon 12 mutations, were observed in the same two NIH 3T3 tumor cell groups that contained the human HRAS bands. Genomic DNA from one of these two human anchorage-independent cell populations (clone 21A) was used to enzymatically amplify a portion of exon 1 of the HRAS gene. The results demonstrate that exposure of normal human cells to a common environmental mutagen yields HRAS GC {yields} TA codon 12 transversions that have been commonly observed in human tumors.« less

Genetic Diversity of Small Eukaryotes in Lakes Differing by Their Trophic Status

PubMed Central

Lefranc, Marie; Thénot, Aurélie; Lepère, Cécile; Debroas, Didier

2005-01-01

Small eukaryotes, cells with a diameter of less than 5 μm, are fundamental components of lacustrine planktonic systems. In this study, small-eukaryote diversity was determined by sequencing cloned 18S rRNA genes in three libraries from lakes of differing trophic status in the Massif Central, France: the oligotrophic Lake Godivelle, the oligomesotrophic Lake Pavin, and the eutrophic Lake Aydat. This analysis shows that the least diversified library was in the eutrophic lake (12 operational taxonomic units [OTUs]) and the most diversified was in the oligomesotrophic lake (26 OTUs). Certain groups were present in at least two ecosystems, while the others were specific to one lake on the sampling date. Cryptophyta, Chrysophyceae, and the strictly heterotrophic eukaryotes, Ciliophora and fungi, were identified in the three libraries. Among the small eukaryotes found only in two lakes, Choanoflagellida and environmental sequences (LKM11) were not detected in the eutrophic system whereas Cercozoa were confined to the oligomesotrophic and eutrophic lakes. Three OTUs, linked to the Perkinsozoa, were detected only in the Aydat library, where they represented 60% of the clones of the library. Chlorophyta and Haptophyta lineages were represented by a single clone and were present only in Godivelle and Pavin, respectively. Of the 127 clones studied, classical pigmented organisms (autotrophs and mixotrophs) represented only a low proportion regardless of the library's origin. This study shows that the small-eukaryote community composition may differ as a function of trophic status; certain lineages could be detected only in a single ecosystem. PMID:16204507

Open resource metagenomics: a model for sharing metagenomic libraries.

PubMed

Neufeld, J D; Engel, K; Cheng, J; Moreno-Hagelsieb, G; Rose, D R; Charles, T C

2011-11-30

Both sequence-based and activity-based exploitation of environmental DNA have provided unprecedented access to the genomic content of cultivated and uncultivated microorganisms. Although researchers deposit microbial strains in culture collections and DNA sequences in databases, activity-based metagenomic studies typically only publish sequences from the hits retrieved from specific screens. Physical metagenomic libraries, conceptually similar to entire sequence datasets, are usually not straightforward to obtain by interested parties subsequent to publication. In order to facilitate unrestricted distribution of metagenomic libraries, we propose the adoption of open resource metagenomics, in line with the trend towards open access publishing, and similar to culture- and mutant-strain collections that have been the backbone of traditional microbiology and microbial genetics. The concept of open resource metagenomics includes preparation of physical DNA libraries, preferably in versatile vectors that facilitate screening in a diversity of host organisms, and pooling of clones so that single aliquots containing complete libraries can be easily distributed upon request. Database deposition of associated metadata and sequence data for each library provides researchers with information to select the most appropriate libraries for further research projects. As a starting point, we have established the Canadian MetaMicroBiome Library (CM(2)BL [1]). The CM(2)BL is a publicly accessible collection of cosmid libraries containing environmental DNA from soils collected from across Canada, spanning multiple biomes. The libraries were constructed such that the cloned DNA can be easily transferred to Gateway® compliant vectors, facilitating functional screening in virtually any surrogate microbial host for which there are available plasmid vectors. The libraries, which we are placing in the public domain, will be distributed upon request without restriction to members of both the academic research community and industry. This article invites the scientific community to adopt this philosophy of open resource metagenomics to extend the utility of functional metagenomics beyond initial publication, circumventing the need to start from scratch with each new research project.

Open resource metagenomics: a model for sharing metagenomic libraries

PubMed Central

Neufeld, J.D.; Engel, K.; Cheng, J.; Moreno-Hagelsieb, G.; Rose, D.R.; Charles, T.C.

2011-01-01

Both sequence-based and activity-based exploitation of environmental DNA have provided unprecedented access to the genomic content of cultivated and uncultivated microorganisms. Although researchers deposit microbial strains in culture collections and DNA sequences in databases, activity-based metagenomic studies typically only publish sequences from the hits retrieved from specific screens. Physical metagenomic libraries, conceptually similar to entire sequence datasets, are usually not straightforward to obtain by interested parties subsequent to publication. In order to facilitate unrestricted distribution of metagenomic libraries, we propose the adoption of open resource metagenomics, in line with the trend towards open access publishing, and similar to culture- and mutant-strain collections that have been the backbone of traditional microbiology and microbial genetics. The concept of open resource metagenomics includes preparation of physical DNA libraries, preferably in versatile vectors that facilitate screening in a diversity of host organisms, and pooling of clones so that single aliquots containing complete libraries can be easily distributed upon request. Database deposition of associated metadata and sequence data for each library provides researchers with information to select the most appropriate libraries for further research projects. As a starting point, we have established the Canadian MetaMicroBiome Library (CM2BL [1]). The CM2BL is a publicly accessible collection of cosmid libraries containing environmental DNA from soils collected from across Canada, spanning multiple biomes. The libraries were constructed such that the cloned DNA can be easily transferred to Gateway® compliant vectors, facilitating functional screening in virtually any surrogate microbial host for which there are available plasmid vectors. The libraries, which we are placing in the public domain, will be distributed upon request without restriction to members of both the academic research community and industry. This article invites the scientific community to adopt this philosophy of open resource metagenomics to extend the utility of functional metagenomics beyond initial publication, circumventing the need to start from scratch with each new research project. PMID:22180823

Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

PubMed

Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

2006-08-01

To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.

PubMed

Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk

2016-05-01

Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Environmental and genetic modulation of the phenotypic expression of antibiotic resistance

PubMed Central

Andersson, Dan I

2017-01-01

Abstract Antibiotic resistance can be acquired by mutation or horizontal transfer of a resistance gene, and generally an acquired mechanism results in a predictable increase in phenotypic resistance. However, recent findings suggest that the environment and/or the genetic context can modify the phenotypic expression of specific resistance genes/mutations. An important implication from these findings is that a given genotype does not always result in the expected phenotype. This dissociation of genotype and phenotype has important consequences for clinical bacteriology and for our ability to predict resistance phenotypes from genetics and DNA sequences. A related problem concerns the degree to which the genes/mutations currently identified in vitro can fully explain the in vivo resistance phenotype, or whether there is a significant additional amount of presently unknown mutations/genes (genetic ‘dark matter’) that could contribute to resistance in clinical isolates. Finally, a very important question is whether/how we can identify the genetic features that contribute to making a successful pathogen, and predict why some resistant clones are very successful and spread globally? In this review, we describe different environmental and genetic factors that influence phenotypic expression of antibiotic resistance genes/mutations and how this information is needed to understand why particular resistant clones spread worldwide and to what extent we can use DNA sequences to predict evolutionary success. PMID:28333270

An apparent Acanthamoeba genotype is the product of a chimeric 18S rDNA artifact.

PubMed

Corsaro, Daniele; Venditti, Danielle

2018-02-01

Free-living amoebae of the genus Acanthamoeba are potentially pathogenic protozoa widespread in the environment. The detection/diagnosis as well as environmental survey strategies is mainly based on the identification of the 18S rDNA sequences of the strains that allow the recovery of various distinct genotypes/subgenotypes. The accurate recording of such data is important to better know the environmental distribution of distinct genotypes and how they may be preferentially associated with disease. Recently, a putative new acanthamoebal genotype T99 was introduced, which comprises only environmental clones apparently with some anomalous features. Here, we analyze these sequences through partial treeing and BLAST analyses and find that they are actually chimeras. Our results show that the putative T99 genotype is very likely formed by chimeric sequences including a middle fragment from acanthamoebae of genotype T13, while the 5'- and 3'-end fragments came from a nematode and a cercozoan, respectively. Molecular phylogenies of Acanthamoeba including T99 are consequently erroneous as genotype T99 does not exist in nature. Careful identification of Acanthamoeba genotypes is therefore critical for both phylogenetic and diagnostic applications.

Solution Hybrid Selection Capture for the Recovery of Functional Full-Length Eukaryotic cDNAs From Complex Environmental Samples

PubMed Central

Bragalini, Claudia; Ribière, Céline; Parisot, Nicolas; Vallon, Laurent; Prudent, Elsa; Peyretaillade, Eric; Girlanda, Mariangela; Peyret, Pierre; Marmeisse, Roland; Luis, Patricia

2014-01-01

Eukaryotic microbial communities play key functional roles in soil biology and potentially represent a rich source of natural products including biocatalysts. Culture-independent molecular methods are powerful tools to isolate functional genes from uncultured microorganisms. However, none of the methods used in environmental genomics allow for a rapid isolation of numerous functional genes from eukaryotic microbial communities. We developed an original adaptation of the solution hybrid selection (SHS) for an efficient recovery of functional complementary DNAs (cDNAs) synthesized from soil-extracted polyadenylated mRNAs. This protocol was tested on the Glycoside Hydrolase 11 gene family encoding endo-xylanases for which we designed 35 explorative 31-mers capture probes. SHS was implemented on four soil eukaryotic cDNA pools. After two successive rounds of capture, >90% of the resulting cDNAs were GH11 sequences, of which 70% (38 among 53 sequenced genes) were full length. Between 1.5 and 25% of the cloned captured sequences were expressed in Saccharomyces cerevisiae. Sequencing of polymerase chain reaction-amplified GH11 gene fragments from the captured sequences highlighted hundreds of phylogenetically diverse sequences that were not yet described, in public databases. This protocol offers the possibility of performing exhaustive exploration of eukaryotic gene families within microbial communities thriving in any type of environment. PMID:25281543

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

Sequence Typing Confirms that a Predominant Listeria monocytogenes Clone Caused Human Listeriosis Cases and Outbreaks in Canada from 1988 to 2010

PubMed Central

Reimer, Aleisha; Verghese, Bindhu; Lok, Mei; Ziegler, Jennifer; Farber, Jeffrey; Pagotto, Franco; Graham, Morag; Nadon, Celine A.

2012-01-01

Human listeriosis outbreaks in Canada have been predominantly caused by serotype 1/2a isolates with highly similar pulsed-field gel electrophoresis (PFGE) patterns. Multilocus sequence typing (MLST) and multi-virulence-locus sequence typing (MVLST) each identified a diverse population of Listeria monocytogenes isolates, and within that, both methods had congruent subtypes that substantiated a predominant clone (clonal complex 8; virulence type 59; proposed epidemic clone 5 [ECV]) that has been causing human illness across Canada for more than 2 decades. PMID:22337989

Nucleotide sequence and regulatory studies of VGF, a nervous system-specific mRNA that is rapidly and relatively selectively induced by nerve growth factor.

PubMed

Salton, S R

1991-09-01

A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.

Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

PubMed Central

Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

2001-01-01

The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

Sequence verification of synthetic DNA by assembly of sequencing reads

PubMed Central

Wilson, Mandy L.; Cai, Yizhi; Hanlon, Regina; Taylor, Samantha; Chevreux, Bastien; Setubal, João C.; Tyler, Brett M.; Peccoud, Jean

2013-01-01

Gene synthesis attempts to assemble user-defined DNA sequences with base-level precision. Verifying the sequences of construction intermediates and the final product of a gene synthesis project is a critical part of the workflow, yet one that has received the least attention. Sequence validation is equally important for other kinds of curated clone collections. Ensuring that the physical sequence of a clone matches its published sequence is a common quality control step performed at least once over the course of a research project. GenoREAD is a web-based application that breaks the sequence verification process into two steps: the assembly of sequencing reads and the alignment of the resulting contig with a reference sequence. GenoREAD can determine if a clone matches its reference sequence. Its sophisticated reporting features help identify and troubleshoot problems that arise during the sequence verification process. GenoREAD has been experimentally validated on thousands of gene-sized constructs from an ORFeome project, and on longer sequences including whole plasmids and synthetic chromosomes. Comparing GenoREAD results with those from manual analysis of the sequencing data demonstrates that GenoREAD tends to be conservative in its diagnostic. GenoREAD is available at www.genoread.org. PMID:23042248

Ultra-low background DNA cloning system.

PubMed

Goto, Kenta; Nagano, Yukio

2013-01-01

Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Microbial community diversity in the gut of the South American termite Cornitermes cumulans (Isoptera: Termitidae).

PubMed

Grieco, Maria Angela B; Cavalcante, Janaina J V; Cardoso, Alexander M; Vieira, Ricardo P; Machado, Ednildo A; Clementino, Maysa M; Medeiros, Marcelo N; Albano, Rodolpho M; Garcia, Eloi S; de Souza, Wanderley; Constantino, Reginaldo; Martins, Orlando B

2013-01-01

Termites inhabit tropical and subtropical areas where they contribute to structure and composition of soils by efficiently degrading biomass with aid of resident gut microbiota. In this study, culture-independent molecular analysis was performed based on bacterial and archaeal 16S rRNA clone libraries to describe the gut microbial communities within Cornitermes cumulans, a South American litter-feeding termite. Our data reveal extensive bacterial diversity, mainly composed of organisms from the phyla Spirochaetes, Bacteroidetes, Firmicutes, Actinobacteria, and Fibrobacteres. In contrast, a low diversity of archaeal 16S rRNA sequences was found, comprising mainly members of the Crenarchaeota phylum. The diversity of archaeal methanogens was further analyzed by sequencing clones from a library for the mcrA gene, which encodes the enzyme methyl coenzyme reductase, responsible for catalyzing the last step in methane production, methane being an important greenhouse gas. The mcrA sequences were diverse and divided phylogenetically into three clades related to uncultured environmental archaea and methanogens found in different termite species. C. cumulans is a litter-feeding, mound-building termite considered a keystone species in natural ecosystems and also a pest in agriculture. Here, we describe the archaeal and bacterial communities within this termite, revealing for the first time its intriguing microbiota.

Variations on a theme of Lander and Waterman

DOE Office of Scientific and Technical Information (OSTI.GOV)

Speed, T.

1997-12-01

The original Lander and Waterman mathematical analysis was for fingerprinting random clones. Since that time, a number of variants of their theory have appeared, including ones which apply to mapping by anchoring random clones, and to non-random or directed clone mapping. The same theory is now widely used to devise random sequencing strategies. In this talk I will review these developments, and go on the discuss the theory required for directed sequencing strategies.

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE PAGES

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.; ...

2015-01-14

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

Generating an Open Reading Frame (ORF) Entry Clone and Destination Clone.

PubMed

Reece-Hoyes, John S; Walhout, Albertha J M

2018-01-02

This protocol describes using the Gateway recombinatorial cloning system to create an Entry clone carrying an open reading frame (ORF) and then to transfer the ORF into a Destination vector. In this example, BP recombination is used to clone an ORF from a cDNA source into the Donor vector pDONR 221. The ORF from the resulting Entry clone is then transferred into the Destination vector pDEST-15; the product (the Destination clone) will express the ORF as an amino-terminal GST-fusion. The technique can be used as a guide for cloning any other DNA fragment of interest-a promoter sequence or 3' untranslated region (UTR), for example-with substitutions of different genetic material such as genomic DNA, att sites, and vectors as required. The series of constructions and transformations requires 9-15 d, not including time that may be required for sequence confirmation, if desired/necessary. © 2018 Cold Spring Harbor Laboratory Press.

DNA sequences and composition from 12 BAC clones-derived MUSB SSR markers mapped to cotton (Gossypium Hirsutum L. x G. Barbadense L.)chromosomes 11 and 21

USDA-ARS?s Scientific Manuscript database

To discover resistance (R) and/or pathogen-induced (PR) genes involved in disease response, 12 bacterial artificial chromosome (BAC) clones from cv. Acala Maxxa (G. hirsutum) were sequenced at the Clemson University, Genomics Institute, Clemson, SC. These BACs derived MUSB single sequence repeat (SS...

Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

PubMed Central

Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

2000-01-01

Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

Depletion of Unwanted Nucleic Acid Templates by Selective Cleavage: LNAzymes, Catalytically Active Oligonucleotides Containing Locked Nucleic Acids, Open a New Window for Detecting Rare Microbial Community Members

PubMed Central

Dolinšek, Jan; Dorninger, Christiane; Lagkouvardos, Ilias; Wagner, Michael

2013-01-01

Many studies of molecular microbial ecology rely on the characterization of microbial communities by PCR amplification, cloning, sequencing, and phylogenetic analysis of genes encoding rRNAs or functional marker enzymes. However, if the established clone libraries are dominated by one or a few sequence types, the cloned diversity is difficult to analyze by random clone sequencing. Here we present a novel approach to deplete unwanted sequence types from complex nucleic acid mixtures prior to cloning and downstream analyses. It employs catalytically active oligonucleotides containing locked nucleic acids (LNAzymes) for the specific cleavage of selected RNA targets. When combined with in vitro transcription and reverse transcriptase PCR, this LNAzyme-based technique can be used with DNA or RNA extracts from microbial communities. The simultaneous application of more than one specific LNAzyme allows the concurrent depletion of different sequence types from the same nucleic acid preparation. This new method was evaluated with defined mixtures of cloned 16S rRNA genes and then used to identify accompanying bacteria in an enrichment culture dominated by the nitrite oxidizer “Candidatus Nitrospira defluvii.” In silico analysis revealed that the majority of publicly deposited rRNA-targeted oligonucleotide probes may be used as specific LNAzymes with no or only minor sequence modifications. This efficient and cost-effective approach will greatly facilitate tasks such as the identification of microbial symbionts in nucleic acid preparations dominated by plastid or mitochondrial rRNA genes from eukaryotic hosts, the detection of contaminants in microbial cultures, and the analysis of rare organisms in microbial communities of highly uneven composition. PMID:23263968

Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China.

PubMed

Huang, Xiao Dan; Tan, Hui Yin; Long, Ruijun; Liang, Juan Boo; Wright, André-Denis G

2012-10-19

Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from "energy-saving" animal (yak) and normal animal (cattle) in order to investigate the link between methanogen structure and low methane production. Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones) and four cattle (205 clones) from the Qinghai-Tibetan Plateau area (QTP). Overall, a total of 414 clones (i.e. sequences) were examined and assigned to 95 operational taxonomic units (OTUs) using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC) were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110) was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle.

Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China

PubMed Central

2012-01-01

Background Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from “energy-saving” animal (yak) and normal animal (cattle) in order to investigate the link between methanogen structure and low methane production. Results Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones) and four cattle (205 clones) from the Qinghai-Tibetan Plateau area (QTP). Overall, a total of 414 clones (i.e. sequences) were examined and assigned to 95 operational taxonomic units (OTUs) using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC) were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110) was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. Conclusion This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle. PMID:23078429

Changes in coral-associated microbial communities during a bleaching event.

PubMed

Bourne, David; Iida, Yuki; Uthicke, Sven; Smith-Keune, Carolyn

2008-04-01

Environmental stressors such as increased sea surface temperatures are well-known for contributing to coral bleaching; however, the effect of increased temperatures and subsequent bleaching on coral-associated microbial communities is poorly understood. Colonies of the hard coral Acropora millepora were tagged on a reef flat off Magnetic Island (Great Barrier Reef) and surveyed over 2.5 years, which included a severe bleaching event in January/February 2002. Daily average water temperatures exceeded the previous 10-year average by more than 1 degrees C for extended periods with field-based visual surveys recording all tagged colonies displaying signs of bleaching. During the bleaching period, direct counts of coral zooxanthellae densities decreased by approximately 64%, before recovery to pre-bleaching levels after the thermal stress event. A subset of three tagged coral colonies were sampled through the bleaching event and changes in the microbial community elucidated. Denaturing gradient gel electrophoresis (DGGE) analysis demonstrated conserved bacterial banding profiles between the three coral colonies, confirming previous studies highlighting specific microbial associations. As coral colonies bleached, the microbial community shifted and redundancy analysis (RDA) of DGGE banding patterns revealed a correlation of increasing temperature with the appearance of Vibrio-affiliated sequences. Interestingly, this shift to a Vibrio-dominated community commenced prior to visual signs of bleaching. Clone libraries hybridized with Vibrio-specific oligonucleotide probes confirmed an increase in the fraction of Vibrio-affiliated clones during the bleaching period. Post bleaching, the coral microbial associations again shifted, returning to a profile similar to the fingerprints prior to bleaching. This provided further evidence for corals selecting and shaping their microbial partners. For non-bleached samples, a close association with Spongiobacter-related sequences were revealed by both clone libraries and DGGE profiling. Despite Vibrio species being previously implicated in bleaching of specific coral species, it is unsure if the relative increase in retrieved Vibrio sequences is due to bacterial infection or an opportunistic response to compromised health and changing environmental parameters of the coral host. This study provides the first molecular-based study demonstrating changes in coral-associated bacterial assemblages during a bleaching event on a natural reef system.

Discovery of new cellulases from the metagenome by a metagenomics-guided strategy.

PubMed

Yang, Chao; Xia, Yu; Qu, Hong; Li, An-Dong; Liu, Ruihua; Wang, Yubo; Zhang, Tong

2016-01-01

Energy shortage has become a global problem. Production of biofuels from renewable biomass resources is an inevitable trend of sustainable development. Cellulose is the most abundant and renewable resource in nature. Lack of new cellulases with unique properties has become the bottleneck of the efficient utilization of cellulose. Environmental metagenomes are regarded as huge reservoirs for a variety of cellulases. However, new cellulases cannot be obtained easily by functional screening of metagenomic libraries. In this work, a metagenomics-guided strategy for obtaining new cellulases from the metagenome was proposed. Metagenomic sequences of DNA extracted from the anaerobic beer lees converting consortium enriched at thermophilic conditions were assembled, and 23 glycoside hydrolase (GH) sequences affiliated with the GH family 5 were identified. Among the 23 GH sequences, three target sequences (designated as cel7482, cel3623 and cel36) showing low identity with those known GHs were chosen as the putative cellulase genes to be functionally expressed in Escherichia coli after PCR cloning. The three cellulases were classified into endo-β-1,4-glucanases by product pattern analysis. The recombinant cellulases were more active at pH 5.5 and within a temperature range of 60-70 °C. Computer-assisted 3D structure modeling indicated that the active residues in the active site of the recombinant cellulases were more similar to each other compared with non-active site residues. The recombinant cel7482 was extremely tolerant to 2 M NaCl, suggesting that cel7482 may be a halotolerant cellulase. Moreover, the recombinant cel7482 was shown to have an ability to resist three ionic liquids (ILs), which are widely used for cellulose pretreatment. Furthermore, active cel7482 was secreted by the twin-arginine translocation (Tat) pathway of Bacillus subtilis 168 into the culture medium, which facilitates the subsequent purification and reduces the formation of inclusion body in the context of overexpression. This study demonstrated a simple and efficient method for direct cloning of new cellulase genes from environmental metagenomes. In the future, the metagenomics-guided strategy may be applied to the high-throughput screening of new cellulases from environmental metagenomes.

Combinatorial Pooling Enables Selective Sequencing of the Barley Gene Space

PubMed Central

Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R.; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J.

2013-01-01

For the vast majority of species – including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding. PMID:23592960

Combinatorial pooling enables selective sequencing of the barley gene space.

PubMed

Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J

2013-04-01

For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.

Marine Fungi: Their Ecology and Molecular Diversity

NASA Astrophysics Data System (ADS)

Richards, Thomas A.; Jones, Meredith D. M.; Leonard, Guy; Bass, David

2012-01-01

Fungi appear to be rare in marine environments. There are relatively few marine isolates in culture, and fungal small subunit ribosomal DNA (SSU rDNA) sequences are rarely recovered in marine clone library experiments (i.e., culture-independent sequence surveys of eukaryotic microbial diversity from environmental DNA samples). To explore the diversity of marine fungi, we took a broad selection of SSU rDNA data sets and calculated a summary phylogeny. Bringing these data together identified a diverse collection of marine fungi, including sequences branching close to chytrids (flagellated fungi), filamentous hypha-forming fungi, and multicellular fungi. However, the majority of the sequences branched with ascomycete and basidiomycete yeasts. We discuss evidence for 36 novel marine lineages, the majority and most divergent of which branch with the chytrids. We then investigate what these data mean for the evolutionary history of the Fungi and specifically marine-terrestrial transitions. Finally, we discuss the roles of fungi in marine ecosystems.

SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

NASA Astrophysics Data System (ADS)

Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

2015-09-01

The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

CRISPR-Cas9-Edited Site Sequencing (CRES-Seq): An Efficient and High-Throughput Method for the Selection of CRISPR-Cas9-Edited Clones.

PubMed

Veeranagouda, Yaligara; Debono-Lagneaux, Delphine; Fournet, Hamida; Thill, Gilbert; Didier, Michel

2018-01-16

The emergence of clustered regularly interspaced short palindromic repeats-Cas9 (CRISPR-Cas9) gene editing systems has enabled the creation of specific mutants at low cost, in a short time and with high efficiency, in eukaryotic cells. Since a CRISPR-Cas9 system typically creates an array of mutations in targeted sites, a successful gene editing project requires careful selection of edited clones. This process can be very challenging, especially when working with multiallelic genes and/or polyploid cells (such as cancer and plants cells). Here we described a next-generation sequencing method called CRISPR-Cas9 Edited Site Sequencing (CRES-Seq) for the efficient and high-throughput screening of CRISPR-Cas9-edited clones. CRES-Seq facilitates the precise genotyping up to 96 CRISPR-Cas9-edited sites (CRES) in a single MiniSeq (Illumina) run with an approximate sequencing cost of $6/clone. CRES-Seq is particularly useful when multiple genes are simultaneously targeted by CRISPR-Cas9, and also for screening of clones generated from multiallelic genes/polyploid cells. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

Analysis of Facultative Lithotroph Distribution and Diversity on Volcanic Deposits by Use of the Large Subunit of Ribulose 1,5-Bisphosphate Carboxylase/Oxygenase†

PubMed Central

Nanba, K.; King, G. M.; Dunfield, K.

2004-01-01

A 492- to 495-bp fragment of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) (rbcL) was amplified by PCR from facultatively lithotrophic aerobic CO-oxidizing bacteria, colorless and purple sulfide-oxidizing microbial mats, and genomic DNA extracts from tephra and ash deposits from Kilauea volcano, for which atmospheric CO and hydrogen have been previously documented as important substrates. PCR products from the mats and volcanic sites were used to construct rbcL clone libraries. Phylogenetic analyses showed that the rbcL sequences from all isolates clustered with form IC rbcL sequences derived from facultative lithotrophs. In contrast, the microbial mat clone sequences clustered with sequences from obligate lithotrophs representative of form IA rbcL. Clone sequences from volcanic sites fell within the form IC clade, suggesting that these sites were dominated by facultative lithotrophs, an observation consistent with biogeochemical patterns at the sites. Based on phylogenetic and statistical analyses, clone libraries differed significantly among volcanic sites, indicating that they support distinct lithotrophic assemblages. Although some of the clone sequences were similar to known rbcL sequences, most were novel. Based on nucleotide diversity and average pairwise difference, a forested site and an 1894 lava flow were found to support the most diverse and least diverse lithotrophic populations, respectively. These indices of diversity were not correlated with rates of atmospheric CO and hydrogen uptake but were correlated with estimates of respiration and microbial biomass. PMID:15066819

Analysis of facultative lithotroph distribution and diversity on volcanic deposits by use of the large subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase.

PubMed

Nanba, K; King, G M; Dunfield, K

2004-04-01

A 492- to 495-bp fragment of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) (rbcL) was amplified by PCR from facultatively lithotrophic aerobic CO-oxidizing bacteria, colorless and purple sulfide-oxidizing microbial mats, and genomic DNA extracts from tephra and ash deposits from Kilauea volcano, for which atmospheric CO and hydrogen have been previously documented as important substrates. PCR products from the mats and volcanic sites were used to construct rbcL clone libraries. Phylogenetic analyses showed that the rbcL sequences from all isolates clustered with form IC rbcL sequences derived from facultative lithotrophs. In contrast, the microbial mat clone sequences clustered with sequences from obligate lithotrophs representative of form IA rbcL. Clone sequences from volcanic sites fell within the form IC clade, suggesting that these sites were dominated by facultative lithotrophs, an observation consistent with biogeochemical patterns at the sites. Based on phylogenetic and statistical analyses, clone libraries differed significantly among volcanic sites, indicating that they support distinct lithotrophic assemblages. Although some of the clone sequences were similar to known rbcL sequences, most were novel. Based on nucleotide diversity and average pairwise difference, a forested site and an 1894 lava flow were found to support the most diverse and least diverse lithotrophic populations, respectively. These indices of diversity were not correlated with rates of atmospheric CO and hydrogen uptake but were correlated with estimates of respiration and microbial biomass.

Cloning and characterization of new bioluminescent proteins

NASA Astrophysics Data System (ADS)

Szent-Gyorgyi, Christopher; Ballou, Byron T.; Dagnal, Erich; Bryan, Bruce

1999-07-01

Over the past two years Prolume has undertaken a comprehensive program to clone luciferases and associated 'green fluorescent proteins' (GFPs) from marine animals that use coelenterazine as the luciferin. To data we have cloned several bioluminescent proteins, including two novel copepod luciferases and two anthozoan GFPs. These four proteins have sequences that differ greatly form previously cloned analogous proteins; the sequence diversity apparently is due to independent evolutionary origins and unusual evolutionary constraints. Thus coelenterazine-based bioluminescent systems may also manifest a variety of useful properties. We discuss form this taxonomic perspective the initial biochemical and spectral characterization of our cloned proteins. Emphasis is placed on the anthozoan luciferase-GFP systems, whose efficient resonance energy transfer has elicited much current interest.

Diversity and distribution of actinobacterial aromatic ring oxygenase genes across contrasting soil properties.

PubMed

Weidow, Christopher A; Bae, Hee-Sung; Chauhan, Ashvini; Ogram, Andrew

2015-04-01

The diversity of a gene family encoding Actinobacterial aromatic ring oxygenases (AAROs) was detected by the PCR-cloning approach using a newly designed PCR primer set. The distribution of AAROs was investigated in 11 soils representing different land management and vegetation zones and was correlated with several geochemical parameters including pH, organic matter (OM), total Kjeldahl nitrogen (TKN), and nitrogen oxides (NO(x)-N: mostly NO3(-)-N). The distribution of individual clades encoding enzymes with potentially different substrates were correlated with different environmental factors, suggesting differential environmental controls on the distribution of specific enzymes as well as sequence diversity. For example, individual clades associated with phthalate dioxygenases were either strongly negatively correlated with pH, or not correlated with pH but showed strong positive correlation with organic carbon content. A large number of clones clustering in a clade related to PAH oxygenases were positively correlated with pH and nitrogen, but not with organic matter. This analysis may yield insight into the ecological forces driving the distribution of these catabolic genes.

Bioproduction and characterization of extracellular melanin-like pigment from industrially polluted metagenomic library equipped Escherichia coli.

PubMed

Amin, Shivani; Rastogi, Rajesh P; Sonani, Ravi R; Ray, Arabinda; Sharma, Rakesh; Madamwar, Datta

2018-04-15

To explore the potential genes from the industrially polluted Amlakhadi canal, located in Ankleshwar, Gujarat, India, its community genome was extracted and cloned into E. coli EPI300™-T1 R using a fosmid vector (pCC2 FOS™) generating a library of 3,92,000 clones with average size of 40kb of DNA-insert. From this library, the clone DM1 producing brown colored melanin-like pigment was isolated and characterized. For over expression of the pigment, further sub-cloning of the clone DM1 was done. Sub-clone containing 10kb of the insert was sequenced for gene identification. The amino acids sequence of a protein 4-Hydroxyphenylpyruvate dioxygenase (HPPD), which is know to be involved in melanin biosynthesis was obtained from the gene sequence. The sequence-homology based 3D structure model of HPPD was constructed and analyzed. The physico-chemical nature of pigment was further analysed using 1 H and 13 C NMR, LC-MS, FTIR and UV-visible spectroscopy. The pigment was readily soluble in DMSO with an absorption maximum around 290nm. Based on the genetic and chemical characterization, the compound was confirmed as melanin-like pigment. The present results indicate that the metagenomic library from industrially polluted environment generated a microbial tool for the production of melanin-like pigment. Copyright © 2018 Elsevier B.V. All rights reserved.

Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.

PubMed

Yang, W J; Rao, K R

2001-11-30

Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.

ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

PubMed

Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2017-03-01

Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

Identification of Genes and Pathways Related to Phenol Degradation in Metagenomic Libraries from Petroleum Refinery Wastewater

PubMed Central

Silva, Cynthia C.; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; De Paula, Sérgio O.; Silva, Lívia C. F.; Vidigal, Pedro M. P.; Vicentini, Renato; Sousa, Maíra P.; Torres, Ana Paula R.; Santiago, Vânia M. J.; Oliveira, Valéria M.

2013-01-01

Two fosmid libraries, totaling 13,200 clones, were obtained from bioreactor sludge of petroleum refinery wastewater treatment system. The library screening based on PCR and biological activity assays revealed more than 400 positive clones for phenol degradation. From these, 100 clones were randomly selected for pyrosequencing in order to evaluate the genetic potential of the microorganisms present in wastewater treatment plant for biodegradation, focusing mainly on novel genes and pathways of phenol and aromatic compound degradation. The sequence analysis of selected clones yielded 129,635 reads at an estimated 17-fold coverage. The phylogenetic analysis showed Burkholderiales and Rhodocyclales as the most abundant orders among the selected fosmid clones. The MG-RAST analysis revealed a broad metabolic profile with important functions for wastewater treatment, including metabolism of aromatic compounds, nitrogen, sulphur and phosphorus. The predicted 2,276 proteins included phenol hydroxylases and cathecol 2,3- dioxygenases, involved in the catabolism of aromatic compounds, such as phenol, byphenol, benzoate and phenylpropanoid. The sequencing of one fosmid insert of 33 kb unraveled the gene that permitted the host, Escherichia coli EPI300, to grow in the presence of aromatic compounds. Additionally, the comparison of the whole fosmid sequence against bacterial genomes deposited in GenBank showed that about 90% of sequence showed no identity to known sequences of Proteobacteria deposited in the NCBI database. This study surveyed the functional potential of fosmid clones for aromatic compound degradation and contributed to our knowledge of the biodegradative capacity and pathways of microbial assemblages present in refinery wastewater treatment system. PMID:23637911

Identification of gene fragments related to nitrogen deficiency in Eichhornia crassipes (Pontederiaceae).

PubMed

Fu, Minghui; Jiang, Lihua; Li, Yuanmei; Yan, Guohua; Zheng, Lijun; Jinping, Peng

2014-12-01

Eichhornia crassipes is an aquatic plant native to the Amazon River Basin. It has become a serious weed in freshwater habitats in rivers, lakes and reservoirs both in tropical and warm temperate areas worldwide. Some research has stated that it can be used for water phytoremediation, due to its strong assimilation of nitrogen and phosphorus, and the accumulation of heavy metals, and its growth and spread may play an important role in environmental ecology. In order to explore the molecular mechanism of E. crassipes to responses to nitrogen deficiency, we constructed forward and reversed subtracted cDNA libraries for E. crassipes roots under nitrogen deficient condition using a suppressive subtractive hybridization (SSH) method. The forward subtraction included 2,100 clones, and the reversed included 2,650 clones. One thousand clones were randomly selected from each library for sequencing. About 737 (527 unigenes) clones from the forward library and 757 (483 unigenes) clones from the reversed library were informative. Sequence BlastX analysis showed that there were more transporters and adenosylhomocysteinase-like proteins in E. crassipes cultured in nitrogen deficient medium; while, those cultured in nitrogen replete medium had more proteins such as UBR4-like e3 ubiquitin-protein ligase and fasciclin-like arabinogalactan protein 8-like, as well as more cytoskeletal proteins, including actin and tubulin. Cluster of Orthologous Group (COG) analysis also demonstrated that in the forward library, the most ESTs were involved in coenzyme transportation and metabolism. In the reversed library, cytoskeletal ESTs were the most abundant. Gene Ontology (GO) analysis categories demonstrated that unigenes involved in binding, cellular process and electron carrier were the most differentially expressed unigenes between the forward and reversed libraries. All these results suggest that E. crassipes can respond to different nitrogen status by efficiently regulating and controlling some transporter gene expressions, certain metabolism processes, specific signal transduction pathways and cytoskeletal construction.

Widespread epidemic cholera caused by a restricted subset of Vibrio cholerae clones.

