Sample records for epidermal permeability barrier

  1. Testosterone perturbs epidermal permeability barrier homeostasis.


    Kao, J S; Garg, A; Mao-Qiang, M; Crumrine, D; Ghadially, R; Feingold, K R; Elias, P M


    Although there are no known gender-related differences in permeability barrier function in adults, estrogens accelerate whereas testosterone retards barrier development in fetal skin, and male fetuses demonstrate slower barrier development than female littermates. Moreover, prenatal administration of the androgen receptor antagonist, flutamide, equalizes developmental rates in male and female fetuses. Therefore, we evaluated the effects of changes in testosterone on barrier homeostasis in adult murine and human skin. Hypogonadal mice (whether by castration or by treatment with systemic flutamide) displayed significantly faster barrier recovery at 3, 6, and 12 h than did controls, and testosterone replacement slowed barrier recovery in castrated mice. Moreover, testosterone directly effects the skin, as topical flutamide also accelerated barrier recovery in normal male mice. These findings appear to be of physiologic significance, since prepubertal male mice (age 5 wk) displayed accelerated barrier recovery in comparison with adult postpubertal (11 wk) males. These studies also appear to be relevant for humans, as a hypopituitary human subject demonstrated repeated changes in barrier recovery in parallel with peaks and nadirs in serum testosterone levels during intermittent testosterone replacement. Mechanistic studies showed that differences in epidermal lipid synthesis do not account for the testosterone-induced functional alterations. Instead, epidermal lamellar body (LB) formation and secretion both decrease, resulting in decreased extracellular lamellar bilayers in testosterone-replete animals. These studies demonstrate that fluctuations in testosterone modulate barrier function, and that testosterone repletion can have negative consequences for permeability barrier homeostasis.

  2. Epidermal Permeability Barrier (EPB) measurement in mammalian skin

    PubMed Central

    Indra, Arup Kumar; Leid, Mark


    A defective skin epidermal permeability barrier (EPB) is responsible for a high mortality rate in premature infants, and is an important risk factor in inflammatory skin diseases such as eczema. We report here fast and accurate methods for measurement of EPB in animal models or in human patients using simple techniques that monitor diffusion of dyes (X-Gal or Lucifer Yellow) through the upper epidermis and measure transepidermal water loss (TEWL) resulting from a defective skin barrier. Accurate diagnosis and early detection of EPB defects in human patients are critical for effective treatment of certain classes of inflammatory skin diseases. PMID:21874444

  3. Epidermal Vascular Endothelial Growth Factor Production Is Required for Permeability Barrier Homeostasis, Dermal Angiogenesis, and the Development of Epidermal Hyperplasia

    PubMed Central

    Elias, Peter M.; Arbiser, Jack; Brown, Barbara E.; Rossiter, Heidemarie; Man, Mao-Qiang; Cerimele, Francesca; Crumrine, Debra; Gunathilake, Roshan; Choi, Eung Ho; Uchida, Yoshikazu; Tschachler, Erwin; Feingold, Kenneth R.


    Primary abnormalities in permeability barrier function appear to underlie atopic dermatitis and epidermal trauma; a concomitant barrier dysfunction could also drive other inflammatory dermatoses, including psoriasis. Central to this outside-inside view of disease pathogenesis is the epidermal generation of cytokines/growth factors, which in turn signal downstream epidermal repair mechanisms. Yet, this cascade, if sustained, signals downstream epidermal hyperplasia and inflammation. We found here that acute barrier disruption rapidly stimulates mRNA and protein expression of epidermal vascular endothelial growth factor-A (VEGF-A) in normal hairless mice, a specific response to permeability barrier requirements because up-regulation is blocked by application of a vapor-impermeable membrane. Moreover, epidermal vegf−/− mice display abnormal permeability barrier homeostasis, attributable to decreased VEGF signaling of epidermal lamellar body production; a paucity of dermal capillaries with reduced vascular permeability; and neither angiogenesis nor epidermal hyperplasia in response to repeated tape stripping (a model of psoriasiform hyperplasia). These results support a central role for epidermal VEGF in the maintenance of epidermal permeability barrier homeostasis and a link between epidermal VEGF production and both dermal angiogenesis and the development of epidermal hyperplasia. Because psoriasis is commonly induced by external trauma [isomorphic (Koebner) phenomenon] and is associated with a prominent permeability barrier abnormality, excess VEGF production, prominent angiogenesis, and epidermal hyperplasia, these results could provide a potential outside-inside mechanistic basis for the development of psoriasis. PMID:18688025

  4. Epidermal Permeability Barrier Defects and Barrier Repair Therapy in Atopic Dermatitis

    PubMed Central

    Lee, Hae-Jin


    Atopic dermatitis (AD) is a multifactorial inflammatory skin disease perpetuated by gene-environmental interactions and which is characterized by genetic barrier defects and allergic inflammation. Recent studies demonstrate an important role for the epidermal permeability barrier in AD that is closely related to chronic immune activation in the skin during systemic allergic reactions. Moreover, acquired stressors (e.g., Staphylococcus aureus infection) to the skin barrier may also initiate inflammation in AD. Many studies involving patients with AD revealed that defective skin barriers combined with abnormal immune responses might contribute to the pathophysiology of AD, supporting the outside-inside hypothesis. In this review, we discuss the recent advances in human and animal models, focusing on the defects of the epidermal permeability barrier, its immunologic role and barrier repair therapy in AD. PMID:24991450

  5. Topical apigenin improves epidermal permeability barrier homoeostasis in normal murine skin by divergent mechanisms.


    Hou, Maihua; Sun, Richard; Hupe, Melanie; Kim, Peggy L; Park, Kyungho; Crumrine, Debra; Lin, Tzu-Kai; Santiago, Juan Luis; Mauro, Theodora M; Elias, Peter M; Man, Mao-Qiang


    The beneficial effects of certain herbal medicines on cutaneous function have been appreciated for centuries. Among these agents, chrysanthemum extract, apigenin, has been used for skin care, particularly in China, for millennia. However, the underlying mechanisms by which apigenin benefits the skin are not known. In this study, we first determined whether topical apigenin positively influences permeability barrier homoeostasis, and then the basis thereof. Hairless mice were treated topically with either 0.1% apigenin or vehicle alone twice daily for 9 days. At the end of the treatments, permeability barrier function was assessed with either an electrolytic water analyzer or a Tewameter. Our results show that topical apigenin significantly enhanced permeability barrier homoeostasis after tape stripping, although basal permeability barrier function remained unchanged. Improved barrier function correlated with enhanced filaggrin expression and lamellar body production, which was paralleled by elevated mRNA levels for the epidermal ABCA12. The mRNA levels for key lipid synthetic enzymes also were upregulated by apigenin. Finally, both cathelicidin-related peptide and mouse beta-defensin 3 immunostaining were increased by apigenin. We conclude that topical apigenin improves epidermal permeability barrier function by stimulating epidermal differentiation, lipid synthesis and secretion, as well as cutaneous antimicrobial peptide production. Apigenin could be useful for the prevention and treatment of skin disorders characterized by permeability barrier dysfunction, associated with reduced filaggrin levels and impaired antimicrobial defenses, such as atopic dermatitis.

  6. Topical application of TRPM8 agonists accelerates skin permeability barrier recovery and reduces epidermal proliferation induced by barrier insult: role of cold-sensitive TRP receptors in epidermal permeability barrier homoeostasis.


    Denda, Mitsuhiro; Tsutsumi, Moe; Denda, Sumiko


    TRPA1 and TRPM8 receptors are activated at low temperature (A1: below 17 degrees C and M8: below 22 degrees C). Recently, we observed that low temperature (below 22 degrees C) induced elevation of intracellular calcium in keratinocytes. Moreover, we demonstrated that topical application of TRPA1 agonists accelerated the recovery of epidermal permeability barrier function after disruption. In this study, we examined the effect of topical application of TRPM8 modulators on epidermal permeability barrier homoeostasis. Immunohistochemical study and RT-PCR confirmed the expression of TRPM8 or TRPM8-like protein in epidermal keratinocytes. Topical application of TRPM8 agonists, menthol and WS 12 accelerated barrier recovery after tape stripping. The effect of WS12 was blocked by a non-selective TRP antagonist, Ruthenium Red, and a TRPM8-specific antagonist, BTCT. Topical application of WS12 also reduced epidermal proliferation associated with barrier disruption under low humidity, and this effect was blocked by BTCT. Our results indicate that TRPM8 or a closely related protein in epidermal keratinocytes plays a role in epidermal permeability barrier homoeostasis and epidermal proliferation after barrier insult.

  7. Epidermal Permeability Barrier Recovery Is Delayed in Vitiligo-Involved Sites

    PubMed Central

    Liu, J.; Man, W.Y.; Lv, C.Z.; Song, S.P.; Shi, Y.J.; Elias, P.M.; Man, M.Q.


    Background/Objectives Prior studies have demonstrated that both the skin surface pH and epidermal permeability barrier function vary with skin pigmentation types. Although melanin deficiency is the main feature of vitiligo, alterations in cutaneous biophysical properties in vitiligo have not yet been well defined. In the present study, stratum corneum (SC) hydration, the skin surface pH and epidermal permeability barrier function in vitiligo were evaluated. Methods A total of 30 volunteers with vitiligo comprising 19 males and 11 females aged 13–51 years (mean age: 27.91 ± 2.06 years) were enrolled in this study. The skin surface pH, SC hydration, melanin/erythema index and transepidermal water loss (TEWL) were measured by respective probes connected to a Courage-Khazaka MPA5. SC integrity was determined by measuring the TEWL following each D-Squame application. The barrier recovery rate was assessed at 5 h following barrier disruption by repeated tape stripping. Results In addition to SC hydration, both melanin and erythema index were significantly lower in vitiligo lesions than in contralateral, nonlesional sites, while no difference in skin surface pH between vitiligo-involved and uninvolved areas was observed. In addition, neither the basal TEWL nor SC integrity in the involved areas differed significantly from that in the uninvolved areas. However, barrier recovery in vitiligo-involved sites was significantly delayed in comparison with uninvolved sites (40.83 ± 5.39% vs. 58.30 ± 4.71%; t = 2.441; p < 0.02). Conclusion Barrier recovery following tape stripping of the SC is delayed in vitiligo. Therefore, improvement in epidermal permeability barrier function may be an important unrecognized factor to be considered in treating patients with vitiligo. PMID:20185976

  8. ABCA12 maintains the epidermal lipid permeability barrier by facilitating formation of ceramide linoleic esters.


    Zuo, Ying; Zhuang, Debbie Z; Han, Rong; Isaac, Giorgis; Tobin, Jennifer J; McKee, Mary; Welti, Ruth; Brissette, Janice L; Fitzgerald, Michael L; Freeman, Mason W


    Harlequin ichthyosis is a congenital scaling syndrome of the skin in which affected infants have epidermal hyperkeratosis and a defective permeability barrier. Mutations in the gene encoding a member of the ABCA transporter family, ABCA12, have been linked to harlequin ichthyosis, but the molecular function of the protein is unknown. To investigate the activity of ABCA12, we generated Abca12 null mice and analyzed the impact on skin function and lipid content. Abca12-/- mice are born with a thickened epidermis and die shortly after birth, as water rapidly evaporates from their skin. In vivo skin proliferation measurements suggest a lack of desquamation of the skin cells, rather than enhanced proliferation of basal layer keratinocytes, accounts for the 5-fold thickening of the Abca12-/- stratum corneum. Electron microscopy revealed a loss of the lamellar permeability barrier in Abca12-/- skin. This was associated with a profound reduction in skin linoleic esters of long-chain omega-hydroxyceramides and a corresponding increase in their glucosyl ceramide precursors. Because omega-hydroxyceramides are required for the barrier function of the skin, these results establish that ABCA12 activity is required for the generation of long-chain ceramide esters that are essential for the development of normal skin structure and function.

  9. New treatments for restoring impaired epidermal barrier permeability: skin barrier repair creams.


    Draelos, Zoe Diana


    Skin health depends on an intact barrier composed of protein-rich corneocytes surrounded by the lamellar intercellular lipids. This barrier provides waterproof protection for the body, preventing infection, regulating electrolyte balance, maintaining body temperature, and providing a mechanism for sensation. Damage to the skin barrier results in skin disease that can be treated by a variety of externally applied substances, such as ceramides, hyaluronic acid, licorice extracts, dimethicone, petrolatum, and paraffin wax. These substances are found in moisturizers that are sold as cosmetics and in prescriptions as 510(k) devices. This contribution examines the formulation and effect of skin barrier creams.

  10. Cellular responses to disruption of the permeability barrier in a three-dimensional organotypic epidermal model

    SciTech Connect

    Ajani, Gati; Sato, Nobuyuki; Mack, Judith A.; Maytin, Edward V. . E-mail:


    Repeated injury to the stratum corneum of mammalian skin (caused by friction, soaps, or organic solvents) elicits hyperkeratosis and epidermal thickening. Functionally, these changes serve to restore the cutaneous barrier and protect the organism. To better understand the molecular and cellular basis of this response, we have engineered an in vitro model of acetone-induced injury using organotypic epidermal cultures. Rat epidermal keratinocytes (REKs), grown on a collagen raft in the absence of any feeder fibroblasts, developed all the hallmarks of a true epidermis including a well-formed cornified layer. To induce barrier injury, REK cultures were treated with intermittent 30-s exposures to acetone then were fixed and paraffin-sectioned. After two exposures, increased proliferation (Ki67 and BrdU staining) was observed in basal and suprabasal layers. After three exposures, proliferation became confined to localized buds in the basal layer and increased terminal differentiation was observed (compact hyperkeratosis of the stratum corneum, elevated levels of K10 and filaggrin, and heightened transglutaminase activity). Thus, barrier disruption causes epidermal hyperplasia and/or enhances differentiation, depending upon the extent and duration of injury. Given that no fibroblasts are present in the model, the ability to mount a hyperplastic response to barrier injury is an inherent property of keratinocytes.

  11. Cellular responses to disruption of the permeability barrier in a three-dimensional organotypic epidermal model.


    Ajani, Gati; Sato, Nobuyuki; Mack, Judith A; Maytin, Edward V


    Repeated injury to the stratum corneum of mammalian skin (caused by friction, soaps, or organic solvents) elicits hyperkeratosis and epidermal thickening. Functionally, these changes serve to restore the cutaneous barrier and protect the organism. To better understand the molecular and cellular basis of this response, we have engineered an in vitro model of acetone-induced injury using organotypic epidermal cultures. Rat epidermal keratinocytes (REKs), grown on a collagen raft in the absence of any feeder fibroblasts, developed all the hallmarks of a true epidermis including a well-formed cornified layer. To induce barrier injury, REK cultures were treated with intermittent 30-s exposures to acetone then were fixed and paraffin-sectioned. After two exposures, increased proliferation (Ki67 and BrdU staining) was observed in basal and suprabasal layers. After three exposures, proliferation became confined to localized buds in the basal layer and increased terminal differentiation was observed (compact hyperkeratosis of the stratum corneum, elevated levels of K10 and filaggrin, and heightened transglutaminase activity). Thus, barrier disruption causes epidermal hyperplasia and/or enhances differentiation, depending upon the extent and duration of injury. Given that no fibroblasts are present in the model, the ability to mount a hyperplastic response to barrier injury is an inherent property of keratinocytes.

  12. The effect of obesity on skin disease and epidermal permeability barrier status in children.


    Nino, Massimiliano; Franzese, Adriana; Ruggiero Perrino, Nunzia; Balato, Nicola


    Obese adult patients have many dermatoses, such as skin tags, candida infection, cellulite, and intertrigo, but only limited data have been published on obese children and the barrier function of their skin. Sixty-five overweight and obese children (n = 40, BMI 85th-95th percentile; n = 25, BMI > 95th percentile) (aged 8-15; mean age 11.6) and 30 normal-weight controls (aged 7-15; mean age 11.1) underwent a clinical evaluation and calculation of transepidermal water loss (TEWL). Higher weight percentile was associated with a higher incidence of some dermatoses. Skin tags were found in 40% of subjects in the 95th percentile and 2.5% of those in the 85th percentile. Striae distensae were observed in 32% of patients in the 95th percentile and 22.5% of those in the 85th percentile. Plantar hyperkeratosis was observed only in 20% of the 95th percentile subjects and was not observed in the other groups. TEWL values at the forearm site were significantly higher (p < 0.05) in obese children than in the control group, but no significant differences in TEWL values according to BMI level were found between the two groups of obese children. Degree of obesity influences the incidence of some associated dermatoses; skin tags, striae distensae, and plantar hyperkeratosis were more frequent in children in the 95th percentile of BMI. Obesity increases the TEWL rate, suggesting that obese children might become more easily overheated as weight increases, with more profuse sweating because of the thick layers of subcutaneous fat.


    PubMed Central

    Curtis, Brenda J.; Radek, Katherine A.


    Several cutaneous inflammatory diseases and their clinical phenotypes are recapitulated in animal models of skin disease. However, the identification of shared pathways for disease progression is limited by the ability to delineate the complex biochemical processes fundamental for development of the disease. Identifying common signaling pathways that contribute to cutaneous inflammation and immune function will facilitate better scientific and therapeutic strategies to span a variety of inflammatory skin diseases. Aberrant antimicrobial peptide (AMP) expression and activity is one mechanism behind the development and severity of several inflammatory skin diseases and directly influences the susceptibility of skin to microbial infections. Our studies have recently exposed a newly identified pathway for negative regulation of AMPs in the skin by the cholinergic anti-inflammatory pathway via acetylcholine (ACh). The role of ACh in AMP regulation of immune and permeability barrier function in keratinocytes is reviewed, and the importance for a better comprehension of cutaneous disease progression by cholinergic signaling is discussed. PMID:21918536

  14. Effects of in Utero Exposure of C57BL/6J Mice to 2,3,7,8-Tetrachlorodibenzo-p-dioxin on Epidermal Permeability Barrier Development and Function

    PubMed Central

    Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.


    Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; PMID:24904982

  15. Epidermal Growth Factor and Intestinal Barrier Function

    PubMed Central

    Liu, Hu; Yang, Shufen; Li, Zuohua; Zhong, Jinfeng


    Epidermal growth factor (EGF) is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health. PMID:27524860

  16. Claudin-1 Binder Enhances Epidermal Permeability in a Human Keratinocyte Model.


    Nakajima, Misaki; Nagase, Shotaro; Iida, Manami; Takeda, Shuji; Yamashita, Mayo; Watari, Akihiro; Shirasago, Yoshitaka; Fukasawa, Masayoshi; Takeda, Hiroyuki; Sawasaki, Tatsuya; Yagi, Kiyohito; Kondoh, Masuo


    Tight junctions (TJs) are complex biochemical structures that seal the intercellular space and prevent the free movement of solutes across epithelial cell sheets. Modulating the TJ seal is a promising option for increasing the transdermal absorption of drugs. Within TJs, the binding of the claudin (CLDN) family of tetratransmembrane proteins through cis- and trans-interactions is an integral part of seal formation. Because epidermal TJs contain CLDN-1 and CLDN-4, a binder for these CLDNs may be a useful modulator of the permeability of the epidermal barrier. Here, we investigated whether m19, which can bind to CLDN-1/-4 (also CLDN-2/-5), modulates the integrity of epidermal TJs and the permeability of cell sheets to solutes. Treatment of normal human epidermal keratinocytes (NHEKs) with the CLDN binder reduced the integrity of TJs. A CLDN-1-specific binder (a monoclonal antibody, clone 7A5) also weakened the TJ seal in NHEKs. Although m19 attenuated the TJ barrier in human intestinal epithelial cells (Caco-2), 7A5 did not. Treatment of NHEKs with 7A5 enhanced permeation of a paracellular permeation marker. These findings indicate that CLDN-1 is a potential target for modulating the permeability of the epidermis, and that our CLDN-1 binder is a promising candidate molecule for development as a dermal absorption enhancer.

  17. Permeability Barrier Generation in the Martian Lithosphere

    NASA Astrophysics Data System (ADS)

    Schools, Joe; Montési, Laurent


    Permeability barriers develop when a magma produced in the interior of a planet rises into the cooler lithosphere and crystallizes more rapidly than the lithosphere can deform (Sparks and Parmentier, 1991). Crystallization products may then clog the porous network in which melt is propagating, reducing the permeability to almost zero, i.e., forming a permeability barrier. Subsequent melts cannot cross the barrier. Permeability barriers have been useful to explain variations in crustal thickness at mid-ocean ridges on Earth (Magde et al., 1997; Hebert and Montési, 2011; Montési et al., 2011). We explore here under what conditions permeability barriers may form on Mars.We use the MELTS thermodynamic calculator (Ghiorso and Sack, 1995; Ghiorso et al., 2002; Asimow et al., 2004) in conjunction with estimated Martian mantle compositions (Morgan and Anders, 1979; Wänke and Dreibus, 1994; Lodders and Fegley, 1997; Sanloup et al., 1999; Taylor 2013) to model the formation of permeability barriers in the lithosphere of Mars. In order to represent potential past and present conditions of Mars, we vary the lithospheric thickness, mantle potential temperature (heat flux), oxygen fugacity, and water content.Our results show that permeability layers can develop in the thermal boundary layer of the simulated Martian lithosphere if the mantle potential temperature is higher than ~1500°C. The various Martian mantle compositions yield barriers in the same locations, under matching variable conditions. There is no significant difference in barrier location over the range of accepted Martian oxygen fugacity values. Water content is the most significant influence on barrier development as it reduces the temperature of crystallization, allowing melt to rise further into the lithosphere. Our lower temperature and thicker lithosphere model runs, which are likely the most similar to modern Mars, show no permeability barrier generation. Losing the possibility of having a permeability

  18. Bricks and mortar of the epidermal barrier.


    Nemes, Z; Steinert, P M


    A specialized tissue type, the keratinizing epithelium, protects terrestrial mammals from water loss and noxious physical, chemical and mechanical insults. This barrier between the body and the environment is constantly maintained by reproduction of inner living epidermal keratinocytes which undergo a process of terminal differentiation and then migrate to the surface as interlocking layers of dead stratum corneum cells. These cells provide the bulwark of mechanical and chemical protection, and together with their intercellular lipid surroundings, confer water-impermeability. Much of this barrier function is provided by the cornified cell envelope (CE), an extremely tough protein/lipid polymer structure formed just below the cytoplasmic membrane and subsequently resides on the exterior of the dead cornified cells. It consists of two parts: a protein envelope and a lipid envelope. The protein envelope is thought to contribute to the biomechanical properties of the CE as a result of cross-linking of specialized CE structural proteins by both disulfide bonds and N(epsilon)-(gamma-glutamyl)lysine isopeptide bonds formed by transglutaminases. Some of the structural proteins involved include involucrin, loricrin, small proline rich proteins, keratin intermediate filaments, elafin, cystatin A, and desmosomal proteins. The lipid envelope is located on the exterior of and covalently attached by ester bonds to the protein envelope and consists of a monomolecular layer of omega-hydroxyceramides. These not only serve of provide a Teflon-like coating to the cell, but also interdigitate with the intercellular lipid lamellae perhaps in a Velcro-like fashion. In fact the CE is a common feature of all stratified squamous epithelia, although its precise composition, structure and barrier function requirements vary widely between epithelia. Recent work has shown that a number of diseases which display defective epidermal barrier function, generically known as ichthyoses, are the


    EPA Science Inventory

    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating groundwater contamination that combine subsurface fluid flow management with a passive chemical treatment zone. Removal of contaminants from the groundwater plume is achieved by alt...


    EPA Science Inventory

    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating groundwater contamination that combine subsurface fluid flow management with a passive chemical treatment zone. Removal of contaminants from the groundwater plume is achieved by alt...

  1. Epidermal barrier dysfunction and cutaneous sensitization in atopic diseases.


    Kubo, Akiharu; Nagao, Keisuke; Amagai, Masayuki


    Classic atopic dermatitis is complicated by asthma, allergic rhinitis, and food allergies, cumulatively referred to as atopic diseases. Recent discoveries of mutations in the filaggrin gene as predisposing factors for atopic diseases have refocused investigators' attention on epidermal barrier dysfunction as a causative mechanism. The skin's barrier function has three elements: the stratum corneum (air-liquid barrier), tight junctions (liquid-liquid barrier), and the Langerhans cell network (immunological barrier). Clarification of the molecular events underpinning epidermal barrier function and dysfunction should lead to a better understanding of the pathophysiological mechanisms of atopic diseases.

  2. Sphingolipids are required for mammalian epidermal barrier function. Inhibition of sphingolipid synthesis delays barrier recovery after acute perturbation.

    PubMed Central

    Holleran, W M; Man, M Q; Gao, W N; Menon, G K; Elias, P M; Feingold, K R


    Stratum corneum lipids comprise an approximately equimolar mixture of sphingolipids, cholesterol, and free fatty acids, arranged as intercellular membrane bilayers that are presumed to mediate the epidermal permeability barrier. Prior studies have shown that alterations in epidermal barrier function lead to a rapid increase in cholesterol and fatty acid synthesis which parallels the early stages of the repair process. Despite an abundance of indirect evidence for their role in the barrier, the importance of sphingolipids has yet to be demonstrated directly. Whereas sphingolipid synthesis also increases during barrier repair, this response is delayed in comparison to cholesterol and fatty acid synthesis (Holleran, W.M., et al. 1991. J. Lipid Res. 32:1151-1158). To further delineate the role of sphingolipids in barrier homeostasis, we assessed the impact of inhibition of sphingolipid synthesis on epidermal barrier recovery. A single topical application of beta-chloro-L-alanine (beta-CA), an irreversible inhibitor of serine-palmitoyl transferase (SPT), applied to acetone-treated skin of hairless mice resulted in: (a) greater than 75% inhibition of SPT activity at 30 min (P less than 0.001); (b) a global decrease in sphingolipid synthesis between 1 and 3 h (P less than 0.02); (c) reduction of epidermal sphingolipid content at 18 h (P less than 0.01); (d) delayed reaccumulation of histochemical staining for sphingolipids in the stratum corneum; and (e) reduced numbers and contents of lamellar bodies in the stratum granulosum. Finally, despite its immediate, marked diminution of sphingolipid synthesis, beta-CA slowed barrier recovery only at late time points (greater than 6 h) after acetone treatment. This inhibition was overridden by coapplications of ceramides (the distal SPT product), indicating that the delay in repair was not due to non-specific toxicity. These studies demonstrate a distinctive role for epidermal sphingolipids in permeability barrier homeostasis

  3. Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

    PubMed Central

    Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.


    Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (<20 cigarettes/day) or heavy smokers (≥20 cigarettes/day). An MPA5 was used to measure SC hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403


    EPA Science Inventory

    The permeable reactive barrier (PRB) technology represents a passive option for long-term treatment of ground-water contamination. PRBs are a potentially more cost-effective treatment option for a variety of dissolved contaminants, such as certain types of chlorinated solvents, ...

  5. Clamshell excavation of a permeable reactive barrier

    NASA Astrophysics Data System (ADS)

    Molfetta, Antonio Di; Sethi, Rajandrea


    Nowadays, permeable reactive barriers (PRB) are one of the most widespread techniques for the remediation of contaminated aquifers. Over the past 10 years, the use of iron-based PRBs has evolved from innovative to accepted standard practice for the treatment of a variety of groundwater contaminants (ITRC in: Permeable reactive barriers: lessons learned/new directions. The Interstate Technology and Regulatory Council, Permeable Reactive Barriers Team 2005). Although, a variety of excavation methods have been developed, backhoe excavators are often used for the construction of PRBs. The aim of this study is to describe the emplacement of a full-scale PRB and the benefits deriving from the use of a crawler crane equipped with a hydraulic grab (also known as clamshell excavator) in the excavation phases. The studied PRB was designed to remediate a chlorinated hydrocarbons plume at an old industrial landfill site, in Avigliana, near the city of Torino, in Italy. The continuous reactive barrier was designed to be 120 m long, 13 m deep, and 0.6 m thick. The installation of the barrier was accomplished using a clamshell for the excavation of the trench and a guar-gum slurry to support the walls. The performance of this technique was outstanding and allowed the installation of the PRB in 7 days. The degree of precision of the excavation was very high because of the intrinsic characteristics of this excavation tool and of the use of a concrete curb to guide the hydraulic grab. Moreover, the adopted technique permitted a saving of bioslurry thus minimizing the amount of biocide required.

  6. Prolactin and blood-brain barrier permeability.


    Rosas-Hernandez, Hector; Cuevas, Elvis; Lantz, Susan M; Hamilton, W Ryan; Ramirez-Lee, Manuel A; Ali, Syed F; Gonzalez, Carmen


    The blood-brain barrier (BBB) consists in part of a highly specialized set of cells which separates the brain from the vascular system. The BBB controls the entry and exit of substances from the brain tissue through tight junctions (TJs) between endothelial cells. It is known that the hormone prolactin (PRL) is able to regulate endothelial-dependent processes, like the balance between proliferation and apoptosis and the mammary epithelial permeability. However, the effects of PRL and the role it plays in the BBB permeability are still not well understood. A primary culture of bovine brain microvessel endothelial cells was used as in vitro model of BBB. Cells were treated with PRL (0.1, 1, 10 and 100 nM) for 24 hours. PRL significantly increased cellular proliferation at 10 and 100 nM, but did not modify basal apoptosis. These effects were dependent on the production of the mitogenic factor nitric oxide (NO). PRL significantly decreased the permeability and promoted an increase in trans-endothelial electrical resistance in a NO-independent way. PRL also increased the expression of the TJs proteins claudin-5 and occludin. The short form of the PRL receptor was detected in these cells but its expression was not modified by PRL. Together, these results suggest that PRL has the ability to increase cellular proliferation associated with a decrease on BBB permeability by increasing the expression of TJs proteins.

  7. TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation

    PubMed Central

    Malaisse, Jérémy; Balau, Benoit; Sterpin, Christiane; Achouri, Younes; Lambert De Rouvroit, Catherine; Poumay, Yves; Michiels, Carine; De Backer, Olivier


    TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study. PMID:26785122

  8. Specific binding of Clostridium perfringens enterotoxin fragment to Claudin-b and modulation of zebrafish epidermal barrier.