PubMed

Moore, S; Thomson, N; Mutreja, A; Piarroux, R

2014-05-01

Since 1817, seven cholera pandemics have plagued humankind. As the causative agent, Vibrio cholerae, is autochthonous in the aquatic ecosystem and some studies have revealed links between outbreaks and fluctuations in climatic and aquatic conditions, it has been widely assumed that cholera epidemics are triggered by environmental factors that promote the growth of local bacterial reservoirs. However, mounting epidemiological findings and genome sequence analysis of clinical isolates have indicated that epidemics are largely unassociated with most of the V. cholerae strains in aquatic ecosystems. Instead, only a specific subset of V. cholerae El Tor 'types' appears to be responsible for current epidemics. A recent report examining the evolution of a variety of V. cholerae strains indicates that the current pandemic is monophyletic and originated from a single ancestral clone that has spread globally in successive waves. In this review, we examine the clonal nature of the disease, with the example of the recent history of cholera in the Americas. Epidemiological data and genome sequence-based analysis of V. cholerae isolates demonstrate that the cholera epidemics of the 1990s in South America were triggered by the importation of a pathogenic V. cholerae strain that gradually spread throughout the region until local outbreaks ceased in 2001. Latin America remained almost unaffected by the disease until a new toxigenic V. cholerae clone was imported into Haiti in 2010. Overall, cholera appears to be largely caused by a subset of specific V. cholerae clones rather than by the vast diversity of V. cholerae strains in the environment. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

Deep nirS amplicon sequencing of San Francisco Bay sediments enables prediction of geography and environmental conditions from denitrifying community composition.

PubMed

Lee, Jessica A; Francis, Christopher A

2017-12-01

Denitrification is a dominant nitrogen loss process in the sediments of San Francisco Bay. In this study, we sought to understand the ecology of denitrifying bacteria by using next-generation sequencing (NGS) to survey the diversity of a denitrification functional gene, nirS (encoding cytchrome-cd 1 nitrite reductase), along the salinity gradient of San Francisco Bay over the course of a year. We compared our dataset to a library of nirS sequences obtained previously from the same samples by standard PCR cloning and Sanger sequencing, and showed that both methods similarly demonstrated geography, salinity and, to a lesser extent, nitrogen, to be strong determinants of community composition. Furthermore, the depth afforded by NGS enabled novel techniques for measuring the association between environment and community composition. We used Random Forests modelling to demonstrate that the site and salinity of a sample could be predicted from its nirS sequences, and to identify indicator taxa associated with those environmental characteristics. This work contributes significantly to our understanding of the distribution and dynamics of denitrifying communities in San Francisco Bay, and provides valuable tools for the further study of this key N-cycling guild in all estuarine systems. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

PubMed

Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

2005-10-01

The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis.

PubMed

Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy Te; Basso, Giuseppe

2016-10-04

To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations.

A molecular model for illegitimate recombination in Bacillus subtilis.

PubMed

Temeyer, K B; Hopkins, K M; Chapman, L F

1991-01-01

The recombinant DNA junctions at which pUB110 and Bacillus subtilis chromosomal DNA were joined to form the plasmid pKBT1 were cloned and sequenced. From the sequencing data we conclude that the pUB110 sequence is intact in the pair of cloned pKBT1 fragments and pTL12 sequences are not present. A molecular model for the formation of pKBT1 based on structural motifs characteristic of the joint sites is presented.

Novel Immune Modulating Cellular Vaccine for Prostate Cancer

DTIC Science & Technology

2014-10-01

restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal

Cloning, sequencing and characterization of lipase from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...

Quantitative DNA fiber mapping

DOEpatents

Gray, Joe W.; Weier, Heinz-Ulrich G.

1998-01-01

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

The Genome Sequence of a Type ST239 Methicillin-Resistant Staphylococcus aureus Isolate from a Malaysian Hospital

PubMed Central

Lee, LS; Teh, LK; Zainuddin, ZF; Salleh, MZ

2014-01-01

We report the genome sequence of a healthcare-associated MRSA type ST239 clone isolated from a patient with septicemia in Malaysia. This clone typifies the characteristics of ST239 lineage, including resistance to multiple antibiotics and antiseptics. PMID:25197474

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Microeukaryotic diversity in marine environments, an analysis of surface layer sediments from the East Sea.

PubMed

Park, Soo-Je; Park, Byoung-Joon; Pham, Vinh Hoa; Yoon, Dae-No; Kim, Si-Kwan; Rhee, Sung-Keun

2008-06-01

Molecular techniques, based on clone library of 18S rRNA gene, were employed to ascertain the diversity of microeukaryotic organisms in sediments from the East Sea. A total of 261 clones were recovered from surface sediments. Most of the clone sequences (90%) were affiliated with protists, dominated by Ciliates (18%) and Dinoflagellates (19%) of Alveolates, phototrophic Stramenopiles (11%), and Cercozoa (20%). Many of the clones were related to uncultivated eukaryotes clones retrieved from anoxic environments with several highly divergent 18S rRNA gene sequences. However, no clones were related to cultivated obligate anaerobic protists. Protistan communities between subsurface layers of 1 and 9 cm shared 23% of total phylotypes which comprised 64% of total clones retrieved. Analysis of diversity indices and rarefaction curve showed that the protistan community within the 1 cm layer exhibited higher diversity than the 9 cm layer. Our results imply that diverse protists remain to be uncovered within marine benthic environments.

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

Cloning and sequence determination of the gene coding for the pyruvate phosphate dikinase of Entamoeba histolytica.

PubMed

Saavedra-Lira, E; Pérez-Montfort, R

1994-05-16

We isolated three overlapping clones from a DNA genomic library of Entamoeba histolytica strain HM1:IMSS, whose translated nucleotide (nt) sequence shows similarities of 51, 48 and 47% with the amino acid (aa) sequences reported for the pyruvate phosphate dikinases from Bacteroides symbiosus, maize and Flaveria trinervia, respectively. The reading frame determined codes for a protein of 886 aa.

Envelope-like retrotransposons in the plant kingdom: evidence of their presence in gymnosperms (Pinus pinaster).

PubMed

Miguel, Célia; Simões, Marta; Oliveira, Maria Margarida; Rocheta, Margarida

2008-11-01

Retroviruses differ from retrotransposons due to their infective capacity, which depends critically on the encoded envelope. Some plant retroelements contain domains reminiscent of the env of animal retroviruses but the number of such elements described to date is restricted to angiosperms. We show here the first evidence of the presence of putative env-like gene sequences in a gymnosperm species, Pinus pinaster (maritime pine). Using a degenerate primer approach for conserved domains of RNaseH gene, three clones from putative envelope-like retrotransposons (PpRT2, PpRT3, and PpRT4) were identified. The env-like sequences of P. pinaster clones are predicted to encode proteins with transmembrane domains. These sequences showed identity scores of up to 30% with env-like sequences belonging to different organisms. A phylogenetic analysis based on protein alignment of deduced aminoacid sequences revealed that these clones clustered with env-containing plant retrotransposons, as well as with retrotransposons from invertebrate organisms. The differences found among the sequences of maritime pine clones isolated here suggest the existence of different putative classes of env-like retroelements. The identification for the first time of env-like genes in a gymnosperm species may support the ancestrality of retroviruses among plants shedding light on their role in plant evolution.

Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

NASA Astrophysics Data System (ADS)

Su, Lei; Zhang, Qianqian; Gong, Jun

2017-07-01

Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

Distribution of sequence-based types of legionella pneumophila serogroup 1 strains isolated from cooling towers, hot springs, and potable water systems in China.

PubMed

Qin, Tian; Zhou, Haijian; Ren, Hongyu; Guan, Hong; Li, Machao; Zhu, Bingqing; Shao, Zhujun

2014-04-01

Legionella pneumophila serogroup 1 causes Legionnaires' disease. Water systems contaminated with Legionella are the implicated sources of Legionnaires' disease. This study analyzed L. pneumophila serogroup 1 strains in China using sequence-based typing. Strains were isolated from cooling towers (n = 96), hot springs (n = 42), and potable water systems (n = 26). Isolates from cooling towers, hot springs, and potable water systems were divided into 25 sequence types (STs; index of discrimination [IOD], 0.711), 19 STs (IOD, 0.934), and 3 STs (IOD, 0.151), respectively. The genetic variation among the potable water isolates was lower than that among cooling tower and hot spring isolates. ST1 was the predominant type, accounting for 49.4% of analyzed strains (n = 81), followed by ST154. With the exception of two strains, all potable water isolates (92.3%) belonged to ST1. In contrast, 53.1% (51/96) and only 14.3% (6/42) of cooling tower and hot spring, respectively, isolates belonged to ST1. There were differences in the distributions of clone groups among the water sources. The comparisons among L. pneumophila strains isolated in China, Japan, and South Korea revealed that similar clones (ST1 complex and ST154 complex) exist in these countries. In conclusion, in China, STs had several unique allelic profiles, and ST1 was the most prevalent sequence type of environmental L. pneumophila serogroup 1 isolates, similar to its prevalence in Japan and South Korea.

Cloning and characterization of a Prevotella melaninogenica hemolysin.

PubMed Central

Allison, H E; Hillman, J D

1997-01-01

Hemolysins have been proven to be important virulence factors in many medically relevant pathogenic organisms. Their production has also been implicated in the etiology of periodontal disease. Hemolytic strain 361B of Prevotella melaninogenica, a putative etiologic agent of periodontal disease, was used in this study. The cloning, sequencing, and characterization of phyA, the structural gene for a P. melaninogenica hemolysin, is described. No extensive sequence homology could be identified between phyA and any reported sequence at either the nucleotide or amino acid level. As predicted from sequence analysis, this gene produces a 39-kDa protein which has hemolytic activity as measured by zymogram analysis. Unlike many Ca2+-dependent bacterial hemolysins, both the cloned and native PhyA proteins were enhanced by the presence of EDTA in a dose-dependent fashion with 40 mM EDTA allowing maximum activity. Ca2+ and Mg2+ were found to be inhibitory. The hemolytic activity also was found to have a dose-dependent endpoint. Through recovery of hemolytic activity from a spent reaction, this endpoint was shown to be the result of end product inhibition. This is the first report describing the cloning and sequencing of a gene from P. melaninogenica. PMID:9199448

Cloning and characterization of a Prevotella melaninogenica hemolysin.

PubMed

Allison, H E; Hillman, J D

1997-07-01

Hemolysins have been proven to be important virulence factors in many medically relevant pathogenic organisms. Their production has also been implicated in the etiology of periodontal disease. Hemolytic strain 361B of Prevotella melaninogenica, a putative etiologic agent of periodontal disease, was used in this study. The cloning, sequencing, and characterization of phyA, the structural gene for a P. melaninogenica hemolysin, is described. No extensive sequence homology could be identified between phyA and any reported sequence at either the nucleotide or amino acid level. As predicted from sequence analysis, this gene produces a 39-kDa protein which has hemolytic activity as measured by zymogram analysis. Unlike many Ca2+-dependent bacterial hemolysins, both the cloned and native PhyA proteins were enhanced by the presence of EDTA in a dose-dependent fashion with 40 mM EDTA allowing maximum activity. Ca2+ and Mg2+ were found to be inhibitory. The hemolytic activity also was found to have a dose-dependent endpoint. Through recovery of hemolytic activity from a spent reaction, this endpoint was shown to be the result of end product inhibition. This is the first report describing the cloning and sequencing of a gene from P. melaninogenica.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells

PubMed Central

Gole, Jeff; Gore, Athurva; Richards, Andrew; Chiu, Yu-Jui; Fung, Ho-Lim; Bushman, Diane; Chiang, Hsin-I; Chun, Jerold; Lo, Yu-Hwa; Zhang, Kun

2013-01-01

Genome sequencing of single cells has a variety of applications, including characterizing difficult-to-culture microorganisms and identifying somatic mutations in single cells from mammalian tissues. A major hurdle in this process is the bias in amplifying the genetic material from a single cell, a procedure known as polymerase cloning. Here we describe the microwell displacement amplification system (MIDAS), a massively parallel polymerase cloning method in which single cells are randomly distributed into hundreds to thousands of nanoliter wells and simultaneously amplified for shotgun sequencing. MIDAS reduces amplification bias because polymerase cloning occurs in physically separated nanoliter-scale reactors, facilitating the de novo assembly of near-complete microbial genomes from single E. coli cells. In addition, MIDAS allowed us to detect single-copy number changes in primary human adult neurons at 1–2 Mb resolution. MIDAS will further the characterization of genomic diversity in many heterogeneous cell populations. PMID:24213699

Characterization of the Prokaryotic Diversity in Cold Saline Perennial Springs of the Canadian High Arctic▿

PubMed Central

Perreault, Nancy N.; Andersen, Dale T.; Pollard, Wayne H.; Greer, Charles W.; Whyte, Lyle G.

2007-01-01

The springs at Gypsum Hill and Colour Peak on Axel Heiberg Island in the Canadian Arctic originate from deep salt aquifers and are among the few known examples of cold springs in thick permafrost on Earth. The springs discharge cold anoxic brines (7.5 to 15.8% salts), with a mean oxidoreduction potential of −325 mV, and contain high concentrations of sulfate and sulfide. We surveyed the microbial diversity in the sediments of seven springs by denaturing gradient gel electrophoresis (DGGE) and analyzing clone libraries of 16S rRNA genes amplified with Bacteria and Archaea-specific primers. Dendrogram analysis of the DGGE banding patterns divided the springs into two clusters based on their geographic origin. Bacterial 16S rRNA clone sequences from the Gypsum Hill library (spring GH-4) were classified into seven phyla (Actinobacteria, Bacteroidetes, Firmicutes, Gemmatimonadetes, Proteobacteria, Spirochaetes, and Verrucomicrobia); Deltaproteobacteria and Gammaproteobacteria sequences represented half of the clone library. Sequences related to Proteobacteria (82%), Firmicutes (9%), and Bacteroidetes (6%) constituted 97% of the bacterial clone library from Colour Peak (spring CP-1). Most GH-4 archaeal clone sequences (79%) were related to the Crenarchaeota while half of the CP-1 sequences were related to orders Halobacteriales and Methanosarcinales of the Euryarchaeota. Sequences related to the sulfur-oxidizing bacterium Thiomicrospira psychrophila dominated both the GH-4 (19%) and CP-1 (45%) bacterial libraries, and 56 to 76% of the bacterial sequences were from potential sulfur-metabolizing bacteria. These results suggest that the utilization and cycling of sulfur compounds may play a major role in the energy production and maintenance of microbial communities in these unique, cold environments. PMID:17220254

A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence.

PubMed

Navarro, B; Daròs, J A; Flores, R

1996-01-01

Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.

Isolation and characterization of two overlapping cosmid clones from the 4q35 region, near the facioscapulohumeral muscular dystrophy locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deidda, G.; Grisanti, P.; Vigneti, E.

1994-09-01

The gene for facioscapulohumeral muscular dystrophy (FSHD) has been localized by linkage analysis to the 4q35 region. The most telomeric p13E-11 prove has been shown to detect 4q35 DNA rearrangements in both sporadic and familial cases of the disease. With the aim of constructing a detailed physical map of the 4q35 region and searching for the mutant gene, we used p13E-11 probe to isolate cosmid clones from a human genomic library in a pCos-EMBL 2 vector. Two positive clones were isolated, clones 3 and 5, which partially overlap and carry human genomic inserts of 42 and 45 kb, respectively. Themore » cosmids share a common region containing the p13E-11 region and a stretch of KpnI units consisting of 3.2 kb tandemly repeated sequences (about 10). The restriction maps were constructed using the following enzymes: Bam HI, BgIII, Eco RI, EcoRV, KpnI and Sfi I. Clone 3 extends 4 kb upstream of C5 and stops within the Kpn repeats. Clone 5 extends 4 kb downstream from the Kpn repeats and it presents an additional EcoRI site. Clone 5 contains a stretch of Kpn sequences of nearly 32 kb, corresponding to 10 Kpn repeats; clone 3 contains a stretch of 29 kb corresponding to 9 Kpn repeats, as determined by PFGE analysis of partial digestion of the clones. Clone 5 seems to contain the entire Eco RI region prone to rearrangements in FSHD patients. From clone 5 several subclones were obtained, from the Kpn region and from the region spanning from the last Kpn repeat to the cloning site. No single copy sequences were detected. Subclones from the 3{prime} end region contain beta-satellite or Sau3A-like sequences. In situ hybridization with the whole C5 cosmid shows hybridization signals at the tip of chromosome 4 (4q35) and chromosome 10 (10q26), in the pericentromeric region of chromosome 1 (1q12) and in the p12 region of the acrocentric chromosomes (chr. 21, 22, 13, 14, 15).« less

Persistence and evolution of allergen-specific IgE repertoires during subcutaneous specific immunotherapy

PubMed Central

Levin, Mattias; King, Jasmine J.; Glanville, Jacob; Jackson, Katherine J. L.; Looney, Timothy J.; Hoh, Ramona A.; Mari, Adriano; Andersson, Morgan; Greiff, Lennart; Fire, Andrew Z.; Boyd, Scott D.; Ohlin, Mats

2016-01-01

Background Specific immunotherapy (SIT) is the only treatment with proven long-term curative potential in allergic disease. Allergen-specific IgE is the causative agent of allergic disease, and antibodies contribute to SIT, but the effects of SIT on aeroallergen-specific B cell repertoires are not well understood. Objective To characterize the IgE sequences expressed by allergen-specific B cells, and track the fate of these B cell clones during SIT. Methods We have used high-throughput antibody gene sequencing and identification of allergen-specific IgE using combinatorial antibody fragment library technology to analyze immunoglobulin repertoires of blood and nasal mucosa of aeroallergen-sensitized individuals before and during the first year of subcutaneous SIT. Results Of 52 distinct allergen-specific IgE heavy chains from eight allergic donors, 37 were also detected by high-throughput antibody gene sequencing of blood, nasal mucosa, or both sample types. The allergen-specific clones had increased persistence, higher likelihood of belonging to clones expressing other switched isotypes, and possibly larger clone size than the rest of the IgE repertoire. Clone members in nasal tissue showed close mutational relationships. Conclusion Combining functional binding studies, deep antibody repertoire sequencing, and information on clinical outcomes in larger studies may in the future aid assessment of SIT mechanisms and efficacy. PMID:26559321

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA

PubMed Central

Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter

2009-01-01

Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

Treesearch

S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

2006-01-01

We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

PubMed

Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

2003-08-01

A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

Pseudomonas aeruginosa Population Structure Revisited

PubMed Central

Pirnay, Jean-Paul; Bilocq, Florence; Pot, Bruno; Cornelis, Pierre; Zizi, Martin; Van Eldere, Johan; Deschaght, Pieter; Vaneechoutte, Mario; Jennes, Serge; Pitt, Tyrone; De Vos, Daniel

2009-01-01

At present there are strong indications that Pseudomonas aeruginosa exhibits an epidemic population structure; clinical isolates are indistinguishable from environmental isolates, and they do not exhibit a specific (disease) habitat selection. However, some important issues, such as the worldwide emergence of highly transmissible P. aeruginosa clones among cystic fibrosis (CF) patients and the spread and persistence of multidrug resistant (MDR) strains in hospital wards with high antibiotic pressure, remain contentious. To further investigate the population structure of P. aeruginosa, eight parameters were analyzed and combined for 328 unrelated isolates, collected over the last 125 years from 69 localities in 30 countries on five continents, from diverse clinical (human and animal) and environmental habitats. The analysed parameters were: i) O serotype, ii) Fluorescent Amplified-Fragment Length Polymorphism (FALFP) pattern, nucleotide sequences of outer membrane protein genes, iii) oprI, iv) oprL, v) oprD, vi) pyoverdine receptor gene profile (fpvA type and fpvB prevalence), and prevalence of vii) exoenzyme genes exoS and exoU and viii) group I pilin glycosyltransferase gene tfpO. These traits were combined and analysed using biological data analysis software and visualized in the form of a minimum spanning tree (MST). We revealed a network of relationships between all analyzed parameters and non-congruence between experiments. At the same time we observed several conserved clones, characterized by an almost identical data set. These observations confirm the nonclonal epidemic population structure of P. aeruginosa, a superficially clonal structure with frequent recombinations, in which occasionally highly successful epidemic clones arise. One of these clones is the renown and widespread MDR serotype O12 clone. On the other hand, we found no evidence for a widespread CF transmissible clone. All but one of the 43 analysed CF strains belonged to a ubiquitous P. aeruginosa “core lineage” and typically exhibited the exoS +/exoU − genotype and group B oprL and oprD alleles. This is to our knowledge the first report of an MST analysis conducted on a polyphasic data set. PMID:19936230

DNA-based detection of the fungal pathogen Geomyces destructans in soil from bat hibernacula

USGS Publications Warehouse

Lindner, Daniel L.; Gargas, Andrea; Lorch, Jeffrey M.; Banik, Mark T.; Glaeser, Jessie; Kunz, Thomas H.; Blehert, David S.

2011-01-01

White-nose syndrome (WNS) is an emerging disease causing unprecedented morbidity and mortality among bats in eastern North America. The disease is characterized by cutaneous infection of hibernating bats by the psychrophilic fungus Geomyces destructans. Detection of G. destructans in environments occupied by bats will be critical for WNS surveillance, management and characterization of the fungal lifecycle. We initiated an rRNA gene region-based molecular survey to characterize the distribution of G. destructans in soil samples collected from bat hibernacula in the eastern United States with an existing PCR test. Although this test did not specifically detect G. destructans in soil samples based on a presence/absence metric, it did favor amplification of DNA from putative Geomyces species. Cloning and sequencing of PCR products amplified from 24 soil samples revealed 74 unique sequence variants representing 12 clades. Clones with exact sequence matches to G. destructans were identified in three of 19 soil samples from hibernacula in states where WNS is known to occur. Geomyces destructans was not identified in an additional five samples collected outside the region where WNS has been documented. This study highlights the diversity of putative Geomyces spp. in soil from bat hibernacula and indicates that further research is needed to better define the taxonomy of this genus and to develop enhanced diagnostic tests for rapid and specific detection of G. destructans in environmental samples.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Diversity of nifH gene pools in the rhizosphere of two cultivars of sorghum (Sorghum bicolor) treated with contrasting levels of nitrogen fertilizer.

PubMed

Coelho, Marcia Reed Rodrigues; de Vos, Marjon; Carneiro, Newton Portilho; Marriel, Ivanildo Evódio; Paiva, Edilson; Seldin, Lucy

2008-02-01

The diversity of nitrogen-fixing bacteria was assessed in the rhizospheres of two cultivars of sorghum (IS 5322-C and IPA 1011) sown in Cerrado soil amended with two levels of nitrogen fertilizer (12 and 120 kg ha(-1)). The nifH gene was amplified directly from DNA extracted from the rhizospheres, and the PCR products cloned and sequenced. Four clone libraries were generated from the nifH fragments and 245 sequences were obtained. Most of the clones (57%) were closely related to nifH genes of uncultured bacteria. NifH clones affiliated with Azohydromonas spp., Ideonella sp., Rhizobium etli and Bradyrhizobium sp. were found in all libraries. Sequences affiliated with Delftia tsuruhatensis were found in the rhizosphere of both cultivars sown with high levels of nitrogen, while clones affiliated with Methylocystis sp. were detected only in plants sown under low levels of nitrogen. Moreover, clones affiliated with Paenibacillus durus could be found in libraries from the cultivar IS 5322-C sown either in high or low amounts of fertilizer. This study showed that the amount of nitrogen used for fertilization is the overriding determinative factor that influenced the nitrogen-fixing community structures in sorghum rhizospheres cultivated in Cerrado soil.

Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes.

PubMed Central

Trapani, J A; Klein, J L; White, P C; Dupont, B

1988-01-01

A cDNA clone encoding a human serine esterase gene was isolated from a library constructed from poly(A)+ RNA of allogeneically stimulated, interleukin 2-expanded peripheral blood mononuclear cells. The clone, designated HSE26.1, represents a full-length copy of a 0.9-kilobase mRNA present in human cytotoxic cells but absent from a wide variety of noncytotoxic cell lines. Clone HSE26.1 contains an 892-base-pair sequence, including a single 741-base-pair open reading frame encoding a putative 247-residue polypeptide. The first 20 amino acids of the polypeptide form a leader sequence. The mature protein is predicted to have an unglycosylated Mr of approximately equal to 26,000 and contains a single potential site for N-linked glycosylation. The nucleotide and predicted amino acid sequences of clone HSE26.1 are homologous with all murine and human serine esterases cloned thus far but are most similar to mouse granzyme B (70% nucleotide and 68% amino acid identity). HSE26.1 protein is expressed weakly in unstimulated peripheral blood mononuclear cells but is strongly induced within 6-hr incubation in medium containing phytohemagglutinin. The data suggest that the protein encoded by HSE26.1 plays a role in cell-mediated cytotoxicity. Images PMID:3261871

[Isolation of ABA-regulated genes in Oryza sativa through fluorescent differential display PCR (FDD-PCR)].

PubMed

Xu, Shou Ling; Shen, Si Shi; Xu, Zhi Hong; Xue, Hong Wei

2002-12-01

Abscisic acid (ABA) was critical in plant seed development and response to environmental factors such as stress situations. To study the possible ABA related signaling transduction pathways, we tried to isolate the ABA-regulated genes through fluorescent differential display PCR (FDD-PCR) technology using rice seedling as materials (treated with ABA for 2, 4, 8 and 12h). In the 17 fragments isolated, 14 and 3 clones were up-and down-regulated respectively. Sequence analyses revealed that the encoded proteins were involved in photosynthesis (7 fragments), signal transduction (1 fragments), transcription (2 fragments), metabolism and resistance (6 fragments), and unknown protein (1 fragments). 3 clones, encoding putative alpha/beta hydrolase fold, putative vacuolar H+ -ATPase B subunit, putative tyrosine phosphatase, were confirmed to be regulated under ABA treatment by RT-PCR and northern blot analysis. FDD-PCR and possible functional mechanisms of ABA were discussed.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1991-01-21

bisphosphate carboxylase ( RubisCO ) from symbiotic bacteria of various origins, b) To continue methods development for 16S rRNA sequencing from symbionts in...frozen and badly preserved specimens, and c) To use these new techniques to sequence 16s DNA from a variety of symbionts a) RubisCO We have cloned the...gene coding for RubisCO from the sulfur oxidixing symbiont of the gastropod Alvinochoncha hessleri. Nucleotide sequence analysis of the cloned fragment

Crotoxin: Structural Studies, Mechanism of Action and Cloning of Its Gene

DTIC Science & Technology

1987-03-01

other venoms and examine their toxin neutral- izing ability. The amino acid sequences of both crotoxin subunits were determined Is a prelude to cloning...be examined for their potential as anti-idiotype vaccines The complete amino acid sequence of the basic subunit and two of the three dic subunit chains...of crotoxin from the venom of C.d. terrificus has been de rmined. Sequence comparison data suggest that the non-toxic, acidic subunit was derived

A maize map standard with sequenced core markers, grass genome reference points and 932 expressed sequence tagged sites (ESTs) in a 1736-locus map.

PubMed Central

Davis, G L; McMullen, M D; Baysdorfer, C; Musket, T; Grant, D; Staebell, M; Xu, G; Polacco, M; Koster, L; Melia-Hancock, S; Houchins, K; Chao, S; Coe, E H

1999-01-01

We have constructed a 1736-locus maize genome map containing1156 loci probed by cDNAs, 545 probed by random genomic clones, 16 by simple sequence repeats (SSRs), 14 by isozymes, and 5 by anonymous clones. Sequence information is available for 56% of the loci with 66% of the sequenced loci assigned functions. A total of 596 new ESTs were mapped from a B73 library of 5-wk-old shoots. The map contains 237 loci probed by barley, oat, wheat, rice, or tripsacum clones, which serve as grass genome reference points in comparisons between maize and other grass maps. Ninety core markers selected for low copy number, high polymorphism, and even spacing along the chromosome delineate the 100 bins on the map. The average bin size is 17 cM. Use of bin assignments enables comparison among different maize mapping populations and experiments including those involving cytogenetic stocks, mutants, or quantitative trait loci. Integration of nonmaize markers in the map extends the resources available for gene discovery beyond the boundaries of maize mapping information into the expanse of map, sequence, and phenotype information from other grass species. This map provides a foundation for numerous basic and applied investigations including studies of gene organization, gene and genome evolution, targeted cloning, and dissection of complex traits. PMID:10388831

High Bacterial Diversity in Permanently Cold Marine Sediments

PubMed Central

Ravenschlag, Katrin; Sahm, Kerstin; Pernthaler, Jakob; Amann, Rudolf

1999-01-01

A 16S ribosomal DNA (rDNA) clone library from permanently cold marine sediments was established. Screening 353 clones by dot blot hybridization with group-specific oligonucleotide probes suggested a predominance of sequences related to bacteria of the sulfur cycle (43.4% potential sulfate reducers). Within this fraction, the major cluster (19.0%) was affiliated with Desulfotalea sp. and other closely related psychrophilic sulfate reducers isolated from the same habitat. The cloned sequences showed between 93 and 100% similarity to these bacteria. Two additional groups were frequently encountered: 13% of the clones were related to Desulfuromonas palmitatis, and a second group was affiliated with Myxobacteria spp. and Bdellovibrio spp. Many clones (18.1%) belonged to the γ subclass of the class Proteobacteria and were closest to symbiotic or free-living sulfur oxidizers. Probe target groups were further characterized by amplified rDNA restriction analysis to determine diversity within the groups and within the clone library. Rarefaction analysis suggested that the total diversity assessed by 16S rDNA analysis was very high in these permanently cold sediments and was only partially revealed by screening of 353 clones. PMID:10473405

Trypanosoma cruzi Clone Dm28c Draft Genome Sequence

PubMed Central

Grisard, Edmundo Carlos; Teixeira, Santuza Maria Ribeiro; de Almeida, Luiz Gonzaga Paula; Stoco, Patricia Hermes; Gerber, Alexandra Lehmkuhl; Talavera-López, Carlos; Lima, Oberdan Cunha; Andersson, Björn

2014-01-01

Trypanosoma cruzi affects millions of people worldwide. Clinical variability of Chagas disease can be due to the genetic variability of this parasite, requiring further genome studies. Here we report the genome sequence of the T. cruzi Dm28c clone (TcI), a strain related to the sylvatic cycle of the parasite. PMID:24482508

Asymmetric single-strand polymorphism: an accurate and cost-effective method to amplify and sequence allelic variants

USDA-ARS?s Scientific Manuscript database

We needed to obtain an alternative to conventional cloning to generate high-quality DNA sequences from a variety of nuclear orthologs for phylogenetic studies in potato, to save time and money and to avoid problems typically encountered in cloning. We tested a variety of SSCP protocols to include pu...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

PubMed

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Cloning

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Bacteria Community in the Terrestrial Deep Subsurface Microbiology Research of the Chinese Continent Scientific Drilling

NASA Astrophysics Data System (ADS)

Wang, Y.; Xia, Y.; Dong, H.; Dong, X.; Yang, K.; Dong, Z.; Huang, L.

2005-12-01

Microbial communities in the deep drill cores from the Chinese Continent Scientific Drilling were analyzed with culture-independent and dependent techniques. Genomic DNA was extracted from two metamorphic rocks: S1 from 430 and S13 from 1033 meters below the ground surface. The 16S rRNA gene was amplified by polymerase chain reaction (PCR) followed by cloning and sequencing. The total cell number was counted using the 4',6-diamidino-2-phenylindole (DAPI) staining and biomass of two specific bacteria were quantified using real-time PCR. Enrichment was set up for a rock from 3911 meters below the surface in medium for authotrophic methanogens (i.e., CO2 + H2). The total cell number in S13 was 1.0 × 104 cells per gram of rock. 16S rRNA gene analysis indicated that low G + C Gram positive sequences were dominant (50 percent of all 54 clone sequenced) followed by the alpha-, beta, and gamma-Proteobacteria. Within the low G + C Gram positive bacteria, most clone sequences were similar to species of Bacillus from various natural environments (deserts, rivers etc.). Within the Proteobacteria, our clone sequences were similar to species of Acinetobacter, Acidovorax, and Aeromonas. The RT-RCP results showed that biomass of two particular clone sequences (CCSD1305, similar to Aeromonas caviae and CCSD1307, similar to Acidovorax facilis) was 95 and 1258 cells/g, respectively. A bacterial isolate was obtained from the 3911-m rock in methanogenic medium. It was Gram negative with no flagella, immobile, and facultative anaerobic, and grows optimally at 65oC. Phylogenetic analysis indicated that it was closely related to the genus of Bacillus. Physiological tests further revealed that it was a strain of Bacillus caldotenax.

Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

PubMed

Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

2004-05-01

Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

(Mechanisms of inhibition of viral replication in plants): Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palukaitis, P.

1988-01-01

The genome of cucumber virus (CMV) was cloned and about 300 clones were obtained that contained CMV sequences. These were further subdivided into clones that were derived from RNAs 3 and 4, and those that were not, and thus represented RNAs 1 and 2.

[Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].

PubMed

Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao

2013-02-01

The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains.

[Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

PubMed

Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

2007-02-01

To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

PubMed Central

Throop, Andrea L.; LaBaer, Joshua

2015-01-01

The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

Polynucleobacter bacteria in the brackish-water species Euplotes harpa (Ciliata Hypotrichia).

PubMed

Vannini, Claudia; Petroni, Giulio; Verni, Franco; Rosati, Giovanna

2005-01-01

We have found a Polynucleobacter bacterium in the cytoplasm of Euplotes harpa, a species living in a brackish-water habitat, with a cirral pattern not corresponding to that of the freshwater Euplotes species known to harbor this type of bacteria. The symbiont has been found in three strains of the species, obtained by clonal cultures from ciliates collected in different geographic regions. The 16S rRNA gene sequence of this bacterium identifies it as a member of the beta-proteobacterial genus Polynucleobacter. This sequence shares a high similarity value (98.4-98.5%) with P. necessarius, the type species of the genus, and is associated with 16S rRNA gene sequences of environmental clones and bacterial strains included in the Polynucleobacter cluster (>95%). An oligonucleotide probe was designed to corroborate the assignment of the retrieved sequence to the symbiont and to detect similar bacteria rapidly. Antibiotic experiments showed that the elimination of the bacteria stops the reproductive cycle in E. harpa, as has been shown for the freshwater Euplotes species.

Cloning the Gravity and Shear Stress Related Genes from MG-63 Cells by Subtracting Hybridization

NASA Astrophysics Data System (ADS)

Zhang, Shu; Dai, Zhong-quan; Wang, Bing; Cao, Xin-sheng; Li, Ying-hui; Sun, Xi-qing

2008-06-01

Background The purpose of the present study was to clone the gravity and shear stress related genes from osteoblast-like human osteosarcoma MG-63 cells by subtractive hybridization. Method MG-63 cells were divided into two groups (1G group and simulated microgravity group). After cultured for 60 h in two different gravitational environments, two groups of MG-63 cells were treated with 1.5Pa fluid shear stress (FSS) for 60 min, respectively. The total RNA in cells was isolated. The gravity and shear stress related genes were cloned by subtractive hybridization. Result 200 clones were gained. 30 positive clones were selected using PCR method based on the primers of vector and sequenced. The obtained sequences were analyzed by blast. changes of 17 sequences were confirmed by RT-PCR and these genes are related to cell proliferation, cell differentiation, protein synthesis, signal transduction and apoptosis. 5 unknown genes related to gravity and shear stress were found. Conclusion In this part of our study, our result indicates that simulated microgravity may change the activities of MG-63 cells by inducing the functional alterations of specific genes.

Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt.

PubMed

Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; El-Mahallawy, Hadir Ahmed; Amin, Magdy Aly; El Din Ashour, Seif

2015-03-12

Pseudomonas aeruginosa is an important nosocomial pathogen, commonly causing infections in immunocompromised patients. The aim of this study was to examine the genetic relatedness of metallo-beta-lactamase (MBL) producing carbapenem resistant Pseudomonas aeruginosa clinical isolates collected from 2 tertiary hospitals in Cairo, Egypt using Multi Locus sequence typing (MLST). Phenotypic and genotypic detection of metallo-beta-lactamase for forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were carried out. DNA sequencing and MLST were done. The bla VIM-2 gene was highly prevalent (28/33 strains, 85%) among 33 MBL-positive P.aeruginosa isolates. MLST revealed eleven distinct Sequence Types (STs). A unique ST233 clone producing VIM-2 was documented by MLST in P.aeruginosa strains isolated from Cairo university hospitals. The high prevalence of VIM-2 producers was not due to the spread of a single clone. The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones.

Molecular Identification of Ectomycorrhizal Mycelium in Soil Horizons

PubMed Central

Landeweert, Renske; Leeflang, Paula; Kuyper, Thom W.; Hoffland, Ellis; Rosling, Anna; Wernars, Karel; Smit, Eric

2003-01-01

Molecular identification techniques based on total DNA extraction provide a unique tool for identification of mycelium in soil. Using molecular identification techniques, the ectomycorrhizal (EM) fungal community under coniferous vegetation was analyzed. Soil samples were taken at different depths from four horizons of a podzol profile. A basidiomycete-specific primer pair (ITS1F-ITS4B) was used to amplify fungal internal transcribed spacer (ITS) sequences from total DNA extracts of the soil horizons. Amplified basidiomycete DNA was cloned and sequenced, and a selection of the obtained clones was analyzed phylogenetically. Based on sequence similarity, the fungal clone sequences were sorted into 25 different fungal groups, or operational taxonomic units (OTUs). Out of 25 basidiomycete OTUs, 7 OTUs showed high nucleotide homology (≥99%) with known EM fungal sequences and 16 were found exclusively in the mineral soil. The taxonomic positions of six OTUs remained unclear. OTU sequences were compared to sequences from morphotyped EM root tips collected from the same sites. Of the 25 OTUs, 10 OTUs had ≥98% sequence similarity with these EM root tip sequences. The present study demonstrates the use of molecular techniques to identify EM hyphae in various soil types. This approach differs from the conventional method of EM root tip identification and provides a novel approach to examine EM fungal communities in soil. PMID:12514012

Molecular analysis of the microbial diversity present in the colonic wall, colonic lumen, and cecal lumen of a pig.

PubMed

Pryde, S E; Richardson, A J; Stewart, C S; Flint, H J

1999-12-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined.

Molecular Analysis of the Microbial Diversity Present in the Colonic Wall, Colonic Lumen, and Cecal Lumen of a Pig

PubMed Central

Pryde, Susan E.; Richardson, Anthony J.; Stewart, Colin S.; Flint, Harry J.

1999-01-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined. PMID:10583991

Differences in expression of retinal pigment epithelium mRNA between normal canines

PubMed Central

2004-01-01

Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

Cloning and Characterization of the Pyrrolomycin Biosynthetic Gene Clusters from Actinosporangium vitaminophilum ATCC 31673 and Streptomyces sp. Strain UC 11065▿

PubMed Central

Zhang, Xiujun; Parry, Ronald J.

2007-01-01

The pyrrolomycins are a family of polyketide antibiotics, some of which contain a nitro group. To gain insight into the nitration mechanism associated with the formation of these antibiotics, the pyrrolomycin biosynthetic gene cluster from Actinosporangium vitaminophilum was cloned. Sequencing of ca. 56 kb of A. vitaminophilum DNA revealed 35 open reading frames (ORFs). Sequence analysis revealed a clear relationship between some of these ORFs and the biosynthetic gene cluster for pyoluteorin, a structurally related antibiotic. Since a gene transfer system could not be devised for A. vitaminophilum, additional proof for the identity of the cloned gene cluster was sought by cloning the pyrrolomycin gene cluster from Streptomyces sp. strain UC 11065, a transformable pyrrolomycin producer. Sequencing of ca. 26 kb of UC 11065 DNA revealed the presence of 17 ORFs, 15 of which exhibit strong similarity to ORFs in the A. vitaminophilum cluster as well as a nearly identical organization. Single-crossover disruption of two genes in the UC 11065 cluster abolished pyrrolomycin production in both cases. These results confirm that the genetic locus cloned from UC 11065 is essential for pyrrolomycin production, and they also confirm that the highly similar locus in A. vitaminophilum encodes pyrrolomycin biosynthetic genes. Sequence analysis revealed that both clusters contain genes encoding the two components of an assimilatory nitrate reductase. This finding suggests that nitrite is required for the formation of the nitrated pyrrolomycins. However, sequence analysis did not provide additional insights into the nitration process, suggesting the operation of a novel nitration mechanism. PMID:17158935

Whole-Genome Sequence of Coxiella burnetii Nine Mile RSA439 (Phase II, Clone 4), a Laboratory Workhorse Strain

PubMed Central

Beare, Paul A.; Moses, Abraham S.; Martens, Craig A.; Heinzen, Robert A.

2017-01-01

ABSTRACT Here, we report the whole-genome sequence of Coxiella burnetii Nine Mile RSA439 (phase II, clone 4), a laboratory strain used extensively to investigate the biology of this intracellular bacterial pathogen. The genome consists of a 1.97-Mb chromosome and a 37.32-kb plasmid. PMID:28596399

Whole-Genome Sequence of Coxiella burnetii Nine Mile RSA439 (Phase II, Clone 4), a Laboratory Workhorse Strain.

PubMed

Millar, Jess A; Beare, Paul A; Moses, Abraham S; Martens, Craig A; Heinzen, Robert A; Raghavan, Rahul

2017-06-08

Here, we report the whole-genome sequence of Coxiella burnetii Nine Mile RSA439 (phase II, clone 4), a laboratory strain used extensively to investigate the biology of this intracellular bacterial pathogen. The genome consists of a 1.97-Mb chromosome and a 37.32-kb plasmid. Copyright © 2017 Millar et al.

Hypervirulent Clone of Group B Streptococcus Serotype III Sequence Type 283, Hong Kong, 1993–2012

PubMed Central

Ang, Irene; Fung, Kitty; Liyanapathirana, Veranja; Luo, Ming Jing; Lai, Raymond

2016-01-01

We describe a hypervirulent clone of group B Streptococcus serotype III, subtype 4, sequence type 283, that caused invasive disease with a predilection for meningitis in Hong Kong during 1993–2012. The organism is associated with high mortality and increased summer prevalence and is linked to diseased fish from freshwater fish farms. PMID:27648702

Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

PubMed

Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

2000-10-06

Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

Genetics of bacteria that utilize one carbon compounds: Final report, March 1, 1982-February 29, 1988

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanson, R.S.

Broad host range plasmid vectors useful for cloning genes from bacteria that grow on methane and methanol were constructed. We have cloned and mapped nineteen genes required for the growth of Methylobacterium organophilum strain XX on methanol. Nineteen genes were found in seven linkage groups on the M. organophilum genome and were separated by 40 kb or more. Eleven genes were required for the synthesis of methanol dehydrogenase (MDH) and were located in three unlinked gene clusters. The MDH structural gene was localized on a 2.5 kb DNA fragment. The gene was sequenced and contains a 175 bp untranslated leadermore » sequence, a signal sequence and the structural gene. MDH messenger RNA (mRNA) has a half life of approximately 20 min. and is present at approximately 2% of the cellular mRNA. The structural gene for the ..gamma.. subunit of methane monoxygenases has been cloned from Methylosporovibrio. Methane monooxygenase subunits have been purified by Prof. J. Lipscomb's laboratory and are being sequenced to construct DNA probes to identify cloned subunit genes. New facultative methylotrophic bacteria were isolated and characterized. Several amino acid auxotrophs have been isolated. 11 refs.« less

Reduced randomness in quantum cryptography with sequences of qubits encoded in the same basis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lamoureux, L.-P.; Cerf, N. J.; Bechmann-Pasquinucci, H.

2006-03-15

We consider the cloning of sequences of qubits prepared in the states used in the BB84 or six-state quantum cryptography protocol, and show that the single-qubit fidelity is unaffected even if entire sequences of qubits are prepared in the same basis. This result is only valid provided that the sequences are much shorter than the total key. It is of great importance for practical quantum cryptosystems because it reduces the need for high-speed random number generation without impairing on the security against finite-size cloning attacks.

Analysis of a diverse assemblage of diazotrophic bacteria from Spartina alterniflora using DGGE and clone library screening.

PubMed

Lovell, Charles R; Decker, Peter V; Bagwell, Christopher E; Thompson, Shelly; Matsui, George Y

2008-05-01

Methods to assess the diversity of the diazotroph assemblage in the rhizosphere of the salt marsh cordgrass, Spartina alterniflora were examined. The effectiveness of nifH PCR-denaturing gradient gel electrophoresis (DGGE) was compared to that of nifH clone library analysis. Seventeen DGGE gel bands were sequenced and yielded 58 nonidentical nifH sequences from a total of 67 sequences determined. A clone library constructed using the GC-clamp nifH primers that were employed in the PCR-DGGE (designated the GC-Library) yielded 83 nonidentical sequences from a total of 257 nifH sequences. A second library constructed using an alternate set of nifH primers (N-Library) yielded 83 nonidentical sequences from a total of 138 nifH sequences. Rarefaction curves for the libraries did not reach saturation, although the GC-Library curve was substantially dampened and appeared to be closer to saturation than the N-Library curve. Phylogenetic analyses showed that DGGE gel band sequencing recovered nifH sequences that were frequently sampled in the GC-Library, as well as sequences that were infrequently sampled, and provided a species composition assessment that was robust, efficient, and relatively inexpensive to obtain. Further, the DGGE method permits a large number of samples to be examined for differences in banding patterns, after which bands of interest can be sampled for sequence determination.

Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

PubMed Central

Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

1990-01-01

Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

Feasibility of physical map construction from fingerprinted bacterial artificial chromosome libraries of polyploid plant species

PubMed Central

2010-01-01

Background The presence of closely related genomes in polyploid species makes the assembly of total genomic sequence from shotgun sequence reads produced by the current sequencing platforms exceedingly difficult, if not impossible. Genomes of polyploid species could be sequenced following the ordered-clone sequencing approach employing contigs of bacterial artificial chromosome (BAC) clones and BAC-based physical maps. Although BAC contigs can currently be constructed for virtually any diploid organism with the SNaPshot high-information-content-fingerprinting (HICF) technology, it is currently unknown if this is also true for polyploid species. It is possible that BAC clones from orthologous regions of homoeologous chromosomes would share numerous restriction fragments and be therefore included into common contigs. Because of this and other concerns, physical mapping utilizing the SNaPshot HICF of BAC libraries of polyploid species has not been pursued and the possibility of doing so has not been assessed. The sole exception has been in common wheat, an allohexaploid in which it is possible to construct single-chromosome or single-chromosome-arm BAC libraries from DNA of flow-sorted chromosomes and bypass the obstacles created by polyploidy. Results The potential of the SNaPshot HICF technology for physical mapping of polyploid plants utilizing global BAC libraries was evaluated by assembling contigs of fingerprinted clones in an in silico merged BAC library composed of single-chromosome libraries of two wheat homoeologous chromosome arms, 3AS and 3DS, and complete chromosome 3B. Because the chromosome arm origin of each clone was known, it was possible to estimate the fidelity of contig assembly. On average 97.78% or more clones, depending on the library, were from a single chromosome arm. A large portion of the remaining clones was shown to be library contamination from other chromosomes, a feature that is unavoidable during the construction of single-chromosome BAC libraries. Conclusions The negligibly low level of incorporation of clones from homoeologous chromosome arms into a contig during contig assembly suggested that it is feasible to construct contigs and physical maps using global BAC libraries of wheat and almost certainly also of other plant polyploid species with genome sizes comparable to that of wheat. Because of the high purity of the resulting assembled contigs, they can be directly used for genome sequencing. It is currently unknown but possible that equally good BAC contigs can be also constructed for polyploid species containing smaller, more gene-rich genomes. PMID:20170511

The population structure of Vibrio cholerae from the Chandigarh Region of Northern India.

PubMed

Abd El Ghany, Moataz; Chander, Jagadish; Mutreja, Ankur; Rashid, Mamoon; Hill-Cawthorne, Grant A; Ali, Shahjahan; Naeem, Raeece; Thomson, Nicholas R; Dougan, Gordon; Pain, Arnab

2014-07-01

Cholera infection continues to be a threat to global public health. The current cholera pandemic associated with Vibrio cholerae El Tor has now been ongoing for over half a century. Thirty-eight V. cholerae El Tor isolates associated with a cholera outbreak in 2009 from the Chandigarh region of India were characterised by a combination of microbiology, molecular typing and whole-genome sequencing. The genomic analysis indicated that two clones of V. cholera circulated in the region and caused disease during this time. These clones fell into two distinct sub-clades that map independently onto wave 3 of the phylogenetic tree of seventh pandemic V. cholerae El Tor. Sequence analyses of the cholera toxin gene, the Vibrio seventh Pandemic Island II (VSPII) and SXT element correlated with this phylogenetic position of the two clades on the El Tor tree. The clade 2 isolates, characterized by a drug-resistant profile and the expression of a distinct cholera toxin, are closely related to the recent V. cholerae isolated elsewhere, including Haiti, but fell on a distinct branch of the tree, showing they were independent outbreaks. Multi-Locus Sequence Typing (MLST) distinguishes two sequence types among the 38 isolates, that did not correspond to the clades defined by whole-genome sequencing. Multi-Locus Variable-length tandem-nucleotide repeat Analysis (MLVA) identified 16 distinct clusters. The use of whole-genome sequencing enabled the identification of two clones of V. cholerae that circulated during the 2009 Chandigarh outbreak. These clones harboured a similar structure of ICEVchHai1 but differed mainly in the structure of CTX phage and VSPII. The limited capacity of MLST and MLVA to discriminate between the clones that circulated in the 2009 Chandigarh outbreak highlights the value of whole-genome sequencing as a route to the identification of further genetic markers to subtype V. cholerae isolates.

Citrus and Prunuscopia-like retrotransposons.

PubMed

Asíns, M J; Monforte, A J; Mestre, P F; Carbonell, E A

1999-08-01

Many of the world's most important citrus cultivars ("Washington Navel", satsumas, clementines) have arisen through somatic mutation. This phenomenon occurs fairly often in the various species and varieties of the genus.The presence of copia-like retrotransposons has been investigated in fruit trees, especially citrus, by using a PCR assay designed to detect copia-like reverse transcriptase (RT) sequences. Amplification products from a genotype of each the following species Citrus sinensis, Citrus grandis, Citrus clementina, Prunus armeniaca and Prunus amygdalus, were cloned and some of them sequenced. Southern-blot hybridization using RT clones as probes showed that multiple copies are integrated throughout the citrus genome, while only 1-3 copies are detected in the P. armeniaca genome, which is in accordance with the Citrus and Prunus genome sizes. Sequence analysis of RT clones allowed a search for homologous sequences within three gene banks. The most similar ones correspond to RT domains of copia-like retrotransposons from unrelated plant species. Cluster analysis of these sequences has shown a great heterogeneity among RT domains cloned from the same genotype. This finding supports the hypothesis that horizontal transmission of retrotransposons has occurred in the past. The species presenting a RT sequence most similar to citrus RT clones is Gnetum montanum, a gymnosperm whose distribution area coincides with two of the main centers of origin of Citrus spp. A new C-methylated restriction DNA fragment containing a RT sequence is present in navel sweet oranges, but not in Valencia oranges from which the former originated suggesting, that retrotransposon activity might be, at least in part, involved in the genetic variability among sweet orange cultivars. Given that retrotransposons are quite abundant throughout the citrus genome, their activity should be investigated thoroughly before commercializing any transgenic citrus plant where the transgene(s) is part of a viral genome in order to avoid its possible recombination with an active retroelement. Focusing on other strategies to control virus diseases is recommended in citrus.

Clones from a shooty tobacco crown gall tumor I: deletions, rearrangements and amplifications resulting in irregular T-DNA structures and organizations.

PubMed

Peerbolte, R; Leenhouts, K; Hooykaas-van Slogteren, G M; Hoge, J H; Wullems, G J; Schilperoort, R A

1986-07-01

Transformed clones from a shooty tobacco crown gall tumor, induced byAgrobacterium tumefaciens strain LBA1501, having a Tn1831 insertion in the auxin locus, were investigated for their T-DNA structure and expression. In addition to clones with the expected phenotype, i.e. phytohormone autonomy, regeneration of non-rooting shoots and octopine synthesis (Aut(+)Reg(+)Ocs(+) 'type I' clones), clones were obtained with an aberrant phenotype. Among these were the Aut(-)Reg(-)Ocs(+) 'type II' clones. Two shooty type I clones and three type II callus clones (all randomly chosen) as well as a rooting shoot regenerated from a type II clone via a high kinetin treatment, all had a T-DNA structure which differed significantly from 'regular' T-DNA structures. No Tn1831 DNA sequences were detected in these clones. The two type I clones were identical: they both contained the same highly truncated T-DNA segments. One TL-DNA segment of approximately 0.7 kb, originating form the left part of the TL-region, was present at one copy per diploid tobacco genome. Another segment with a maximum size of about 7 kb was derived from the right hand part of the TL-region and was present at minimally two copies. Three copies of a truncated TR-DNA segment were detected, probably starting at the right TR-DNA border repeat and ending halfway the regular TR-region. Indications have been obtained that at least some of the T-DNA segments are closely linked, sometimes via intervening plant DNA sequences. The type I clones harbored TL-DNA transcripts 4, 6a/b and 3 as well as TR-DNA transcript 0'. The type II clones harbored three to six highly truncated T-DNA segments, originating from the right part of the TL-region. In addition they had TR-DNA segments, similar to those of the type I clones. On Northern blots TR-DNA transcripts 0' and 1' were detected as well as the TL-DNA transcripts 3 and 6a/b and an 1800 bp hybrid transcript (tr.Y) containing gene 6b sequences. Possible origins of the observed irregularities in T-DNA structures are discussed in relation to fidelity of transformation of plant cells viaAgrobacterium.

Successful application of FTA Classic Card technology and use of bacteriophage phi29 DNA polymerase for large-scale field sampling and cloning of complete maize streak virus genomes.

PubMed

Owor, Betty E; Shepherd, Dionne N; Taylor, Nigel J; Edema, Richard; Monjane, Adérito L; Thomson, Jennifer A; Martin, Darren P; Varsani, Arvind

2007-03-01

Leaf samples from 155 maize streak virus (MSV)-infected maize plants were collected from 155 farmers' fields in 23 districts in Uganda in May/June 2005 by leaf-pressing infected samples onto FTA Classic Cards. Viral DNA was successfully extracted from cards stored at room temperature for 9 months. The diversity of 127 MSV isolates was analysed by PCR-generated RFLPs. Six representative isolates having different RFLP patterns and causing either severe, moderate or mild disease symptoms, were chosen for amplification from FTA cards by bacteriophage phi29 DNA polymerase using the TempliPhi system. Full-length genomes were inserted into a cloning vector using a unique restriction enzyme site, and sequenced. The 1.3-kb PCR product amplified directly from FTA-eluted DNA and used for RFLP analysis was also cloned and sequenced. Comparison of cloned whole genome sequences with those of the original PCR products indicated that the correct virus genome had been cloned and that no errors were introduced by the phi29 polymerase. This is the first successful large-scale application of FTA card technology to the field, and illustrates the ease with which large numbers of infected samples can be collected and stored for downstream molecular applications such as diversity analysis and cloning of potentially new virus genomes.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

Phylogenetic diversity of bacteria associated with Paleolithic paintings and surrounding rock walls in two Spanish caves (Llonín and La Garma).

PubMed

Schabereiter-Gurtner, Claudia; Saiz-Jimenez, Cesareo; Piñar, Guadalupe; Lubitz, Werner; Rölleke, Sabine

2004-02-01

Bacterial diversity in caves is still rarely investigated using culture-independent techniques. In the present study, bacterial communities on Paleolithic paintings and surrounding rock walls in two Spanish caves (Llonín and La Garma) were analyzed, using 16S rDNA-based denaturing gradient gel electrophoresis community fingerprinting and phylogenetic analyses without prior cultivation. Results revealed complex bacterial communities consisting of a high number of novel 16S rDNA sequence types and indicated a high biodiversity of lithotrophic and heterotrophic bacteria. Identified bacteria were related to already cultured bacteria (39 clones) and to environmental 16S rDNA clones (46 clones). The nearest phylogenetic relatives were members of the Proteobacteria (41.1%), of the Acidobacterium division (16.5%), Actinobacteria (20%), Firmicutes (10.6%), of the Cytophaga/Flexibacter/Bacteroides division (5.9%), Nitrospira group (3.5%), green non-sulfur bacteria (1.2%), and candidate WS3 division (1.2%). Thirteen of these clones were most closely related to those obtained from the previous studies on Tito Bustillo Cave. The comparison of the present data with the data obtained previously from Altamira and Tito Bustillo Caves revealed similarities in the bacterial community components, especially in the high abundance of the Acidobacteria and Rhizobiaceae, and in the presence of bacteria related to ammonia and sulfur oxidizers.

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

PubMed

Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

1998-07-01

The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

Highly Efficient CRISPR/Cas9-Mediated Cloning and Functional Characterization of Gastric Cancer-Derived Epstein-Barr Virus Strains.

PubMed

Kanda, Teru; Furuse, Yuki; Oshitani, Hitoshi; Kiyono, Tohru

2016-05-01

The Epstein-Barr virus (EBV) is etiologically linked to approximately 10% of gastric cancers, in which viral genomes are maintained as multicopy episomes. EBV-positive gastric cancer cells are incompetent for progeny virus production, making viral DNA cloning extremely difficult. Here we describe a highly efficient strategy for obtaining bacterial artificial chromosome (BAC) clones of EBV episomes by utilizing a CRISPR/Cas9-mediated strand break of the viral genome and subsequent homology-directed repair. EBV strains maintained in two gastric cancer cell lines (SNU719 and YCCEL1) were cloned, and their complete viral genome sequences were determined. Infectious viruses of gastric cancer cell-derived EBVs were reconstituted, and the viruses established stable latent infections in immortalized keratinocytes. While Ras oncoprotein overexpression caused massive vacuolar degeneration and cell death in control keratinocytes, EBV-infected keratinocytes survived in the presence of Ras expression. These results implicate EBV infection in predisposing epithelial cells to malignant transformation by inducing resistance to oncogene-induced cell death. Recent progress in DNA-sequencing technology has accelerated EBV whole-genome sequencing, and the repertoire of sequenced EBV genomes is increasing progressively. Accordingly, the presence of EBV variant strains that may be relevant to EBV-associated diseases has begun to attract interest. Clearly, the determination of additional disease-associated viral genome sequences will facilitate the identification of any disease-specific EBV variants. We found that CRISPR/Cas9-mediated cleavage of EBV episomal DNA enabled the cloning of disease-associated viral strains with unprecedented efficiency. As a proof of concept, two gastric cancer cell-derived EBV strains were cloned, and the infection of epithelial cells with reconstituted viruses provided important clues about the mechanism of EBV-mediated epithelial carcinogenesis. This experimental system should contribute to establishing the relationship between viral genome variation and EBV-associated diseases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Tenebrio molitor antifreeze protein gene identification and regulation.

PubMed

Qin, Wensheng; Walker, Virginia K

2006-02-15

The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

Transposon-containing DNA cloning vector and uses thereof

DOEpatents

Berg, C.M.; Berg, D.E.; Wang, G.

1997-07-08

The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed. 4 figs.

Transposon-containing DNA cloning vector and uses thereof

DOEpatents

Berg, Claire M.; Berg, Douglas E.; Wang, Gan

1997-01-01

The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed.

Whole genome comparison of donor and cloned dogs

PubMed Central

Kim, Hak-Min; Cho, Yun Sung; Kim, Hyunmin; Jho, Sungwoong; Son, Bongjun; Choi, Joung Yoon; Kim, Sangsoo; Lee, Byeong Chun; Bhak, Jong; Jang, Goo

2013-01-01

Cloning is a process that produces genetically identical organisms. However, the genomic degree of genetic resemblance in clones needs to be determined. In this report, the genomes of a cloned dog and its donor were compared. Compared with a human monozygotic twin, the genome of the cloned dog showed little difference from the genome of the nuclear donor dog in terms of single nucleotide variations, chromosomal instability, and telomere lengths. These findings suggest that cloning by somatic cell nuclear transfer produced an almost identical genome. The whole genome sequence data of donor and cloned dogs can provide a resource for further investigations on epigenetic contributions in phenotypic differences. PMID:24141358

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

[Expression of human-mouse chimeric antibody directed against Chikungunya virus with site-specific integration system].

PubMed

Li, Jian-min; Chen, Wei; Jia, Xiu-jie; An, Xiao-ping; Li, Bing; Fan, Ying-ru; Tong, Yi-gang

2005-05-01

To obtain CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site and to express human-mouse chimeric antibody directed against Chikungunya Virus by using the cell line. The fusion gene of FRT and HBsAg was constructed by PCR and cloned into the MCS of pCI-neo to construct pCI-FRT-HBsAg. The pCI-FRT-HBsAg was transfected into CHO/dhfr(-) cells and cell clones with high expression of HBsAg were screened by detecting the amount of HBsAg with ELISA. A CHO cell clone with the highest expression was chosen and named as CHO/dhfr(-) FRT(+). pAFRT HFLF, a expression plasmid of chimeric antibody with RFT sequence was transfected into CHO/dhfr(-) FRT(+) cells and cell clones with high expression of the chimeric antibody were screened by increasing concentration of MTX. A CHO cell clone with high expression of the chimeric antibody was cultured in large scale and supernatant was collected from which the chimeric antibody was purified. The purified chimeric antibody was analyzed by SDS-PAGE, Western blot and IFA. A CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site was obtained successfully. A cell clone with yield of 5 mg/L of chimeric antibody was obtained, as compared with routine CHO cell expression system with a yield of 2 mg/L. A cell line with integrated FRT sequence in the chromosome transcription active site was obtained and with it human-mouse chimeric antibody directed against Chikungunya virus was expressed. This system lays a solid foundation which can be used for expressing antibodies and other proteins.

Genetic variability in G2 and F2 region between biological clones of human respiratory syncytial virus with or without host immune selection pressure

PubMed Central

Moraes, Claudia Trigo Pedroso; Oliveira, Danielle Bruna Leal; Campos, Angelica Cristine Almeida; Bosso, Patricia Alves; Lima, Hildener Nogueira; Stewien, Klaus Eberhard; Gilio, Alfredo Elias; Vieira, Sandra Elisabete; Botosso, Viviane Fongaro; Durigon, Edison Luiz

2015-01-01

Human respiratory syncytial virus (HRSV) is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn) in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro) in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample. PMID:25742274

Genetic variability in G2 and F2 region between biological clones of human respiratory syncytial virus with or without host immune selection pressure.

PubMed

Moraes, Claudia Trigo Pedroso; Oliveira, Danielle Bruna Leal; Campos, Angelica Cristine Almeida; Bosso, Patricia Alves; Lima, Hildener Nogueira; Stewien, Klaus Eberhard; Gilio, Alfredo Elias; Vieira, Sandra Elisabete; Botosso, Viviane Fongaro; Durigon, Edison Luiz

2015-02-01

Human respiratory syncytial virus (HRSV) is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn) in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro) in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.

Rhipicephalus (Boophilus) microplus strain Deutsch, 5 BAC clone sequencing, including two encoding Cytochrome P450s and one encoding CzEst9 carboxylesterase

USDA-ARS?s Scientific Manuscript database

The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. BAC clones give insight into the genome struct...

Isolation, cloning, and characterization of the 2S albumin: a new allergen from hazelnut.

PubMed

Garino, Cristiano; Zuidmeer, Laurian; Marsh, Justin; Lovegrove, Alison; Morati, Maria; Versteeg, Serge; Schilte, Piet; Shewry, Peter; Arlorio, Marco; van Ree, Ronald

2010-09-01

2S albumins are the major allergens involved in severe food allergy to nuts, seeds, and legumes. We aimed to isolate, clone, and express 2S albumin from hazelnut and determine its allergenicity. 2S albumin from hazelnut extract was purified using size exclusion chromatography and RP-HPLC. After N-terminal sequencing, degenerated and poly-d(T) primers were used to clone the 2S albumin sequence from hazelnut cDNA. After expression in Escherichia coli and affinity purification, IgE reactivity was evaluated by Immunoblot/ImmunoCAP (inhibition) analyses using sera of nut-allergic patients. N-terminal sequencing of a approximately 10 kDa peak from size exclusion chromatography/RP-HPLC gave two sequences highly homologous to pecan 2S albumin, an 11 amino acid (aa) N-terminal and a 10 aa internal peptide. The obtained clone (441 bp) encoded a 147 aa hazelnut 2S albumin consisting of a putative signal peptide (22 aa), a linker peptide (20 aa), and the mature protein sequence (105 aa). The latter was successfully expressed in E. coli. Both recombinant and natural 2S albumin demonstrated similar IgE reactivity in Immunoblot/ImmunoCAP (inhibition) analyses. We confirmed the postulated role of hazelnut 2S albumin as an allergen. The availability of recombinant molecules will allow establishing the importance of hazelnut 2S albumin for hazelnut allergy.

Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

1994-12-01

The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3-Endoglucanase, in Soybean.

PubMed

Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O

1990-06-01

Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.

Monitoring of microbial communities in anaerobic digestion sludge for biogas optimisation.

PubMed

Lim, Jun Wei; Ge, Tianshu; Tong, Yen Wah

2018-01-01

This study characterised and compared the microbial communities of anaerobic digestion (AD) sludge using three different methods - (1) Clone library; (2) Pyrosequencing; and (3) Terminal restriction fragment length polymorphism (T-RFLP). Although high-throughput sequencing techniques are becoming increasingly popular and affordable, the reliance of such techniques for frequent monitoring of microbial communities may be a financial burden for some. Furthermore, the depth of microbial analysis revealed by high-throughput sequencing may not be required for monitoring purposes. This study aims to develop a rapid, reliable and economical approach for the monitoring of microbial communities in AD sludge. A combined approach where genetic information of sequences from clone library was used to assign phylogeny to T-RFs determined experimentally was developed in this study. In order to assess the effectiveness of the combined approach, microbial communities determined by the combined approach was compared to that characterised by pyrosequencing. Results showed that both pyrosequencing and clone library methods determined the dominant bacteria phyla to be Proteobacteria, Firmicutes, Bacteroidetes, and Thermotogae. Both methods also found that sludge A and B were predominantly dominated by acetogenic methanogens followed by hydrogenotrophic methanogens. The number of OTUs detected by T-RFLP was significantly lesser than that detected by the clone library. In this study, T-RFLP analysis identified majority of the dominant species of the archaeal consortia. However, many of the more highly diverse bacteria consortia were missed. Nevertheless, the combined approach developed in this study where clone sequences from the clone library were used to assign phylogeny to T-RFs determined experimentally managed to accurately predict the same dominant microbial groups for both sludge A and sludge B, as compared to the pyrosequencing results. Results showed that the combined approach of clone library and T-RFLP accurately predicted the dominant microbial groups and thus is a reliable and more economical way to monitor the evolution of microbial systems in AD sludge. Copyright © 2017 Elsevier Ltd. All rights reserved.

Defense Response in Slash Pine: Chitosan Treatment Alters the Abundance of Specific mRNAs

Treesearch

Mary E. Mason; John M. Davis

1997-01-01

We used differential display to identify chitosan responsive cDNAs in slashpine cell cultures. Two clones that showed increased mRNA abundance had sequence similarity to genes with roles in major plant defense responses, clone 18 to cinnamic acid 4-hydroxylase, and clone 30 to chitinase.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range chromosome assembly.

PubMed

Thind, Anupriya Kaur; Wicker, Thomas; Šimková, Hana; Fossati, Dario; Moullet, Odile; Brabant, Cécile; Vrána, Jan; Doležel, Jaroslav; Krattinger, Simon G

2017-08-01

Cereal crops such as wheat and maize have large repeat-rich genomes that make cloning of individual genes challenging. Moreover, gene order and gene sequences often differ substantially between cultivars of the same crop species. A major bottleneck for gene cloning in cereals is the generation of high-quality sequence information from a cultivar of interest. In order to accelerate gene cloning from any cropping line, we report 'targeted chromosome-based cloning via long-range assembly' (TACCA). TACCA combines lossless genome-complexity reduction via chromosome flow sorting with Chicago long-range linkage to assemble complex genomes. We applied TACCA to produce a high-quality (N50 of 9.76 Mb) de novo chromosome assembly of the wheat line CH Campala Lr22a in only 4 months. Using this assembly we cloned the broad-spectrum Lr22a leaf-rust resistance gene, using molecular marker information and ethyl methanesulfonate (EMS) mutants, and found that Lr22a encodes an intracellular immune receptor homologous to the Arabidopsis thaliana RPM1 protein.

Local circulating clones of Staphylococcus aureus in Ecuador.

PubMed

Zurita, Jeannete; Barba, Pedro; Ortega-Paredes, David; Mora, Marcelo; Rivadeneira, Sebastián

The spread of pandemic Staphylococcus aureus clones, mainly methicillin-resistant S. aureus (MRSA), must be kept under surveillance to assemble an accurate, local epidemiological analysis. In Ecuador, the prevalence of the USA300 Latin American variant clone (USA300-LV) is well known; however, there is little information about other circulating clones. The aim of this work was to identify the sequence types (ST) using a Multiple-Locus Variable number tandem repeat Analysis 14-locus genotyping approach. We analyzed 132 S. aureus strains that were recovered from 2005 to 2013 and isolated in several clinical settings in Quito, Ecuador. MRSA isolates composed 46.97% (62/132) of the study population. Within MRSA, 37 isolates were related to the USA300-LV clone (ST8-MRSA-IV, Panton-Valentine Leukocidin [PVL] +) and 10 were related to the Brazilian clone (ST239-MRSA-III, PVL-). Additionally, two isolates (ST5-MRSA-II, PVL-) were related to the New York/Japan clone. One isolate was related to the Pediatric clone (ST5-MRSA-IV, PVL-), one isolate (ST45-MRSA-II, PVL-) was related to the USA600 clone, and one (ST22-MRSA-IV, PVL-) was related to the epidemic UK-EMRSA-15 clone. Moreover, the most prevalent MSSA sequence types were ST8 (11 isolates), ST45 (8 isolates), ST30 (8 isolates), ST5 (7 isolates) and ST22 (6 isolates). Additionally, we found one isolate that was related to the livestock associated S. aureus clone ST398. We conclude that in addition to the high prevalence of clone LV-ST8-MRSA-IV, other epidemic clones are circulating in Quito, such as the Brazilian, Pediatric and New York/Japan clones. The USA600 and UK-EMRSA-15 clones, which were not previously described in Ecuador, were also found. Moreover, we found evidence of the presence of the livestock associated clone ST398 in a hospital environment. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

[Detection and diversity analysis of rumen methanogens in the co-cultures with anaerobic fungi].

PubMed

Cheng, Yan-fen; Mao, Sheng-yong; Pei, Cai-xia; Liu, Jian-xin; Zhu, Wei-yun

2006-12-01

Rumen methanogen diversity in the co-cultures with anaerobic fungi from goat rumen was analyzed. Mix-cultures of anaerobic fungi and methanogens were obtained from goat rumen using anaerobic fungal medium and the addition of penicillin and streptomycin and then subcultured 62 times by transferring cultures every 3 - 4d. Total DNA from the original rumen fluid and subcultured fungal cultures was used for PCR/DGGE and RFLP analysis. 16S rDNA of clones corresponding to representative OTUs were sequenced. Results showed that the diversity index (Shannon index) of the methanogens generated from DGGE profiles reduced from 1.32 to 0.99 from rumen fluid to fungal culture after 45 subculturing, with the lowest similarity of DGGE profiles at 34.7%. The Shannon index increased from 0.99 to 1.15 from the fungal culture after 45 subculturing to that after 62 subculturing, with the lowest similarity at 89.2% . A total of 5 OTUs were obtained from 69. clones using RFLP analysis and six clones representing the 5 OTUs respectively were sequenced. Of the 5 OTUs, three had their cloned 16S rDNA sequences most closely related to uncultured archaeal symbiont PA202 with the same similarity of 95 %, but had not closely related to any identified culturable methanogen. The rest two OTUs had their cloned 16S rDNA sequences sharing the same closest relative, uncultured rumen methanogen 956, with the same similarity of 97% .Their 16S rDNA sequences of these two OTUs also showed 97% similar to the closest identified culturable methanogen Methanobrevibacter sp. NT7. In conclusion, diverse yet unidentified rumen methanogen species exist in the co-cultures with anaerobic fungi isolated from the goat rumen.

Complex structural behavior of oligopurine-oligopyrimidine sequence cloned within the supercoiled plasmid.

PubMed Central

Parniewski, P; Galazka, G; Wilk, A; Klysik, J

1989-01-01

Synthetic sequence GATCC(AG)7ATCG(AT)4CG(AG)7 was cloned into plasmid and its structural behavior under the influence of supercoiling was analysed by chemical modification at variety of experimental conditions. It was found that this sequence adopts at least two different non-B conformations depending on -delta and pH values. Moreover, 12 nucleotide long non-pur.pyr spacer region separating two identical (AG)7 blocks does not provide a significant energy barrier protecting against unusual structures formation. Images PMID:2644622

Unprecedented genomic diversity of AhR1 and AhR2 genes in Atlantic salmon (Salmo salar L.).