    Zhang, Jingjing; Ni, Chen; Yang, Zhenguo; Piontek, Anna; Chen, Huapu; Wang, Sijie; Fan, Yiming; Qin, Zhihai; Piontek, Joerg


    Claudins (Cldn) are the major components of tight junctions (TJs) sealing the paracellular cleft in tissue barriers of various organs. Zebrafish Cldnb, the homolog of mammalian Cldn4, is expressed at epithelial cell-cell contacts and is important for regulating epidermal permeability. The bacterial toxin Clostridium perfringens enterotoxin (CPE) has been shown to bind to a subset of mammalian Cldns. In this study, we used the Cldn-binding C-terminal domain of CPE (194-319 amino acids, cCPE 194-319 ) to investigate its functional role in modulating zebrafish larval epidermal barriers. In vitro analyses show that cCPE 194-319 removed Cldn4 from epithelial cells and disrupted the monolayer tightness, which could be rescued by the removal of cCPE 194-319. Incubation of zebrafish larvae with cCPE 194-319 removed Cldnb specifically from the epidermal cell membrane. Dye diffusion analysis with 4-kDa fluorescent dextran indicated that the permeability of the epidermal barrier increased due to cCPE 194-319 incubation. Electron microscopic investigation revealed reversible loss of TJ integrity by Cldnb removal. Collectively, these results suggest that cCPE 194-319 could be used as a Cldnb modulator to transiently open the epidermal barrier in zebrafish. In addition, zebrafish might be used as an in vivo system to investigate the capability of cCPE to enhance drug delivery across tissue barriers.

  9. EPA/ITRC-RTDF permeable reactive barrier short course. Permeable reactive barriers: Application and deployment

    SciTech Connect


    This report focuses on the following: Permeable Reactive Barriers: Application and Deployment; Introduction to Permeable Reactive Barriers (PRBs) for Remediating and Managing Contaminated Groundwater in Situ; Collection and Interpretation of Design Data 1: Site Characterization for PRBs; Reactive Materials: Zero-Valent Iron; Collection and Interpretation of Design Data 2: Laboratory and Pilot Scale Tests; Design Calculations; Compliance Monitoring, Performance Monitoring and Long-Term Maintenance for PRBs; PRB Emplacement Techniques; PRB Permitting and Implementation; Treatment of Metals; Non-Metallic Reactive Materials; Economic Considerations for PRB Deployment; and Bibliography.

  10. EPA/ITRC-RTDF permeable reactive barrier short course. Permeable reactive barriers: Application and deployment

    SciTech Connect

    Not Available


    This report focuses on the following: Permeable Reactive Barriers: Application and Deployment; Introduction to Permeable Reactive Barriers (PRBs) for Remediating and Managing Contaminated Groundwater in Situ; Collection and Interpretation of Design Data 1: Site Characterization for PRBs; Reactive Materials: Zero-Valent Iron; Collection and Interpretation of Design Data 2: Laboratory and Pilot Scale Tests; Design Calculations; Compliance Monitoring, Performance Monitoring and Long-Term Maintenance for PRBs; PRB Emplacement Techniques; PRB Permitting and Implementation; Treatment of Metals; Non-Metallic Reactive Materials; Economic Considerations for PRB Deployment; and Bibliography.

  11. Epidermal barrier in hereditary ichthyoses, atopic dermatitis, and psoriasis.


    Schmuth, Matthias; Blunder, Stefan; Dubrac, Sandrine; Gruber, Robert; Moosbrugger-Martinz, Verena


    Several skin disorders are associated with impaired skin barrier function. Primary dysfunction is caused by monogenic defects in key components of the epidermis (for example ichthyoses). Secondary barrier impairment occurs in inflammatory dermatoses marked by disturbed epidermal homeostasis (eczema, psoriasis, etc.). In these disorders, inflammation impedes the synthesis or maintenance of skin barrier components. Recent evidence suggests a combination of primary and secondary barrier dysfunction in atopic dermatitis and, to a lesser extent, also in psoriasis. In the future, subtypes of atopic dermatitis may likely be defined, in which one or the other is prevalent.

  12. pH-Regulated Mechanisms Account for Pigment-Type Differences in Epidermal Barrier Function

    PubMed Central

    Gunathilake, Roshan; Schurer, Nanna Y.; Shoo, Brenda A.; Celli, Anna; Hachem, Jean-Pierre; Crumrine, Debra; Sirimanna, Ganga; Feingold, Kenneth R.; Mauro, Theodora M.; Elias, Peter M.


    To determine whether pigment type determines differences in epidermal function, we studied stratum corneum (SC) pH, permeability barrier homeostasis, and SC integrity in three geographically disparate populations with pigment type I–II versus IV–V skin (Fitzpatrick I–VI scale). Type IV–V subjects showed: (i) lower surface pH (≈0.5 U); (ii) enhanced SC integrity (transepidermal water loss change with sequential tape strippings); and (iii) more rapid barrier recovery than type I–II subjects. Enhanced barrier function could be ascribed to increased epidermal lipid content, increased lamellar body production, and reduced acidity, leading to enhanced lipid processing. Compromised SC integrity in type I–II subjects could be ascribed to increased serine protease activity, resulting in accelerated desmoglein-1 (DSG-1)/corneodesmosome degradation. In contrast, DSG-1-positive CDs persisted in type IV–V subjects, but due to enhanced cathepsin-D activity, SC thickness did not increase. Adjustment of pH of type I–II SC to type IV–V levels improved epidermal function. Finally, dendrites from type IV–V melanocytes were more acidic than those from type I–II subjects, and they transfer more melanosomes to the SC, suggesting that melanosome secretion could contribute to the more acidic pH of type IV–V skin. These studies show marked pigment-type differences in epidermal structure and function that are pH driven. PMID:19177137

  13. Using FLIM in the study of permeability barrier function of aged and young skin

    NASA Astrophysics Data System (ADS)

    Xu, P.; Choi, E. H.; Man, M. Q.; Crumrine, D.; Mauro, T.; Elias, P.


    Aged skin commonly is afflicted by inflammatory skin diseases or xerosis/eczema that can be triggered or exacerbated by impaired epidermal permeability barrier homeostasis. It has been previously described a permeability barrier defect in humans of advanced age (> 75 years), which in a murine analog >18 mos, could be attributed to reduced lipid synthesis synthesis. However, the functional abnormality in moderately aged mice is due not to decreased lipid synthesis, but rather to a specific defect in stratum corneum (SC) acidification causing impaired lipid processing processing. Endogenous Na +/H + antiporter (NHE1) level was found declined in moderately aged mouse epidermis. This acidification defect leads to perturbed permeability barrier homeostasis through more than one pathways, we addressed suboptimal activation of the essential, lipid-processing enzyme, β-glucocerebrosidase (BGC) is linked to elevated SC pH. Finally, the importance of the epidermis acidity is shown by the normalization of barrier function after exogenous acidification of moderately aged skin.

  14. sPLA2 and the epidermal barrier

    PubMed Central

    Ilic, Dusko; Bollinger, James M.; Gelb, Michael; Mauro, Theodora M.


    The mammalian epidermis provides both an interface and a protective barrier between the organism and its environment. Lipid, processed into water-impermeable bilayers between the outermost layers of the epidermal cells, forms the major barrier that prevents water from exiting the organism, and also prevents toxins and infectious agents from entering. The secretory phospholipase 2 (sPLA2) enzymes control important processes in skin and other organs, including inflammation and differentiation. sPLA2 activity contributes to epidermal barrier formation and homeostasis by generating free fatty acids, which are required both for formation of lamellar membranes and also for acidification of the stratum corneum (SC). sPLA2 is especially important in controlling SC acidification and establishment of an optimum epidermal barrier during the first postnatal week. Several sPLA2 isoforms are present in the epidermis. We find that two of these isoforms, sPLA2 IIA and sPLA2 IIF, localize to the upper stratum granulosum and increase in response to experimental barrier perturbation. sPLA2F−/− mice also demonstrate a more neutral SC pH than do their normal littermates, and their initial recovery from barrier perturbation is delayed. These findings confirm that sPLA2 enzymes perform important roles in epidermal development, and suggest that the sPLA2IIF isoform may be central to SC acidification and barrier function. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. PMID:24269828

  15. Topical Corticosteroid Application and the Structural and Functional Integrity of the Epidermal Barrier

    PubMed Central

    Cash, Kimberly


    Topical corticosteroids are a very important part of the treatment of many skin disorders, especially eczematous dermatoses. When utilized properly and judiciously these agents often achieve excellent results in clearing or markedly improving many dermatological disorders. As some studies have shown, topical corticosteroids, despite their ability to decrease inflammation through several mechanisms, induce abnormalities in lipid synthesis and intercellular bilayer structure in the stratum corneum, which appear to prolong epidermal barrier recovery. These adverse effects may contribute to eariier eczematous flaring if measures to provide barrier repair are not undertaken. In addition, although topical corticosteroids are applied only to sites affected by the skin eruption, the incorporation of “barrier friendly” excipients into the vehicle that improve stratum corneum permeability barrier function and integrity is very rational. PMID:24307921

  16. Cell Adhesion in Epidermal Development and Barrier Formation

    PubMed Central

    Sumigray, Kaelyn D.; Lechler, Terry


    Cell–cell adhesions are necessary for structural integrity and barrier formation of the epidermis. Here, we discuss insights from genetic and cell biological studies into the roles of individual cell–cell junctions and their composite proteins in regulating epidermal development and function. In addition to individual adhesive functions, we will discuss emerging ideas on mechanosensation/transduction of junctions in the epidermis, noncanonical roles for adhesion proteins, and crosstalk/interdependencies between the junctional systems. These studies have revealed that cell adhesion proteins are connected to many aspects of tissue physiology including growth control, differentiation, and inflammation. PMID:25733147


    EPA Science Inventory

    Permeable reactive barriers are an emerging alternative to traditional pump and treat systems for groundwater remediation. This technique has progressed rapidly over the past decade from laboratory bench-scale studies to full-scale implementation. Laboratory studies indicate the ...


    EPA Science Inventory

    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating groundwater contamination that combine subsurface fluid flow management with a passive chemical treatment zone. Removal of contaminants from the groundwater plume is achieved by alt...


    EPA Science Inventory

    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating groundwater contamination that combine subsurface fluid flow management with a passive chemical treatment zone. Removal of contaminants from the groundwater plume is achieved by alt...


    EPA Science Inventory

    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating groundwater contamination that combine subsurface fluid flow management with a passive chemical treatment zone. Removal of contaminants from the groundwater plume is achieved by alt...


    EPA Science Inventory

    Environmental scientists are generally familiar with the concept of barriers for restricting the movement of contaminant plumes in ground water. Such barriers are typically constructed of highly impermeable emplacements of materials such as grouts, slurries, or sheet pilings to ...

  2. Review of potential subsurface permeable barrier emplacement and monitoring technologies

    SciTech Connect

    Riggsbee, W.H.; Treat, R.L.; Stansfield, H.J.; Schwarz, R.M.; Cantrell, K.J.; Phillips, S.J.


    This report focuses on subsurface permeable barrier technologies potentially applicable to existing waste disposal sites. This report describes candidate subsurface permeable barriers, methods for emplacing these barriers, and methods used to monitor the barrier performance. Two types of subsurface barrier systems are described: those that apply to the unsaturated zone, and those that apply to groundwater and to mobile contamination near the groundwater table. These barriers may be emplaced either horizontally or vertically depending on waste and site characteristics. Materials for creating permeable subsurface barriers are emplaced using one of three basic methods: injection, in situ mechanical mixing, or excavation-insertion. Injection is the emplacement of dissolved reagents or colloidal suspensions into the soil at elevated pressures. In situ mechanical mixing is the physical blending of the soil and the barrier material underground. Excavation-insertion is the removal of a soil volume and adding barrier materials to the space created. Major vertical barrier emplacement technologies include trenching-backfilling; slurry trenching; and vertical drilling and injection, including boring (earth augering), cable tool drilling, rotary drilling, sonic drilling, jetting methods, injection-mixing in drilled holes, and deep soil mixing. Major horizontal barrier emplacement technologies include horizontal drilling, microtunneling, compaction boring, horizontal emplacement, longwall mining, hydraulic fracturing, and jetting methods.

  3. Controlling ferrofluid permeability across the blood–brain barrier model.


    Shi, Di; Sun, Linlin; Mi, Gujie; Sheikh, Lubna; Bhattacharya, Soumya; Nayar, Suprabha; Webster, Thomas J


    In the present study, an in vitro blood–brain barrier model was developed using murine brain endothelioma cells (b.End3 cells). Confirmation of the blood–brain barrier model was completed by examining the permeability of FITCDextran at increasing exposure times up to 96 h in serum-free medium and comparing such values with values from the literature. After such confirmation, the permeability of five novel ferrofluid (FF) nanoparticle samples, GGB (ferrofluids synthesized using glycine, glutamic acid and BSA), GGC (glycine, glutamic acid and collagen), GGP (glycine, glutamic acid and PVA), BPC (BSA, PEG and collagen) and CPB (collagen, PVA and BSA), was determined using this blood–brain barrier model. All of the five FF samples were characterized by zeta potential to determine their charge as well as TEM and dynamic light scattering for determining their hydrodynamic diameter. Results showed that FF coated with collagen passed more easily through the blood–brain barrier than FF coated with glycine and glutamic acid based on an increase of 4.5% in permeability. Through such experiments, diverse magnetic nanomaterials (such as FF) were identified for: (1) MRI use since they were less permeable to penetrate the blood–brain barrier to avoid neural tissue toxicity (e.g. GGB) or (2) brain drug delivery since they were more permeable to the blood–brain barrier (e.g. CPB).

  4. Controlling ferrofluid permeability across the blood-brain barrier model

    NASA Astrophysics Data System (ADS)

    Shi, Di; Sun, Linlin; Mi, Gujie; Sheikh, Lubna; Bhattacharya, Soumya; Nayar, Suprabha; Webster, Thomas J.


    In the present study, an in vitro blood-brain barrier model was developed using murine brain endothelioma cells (b.End3 cells). Confirmation of the blood-brain barrier model was completed by examining the permeability of FITC-Dextran at increasing exposure times up to 96 h in serum-free medium and comparing such values with values from the literature. After such confirmation, the permeability of five novel ferrofluid (FF) nanoparticle samples, GGB (ferrofluids synthesized using glycine, glutamic acid and BSA), GGC (glycine, glutamic acid and collagen), GGP (glycine, glutamic acid and PVA), BPC (BSA, PEG and collagen) and CPB (collagen, PVA and BSA), was determined using this blood-brain barrier model. All of the five FF samples were characterized by zeta potential to determine their charge as well as TEM and dynamic light scattering for determining their hydrodynamic diameter. Results showed that FF coated with collagen passed more easily through the blood-brain barrier than FF coated with glycine and glutamic acid based on an increase of 4.5% in permeability. Through such experiments, diverse magnetic nanomaterials (such as FF) were identified for: (1) MRI use since they were less permeable to penetrate the blood-brain barrier to avoid neural tissue toxicity (e.g. GGB) or (2) brain drug delivery since they were more permeable to the blood-brain barrier (e.g. CPB).

  5. Evolutionary origin and diversification of epidermal barrier proteins in amniotes.


    Strasser, Bettina; Mlitz, Veronika; Hermann, Marcela; Rice, Robert H; Eigenheer, Richard A; Alibardi, Lorenzo; Tschachler, Erwin; Eckhart, Leopold


    The evolution of amniotes has involved major molecular innovations in the epidermis. In particular, distinct structural proteins that undergo covalent cross-linking during cornification of keratinocytes facilitate the formation of mechanically resilient superficial cell layers and help to limit water loss to the environment. Special modes of cornification generate amniote-specific skin appendages such as claws, feathers, and hair. In mammals, many protein substrates of cornification are encoded by a cluster of genes, termed the epidermal differentiation complex (EDC). To provide a basis for hypotheses about the evolution of cornification proteins, we screened for homologs of the EDC in non-mammalian vertebrates. By comparative genomics, de novo gene prediction and gene expression analyses, we show that, in contrast to fish and amphibians, the chicken and the green anole lizard have EDC homologs comprising genes that are specifically expressed in the epidermis and in skin appendages. Our data suggest that an important component of the cornified protein envelope of mammalian keratinocytes, that is, loricrin, has originated in a common ancestor of modern amniotes, perhaps during the acquisition of a fully terrestrial lifestyle. Moreover, we provide evidence that the sauropsid-specific beta-keratins have evolved as a subclass of EDC genes. Based on the comprehensive characterization of the arrangement, exon-intron structures and conserved sequence elements of EDC genes, we propose new scenarios for the evolutionary origin of epidermal barrier proteins via fusion of neighboring S100A and peptidoglycan recognition protein genes, subsequent loss of exons and highly divergent sequence evolution.

  6. Test device for measuring permeability of a barrier material


    Reese, Matthew; Dameron, Arrelaine; Kempe, Michael


    A test device for measuring permeability of a barrier material. An exemplary device comprises a test card having a thin-film conductor-pattern formed thereon and an edge seal which seals the test card to the barrier material. Another exemplary embodiment is an electrical calcium test device comprising: a test card an impermeable spacer, an edge seal which seals the test card to the spacer and an edge seal which seals the spacer to the barrier material.

  7. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function.


    Boer, Magdalena; Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola


    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part - stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  8. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    PubMed Central

    Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola


    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function. PMID:26985171

  9. Nifedipine prevents sodium caprate-induced barrier dysfunction in human epidermal keratinocyte cultures.


    Uchino, Yoshihiro; Matsumoto, Junichi; Watanabe, Takuya; Hamabashiri, Masato; Tsuchiya, Takashi; Kimura, Ikuya; Yamauchi, Atsushi; Kataoka, Yasufumi


    Tight junctions (TJs) of the epidermis play an important role in maintaining the epidermal barrier. TJ breakdown is associated with skin problems, such as wrinkles and transepidermal water loss (TEWL). Clinical studies have reported that topical nifedipine is effective in reducing the depth of wrinkles and improving TEWL. However, it remains unknown whether nifedipine influences the TJ function in the epidermis. In the present study, we investigated the effect of nifedipine on epidermal barrier dysfunction in normal human epidermal keratinocytes (NHEKs) treated with sodium caprate (C10), a TJ inhibitor. Nifedipine reversed the C10-decreased transepithelial electrical resistance values as a measure of disruption of the epidermal barrier. Immunocytochemical observations revealed that nifedipine improved the C10-induced irregular arrangement of claudin-1, a key protein in TJs. Taken together, these findings suggest that nifedipine prevents epidermal barrier dysfunction, at least in part, by reconstituting the irregular claudin-1 localization at TJs in C10-treated NHEKs.

  10. Improved epidermal barrier formation in human skin models by chitosan modulated dermal matrices

    PubMed Central

    Mieremet, Arnout; Rietveld, Marion; Absalah, Samira; van Smeden, Jeroen


    Full thickness human skin models (FTMs) contain an epidermal and a dermal equivalent. The latter is composed of a collagen dermal matrix which harbours fibroblasts. Current epidermal barrier properties of FTMs do not fully resemble that of native human skin (NHS), which makes these human skin models less suitable for barrier related studies. To further enhance the resemblance of NHS for epidermal morphogenesis and barrier formation, we modulated the collagen dermal matrix with the biocompatible polymer chitosan. Herein, we report that these collagen-chitosan FTMs (CC-FTMs) possess a well-organized epidermis and maintain both the early and late differentiation programs as in FTMs. Distinctively, the epidermal cell activation is reduced in CC-FTMs to levels observed in NHS. Dermal-epidermal interactions are functional in both FTM types, based on the formation of the basement membrane. Evaluation of the barrier structure by the organization of the extracellular lipid matrix of the stratum corneum revealed an elongated repeat distance of the long periodicity phase. The ceramide composition exhibited a higher resemblance of the NHS, based on the carbon chain-length distribution and subclass profile. The inside-out barrier functionality indicated by the transepidermal water loss is significantly improved in the CC-FTMs. The expression of epidermal barrier lipid processing enzymes is marginally affected, although more restricted to a single granular layer. The novel CC-FTM resembles the NHS more closely, which makes them a promising tool for epidermal barrier related studies. PMID:28333992

  11. Advances in Permeable Reactive Barrier Technologies

    DTIC Science & Technology


    technical methods, such as jetting and hydraulic fracturing , has improved the ability to access deeper aquifers. Table 1 describes the established and...34, Cape Canaveral Air Station, FL. Hydraulic Fracturing 120 A series of wells are installed along the length of the PRB. A vertical fracture is...especially helpful with deep instal- lation methods, such as hydraulic fracturing , where the barrier installed is just a few inches thick. A second, new type

  12. Permeable Reactive Barriers for Treatment of Cr6

    EPA Science Inventory

    Several options are available for treatment of hexavalent chromium (Cr(VI)) in groundwater using the permeable reactive barrier (PRB) approach. They include conventional trench-and-fill systems, chemical redox curtains, and organic carbon redox curtains. Each of these PRB syste...


    EPA Science Inventory

    The implementation of permeable reactive barriers (PRB) provides a viable option for the remediation of contaminants of environmental significance such as dissolved metals (i.e., chromium), chlorinated solvents, and nitrate/ammonia. The designs of PRBs are usually based on the a...


    EPA Science Inventory

    Permeable reactive barriers (PRBs) for the restoration of contaminated ground water are no longer innovative. PRBs have evolved from innovative to accepted, standard practice, for the containment and treatment of a variety of contaminants in ground water. Like any remedial tech...


    EPA Science Inventory

    This presentation will provide an overview of research efforts at EPA on the application, monitoring, and performance of Permeable Reactive Barriers (PRBs) for groundwater restoration. Over the past 10 years, research projects conducted by research staff at EPA's National Risk M...


    EPA Science Inventory

    The permeable reactive barrier (PRB) technology is an in-situ approach for groundwater remediation that couples subsurface flow management with a passive chemical or biochemical treatment zone. The development and application of the PRB technology has progressed over the last de...

  17. Monitoring of Zero-Valent Iron Permeable Reactive Barriers: Electrical Properties and Barrier Aging

    NASA Astrophysics Data System (ADS)

    Labrecque, D. J.; Adkins, P. L.; Slater, L. D.; Versteeg, R.; Sharpe, R.


    An innovative method of groundwater remediation invented in the 1990"s, Permeable Reactive Barriers, use sand-sized grains of scrap iron placed in trenches or injected under pressure to remediate a number of organic and inorganic contaminants. Monitoring the aging of these barriers becomes increasingly important as many of these barriers approach their predicted life spans. In-situ resistivity and induced polarization studies have been conducted at six barriers at four different sites: Monticello, Utah; the Denver Federal Center; Kansas City, Missouri; and East Helena, Montana. As some barriers tend to age dramatically faster than others, for this study we consider low permeability barriers as of greater age, as "old" barriers tend to loose permeability rather than exhaust reactive materials. One complicating factor is that two of the barriers studied appear to have issues related to installation. One site, the former Asarco Smelter Site near East Helena, Montana, has been instrumented with an autonomous monitoring system allowing continuous monitoring of the evolution of a relatively new (less than three years old) barrier. The barrier showed surprisingly rapid evolution over the first year of monitoring with changes in both resistivity and chargeability of tens of percent per month. In general, the electrical properties of all of the barriers studied follow a pattern. New barriers are fairly resistive with in-situ conductivity only a few times background (outside the barrier) values. Older barriers get increasingly conductive, with failed barriers showing values of over 100 S/m. The induced polarization response is more complicated. Chargeability values increase over time for young barriers, are largest for healthy barriers in the middle of their lifespan, and decrease as the barrier ages.

  18. Simulation of solute transport across low-permeability barrier walls

    USGS Publications Warehouse

    Harte, P.T.; Konikow, L.F.; Hornberger, G.Z.


    Low-permeability, non-reactive barrier walls are often used to contain contaminants in an aquifer. Rates of solute transport through such barriers are typically many orders of magnitude slower than rates through the aquifer. Nevertheless, the success of remedial actions may be sensitive to these low rates of transport. Two numerical simulation methods for representing low-permeability barriers in a finite-difference groundwater-flow and transport model were tested. In the first method, the hydraulic properties of the barrier were represented directly on grid cells and in the second method, the intercell hydraulic-conductance values were adjusted to approximate the reduction in horizontal flow, allowing use of a coarser and computationally efficient grid. The alternative methods were tested and evaluated on the basis of hypothetical test problems and a field case involving tetrachloroethylene (PCE) contamination at a Superfund site in New Hampshire. For all cases, advective transport across the barrier was negligible, but preexisting numerical approaches to calculate dispersion yielded dispersive fluxes that were greater than expected. A transport model (MODFLOW-GWT) was modified to (1) allow different dispersive and diffusive properties to be assigned to the barrier than the adjacent aquifer and (2) more accurately calculate dispersion from concentration gradients and solute fluxes near barriers. The new approach yields reasonable and accurate concentrations for the test cases. ?? 2006.

  19. Simulation of solute transport across low-permeability barrier walls

    NASA Astrophysics Data System (ADS)

    Harte, Philip T.; Konikow, Leonard F.; Hornberger, George Z.


    Low-permeability, non-reactive barrier walls are often used to contain contaminants in an aquifer. Rates of solute transport through such barriers are typically many orders of magnitude slower than rates through the aquifer. Nevertheless, the success of remedial actions may be sensitive to these low rates of transport. Two numerical simulation methods for representing low-permeability barriers in a finite-difference groundwater-flow and transport model were tested. In the first method, the hydraulic properties of the barrier were represented directly on grid cells and in the second method, the intercell hydraulic-conductance values were adjusted to approximate the reduction in horizontal flow, allowing use of a coarser and computationally efficient grid. The alternative methods were tested and evaluated on the basis of hypothetical test problems and a field case involving tetrachloroethylene (PCE) contamination at a Superfund site in New Hampshire. For all cases, advective transport across the barrier was negligible, but preexisting numerical approaches to calculate dispersion yielded dispersive fluxes that were greater than expected. A transport model (MODFLOW-GWT) was modified to (1) allow different dispersive and diffusive properties to be assigned to the barrier than the adjacent aquifer and (2) more accurately calculate dispersion from concentration gradients and solute fluxes near barriers. The new approach yields reasonable and accurate concentrations for the test cases.

  20. Blood-brain barrier permeability imaging using perfusion computed tomography

    PubMed Central

    Avsenik, Jernej; Bisdas, Sotirios; Popovic, Katarina Surlan


    Background. The blood-brain barrier represents the selective diffusion barrier at the level of the cerebral microvascular endothelium. Other functions of blood-brain barrier include transport, signaling and osmoregulation. Endothelial cells interact with surrounding astrocytes, pericytes and neurons. These interactions are crucial to the development, structural integrity and function of the cerebral microvascular endothelium. Dysfunctional blood-brain barrier has been associated with pathologies such as acute stroke, tumors, inflammatory and neurodegenerative diseases. Conclusions. Blood-brain barrier permeability can be evaluated in vivo by perfusion computed tomography - an efficient diagnostic method that involves the sequential acquisition of tomographic images during the intravenous administration of iodinated contrast material. The major clinical applications of perfusion computed tomography are in acute stroke and in brain tumor imaging. PMID:26029020

  1. Melt Focusing Along Permeability Barriers in Various Tectonic Settings

    NASA Astrophysics Data System (ADS)

    Montesi, L. G.; Hebert, L. B.


    The lithosphere, cold and rigid, acts as a barrier to the migration of melt from sources in the convecting mantle to the surface. In mid-ocean ridge settings in particular, the contrast between the width of the melt production zone at depths, reaching tens to hundreds of kilometer from the ridge axis, and the zone of crustal accretion, only one or two kilometers wide, points to the presence of an efficient focusing mechanism. The development of a zone impermeable to melt, or permeability barrier, at the base of the thermal boundary layer, and transport of melt in a high porosity channel at the base of this barrier provides a reasonable explanation for this focusing. Applied to various segmented and non-segmented mid-ocean ridges like the ultraslow Southwest Indian Ridge and the ultrafast East Pacific Rise at the Siqueiros transform, this process predicts along-strike variations in crustal thickness that compare favorably with observations. Although the concept of permeability barriers has been discussed mainly in the context of mid-ocean ridges, it may apply to other locations where melting in the upper mantle occurs. Permeability barriers form when ascending melt cools and crystallizes as it enters the thermal boundary layer at the base of the lithosphere. Such a setup is present at subduction zones as melts ascending from the mantle wedge interact with the overriding plate. Convection in the wedge introduces thermal gradients that may focus melt roughly to a point above the transition from a coupled to decoupled slab interface. This location is close to where volcanic arcs are observed. Above mantle plumes, a permeability barrier may develop coincident with the lithosphere-asthenosphere boundary, allowing low-degree melts to stall and form a low-velocity layer that has been observed seismically. To date, the hypothesis of a permeability barrier has been thoroughly tested only in the context of mid-ocean ridges. Whether crystallization would be rapid enough in

  2. Striatal blood-brain barrier permeability in Parkinson's disease.


    Gray, Madison T; Woulfe, John M


    In vivo studies have shown that blood-brain barrier (BBB) dysfunction is involved in the course of Parkinson's disease (PD). However, these have lacked either anatomic definition or the ability to recognize minute changes in BBB integrity. Here, using histologic markers of serum protein, iron, and erythrocyte extravasation, we have shown significantly increased permeability of the BBB in the postcommissural putamen of PD patients. The dense innervation of the striatum by PD-affected regions allows for exploitation of this permeability for therapeutic goals. These results are also discussed in the context of the retrograde trans-synaptic hypothesis of PD spread.

  3. Selective permeability barrier to urea in shark rectal gland.


    Zeidel, Joshua D; Mathai, John C; Campbell, John D; Ruiz, Wily G; Apodaca, Gerard L; Riordan, John; Zeidel, Mark L


    Elasmobranchs such as the dogfish shark Squalus acanthius achieve osmotic homeostasis by maintaining urea concentrations in the 300- to 400-mM range, thus offsetting to some degree ambient marine osmolalities of 900-1,000 mosmol/kgH(2)O. These creatures also maintain salt balance without losing urea by secreting a NaCl-rich (500 mM) and urea-poor (18 mM) fluid from the rectal gland that is isotonic with the plasma. The composition of the rectal gland fluid suggests that its epithelial cells are permeable to water and not to urea. Because previous work showed that lipid bilayers that permit water flux do not block flux of urea, we reasoned that the plasma membranes of rectal gland epithelial cells must either have aquaporin water channels or must have some selective barrier to urea flux. We therefore isolated apical and basolateral membranes from shark rectal glands and determined their permeabilities to water and urea. Apical membrane fractions were markedly enriched for Na-K-2Cl cotransporter, whereas basolateral membrane fractions were enriched for Na-K-ATPase. Basolateral membrane osmotic water permeability (P(f)) averaged 4.3 +/- 1.3 x 10(-3) cm/s, whereas urea permeability averaged 4.2 +/- 0.8 x 10(-7) cm/s. The activation energy for water flow averaged 16.4 kcal/mol. Apical membrane P(f) averaged 7.5 +/- 1.6 x 10(-4) cm/s, and urea permeability averaged 2.2 +/- 0.4 x 10(-7) cm/s, with an average activation energy for water flow of 18.6 kcal/mol. The relatively low water permeabilities and high activation energies argue strongly against water flux via aquaporins. Comparison of membrane water and urea permeabilities with those of artificial liposomes and other isolated biological membranes indicates that the basolateral membrane urea permeability is fivefold lower than would be anticipated for its water permeability. These results indicate that the rectal gland maintains a selective barrier to urea in its basolateral membranes.