PubMed

Hansson, Maria C; Wittzell, Håkan; Persson, Kerstin; von Schantz, Torbjörn

2004-06-24

Aryl hydrocarbon receptor (AhR) genes encode proteins involved in mediating the toxic responses induced by several environmental pollutants. Here, we describe the identification of the first two AhR1 (alpha and beta) genes and two additional AhR2 (alpha and beta) genes in the tetraploid species Atlantic salmon (Salmo salar L.) from a cosmid library screening. Cosmid clones containing genomic salmon AhR sequences were isolated using a cDNA clone containing the coding region of the Atlantic salmon AhR2gamma as a probe. Screening revealed 14 positive clones, from which four were chosen for further analyses. One of the cosmids contained genomic AhR sequences that were highly similar to the rainbow trout (Oncorhynchus mykiss) AhR2alpha and beta genes. SMART RACE amplified two complete, highly similar but not identical AhR type 2 sequences from salmon cDNA, which from phylogenetic analyses were determined as the rainbow trout AhR2alpha and beta orthologs. The salmon AhR2alpha and beta encode proteins of 1071 and 1058 residues, respectively, and encompass characteristic AhR sequence elements like a basic-helix-loop-helix (bHLH) and two PER-ARNT-SIM (PAS) domains. Both genes are transcribed in liver, spleen and muscle tissues of adult salmon. A second cosmid contained partial sequences, which were identical to the previously characterized AhR2gamma gene. The last two cosmids contained partial genomic AhR sequences, which were more similar to other AhR type 1 fish genes than the four characterized salmon AhR2 genes. However, attempts to amplify the corresponding complete cDNA sequences of the inserts proved very difficult, suggesting that these genes are non-functional or very weakly transcribed in the examined tissues. Phylogenetic analyses of the conserved regions did, however, clearly indicate that these two AhRs belong to the AhR type 1 clade and have been assigned as the Atlantic salmon AhR1alpha and AhR1beta genes. Taken together, these findings demonstrate that multiple AhR genes are present in Atlantic salmon genome, which likely is a consequence of previous genome duplications in the evolutionary past of salmonids. Plausible explanations for the high incidence of AhR genes in fish and more specifically in salmonids, like rapid divergences in specialized functions, are discussed.

Whole genome sequence revealed the fine transmission map of carbapenem-resistant Klebsiella pneumonia isolates within a nosocomial outbreak.

PubMed

Sui, Wenjun; Zhou, Haijian; Du, Pengcheng; Wang, Lijun; Qin, Tian; Wang, Mei; Ren, Hongyu; Huang, Yanfei; Hou, Jing; Chen, Chen; Lu, Xinxin

2018-01-01

Carbapenem-resistant Klebsiella pneumoniae (CRKP) is a major cause of nosocomial infections worldwide. The transmission route of CRKP isolates within an outbreak is rarely described. This study aimed to reveal the molecular characteristics and transmission route of CRKP isolates within an outbreak of nosocomial infection. Collecting case information, active screening and targeted environmental monitoring were carried out. The antibiotic susceptibility, drug-resistant genes, molecular subtype and whole genome sequence of CRKP strains were analyzed. Between October and December 2011, 26 CRKP isolates were collected from eight patients in a surgical intensive care unit and subsequent transfer wards of Beijing Tongren hospital, China. All 26 isolates harbored bla KPC-2 , bla SHV-1 , and bla CTX-M-15 genes, had the same or similar pulsed-field gel electrophoresis patterns, and belonged to the sequence type 11 (ST11) clone. By comprehensive consideration of genomic and epidemiological information, a putative transmission map was constructed, including identifying one case as an independent event distinct from the other seven cases, and revealing two transmissions starting from the same case. This study provided the first report confirming an outbreak caused by K. pneumoniae ST11 clone co-harboring the bla KPC-2 , bla CTX-M-15 , and bla SHV-1 genes, and suggested that comprehensive consideration of genomic and epidemiological data can yield a fine transmission map of an outbreak and facilitate the control of nosocomial transmission.

Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

PubMed Central

Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

1993-01-01

A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Outbreak of OXA-48-Producing Klebsiella pneumoniae Involving a Sequence Type 101 Clone in Batna University Hospital, Algeria

PubMed Central

Loucif, Lotfi; Kassah-Laouar, Ahmed; Saidi, Mahdia; Messala, Amina; Chelaghma, Widad

2016-01-01

Seven nonredundant ertapenem-resistant Klebsiella pneumoniae isolates were collected between May 2014 and 19 January 2015 in the nephrology and hematology units of Batna University Hospital in Algeria. All strains coproduced the blaOXA-48, blaCTX-M-15, blaSHV-1, and blaTEM-1D genes. Six of these isolates belonged to the pandemic clone sequence type 101 (ST101). The blaOXA-48 gene was located on a conjugative IncL/M-type plasmid. This is the first known outbreak of OXA-48-producing K. pneumoniae isolates involving an ST101 clone in Batna University Hospital. PMID:27645236

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

A Blumeria graminisf.sp. hordei BAC library--contig building and microsynteny studies.

PubMed

Pedersen, Carsten; Wu, Boqian; Giese, Henriette

2002-11-01

A bacterial artificial chromosome (BAC) library of Blumeria graminis f.sp. hordei, containing 12,000 clones with an average insert size of 41 kb, was constructed. The library represents about three genome equivalents and BAC-end sequencing showed a high content of repetitive sequences, making contig-building difficult. To identify overlapping clones, several strategies were used: colony hybridisation, PCR screening, fingerprinting techniques and the use of single-copy expressed sequence tags. The latter proved to be the most efficient method for identification of overlapping clones. Two contigs, at or close to avirulence loci, were constructed. Single nucleotide polymorphism (SNP) markers were developed from BAC-end sequences to link the contigs to the genetic maps. Two other BAC contigs were used to study microsynteny between B. graminis and two other ascomycetes, Neurospora crassa and Aspergillus fumigatus. The library provides an invaluable tool for the isolation of avirulence genes from B. graminis and for the study of gene synteny between this fungus and other fungi.

Isolation and cloning of a metalloproteinase from king cobra snake venom.

PubMed

Guo, Xiao-Xi; Zeng, Lin; Lee, Wen-Hui; Zhang, Yun; Jin, Yang

2007-06-01

A 50 kDa fibrinogenolytic protease, ohagin, from the venom of Ophiophagus hannah was isolated by a combination of gel filtration, ion-exchange and heparin affinity chromatography. Ohagin specifically degraded the alpha-chain of human fibrinogen and the proteolytic activity was completely abolished by EDTA, but not by PMSF, suggesting it is a metalloproteinase. It dose-dependently inhibited platelet aggregation induced by ADP, TMVA and stejnulxin. The full sequence of ohagin was deduced by cDNA cloning and confirmed by protein sequencing and peptide mass fingerprinting. The full-length cDNA sequence of ohagin encodes an open reading frame of 611 amino acids that includes signal peptide, proprotein and mature protein comprising metalloproteinase, disintegrin-like and cysteine-rich domains, suggesting it belongs to P-III class metalloproteinase. In addition, P-III class metalloproteinases from the venom glands of Naja atra, Bungarus multicinctus and Bungarus fasciatus were also cloned in this study. Sequence analysis and phylogenetic analysis indicated that metalloproteinases from elapid snake venoms form a new subgroup of P-III SVMPs.

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

C/N Ratio Drives Soil Actinobacterial Cellobiohydrolase Gene Diversity

PubMed Central

Prendergast-Miller, Miranda T.; Poonpatana, Pabhon; Farrell, Mark; Bissett, Andrew; Macdonald, Lynne M.; Toscas, Peter; Richardson, Alan E.; Thrall, Peter H.

2015-01-01

Cellulose accounts for approximately half of photosynthesis-fixed carbon; however, the ecology of its degradation in soil is still relatively poorly understood. The role of actinobacteria in cellulose degradation has not been extensively investigated despite their abundance in soil and known cellulose degradation capability. Here, the diversity and abundance of the actinobacterial glycoside hydrolase family 48 (cellobiohydrolase) gene in soils from three paired pasture-woodland sites were determined by using terminal restriction fragment length polymorphism (T-RFLP) analysis and clone libraries with gene-specific primers. For comparison, the diversity and abundance of general bacteria and fungi were also assessed. Phylogenetic analysis of the nucleotide sequences of 80 clones revealed significant new diversity of actinobacterial GH48 genes, and analysis of translated protein sequences showed that these enzymes are likely to represent functional cellobiohydrolases. The soil C/N ratio was the primary environmental driver of GH48 community compositions across sites and land uses, demonstrating the importance of substrate quality in their ecology. Furthermore, mid-infrared (MIR) spectrometry-predicted humic organic carbon was distinctly more important to GH48 diversity than to total bacterial and fungal diversity. This suggests a link between the actinobacterial GH48 community and soil organic carbon dynamics and highlights the potential importance of actinobacteria in the terrestrial carbon cycle. PMID:25710367

[Microbial community in the Anammox process of thermal denitration tail liquid].

PubMed

Li, Jin; Yu, Deshuang; Zhao, Dan; Wang, Xiaochen

2014-12-01

An anaerobic sequencing batch reactor (ASBR) was used to treat thermal denitration tail liquid and microbial community was studied. Activated sludge was taken from the reactor for scanning electron microscope analysis. The images showed that the dominant cells in the flora were oval cocci. Its diameter was about 0.7 μm. Through a series of molecular biology methods such as extracting total DNA from the sludge, PCR amplification, positive clone authentication and sequencing, we obtained the 16S rDNA sequences of the flora. Phylogenetic tree and clone library were established. The universal bacteria primers of 27F-1492R PCR amplification system obtained 85 clones and could be divided into 21 OTUS. The proportions were as follows: Proteobacteria 61.18%; Acidobacteria 17.65%; Chlorobi 8.24%; Chlorofexi 5.88%; Gemmatimonadetes 3.53%; Nitrospirae 2.35% and Planctomycetes 1.18%. The specific anammox bacterial primers of pla46rc-630r and AMX368-AMX820 PCR amplification system obtained 45 clones. They were divided into 3 OTUS. Candidatus brocadia sp. occupied 95.6% and unknown strains occupied 4.4%.

Cloning and expression of Bartonella henselae sucB gene encoding an immunogenic dihydrolipoamide succinyltransferase homologous protein.

PubMed

Kabeya, Hidenori; Maruyama, Soichi; Hirano, Kouji; Mikami, Takeshi

2003-01-01

Immunoscreening of a ZAP genomic library of Bartonella henselae strain Houston-1 expressed in Escherichia coli resulted in the isolation of a clone containing 3.5 kb BamHI genomic DNA fragment. This 3.5 kb DNA fragment was found to contain a sequence of a gene encoding a protein with significant homology to the dihydrolipoamide succinyltransferase of Brucella melitensis (sucB). Subsequent cloning and DNA sequence analysis revealed that the deduced amino acid sequence from the cloned gene showed 66.5% identity to SucB protein of B. melitensis, and 43.4 and 47.2% identities to those of Coxiella burnetii and E. coli, respectively. The gene was expressed as a His-Nus A-tagged fusion protein. The recombinant SucB protein (rSucB) was shown to be an immunoreactive protein of about 115 kDa by Western blot analysis with sera from B. henselae-immunized mice. Therefore the rSucB may be a candidate antigen for a specific serological diagnosis of B. henselae infection.

Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moeis, Maelita R., E-mail: sony@sith.itb.ac.id; Berlian, Liska, E-mail: sony@sith.itb.ac.id; Suhandono, Sony, E-mail: sony@sith.itb.ac.id

Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5α. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNAmore » sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.« less

Identification of Prostate Cancer-Specific microDNAs

DTIC Science & Technology

2014-12-01

displacement amplification (MDA). 2 adopted multiple displacement amplification (MDA) with random primers for enriched circular DNA by rolling circle ... amplification (RCA) (Fig. 1) and then amplified DNA fragments were subject to deep sequencing. Sequence NO of Reads seq 1 184 seq 2 133 seq 3 2407 seq...prostate cancer cells through multiple displacement amplification .  Clone #7 is the top candidate which has been cloned in an expression vector and it

Identification and characterization of mutant clones with enhanced propagation rates from phage-displayed peptide libraries.

PubMed

Nguyen, Kieu T H; Adamkiewicz, Marta A; Hebert, Lauren E; Zygiel, Emily M; Boyle, Holly R; Martone, Christina M; Meléndez-Ríos, Carola B; Noren, Karen A; Noren, Christopher J; Hall, Marilena Fitzsimons

2014-10-01

A target-unrelated peptide (TUP) can arise in phage display selection experiments as a result of a propagation advantage exhibited by the phage clone displaying the peptide. We previously characterized HAIYPRH, from the M13-based Ph.D.-7 phage display library, as a propagation-related TUP resulting from a G→A mutation in the Shine-Dalgarno sequence of gene II. This mutant was shown to propagate in Escherichia coli at a dramatically faster rate than phage bearing the wild-type Shine-Dalgarno sequence. We now report 27 additional fast-propagating clones displaying 24 different peptides and carrying 14 unique mutations. Most of these mutations are found either in or upstream of the gene II Shine-Dalgarno sequence, but still within the mRNA transcript of gene II. All 27 clones propagate at significantly higher rates than normal library phage, most within experimental error of wild-type M13 propagation, suggesting that mutations arise to compensate for the reduced virulence caused by the insertion of a lacZα cassette proximal to the replication origin of the phage used to construct the library. We also describe an efficient and convenient assay to diagnose propagation-related TUPS among peptide sequences selected by phage display. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Diversity of the small subunit ribosomal RNA gene of the arbuscular mycorrhizal fungi colonizing Clintonia borealis from a mixed-wood boreal forest.

PubMed

DeBellis, Tonia; Widden, Paul

2006-11-01

Arbuscular mycorrhizal fungi (AMF) communities in Clintonia borealis roots from a boreal mixed forests in northwestern Québec were investigated. Roots were sampled from 100 m2 plots whose overstory was dominated by either trembling aspen (Populus tremuloides Michx.), white birch (Betula papyrifera Marsh.), or mixed white spruce (Picea glauca (Moench) Voss) and balsam fir (Abies balsamea (L.) Mill.). Part of the 18S ribosomal gene of the AMF was amplified and the resulting PCR products were cloned. Restriction analysis of the 576 resulting clones yielded 92 different restriction patterns which were then sequenced. Fifty-two sequences closely matched other Glomus sequences from Genbank. Phylogenetic analysis revealed 10 different AMF sequence types, most of which clustered with other uncultured AM sequences from plant roots from various field sites. Compared with other AMF communities from comparable studies, richness and diversity were higher than observed in an arable field, but lower than seen in a tropical forest and a temperate wetland. The AMF communities from Clintonia roots under the different canopy types did not differ significantly and the dominant sequence type, which clustered with AM sequences from a variety of environments and hosts at distant geographical locations, represented 66.9% of all the clones analyzed.

In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

PubMed Central

Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

2005-01-01

The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

PubMed

Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

1987-01-26

Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

EPA Science Inventory

The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

PubMed

Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

2016-10-01

To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

Epoxyalkane:Coenzyme M Transferase Gene Diversity and Distribution in Groundwater Samples from Chlorinated-Ethene-Contaminated Sites

PubMed Central

Liu, Xikun

2016-01-01

ABSTRACT Epoxyalkane:coenzyme M transferase (EaCoMT) plays a critical role in the aerobic biodegradation and assimilation of alkenes, including ethene, propene, and the toxic chloroethene vinyl chloride (VC). To improve our understanding of the diversity and distribution of EaCoMT genes in the environment, novel EaCoMT-specific terminal-restriction fragment length polymorphism (T-RFLP) and nested-PCR methods were developed and applied to groundwater samples from six different contaminated sites. T-RFLP analysis revealed 192 different EaCoMT T-RFs. Using clone libraries, we retrieved 139 EaCoMT gene sequences from these samples. Phylogenetic analysis revealed that a majority of the sequences (78.4%) grouped with EaCoMT genes found in VC- and ethene-assimilating Mycobacterium strains and Nocardioides sp. strain JS614. The four most-abundant T-RFs were also matched with EaCoMT clone sequences related to Mycobacterium and Nocardioides strains. The remaining EaCoMT sequences clustered within two emergent EaCoMT gene subgroups represented by sequences found in propene-assimilating Gordonia rubripertincta strain B-276 and Xanthobacter autotrophicus strain Py2. EaCoMT gene abundance was positively correlated with VC and ethene concentrations at the sites studied. IMPORTANCE The EaCoMT gene plays a critical role in assimilation of short-chain alkenes, such as ethene, VC, and propene. An improved understanding of EaCoMT gene diversity and distribution is significant to the field of bioremediation in several ways. The expansion of the EaCoMT gene database and identification of incorrectly annotated EaCoMT genes currently in the database will facilitate improved design of environmental molecular diagnostic tools and high-throughput sequencing approaches for future bioremediation studies. Our results further suggest that potentially significant aerobic VC degraders in the environment are not well represented in pure culture. Future research should aim to isolate and characterize aerobic VC-degrading bacteria from these underrepresented groups. PMID:27016563

Isolation and mapping of telomeric pentanucleotide (TAACC)n repeats of the Pacific whiteleg shrimp, Penaeus vannamei, using fluorescence in situ hybridization.

PubMed

Alcivar-Warren, Acacia; Meehan-Meola, Dawn; Wang, Yongping; Guo, Ximing; Zhou, Linghua; Xiang, Jianhai; Moss, Shaun; Arce, Steve; Warren, William; Xu, Zhenkang; Bell, Kireina

2006-01-01

To develop genetic and physical maps for shrimp, accurate information on the actual number of chromosomes and a large number of genetic markers is needed. Previous reports have shown two different chromosome numbers for the Pacific whiteleg shrimp, Penaeus vannamei, the most important penaeid shrimp species cultured in the Western hemisphere. Preliminary results obtained by direct sequencing of clones from a Sau3A-digested genomic library of P. vannamei ovary identified a large number of (TAACC/GGTTA)-containing SSRs. The objectives of this study were to (1) examine the frequency of (TAACC)n repeats in 662 P. vannamei genomic clones that were directly sequenced, and perform homology searches of these clones, (2) confirm the number of chromosomes in testis of P. vannamei, and (3) localize the TAACC repeats in P. vannamei chromosome spreads using fluorescence in situ hybridization (FISH). Results for objective 1 showed that 395 out of the 662 clones sequenced contained single or multiple SSRs with three or more repeat motifs, 199 of which contained variable tandem repeats of the pentanucleotide (TAACC/GGTTA)n, with 3 to 14 copies per sequence. The frequency of (TAACC)n repeats in P. vannamei is 4.68 kb for SSRs with five or more repeat motifs. Sequence comparisons using the BLASTN nonredundant and expressed sequence tag (EST) databases indicated that most of the TAACC-containing clones were similar to either the core pentanucleotide repeat in PVPENTREP locus (GenBank accession no. X82619) or portions of 28S rRNA. Transposable elements (transposase for Tn1000 and reverse transcriptase family members), hypothetical or unnamed protein products, and genes of known function such as 18S and 28S rRNAs, heat shock protein 70, and thrombospondin were identified in non-TAACC-containing clones. For objective 2, the meiotic chromosome number of P. vannamei was confirmed as N = 44. For objective 3, four FISH probes (P1 to P4) containing different numbers of TAACC repeats produced positive signals on telomeres of P. vannamei chromosomes. A few chromosomes had positive signals interstitially. Probe signal strength and chromosome coverage differed in the general order of P1>P2>P3>P4, which correlated with the length of TAACC repeats within the probes: 83, 66, 35, and 30 bp, respectively, suggesting that the TAACC repeats, and not the flanking sequences, produced the TAACC signals at chromosome ends and TAACC is likely the telomere sequence for P. vannamei.

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

A Novel Phytase with Sequence Similarity to Purple Acid Phosphatases Is Expressed in Cotyledons of Germinating Soybean Seedlings 1

PubMed Central

Hegeman, Carla E.; Grabau, Elizabeth A.

2001-01-01

Phytic acid (myo-inositol hexakisphosphate) is the major storage form of phosphorus in plant seeds. During germination, stored reserves are used as a source of nutrients by the plant seedling. Phytic acid is degraded by the activity of phytases to yield inositol and free phosphate. Due to the lack of phytases in the non-ruminant digestive tract, monogastric animals cannot utilize dietary phytic acid and it is excreted into manure. High phytic acid content in manure results in elevated phosphorus levels in soil and water and accompanying environmental concerns. The use of phytases to degrade seed phytic acid has potential for reducing the negative environmental impact of livestock production. A phytase was purified to electrophoretic homogeneity from cotyledons of germinated soybeans (Glycine max L. Merr.). Peptide sequence data generated from the purified enzyme facilitated the cloning of the phytase sequence (GmPhy) employing a polymerase chain reaction strategy. The introduction of GmPhy into soybean tissue culture resulted in increased phytase activity in transformed cells, which confirmed the identity of the phytase gene. It is surprising that the soybean phytase was unrelated to previously characterized microbial or maize (Zea mays) phytases, which were classified as histidine acid phosphatases. The soybean phytase sequence exhibited a high degree of similarity to purple acid phosphatases, a class of metallophosphoesterases. PMID:11500558

Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

Cancer.gov

The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

PubMed

Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

2014-01-01

The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

Anti-digoxin Fab variants generated by phage display.

PubMed

Murata, Viviane Midori; Schmidt, Mariana Costa Braga; Kalil, Jorge; Tsuruta, Lilian Rumi; Moro, Ana Maria

2013-06-01

Digoxin is a pharmaceutical used in the control of cardiac dysfunction. Its therapeutic window is narrow, with effect dosage very close to the toxic dosage. To counteract the toxic effect, polyclonal Fab fragments are commercially available. Our study is based on a monoclonal anti-digoxin antibody, which would provide a product with a specific potency and more precise dosage for the detoxification of patients under digoxin treatment. Phage display technology was used to select variants with high affinity. From an anti-digoxin hybridoma, RNA was extracted for subsequent cDNA synthesis. Specific primers were used for the LC and Fd amplifications, then cloned sequentially in a phagemid vector (pComb3X) for the combinatorial Fab library construction. Clones were selected for their ability to bind to digoxin-BSA. The presence of light and heavy chains was checked, randomly selected clones then sequenced and induced to produce soluble Fabs, and subsequently analyzed for anti-digoxin expression. Out of ten clones randomly chosen, six resulted positive expression of the product. The sequencing of these revealed two identical clones and one presenting a pseudogene in the LC. Four clones presenting variations in the framework1 showed binding to digoxin-BSA by ELISA and western blotting. The specific binding was further confirmed by Biacore(®), which allowed ranking of the clones. The development of these clones allowed the selection of variants with higher affinity than the original version.

The Three Major Spanish Clones of Penicillin-Resistant Streptococcus pneumoniae Are the Most Common Clones Recovered in Recent Cases of Meningitis in Spain

PubMed Central

Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.

1999-01-01

One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179

Evidence of environmental and vertical transmission of Burkholderia symbionts in the oriental chinch bug, Cavelerius saccharivorus (Heteroptera: Blissidae).

PubMed

Itoh, Hideomi; Aita, Manabu; Nagayama, Atsushi; Meng, Xian-Ying; Kamagata, Yoichi; Navarro, Ronald; Hori, Tomoyuki; Ohgiya, Satoru; Kikuchi, Yoshitomo

2014-10-01

The vertical transmission of symbiotic microorganisms is omnipresent in insects, while the evolutionary process remains totally unclear. The oriental chinch bug, Cavelerius saccharivorus (Heteroptera: Blissidae), is a serious sugarcane pest, in which symbiotic bacteria densely populate the lumen of the numerous tubule-like midgut crypts that the chinch bug develops. Cloning and sequence analyses of the 16S rRNA genes revealed that the crypts were dominated by a specific group of bacteria belonging to the genus Burkholderia of the Betaproteobacteria. The Burkholderia sequences were distributed into three distinct clades: the Burkholderia cepacia complex (BCC), the plant-associated beneficial and environmental (PBE) group, and the stinkbug-associated beneficial and environmental group (SBE). Diagnostic PCR revealed that only one of the three groups of Burkholderia was present in ∼89% of the chinch bug field populations tested, while infections with multiple Burkholderia groups within one insect were observed in only ∼10%. Deep sequencing of the 16S rRNA gene confirmed that the Burkholderia bacteria specifically colonized the crypts and were dominated by one of three Burkholderia groups. The lack of phylogenetic congruence between the symbiont and the host population strongly suggested host-symbiont promiscuity, which is probably caused by environmental acquisition of the symbionts by some hosts. Meanwhile, inspections of eggs and hatchlings by diagnostic PCR and egg surface sterilization demonstrated that almost 30% of the hatchlings vertically acquire symbiotic Burkholderia via symbiont-contaminated egg surfaces. The mixed strategy of symbiont transmission found in the oriental chinch bug might be an intermediate stage in evolution from environmental acquisition to strict vertical transmission in insects. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

PubMed

Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

1991-08-01

1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp.

PubMed

Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong

2015-03-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

PubMed Central

DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

2015-01-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

PubMed

Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

2008-06-15

To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

Sequence Ready Characterization of the Pericentromeric Region of 19p12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evan E. Eichler

2006-08-31

Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy tomore » generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence characterization of other difficult regions of the human genome« less

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Stable MSAP markers for the distinction of Vitis vinifera cv Pinot noir clones.

PubMed

Ocaña, Juan; Walter, Bernard; Schellenbaum, Paul

2013-11-01

Grapevine is one of the most economically important fruit crops. Molecular markers have been used to study grapevine diversity. For instance, simple sequence repeats are a powerful tool for identification of grapevine cultivars, while amplified fragment length polymorphisms have shown their usefulness in intra-varietal diversity studies. Other techniques such as sequence-specific amplified polymorphism are based on the presence of mobile elements in the genome, but their detection lies upon their activity. Relevant attention has been drawn toward epigenetic sources of variation. In this study, a set of Vitis vinifera cv Pinot noir clones were analyzed using the methylation-sensitive amplified polymorphism technique with isoschizomers MspI and HpaII. Nine out of fourteen selective primer combinations were informative and generated two types of polymorphic fragments which were categorized as "stable" and "unstable." In total, 23 stable fragments were detected and they discriminated 92.5 % of the studied clones. Detected stable polymorphisms were either common to several clones, restricted to a few clones or unique to a single clone. The identification of these stable epigenetic markers will be useful in clonal diversity studies. We highlight the relevance of stable epigenetic variation in V. vinifera clones and analyze at which level these markers could be applicable for the development of forthright techniques for clonal distinction.

A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

PubMed Central

Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

2009-01-01

Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

Natural Selection and Adaptive Evolution of Leptin in the Ochotona Family Driven by the Cold Environmental Stress

PubMed Central

Yang, Jie; Wang, Zhen Long; Zhao, Xin Quan; Wang, De Peng; Qi, De Lin; Xu, Bao Hong; Ren, Yong Hong; Tian, Hui Fang

2008-01-01

Background Environmental stress can accelerate the evolutionary rate of specific stress-response proteins and create new functions specialized for different environments, enhancing an organism's fitness to stressful environments. Pikas (order Lagomorpha), endemic, non-hibernating mammals in the modern Holarctic Region, live in cold regions at either high altitudes or high latitudes and have a maximum distribution of species diversification confined to the Qinghai-Tibet Plateau. Variations in energy metabolism are remarkable for them living in cold environments. Leptin, an adipocyte-derived hormone, plays important roles in energy homeostasis. Methodology/Principal Findings To examine the extent of leptin variations within the Ochotona family, we cloned the entire coding sequence of pika leptin from 6 species in two regions (Qinghai-Tibet Plateau and Inner Mongolia steppe in China) and the leptin sequences of plateau pikas (O. curzonia) from different altitudes on Qinghai-Tibet Plateau. We carried out both DNA and amino acid sequence analyses in molecular evolution and compared modeled spatial structures. Our results show that positive selection (PS) acts on pika leptin, while nine PS sites located within the functionally significant segment 85-119 of leptin and one unique motif appeared only in pika lineages-the ATP synthase α and β subunit signature site. To reveal the environmental factors affecting sequence evolution of pika leptin, relative rate test was performed in pikas from different altitudes. Stepwise multiple regression shows that temperature is significantly and negatively correlated with the rates of non-synonymous substitution (Ka) and amino acid substitution (Aa), whereas altitude does not significantly affect synonymous substitution (Ks), Ka and Aa. Conclusions/Significance Our findings support the viewpoint that adaptive evolution may occur in pika leptin, which may play important roles in pikas' ecological adaptation to extreme environmental stress. We speculate that cold, and probably not hypoxia, may be the primary environmental factor for driving adaptive evolution of pika leptin. PMID:18213380

Cloning and characterization of the gene encoding the endopolygalacturonase-inhibiting protein (PGIP) of Phaseolus vulgaris L.

PubMed

Toubart, P; Desiderio, A; Salvi, G; Cervone, F; Daroda, L; De Lorenzo, G

1992-05-01

Polygalacturonase-inhibiting protein (PGIP) is a cell wall protein purified from hypocotyls of true bean (Phaseolus vulgaris L.). PGIP inhibits fungal endopolygalacturonases and is considered to be an important factor for plant resistance to phytopathogenic fungi (Albersheim and Anderson, 1971; Cervone et al., 1987). The amino acid sequences of the N-terminus and one internal tryptic peptide of the PGIP purified from P. vulgaris cv. Pinto were used to design redundant oligonucleotides that were successfully utilized as primers in a polymerase chain reaction (PCR) with total DNA of P. vulgaris as a template. A DNA band of 758 bp (a specific PCR amplification product of part of the gene coding for PGIP) was isolated and cloned. By using the 758-bp DNA as a hybridization probe, a lambda clone containing the PGIP gene was isolated from a genomic library of P. vulgaris cv. Saxa. The coding and immediate flanking regions of the PGIP gene, contained on a subcloned 3.3 kb SalI-SalI DNA fragment, were sequenced. A single, continuous ORF of 1026 nt (342 amino acids) was present in the genomic clone. The nucleotide and deduced amino acid sequences of the PGIP gene showed no significant similarity with any known databank sequence. Northern blotting analysis of poly(A)+ RNAs, isolated from various tissues of bean seedlings or from suspension-cultured bean cells, were also performed using the cloned PCR-generated DNA as a probe. A 1.2 kb transcript was detected in suspension-cultured cells and, to a lesser extent, in leaves, hypocotyls, and flowers.(ABSTRACT TRUNCATED AT 250 WORDS)

A fosmid cloning strategy for detecting the widest possible spectrum of microbes from the international space station drinking water system.

PubMed

Choi, Sangdun; Chang, Mi Sook; Stuecker, Tara; Chung, Christine; Newcombe, David A; Venkateswaran, Kasthuri

2012-12-01

In this study, fosmid cloning strategies were used to assess the microbial populations in water from the International Space Station (ISS) drinking water system (henceforth referred to as Prebiocide and Tank A water samples). The goals of this study were: to compare the sensitivity of the fosmid cloning strategy with that of traditional culture-based and 16S rRNA-based approaches and to detect the widest possible spectrum of microbial populations during the water purification process. Initially, microbes could not be cultivated, and conventional PCR failed to amplify 16S rDNA fragments from these low biomass samples. Therefore, randomly primed rolling-circle amplification was used to amplify any DNA that might be present in the samples, followed by size selection by using pulsed-field gel electrophoresis. The amplified high-molecular-weight DNA from both samples was cloned into fosmid vectors. Several hundred clones were randomly selected for sequencing, followed by Blastn/Blastx searches. Sequences encoding specific genes from Burkholderia, a species abundant in the soil and groundwater, were found in both samples. Bradyrhizobium and Mesorhizobium, which belong to rhizobia, a large community of nitrogen fixers often found in association with plant roots, were present in the Prebiocide samples. Ralstonia, which is prevalent in soils with a high heavy metal content, was detected in the Tank A samples. The detection of many unidentified sequences suggests the presence of potentially novel microbial fingerprints. The bacterial diversity detected in this pilot study using a fosmid vector approach was higher than that detected by conventional 16S rRNA gene sequencing.

Characterization of species-specific repeated DNA sequences from B. nigra.

PubMed

Gupta, V; Lakshmisita, G; Shaila, M S; Jagannathan, V; Lakshmikumaran, M S

1992-07-01

The construction and characterization of two genome-specific recombinant DNA clones from B. nigra are described. Southern analysis showed that the two clones belong to a dispersed repeat family. They differ from each other in their length, distribution and sequence, though the average GC content is nearly the same (45%). These B genome-specific repeats have been used to analyse the phylogenetic relationships between cultivated and wild species of the family Brassicaceae.

Complete sequence of the first chimera genome constructed by cloning the whole genome of Synechocystis strain PCC6803 into the Bacillus subtilis 168 genome.

PubMed

Watanabe, Satoru; Shiwa, Yuh; Itaya, Mitsuhiro; Yoshikawa, Hirofumi

2012-12-01

Genome synthesis of existing or designed genomes is made feasible by the first successful cloning of a cyanobacterium, Synechocystis PCC6803, in Gram-positive, endospore-forming Bacillus subtilis. Whole-genome sequence analysis of the isolate and parental B. subtilis strains provides clues for identifying single nucleotide polymorphisms (SNPs) in the 2 complete bacterial genomes in one cell.

Molecular evidence for zoonotic transmission of an emergent, highly pathogenic Campylobacter jejuni clone in the United States.

PubMed

Sahin, Orhan; Fitzgerald, Collette; Stroika, Steven; Zhao, Shaohua; Sippy, Rachel J; Kwan, Patrick; Plummer, Paul J; Han, Jing; Yaeger, Michael J; Zhang, Qijing

2012-03-01

Campylobacter jejuni is a major zoonotic pathogen. A highly virulent, tetracycline-resistant C. jejuni clone (clone SA) has recently emerged in ruminant reservoirs and has become the predominant cause of sheep abortion in the United States. To determine whether clone SA is associated with human disease, we compared the clinical isolates of clone SA from sheep abortions with the human isolates of the PulseNet National Campylobacter databases at the CDC and the FDA using pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and serotyping. The combined SmaI and KpnI PFGE pattern designations of clone SA from sheep were indistinguishable from those of 123 (9.03%) human C. jejuni isolates (total, 1,361) in the CDC database, among which 56 were associated with sporadic infections and 67 were associated with outbreaks that occurred in multiple states from 2003 to 2010. Most of the outbreaks were attributed to raw milk, while the sources for most of the sporadic cases were unknown. All clone SA isolates examined, including PFGE-matched human isolates, belong to sequence type 8 (ST-8) by MLST and serotype HS:1,8, further indicating the clonality of the related isolates from different host species. Additionally, C. jejuni clone SA was identified in raw milk, cattle feces, the feces and bile of healthy sheep, and abortion cases of cattle and goats, indicating the broad distribution of this pathogenic clone in ruminants. These results provide strong molecular and epidemiological evidence for zoonotic transmission of this emergent clone from ruminants to humans and indicate that C. jejuni clone SA is an important threat to public health.

Molecular Evidence for Zoonotic Transmission of an Emergent, Highly Pathogenic Campylobacter jejuni Clone in the United States

PubMed Central

Sahin, Orhan; Fitzgerald, Collette; Stroika, Steven; Zhao, Shaohua; Sippy, Rachel J.; Kwan, Patrick; Plummer, Paul J.; Han, Jing; Yaeger, Michael J.