  4. The repair of impaired epidermal barrier function in rats by the cutaneous application of linoleic acid.


    Prottey, C; Hartop, P J; Black, J G; McCormack, J I


    Epidermal barrier function in rats was experimentally impaired by two separate means, namely, by rendering the animals deficient in essential fatty acids and by evoking a primary cutaneous irritant response by treating with a solution of sodium laurate. Impaired barrier function was manifested by a greatly increased rate of transepidermal water loss. Application to the skin of sunflower seed oil, which is rich in linoleic acid, rapidly restored to normal the abnormally high rates of transepidermal water loss in both experimental cases, and it was shown with the essential fatty acid-deficient rats that there was a concomitant incorporation of linoleic acid of the sunflower seed oil into epidermal lipids. Cutaneous application of olive oil, which is low in linoleic acid but rich in the non-essential oleic acid, did not influence epidermal barrier function. A close relationship of barrier function and essential fatty acids is indicated.

  5. New perspectives on epidermal barrier dysfunction in atopic dermatitis: gene-environment interactions.


    Cork, Michael J; Robinson, Darren A; Vasilopoulos, Yiannis; Ferguson, Adam; Moustafa, Manar; MacGowan, Alice; Duff, Gordon W; Ward, Simon J; Tazi-Ahnini, Rachid


    Atopic dermatitis (AD) is a multifactorial, chronic inflammatory skin disorder in which genetic mutations and cutaneous hyperreactivity to environmental stimuli play a causative role. Genetic mutations alone might not be enough to cause clinical manifestations of AD, and this review will propose a new perspective on the importance of epidermal barrier dysfunction in genetically predisposed individuals, predisposing them to the harmful effects of environmental agents. The skin barrier is known to be damaged in patients with AD, both in acute eczematous lesions and also in clinically unaffected skin. Skin barrier function can be impaired first by a genetic predisposition to produce increased levels of stratum corneum chymotryptic enzyme. This protease enzyme causes premature breakdown of corneodesmosomes, leading to impairment of the epidermal barrier. The addition of environmental interactions, such as washing with soap and detergents, or long-term application of topical corticosteroids can further increase production of stratum corneum chymotryptic enzyme and impair epidermal barrier function. The epidermal barrier can also be damaged by exogenous proteases from house dust mites and Staphylococcus aureus. One or more of these factors in combination might lead to a defective barrier, thereby increasing the risk of allergen penetration and succeeding inflammatory reaction, thus contributing to exacerbations of this disease.

  6. Basis for the gain and subsequent dilution of epidermal pigmentation during human evolution: The barrier and metabolic conservation hypotheses revisited.


    Elias, Peter M; Williams, Mary L


    The evolution of human skin pigmentation must address both the initial evolution of intense epidermal pigmentation in hominins, and its subsequent dilution in modern humans. While many authorities believe that epidermal pigmentation evolved to protect against either ultraviolet B (UV-B) irradiation-induced mutagenesis or folic acid photolysis, we hypothesize that pigmentation augmented the epidermal barriers by shifting the UV-B dose-response curve from toxic to beneficial. Whereas erythemogenic UV-B doses produce apoptosis and cell death, suberythemogenic doses benefit permeability and antimicrobial function. Heavily melanized melanocytes acidify the outer epidermis and emit paracrine signals that augment barrier competence. Modern humans, residing in the cooler, wetter climes of south-central Europe and Asia, initially retained substantial pigmentation. While their outdoor lifestyles still permitted sufficient cutaneous vitamin D3 (VD3) synthesis, their marginal nutritional status, coupled with cold-induced caloric needs, selected for moderate pigment reductions that diverted limited nutritional resources towards more urgent priorities (=metabolic conservation). The further pigment-dilution that evolved as humans reached north-central Europe (i.e., northern France, Germany), likely facilitated cutaneous VD3 synthesis, while also supporting ongoing, nutritional requirements. But at still higher European latitudes where little UV-B breaches the atmosphere (i.e., present-day UK, Scandinavia, Baltic States), pigment dilution alone could not suffice. There, other nonpigment-related mutations evolved to facilitate VD3 production; for example, in the epidermal protein, filaggrin, resulting in reduced levels of its distal metabolite, trans-urocanic acid, a potent UV-B chromophore. Thus, changes in human pigmentation reflect a complex interplay between latitude, climate, diet, lifestyle, and shifting metabolic priorities.

  7. Barrier function, epidermal differentiation, and human beta-defensin 2 expression in tinea corporis.


    Jensen, Jens-Michael; Pfeiffer, Stephan; Akaki, Tatsuya; Schröder, Jens-Michael; Kleine, Michael; Neumann, Claudia; Proksch, Ehrhardt; Brasch, Jochen


    Tinea corporis is a superficial mycotic infection resulting in substantial epidermal changes. We determined skin barrier function, epidermal differentiation, and human-beta-defensin 2 (hBD-2) protein expression in 10 patients with tinea corporis caused by Trichophyton rubrum (T. rubrum). We found disturbed skin barrier function as shown by a significant increase in transepidermal water loss (TEWL) and specific ultrastructural changes including disturbed formation of extracellular lipid bilayers, lamellar body extrusion, and deposit of clotted material at the stratum granulosum/stratum corneum interface. Epidermal proliferation in tinea increased several fold and accordingly, proliferation and inflammation-associated keratins K6, K16, and K17 were expressed. Expression of basal keratins K5 and K14 increased, whereas differentiation-associated K10 was reduced. Reduction of the cornified envelope proteins involucrin, loricrin, and the S100 protein filaggrin was also seen. Reduced filaggrin expression correlated with reduced skin hydration; protein breakdown products of filaggrin have been shown to be important for water binding. Surprisingly, we found pronounced epidermal protein expression of hBD-2, which may be related to disturbed epidermal differentiation and inflammation. hBD-2 showed a weak, although significant, antifungal activity against T. rubrum in the turbidimetric assay and the immunohistological staining was somewhat less pronounced in areas directly underneath fungal hyphae in the stratum corneum. Together, we describe profound changes in skin barrier structure and function, epidermal proliferation, and differentiation including pronounced protein expression of hBD-2 in tinea corporis.

  8. Blood-brain barrier tight junction permeability and ischemic stroke.


    Sandoval, Karin E; Witt, Ken A


    The blood-brain barrier (BBB) is formed by the endothelial cells of cerebral microvessels, providing a dynamic interface between the peripheral circulation and the central nervous system. The tight junctions (TJs) between the endothelial cells serve to restrict blood-borne substances from entering the brain. Under ischemic stroke conditions decreased BBB TJ integrity results in increased paracellular permeability, directly contributing to cerebral vasogenic edema, hemorrhagic transformation, and increased mortality. This loss of TJ integrity occurs in a phasic manner, which is contingent on several interdependent mechanisms (ionic dysregulation, inflammation, oxidative and nitrosative stress, enzymatic activity, and angiogenesis). Understanding the inter-relation of these mechanisms is critical for the development of new therapies. This review focuses on those aspects of ischemic stroke impacting BBB TJ integrity and the principle regulatory pathways, respective to the phases of paracellular permeability.

  9. Automated Impedance Tomography for Monitoring Permeable Reactive Barrier Health

    SciTech Connect

    LaBrecque, D J; Adkins, P L


    The objective of this research was the development of an autonomous, automated electrical geophysical monitoring system which allows for near real-time assessment of Permeable Reactive Barrier (PRB) health and aging and which provides this assessment through a web-based interface to site operators, owners and regulatory agencies. Field studies were performed at four existing PRB sites; (1) a uranium tailing site near Monticello, Utah, (2) the DOE complex at Kansas City, Missouri, (3) the Denver Federal Center in Denver, Colorado and (4) the Asarco Smelter site in East Helena, Montana. Preliminary surface data over the PRB sites were collected (in December, 2005). After the initial round of data collection, the plan was modified to include studies inside the barriers in order to better understand barrier aging processes. In September 2006 an autonomous data collection system was designed and installed at the EPA PRB and the electrode setups in the barrier were revised and three new vertical electrode arrays were placed in dedicated boreholes which were in direct contact with the PRB material. Final data were collected at the Kansas City, Denver and Monticello, Utah PRB sites in the fall of 2007. At the Asarco Smelter site in East Helena, Montana, nearly continuous data was collected by the autonomous monitoring system from June 2006 to November 2007. This data provided us with a picture of the evolution of the barrier, enabling us to examine barrier changes more precisely and determine whether these changes are due to installation issues or are normal barrier aging. Two rounds of laboratory experiments were carried out during the project. We conducted column experiments to investigate the effect of mineralogy on the electrical signatures resulting from iron corrosion and mineral precipitation in zero valent iron (ZVI) columns. In the second round of laboratory experiments we observed the electrical response from simulation of actual field PRBs at two sites: the

  10. An epidermal barrier wound repair pathway in Drosophila is mediated by grainy head.


    Mace, Kimberly A; Pearson, Joseph C; McGinnis, William


    We used wounded Drosophila embryos to define an evolutionarily conserved pathway for repairing the epidermal surface barrier. This pathway includes a wound response enhancer from the Ddc gene that requires grainy head (grh) function and binding sites for the Grh transcription factor. At the signaling level, tyrosine kinase and extracellular signal-regulated kinase (ERK) activities are induced in epidermal cells near wounds, and activated ERK is required for a robust wound response. The conservation of this Grh-dependent pathway suggests that the repair of insect cuticle and mammal skin is controlled by an ancient, shared control system for constructing and healing the animal body surface barrier.

  11. Activated Protein C Enhances Human Keratinocyte Barrier Integrity via Sequential Activation of Epidermal Growth Factor Receptor and Tie2*

    PubMed Central

    Xue, Meilang; Chow, Shu-Oi; Dervish, Suat; Chan, Yee-Ka Agnes; Julovi, Sohel M.; Jackson, Christopher J.


    Keratinocytes play a critical role in maintaining epidermal barrier function. Activated protein C (APC), a natural anticoagulant with anti-inflammatory and endothelial barrier protective properties, significantly increased the barrier impedance of keratinocyte monolayers, measured by electric cell substrate impedance sensing and FITC-dextran flux. In response to APC, Tie2, a tyrosine kinase receptor, was rapidly activated within 30 min, and relocated to cell-cell contacts. APC also increased junction proteins zona occludens, claudin-1 and VE-cadherin. Inhibition of Tie2 by its peptide inhibitor or small interfering RNA abolished the barrier protective effect of APC. Interestingly, APC did not activate Tie2 through its major ligand, angiopoietin-1, but instead acted by binding to endothelial protein C receptor, cleaving protease-activated receptor-1 and transactivating EGF receptor. Furthermore, when activation of Akt, but not ERK, was inhibited, the barrier protective effect of APC on keratinocytes was abolished. Thus, APC activates Tie2, via a mechanism requiring, in sequential order, the receptors, endothelial protein C receptor, protease-activated receptor-1, and EGF receptor, which selectively enhances the PI3K/Akt signaling to enhance junctional complexes and reduce keratinocyte permeability. PMID:21173154

  12. Long-Term Monitoring of Permeable Reactive Barriers - Progress Report

    SciTech Connect

    Liang, L.


    The purpose of this project is to conduct collaborative research to evaluate and maximize the effectiveness of permeable reactive barriers (PRBs) with a broad-based working group including representatives from the U.S. Department of Energy (DOE), U.S. Department of Defense (DoD), and the U.S. Environmental Protection Agency (EPA). The Naval Facilities Engineering Service Center (NFESC) and its project partner, Battelle, are leading the DoD effort with funding from DoD's Environmental Security Technology Certification Program (ESTCP) and Strategic Environmental Research and Development Program (SERDP). Oak Ridge National Laboratory (ORNL) is coordinating the DOE effort with support from Subsurface Contaminant Focus Area (SCFA), a research program under DOEs Office of Science and Technology. The National Risk Management Research Laboratory's Subsurface Protection and Remediation Division is leading EPA's effort. The combined effort of these three agencies allows the evaluation of a large number of sites. Documents generated by this joint project will be reviewed by the participating agencies' principal investigators, the Permeable Barriers Group of the Remediation Technologies Development Forum (RTDF), and the Interstate Technology and Regulatory Cooperation (ITRC). The technical objectives of this project are to collect and review existing field data at selected PRB sites, identify data gaps, conduct additional measurements, and provide recommendations to DOE users on suitable long-term monitoring strategies. The specific objectives are to (1) evaluate geochemical and hydraulic performance of PRBs, (2) develop guidelines for hydraulic and geochemical characterization/monitoring, and (3) devise and implement long-term monitoring strategies through the use of hydrological and geochemical models. Accomplishing these objectives will provide valuable information regarding the optimum configuration and lifetime of barriers at specific sites. It will also permit

  13. Characterisation of the passive permeability barrier of nuclear pore complexes

    PubMed Central

    Mohr, Dagmar; Frey, Steffen; Fischer, Torsten; Güttler, Thomas; Görlich, Dirk


    Nuclear pore complexes (NPCs) restrict uncontrolled nucleocytoplasmic fluxes of inert macromolecules but permit facilitated translocation of nuclear transport receptors and their cargo complexes. We probed the passive barrier of NPCs and observed sieve-like properties with a dominating mesh or channel radius of 2.6 nm, which is narrower than proposed earlier. A small fraction of diffusion channels has a wider opening, explaining the very slow passage of larger molecules. The observed dominant passive diameter approximates the distance of adjacent hydrophobic clusters of FG repeats, supporting the model that the barrier is made of FG repeat domains cross-linked with a spacing of an FG repeat unit length. Wheat germ agglutinin and the dominant-negative importin β45-462 fragment were previously regarded as selective inhibitors of facilitated NPC passage. We now observed that they do not distinguish between the passive and the facilitated mode. Instead, their inhibitory effect correlates with the size of the NPC-passing molecule. They have little effect on small species, inhibit the passage of green fluorescent protein-sized objects >10-fold and virtually block the translocation of larger ones. This suggests that passive and facilitated NPC passage proceed through one and the same permeability barrier. PMID:19680228

  14. Wave scattering by a permeable barrier over undulating bed topography

    NASA Astrophysics Data System (ADS)

    Choudhary, A.; Martha, S. C.


    The scattering of surface water waves by bottom undulation in the presence of a permeable vertical barrier is investigated for its solution. A mixed boundary value problem (BVP) arises here in a natural way while examining this physical problem. Regular perturbation analysis is employed to determine the solution of the BVP. By utilizing this analysis the given BVP reduces to two different BVPs up to first order. The solution of the zeroth order BVP is obtained with the aid of eigenfunction expansion method in conjunction with least-squares approximation. The first order BVP is solved with the help of the Green's integral theorem and the physical quantities, namely the reflection and transmission coefficients, are obtained in the form of integrals which involve the bottom undulation and the solution of the zeroth order BVP. A particular form of the bottom undulation which closely resembles to some obstacles made by nature due to sedimentation and ripple growth of sand, is considered to evaluate these integrals. The variation of these coefficients is examined for different values of the porous effect parameter, barrier length, number of ripples and ripple amplitude.

  15. Directed site exploration for permeable reactive barrier design

    USGS Publications Warehouse

    Lee, J.; Graettinger, A.J.; Moylan, J.; Reeves, H.W.


    Permeable reactive barriers (PRBs) are being employed for in situ site remediation of groundwater that is typically flowing under natural gradients. Site characterization is of critical importance to the success of a PRB. A design-specific site exploration approach called quantitatively directed exploration (QDE) is presented. The QDE approach employs three spatially related matrices: (1) covariance of input parameters, (2) sensitivity of model outputs, and (3) covariance of model outputs to identify the most important location to explore based on a specific design. Sampling at the location that most reduces overall site uncertainty produces a higher probability of success of a particular design. The QDE approach is demonstrated on the Kansas City Plant, Kansas City, MO, a case study where a PRB was installed and failed. It is shown that additional quantitatively directed site exploration during the design phase could have prevented the remedial failure that was caused by missing a geologic body having high hydraulic conductivity at the south end of the barrier. The most contributing input parameter approach using head uncertainty clearly indicated where the next sampling should be made toward the high hydraulic conductivity zone. This case study demonstrates the need to include the specific design as well as site characterization uncertainty when choosing the sampling locations. ?? 2008 Elsevier B.V.


    SciTech Connect

    Robert S. Bowman; Zhaohui Li; Stephen J. Roy; Todd Burt; Timothy L. Johnson; Richard L. Johnson


    The overall objective of this effort is to develop and test a zeolite-based permeable barrier system for containing and remediating contaminated groundwater. The projected product is an engineered and tested permeable barrier system that can be adopted by the commercial sector.

  17. Surface altered zeolites as permeable barriers for in situ treatment of contaminated groundwater

    SciTech Connect


    The authors characterized surfactant-modified zeolite (SMZ) for its ability to sorb organic and inorganic contaminants from water. The ultimate objective is to use SMZ as a permeable barrier to prevent migration of contaminants in groundwater. This report summarizes results under Phase 1 of a three-phase project leading to a full-scale field demonstration of SMZ permeable- barrier technology.


    EPA Science Inventory

    This report presents an analysis of the cost of using permeable reactive barriers to remediate contaminated ground water. When possible, these costs are compared with the cost of pump-and-treat technology for similar situations. Permeable reactive barriers are no longer perceiv...

  19. Compromised epidermal barrier stimulates Harderian gland activity and hypertrophy in ACBP−/− mice[S

    PubMed Central

    Bek, Signe; Neess, Ditte; Dixen, Karen; Bloksgaard, Maria; Marcher, Ann-Britt; Chemnitz, John; Færgeman, Nils J.; Mandrup, Susanne


    Acyl-CoA binding protein (ACBP) is a small, ubiquitously expressed intracellular protein that binds C14-C22 acyl-CoA esters with very high affinity and specificity. We have recently shown that targeted disruption of the Acbp gene leads to a compromised epidermal barrier and that this causes delayed adaptation to weaning, including the induction of the hepatic lipogenic and cholesterogenic gene programs. Here we show that ACBP is highly expressed in the Harderian gland, a gland that is located behind the eyeball of rodents and involved in the production of fur lipids and lipids used for lubrication of the eye lid. We show that disruption of the Acbp gene leads to a significant enlargement of this gland with hypertrophy of the acinar cells and increased de novo synthesis of monoalkyl diacylglycerol, the main lipid species produced by the gland. Mice with conditional targeting of the Acbp gene in the epidermis recapitulate this phenotype, whereas generation of an artificial epidermal barrier during gland development reverses the phenotype. Our findings indicate that the Harderian gland is activated by the compromised epidermal barrier as an adaptive and protective mechanism to overcome the barrier defect. PMID:26142722

  20. Compromised epidermal barrier stimulates Harderian gland activity and hypertrophy in ACBP-/- mice.


    Bek, Signe; Neess, Ditte; Dixen, Karen; Bloksgaard, Maria; Marcher, Ann-Britt; Chemnitz, John; Færgeman, Nils J; Mandrup, Susanne


    Acyl-CoA binding protein (ACBP) is a small, ubiquitously expressed intracellular protein that binds C14-C22 acyl-CoA esters with very high affinity and specificity. We have recently shown that targeted disruption of the Acbp gene leads to a compromised epidermal barrier and that this causes delayed adaptation to weaning, including the induction of the hepatic lipogenic and cholesterogenic gene programs. Here we show that ACBP is highly expressed in the Harderian gland, a gland that is located behind the eyeball of rodents and involved in the production of fur lipids and lipids used for lubrication of the eye lid. We show that disruption of the Acbp gene leads to a significant enlargement of this gland with hypertrophy of the acinar cells and increased de novo synthesis of monoalkyl diacylglycerol, the main lipid species produced by the gland. Mice with conditional targeting of the Acbp gene in the epidermis recapitulate this phenotype, whereas generation of an artificial epidermal barrier during gland development reverses the phenotype. Our findings indicate that the Harderian gland is activated by the compromised epidermal barrier as an adaptive and protective mechanism to overcome the barrier defect.

  1. Zeolite in horizontal permeable reactive barriers for artificial groundwater recharge

    NASA Astrophysics Data System (ADS)

    Leal, María; Martínez-Hernández, Virtudes; Lillo, Javier; Meffe, Raffaella; de Bustamante, Irene


    The Spanish Water Reuse Royal Decree 1620/2007 considers groundwater recharge as a feasible use of reclaimed water. To achieve the water quality established in the above-mentioned legislation, a tertiary wastewater treatment is required. In this context, the infiltration of effluents generated by secondary wastewater treatments through a Horizontal Permeable Reactive Barrier (HPRB) may represent a suitable regeneration technology. Some nutrients (phosphate and ammonium) and some Pharmaceutical and Personal Care Products (PPCPs) are not fully removed in conventional wastewater treatment plants. To avoid groundwater contamination when effluents of wastewater treatments plants are used in artificial recharge activities, these contaminants have to be removed. Due to its sorption capacities, zeolite is among the most used reactive materials in Permeable Reactive Barrier (PRB). Therefore, the main goal of this study is to evaluate the zeolite retention effectiveness of nutrients and PPCPs occurring in treated wastewater. Batch sorption experiments using synthetic wastewater (SWW) and zeolite were performed. A 1:4 zeolite/SWW ratio was selected due to the high sorption capacity of the reactive material.The assays were carried out by triplicate. All the bottles containing the SWW-zeolite mixture were placed on a mechanical shaker during 24 hours at 140 rpm and 25 °C. Ammonium and phosphate, as main nutrients, and a group of PPCPs were selected as compounds to be tested during the experiments. Nutrients were analyzed by ion chromatography. For PPCPs determination, Solid Phase Extraction (SPE) was applied before their analysis by liquid chromatography-mass spectrometry time of flight (LC-MS/ TOF). The experimental data were fitted to linearized Langmuir and Freundlich isotherm equations to obtain sorption parameters. In general, Freundlich model shows a greater capability of reproducing experimental data. To our knowledge, sorption of the investigated compounds on zeolite

  2. [Removal of nitrate from groundwater using permeable reactive barrier].


    Li, Xiu-Li; Yang, Jun-Jun; Lu, Xiao-Xia; Zhang, Shu; Hou, Zhen


    To provide a cost-effective method for the remediation of nitrate-polluted groundwater, column experiments were performed to study the removal of nitrate by permeable reactive barrier filled with fermented mulch and sand (biowall), and the mechanisms and influence factors were explored. The experimental results showed that the environmental condition in the simulated biowall became highly reduced after three days of operation (oxidation-reduction potential was below - 100 mV), which was favorable for the reduction of nitrate. During the 15 days of operation, the removal rate of nitrate nitrogen (NO3(-) -N) by the simulated biowall was 80%-90% (NO3(-)-N was reduced from 20 mg x L(-1) in the inlet water to 1.6 mg x L(-1) in the outlet water); the concentration of nitrite nitrogen (NO2(-) -N) in the outlet water was below 2.5 mg x L(-1); the concentration of ammonium nitrogen (NH4(+) -N) was low in the first two days but increased to about 12 mg x L(-1) since day three. The major mechanisms involved in the removal of nitrate nitrogen were adsorption and biodegradation. When increasing the water flow velocity in the simulated biowall, the removal rate of NO3(-) -N was reduced and the concentration of NH4(+) -N in the outlet water was significantly reduced. A simulated zeolite wall was set up following the simulated biowall and 98% of the NH4(+) -N could be removed from the water.

  3. Clathrin inhibitor Pitstop-2 disrupts the nuclear pore complex permeability barrier

    PubMed Central

    Liashkovich, Ivan; Pasrednik, Dzmitry; Prystopiuk, Valeria; Rosso, Gonzalo; Oberleithner, Hans; Shahin, Victor


    Existence of a selective nucleocytoplasmic permeability barrier is attributed to Phenylalanine-Glycine rich proteins (FG-nups) within the central channel of the nuclear pore complex (NPC). Limited understanding of the FG-nup structural arrangement hinders development of strategies directed at disrupting the NPC permeability barrier. In this report we explore an alternative approach to enhancing the NPC permeability for exogenous macromolecules. We demonstrate that the recently discovered inhibitor of clathrin coat assembly Pitstop-2 compromises the NPC permeability barrier in a rapid and effective manner. Treatment with Pitstop-2 causes a collapse of the NPC permeability barrier and a reduction of Importin β binding accompanied by alteration of the NPC ultrastructure. Interestingly, the effects are induced by the same chemical agent that is capable of inhibiting clathrin-mediated endocytosis. To our knowledge, this is the first functional indication of the previously postulated evolutionary relation between clathrin and NPC scaffold proteins. PMID:25944393

  4. Construction of low permeability soil-bentonite barrier caps and liners for landfills

    SciTech Connect

    Webber, T.; Williams, M.


    A low permeability soil barrier layer is the usual regulatory requirement for both caps and liner systems on modern municipal, industrial, and hazardous waste landfills. This soil layer is either used as the sole barrier or as the soil component of a composite liner system. This paper presents construction experience for blending on site soils with sodium bentonite to produce a thick, low permeability soil barrier layer. The paper begins with a description of the components and construction of the barrier layer and discusses how soil-bentonite barrier layers meet or exceed the regulatory performance criteria for both State and Federal agencies.

  5. A somatic permeability barrier around the germline is essential for Drosophila spermatogenesis.


    Fairchild, Michael J; Smendziuk, Christopher M; Tanentzapf, Guy


    Interactions between the soma and germline are essential for gametogenesis. In the Drosophila testis, differentiating germ cells are encapsulated by two somatic cells that surround the germline throughout spermatogenesis. chickadee (chic), the fly ortholog of Profilin, mediates soma-germline interactions. Knockdown of Chic in the soma results in sterility and severely disrupted spermatogenesis due to defective encapsulation. To study this defect further, we developed a permeability assay to analyze whether the germline is isolated from the surrounding environment by the soma. We find that germline encapsulation by the soma is, by itself, insufficient for the formation of a permeability barrier, but that such a barrier gradually develops during early spermatogenesis. Thus, germline stem cells, gonialblasts and early spermatogonia are not isolated from the outside environment. By late spermatocyte stages, however, a permeability barrier is formed by the soma. Furthermore, we find that, concomitant with formation of the permeability barrier, septate junction markers are expressed in the soma and localize to junctional sites connecting the two somatic cells that surround the germline. Importantly, knockdown of septate junction components also disrupts the permeability barrier. Finally, we show that germline differentiation is delayed when the permeability barrier is compromised. We propose that the permeability barrier around the germline serves an important regulatory function during spermatogenesis by shaping the signaling events that take place between the soma and the germline.

  6. mTORC1 and mTORC2 regulate skin morphogenesis and epidermal barrier formation

    PubMed Central

    Ding, Xiaolei; Bloch, Wilhelm; Iden, Sandra; Rüegg, Markus A.; Hall, Michael N.; Leptin, Maria; Partridge, Linda; Eming, Sabine A.


    Mammalian target of rapamycin (mTOR), a regulator of growth in many tissues, mediates its activity through two multiprotein complexes, mTORC1 or mTORC2. The role of mTOR signalling in skin morphogenesis and epidermal development is unknown. Here we identify mTOR as an essential regulator in skin morphogenesis by epidermis-specific deletion of Mtor in mice (mTOREKO). mTOREKO mutants are viable, but die shortly after birth due to deficits primarily during the early epidermal differentiation programme and lack of a protective barrier development. Epidermis-specific loss of Raptor, which encodes an essential component of mTORC1, confers the same skin phenotype as seen in mTOREKO mutants. In contrast, newborns with an epidermal deficiency of Rictor, an essential component of mTORC2, survive despite a hypoplastic epidermis and disruption in late stage terminal differentiation. These findings highlight a fundamental role for mTOR in epidermal morphogenesis that is regulated by distinct functions for mTORC1 and mTORC2. PMID:27807348

  7. Epidermal barrier defects link atopic dermatitis with altered skin cancer susceptibility.


    Cipolat, Sara; Hoste, Esther; Natsuga, Ken; Quist, Sven R; Watt, Fiona M


    Atopic dermatitis can result from loss of structural proteins in the outermost epidermal layers, leading to a defective epidermal barrier. To test whether this influences tumour formation, we chemically induced tumours in EPI-/- mice, which lack three barrier proteins-Envoplakin, Periplakin, and Involucrin. EPI-/- mice were highly resistant to developing benign tumours when treated with 7,12-dimethylbenz(a)anthracene (DMBA) and 12-O-tetradecanoylphorbol-13-acetate (TPA). The DMBA response was normal, but EPI-/- skin exhibited an exaggerated atopic response to TPA, characterised by abnormal epidermal differentiation, a complex immune infiltrate and elevated serum thymic stromal lymphopoietin (TSLP). The exacerbated TPA response could be normalised by blocking TSLP or the immunoreceptor NKG2D but not CD4+ T cells. We conclude that atopy is protective against skin cancer in our experimental model and that the mechanism involves keratinocytes communicating with cells of the immune system via signalling elements that normally protect against environmental assaults.DOI:

  8. Performance Assessment of a Permeable Reactive Barrier for Ground Water Remediation Fifteen Years After Installation

    EPA Science Inventory

    The fifteen-year performance of a granular iron, permeable reactive barrier (PRB; Elizabeth City, North Carolina) is reviewed with respect to contaminanttreatment (hexavalent chromium and trichloroethylene) and hydraulic performance. Due to in-situ treatment of the chromium sourc...


    EPA Science Inventory

    Permeable reactive barriers (PRBs) are an emerging, alternative in-situ approach for remediating groundwater contamination that combine subsurface fluid flow management with a passive chemical treatment zone. The few pilot and commercial installations which have been implemented ...


    EPA Science Inventory

    Bifunctional aluminum is an innovative remedial material for the treatment of gasoline oxygenates in permeable reactive barriers (PRBs). PRBs represent a promising environmental technology for remediation of groundwater contamination. Although zero-valent metals (ZVM) have been...


    EPA Science Inventory

    Laboratory and field research has shown that permeable reactive barriers (PRBs) containing a variety of materials can treat arsenic (As) contaminated groundwater. Sites where these PRBs are located include a mine tailings facility, fertilizer and chemical manufacturing sites, a...