2012-01-01

Campylobacter jejuni is a major zoonotic pathogen. A highly virulent, tetracycline-resistant C. jejuni clone (clone SA) has recently emerged in ruminant reservoirs and has become the predominant cause of sheep abortion in the United States. To determine whether clone SA is associated with human disease, we compared the clinical isolates of clone SA from sheep abortions with the human isolates of the PulseNet National Campylobacter databases at the CDC and the FDA using pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and serotyping. The combined SmaI and KpnI PFGE pattern designations of clone SA from sheep were indistinguishable from those of 123 (9.03%) human C. jejuni isolates (total, 1,361) in the CDC database, among which 56 were associated with sporadic infections and 67 were associated with outbreaks that occurred in multiple states from 2003 to 2010. Most of the outbreaks were attributed to raw milk, while the sources for most of the sporadic cases were unknown. All clone SA isolates examined, including PFGE-matched human isolates, belong to sequence type 8 (ST-8) by MLST and serotype HS:1,8, further indicating the clonality of the related isolates from different host species. Additionally, C. jejuni clone SA was identified in raw milk, cattle feces, the feces and bile of healthy sheep, and abortion cases of cattle and goats, indicating the broad distribution of this pathogenic clone in ruminants. These results provide strong molecular and epidemiological evidence for zoonotic transmission of this emergent clone from ruminants to humans and indicate that C. jejuni clone SA is an important threat to public health. PMID:22189122

Massive dominance of Epsilonproteobacteria in formation waters from a Canadian oil sands reservoir containing severely biodegraded oil

PubMed Central

Hubert, Casey R J; Oldenburg, Thomas B P; Fustic, Milovan; Gray, Neil D; Larter, Stephen R; Penn, Kevin; Rowan, Arlene K; Seshadri, Rekha; Sherry, Angela; Swainsbury, Richard; Voordouw, Gerrit; Voordouw, Johanna K; Head, Ian M

2012-01-01

Summary The subsurface microbiology of an Athabasca oil sands reservoir in western Canada containing severely biodegraded oil was investigated by combining 16S rRNA gene- and polar lipid-based analyses of reservoir formation water with geochemical analyses of the crude oil and formation water. Biomass was filtered from formation water, DNA was extracted using two different methods, and 16S rRNA gene fragments were amplified with several different primer pairs prior to cloning and sequencing or community fingerprinting by denaturing gradient gel electrophoresis (DGGE). Similar results were obtained irrespective of the DNA extraction method or primers used. Archaeal libraries were dominated by Methanomicrobiales (410 of 414 total sequences formed a dominant phylotype affiliated with a Methanoregula sp.), consistent with the proposed dominant role of CO2-reducing methanogens in crude oil biodegradation. In two bacterial 16S rRNA clone libraries generated with different primer pairs, > 99% and 100% of the sequences were affiliated with Epsilonproteobacteria (n = 382 and 72 total clones respectively). This massive dominance of Epsilonproteobacteria sequences was again obtained in a third library (99% of sequences; n = 96 clones) using a third universal bacterial primer pair (inosine-341f and 1492r). Sequencing of bands from DGGE profiles and intact polar lipid analyses were in accordance with the bacterial clone library results. Epsilonproteobacterial OTUs were affiliated with Sulfuricurvum, Arcobacter and Sulfurospirillum spp. detected in other oil field habitats. The dominant organism revealed by the bacterial libraries (87% of all sequences) is a close relative of Sulfuricurvum kujiense – an organism capable of oxidizing reduced sulfur compounds in crude oil. Geochemical analysis of organic extracts from bitumen at different reservoir depths down to the oil water transition zone of these oil sands indicated active biodegradation of dibenzothiophenes, and stable sulfur isotope ratios for elemental sulfur and sulfate in formation waters were indicative of anaerobic oxidation of sulfur compounds. Microbial desulfurization of crude oil may be an important metabolism for Epsilonproteobacteria indigenous to oil reservoirs with elevated sulfur content and may explain their prevalence in formation waters from highly biodegraded petroleum systems. PMID:21824242

A hybrid BAC physical map of potato: a framework for sequencing a heterozygous genome

PubMed Central

2011-01-01

Background Potato is the world's third most important food crop, yet cultivar improvement and genomic research in general remain difficult because of the heterozygous and tetraploid nature of its genome. The development of physical map resources that can facilitate genomic analyses in potato has so far been very limited. Here we present the methods of construction and the general statistics of the first two genome-wide BAC physical maps of potato, which were made from the heterozygous diploid clone RH89-039-16 (RH). Results First, a gel electrophoresis-based physical map was made by AFLP fingerprinting of 64478 BAC clones, which were aligned into 4150 contigs with an estimated total length of 1361 Mb. Screening of BAC pools, followed by the KeyMaps in silico anchoring procedure, identified 1725 AFLP markers in the physical map, and 1252 BAC contigs were anchored the ultradense potato genetic map. A second, sequence-tag-based physical map was constructed from 65919 whole genome profiling (WGP) BAC fingerprints and these were aligned into 3601 BAC contigs spanning 1396 Mb. The 39733 BAC clones that overlap between both physical maps provided anchors to 1127 contigs in the WGP physical map, and reduced the number of contigs to around 2800 in each map separately. Both physical maps were 1.64 times longer than the 850 Mb potato genome. Genome heterozygosity and incomplete merging of BAC contigs are two factors that can explain this map inflation. The contig information of both physical maps was united in a single table that describes hybrid potato physical map. Conclusions The AFLP physical map has already been used by the Potato Genome Sequencing Consortium for sequencing 10% of the heterozygous genome of clone RH on a BAC-by-BAC basis. By layering a new WGP physical map on top of the AFLP physical map, a genetically anchored genome-wide framework of 322434 sequence tags has been created. This reference framework can be used for anchoring and ordering of genomic sequences of clone RH (and other potato genotypes), and opens the possibility to finish sequencing of the RH genome in a more efficient way via high throughput next generation approaches. PMID:22142254

Automated sample-preparation technologies in genome sequencing projects.

PubMed

Hilbert, H; Lauber, J; Lubenow, H; Düsterhöft, A

2000-01-01

A robotic workstation system (BioRobot 96OO, QIAGEN) and a 96-well UV spectrophotometer (Spectramax 250, Molecular Devices) were integrated in to the process of high-throughput automated sequencing of double-stranded plasmid DNA templates. An automated 96-well miniprep kit protocol (QIAprep Turbo, QIAGEN) provided high-quality plasmid DNA from shotgun clones. The DNA prepared by this procedure was used to generate more than two mega bases of final sequence data for two genomic projects (Arabidopsis thaliana and Schizosaccharomyces pombe), three thousand expressed sequence tags (ESTs) plus half a mega base of human full-length cDNA clones, and approximately 53,000 single reads for a whole genome shotgun project (Pseudomonas putida).

T cell receptor (TCR) structure of autologous melanoma-reactive cytotoxic T lymphocyte (CTL) clones: tumor-infiltrating lymphocytes overexpress in vivo the TCR beta chain sequence used by an HLA-A2- restricted and melanocyte-lineage-specific CTL clone

PubMed Central

1993-01-01

HLA-A2+ melanomas express common melanoma-associated antigens (Ags) recognized in vitro by autologous cytotoxic T lymphocytes (CTL). However, it is not known whether tumor Ags can drive in vivo a selective accumulation/expansion of Ag-specific, tumor-infiltrating T lymphocytes (TIL). Therefore, to evaluate this possibility, 39 CTL clones isolated from several independent mixed lymphocyte tumor cultures (MLTC) of TIL and peripheral blood lymphocytes (PBL) of an HLA- A2+ melanoma patient and selected for T cell receptor (TCR)-dependent, HLA-restricted tumor lysis, were used for analysis of TCR alpha and beta chain structure by the cDNA polymerase chain reaction (PCR) technique with variable gene-specific primers followed by sequencing. Despite absence of oligoclonality in fresh TIL and PBL, as well as in T cells of day 28 MLTC (day of cloning), sequence analysis of TCR alpha and beta chains of TIL clones revealed a dominance of a major category of melanoma-specific, HLA-A2-restricted T cells expressing a V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1 TCR. The same TCR was also found in 2 out of 14 PBL clones. The other PBL clones employed a V alpha 2.1 gene segment associated with either V beta 13.2, 14, or w22. Clones A81 (V alpha 2.1/J alpha IGRJ alpha 04/C alpha and V beta 14/D beta 1/J beta 1.2/C beta 1) and A21 (V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1), representative of the two most frequent TCR of PBL and TIL, respectively, expressed different lytic patterns, but both were HLA-A2 restricted and lysed only HLA-A2+ melanomas and normal melanocytes, thus indicating recognition of two distinct HLA-A2-associated and tissue-related Ags. Finally, by the inverse PCR technique, the specific TCR beta chain (V beta 2.1/D beta 1/J beta 1.1/C beta 1) expressed by the dominant TIL clone was found to represent 19 and 18.4% of all V beta 2 sequences expressed in the fresh tumor sample and in the purified TIL, respectively, but < 0.19% of V beta 2+ sequences expressed in PBL. These results are consistent with the hypothesis that a clonal expansion/accumulation of a melanocyte-lineage-specific and HLA-A2-restricted T cell clone occurred in vivo at the site of tumor growth. PMID:8376931

Sequence Analysis and Expression of a Blue-light Photoreceptor Gene, Slwc-1 from the Cauliflower Mushroom Sparassis latifolia.

PubMed

Yang, Chi; Ma, Lu; Ying, Zhenghe; Jiang, Xiaoling; Lin, Yanquan

2017-04-01

Light is a necessary environmental factor for fruit body formation and development of the cauliflower mushroom Sparassis latifolia, a well-known edible and medicinal fungus. In this study, we firstly characterized the SP-C strain, which belonged to S. latifolia. And then we cloned and sequenced a photoreceptor gene (Slwc-1) from S. latifolia. The product of Slwc-1, SlWC-1 (872 aa residues) contained a coiled-coil region, a LOV domain, and two PAS domains. Phylogenetic tree result showed that SLWC-1 was most close to GfWC-1 from Grifola frondosa in edible and medicinal fungus. The Slwc-1 gene was found to be enhanced by light. This report will help to open the still-unexplored field of fruit body development for this fungus.

Cytochrome P450 20A1 in zebrafish: Cloning, regulation and potential involvement in hyperactivity disorders

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lemaire, Benjamin; Kubota, Akira; O'Meara, Conor M.

Cytochrome P450 (CYP) enzymes for which there is no functional information are considered “orphan” CYPs. Previous studies showed that CYP20A1, an orphan, is expressed in human hippocampus and substantia nigra, and in zebrafish (Danio rerio) CYP20A1 maternal transcript occurs in eggs, suggesting involvement in brain and in early development. Moreover, hyperactivity is reported in humans with chromosome 2 microdeletions including CYP20A1. We examined CYP20A1 in zebrafish, including impacts of chemical exposure on expression. Zebrafish CYP20A1 cDNA was cloned, sequenced, and aligned with cloned human CYP20A1 and predicted vertebrate orthologs. CYP20A1s share a highly conserved N-terminal region and unusual sequences inmore » the I-helix and the heme-binding CYP signature motifs. CYP20A1 mRNA expression was observed in adult zebrafish organs including the liver, heart, gonads, spleen and brain, as well as the eye and optic nerve. Putative binding sites in proximal promoter regions of CYP20A1s, and response of zebrafish CYP20A1 to selected nuclear and xenobiotic receptor agonists, point to up-regulation by agents involved in steroid hormone response, cholesterol and lipid metabolism. There also was a dose-dependent reduction of CYP20A1 expression in embryos exposed to environmentally relevant levels of methylmercury. Morpholino knockdown of CYP20A1 in developing zebrafish resulted in behavioral effects, including hyperactivity and a slowing of the optomotor response in larvae. The results suggest that altered expression of CYP20A1 might be part of a mechanism linking methylmercury exposure to neurobehavioral deficits. The expanded information on CYP20A1 brings us closer to “deorphanization”, that is, identifying CYP20A1 functions and its roles in health and disease. - Highlights: • The “orphan” CYP20A1 was cloned from zebrafish and its sequence analyzed. • Knockdown of CYP20A1 reduced an optomotor response and elicited bursts of activity. • Effects of knockdown resemble some features of a microdeletion of CYP20A1 in human. • Expression of CYP20A1 was downregulated by the neurotoxicant methylmercury. • CYP20A1 may be involved in neurobehavioral processes and effects of some chemicals.« less

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

PubMed

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Gene Transfer and Molecular Cloning of the Human NGF Receptor

NASA Astrophysics Data System (ADS)

Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

1986-04-01

Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Proline biosynthesis genes and their regulation under salinity stress in the euryhaline copepod Tigriopus californicus.

PubMed

Willett, Christopher S; Burton, Ronald S

2002-08-01

Diverse organisms regulate concentrations of intracellular organic osmolytes in response to changes in environmental salinity or desiccation. In marine crustaceans, accumulation of high concentrations of proline is a dominant component of response to hyperosmotic stress. In the euryhaline copepod Tigriopus californicus, synthesis of proline from its metabolic precursor glutamate is tightly regulated by changes in environmental salinity. Here, for the first time in a marine invertebrate, the genes responsible for this pathway have been cloned and characterized. The two proteins display the sequence features of homologous enzymes identified from other eukaryotes. One of the cloned genes, delta1-pyrroline-5-carboxylase reductase (P5CR), is demonstrated to have the reductase enzyme activity when expressed in proline-auxotroph bacteria, while the second, delta1-pyrroline-5-carboxylase synthase (P5CS), does not rescue proline-auxotroph bacteria. In contrast to results from higher plants, neither levels of P5CS nor P5CR mRNAs increase in response to salinity stress in T. californicus. Hence, regulation of proline synthesis during osmotic stress in T. californicus is likely mediated by some form of post-transcriptional regulation of either P5CS or P5CR. Understanding the regulation this pathway may elucidate the mechanisms limiting the salinity ranges of marine taxa. Copyright 2002 Elsevier Science Inc.

Cloning and Sequencing of Defective Particles Derived from the Autonomous Parvovirus Minute Virus of Mice for the Construction of Vectors with Minimal cis-Acting Sequences

PubMed Central

Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick

2001-01-01

The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501

Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

PubMed Central

Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

1986-01-01

Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

NASA Astrophysics Data System (ADS)

Sun, S. M.; Slightom, J. L.; Hall, T. C.

1981-01-01

A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

Worldwide Diversity and Occurrence of Arsenite Transporter acr3(2) Suggests an Important and Overlooked Pathway

NASA Astrophysics Data System (ADS)

Mailloux, B. J.; Wagner, P.; Foster, R.; Stolz, J. F.; Scholz, M.; Wovkulich, K.; Freyer, G. A.

2009-12-01

Arsenic is a toxic element that occurs naturally in the environment. Microorganisms have detoxification pathways that involve the expulsion of arsenite from the cytoplasm. The genes encoding these processes, including acr3(2), have been well studied in laboratory. However, comparatively less is known of detoxification genes in the environment. Here we report on the environmental diversity of acr3(2), an arsenite transporter gene, in 15 samples from a variety of habitats, including 2 marine samples from near the Amazon River plume, 2 sediment samples from California Soda Lakes (Mono and Searle), 8 groundwater samples from Bangladesh, 1 sediment sample from Union Lake, NJ, and 2 microcosm experiments using sediment from the Vineland Chemical Co Superfund site, NJ amended with acetate and arsenate. These sites were chosen to represent a variety arsenic impacted environments. Aqueous concentrations of arsenic ranged from below 13 nM to 5.6 mM (1 ppb to 422 ppm). Fifteen clone libraries were generated, and the 304 unique sequences clustered with or near Proteobacteria, Cyanobacteria , Euryarchaeota (Archaea),Acidobacteria, Thermatogae (Archaea), Planctomycetes, Bacteroidetes and Firmicutes. Thus, the acr3(2) gene appears to be highly conserved worldwide and across the domains of Archaea and Bacteria. Comparison of clone libraries, however, indicated that individual sites had distinct communities. Rarefraction analysis and CHAO1 estimation of species richness showed that even with 1406 available acr sequences from JGI and this study, the known diversity of the gene is not saturated. These results suggests that the acr3(2) gene and detoxification in general may be more important than previously thought in environmental arsenic cycling and mobilization.

Mycobiome of the bat white nose syndrome affected caves and mines reveals diversity of fungi and local adaptation by the fungal pathogen Pseudogymnoascus (Geomyces) destructans.

PubMed

Zhang, Tao; Victor, Tanya R; Rajkumar, Sunanda S; Li, Xiaojiang; Okoniewski, Joseph C; Hicks, Alan C; Davis, April D; Broussard, Kelly; LaDeau, Shannon L; Chaturvedi, Sudha; Chaturvedi, Vishnu

2014-01-01

Current investigations of bat White Nose Syndrome (WNS) and the causative fungus Pseudogymnoascus (Geomyces) destructans (Pd) are intensely focused on the reasons for the appearance of the disease in the Northeast and its rapid spread in the US and Canada. Urgent steps are still needed for the mitigation or control of Pd to save bats. We hypothesized that a focus on fungal community would advance the understanding of ecology and ecosystem processes that are crucial in the disease transmission cycle. This study was conducted in 2010-2011 in New York and Vermont using 90 samples from four mines and two caves situated within the epicenter of WNS. We used culture-dependent (CD) and culture-independent (CI) methods to catalogue all fungi ('mycobiome'). CD methods included fungal isolations followed by phenotypic and molecular identifications. CI methods included amplification of DNA extracted from environmental samples with universal fungal primers followed by cloning and sequencing. CD methods yielded 675 fungal isolates and CI method yielded 594 fungal environmental nucleic acid sequences (FENAS). The core mycobiome of WNS comprised of 136 operational taxonomic units (OTUs) recovered in culture and 248 OTUs recovered in clone libraries. The fungal community was diverse across the sites, although a subgroup of dominant cosmopolitan fungi was present. The frequent recovery of Pd (18% of samples positive by culture) even in the presence of dominant, cosmopolitan fungal genera suggests some level of local adaptation in WNS-afflicted habitats, while the extensive distribution of Pd (48% of samples positive by real-time PCR) suggests an active reservoir of the pathogen at these sites. These findings underscore the need for integrated disease control measures that target both bats and Pd in the hibernacula for the control of WNS.

Response of bacterial pdo1, nah, and C12O genes to aged soil PAH pollution in a coke factory area.

PubMed

Han, Xue-Mei; Liu, Yu-Rong; Zheng, Yuan-Ming; Zhang, Xiao-Xia; He, Ji-Zheng

2014-01-01

Soil pollution caused by polycyclic aromatic hydrocarbons (PAHs) is threatening human health and environmental safety. Investigating the relative prevalence of different PAH-degrading genes in PAH-polluted soils and searching for potential bioindicators reflecting the impact of PAH pollution on microbial communities are useful for microbial monitoring, risk evaluation, and potential bioremediation of soils polluted by PAHs. In this study, three functional genes, pdo1, nah, and C12O, which might be involved in the degradation of PAHs from a coke factory, were investigated by real-time quantitative PCR (qPCR) and clone library approaches. The results showed that the pdo1 and C12O genes were more abundant than the nah gene in the soils. There was a significantly positive relationship between the nah or pdo1 gene abundances and PAH content, while there was no correlation between C12O gene abundance and PAH content. Analyses of clone libraries showed that all the pdo1 sequences were grouped into Mycobacterium, while all the nah sequences were classified into three groups: Pseudomonas, Comamonas, and Polaromonas. These results indicated that the abundances of nah and pdo1 genes were positively influenced by levels of PAHs in soil and could be potential microbial indicators reflecting the impact of soil PAH pollution and that Mycobacteria were one of the most prevalent PAHs degraders in these PAH-polluted soils. Principal component analysis (PCA) and correlation analyses between microbial parameters and environmental factors revealed that total carbon (TC), total nitrogen (TN), and dissolved organic carbon (DOC) had positive effects on the abundances of all PAH-degrading genes. It suggests that increasing TC, TN, and DOC inputs could be a useful way to remediate PAH-polluted soils.

Spatial constraints govern competition of mutant clones in human epidermis.

PubMed

Lynch, M D; Lynch, C N S; Craythorne, E; Liakath-Ali, K; Mallipeddi, R; Barker, J N; Watt, F M

2017-10-24

Deep sequencing can detect somatic DNA mutations in tissues permitting inference of clonal relationships. This has been applied to human epidermis, where sun exposure leads to the accumulation of mutations and an increased risk of skin cancer. However, previous studies have yielded conflicting conclusions about the relative importance of positive selection and neutral drift in clonal evolution. Here, we sequenced larger areas of skin than previously, focusing on cancer-prone skin spanning five decades of life. The mutant clones identified were too large to be accounted for solely by neutral drift. Rather, using mathematical modelling and computational lattice-based simulations, we show that observed clone size distributions can be explained by a combination of neutral drift and stochastic nucleation of mutations at the boundary of expanding mutant clones that have a competitive advantage. These findings demonstrate that spatial context and cell competition cooperate to determine the fate of a mutant stem cell.

Molecular analysis of microflora associated with dentoalveolar abscesses.

PubMed Central

Dymock, D; Weightman, A J; Scully, C; Wade, W G

1996-01-01

The microflora associated with three dentoalveolar abscesses was determined by cultural and molecular methods. 16S rRNA genes were randomly amplified by means of conserved eubacterial primers and cloned. Restriction fragment length polymorphism analysis of the clones and amplified genes encoding 16S rRNA from the cultured bacteria was used to detect putative unculturable bacteria. Clones representative of five predominant groups of uncultured organisms were sequenced. Two were identified as Porphyromonas gingivalis and Prevotella oris, and one was found to be closely related to Peptostreptococcus micros. The remaining two clones did not correspond to known, previously sequenced organisms. One was related to Zoogloea ramigera, a species of aerobic waterborne organisms, while the other was distantly related to the genus Prevotella. This study has demonstrated the possibility of the characterization of microflora associated with human infection by molecular methods without the inherent biases of culture. PMID:8904410

In vitro resistance to 5-nitroimidazoles and benzimidazoles in Giardia duodenalis: variability and variation in gene expression.

PubMed

Argüello-García, Raúl; Cruz-Soto, Maricela; Romero-Montoya, Lydia; Ortega-Pierres, Guadalupe

2009-12-01

The susceptibility of Giardia duodenalis trophozoites exposed in vitro to sublethal concentrations of metronidazole (MTZ) and albendazole (ABZ) may exhibit inter-culture (variability) and intra-culture (variation) differences in drug susceptibility. It was previously reported that MTZ-resistant trophozoites may display changes in pyruvate:ferredoxin oxidoreductase (PFOR) expression while changes at the beta-tubulin molecule are apparently absent in ABZ-resistant cultures. To assess the levels of gene expression of these molecules, we obtained cloned cultures growing at concentrations up to 23 microM MTZ (WBRM23) and up to 8muM ABZ (WBRA8) and gene sequence and expression of pfor and beta-tubulin loci were compared with these of drug-susceptible clone WB1. Neither the pfor nor the beta-tubulin genes showed changes at sequence level but the MTZ-resistant clones WBRM21 and WBRM23 showed up-regulation of the pfor RNA using the gdh gene as reference. By using WB1 and WBRA8 clones in representational difference analyses of gene expression (RDA) an insert referred to as ARR-VSP was selected and sequenced. It showed the highest homology to one VSP molecule in the Giardia Genome Database (orf GL50803_101765). This isogene was up-regulated in five ABZ-resistant clones and the clone WBRA8 exhibited the highest RNA expression level. When successive progenies of clones WB1, WBRM23 and WBRA8 were analyzed in Northern blot assays to detect pfor and ARR-VSP RNAs respectively, the expression patterns showed variation for both genes but it was much lower in the clone WBRA8. These results suggest that G. duodenalis cultures either susceptible or resistant to MTZ and ABZ may display variability and variation at RNA expression levels albeit these were more marked in the MTZ-resistant parasites. These data might have further implications defining major mechanisms involved in drug resistance of Giardia.

Regulation of pathogenicity in hop stunt viroid-related group II citrus viroids.

PubMed

Reanwarakorn, K; Semancik, J S

1998-12-01

Nucleotide sequences were determined for two hop stunt viroid-related Group II citrus viroids characterized as either a cachexia disease non-pathogenic variant (CVd-IIa) or a pathogenic variant (CVd-IIb). Sequence identity between the two variants of 95.6% indicated a conserved genome with the principal region of nucleotide difference clustered in the variable (V) domain. Full-length viroid RT-PCR cDNA products were cloned into plasmid SP72. Viroid cDNA clones as well as derived RNA transcripts were transmissible to citron (Citrus medica L.) and Luffa aegyptiaca Mill. To determine the locus of cachexia pathogenicity as well as symptom expression in Luffa, chimeric viroid cDNA clones were constructed from segments of either the left terminal, pathogenic and conserved (T1-P-C) domains or the conserved, variable and right terminal (C-V-T2) domains of CVd-IIa or CVd-IIb in reciprocal exchanges. Symptoms induced by the various chimeric constructs on the two bioassay hosts reflected the differential response observed with CVd-IIa and -IIb. Constructs with the C-V-T2 domains region from clone-IIa induced severe symptoms on Luffa typical of CVd-IIa, but were non-symptomatic on mandarin as a bioassay host for the cachexia disease. Constructs with the same region (C-V-T2) from the clone-IIb genome induced only mild symptoms on Luffa, but produced a severe reaction on mandarin, as observed for CVd-IIb. Specific site-directed mutations were introduced into the V domain of the CVd-IIa clone to construct viroid cDNA clones with either partial or complete conversions to the CVd-IIb sequence. With the introduction of six site-specific changes into the V domain of the clone-IIa genome, cachexia pathogenicity was acquired as well as a moderation of severe symptoms on Luffa.

Unprecedented Melioidosis Cases in Northern Australia Caused by an Asian Burkholderia pseudomallei Strain Identified by Using Large-Scale Comparative Genomics

PubMed Central

Smith, Emma J.; MacHunter, Barbara; Harrington, Glenda; Theobald, Vanessa; Hall, Carina M.; Hornstra, Heidie M.; McRobb, Evan; Podin, Yuwana; Mayo, Mark; Sahl, Jason W.; Wagner, David M.; Keim, Paul; Kaestli, Mirjam; Currie, Bart J.

2015-01-01

Melioidosis is a disease of humans and animals that is caused by the saprophytic bacterium Burkholderia pseudomallei. Once thought to be confined to certain locations, the known presence of B. pseudomallei is expanding as more regions of endemicity are uncovered. There is no vaccine for melioidosis, and even with antibiotic administration, the mortality rate is as high as 40% in some regions that are endemic for the infection. Despite high levels of recombination, phylogenetic reconstruction of B. pseudomallei populations using whole-genome sequencing (WGS) has revealed surprisingly robust biogeographic separation between isolates from Australia and Asia. To date, there have been no confirmed autochthonous melioidosis cases in Australia caused by an Asian isolate; likewise, no autochthonous cases in Asia have been identified as Australian in origin. Here, we used comparative genomic analysis of 455 B. pseudomallei genomes to confirm the unprecedented presence of an Asian clone, sequence type 562 (ST-562), in Darwin, northern Australia. First observed in Darwin in 2005, the incidence of melioidosis cases attributable to ST-562 infection has steadily risen, and it is now a common strain in Darwin. Intriguingly, the Australian ST-562 appears to be geographically restricted to a single locale and is genetically less diverse than other common STs from this region, indicating a recent introduction of this clone into northern Australia. Detailed genomic and epidemiological investigations of new clinical and environmental B. pseudomallei isolates in the Darwin region and ST-562 isolates from Asia will be critical for understanding the origin, distribution, and dissemination of this emerging clone in northern Australia. PMID:26607593

Metagenomes of complex microbial consortia derived from different soils as sources for novel genes conferring formation of carbonyls from short-chain polyols on Escherichia coli.

PubMed

Knietsch, Anja; Waschkowitz, Tanja; Bowien, Susanne; Henne, Anke; Daniel, Rolf

2003-01-01

Metagenomic DNA libraries from three different soil samples (meadow, sugar beet field, cropland) were constructed. The three unamplified libraries comprised approximately 1267000 independent clones and harbored approximately 4.05 Gbp of environmental DNA. Approximately 300000 recombinant Escherichia coli strains of each library per test substrate were screened for the production of carbonyls from short-chain (C2 to C4) polyols such as 1,2-ethanediol, 2,3-butanediol, and a mixture of glycerol and 1,2-propanediol on indicator agar. Twenty-four positive E. COLI clones were obtained during the initial screen. Fifteen of them contained recombinant plasmids, designated pAK201-215, which conferred a stable carbonyl-forming phenotype on E. coli Sequencing revealed that the inserts of pAK201-215 encoded 26 complete and 14 incomplete predicted protein-encoding genes. Most of these genes were similar to genes with unknown functions from other microorganisms or unrelated to any other known gene. The further analysis was focused on the 7 plasmids (pAK204, pAK206, pAK208, and pAK210-213) recovered from the positive clones, which exhibited an NAD(H)-dependent alcohol oxidoreductase activity with polyols or the correlating carbonyls as substrates in crude extracts. Three genes (ORF6, ORF24, and ORF25) conferring this activity were identified during subcloning of the inserts of pAK204, pAK211, and pAK212. The sequences of the three deduced gene products revealed no significant similarities to known alcohol oxidoreductases, but contained putative glycine-rich regions, which are characteristic for binding of nicotinamide cofactors. Copyright 2003 S. Karger AG, Basel

Effects of legacy nuclear waste on the compositional diversity and distributions of sulfate-reducing bacteria in a terrestrial subsurface aquifer.

PubMed

Bagwell, Christopher E; Liu, Xuaduan; Wu, Liyou; Zhou, Jizhong

2006-03-01

The impact of legacy nuclear waste on the compositional diversity and distribution of sulfate-reducing bacteria in a heavily contaminated subsurface aquifer was examined. dsrAB clone libraries were constructed and restriction fragment length polymorphism (RFLP) analysis used to evaluate genetic variation between sampling wells. Principal component analysis identified nickel, nitrate, technetium, and organic carbon as the primary variables contributing to well-to-well geochemical variability, although comparative sequence analysis showed the sulfate-reducing bacteria community structure to be consistent throughout contaminated and uncontaminated regions of the aquifer. Only 3% of recovered dsrAB gene sequences showed apparent membership to the Deltaproteobacteria. The remainder of recovered sequences may represent novel, deep-branching lineages that, to our knowledge, do not presently contain any cultivated members; although corresponding phylotypes have recently been reported from several different marine ecosystems. These findings imply resiliency and adaptability of sulfate-reducing bacteria to extremes in environmental conditions, although the possibility for horizontal transfer of dsrAB is also discussed.

Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

PubMed

Jiang, Xuexia; Jiao, Nianzhi

2016-09-01

Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

MagnaportheDB: a federated solution for integrating physical and genetic map data with BAC end derived sequences for the rice blast fungus Magnaporthe grisea.

PubMed

Martin, Stanton L; Blackmon, Barbara P; Rajagopalan, Ravi; Houfek, Thomas D; Sceeles, Robert G; Denn, Sheila O; Mitchell, Thomas K; Brown, Douglas E; Wing, Rod A; Dean, Ralph A

2002-01-01

We have created a federated database for genome studies of Magnaporthe grisea, the causal agent of rice blast disease, by integrating end sequence data from BAC clones, genetic marker data and BAC contig assembly data. A library of 9216 BAC clones providing >25-fold coverage of the entire genome was end sequenced and fingerprinted by HindIII digestion. The Image/FPC software package was then used to generate an assembly of 188 contigs covering >95% of the genome. The database contains the results of this assembly integrated with hybridization data of genetic markers to the BAC library. AceDB was used for the core database engine and a MySQL relational database, populated with numerical representations of BAC clones within FPC contigs, was used to create appropriately scaled images. The database is being used to facilitate sequencing efforts. The database also allows researchers mapping known genes or other sequences of interest, rapid and easy access to the fundamental organization of the M.grisea genome. This database, MagnaportheDB, can be accessed on the web at http://www.cals.ncsu.edu/fungal_genomics/mgdatabase/int.htm.

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

Human somatostatin I: sequence of the cDNA.

PubMed Central

Shen, L P; Pictet, R L; Rutter, W J

1982-01-01

RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

A second gene for acyl-(acyl-carrier-protein): glycerol-3-phosphate acyltransferase in squash, Cucurbita moschata cv. Shirogikuza(*), codes for an oleate-selective isozyme: molecular cloning and protein purification studies.

PubMed

Nishida, I; Sugiura, M; Enju, A; Nakamura, M

2000-12-01

A new isogene for acyl-(acyl-carrier-protein):glycerol-3-phosphate acyltransferase (GPAT; EC 2.3.1.15) in squash has been cloned and the gene product was identified as oleate-selective GPAT. Using PCR primers that could hybridise with exons for a previously cloned squash GPAT, we obtained two PCR products of different size: one coded for a previously cloned squash GPAT corresponding to non-selective isoforms AT2 and AT3, and the other for a new isozyme, probably the oleate-selective isoform AT1. Full-length amino acid sequences of respective isozymes were deduced from the nucleotide sequences of genomic genes and cDNAs, which were cloned by a series of PCR-based methods. Thus, we designated the new gene CmATS1;1 and the other one CmATS1;2. Genome blot analysis revealed that the squash genome contained the two isogenes at non-allelic loci. AT1-active fractions were partially purified, and three polypeptide bands were identified as being AT1 polypeptides, which exhibited relative molecular masses of 39.5-40.5 kDa, pI values of 6.75-7.15, and oleate selectivity over palmitate. Partial amino-terminal sequences obtained from two of these bands verified that the new isogene codes for AT1 polypeptides.

The rapidly emerging ESBL-producing Escherichia coli O25-ST131 clone carries LPS core synthesis genes of the K-12 type.

PubMed

Szijártó, Valéria; Pal, Tibor; Nagy, Gabor; Nagy, Eszter; Ghazawi, Akela; al-Haj, Mohammed; El Kurdi, Sylvia; Sonnevend, Agnes

2012-07-01

The clone Escherichia coli O25 ST131, typically producing extended-spectrum beta-lactamases (ESBLs), has spread globally and became the dominant type among extraintestinal isolates at many parts of the world. However, the reasons behind the emergence and success of this clone are only partially understood. We compared the core type genes by PCR of ESBL-producing and ESBL-nonproducing strains isolated from urinary tract infections in the United Arab Emirates and found a surprisingly high frequency of the K-12 core type (44.6%) among members of the former group, while in the latter one, it was as low (3.7%), as reported earlier. The high figure was almost entirely attributable to the presence of members of the clone O25 ST131 among ESBL producers. Strains from the same clone isolated in Europe also carried the K-12 core type genes. Sequencing the entire core operon of an O25 ST131 isolate revealed a high level of similarity to known K-12 core gene sequences and an almost complete identity with a recently sequenced non-O25 ST131 fecal isolate. The exact chemical structure and whether and how this unusual core type contributed to the sudden emergence of ST131 require further investigations. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Bacterial examination of endodontic infections by clonal analysis in concert with denaturing high-performance liquid chromatography.

PubMed

Jacinto, R C; Gomes, B P F A; Desai, M; Rajendram, D; Shah, H N

2007-12-01

The aim of this study was to examine the diversity of bacterial species in the infected root canals of teeth associated with endodontic abscesses by cloning and sequencing techniques in concert with denaturing high-performance liquid chromatography. Samples collected from five infected root canals were subjected to polymerase chain reaction (PCR) with universal 16S ribosomal DNA primers. Products of these PCRs were cloned and sequenced. Denaturing high-performance liquid chromatography (DHPLC) was used as a screening method to reduce the number of clones necessary for DNA sequencing. All samples were positive for the presence of bacteria and a range of 7-13 different bacteria were found per root canal sample. In total, 48 different oral clones were detected among the five root canal samples. Olsenella profusa was the only species present in all samples. Porphyromonas gingivalis, Dialister pneumosintes, Dialister invisus, Lachnospiraceae oral clone, Staphylococcus aureus, Pseudoramibacter alactolyticus, Peptostreptococcus micros and Enterococcus faecalis were found in two of the five samples. The majority of the taxa were present in only one sample, for example Tannerella forsythia, Shuttleworthia satelles and Filifactor alocis. Some facultative anaerobes that are frequently isolated from endodontic infections such as E. faecalis, Streptococcus anginosus and Lactobacillus spp. were also found in this study. Clonal analysis of the microflora associated with endodontic infections revealed a wide diversity of oral species.

Cloning, expression, and sequence analysis of the Bacillus methanolicus C1 methanol dehydrogenase gene.

PubMed Central

de Vries, G E; Arfman, N; Terpstra, P; Dijkhuizen, L

1992-01-01

The gene (mdh) coding for methanol dehydrogenase (MDH) of thermotolerant, methylotroph Bacillus methanolicus C1 has been cloned and sequenced. The deduced amino acid sequence of the mdh gene exhibited similarity to those of five other alcohol dehydrogenase (type III) enzymes, which are distinct from the long-chain zinc-containing (type I) or short-chain zinc-lacking (type II) enzymes. Highly efficient expression of the mdh gene in Escherichia coli was probably driven from its own promoter sequence. After purification of MDH from E. coli, the kinetic and biochemical properties of the enzyme were investigated. The physiological effect of MDH synthesis in E. coli and the role of conserved sequence patterns in type III alcohol dehydrogenases have been analyzed and are discussed. Images PMID:1644761

Communities of nirS-type denitrifiers in the water column of the oxygen minimum zone in the eastern South Pacific.

PubMed

Castro-González, Maribeb; Braker, Gesche; Farías, Laura; Ulloa, Osvaldo

2005-09-01

The major sites of water column denitrification in the ocean are oxygen minimum zones (OMZ), such as one in the eastern South Pacific (ESP). To understand the structure of denitrifying communities in the OMZ off Chile, denitrifier communities at two sites in the Chilean OMZ (Antofagasta and Iquique) and at different water depths were explored by terminal restriction fragment length polymorphism analysis and cloning of polymerase chain reaction (PCR)-amplified nirS genes. NirS is a functional marker gene for denitrification encoding cytochrome cd1-containing nitrite reductase, which catalyses the reduction of nitrite to nitric oxide, the key step in denitrification. Major differences were found between communities from the two geographic locations. Shifts in community structure occurred along a biogeochemical gradient at Antofagasta. Canonical correspondence analysis indicated that O2, NO3-, NO2- and depth were important environmental factors governing these communities along the biogeochemical gradient in the water column. Phylogenetic analysis grouped the majority of clones from the ESP in distinct clusters of genes from presumably novel and yet uncultivated denitrifers. These nirS clusters were distantly related to those found in the water column of the Arabian Sea but the phylogenetic distance was even higher compared with environmental sequences from marine sediments or any other habitat. This finding suggests similar environmental conditions trigger the development of denitrifiers with related nirS genotypes despite large geographic distances.

The Drosophila gene collection: Identification of putative full-length cDNAs for 70 percent of D. melanogaster genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stapleton, Mark; Liao, Guochun; Brokstein, Peter

2002-08-12

Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less

An in silico DNA cloning experiment for the biochemistry laboratory.

PubMed

Elkins, Kelly M

2011-01-01

This laboratory exercise introduces students to concepts in recombinant DNA technology while accommodating a major semester project in protein purification, structure, and function in a biochemistry laboratory for junior- and senior-level undergraduate students. It is also suitable for forensic science courses focused in DNA biology and advanced high school biology classes. Students begin by examining a plasmid map with the goal of identifying which restriction enzymes may be used to clone a piece of foreign DNA containing a gene of interest into the vector. From the National Center for Biotechnology Initiative website, students are instructed to retrieve a protein sequence and use Expasy's Reverse Translate program to reverse translate the protein to cDNA. Students then use Integrated DNA Technologies' OligoAnalyzer to predict the complementary DNA strand and obtain DNA recognition sequences for the desired restriction enzymes from New England Biolabs' website. Students add the appropriate DNA restriction sequences to the double-stranded foreign DNA for cloning into the plasmid and infecting Escherichia coli cells. Students are introduced to computational biology tools, molecular biology terminology and the process of DNA cloning in this valuable single session, in silico experiment. This project develops students' understanding of the cloning process as a whole and contrasts with other laboratory and internship experiences in which the students may be involved in only a piece of the cloning process/techniques. Students interested in pursuing postgraduate study and research or employment in an academic biochemistry or molecular biology laboratory or industry will benefit most from this experience. Copyright © 2010 Wiley Periodicals, Inc.

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Environmental genomics of "Haloquadratum walsbyi" in a saltern crystallizer indicates a large pool of accessory genes in an otherwise coherent species

PubMed Central

Legault, Boris A; Lopez-Lopez, Arantxa; Alba-Casado, Jose Carlos; Doolittle, W Ford; Bolhuis, Henk; Rodriguez-Valera, Francisco; Papke, R Thane

2006-01-01

Background Mature saturated brine (crystallizers) communities are largely dominated (>80% of cells) by the square halophilic archaeon "Haloquadratum walsbyi". The recent cultivation of the strain HBSQ001 and thesequencing of its genome allows comparison with the metagenome of this taxonomically simplified environment. Similar studies carried out in other extreme environments have revealed very little diversity in gene content among the cell lineages present. Results The metagenome of the microbial community of a crystallizer pond has been analyzed by end sequencing a 2000 clone fosmid library and comparing the sequences obtained with the genome sequence of "Haloquadratum walsbyi". The genome of the sequenced strain was retrieved nearly complete within this environmental DNA library. However, many ORF's that could be ascribed to the "Haloquadratum" metapopulation by common genome characteristics or scaffolding to the strain genome were not present in the specific sequenced isolate. Particularly, three regions of the sequenced genome were associated with multiple rearrangements and the presence of different genes from the metapopulation. Many transposition and phage related genes were found within this pool which, together with the associated atypical GC content in these areas, supports lateral gene transfer mediated by these elements as the most probable genetic cause of this variability. Additionally, these sequences were highly enriched in putative regulatory and signal transduction functions. Conclusion These results point to a large pan-genome (total gene repertoire of the genus/species) even in this highly specialized extremophile and at a single geographic location. The extensive gene repertoire is what might be expected of a population that exploits a diverse nutrient pool, resulting from the degradation of biomass produced at lower salinities. PMID:16820057

Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel

NASA Astrophysics Data System (ADS)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

PubMed

Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

1987-01-01

cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

Screening of Pro-Asp Sequences Exposed on Bacteriophage M13 as an Ideal Anchor for Gold Nanocubes.

PubMed

Lee, Hwa Kyoung; Lee, Yujean; Kim, Hyori; Lee, Hye-Eun; Chang, Hyejin; Nam, Ki Tae; Jeong, Dae Hong; Chung, Junho

2017-09-15

Bacteriophages are thought to be ideal vehicles for linking antibodies to nanoparticles. Here, we define the sequence of peptides exposed as a fusion protein on M13 bacteriophages to yield optimal binding of gold nanocubes and efficient bacteriophage amplification. We generated five helper bacteriophage libraries using AE(X) 2 DP, AE(X) 3 DP, AE(X) 4 DP, AE(X) 5 DP, and AE(X) 6 DP as the exposed portion of pVIII, in which X was a randomized amino acid residue encoded by the nucleotide sequence NNK. Efficient phage amplification was achievable only in the AE(X) 2 DP, AE(X) 3 DP, and AE(X) 4 DP libraries. Through biopanning with gold nanocubes, we enriched the phage clones and selected the clone with the highest fold change after enrichment. This clone displayed Pro-Asp on the surface of the bacteriophage and had amplification yields similar to those of the wild-type helper bacteriophage (VCSM13). The clone displayed even binding of gold nanocubes along its length and minimal aggregation after binding. We conclude that, for efficient amplification, the exposed pVIII amino acid length should be limited to six residues and Ala-Glu-Pro-Asp-Asp-Pro (AEPDDP) is the ideal fusion protein sequence for guaranteeing the optimal formation of a complex with gold nanocubes.

Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.

PubMed Central

Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A

1982-01-01

Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459

Communities of archaea and bacteria in a subsurface radioactive thermal spring in the Austrian Central Alps, and evidence of ammonia-oxidizing Crenarchaeota.

PubMed

Weidler, Gerhard W; Dornmayr-Pfaffenhuemer, Marion; Gerbl, Friedrich W; Heinen, Wolfgang; Stan-Lotter, Helga

2007-01-01

Scanning electron microscopy revealed great morphological diversity in biofilms from several largely unexplored subterranean thermal Alpine springs, which contain radium 226 and radon 222. A culture-independent molecular analysis of microbial communities on rocks and in the water of one spring, the "Franz-Josef-Quelle" in Bad Gastein, Austria, was performed. Four hundred fifteen clones were analyzed. One hundred thirty-two sequences were affiliated with 14 bacterial operational taxonomic units (OTUs) and 283 with four archaeal OTUs. Rarefaction analysis indicated a high diversity of bacterial sequences, while archaeal sequences were less diverse. The majority of the cloned archaeal 16S rRNA gene sequences belonged to the soil-freshwater-subsurface (1.1b) crenarchaeotic group; other representatives belonged to the freshwater-wastewater-soil (1.3b) group, except one clone, which was related to a group of uncultivated Euryarchaeota. These findings support recent reports that Crenarchaeota are not restricted to high-temperature environments. Most of the bacterial sequences were related to the Proteobacteria (alpha, beta, gamma, and delta), Bacteroidetes, and Planctomycetes. One OTU was allied with Nitrospina sp. (delta-Proteobacteria) and three others grouped with Nitrospira. Statistical analyses suggested high diversity based on 16S rRNA gene analyses; the rarefaction plot of archaeal clones showed a plateau. Since Crenarchaeota have been implicated recently in the nitrogen cycle, the spring environment was probed for the presence of the ammonia monooxygenase subunit A (amoA) gene. Sequences were obtained which were related to crenarchaeotic amoA genes from marine and soil habitats. The data suggested that nitrification processes are occurring in the subterranean environment and that ammonia may possibly be an energy source for the resident communities.

Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

PubMed

Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

2001-01-24

We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

SCREENING OF PROTEASE INHIBITORS RESISTANCE MUTATIONS IN HEPATITIS C VIRUS ISOLATES INFECTING ROMANIAN PATIENTS UNEXPOSED TO TRIPLE THERAPY.

PubMed

Dinu, Sorin; Calistru, Petre-Iacob; Ceauşu, Emanoil; Târdeil, Graţiela; Oprişan, Gabriela

2015-01-01

Although the European recommendations include the use of new antiviral drugs for the treatment of hepatitis C, in Romania the current treatment remains interferon plus ribavirin. First generation viral protease inhibitors (i.e. boceprevir, telaprevir), which have raised the chances of obtaining viral clearance in up to 70% of infection cases produced by genotype 1 isolates, have not been introduced yet as standard treatment in our country. The success of these new antivirals is limited by the occurrence and selection of resistance mutations during therapy. We set-up a molecular study aiming to detect any resistance mutations to boceprevir and telaprevir harbored by hepatitis C isolates infecting Romanian patients naïve to viral protease inhibitors. Since these new antivirals are efficient and approved for genotype 1 infection, viral samples were genotyped following a protocol previously developed by our research group. We analyzed by both population sequencing and molecular cloning and sequencing the NS3 protease region of hepatitis C virus isolates infecting patients which were not previously exposed to boceprevir and telaprevir. All the analyzed samples were subtype 1b and resembled the samples collected in recent years from Romanian patients. Molecular cloning followed by sequencing showed great intra-host diversity, which is known to represent the source of isolates with different resistance phenotypes. Both population sequencing and molecular cloning followed by clone sequencing revealed two boceprevir resistance mutations (T54S and V55A), respectively, a telaprevir resistance mutation (T54S) in the sequences obtained from a patient with chronic hepatitis C. To our knowledge, this is the first study indicating the existence of pre-treatment resistance mutations to boceprevir and telaprevir in hepatitis C virus isolates infecting Romanian patients.

The Chapel Hill hemophilia A dog colony exhibits a factor VIII gene inversion

PubMed Central

Lozier, Jay N.; Dutra, Amalia; Pak, Evgenia; Zhou, Nan; Zheng, Zhili; Nichols, Timothy C.; Bellinger, Dwight A.; Read, Marjorie; Morgan, Richard A.

2002-01-01

In the Chapel Hill colony of factor VIII-deficient dogs, abnormal sequence (ch8, for canine hemophilia 8, GenBank no. AF361485) follows exons 1–22 in the factor VIII transcript in place of exons 23–26. The canine hemophilia 8 locus (ch8) sequence was found in a 140-kb normal dog genomic DNA bacterial artificial chromosome (BAC) clone that was completely outside the factor VIII gene, but not in BAC clones containing the factor VIII gene. The BAC clone that contained ch8 also contained a homologue of F8A (factor 8 associated) sequence, which participates in a common inversion that causes severe hemophilia A in humans. Fluorescence in situ hybridization analysis indicated that exons 1–26 normally proceed sequentially from telomere to centromere at Xq28, and ch8 is telomeric to the factor VIII gene. The appearance of an “upstream” genomic sequence element (ch8) at the end of the aberrant factor VIII transcript suggested that an inversion of genomic DNA replaced factor VIII exons 22–26 with ch8. The F8A sequence appeared also in overlapping normal BAC clones containing factor VIII sequence. We hypothesized that homologous recombination between copies of canine F8A inside and outside the factor VIII gene had occurred, as in human hemophilia A. High-resolution fluorescent in situ hybridization on hemophilia A dog DNA revealed a pattern consistent with this inversion mechanism. We also identified a HindIII restriction fragment length polymorphism of F8A fragments that distinguished hemophilia A, carrier, and normal dogs' DNA. The Chapel Hill hemophilia A dog colony therefore replicates the factor VIII gene inversion commonly seen in humans with severe hemophilia A. PMID:12242334

Ageratum enation virus-a begomovirus of weeds with the potential to infect crops.

PubMed

Tahir, Muhammad; Amin, Imran; Haider, Muhammad Saleem; Mansoor, Shahid; Briddon, Rob W

2015-02-10

Samples of two Ageratum conyzoides, one Sonchus oleraceus and one turnip (Brassica rapa var. rapa) exhibiting virus-like symptoms were collected from Pakistan and Nepal. Full-length begomovirus clones were obtained from the four plant samples and betasatellite clones from three of these. The begomovirus sequences were shown to be isolates of Ageratum enation virus (AEV) with greater than 89.1% nucleotide sequence identity to the 26 AEV sequences available in the databases. The three betasatellite sequences were shown to be isolates of Ageratum yellow leaf curl betasatellite (AYLCB) with greater than 90% identity to the 18 AYLCB sequences available in the databases. The AEV sequences were shown to fall into two distinct strains, for which the names Nepal (consisting of isolates from Nepal, India, and Pakistan-including the isolates identified here) and India (isolates occurring only in India) strains are proposed. For the clones obtained from two AEV isolates, with their AYLCB, infectivity was shown by Agrobacterium-mediated inoculation to Nicotiana benthamiana, N. tabacum, Solanum lycopersicon and A. conyzoides. N. benthamiana plants infected with AEV alone or betasatellite alone showed no symptoms. N. benthamiana plants infected with AEV with its associated betasatellite showed leaf curl symptoms. The findings show that AEV is predominantly a virus of weeds that has the capacity to infect crops. AYLCB appears to be the common partner betasatellite of AEV and is associated with diseases with a range of very different symptoms in the same plant species. The inability to satisfy Koch's postulates with the cloned components of isolate SOL in A. conyzoides suggests that the etiology may be more complex than a single virus with a single betasatellite.

Ageratum enation virus—A Begomovirus of Weeds with the Potential to Infect Crops

PubMed Central

Tahir, Muhammad; Amin, Imran; Haider, Muhammad Saleem; Mansoor, Shahid; Briddon, Rob W.

2015-01-01

Samples of two Ageratum conyzoides, one Sonchus oleraceus and one turnip (Brassica rapa var. rapa) exhibiting virus-like symptoms were collected from Pakistan and Nepal. Full-length begomovirus clones were obtained from the four plant samples and betasatellite clones from three of these. The begomovirus sequences were shown to be isolates of Ageratum enation virus (AEV) with greater than 89.1% nucleotide sequence identity to the 26 AEV sequences available in the databases. The three betasatellite sequences were shown to be isolates of Ageratum yellow leaf curl betasatellite (AYLCB) with greater than 90% identity to the 18 AYLCB sequences available in the databases. The AEV sequences were shown to fall into two distinct strains, for which the names Nepal (consisting of isolates from Nepal, India, and Pakistan—including the isolates identified here) and India (isolates occurring only in India) strains are proposed. For the clones obtained from two AEV isolates, with their AYLCB, infectivity was shown by Agrobacterium-mediated inoculation to Nicotiana benthamiana, N. tabacum, Solanum lycopersicon and A. conyzoides. N. benthamiana plants infected with AEV alone or betasatellite alone showed no symptoms. N. benthamiana plants infected with AEV with its associated betasatellite showed leaf curl symptoms. The findings show that AEV is predominantly a virus of weeds that has the capacity to infect crops. AYLCB appears to be the common partner betasatellite of AEV and is associated with diseases with a range of very different symptoms in the same plant species. The inability to satisfy Koch’s postulates with the cloned components of isolate SOL in A. conyzoides suggests that the etiology may be more complex than a single virus with a single betasatellite. PMID:25674770

Enhanced pulmonary absorption of a macromolecule through coupling to a sequence-specific phage display-derived peptide.

PubMed

Morris, Christopher J; Smith, Mathew W; Griffiths, Peter C; McKeown, Neil B; Gumbleton, Mark

2011-04-10

With the aim of identifying a peptide sequence that promotes pulmonary epithelial transport of macromolecule cargo we used a stringent peptide-phage display library screening protocol against rat lung alveolar epithelial primary cell cultures. We identified a peptide-phage clone (LTP-1) displaying the disulphide-constrained 7-mer peptide sequence, C-TSGTHPR-C, that showed significant pulmonary epithelial translocation across highly restrictive polarised cell monolayers. Cell biological data supported a differential alveolar epithelial cell interaction of the LTP-1 peptide-phage clone and the corresponding free synthetic LTP-1 peptide. Delivering select phage-clones to the intact pulmonary barrier of an isolated perfused rat lung (IPRL) resulted in 8.7% of lung deposited LTP-1 peptide-phage clone transported from the IPRL airways to the vasculature compared (p<0.05) to the cumulative transport of less than 0.004% for control phage-clone groups. To characterise phage-independent activity of LTP-1 peptide, the LTP-1 peptide was conjugated to a 53kDa anionic PAMAM dendrimer. Compared to respective peptide-dendrimer control conjugates, the LTP-1-PAMAM conjugate displayed a two-fold (bioavailability up to 31%) greater extent of absorption in the IPRL. The LTP-1 peptide-mediated enhancement of transport, when LTP-1 was either attached to the phage clone or conjugated to dendrimer, was sequence-dependent and could be competitively inhibited by co-instillation of excess synthetic free LTP-1 peptide. The specific nature of the target receptor or mechanism involved in LTP-1 lung transport remains unclear although the enhanced transport is enabled through a mechanism that is non-disruptive with respect to the pulmonary transport of hydrophilic permeability probes. This study shows proof-of principle that array technologies can be effectively exploited to identify peptides mediating enhanced transmucosal delivery of macromolecule therapeutics across an intact organ. Copyright © 2010 Elsevier B.V. All rights reserved.

Literature and patent analysis of the cloning and identification of human functional genes in China.

PubMed

Xia, Yan; Tang, LiSha; Yao, Lei; Wan, Bo; Yang, XianMei; Yu, Long

2012-03-01

The Human Genome Project was launched at the end of the 1980s. Since then, the cloning and identification of functional genes has been a major focus of research across the world. In China too, the potentially profound impact of such studies on the life sciences and on human health was realized, and relevant studies were initiated in the 1990s. To advance China's involvement in the Human Genome Project, in the mid-1990s, Committee of Experts in Biology from National High Technology Research and Development Program of China (863 Program) proposed the "two 1%" goal. This goal envisaged China contributing 1% of the total sequencing work, and cloning and identifying 1% of the total human functional genes. Over the past 20 years, tremendous achievement has been accomplished by Chinese scientists. It is well known that scientists in China finished the 1% of sequencing work of the Human Genome Project, whereas, there is no comprehensive report about "whether China had finished cloning and identifying 1% of human functional genes". In the present study, the GenBank database at the National Center of Biotechnology Information, the PubMed search tool, and the patent database of the State Intellectual Property Office, China, were used to retrieve entries based on two screening standards: (i) Were the newly cloned and identified genes first reported by Chinese scientists? (ii) Were the Chinese scientists awarded the gene sequence patent? Entries were retrieved from the databases up to the cut-off date of 30 June 2011 and the obtained data were analyzed further. The results showed that 589 new human functional genes were first reported by Chinese scientists and 159 gene sequences were patented (http://gene.fudan.sh.cn/introduction/database/chinagene/chinagene.html). This study systematically summarizes China's contributions to human functional genomics research and answers the question "has China finished cloning and identifying 1% of human functional genes?" in the affirmative.

An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van De Loo, F.J.; Broun, P.; Turner, S.

1995-07-18

Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less

Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

PubMed

Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

2007-06-01

As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

Fast multiclonal clusterization of V(D)J recombinations from high-throughput sequencing.

PubMed

Giraud, Mathieu; Salson, Mikaël; Duez, Marc; Villenet, Céline; Quief, Sabine; Caillault, Aurélie; Grardel, Nathalie; Roumier, Christophe; Preudhomme, Claude; Figeac, Martin

2014-05-28

V(D)J recombinations in lymphocytes are essential for immunological diversity. They are also useful markers of pathologies. In leukemia, they are used to quantify the minimal residual disease during patient follow-up. However, the full breadth of lymphocyte diversity is not fully understood. We propose new algorithms that process high-throughput sequencing (HTS) data to extract unnamed V(D)J junctions and gather them into clones for quantification. This analysis is based on a seed heuristic and is fast and scalable because in the first phase, no alignment is performed with germline database sequences. The algorithms were applied to TR γ HTS data from a patient with acute lymphoblastic leukemia, and also on data simulating hypermutations. Our methods identified the main clone, as well as additional clones that were not identified with standard protocols. The proposed algorithms provide new insight into the analysis of high-throughput sequencing data for leukemia, and also to the quantitative assessment of any immunological profile. The methods described here are implemented in a C++ open-source program called Vidjil.

Identification, cloning and sequencing of Escherichia coli strain chi1378 (O78:K80) iss gene isolated from poultry colibacillosis in Iran.

PubMed

Derakhshandeh, A; Zahraei Salehi, T; Tadjbakhsh, H; Karimi, V

2009-09-01

To identify, clone and sequence the iss (increased serum survival) gene from E. coli strain chi1378 isolated from Iranian poultry and to predict its protein product, Iss. The iss gene from E. coli strain chi1378 was amplified and cloned into the pTZ57R/T vector and sequenced. From the DNA sequence, the Iss predictive protein was evaluated using bioinformatics. Iss from strain chi1378 had 100% identity with other E. coli serotypes and isolates from different origins and also 98% identity with E. coli O157:H7 Iss protein. Phylogenetic analysis showed no significant different phylogenic groups among E. coli strains. The strong association of predicted Iss protein among different E. coli strains suggests that it could be a good antigen to control and detect avian pathogenic E. coli (APEC). Because the exact pathogenesis and the role of virulence factors are unknown, the Iss protein could be used as a target for vaccination in the future, but further research is required.

[The primary structure of a vaccine strain of tobacco mosaic virus V-69].

PubMed

Shiian, A N; Mil'shina, N V; Snegireva, P B; Pukhal'skiĭ, V A

1994-12-01

A random set of cDNA fragments were synthesized on genomic RNA of TMV vaccine strain V-69, using random primers and reverse transcriptase. Following synthesis of double-stranded cDNA, they were cloned into the pUC-19 plasmid; and 28 clones were sequenced (insert size 100-500 bp). High nucleotide sequence homology of V-69 (more than 95%) was shown only with tomato strain TMV-L [1]. Sequenced clones represent 54% of the genome (50% of the replicase gene, 98% of the transport protein gene, and 60% of the coat protein gene). In this genome region, 24 base substitutions were revealed, as compared to the wild-type TMV-L sequence. Six base substitutions resulted in changes in corresponding amino acid codons. No substitutions coincided with those discovered in the related TMV vaccine strain L11A [2], while two substitutions in the replicase gene were identical to those found in TMV strain Lta1 [3], which is capable of overcoming protection in tomatoes with the resistance gene Tm-1.

Molecular analysis of Toxoplasma gondii Surface Antigen 1 (SAG1) gene cloned from Toxoplasma gondii DNA isolated from Javanese acute toxoplasmosis

NASA Astrophysics Data System (ADS)

Haryati, Sri; Agung Prasetyo, Afiono; Sari, Yulia; Dharmawan, Ruben

2018-05-01

Toxoplasma gondii Surface Antigen 1 (SAG1) is often used as a diagnostic tool due to its immunodominant-specific as antigen. However, data of the Toxoplasma gondii SAG1 protein from Indonesian isolate is limited. To study the protein, genomic DNA was isolated from a Javanese acute toxoplasmosis blood samples patient. A complete coding sequence of Toxoplasma gondii SAG1 was cloned and inserted into an Escherichia coli expression plasmid and sequenced. The sequencing results were subjected to bioinformatics analysis. The Toxoplasma gondii SAG1 complete coding sequences were successfully cloned. Physicochemical analysis revealed the 336 aa of SAG1 had 34.7 kDa of weight. The isoelectric point and aliphatic index were 8.4 and 78.4, respectively. The N-terminal methionine half-life in Escherichia coli was more than 10 hours. The antigenicity, secondary structure, and identification of the HLA binding motifs also had been discussed. The results of this study would contribute information about Toxoplasma gondii SAG1 and benefits for further works willing to develop diagnostic and therapeutic strategies against the parasite.

Molecular cloning of a putative gene encoding isopentenyltransferase from pingyitiancha (Malus hupehensis) and characterization of its response to nitrate.

PubMed

Peng, Jing; Peng, Futian; Zhu, Chunfu; Wei, Shaochong

2008-06-01

A putative isopentenyltransferase (IPT) encoding gene was identified from a pingyitiancha (Malus hupehensis Rehd.) expressed sequence tag database, and the full-length gene was cloned by RACE. Based on expression profile and sequence alignment, the nucleotide sequence of the clone, named MhIPT3, was most similar to AtIPT3, an IPT gene in Arabidopsis. The full-length cDNA contained a 963-bp open reading frame encoding a protein of 321 amino acids with a molecular mass of 37.3 kDa. Sequence analysis of genomic DNA revealed the absence of introns in the frame. Quantitative real-time PCR analysis demonstrated that the gene was expressed in roots, stems and leaves. Application of nitrate to roots of nitrogen-deprived seedlings strongly induced expression of MhIPT3 and was accompanied by the accumulation of cytokinins, whereas MhIPT3 expression was little affected by ammonium application to roots of nitrogen-deprived seedlings. Application of nitrate to leaves also up-regulated the expression of MhIPT3 and corresponded closely with the accumulation of isopentyladenine and isopentyladenosine in leaves.

Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

PubMed Central

Cai, Yongping; Lin, Yi

2013-01-01

In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

PubMed

Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

2004-12-15

cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

Mapping and characterization of vicriviroc resistance mutations from HIV-1 isolated from treatment-experienced subjects enrolled in a phase II study (VICTOR-E1).

PubMed

McNicholas, Paul M; Mann, Paul A; Wojcik, Lisa; Qiu, Ping; Lee, Erin; McCarthy, Michael; Shen, Junwu; Black, Todd A; Strizki, Julie M

2011-03-01

In the phase 2 VICTOR-E1 study, treatment-experienced subjects receiving 20 mg or 30 mg of the CCR5 antagonist vicriviroc (VCV), with a boosted protease containing optimized background regimen, experienced significantly greater reductions in HIV-1 viral load compared with control subjects. Among the 79 VCV-treated subjects, 15 experienced virologic failure, and of these 5 had VCV-resistant virus. This study investigated the molecular basis for the changes in susceptibility to VCV in these subjects. Sequence analysis and phenotypic susceptibility testing was performed on envelope clones from VCV-resistant virus. For select clones, an exchange of mutations in the V3 loop was performed between phenotypically resistant clones and the corresponding susceptible clones. Phenotypic resistance was manifest by reductions in the maximum percent inhibition. Clonal analysis of envelopes from the 5 subjects identified multiple amino acid changes in gp160 that were exclusive to the resistant clones, however, none of the changes were conserved between subjects. Introduction of V3 loop substitutions from the resistant clones into the matched susceptible clones was not sufficient to reproduce the resistant phenotype. Likewise, changing the substitutions in the V3 loops from resistant clones to match susceptible clones only restored susceptibility in 1 clone. There were no clearly conserved patterns of mutations in gp160 associated with phenotypic resistance to VCV and mutations both within and outside of the V3 loop contributed to the resistance phenotype. These data suggest that genotypic tests for VCV susceptibility may require larger training sets and additional information beyond V3 sequences.

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

PubMed Central

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-01-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

PubMed

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-12-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

Community composition of lacustrine small eukaryotes in hyper-eutrophic conditions in relation to top-down and bottom-up factors.

PubMed

Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier

2007-09-01

Small eukaryotes (0.2-5 microm) in hyper-eutrophic conditions were described using terminal restriction fragment length polymorphism and cloning-sequencing, and were related to environmental variables both by an experimental approach and by a temporal field study. In situ analysis showed marked temporal variations in the dominant terminal restriction fragments (T-RFs), which were related to environmental variables such as nutrient concentrations and metazooplankton composition. To monitor the responses of the small-eukaryote community to top-down (absence or presence of planktivorous fish) and bottom-up (low or high nitrogen and phosphorus addition) effects, a cross-classified design mesocosm experiment was used. Depending on the type of treatment, we recorded changes in the diversity of T-RFs, as well as modifications in phylogenetic composition. Centroheliozoa and Cryptophyta were found in all types of treatment, whereas Chlorophyta were specific to enclosures receiving high nutrient loadings, and were associated either with LKM11 and 'environmental sequences'. Cercozoa and Fungi were not detected in enclosures receiving high nutrient loadings and fishes. Our results showed that resources and top-down factors are both clearly involved in shaping the structure of small eukaryotes, not only autotrophs but also heterotrophs, via complex interactions and trophic cascades within a microbial loop, notably in response to nutrient loading.

Differences in community composition of bacteria in four glaciers in western China

NASA Astrophysics Data System (ADS)

An, L. Z.; Chen, Y.; Xiang, S.-R.; Shang, T.-C.; Tian, L.-D.

2010-06-01

Microbial community patterns vary in glaciers worldwide, presenting unique responses to global climatic and environmental changes. Four bacterial clone libraries were established by 16S rRNA gene amplification from four ice layers along the 42-m-long ice core MuztB drilled from the Muztag Ata Glacier. A total of 151 bacterial sequences obtained from the ice core MuztB were phylogenetically compared with the 71 previously reported sequences from three ice cores extracted from ice caps Malan, Dunde, and Puruogangri. Six phylogenetic clusters Flavisolibacter, Flexibacter (Bacteroidetes), Acinetobacter, Enterobacter (Gammaproteobacteria), Planococcus/Anoxybacillus (Firmicutes), and Propionibacter/Luteococcus (Actinobacteria) frequently occurred along the Muztag Ata Glacier profile, and their proportion varied by seasons. Sequence analysis showed that most of the sequences from the ice core clustered with those from cold environments, and the sequence clusters from the same glacier more closely grouped together than those from the geographically isolated glaciers. Moreover, bacterial communities from the same location or similarly aged ice formed a cluster, and were clearly separate from those from other geographically isolated glaciers. In summary, the findings provide preliminary evidence of zonal distribution of microbial community, and suggest biogeography of microorganisms in glacier ice.

Differences in community composition of bacteria in four deep ice sheets in western China

NASA Astrophysics Data System (ADS)

An, L.; Chen, Y.; Xiang, S.-R.; Shang, T.-C.; Tian, L.-De

2010-02-01

Microbial community patterns vary in glaciers world wide, presenting unique responses to global climatic and environmental changes. Four bacterial clone libraries were established by 16S rRNA gene amplification from four ice layers along the 42-m-long ice core MuztB drilled from the Muztag Ata Glacier. A total of 152 bacterial sequences obtained from the ice core MuztB were phylogenetically compared with the 71 previously reported sequences from three ice cores extracted from ice caps Malan, Dunde, and Puruoganri. The six functional clusters Flavisolibacter, Flexibacter (Bacteroidetes), Acinetobacter, Enterobacter (Gammaproteobacteria), Planococcus/Anoxybacillus (Firmicutes), and Propionibacter/Luteococcus (Actinobacteria) frequently occurred along the Muztag Ata Glacier profile. Sequence analysis showed that most of the sequences from the ice core clustered with those from cold environments, and the sequences from the same glacier formed a distinct cluster. Moreover, bacterial communities from the same location or similarly aged ice formed a cluster, and were clearly separate from those from other geographically isolated glaciers. In a summary, the findings provide preliminary evidence of zone distribution of microbial community, support our hypothesis of the spatial and temporal biogeography of microorganisms in glacial ice.

Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning

PubMed Central

Meghdadi, Hossein; Khosravi, Azar D.; Ghadiri, Ata A.; Sina, Amir H.; Alami, Ameneh

2015-01-01

Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39–31.27% for rpoB-PCR, 36.44–60.83% for IS6110- PCR, 75.29–92.93% for nested-rpoB PCR, and 87.98–99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15–100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results. PMID:26191059

Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

PubMed

Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

2015-01-01

Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15-100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results.

Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

PubMed Central

2011-01-01

Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559

Genome Sequences of Populus tremula Chloroplast and Mitochondrion: Implications for Holistic Poplar Breeding

PubMed Central

Mader, Malte; Le Paslier, Marie-Christine; Bounon, Rémi; Berard, Aurélie; Vettori, Cristina; Schroeder, Hilke; Leplé, Jean-Charles; Fladung, Matthias

2016-01-01

Complete Populus genome sequences are available for the nucleus (P. trichocarpa; section Tacamahaca) and for chloroplasts (seven species), but not for mitochondria. Here, we provide the complete genome sequences of the chloroplast and the mitochondrion for the clones P. tremula W52 and P. tremula x P. alba 717-1B4 (section Populus). The organization of the chloroplast genomes of both Populus clones is described. A phylogenetic tree constructed from all available complete chloroplast DNA sequences of Populus was not congruent with the assignment of the related species to different Populus sections. In total, 3,024 variable nucleotide positions were identified among all compared Populus chloroplast DNA sequences. The 5-prime part of the LSC from trnH to atpA showed the highest frequency of variations. The variable positions included 163 positions with SNPs allowing for differentiating the two clones with P. tremula chloroplast genomes (W52, 717-1B4) from the other seven Populus individuals. These potential P. tremula-specific SNPs were displayed as a whole-plastome barcode on the P. tremula W52 chloroplast DNA sequence. Three of these SNPs and one InDel in the trnH-psbA linker were successfully validated by Sanger sequencing in an extended set of Populus individuals. The complete mitochondrial genome sequence of P. tremula is the first in the family of Salicaceae. The mitochondrial genomes of the two clones are 783,442 bp (W52) and 783,513 bp (717-1B4) in size, structurally very similar and organized as single circles. DNA sequence regions with high similarity to the W52 chloroplast sequence account for about 2% of the W52 mitochondrial genome. The mean SNP frequency was found to be nearly six fold higher in the chloroplast than in the mitochondrial genome when comparing 717-1B4 with W52. The availability of the genomic information of all three DNA-containing cell organelles will allow a holistic approach in poplar molecular breeding in the future. PMID:26800039

Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine.

PubMed

Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L

1989-09-01

A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.

First freshwater member ever reported for the family Bathycoccaceae (Chlorophyta; Archaeplastida) from Argentinean Patagonia revealed by environmental DNA survey.

PubMed

Lara, Enrique; Fernández, Leonardo D; Schiaffino, M Romina; Izaguirre, Irina

2017-08-01

We characterized molecularly the first freshwater member ever reported for the family Bathycoccaceae in Lake Musters (Argentinean Patagonia). Members of this family are extremely numerous and play a key ecological role in marine systems as primary producers. We cloned a fragment comprising the SSU rRNA gene+ITS region from environmental DNA using specific mamiellophyte primers. The unique SSU rRNA gene sequence obtained clustered robustly with Bathycoccus prasinos. Analysis of the two-dimensional structure of the ITS region showed the presence of a typical supplementary helix in the ITS-2 region, a synapomorphy of Bathycoccaceae, which confirmed further its phylogenetic placement. We finally discuss the possible causes for the presence of this organism in Lake Musters. Copyright © 2017 Elsevier GmbH. All rights reserved.

An Outbreak of Respiratory Tularemia Caused by Diverse Clones of Francisella tularensis

PubMed Central

Johansson, Anders; Lärkeryd, Adrian; Widerström, Micael; Mörtberg, Sara; Myrtännäs, Kerstin; Öhrman, Caroline; Birdsell, Dawn; Keim, Paul; Wagner, David M.; Forsman, Mats; Larsson, Pär

2014-01-01

Background. The bacterium Francisella tularensis is recognized for its virulence, infectivity, genetic homogeneity, and potential as a bioterrorism agent. Outbreaks of respiratory tularemia, caused by inhalation of this bacterium, are poorly understood. Such outbreaks are exceedingly rare, and F. tularensis is seldom recovered from clinical specimens. Methods. A localized outbreak of tularemia in Sweden was investigated. Sixty-seven humans contracted laboratory-verified respiratory tularemia. F. tularensis subspecies holarctica was isolated from the blood or pleural fluid of 10 individuals from July to September 2010. Using whole-genome sequencing and analysis of single-nucleotide polymorphisms (SNPs), outbreak isolates were compared with 110 archived global isolates. Results. There were 757 SNPs among the genomes of the 10 outbreak isolates and the 25 most closely related archival isolates (all from Sweden/Finland). Whole genomes of outbreak isolates were >99.9% similar at the nucleotide level and clustered into 3 distinct genetic clades. Unexpectedly, high-sequence similarity grouped some outbreak and archival isolates that originated from patients from different geographic regions and up to 10 years apart. Outbreak and archival genomes frequently differed by only 1–3 of 1 585 229 examined nucleotides. Conclusions. The outbreak was caused by diverse clones of F. tularensis that occurred concomitantly, were widespread, and apparently persisted in the environment. Multiple independent acquisitions of F. tularensis from the environment over a short time period suggest that natural outbreaks of respiratory tularemia are triggered by environmental cues. The findings additionally caution against interpreting genome sequence identity for this pathogen as proof of a direct epidemiological link. PMID:25097081

Coral microbial communities, zooxanthellae and mucus along gradients of seawater depth and coastal pollution.

PubMed

Klaus, James S; Janse, Ingmar; Heikoop, Jeffrey M; Sanford, Robert A; Fouke, Bruce W

2007-05-01

The high incidence of coral disease in shallow coastal marine environments suggests seawater depth and coastal pollution have an impact on the microbial communities inhabiting healthy coral tissues. A study was undertaken to determine how bacterial communities inhabiting tissues of the coral Montastraea annularis change at 5 m, 10 m and 20 m water depth in varying proximity to the urban centre and seaport of Willemstad, Curaçao, Netherlands Antilles. Analyses of terminal restriction fragment length polymorphisms (TRFLP) of 16S rRNA gene sequences show significant differences in bacterial communities of polluted and control localities only at the shallowest seawater depth. Furthermore, distinct differences in bacterial communities were found with increasing water depth. Comparisons of TRFLP peaks with sequenced clone libraries indicate the black band disease cyanobacterium clone CD1C11 is common and most abundant on healthy corals in less than 10 m water depth. Similarly, sequences belonging to a previously unrecognized group of likely phototrophic bacteria, herein referred to as CAB-I, were also more common in shallow water. To assess the influence of environmental and physiologic factors on bacterial community structure, canonical correspondence analysis was performed using explanatory variables associated with: (i) light availability; (ii) seawater pollution; (iii) coral mucus composition; (iv) the community structure of symbiotic algae; and (v) the photosynthetic activity of symbiotic algae. Eleven per cent of the variation in bacterial communities was accounted for by covariation with these variables; the most important being photosynthetically active radiation (sunlight) and the coral uptake of sewage-derived compounds as recorded by the delta(15)N of coral tissue.