    EPA Science Inventory

    Permeable reactive barriers are innovative and cost-effective remedial technologies and are becoming more desirable methods for in-situ passive remediation of ground water contaminated with chlorinated hydrocarbons and redox-sensitive metals. As contaminated water passes through ...


    EPA Science Inventory


    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating contaminated groundwater that combine subsurface fluid flow management with a passive chemical treatment zone. PRB's are a potentially more cost effective treatment...

  14. Iron Hydroxy Carbonate Formation in Zerovalent Iron Permeable Reactive Barriers: Characterization and Evaluation of Phase Stability

    EPA Science Inventory

    Predicting the long-term potential of permeable reactive barriers for treating contaminated groundwater relies on understanding the endpoints of biogeochemical reactions between influent groundwater and the reactive medium. Iron hydroxy carbonate (chukanovite) is frequently obs...


    EPA Science Inventory

    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating groundwater contamination that combine subsurface fluid flow management with a passive chemical treatment zone. Removal of contaminants from the groundwater plume is achieved by alt...

  16. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.


    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo


    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  17. Permeable Barrier Materials for Strontium Immobilization: - UFA Determination of Hydraulic Conductivity. - Column Sorption Experiments

    DTIC Science & Technology


    Meadows clinoptilolite was also tested since it is currently being considered for use as a permeable barrier at N-Springs. 14. SUBJECT TERMS 15. NUMBER OF...permeability of reactive barrier); Soda Springs phosphate rock; and fish debris. Ash Meadows Clinoptilolite was also tested since it is currently being...follows: bone char > quartz sand > NC apatite >> fish debris:sand = Ash Meadows clinoptilolite:sand >> clinoptilolite >> hydroxyapatite > Soda Springs

  18. Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation.


    Chidgey, M; Brakebusch, C; Gustafsson, E; Cruchley, A; Hail, C; Kirk, S; Merritt, A; North, A; Tselepis, C; Hewitt, J; Byrne, C; Fassler, R; Garrod, D


    The desmosomal cadherin desmocollin (Dsc)1 is expressed in upper epidermis where strong adhesion is required. To investigate its role in vivo, we have genetically engineered mice with a targeted disruption in the Dsc1 gene. Soon after birth, null mice exhibit flaky skin and a striking punctate epidermal barrier defect. The epidermis is fragile, and acantholysis in the granular layer generates localized lesions, compromising skin barrier function. Neutrophils accumulate in the lesions and further degrade the tissue, causing sloughing (flaking) of lesional epidermis, but rapid wound healing prevents the formation of overt lesions. Null epidermis is hyperproliferative and overexpresses keratins 6 and 16, indicating abnormal differentiation. From 6 wk, null mice develop ulcerating lesions resembling chronic dermatitis. We speculate that ulceration occurs after acantholysis in the fragile epidermis because environmental insults are more stringent and wound healing is less rapid than in neonatal mice. This dermatitis is accompanied by localized hair loss associated with formation of utriculi and dermal cysts, denoting hair follicle degeneration. Possible resemblance of the lesions to human blistering diseases is discussed. These results show that Dsc1 is required for strong adhesion and barrier maintenance in epidermis and contributes to epidermal differentiation.

  19. Staphylococcus aureus exploits epidermal barrier defects in atopic dermatitis to trigger cytokine expression

    PubMed Central

    Nakatsuji, Teruaki; Chen, Tiffany H.; Two, Aimee M.; Chun, Kimberly A.; Narala, Saisindhu; Geha, Raif S.; Hata, Tissa R.; Gallo, Richard L.


    Patients with atopic dermatitis (AD) have an abnormal skin barrier and are frequently colonized by S. aureus. In this study we investigated if S. aureus penetrates the epidermal barrier of subjects with AD and sought to understand the mechanism and functional significance of this entry. S. aureus was observed to be more abundant in the dermis of lesional skin from AD patients. Bacterial entry past the epidermis was observed in cultured human skin equivalents and in mice, but found to be increased in the skin of cathelicidin knockout (Camp−/−) and ovalbumin-sensitized filaggrin mutant (FLGft/ft) mice. S. aureus penetration through the epidermis was dependent on bacterial viability and protease activity as killed bacteria or a protease-null mutant strain of S. aureus was unable to penetrate. Entry of S. aureus directly correlated with increased expression of IL4, IL13, IL22, TSLP and other cytokines associated with AD, and with decreased expression of cathelicidin. These data illustrate how abnormalities of the epidermal barrier in AD can alter the balance of S. aureus entry into the dermis and provides an explanation for how such dermal dysbiosis results in increased inflammatory cytokines and exacerbation of disease. PMID:27381887

  20. Comparison study of ferrofluid and powder iron oxide nanoparticle permeability across the blood-brain barrier.


    Hoff, Dan; Sheikh, Lubna; Bhattacharya, Soumya; Nayar, Suprabha; Webster, Thomas J


    In the present study, the permeability of 11 different iron oxide nanoparticle (IONP) samples (eight fluids and three powders) was determined using an in vitro blood-brain barrier model. Importantly, the results showed that the ferrofluid formulations were statistically more permeable than the IONP powder formulations at the blood-brain barrier, suggesting a role for the presently studied in situ synthesized ferrofluid formulations using poly(vinyl) alcohol, bovine serum albumin, collagen, glutamic acid, graphene, and their combinations as materials which can cross the blood-brain barrier to deliver drugs or have other neurological therapeutic efficacy. Conversely, the results showed the least permeability across the blood-brain barrier for the IONP with collagen formulation, suggesting a role as a magnetic resonance imaging contrast agent but limiting IONP passage across the blood-brain barrier. Further analysis of the data yielded several trends of note, with little correlation between permeability and fluid zeta potential, but a larger correlation between permeability and fluid particle size (with the smaller particle sizes having larger permeability). Such results lay the foundation for simple modification of iron oxide nanoparticle formulations to either promote or inhibit passage across the blood-brain barrier, and deserve further investigation for a wide range of applications.

  1. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris

    PubMed Central

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji


    Objective: To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Methods: Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Results: Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients (P<0.001). The clinical scores of erythema, burning, dryness and itching in papulopustular rosacea patients were significantly higher than those in acne vulgaris patients (P<0.001). The water content of the stratum cornuem and skin surface lipid level were both significantly lower in papulopustular rosacea patients than that of the acne vulgaris patients (P<0.001) and healthy subjects (P<0.001); Water content of the stratum cornuem and skin surface lipid level were higher in acne vulgaris patients in comparison with that of healthy subjects (P>0.05, P<0.001; respectively). Transepidermal water loss was significantly higher in papulopustular rosacea patients than that of acne vulgaris patients and healthy subjects (P<0.001); transepidermal water loss was lower in skin of acne vulgaris patients than that of healthy subjects (P<0.001). Conclusion: Erythema, burning, dryness and itching are the characteristics of papulopustular rosacea, which makes it different from acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients. PMID:28083023

  2. Current evidence of epidermal barrier dysfunction and thymic stromal lymphopoietin in the atopic march.


    Li, Mei


    It has long been observed that the development of asthma, allergic rhinitis and food allergy are frequently preceded by atopic dermatitis, a phenomenon known as the "atopic march". Clinical, genetic and experimental studies have supported the fact that atopic dermatitis could be the initial step of the atopic march, leading to the subsequent development of other atopic diseases. This brief review will focus on the current evidence showing that epidermal barrier dysfunction and the keratinocyte-derived cytokine thymic stromal lymphopoietin play critical roles in the onset of the atopic march.


    EPA Science Inventory

    A pilot-scale permeable reactive barrier filled with plant mulch was installed at Altus Air Force Base (in Oklahoma, USA) to treat trichloroethylene (TCE) contamination in ground water emanating from a landfill. The barrier was constructed in June 2002. It was 139 meters long, 7 ...

  4. A permeability barrier surrounds taste buds in lingual epithelia.


    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D


    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003-1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste.

  5. Large-scale identification of human genes implicated in epidermal barrier function

    PubMed Central

    Toulza, Eve; Mattiuzzo, Nicolas R; Galliano, Marie-Florence; Jonca, Nathalie; Dossat, Carole; Jacob, Daniel; de Daruvar, Antoine; Wincker, Patrick; Serre, Guy; Guerrin, Marina


    Background During epidermal differentiation, keratinocytes progressing through the suprabasal layers undergo complex and tightly regulated biochemical modifications leading to cornification and desquamation. The last living cells, the granular keratinocytes (GKs), produce almost all of the proteins and lipids required for the protective barrier function before their programmed cell death gives rise to corneocytes. We present here the first analysis of the transcriptome of human GKs, purified from healthy epidermis by an original approach. Results Using the ORESTES method, 22,585 expressed sequence tags (ESTs) were produced that matched 3,387 genes. Despite normalization provided by this method (mean 4.6 ORESTES per gene), some highly transcribed genes, including that encoding dermokine, were overrepresented. About 330 expressed genes displayed less than 100 ESTs in UniGene clusters and are most likely to be specific for GKs and potentially involved in barrier function. This hypothesis was tested by comparing the relative expression of 73 genes in the basal and granular layers of epidermis by quantitative RT-PCR. Among these, 33 were identified as new, highly specific markers of GKs, including those encoding a protease, protease inhibitors and proteins involved in lipid metabolism and transport. We identified filaggrin 2 (also called ifapsoriasin), a poorly characterized member of the epidermal differentiation complex, as well as three new lipase genes clustered with paralogous genes on chromosome 10q23.31. A new gene of unknown function, C1orf81, is specifically disrupted in the human genome by a frameshift mutation. Conclusion These data increase the present knowledge of genes responsible for the formation of the skin barrier and suggest new candidates for genodermatoses of unknown origin. PMID:17562024


    SciTech Connect

    Robert S. Bowman; Pengfei Zhang; Xian Tao


    This report summarizes experiments to develop and test surfactant-modified zeolite/zero-valent iron (SMZ/ZVI) pellets for permeable reactive barriers to treat groundwater contamination. Coating a glass foam core with a mixture of hexadecyltrimethylammonium surfactant, zeolite, and ZVI produced a high hydraulic conductivity, mechanically stable pellet. Laboratory experiments showed that the pellets completely removed soluble chromate from aqueous solution, and reduced perchloroethylene (PCE) concentrations more than pellets that lacked surfactant. Based upon the laboratory results, they predicted a 1-m-wide SMZ/ZVI barrier that would reduce PCE concentrations by four orders of magnitude. Thirteen cubic meters (470 cubic feet) of SMZ/ZVI pellets were manufactured and emplaced in a permeable barrier test facility. A controlled plume of chromate and PCE was allowed to contact the barrier for four weeks. The entire plume was captured by the barrier. No chromate was detected downgradient of the barrier. The PCE broke through the barrier after four weeks, and downgradient concentrations ultimately exceeded 10% of the influent PCE. The less-than-expected PCE reduction was attributed to insufficient surfactant content, the large size, and pH-altering characteristics of the bulk-produced pellets. The pellets developed here can be improved to yield a performance- and cost-competitive permeable barrier material.

  7. Permeability of the blood-brain barrier predicts conversion from optic neuritis to multiple sclerosis.


    Cramer, Stig P; Modvig, Signe; Simonsen, Helle J; Frederiksen, Jette L; Larsson, Henrik B W


    Optic neuritis is an acute inflammatory condition that is highly associated with multiple sclerosis. Currently, the best predictor of future development of multiple sclerosis is the number of T2 lesions visualized by magnetic resonance imaging. Previous research has found abnormalities in the permeability of the blood-brain barrier in normal-appearing white matter of patients with multiple sclerosis and here, for the first time, we present a study on the capability of blood-brain barrier permeability in predicting conversion from optic neuritis to multiple sclerosis and a direct comparison with cerebrospinal fluid markers of inflammation, cellular trafficking and blood-brain barrier breakdown. To this end, we applied dynamic contrast-enhanced magnetic resonance imaging at 3 T to measure blood-brain barrier permeability in 39 patients with monosymptomatic optic neuritis, all referred for imaging as part of the diagnostic work-up at time of diagnosis. Eighteen healthy controls were included for comparison. Patients had magnetic resonance imaging and lumbar puncture performed within 4 weeks of onset of optic neuritis. Information on multiple sclerosis conversion was acquired from hospital records 2 years after optic neuritis onset. Logistic regression analysis showed that baseline permeability in normal-appearing white matter significantly improved prediction of multiple sclerosis conversion (according to the 2010 revised McDonald diagnostic criteria) within 2 years compared to T2 lesion count alone. There was no correlation between permeability and T2 lesion count. An increase in permeability in normal-appearing white matter of 0.1 ml/100 g/min increased the risk of multiple sclerosis 8.5 times whereas having more than nine T2 lesions increased the risk 52.6 times. Receiver operating characteristic curve analysis of permeability in normal-appearing white matter gave a cut-off of 0.13 ml/100 g/min, which predicted conversion to multiple sclerosis with a sensitivity of

  8. Permeability of the blood–brain barrier predicts conversion from optic neuritis to multiple sclerosis

    PubMed Central

    Modvig, Signe; Simonsen, Helle J.; Frederiksen, Jette L.; Larsson, Henrik B. W.


    Optic neuritis is an acute inflammatory condition that is highly associated with multiple sclerosis. Currently, the best predictor of future development of multiple sclerosis is the number of T2 lesions visualized by magnetic resonance imaging. Previous research has found abnormalities in the permeability of the blood–brain barrier in normal-appearing white matter of patients with multiple sclerosis and here, for the first time, we present a study on the capability of blood–brain barrier permeability in predicting conversion from optic neuritis to multiple sclerosis and a direct comparison with cerebrospinal fluid markers of inflammation, cellular trafficking and blood–brain barrier breakdown. To this end, we applied dynamic contrast-enhanced magnetic resonance imaging at 3 T to measure blood–brain barrier permeability in 39 patients with monosymptomatic optic neuritis, all referred for imaging as part of the diagnostic work-up at time of diagnosis. Eighteen healthy controls were included for comparison. Patients had magnetic resonance imaging and lumbar puncture performed within 4 weeks of onset of optic neuritis. Information on multiple sclerosis conversion was acquired from hospital records 2 years after optic neuritis onset. Logistic regression analysis showed that baseline permeability in normal-appearing white matter significantly improved prediction of multiple sclerosis conversion (according to the 2010 revised McDonald diagnostic criteria) within 2 years compared to T2 lesion count alone. There was no correlation between permeability and T2 lesion count. An increase in permeability in normal-appearing white matter of 0.1 ml/100 g/min increased the risk of multiple sclerosis 8.5 times whereas having more than nine T2 lesions increased the risk 52.6 times. Receiver operating characteristic curve analysis of permeability in normal-appearing white matter gave a cut-off of 0.13 ml/100 g/min, which predicted conversion to multiple sclerosis with a

  9. Assessment of permeability barriers to macromolecules in the rodent endometrium at the onset of implantation.


    Bany, Brent M; Hamilton, G Scot


    In rodents, embryo implantation is an invasive process, which begins with its attachment to the uterine wall and culminates in the formation of the definitive placenta several days later. It is critical that the endometrium provide a supportive environment for the implanting embryo during this process, as the placenta is not yet established. The concept of changing permeability barriers to macromolecules between different extracellular compartments in the rodent uterus at the onset of implantation has been established. This chapter provides protocols that can be used to assess this changing permeability barrier and the associated redistribution of macromolecules during the early phases of implantation in rodents. An increased permeability of the endometrial vasculature to plasma proteins occurs in areas adjacent to the implanting blastocyst. In addition, alterations in the extracellular matrix enhance the accumulation of fluid and extravasated macromolecules. We describe several protocols proven to be effective in studying and quantifying early vascular and extravascular responses to natural and artificial "implantation stimuli." The first three protocols represent qualitative and quantitative methods to assess the early endometrial "vascular permeability" response. On the contrary, the fourth protocol addresses the onset of decidualization and the arising permeability barrier, which restricts the movement of macromolecules through the extracellular space. This barrier is believed to provide transient protection for the implanting embryo against potentially harmful maternal serum proteins. This protocol describes assessment of resistance of the primary decidual zone to the movement of macromolecules across the compartments of the extracellular space.