1-deoxy-d-xylulose-5-phosphate reductoisomerases and method of use

DOEpatents

Croteau, Rodney B.; Lange, Bernd M.

2001-01-01

The present invention relates to isolated DNA sequences which code for the expression of plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein, such as the sequence presented in SEQ ID NO:1 which encodes a 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein from peppermint (Mentha x piperita). Additionally, the present invention relates to isolated plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein. In other aspects, the present invention is directed to replicable recombinant cloning vehicles comprising a nucleic acid sequence which codes for a plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase, to modified host cells transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence of the invention.

1-deoxy-D-xylulose-5-phosphate reductoisomerases, and methods of use

DOEpatents

Croteau, Rodney B.; Lange, Bernd M.

2002-07-16

The present invention relates to isolated DNA sequences which code for the expression of plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein, such as the sequence presented in SEQ ID NO:1 which encodes a 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein from peppermint (Mentha x piperita). Additionally, the present invention relates to isolated plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein. In other aspects, the present invention is directed to replicable recombinant cloning vehicles comprising a nucleic acid sequence which codes for a plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase, to modified host cells transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence of the invention.

Genomic Sequence and Virulence of Clonal Isolates of Vaccinia Virus Tiantan, the Chinese Smallpox Vaccine Strain

PubMed Central

Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming

2013-01-01

Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector. PMID:23593246

Group B Streptococcus Vaginal Carriage in Pregnant Women as Deciphered by Clustered Regularly Interspaced Short Palindromic Repeat Analysis.

PubMed

Beauruelle, Clemence; Pastuszka, Adeline; Mereghetti, Laurent; Lanotte, Philippe

2018-06-01

We evaluated the diversity of group B Streptococcus (GBS) vaginal carriage populations in pregnant women. For this purpose, we studied each isolate present in a primary culture of a vaginal swab using a new approach based on clustered regularly interspaced short palindromic repeats (CRISPR) locus analysis. To evaluate the CRISPR array composition rapidly, a restriction fragment length polymorphism (RFLP) analysis was performed. For each different pattern observed, the CRISPR array was sequenced and capsular typing and multilocus sequence typing (MLST) were performed. A total of 970 isolates from 10 women were analyzed by CRISPR-RFLP. Each woman carrying GBS isolates presented one to five specific "personal" patterns. Five women showed similar isolates with specific and unique restriction patterns, suggesting the carriage of a single GBS clone. Different patterns were observed among isolates from the other five women. For three of these, CRISPR locus sequencing highlighted low levels of internal modifications in the locus backbone, whereas there were high levels of modifications for the last two women, suggesting the carriage of two different clones. These two clones were closely related, having the same ancestral spacer(s), the same capsular type and, in one case, the same ST, but showed different antibiotic resistance patterns in pairs. Eight of 10 women were colonized by a single GBS clone, while two of them were colonized by two strains, leading to a risk of selection of more-virulent and/or more-resistant clones during antibiotic prophylaxis. This CRISPR analysis made it possible to separate isolates belonging to a single capsular type and sequence type, highlighting the greater discriminating power of this approach. Copyright © 2018 American Society for Microbiology.

A Fosmid Cloning Strategy for Detecting the Widest Possible Spectrum of Microbes from the International Space Station Drinking Water System

PubMed Central

Choi, Sangdun; Chang, Mi Sook; Stuecker, Tara; Chung, Christine; Newcombe, David A.; Venkateswaran, Kasthuri

2012-01-01

In this study, fosmid cloning strategies were used to assess the microbial populations in water from the International Space Station (ISS) drinking water system (henceforth referred to as Prebiocide and Tank A water samples). The goals of this study were: to compare the sensitivity of the fosmid cloning strategy with that of traditional culture-based and 16S rRNA-based approaches and to detect the widest possible spectrum of microbial populations during the water purification process. Initially, microbes could not be cultivated, and conventional PCR failed to amplify 16S rDNA fragments from these low biomass samples. Therefore, randomly primed rolling-circle amplification was used to amplify any DNA that might be present in the samples, followed by size selection by using pulsed-field gel electrophoresis. The amplified high-molecular-weight DNA from both samples was cloned into fosmid vectors. Several hundred clones were randomly selected for sequencing, followed by Blastn/Blastx searches. Sequences encoding specific genes from Burkholderia, a species abundant in the soil and groundwater, were found in both samples. Bradyrhizobium and Mesorhizobium, which belong to rhizobia, a large community of nitrogen fixers often found in association with plant roots, were present in the Prebiocide samples. Ralstonia, which is prevalent in soils with a high heavy metal content, was detected in the Tank A samples. The detection of many unidentified sequences suggests the presence of potentially novel microbial fingerprints. The bacterial diversity detected in this pilot study using a fosmid vector approach was higher than that detected by conventional 16S rRNA gene sequencing. PMID:23346038

Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

PubMed

Zhang, Qicheng; Tian, Meijuan; Feng, Yi; Zhao, Kai; Xu, Jing; Liu, Ying; Shao, Yiming

2013-01-01

Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV) as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT) was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV) vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1) viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1) and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs). ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH) strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

Cloning and expression of a CYP720B orthologue involved in the biosynthesis of diterpene resin acids in Pinus brutia.

PubMed

Semiz, Asli; Sen, Alaattin

2015-03-01

Cytochrome P450 monooxygenases mediate a broad range of oxidative reactions involved in the biosynthesis of both primary and secondary metabolites in plants. Until now, only two P450 genes, CYP720B1 from Pinus taeda and CYP720B4 from Picea sitchensis, have been functionally characterised and described in the literature. The purpose of this study was to describe the cloning and expression of CYP720B from Pinus brutia due to its suggested role in the synthesis of bioactive compounds used for chemical defence against insects. A PCR product of the P. brutia CYP720B gene was cloned into the pCR8/GW/TOPO cloning vector. After optimising the sequence for codon usage in yeast, it was transferred into the inducible expression vector pYES-DEST52 and transfected into the S. cerevisiae INVSc1 strain. Sequence analysis showed that the P. brutia CYP720B gene contains an open reading frame of 1,464 nucleotides, which encodes a 53,570 Da putative protein of 487 amino acid residues. The putative protein contains the classic heme-binding sequence motif that is conserved in all P450 enzymes. It shares 99 and 61% identity with the deduced amino acid sequences of CYP720B1 from Pinus taeda and CYP720B4 from Picea sitchensis, respectively. Recombinant CYP720B protein expression was confirmed using western blot analysis. Furthermore, recombinant CYP720B was functionally active, showing a Soret peak at approximately 448 nm in the reduced CO difference spectra. These data suggest that the cloned gene is an orthologue of CYP720B in P. brutia and might be involved in DRA biosynthesis.

Physical Mapping in a Triplicated Genome: Mapping the Downy Mildew Resistance Locus Pp523 in Brassica oleracea L.

PubMed Central

Carlier, Jorge D.; Alabaça, Claudia S.; Sousa, Nelson H.; Coelho, Paula S.; Monteiro, António A.; Paterson, Andrew H.; Leitão, José M.

2011-01-01

We describe the construction of a BAC contig and identification of a minimal tiling path that encompass the dominant and monogenically inherited downy mildew resistance locus Pp523 of Brassica oleracea L. The selection of BAC clones for construction of the physical map was carried out by screening gridded BAC libraries with DNA overgo probes derived from both genetically mapped DNA markers flanking the locus of interest and BAC-end sequences that align to Arabidopsis thaliana sequences within the previously identified syntenic region. The selected BAC clones consistently mapped to three different genomic regions of B. oleracea. Although 83 BAC clones were accurately mapped within a ∼4.6 cM region surrounding the downy mildew resistance locus Pp523, a subset of 33 BAC clones mapped to another region on chromosome C8 that was ∼60 cM away from the resistance gene, and a subset of 63 BAC clones mapped to chromosome C5. These results reflect the triplication of the Brassica genomes since their divergence from a common ancestor shared with A. thaliana, and they are consonant with recent analyses of the C genome of Brassica napus. The assembly of a minimal tiling path constituted by 13 (BoT01) BAC clones that span the Pp523 locus sets the stage for map-based cloning of this resistance gene. PMID:22384370

Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

PubMed

Judelson, H S; Michelmore, R W

1990-01-01

Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

Isolation, cloning, and characterization of a partial novel aro A gene in common reed (Phragmites australis).

PubMed

Taravat, Elham; Zebarjadi, Alireza; Kahrizi, Danial; Yari, Kheirollah

2015-05-01

Among the essential amino acids, phenylalanine, tryptophan, and tyrosine are aromatic amino acids which are synthesized by the shikimate pathway in plants and bacteria. Herbicide glyphosate can inhibit the biosynthesis of these amino acids. So, identification of the gene tolerant to glyphosate is very important. It has been shown that the common reed or Phragmites australis Cav. (Poaceae) is relatively tolerant to glyphosate. The aim of the current research is identification, cloning, sequencing, and registering of partial aro A gene of the common reed P. australis. The partial aro A gene of common reed (P. australis) was cloned in Escherichia coli and the amino acid sequence was identified/determined for the first time. This is the first report for isolation, cloning, and sequencing of a part of aro A gene from the common reed. A 670 bp fragment including two introns (86 bp and 289 bp) was obtained. The open reading frame (ORF) region in part of gene was encoded for 98 amino acids. Alignment showed high similarity among this region with Zea mays (L.) (Poaceae) (94.6%), Eleusine indica L. Gaertn (Poaceae) (94.2%), and Zoysia japonica Steud. (Poaceae) (94.2%). The alignment of amino acid sequence of the investigated part of the gene showed a homology with aro A from several other plants. This conserved region forms the enzyme active site. The alignment results of nucleotide and amino acid residues with related sequences showed that there are some differences among them. The relative glyphosate tolerance in the common reed may be related to these differences.

A Sequence-Independent Strategy for Detection and Cloning of Circular DNA Virus Genomes by Using Multiply Primed Rolling-Circle Amplification

PubMed Central

Rector, Annabel; Tachezy, Ruth; Van Ranst, Marc

2004-01-01

The discovery of novel viruses has often been accomplished by using hybridization-based methods that necessitate the availability of a previously characterized virus genome probe or knowledge of the viral nucleotide sequence to construct consensus or degenerate PCR primers. In their natural replication cycle, certain viruses employ a rolling-circle mechanism to propagate their circular genomes, and multiply primed rolling-circle amplification (RCA) with φ29 DNA polymerase has recently been applied in the amplification of circular plasmid vectors used in cloning. We employed an isothermal RCA protocol that uses random hexamer primers to amplify the complete genomes of papillomaviruses without the need for prior knowledge of their DNA sequences. We optimized this RCA technique with extracted human papillomavirus type 16 (HPV-16) DNA from W12 cells, using a real-time quantitative PCR assay to determine amplification efficiency, and obtained a 2.4 × 104-fold increase in HPV-16 DNA concentration. We were able to clone the complete HPV-16 genome from this multiply primed RCA product. The optimized protocol was subsequently applied to a bovine fibropapillomatous wart tissue sample. Whereas no papillomavirus DNA could be detected by restriction enzyme digestion of the original sample, multiply primed RCA enabled us to obtain a sufficient amount of papillomavirus DNA for restriction enzyme analysis, cloning, and subsequent sequencing of a novel variant of bovine papillomavirus type 1. The multiply primed RCA method allows the discovery of previously unknown papillomaviruses, and possibly also other circular DNA viruses, without a priori sequence information. PMID:15113879

An efficient approach to BAC based assembly of complex genomes.

PubMed

Visendi, Paul; Berkman, Paul J; Hayashi, Satomi; Golicz, Agnieszka A; Bayer, Philipp E; Ruperao, Pradeep; Hurgobin, Bhavna; Montenegro, Juan; Chan, Chon-Kit Kenneth; Staňková, Helena; Batley, Jacqueline; Šimková, Hana; Doležel, Jaroslav; Edwards, David

2016-01-01

There has been an exponential growth in the number of genome sequencing projects since the introduction of next generation DNA sequencing technologies. Genome projects have increasingly involved assembly of whole genome data which produces inferior assemblies compared to traditional Sanger sequencing of genomic fragments cloned into bacterial artificial chromosomes (BACs). While whole genome shotgun sequencing using next generation sequencing (NGS) is relatively fast and inexpensive, this method is extremely challenging for highly complex genomes, where polyploidy or high repeat content confounds accurate assembly, or where a highly accurate 'gold' reference is required. Several attempts have been made to improve genome sequencing approaches by incorporating NGS methods, to variable success. We present the application of a novel BAC sequencing approach which combines indexed pools of BACs, Illumina paired read sequencing, a sequence assembler specifically designed for complex BAC assembly, and a custom bioinformatics pipeline. We demonstrate this method by sequencing and assembling BAC cloned fragments from bread wheat and sugarcane genomes. We demonstrate that our assembly approach is accurate, robust, cost effective and scalable, with applications for complete genome sequencing in large and complex genomes.

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

NASA Astrophysics Data System (ADS)

Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

1984-08-01

A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA

DTIC Science & Technology

1989-04-01

strain-specific identification of HAV in human fecal samples was a major aim of the original contract application, as clinical trials of live and...derived materials and human and primate fecal specimens. 4. We molecularly cloned and partially sequenced the genome of PA21 strain HAV, a virus...antibody. This approach revealed that 99% of the infectious virus particles present in disrupted cell lysates from the 23rd passage of persistently

Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

DTIC Science & Technology

1988-02-02

the bands excised, and the DNA extracted with phenol for cloning in M13 . 6 Nuclotida sequence analysis. The two fragments were each cloned into phages ...DNA; and strain JM103 (29) was used to propagate M13 ph&ge derivatives. -1 Subcloning and detection of PA-producing rsccmbinants. The isolation of...method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132. 19. Lauben, J. 0., and J. 2. K. Nielsen. 1982. Penicillinase and

Complete genome sequence of community-associated methicillin-resistant Staphylococcus aureus (strain USA400-0051), a prototype of the USA400 clone

PubMed Central

Côrtes, Marina Farrel; Costa, Maiana OC; Lima, Nicholas CB; Souza, Rangel C; Almeida, Luiz GP; Guedes, Luciane Prioli Ciapina; Vasconcelos, Ana TR; Nicolás, Marisa F; Figueiredo, Agnes MS

2017-01-01

Staphylococcus aureus subsp. aureus, commonly referred as S. aureus, is an important bacterial pathogen frequently involved in hospital- and community-acquired infections in humans, ranging from skin infections to more severe diseases such as pneumonia, bacteraemia, endocarditis, osteomyelitis, and disseminated infections. Here, we report the complete closed genome sequence of a community-acquired methicillin-resistant S. aureus strain, USA400-0051, which is a prototype of the USA400 clone. PMID:29091141

First Isolate of KPC-2-Producing Klebsiella pneumonaie Sequence Type 23 from the Americas

PubMed Central

Cejas, Daniela; Fernández Canigia, Liliana; Rincón Cruz, Giovanna; Elena, Alan X.; Maldonado, Ivana; Gutkind, Gabriel O.

2014-01-01

KPC-2-producing Klebsiella pneumoniae isolates mainly correspond to clonal complex 258 (CC258); however, we describe KPC-2-producing K. pneumoniae isolates belonging to invasive sequence type 23 (ST23). KPC-2 has scarcely been reported to occur in ST23, and this report describes the first isolation of this pathogen in the Americas. Acquisition of resistant markers in virulent clones could mark an evolutionary step toward the establishment of these clones as major nosocomial pathogens. PMID:25031447

The Microbial Ferrous Wheel in a Neutral pH Groundwater Seep

PubMed Central

Roden, Eric E.; McBeth, Joyce M.; Blöthe, Marco; Percak-Dennett, Elizabeth M.; Fleming, Emily J.; Holyoke, Rebecca R.; Luther, George W.; Emerson, David; Schieber, Juergen

2012-01-01

Evidence for microbial Fe redox cycling was documented in a circumneutral pH groundwater seep near Bloomington, Indiana. Geochemical and microbiological analyses were conducted at two sites, a semi-consolidated microbial mat and a floating puffball structure. In situ voltammetric microelectrode measurements revealed steep opposing gradients of O2 and Fe(II) at both sites, similar to other groundwater seep and sedimentary environments known to support microbial Fe redox cycling. The puffball structure showed an abrupt increase in dissolved Fe(II) just at its surface (∼5 cm depth), suggesting an internal Fe(II) source coupled to active Fe(III) reduction. Most probable number enumerations detected microaerophilic Fe(II)-oxidizing bacteria (FeOB) and dissimilatory Fe(III)-reducing bacteria (FeRB) at densities of 102 to 105 cells mL−1 in samples from both sites. In vitro Fe(III) reduction experiments revealed the potential for immediate reduction (no lag period) of native Fe(III) oxides. Conventional full-length 16S rRNA gene clone libraries were compared with high throughput barcode sequencing of the V1, V4, or V6 variable regions of 16S rRNA genes in order to evaluate the extent to which new sequencing approaches could provide enhanced insight into the composition of Fe redox cycling microbial community structure. The composition of the clone libraries suggested a lithotroph-dominated microbial community centered around taxa related to known FeOB (e.g., Gallionella, Sideroxydans, Aquabacterium). Sequences related to recognized FeRB (e.g., Rhodoferax, Aeromonas, Geobacter, Desulfovibrio) were also well-represented. Overall, sequences related to known FeOB and FeRB accounted for 88 and 59% of total clone sequences in the mat and puffball libraries, respectively. Taxa identified in the barcode libraries showed partial overlap with the clone libraries, but were not always consistent across different variable regions and sequencing platforms. However, the barcode libraries provided confirmation of key clone library results (e.g., the predominance of Betaproteobacteria) and an expanded view of lithotrophic microbial community composition. PMID:22783228

Assessing Subsurface Bioaugmentation of a Mixed Culture Capable of Chlorinated Solvent Cometabolism via Molecular Methods

NASA Astrophysics Data System (ADS)

Dolan, M. E.; Lim, H. K.; Semprini, L.; Giovanonni, S.; Vergin, K.; McCarty, P. L.; Hopkins, G. D.

2001-12-01

The goal of this project is the successful bioaugmentation of a mixed culture capable of aerobic cometabolism of chlorinated solvent mixtures into an aquifer test zone at Moffett Federal Airfield, CA (Moffett). The test zone consists of two parallel well legs both fed butane and oxygen. One leg will be bioaugmented and the other will serve as an indigenous control. Injection and extraction wells and six (3 per leg) intermediately placed groundwater monitoring points will be frequently monitored for chlorinated solvents, butane, dissolved oxygen, and pH. Groundwater will also be periodically analyzed for microbial content using terminal restriction fragment length polymorphism (T-RFLP) and fluorescence in-situ hybridization (FISH) analyses. In each well leg, two fully-penetrating wells containing solid media will be periodically analyzed for microbial colonization (T-RFLP). The mixed bioaugmentation culture originated from environmental samples taken from Hanford, WA. The culture was enriched on butane and tested for viability in Moffett groundwater and aquifer solids. A clone library was created from the 16S rDNA in the mixed culture and 86 clones were sorted based on RFLP patterns. Complete sequencing of the 16S rDNA gene from the three most prevalent clones revealed 45 clones similar to Acidovorax or Hydrogenophaga, gram negative proteobacterium, and 12 clones similar to Rhodococcus, a gram positive filamentous organism. Fluorescently-labeled rRNA probes were designed for FISH analyses and appropriate restriction enzymes were chosen for T-RFLP analyses based upon the sequence information. Microcosm tests were conducted prior to the initiation of the field study to evaluate butane, 1,1-dichloroethylene (1,1-DCE), and 1,1,1-trichloroethane (TCA) degradation kinetics and microbial community composition. Bioaugmented microcosms began butane utilization sooner than non-bioaugmented ones in the presence and absence of 1,1-DCE, and were able to degrade more 1,1-DCE (up to 500 Yg/L) faster than non-bioaugmented microcosms. T-RFLP analyses of triplicate bottles produced very consistent results. An organism(s) with a T-RFLP signature of 183 bp was found to dominate in bioaugmented microcosms and was consistently absent from non-bioaugmented microcosms. T-RFLP and FISH analyses of groundwater and solid media during the bioaugmentation field demonstration are expected to reveal the extent of transport and subsurface colonization of the bioaugmentation culture.

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

PubMed

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

ILG1 : a new integrase-like gene that is a marker of bacterial contamination by the laboratory Escherichia coli strain TOP10F'.

PubMed Central

Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.

2002-01-01

BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938

Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

PubMed

Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

1999-12-01

An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

Diversity, virulence, and antimicrobial resistance of the KPC-producing Klebsiella pneumoniae ST307 clone.

PubMed

Villa, Laura; Feudi, Claudia; Fortini, Daniela; Brisse, Sylvain; Passet, Virginie; Bonura, Celestino; Endimiani, Andrea; Mammina, Caterina; Ocampo, Ana Maria; Jimenez, Judy Natalia; Doumith, Michel; Woodford, Neil; Hopkins, Katie; Carattoli, Alessandra

2017-04-01

The global spread of Klebsiella pneumoniae producing Klebsiella pneumoniae carbapenemase (KPC) has been mainly associated with the dissemination of high-risk clones. In the last decade, hospital outbreaks involving KPC-producing K. pneumoniae have been predominantly attributed to isolates belonging to clonal group (CG) 258. However, results of recent epidemiological analysis indicate that KPC-producing sequence type (ST) 307, is emerging in different parts of the world and is a candidate to become a prevalent high-risk clone in the near future. Here we show that the ST307 genome encodes genetic features that may provide an advantage in adaptation to the hospital environment and the human host. Sequence analysis revealed novel plasmid-located virulence factors, including a cluster for glycogen synthesis. Glycogen production is considered to be one of the possible adaptive responses to long-term survival and growth in environments outside the host. Chromosomally-encoded virulence traits in the clone comprised fimbriae, an integrative conjugative element carrying the yersiniabactin siderophore, and two different capsular loci. Compared with the ST258 clone, capsulated ST307 isolates showed higher resistance to complement-mediated killing. The acquired genetic features identified in the genome of this new emerging clone may contribute to increased persistence of ST307 in the hospital environment and shed light on its potential epidemiological success.

Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

USGS Publications Warehouse

Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.

2007-01-01

We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

Evaluation of the metabolic fate of munitions material (TNT & RDX) in plant systems. Initial assessment of plant DNA mutation spectra as a biomarker

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leung, F.; Cataldo, D.A.; Fellows, R.J.

1995-09-01

Munitions material can enter the environment as a result of manufacturing activities and field usage. Predictor methodologies, or biomarkers would enhance evaluation of environmental impacts. The goal of this exploratory study deoxyribonucleic acid (DNA) mutation frequency as a biomarker for munitions exposure. The approach e resolution of an effective repetitive sequence probe for the identification of characteristic mutations, and (2) the development of a testing media [a clonal cell line of carrot (Daucus carota) spension cells]. Commercially available probes demonstrated marginal resolution therefore a low-C{sub o}t library was then constructed. Three colonies from the low-C{sub o}t DNA library were screenedmore » and the DNA isolates sequenced. A suspension culture of carrot (Daucus carota) was developed. A mutation spectra experiment was initiated at a 10-mg TNT/L exposure concentration with the attempt to clone over 1500 single TNT-exposed cells. Over the following six months greater than 98% of the initially isolated cells were unable to survive and produce micro calluses. The remaining calli were too few to be statistically significant and the experiment was terminated. The biomarker concept itself remains to be disproved, but the need for large numbers of uniform clones to differentiate true mutations suggest that more direct techniques using whole tissues need to be developed.« less

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Placement of attine ant-associated Pseudonocardia in a global Pseudonocardia phylogeny (Pseudonocardiaceae, Actinomycetales): a test of two symbiont-association models

PubMed Central

Mueller, Ulrich G.; Ishak, Heather; Lee, Jung C.; Sen, Ruchira; Gutell, Robin R.

2010-01-01

We reconstruct the phylogenetic relationships within the bacterial genus Pseudonocardia to evaluate two models explaining how and why Pseudonocardia bacteria colonize the microbial communities on the integument of fungus-gardening ant species (Attini, Formicidae). The traditional Coevolution-Codivergence model views the integument-colonizing Pseudonocardia as mutualistic microbes that are largely vertically transmitted between ant generations and that supply antibiotics that specifically suppress the garden pathogen Escovopsis. The more recent Acquisition model views Pseudonocardia as part of a larger integumental microbe community that frequently colonizes the ant integument from environmental sources (e.g., soil, plant material). Under this latter model, ant-associated Pseudonocardia may have diverse ecological roles on the ant integument (possibly ranging from pathogenic, to commensal, to mutualistic) and are not necessarily related to Escovopsis suppression. We test distinct predictions of these two models regarding the phylogenetic proximity of ant-associated and environmental Pseudonocardia. We amassed 16S-rRNA gene sequence information for 87 attine-associated and 238 environmental Pseudonocardia, aligned the sequences with the help of RNA secondary structure modeling, and reconstructed phylogenetic relationships using a maximum-likelihood approach. We present 16S-rRNA secondary structure models of representative Pseudonocardia species to improve sequence alignments and identify sequencing errors. Our phylogenetic analyses reveal close affinities and even identical sequence matches between environmental Pseudonocardia and ant-associated Pseudonocardia, as well as nesting of environmental Pseudonocardia in subgroups that were previously thought to be specialized to associate only with attine ants. The great majority of ant associated Pseudonocardia are closely related to autotrophic Pseudonocardia and are placed in a large subgroup of Pseudonocardia that is known essentially only from cultured isolates (rather than cloned 16S sequences). The preponderance of the known ant-associated Pseudonocardia in this latter clade of culturable lineages may not necessarily reflect abundance of these Pseudonocardia types on the ants, but isolation biases when screening for Pseudonocardia (e.g., preferential isolation of autotrophic Pseudonocardia with minimum-nutrient media). The accumulated phylogenetic patterns and the possibility of isolation biases in previous work further erode support for the traditional Coevolution-Codivergence model and calls for continued revision of our understanding how and why Pseudonocardia colonize the microbial communities on the integument of fungus-gardening ant species. PMID:20333466

Placement of attine ant-associated Pseudonocardia in a global Pseudonocardia phylogeny (Pseudonocardiaceae, Actinomycetales): a test of two symbiont-association models.

PubMed

Mueller, Ulrich G; Ishak, Heather; Lee, Jung C; Sen, Ruchira; Gutell, Robin R

2010-08-01

We reconstruct the phylogenetic relationships within the bacterial genus Pseudonocardia to evaluate two models explaining how and why Pseudonocardia bacteria colonize the microbial communities on the integument of fungus-gardening ant species (Attini, Formicidae). The traditional Coevolution-Codivergence model views the integument-colonizing Pseudonocardia as mutualistic microbes that are largely vertically transmitted between ant generations and that supply antibiotics that specifically suppress the garden pathogen Escovopsis. The more recent Acquisition model views Pseudonocardia as part of a larger integumental microbe community that frequently colonizes the ant integument from environmental sources (e.g., soil, plant material). Under this latter model, ant-associated Pseudonocardia may have diverse ecological roles on the ant integument (possibly ranging from pathogenic, to commensal, to mutualistic) and are not necessarily related to Escovopsis suppression. We test distinct predictions of these two models regarding the phylogenetic proximity of ant-associated and environmental Pseudonocardia. We amassed 16S-rRNA gene sequence information for 87 attine-associated and 238 environmental Pseudonocardia, aligned the sequences with the help of RNA secondary structure modeling, and reconstructed phylogenetic relationships using a maximum-likelihood approach. We present 16S-rRNA secondary structure models of representative Pseudonocardia species to improve sequence alignments and identify sequencing errors. Our phylogenetic analyses reveal close affinities and even identical sequence matches between environmental Pseudonocardia and ant-associated Pseudonocardia, as well as nesting of environmental Pseudonocardia in subgroups that were previously thought to be specialized to associate only with attine ants. The great majority of ant-associated Pseudonocardia are closely related to autotrophic Pseudonocardia and are placed in a large subgroup of Pseudonocardia that is known essentially only from cultured isolates (rather than cloned 16S sequences). The preponderance of the known ant-associated Pseudonocardia in this latter clade of culturable lineages may not necessarily reflect abundance of these Pseudonocardia types on the ants, but isolation biases when screening for Pseudonocardia (e.g., preferential isolation of autotrophic Pseudonocardia with minimum-nutrient media). The accumulated phylogenetic patterns and the possibility of isolation biases in previous work further erode support for the traditional Coevolution-Codivergence model and calls for continued revision of our understanding how and why Pseudonocardia colonize the microbial communities on the integument of fungus-gardening ant species.

Candidate Genes Expressed in Tolerant Common Wheat With Resistant to English Grain Aphid.

PubMed

Luo, Kun; Zhang, Gaisheng; Wang, Chunping; Ouellet, Thérèse; Wu, Jingjing; Zhu, Qidi; Zhao, Huiyan

2014-10-01

The English grain aphid, Sitobion avenae (F.) (Hemiptera: Aphididae), is a common worldwide pest of wheat (Triticum aestivum L.). The use of improved resistant cultivars by the farmers is the most effective and environmentally friendly method to control this aphid in the field. The winter wheat genotypes 98-10-35 and Amigo are resistant to S. avenae. To identify genes responsible for resistance to S. avenae in these genotypes, differential-display reverse transcription-polymerase chain reaction was used to identify the corresponding differentially expressed sequences in current study. Two backcross progenies were obtained by crossing the two resistant genotypes with the susceptible genotype 1376. Six potential expected-differential bands were sequenced. Lengths of the expressed sequence tags ranged from 128 to 532 bp. Although these expressed sequences were likely associated with S. avenae resistance, there was one expressed sequence tag located on 7DL chromosome, and its potential function may associate with the ability to maintain photosynthesis in wheat. That serves as an active way for tolerant common wheat with resistant to S. avenae. Cloning the full length of these sequences would help us thoroughly understand the mechanism of wheat resistance to S. avenae and be valuable for breeding cultivars with S. avenae resistance. © 2014 Entomological Society of America.

Clonal Transmission of Gram-Negative Bacteria with Carbapenemases NDM-1, VIM-1, and OXA-23/72 in a Bulgarian Hospital.

PubMed

Pfeifer, Yvonne; Trifonova, Angelina; Pietsch, Michael; Brunner, Magdalena; Todorova, Iva; Gergova, Ivanka; Wilharm, Gottfried; Werner, Guido; Savov, Encho

2017-04-01

We characterized 72 isolates with reduced susceptibility to carbapenems (50 Acinetobacter spp., 13 Proteus mirabilis, five Escherichia coli, one Morganella morganii, one Enterobacter cloacae, one Providencia rettgeri, and one Pseudomonas aeruginosa) from a hospital in Sofia, Bulgaria. Different β-lactamase genes were identified by polymerase chain reaction and sequencing. Bacterial strain typing was performed by enzymatic macrorestriction and pulsed-field gel electrophoresis (PFGE) typing as well as multilocus sequence typing for selected isolates. The majority of Acinetobacter baumannii (46/50) and one Acinetobacter pittii isolate harbored carbapenemase genes bla OXA-23 or bla OXA-72 ; two A. baumannii contained both genes. PFGE typing of all A. baumannii showed the presence of nine different clones belonging to eight sequence types ST350, ST208, ST436, ST437, ST449, ST231, ST502, and ST579. Molecular characterization of the remaining isolates confirmed the presence of one NDM-1-producing E. coli-ST101 clone (five isolates) and one P. mirabilis clone (13 isolates) with VIM-1 and CMY-99. Furthermore, NDM-1 was identified in P. rettgeri and M. morganii and VIM-2 in the P. aeruginosa isolate. The permanent introduction of OXA-23/72 carbapenemase-producing A. baumannii clones into the hospital and the repeated occurrence of one VIM-1-producing P. mirabilis and one NDM-1-producing E. coli-ST101 clone over a period of more than 1 year is of concern and requires intensified investigations.

Characterisation and cloning of a Na(+)-dependent broad-specificity neutral amino acid transporter from NBL-1 cells: a novel member of the ASC/B(0) transporter family.

PubMed

Pollard, Matthew; Meredith, David; McGivan, John D

2002-04-12

Na(+)-dependent neutral amino acid transport into the bovine renal epithelial cell line NBL-1 is catalysed by a broad-specificity transporter originally termed System B(0). This transporter is shown to differ in specificity from the B(0) transporter cloned from JAR cells [J. Biol. Chem. 271 (1996) 18657] in that it interacts much more strongly with phenylalanine. Using probes designed to conserved transmembrane regions of the ASC/B(0) transporter family we have isolated a cDNA encoding the NBL-1 cell System B(0) transporter. When expressed in Xenopus oocytes the clone catalysed Na(+)-dependent alanine uptake which was inhibited by glutamine, leucine and phenylalanine. However, the clone did not catalyse Na(+)-dependent phenylalanine transport, again as in NBL-1 cells. The clone encoded a protein of 539 amino acids; the predicted transmembrane domains were almost identical in sequence to those of the other members of the B(0)/ASC transporter family. Comparison of the sequences of NBL-1 and JAR cell transporters showed some differences near the N-terminus, C-terminus and in the loop between helices 3 and 4. The NBL-1 B(0) transporter is not the same as the renal brush border membrane transporter since it does not transport phenylalanine. Differences in specificity in this protein family arise from relatively small differences in amino acid sequence.

Identification and Characterization of the Insecticidal Toxin “Makes Caterpillars Floppy” in Photorhabdus temperata M1021 Using a Cosmid Library

PubMed Central

Ullah, Ihsan; Jang, Eun-Kyung; Kim, Min-Sung; Shin, Jin-Ho; Park, Gun-Seok; Khan, Abdur Rahim; Hong, Sung-Jun; Jung, Byung-Kwon; Choi, JungBae; Park, YeongJun; Kwak, Yunyoung; Shin, Jae-Ho

2014-01-01

Photorhabdus temperata is an entomopathogenic enterobacterium; it is a nematode symbiont that possesses pathogenicity islands involved in insect virulence. Herein, we constructed a P. temperata M1021 cosmid library in Escherichia coli XL1-Blue MRF` and obtained 7.14 × 105 clones. However, only 1020 physiologically active clones were screened for insect virulence factors by injection of each E. coli cosmid clone into Galleria mellonella and Tenebrio molitor larvae. A single cosmid clone, PtC1015, was consequently selected due to its characteristic virulent properties, e.g., loss of body turgor followed by death of larvae when the clone was injected into the hemocoel. The sequence alignment against the available sequences in Swiss-Prot and NCBI databases, confirmed the presence of the mcf gene homolog in the genome of P. temperata M1021 showing 85% homology and 98% query coverage with the P. luminescens counterpart. Furthermore, a 2932 amino acid long Mcf protein revealed limited similarity with three protein domains. The N-terminus of the Mcf encompassed consensus sequence for a BH3 domain, the central region revealed similarity to toxin B, and the C-terminus of Mcf revealed similarity to the bacterial export domain of ApxIVA, an RTX-like toxin. In short, the Mcf toxin is likely to play a role in the elimination of insect pests, making it a promising model for use in the agricultural field. PMID:25014195

Distribution and abundance of archaeal and bacterial ammonia oxidizers in the sediments of the Dongjiang River, a drinking water supply for Hong Kong.

PubMed

Sun, Wei; Xia, Chunyu; Xu, Meiying; Guo, Jun; Wang, Aijie; Sun, Guoping

2013-01-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) play important roles in nitrification. However, limited information about the characteristics of AOA and AOB in the river ecosystem is available. The distribution and abundance of AOA and AOB in the sediments of the Dongjiang River, a drinking water source for Hong Kong, were investigated by clone library analysis and quantitative real-time PCR. Phylogenetic analysis showed that Group 1.1b- and Group 1.1b-associated sequences of AOA predominated in sediments with comparatively high carbon and nitrogen contents (e.g. total carbon (TC) >13 g kg(-1) sediment, NH4(+)-N >144 mg kg(-1) sediment), while Group 1.1a- and Group 1.1a-associated sequences were dominant in sediments with opposite conditions (e.g. TC <4 g kg(-1) sediment, NH4(+)-N <93 mg kg(-1) sediment). Although Nitrosomonas- and Nitrosospira-related sequences of AOB were detected in the sediments, nearly 70% of the sequences fell into the Nitrosomonas-like B cluster, suggesting similar sediment AOB communities along the river. Higher abundance of AOB than AOA was observed in almost all of the sediments in the Dongjiang River, while significant correlations were only detected between the distribution of AOA and the sediment pH and TC, which suggested that AOA responded more sensitively than AOB to variations of environmental factors. These results extend our knowledge about the environmental responses of ammonia oxidizers in the river ecosystem.

Biogeography of Burkholderia pseudomallei in the Torres Strait Islands of Northern Australia

PubMed Central

Baker, Anthony; Mayo, Mark; Owens, Leigh; Burgess, Graham; Norton, Robert; McBride, William John Hannan; Currie, Bart J.

2013-01-01

It has been hypothesized that biogeographical boundaries are a feature of Burkholderia pseudomallei ecology, and they impact the epidemiology of melioidosis on a global scale. This study examined the relatedness of B. pseudomallei sourced from islands in the Torres Strait of Northern Australia to determine if the geography of isolated island communities is a determinant of the organisms' dispersal. Environmental sampling on Badu Island in the Near Western Island cluster recovered a single clone. An additional 32 clinical isolates from the region were sourced. Isolates were characterized using multilocus sequence typing and a multiplex PCR targeting the flagellum gene cluster. Gene cluster analysis determined that 69% of the isolates from the region encoded the ancestral Burkholderia thailandensis-like flagellum and chemotaxis gene cluster, a proportion significantly lower than that reported from mainland Australia and consistent with observations of isolates from southern Papua New Guinea. A goodness-of-fit test indicated that there was geographic localization of sequence types throughout the archipelago, with the exception of Thursday Island, the economic and cultural hub of the region. Sequence types common to mainland Australia and Papua New Guinea were identified. These findings demonstrate for the first time an environmental reservoir for B. pseudomallei in the Torres Strait, and multilocus sequence typing suggests that the organism is not randomly distributed throughout this region and that seawater may provide a barrier to dispersal of the organism. Moreover, these findings support an anthropogenic dispersal hypothesis for the spread of B. pseudomallei throughout this region. PMID:23698533

cDNA cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus.

PubMed

Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin

2003-12-19

SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.

High-throughput gene mapping in Caenorhabditis elegans.

PubMed

Swan, Kathryn A; Curtis, Damian E; McKusick, Kathleen B; Voinov, Alexander V; Mapa, Felipa A; Cancilla, Michael R

2002-07-01

Positional cloning of mutations in model genetic systems is a powerful method for the identification of targets of medical and agricultural importance. To facilitate the high-throughput mapping of mutations in Caenorhabditis elegans, we have identified a further 9602 putative new single nucleotide polymorphisms (SNPs) between two C. elegans strains, Bristol N2 and the Hawaiian mapping strain CB4856, by sequencing inserts from a CB4856 genomic DNA library and using an informatics pipeline to compare sequences with the canonical N2 genomic sequence. When combined with data from other laboratories, our marker set of 17,189 SNPs provides even coverage of the complete worm genome. To date, we have confirmed >1099 evenly spaced SNPs (one every 91 +/- 56 kb) across the six chromosomes and validated the utility of our SNP marker set and new fluorescence polarization-based genotyping methods for systematic and high-throughput identification of genes in C. elegans by cloning several proprietary genes. We illustrate our approach by recombination mapping and confirmation of the mutation in the cloned gene, dpy-18.

Cloning and characterization of a tuberous root-specific promoter from cassava (Manihot esculenta Crantz).

PubMed

Koehorst-van Putten, Herma J J; Wolters, Anne-Marie A; Pereira-Bertram, Isolde M; van den Berg, Hans H J; van der Krol, Alexander R; Visser, Richard G F

2012-12-01

In order to obtain a tuberous root-specific promoter to be used in the transformation of cassava, a 1,728 bp sequence containing the cassava granule-bound starch synthase (GBSSI) promoter was isolated. The sequence proved to contain light- and sugar-responsive cis elements. Part of this sequence (1,167 bp) was cloned into binary vectors to drive expression of the firefly luciferase gene. Cassava cultivar Adira 4 was transformed with this construct or a control construct in which the luciferase gene was cloned behind the 35S promoter. Luciferase activity was measured in leaves, stems, roots and tuberous roots. As expected, the 35S promoter induced luciferase activity in all organs at similar levels, whereas the GBSSI promoter showed very low expression in leaves, stems and roots, but very high expression in tuberous roots. These results show that the cassava GBSSI promoter is an excellent candidate to achieve tuberous root-specific expression in cassava.

Sequencing and generation of an infectious clone of the pathogenic goose parvovirus strain LH.

PubMed

Wang, Jianye; Duan, Jinkun; Zhu, Liqian; Jiang, Zhiwei; Zhu, Guoqiang

2015-03-01

In this study, the complete genome of the virulent strain LH of goose parvovirus (GPV) was sequenced and cloned into the pBluescript II (SK) plasmid vector. Sequence alignments of the inverted terminal repeats (ITR) of GPV strains revealed a common 14-nt-pair deletion in the stem of the palindromic structure in the LH strain and three other strains isolated after 1982 when compared to three GPV strains isolated earlier than that time. Transfection of 11-day-old embryonated goose eggs with the plasmid pLH, which contains the entire genome of strain LH, resulted in successful rescue of the infectious virus. Death of embryos after transfection via the chorioallantoic membrane infiltration route occurred earlier than when transfection was done via the allantoic cavity inoculation route. The rescued virus exhibited virulence similar to that of its parental virus, as evaluated by the mortality rate in goslings. Generation of the pathogenic infectious clone provides us with a powerful tool to elucidate the molecular pathogenesis of GPV in the future.

Bacteria of an anaerobic 1,2-dichloropropane-dechlorinating mixed culture are phylogenetically related to those of other anaerobic dechlorinating consortia.

PubMed

Schlötelburg, C; von Wintzingerode, F; Hauck, R; Hegemann, W; Göbel, U B

2000-07-01

A 16S-rDNA-based molecular study was performed to determine the bacterial diversity of an anaerobic, 1,2-dichloropropane-dechlorinating bioreactor consortium derived from sediment of the River Saale, Germany. Total community DNA was extracted and bacterial 16S rRNA genes were subsequently amplified using conserved primers. A clone library was constructed and analysed by sequencing the 16S rDNA inserts of randomly chosen clones followed by dot blot hybridization with labelled polynucleotide probes. The phylogenetic analysis revealed significant sequence similarities of several as yet uncultured bacterial species in the bioreactor to those found in other reductively dechlorinating freshwater consortia. In contrast, no close relationship was obtained with as yet uncultured bacteria found in reductively dechlorinating consortia derived from marine habitats. One rDNA clone showed >97% sequence similarity to Dehalobacter species, known for reductive dechlorination of tri- and tetrachloroethene. These results suggest that reductive dechlorination in microbial freshwater habitats depends upon a specific bacterial community structure.

Legume Genome Initiative at the University of Oklahoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bruce A. Roe

2004-02-27

Consolidated Appropriations Resolution, 2003 Conference Report for the Department of Energy's Biological and Environmental Research (BER) program provided $481,000 for the Legume Genome Initiative at the University of Oklahoma. These funds were used to support our research that is aimed at determining the entire sequence of the gene rich regions of the genome of the legume, Medicago truncatula, by allowing us to obtain a greater degree of finished BAC sequences from the draft sequences we have already obtained through research funded by the Noble Foundation. During the funding period we increased the number of Medicago truncatula BACs with finished (Bermudamore » standard) sequences from 109 to 359, and the total number of BACs for which we collected sequence data from 584 to 842, 359 of which reached phase 2 (ordered and oriented contigs). We also sequenced a series of pooled BAC clones that cover additional euchromatic (gene rich) genomic regions. This work resulted in 6 refereed publications, see below. Genes whose sequence was determined during this study included multiple members of the plant disease resistance (R-gene) family as well as several genes involved in flavinoid biosynthesis, nitrogen fixation and plant-microbial symbosis. This work also served as a prelude to obtaining NSF funding for the international collaborative effort to complete the entire sequence of the Medicago truncatula genomic euchromatic regions using a BAC based approach.« less

[Identification of antler powder components based on DNA barcoding technology].

PubMed

Jia, Jing; Shi, Lin-chun; Xu, Zhi-chao; Xin, Tian-yi; Song, Jing-yuan; Chen Shi, Lin

2015-10-01

In order to authenticate the components of antler powder in the market, DNA barcoding technology coupled with cloning method were used. Cytochrome c oxidase subunit I (COI) sequences were obtained according to the DNA barcoding standard operation procedure (SOP). For antler powder with possible mixed components, the cloning method was used to get each COI sequence. 65 COI sequences were successfully obtained from commercial antler powders via sequencing PCR products. The results indicates that only 38% of these samples were derived from Cervus nippon Temminck or Cervus elaphus Linnaeus which is recorded in the 2010 edition of "Chinese Pharmacopoeia", while 62% of them were derived from other species. Rangifer tarandus Linnaeus was the most frequent species among the adulterants. Further analysis showed that some samples collected from different regions, companies and prices, contained adulterants. Analysis of 36 COI sequences obtained by the cloning method showed that C. elaphus and C. nippon were main components. In addition, some samples were marked clearly as antler powder on the label, however, C. elaphus or R. tarandus were their main components. In summary, DNA barcoding can accurately and efficiently distinguish the exact content in the commercial antler powder, which provides a new technique to ensure clinical safety and improve quality control of Chinese traditional medicine

Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagrimini, L.M.

Since this manuscript was submitted we have conducted a more thorough physiological analysis of water relations in wild-type and peroxidase overproducing plants. These experiments include pressure bomb, plasmolysis, and membrane integrity analysis. We are also in the process of analyzing other phenotypes in peroxidase overproducer plants such as excessive browning of tissue, the rapid death of tissue in culture, and poor germination of seed. Transformed plants of Nicotiana tabacum and Nicotiana sylvestris were obtained which have peroxidase activity 3--7 fold lower than wild-type plants. This was done by introducing a chimeric gene composed of the CaMV 35S promoter and themore » 5' half of the tobacco anionic peroxidase cDNA in the antisense RNA configuration. A manuscript which describes this work is being written, and will be submitted for publication in January 1990. The anionic peroxidase gene has been cloned by hybridization to the cloned cDNA. The entire gene is contained on an 8.7kb fragment within a lambda phage clone. Several smaller DNA fragments have been subcloned, and some have been sequenced. One exon within the coding sequence has been sequenced, along with the partial sequence of two introns. Further sequencing is being carried-out to identify the promoter, which will be later joined to a reporter gene. 6 figs.« less

Environmental distribution, abundance and activity of the Miscellaneous Crenarchaeotal Group

NASA Astrophysics Data System (ADS)

Lloyd, K. G.; Biddle, J.; Teske, A.

2011-12-01

Many marine sedimentary microbes have only been identified by 16S rRNA sequences. Consequently, little is known about the types of metabolism, activity levels, or relative abundance of these groups in marine sediments. We found that one of these uncultured groups, called the Miscellaneous Crenarchaeotal Group (MCG), dominated clone libraries made from reverse transcribed 16S rRNA, and 454 pyrosequenced 16S rRNA genes, in the White Oak River estuary. Primers suitable for quantitative PCR were developed for MCG and used to show that 16S rRNA DNA copy numbers from MCG account for nearly all the archaeal 16S rRNA genes present. RT-qPCR shows much less MCG rRNA than total archaeal rRNA, but comparisons of different primers for each group suggest bias in the RNA-based work relative to the DNA-based work. There is no evidence of a population shift with depth below the sulfate-methane transition zone, suggesting that the metabolism of MCG may not be tied to sulfur or methane cycles. We classified 2,771 new sequences within the SSU Silva 106 database that, along with the classified sequences in the Silva database was used to make an MCG database of 4,646 sequences that allowed us to increase the named subgroups of MCG from 7 to 19. Percent terrestrial sequences in each subgroup is positively correlated with percent of the marine sequences that are nearshore, suggesting that membership in the different subgroups is not random, but dictated by environmental selective pressures. Given their high phylogenetic diversity, ubiquitous distribution in anoxic environments, and high DNA copy number relative to total archaea, members of MCG are most likely anaerobic heterotrophs who are integral to the post-depositional marine carbon cycle.

Genetic characterization and barcoding of taxa in the genus Wolffia Horkel ex Schleid. (Lemnaceae) as revealed by two plastidic markers and amplified fragment length polymorphism (AFLP).

PubMed

Bog, Manuela; Schneider, Philipp; Hellwig, Frank; Sachse, Svea; Kochieva, Elena Z; Martyrosian, Elena; Landolt, Elias; Appenroth, Klaus-J

2013-01-01

The genus Wolffia of the duckweed family (Lemnaceae) contains the smallest flowering plants. Presently, 11 species are recognized and categorized mainly on the basis of morphology. Because of extreme reduction of structure of all species, molecular methods are especially required for barcoding and identification of species and clones of this genus. We applied AFLP combined with Bayesian analysis of population structure to 66 clones covering all 11 species. Nine clusters were identified: (1) W. angusta and W. microscopica (only one clone), (2) W. arrhiza, (3) W. cylindracea (except one clone that might be a transition form), (4) W. australiana, (5) W. globosa, (6) W. globosa, W. neglecta, and W. borealis, (7) W. brasiliensis, and W. columbiana, (8) W. columbiana, (9) W. elongata. Furthermore, we investigated the sequences of plastidic regions rps16 (54 clones) and rpl16 (55 clones), and identified the following species: W. angusta, W. australiana, W. brasiliensis, W. cylindracea, W. elongata, W. microscopica, and W. neglecta. Wolffia globosa has been separated into two groups by both methods. One group which consists only of clones from North America and East Asia was labelled here "typical W. globosa". The other group of W. globosa, termed operationally "W. neglecta", contains also clones of W. neglecta and shows high similarity to W. borealis. None of the methods recognized W. borealis as a distinct species. Although each clone could be characterized individually by AFLP and plastidic sequences, and most species could be bar-coded, the presently available data are not sufficient to identify all taxa of Wolffia.

A comparative study of Cutibacterium (Propionibacterium) acnes clones from acne patients and healthy controls.

PubMed

Lomholt, H B; Scholz, C F P; Brüggemann, H; Tettelin, H; Kilian, M

2017-10-01

Cutibacterium (Propionibacterium) acnes is assumed to play an important role in the pathogenesis of acne. To examine if clones with distinct virulence properties are associated with acne. Multiple C. acnes isolates from follicles and surface skin of patients with moderate to severe acne and healthy controls were characterized by multilocus sequence typing. To determine if CC18 isolates from acne patients differ from those of controls in the possession of virulence genes or lack of genes conducive to a harmonious coexistence the full genomes of dominating CC18 follicular clones from six patients and five controls were sequenced. Individuals carried one to ten clones simultaneously. The dominating C. acnes clones in follicles from acne patients were exclusively from the phylogenetic clade I-1a and all belonged to clonal complex CC18 with the exception of one patient dominated by the worldwide-disseminated and often antibiotic resistant clone ST3. The clonal composition of healthy follicles showed a more heterogeneous pattern with follicles dominated by clones representing the phylogenetic clades I-1a, I-1b, I-2 and II. Comparison of follicular CC18 gene contents, allelic versions of putative virulence genes and their promoter regions, and 54 variable-length intragenic and inter-genic homopolymeric tracts showed extensive conservation and no difference associated with the clinical origin of isolates. The study supports that C. acnes strains from clonal complex CC18 and the often antibiotic resistant clone ST3 are associated with acne and suggests that susceptibility of the host rather than differences within these clones may determine the clinical outcome of colonization. Copyright © 2017 Elsevier Ltd. All rights reserved.

Screening and Identification of Peptides Specifically Targeted to Gastric Cancer Cells from a Phage Display Peptide Library

PubMed

Sahin, Deniz; Taflan, Sevket Onur; Yartas, Gizem; Ashktorab, Hassan; Smoot, Duane T

2018-04-25

Background: Gastric cancer is the second most common cancer among the malign cancer types. Inefficiency of traditional techniques both in diagnosis and therapy of the disease makes the development of alternative and novel techniques indispensable. As an alternative to traditional methods, tumor specific targeting small peptides can be used to increase the efficiency of the treatment and reduce the side effects related to traditional techniques. The aim of this study is screening and identification of individual peptides specifically targeted to human gastric cancer cells using a phage-displayed peptide library and designing specific peptide sequences by using experimentally-eluted peptide sequences. Methods: Here, MKN-45 human gastric cancer cells and HFE-145 human normal gastric epithelial cells were used as the target and control cells, respectively. 5 rounds of biopannning with a phage display 12-peptide library were applied following subtraction biopanning with HFE-145 control cells. The selected phage clones were established by enzyme-linked immunosorbent assay and immunofluorescence detection. We first obtain random phage clones after five biopanning rounds, determine the binding levels of each individual clone. Then, we analyze the frequencies of each amino acid in best binding clones to determine positively overexpressed amino acids for designing novel peptide sequences. Results: DE532 (VETSQYFRGTLS) phage clone was screened positive, showing specific binding on MKN-45 gastric cancer cells. DE-Obs (HNDLFPSWYHNY) peptide, which was designed by using amino acid frequencies of experimentally selected peptides in the 5th round of biopanning, showed specific binding in MKN-45 cells. Conclusion: Selection and characterization of individual clones may give us specifically binding peptides, but more importantly, data extracted from eluted phage clones may be used to design theoretical peptides with better binding properties than even experimentally selected ones. Both peptides, experimental and designed, may be potential candidates to be developed as useful diagnostic or therapeutic ligand molecules in gastric cancer research. Creative Commons Attribution License

Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

PubMed

Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

2008-01-01

Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

PubMed

Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

2004-07-01

The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

Molecular cloning and characterization of RGA1 encoding a G protein alpha subunit from rice (Oryza sativa L. IR-36).

PubMed

Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D

1995-03-01

A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.

Accelerated Evolution of the ASPM Gene Controlling Brain Size Begins Prior to Human Brain Expansion

PubMed Central

Solomon, Gregory; Gersch, William; Yoon, Young-Ho; Collura, Randall; Ruvolo, Maryellen; Barrett, J. Carl; Woods, C. Geoffrey; Walsh, Christopher A

2004-01-01

Primary microcephaly (MCPH) is a neurodevelopmental disorder characterized by global reduction in cerebral cortical volume. The microcephalic brain has a volume comparable to that of early hominids, raising the possibility that some MCPH genes may have been evolutionary targets in the expansion of the cerebral cortex in mammals and especially primates. Mutations in ASPM, which encodes the human homologue of a fly protein essential for spindle function, are the most common known cause of MCPH. Here we have isolated large genomic clones containing the complete ASPM gene, including promoter regions and introns, from chimpanzee, gorilla, orangutan, and rhesus macaque by transformation-associated recombination cloning in yeast. We have sequenced these clones and show that whereas much of the sequence of ASPM is substantially conserved among primates, specific segments are subject to high Ka/Ks ratios (nonsynonymous/synonymous DNA changes) consistent with strong positive selection for evolutionary change. The ASPM gene sequence shows accelerated evolution in the African hominoid clade, and this precedes hominid brain expansion by several million years. Gorilla and human lineages show particularly accelerated evolution in the IQ domain of ASPM. Moreover, ASPM regions under positive selection in primates are also the most highly diverged regions between primates and nonprimate mammals. We report the first direct application of TAR cloning technology to the study of human evolution. Our data suggest that evolutionary selection of specific segments of the ASPM sequence strongly relates to differences in cerebral cortical size. PMID:15045028

Microsatellites for Lindera species

Treesearch

Craig S. Echt; D. Deemer; T.L. Kubisiak; C.D. Nelson

2006-01-01

Microsatellite markers were developed for conservation genetic studies of Lindera melissifolia (pondberry), a federally endangered shrub of southern bottomland ecosystems. Microsatellite sequences were obtained from DNA libraries that were enriched for the (AC)n simple sequence repeat motif. From 35 clone sequences, 20 primer...

ASSESSMENT OF CLONE IDENTITY AND SEQUENCE FIDELITY FOR 1189 IMAGE CDNA CLONES. (R827402)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

Production of Mutated Porcine Embryos Using Zinc Finger Nucleases and a Reporter-based Cell Enrichment System.

PubMed

Koo, Ok Jae; Park, Sol Ji; Lee, Choongil; Kang, Jung Taek; Kim, Sujin; Moon, Joon Ho; Choi, Ji Yei; Kim, Hyojin; Jang, Goo; Kim, Jin-Soo; Kim, Seokjoong; Lee, Byeong-Chun

2014-03-01

To facilitate the construction of genetically-modified pigs, we produced cloned embryos derived from porcine fibroblasts transfected with a pair of engineered zinc finger nuclease (ZFN) plasmids to create targeted mutations and enriched using a reporter plasmid system. The reporter expresses RFP and eGFP simultaneously when ZFN-mediated site-specific mutations occur. Thus, double positive cells (RFP(+)/eGFP(+)) were selected and used for somatic cell nuclear transfer. Two types of reporter based enrichment systems were used in this study; the cloned embryos derived from cells enriched using a magnetic sorting-based system showed better developmental competence than did those derived from cells enriched by flow cytometry. Mutated sequences, such as insertions, deletions, or substitutions, together with the wild-type sequence, were found in the cloned porcine blastocysts. Therefore, genetic mutations can be achieved in cloned porcine embryos reconstructed with ZFN-treated cells that were enriched by a reporter-based system.

Microsatellite DNA fingerprinting, differentiation, and genetic relationships of clones, cultivars, and varieties of six poplar species from three sections of the genus Populus.

PubMed

Rahman, Muhammad H; Rajora, Om P

2002-12-01

Accurate identification of Populus clones and cultivars is essential for effective selection, breeding, and genetic resource management programs. The unit of cultivation and breeding in poplars is a clone, and individual cultivars are normally represented by a single clone. Microsatellite DNA markers of 10 simple sequence repeat loci were used for genetic fingerprinting and differentiation of 96 clones/cultivars and varieties belonging to six Populus species (P. deltoides, P. nigra, P. balsamifera, P. trichocarpa, P. grandidentata, and P maximowiczii) from three sections of the genus. All 96 clones/cultivars could be uniquely fingerprinted based on their single- or multilocus microsatellite genotypes. The five P. grandidentata clones could be differentiated based on their single-locus genotypes, while six clones of P. trichocarpa and 11 clones of P. maximowiczii could be identified by their two-locus genotypes. Twenty clones of P. deltoides and 25 clones of P. nigra could be differentiated by their multilocus genotypes employing three loci, and 29 clones of P. balsamifera required the use of multilocus genotypes at five loci for their genetic fingerprinting and differentiation. The loci PTR3, PTR5, and PTR7 were found to be the most informative for genetic fingerprinting and differentiation of the clones. The mean number of alleles per locus ranged from 2.9 in P. trichocarpa or P. grandidentata to 6.0 in P. balsamifera and 11.2 in 96 clones of the six species. The mean number of observed genotypes per locus ranged from 2.4 in P. grandidentata to 7.4 in P. balsamifera and 19.6 in 96 clones of the six species. The mean number of unique genotypes per locus ranged from 1.3 in P. grandidentata to 3.9 in P. deltoides and 8.8 in 96 clones of the six species. The power of discrimination of the microsatellite DNA markers in the 96 clones ranged from 0.726 for PTR4 to 0.939 for PTR7, with a mean of 0.832 over the 10 simple sequence repeat loci. Clones/cultivars from the same species showed higher microsatellite DNA similarities than the clones from the different species. A UPGMA cluster plot constructed from the microsatellite genotypic similarities separated the 96 clones into six major groups corresponding to their species. Populus nigra var. italica clones were genetically differentiated from the P. nigra var. nigra clones. Microsatellite DNA markers could be useful in genetic fingerprinting, identification, classification, certification, and registration of clones, clultivars, and varieties as well as genetic resource management and protection of plant breeders' rights in Populus.

A genome-wide BAC-end sequence survey provides first insights into sweetpotato (Ipomoea batatas (L.) Lam.) genome composition.

PubMed

Si, Zengzhi; Du, Bing; Huo, Jinxi; He, Shaozhen; Liu, Qingchang; Zhai, Hong

2016-11-21

Sweetpotato, Ipomoea batatas (L.) Lam., is an important food crop widely grown in the world. However, little is known about the genome of this species because it is a highly heterozygous hexaploid. Gaining a more in-depth knowledge of sweetpotato genome is therefore necessary and imperative. In this study, the first bacterial artificial chromosome (BAC) library of sweetpotato was constructed. Clones from the BAC library were end-sequenced and analyzed to provide genome-wide information about this species. The BAC library contained 240,384 clones with an average insert size of 101 kb and had a 7.93-10.82 × coverage of the genome, and the probability of isolating any single-copy DNA sequence from the library was more than 99%. Both ends of 8310 BAC clones randomly selected from the library were sequenced to generate 11,542 high-quality BAC-end sequences (BESs), with an accumulative length of 7,595,261 bp and an average length of 658 bp. Analysis of the BESs revealed that 12.17% of the sweetpotato genome were known repetitive DNA, including 7.37% long terminal repeat (LTR) retrotransposons, 1.15% Non-LTR retrotransposons and 1.42% Class II DNA transposons etc., 18.31% of the genome were identified as sweetpotato-unique repetitive DNA and 10.00% of the genome were predicted to be coding regions. In total, 3,846 simple sequences repeats (SSRs) were identified, with a density of one SSR per 1.93 kb, from which 288 SSRs primers were designed and tested for length polymorphism using 20 sweetpotato accessions, 173 (60.07%) of them produced polymorphic bands. Sweetpotato BESs had significant hits to the genome sequences of I. trifida and more matches to the whole-genome sequences of Solanum lycopersicum than those of Vitis vinifera, Theobroma cacao and Arabidopsis thaliana. The first BAC library for sweetpotato has been successfully constructed. The high quality BESs provide first insights into sweetpotato genome composition, and have significant hits to the genome sequences of I. trifida and more matches to the whole-genome sequences of Solanum lycopersicum. These resources as a robust platform will be used in high-resolution mapping, gene cloning, assembly of genome sequences, comparative genomics and evolution for sweetpotato.

Hypergravity-induced changes in gene expression in Arabidopsis hypocotyls

NASA Astrophysics Data System (ADS)

Yoshioka, R.; Soga, K.; Wakabayashi, K.; Takeba, G.; Hoson, T.

2003-05-01

Under hypergravity conditions, the cell wall of stem organs becomes mechanically rigid and elongation growth is suppressed, which can be recognized as the mechanism for plants to resist gravitational force. The changes in gene expression by hypergravity treatment were analyzed in Arabidopsis hypocotyls by the differential display method, for identifying genes involved in hypergravity-induced growth suppression. Sixty-two cDNA clones were expressed differentially between the control and 300 g conditions: the expression levels of 39 clones increased, whereas those of 23 clones decreased under hypergravity conditions. Sequence analysis and database searching revealed that 12 clones, 9 up-regulated and 3 down-regulated, have homology to known proteins. The expression of these genes was further analyzed using RT-PCR. Finally, six genes were confirmed to be up-regulated by hypergravity. One of such genes encoded 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGR), which catalyzes a reaction producing mevalonic acid, a key precursor ofterpenoids such as membrane sterols and several types of hormones. The expression of HMGR gene increased within several hours after hypergravity treatment. Also, compactin, an inhibitor of HMGR, prevented hypergravity-induced growth suppression, suggesting that HMGR is involved in suppression of Arabidopsis hypocotyl growth by hypergravity. In addition, hypergravity increased the expression levels of genes encoding CCR1 and ERD15, which were shown to take part in the signaling pathway of environmental stimuli such as temperature and water, and those of the α-tubulin gene. These genes may be involved in a series of cellular events leading to growth suppression of stem organs under hypergravity conditions.

Single haplotype assembly of the human genome from a hydatidiform mole.

PubMed

Steinberg, Karyn Meltz; Schneider, Valerie A; Graves-Lindsay, Tina A; Fulton, Robert S; Agarwala, Richa; Huddleston, John; Shiryev, Sergey A; Morgulis, Aleksandr; Surti, Urvashi; Warren, Wesley C; Church, Deanna M; Eichler, Evan E; Wilson, Richard K

2014-12-01

A complete reference assembly is essential for accurately interpreting individual genomes and associating variation with phenotypes. While the current human reference genome sequence is of very high quality, gaps and misassemblies remain due to biological and technical complexities. Large repetitive sequences and complex allelic diversity are the two main drivers of assembly error. Although increasing the length of sequence reads and library fragments can improve assembly, even the longest available reads do not resolve all regions. In order to overcome the issue of allelic diversity, we used genomic DNA from an essentially haploid hydatidiform mole, CHM1. We utilized several resources from this DNA including a set of end-sequenced and indexed BAC clones and 100× Illumina whole-genome shotgun (WGS) sequence coverage. We used the WGS sequence and the GRCh37 reference assembly to create an assembly of the CHM1 genome. We subsequently incorporated 382 finished BAC clone sequences to generate a draft assembly, CHM1_1.1 (NCBI AssemblyDB GCA_000306695.2). Analysis of gene, repetitive element, and segmental duplication content show this assembly to be of excellent quality and contiguity. However, comparison to assembly-independent resources, such as BAC clone end sequences and PacBio long reads, indicate misassembled regions. Most of these regions are enriched for structural variation and segmental duplication, and can be resolved in the future. This publicly available assembly will be integrated into the Genome Reference Consortium curation framework for further improvement, with the ultimate goal being a completely finished gap-free assembly. © 2014 Steinberg et al.; Published by Cold Spring Harbor Laboratory Press.

Single haplotype assembly of the human genome from a hydatidiform mole

PubMed Central

Steinberg, Karyn Meltz; Schneider, Valerie A.; Graves-Lindsay, Tina A.; Fulton, Robert S.; Agarwala, Richa; Huddleston, John; Shiryev, Sergey A.; Morgulis, Aleksandr; Surti, Urvashi; Warren, Wesley C.; Church, Deanna M.; Eichler, Evan E.; Wilson, Richard K.

2014-01-01

A complete reference assembly is essential for accurately interpreting individual genomes and associating variation with phenotypes. While the current human reference genome sequence is of very high quality, gaps and misassemblies remain due to biological and technical complexities. Large repetitive sequences and complex allelic diversity are the two main drivers of assembly error. Although increasing the length of sequence reads and library fragments can improve assembly, even the longest available reads do not resolve all regions. In order to overcome the issue of allelic diversity, we used genomic DNA from an essentially haploid hydatidiform mole, CHM1. We utilized several resources from this DNA including a set of end-sequenced and indexed BAC clones and 100× Illumina whole-genome shotgun (WGS) sequence coverage. We used the WGS sequence and the GRCh37 reference assembly to create an assembly of the CHM1 genome. We subsequently incorporated 382 finished BAC clone sequences to generate a draft assembly, CHM1_1.1 (NCBI AssemblyDB GCA_000306695.2). Analysis of gene, repetitive element, and segmental duplication content show this assembly to be of excellent quality and contiguity. However, comparison to assembly-independent resources, such as BAC clone end sequences and PacBio long reads, indicate misassembled regions. Most of these regions are enriched for structural variation and segmental duplication, and can be resolved in the future. This publicly available assembly will be integrated into the Genome Reference Consortium curation framework for further improvement, with the ultimate goal being a completely finished gap-free assembly. PMID:25373144

Collaborative environmental DNA sampling from petal surfaces of flowering cherry Cerasus × yedoensis 'Somei-yoshino' across the Japanese archipelago.

PubMed

Ohta, Tazro; Kawashima, Takeshi; Shinozaki, Natsuko O; Dobashi, Akito; Hiraoka, Satoshi; Hoshino, Tatsuhiko; Kanno, Keiichi; Kataoka, Takafumi; Kawashima, Shuichi; Matsui, Motomu; Nemoto, Wataru; Nishijima, Suguru; Suganuma, Natsuki; Suzuki, Haruo; Taguchi, Y-H; Takenaka, Yoichi; Tanigawa, Yosuke; Tsuneyoshi, Momoka; Yoshitake, Kazutoshi; Sato, Yukuto; Yamashita, Riu; Arakawa, Kazuharu; Iwasaki, Wataru

2018-02-19

Recent studies have shown that environmental DNA is found almost everywhere. Flower petal surfaces are an attractive tissue to use for investigation of the dispersal of environmental DNA in nature as they are isolated from the external environment until the bud opens and only then can the petal surface accumulate environmental DNA. Here, we performed a crowdsourced experiment, the "Ohanami Project", to obtain environmental DNA samples from petal surfaces of Cerasus × yedoensis 'Somei-yoshino' across the Japanese archipelago during spring 2015. C. × yedoensis is the most popular garden cherry species in Japan and clones of this cultivar bloom simultaneously every spring. Data collection spanned almost every prefecture and totaled 577 DNA samples from 149 collaborators. Preliminary amplicon-sequencing analysis showed the rapid attachment of environmental DNA onto the petal surfaces. Notably, we found DNA of other common plant species in samples obtained from a wide distribution; this DNA likely originated from the pollen of the Japanese cedar. Our analysis supports our belief that petal surfaces after blossoming are a promising target to reveal the dynamics of environmental DNA in nature. The success of our experiment also shows that crowdsourced environmental DNA analyses have considerable value in ecological studies.

Biomining active cellulases from a mining bioremediation system.

PubMed

Mewis, Keith; Armstrong, Zachary; Song, Young C; Baldwin, Susan A; Withers, Stephen G; Hallam, Steven J

2013-09-20

Functional metagenomics has emerged as a powerful method for gene model validation and enzyme discovery from natural and human engineered ecosystems. Here we report development of a high-throughput functional metagenomic screen incorporating bioinformatic and biochemical analyses features. A fosmid library containing 6144 clones sourced from a mining bioremediation system was screened for cellulase activity using 2,4-dinitrophenyl β-cellobioside, a previously proven cellulose model substrate. Fifteen active clones were recovered and fully sequenced revealing 9 unique clones with the ability to hydrolyse 1,4-β-D-glucosidic linkages. Transposon mutagenesis identified genes belonging to glycoside hydrolase (GH) 1, 3, or 5 as necessary for mediating this activity. Reference trees for GH 1, 3, and 5 families were generated from sequences in the CAZy database for automated phylogenetic analysis of fosmid end and active clone sequences revealing known and novel cellulase encoding genes. Active cellulase genes recovered in functional screens were subcloned into inducible high copy plasmids, expressed and purified to determine enzymatic properties including thermostability, pH optima, and substrate specificity. The workflow described here provides a general paradigm for recovery and characterization of microbially derived genes and gene products based on genetic logic and contemporary screening technologies developed for model organismal systems. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Use of repetitive DNA sequences to distinguish Mus musculus and Mus caroli cells by in situ hybridization.

PubMed

Siracusa, L D; Chapman, V M; Bennett, K L; Hastie, N D; Pietras, D F; Rossant, J

1983-02-01

Mammalian chimaeras have proved useful for investigating early steps in embryonic development. However, a complete clonal analysis of cell lineages has been limited by the lack of a marker which is ubiquitous and can distinguish parental cell types in situ. We have developed a cell marker system which fulfils these criteria. Chimaeric mice were successfully produced from two mouse species which possess sufficient genetic differences to allow unequivocal identification of parental cell types. DNA-DNA in situ hybridization with cloned, species-specific sequences was performed to distinguish the parental cell types. We have identified a cloned, Mus musculus satellite DNA sequence which shows hybridization differences between Mus musculus and Mus caroli DNA. This clone was used a a probe in in situ hybridizations to bone marrow chromosomes from Mus musculus, Mus caroli, and an interspecific F1 hybrid. The clone could qualitatively distinguish Mus musculus from Mus caroli chromosomes after in situ hybridization, even when they were derived from the same F1 hybrid cell. Quantitation of this hybridization to interphase nuclei from bone marrow spreads indicates that the probe can successfully distinguish Mus musculus from Mus caroli cells and can determine the percentage contribution of Mus musculus in mixtures of bone marrow cells of these species and in chimaeric bone marrow cell preparations.

Direct Analysis of Genes Encoding 16S rRNA from Complex Communities Reveals Many Novel Molecular Species within the Human Gut

PubMed Central

Suau, Antonia; Bonnet, Régis; Sutren, Malène; Godon, Jean-Jacques; Gibson, Glenn R.; Collins, Matthew D.; Doré, Joel

1999-01-01

The human intestinal tract harbors a complex microbial ecosystem which plays a key role in nutrition and health. Although this microbiota has been studied in great detail by culture techniques, microscopic counts on human feces suggest that 60 to 80% of the observable bacteria cannot be cultivated. Using comparative analysis of cloned 16S rRNA gene (rDNA) sequences, we have investigated the bacterial diversity (both cultivated and noncultivated bacteria) within an adult-male fecal sample. The 284 clones obtained from 10-cycle PCR were classified into 82 molecular species (at least 98% similarity). Three phylogenetic groups contained 95% of the clones: the Bacteroides group, the Clostridium coccoides group, and the Clostridium leptum subgroup. The remaining clones were distributed among a variety of phylogenetic clusters. Only 24% of the molecular species recovered corresponded to described organisms (those whose sequences were available in public databases), and all of these were established members of the dominant human fecal flora (e.g., Bacteroides thetaiotaomicron, Fusobacterium prausnitzii, and Eubacterium rectale). However, the majority of generated rDNA sequences (76%) did not correspond to known organisms and clearly derived from hitherto unknown species within this human gut microflora. PMID:10543789