  10. The role of the trans double bond in skin barrier sphingolipids: permeability and infrared spectroscopic study of model ceramide and dihydroceramide membranes.


    Skolová, Barbora; Jandovská, Kateřina; Pullmannová, Petra; Tesař, Ondřej; Roh, Jaroslav; Hrabálek, Alexandr; Vávrová, Kateřina


    Dihydroceramides (dCer) are members of the sphingolipid family that lack the C4 trans double bond in their sphingoid backbone. In addition to being precursors of ceramides (Cer) and phytoceramides, dCer have also been found in the extracellular lipid membranes of the epidermal barrier, the stratum corneum. However, their role in barrier homeostasis is not known. We studied how the lack of the trans double bond in dCer compared to Cer influences the permeability, lipid chain order, and packing of multilamellar membranes composed of the major skin barrier lipids: (d)Cer, fatty acids, cholesterol, and cholesteryl sulfate. The permeability of the membranes with long-chain dCer was measured using various markers and was either comparable to or only slightly greater than (by up to 35%, not significant) that of the Cer membranes. The dCer were less sensitive to acyl chain shortening than Cer (the short dCer membranes were up to 6-fold less permeable that the corresponding short Cer membranes). Infrared spectroscopy showed that long dCer mixed less with fatty acids but formed more thermally stable ordered domains than Cer. The key parameter explaining the differences in permeability in the short dCer and Cer was the proportion of the orthorhombic phase. Our results suggest that the presence of the trans double bond in Cer is not crucial for the permeability of skin lipid membranes and that dCer may be underappreciated members of the stratum corneum lipid barrier that increase its heterogeneity.

  11. Effect of topically applied dexpanthenol on epidermal barrier function and stratum corneum hydration. Results of a human in vivo study.


    Gehring, W; Gloor, M


    In a randomized, double-blind, placebo-controlled study the effect of topical dexpanthenol (CAS 81-13-0) formulated in two different lipophilic vehicles on epidermal barrier function in vivo was carried out. Seven days' treatment with dexpanthenol improved stratum corneum hydration and reduced transepidermal water loss. Active treatment was statistically different from the vehicle control on both measures. Our results suggest that topical dexpanthenol formulated in either lipophilic vehicle stabilizes the skin barrier function.

  12. Potential performance of pillared inorgano- organo bentonite for soil mix technology permeable reactive barrier (Invited)

    NASA Astrophysics Data System (ADS)

    Abunada, Z. M.; Al-Tabbaa, A.


    Modified bentonite has gained more interest for their effect in contaminant removal and environmental protection. This study is investigating the use of three different modified inorgano-organo bentonite (IOB) in soil mixing permeable reactive barrier. IOB were prepared using pillaring agents and quaternary ammonium cations (QAC) with different loading ratios. The permeabilities of compacted specimens containing IOB with two different soil types (sandy and gravelly soil) were measured for site contaminated groundwater, pure water and TEX compounds to study the potential of soil mix permeable reactive barrier (PRB). The soil permeability decreased by 1-2 order of magnitude once mixed with IOB. It also decreased by about 100 in case of TEX compound and site groundwater. The IOB was tested to remove Toluene, Ethyl-benzene, and o-Xylene (TEX) compound from model contaminated water in both batch and column test. Physical characteristics such as pore volume, porosity and specific structure in addition to level of surfactant loading were determined. Materials removal efficiency varied due to the surfactant loading, soil type and contaminant molecular weight. Sorption isotherm showed that the adsorbates preference increased in the order of T>E>X in all IOB types. Maximum TEX compound sorptive capacity varied also due to soil type with the highest was 86.89% 93.19% and 90.2% for T,E,X respectively on sandy soil. Key words: Inorgano-organo bentonite, permeability, reactive barrier, soil mix, sorption

  13. A framework for understanding semi-permeable barrier effects on migratory ungulates

    USGS Publications Warehouse

    Sawyer, Hall; Kauffman, Matthew J.; Middleton, Arthur D.; Morrison, Thomas A.; Nielson, Ryan M.; Wyckoff, Teal B.


    1. Impermeable barriers to migration can greatly constrain the set of possible routes and ranges used by migrating animals. For ungulates, however, many forms of development are semi-permeable, and making informed management decisions about their potential impacts to the persistence of migration routes is difficult because our knowledge of how semi-permeable barriers affect migratory behaviour and function is limited. 2. Here, we propose a general framework to advance the understanding of barrier effects on ungulate migration by emphasizing the need to (i) quantify potential barriers in terms that allow behavioural thresholds to be considered, (ii) identify and measure behavioural responses to semi-permeable barriers and (iii) consider the functional attributes of the migratory landscape (e.g. stopovers) and how the benefits of migration might be reduced by behavioural changes. 3. We used global position system (GPS) data collected from two subpopulations of mule deer Odocoileus hemionus to evaluate how different levels of gas development influenced migratory behaviour, including movement rates and stopover use at the individual level, and intensity of use and width of migration route at the population level. We then characterized the functional landscape of migration routes as either stopover habitat or movement corridors and examined how the observed behavioural changes affected the functionality of the migration route in terms of stopover use. 4. We found migratory behaviour to vary with development intensity. Our results suggest that mule deer can migrate through moderate levels of development without any noticeable effects on migratory behaviour. However, in areas with more intensive development, animals often detoured from established routes, increased their rate of movement and reduced stopover use, while the overall use and width of migration routes decreased. 5. Synthesis and applications. In contrast to impermeable barriers that impede animal movement

  14. Glomerular permeability barrier in the rat. Functional assessment by in vitro methods.

    PubMed Central

    Daniels, B S; Deen, W M; Mayer, G; Meyer, T; Hostetter, T H


    The formation of glomerular ultrafiltrate is dependent on the prevailing hemodynamic forces within the glomerular microcirculation and the intrinsic properties of the filtration barrier. However, direct assessment of the permeability barrier is difficult with most available techniques. We used confocal microscopy to image 1-micron thick optical cross-sections of isolated intact glomeruli and glomeruli denuded of cells and quantitated dextran (70,000 mol wt) diffusion from the capillary lumen. Dextran permeance was 11 times greater for the acellular filtration barrier than the intact peripheral capillary. Consideration of the basement membrane and cells as series resistors demonstrated that cells of the filtration barrier contribute 90% of the total resistance to macromolecular permeance. Using a different approach, dextran sieving coefficients for acellular glomeruli consolidated as a multilayer sheet in a filtration cell were similar to those for intact glomeruli in vivo at radii 30-36 A and approximately 50 times greater at a dextran radius of 60 A. The presence of cells significantly reduced hydraulic permeability determined on consolidated intact or acellular glomeruli in an ultrafiltration cell with 50 mmHg applied pressure. The glomerular basement membrane does restrict macromolecular permeability but cells are important determinants of the overall macromolecular and hydraulic permeability of the glomerulus. Images PMID:7688767


    EPA Science Inventory

    The generation and release of acidic drainage from mine wastes is an environmental problem of international scale. The use of zero-valent iron and/or iron mixtures in subsurface Permeable Reactive Barriers (PRB) presents a possible passive alternative for remediating acidic grou...


    EPA Science Inventory

    An overview of ground water remediation research conducted at the Subsurface Protection and Remediation Division is provided. The focus of the overview is on Permeable Reactive Barriers for treatment of organic and inorganic contaminants and remediation of DNAPL source zones.


    EPA Science Inventory

    This research brief presents findings over the past four years at two sites where detailed investigations by the U.S. Environmental Protection Agency (U.S. EPA) have focused on the long-term performance of PRBs under a Tri-Agency Permeable Reactive Barrier Initiative (TRI). This ...

  18. Blood-Brain Barrier Permeability and Monocyte Infiltration in Experimental Allergic Encephalomyelitis

    ERIC Educational Resources Information Center

    Floris, S.; Blezer, E. L. A.; Schreibelt, G.; Dopp, E.; van der Pol, S. M. A.; Schadee-Eestermans, I. L.; Nicolay, K.; Dijkstra, C. D.; de Vries, H. E.


    Enhanced cerebrovascular permeability and cellular infiltration mark the onset of early multiple sclerosis lesions. So far, the precise sequence of these events and their role in lesion formation and disease progression remain unknown. Here we provide quantitative evidence that blood-brain barrier leakage is an early event and precedes massive…


    EPA Science Inventory

    Recently, a synthesis of research findings by EPA has been prepared and presented in an EPA report titled Capstone Report on the Application, Monitoring, and Performance of Permeable Reactive Barriers for Ground-Water Remediation (EPA/600/R-03/045 a,b). Another report has also be...


    EPA Science Inventory

    Solid-phase associations of chromium were examined in core materials collected from a full-scale, zerovalent iron, permeable reactive barrier (PRB) at the U.S. Coast Guard Support Center located near Elizabeth City (NC). The PRB was installed in 1996 to treat groundwater contami...


    EPA Science Inventory

    Accumulation of mineral precipitates and microbial biomass are key factors that impact the long-term performance of in-situ Permeable Reactive Barriers for treating contaminated groundwater. Both processes can impact remedial performance by decreasing zero-valent iron reactivity...

  2. A Tracer Test to Characterize Treatment of TCE in a Permeable Reactive Barrier

    EPA Science Inventory

    A tracer test was conducted to characterize the flow of ground water surrounding a permeable reactive barrier constructed with plant mulch (a biowall) at the OU-1 site on Altus Air Force Base, Oklahoma. This biowall is intended to intercept and treat ground water contaminated by ...

  3. Nanosized iron based permeable reactive barriers for nitrate removal - Systematic review

    NASA Astrophysics Data System (ADS)

    Araújo, Rui; Castro, Ana C. Meira; Santos Baptista, João; Fiúza, António


    It is unquestionable that an effective decision concerning the usage of a certain environmental clean-up technology should be conveniently supported. Significant amount of scientific work focussing on the reduction of nitrate concentration in drinking water by both metallic iron and nanomaterials and their usage in permeable reactive barriers has been worldwide published over the last two decades. This work aims to present in a systematic review of the most relevant research done on the removal of nitrate from groundwater using nanosized iron based permeable reactive barriers. The research was based on scientific papers published between 2004 and June 2014. It was performed using 16 combinations of keywords in 34 databases, according to PRISMA statement guidelines. Independent reviewers validated the selection criteria. From the 4161 records filtered, 45 met the selection criteria and were selected to be included in this review. This study's outcomes show that the permeable reactive barriers are, indeed, a suitable technology for denitrification and with good performance record but the long-term impact of the use of nanosized zero valent iron in this remediation process, in both on the environment and on the human health, is far to be conveniently known. As a consequence, further work is required on this matter, so that nanosized iron based permeable reactive barriers for the removal of nitrate from drinking water can be genuinely considered an eco-efficient technology.


    EPA Science Inventory

    A permeable reactive barrier (PRB) is a wall of porous reactive material placed in the path of a dissolved contaminant plume for the purpose of removing contaminants from ground water. Chemical processes within these reactive materials remove both inorganic and organic contamina...


    EPA Science Inventory

    The permeable reactive barrier (PRB) technology represents a passive option for long-term treatment of ground-water contamination. PRBs are a potentially more cost-effective treatment option for a variety of dissolved contaminants, such as certain types of chlorinated solvents, ...


    EPA Science Inventory

    The U. S. Environmental Protection Agency's Office of Research and Development and its contractor have evaluated cost data from 22 sites where permeable reactive barriers (PRBs) have been utilized to remediate contaminated ground water resources. Most of the sites evaluated wer...

  7. A clay permeable reactive barrier to remove Cs-137 from groundwater: Column experiments.


    De Pourcq, K; Ayora, C; García-Gutiérrez, M; Missana, T; Carrera, J


    Clay minerals are reputed sorbents for Cs-137 and can be used as a low-permeability material to prevent groundwater flow. Therefore, clay barriers are employed to seal Cs-137 polluted areas and nuclear waste repositories. This work is motivated by cases where groundwater flow cannot be impeded. A permeable and reactive barrier to retain Cs-137 was tested. The trapping mechanism is based on the sorption of cesium on illite-containing clay. The permeability of the reactive material is provided by mixing clay on a matrix of wood shavings. Column tests combined with reactive transport modeling were performed to check both reactivity and permeability. Hydraulic conductivity of the mixture (10(-4) m/s) was sufficient to ensure an adequate hydraulic performance of an eventual barrier excavated in most aquifers. A number of column experiments confirmed Cs retention under different flow rates and inflow solutions. A 1D reactive transport model based on a cation-exchange mechanism was built. It was calibrated with batch experiments for high concentrations of NH4+ and K+ (the main competitors of Cs in the exchange positions). The model predicted satisfactorily the results of the column experiments. Once validated, it was used to investigate the performance and duration of a 2 m thick barrier under different scenarios (flow, clay content, Cs-137 and K concentration).

  8. Phosphorylation of Grainy head by ERK is essential for wound-dependent regeneration but not for development of an epidermal barrier.


    Kim, Myungjin; McGinnis, William


    Grainy head (GRH) is a key transcription factor responsible for epidermal barrier formation and repair, whose function is highly conserved across diverse animal species. However, it is not known how GRH function is reactivated to repair differentiated epidermal barriers after wounding. Here, we show that GRH is directly regulated by extracellular signal-regulated kinase (ERK) phosphorylation, which is required for wound-dependent expression of GRH target genes in epidermal cells. Serine 91 is the principal residue in GRH that is phosphorylated by ERK. Although mutations of the ERK phosphorylation sites in GRH do not impair its DNA binding function, the ERK sites in GRH are required to activate Dopa decarboxylase (Ddc) and misshapen (msn) epidermal wound enhancers as well as functional regeneration of an epidermal barrier upon wounding. This result indicates that the phosphorylation sites are essential for damaged epidermal barrier repair. However, GRH with mutant ERK phosphorylation sites can still promote barrier formation during embryonic epidermal development, suggesting that ERK sites are dispensable for the GRH function in establishing epidermal barrier integrity. These results provide mechanistic insight into how tissue repair can be initiated by posttranslational modification of a key transcription factor that normally mediates the developmental generation of that tissue.

  9. The gut microbiota influences blood-brain barrier permeability in mice.


    Braniste, Viorica; Al-Asmakh, Maha; Kowal, Czeslawa; Anuar, Farhana; Abbaspour, Afrouz; Tóth, Miklós; Korecka, Agata; Bakocevic, Nadja; Ng, Lai Guan; Guan, Ng Lai; Kundu, Parag; Gulyás, Balázs; Halldin, Christer; Hultenby, Kjell; Nilsson, Harriet; Hebert, Hans; Volpe, Bruce T; Diamond, Betty; Pettersson, Sven


    Pivotal to brain development and function is an intact blood-brain barrier (BBB), which acts as a gatekeeper to control the passage and exchange of molecules and nutrients between the circulatory system and the brain parenchyma. The BBB also ensures homeostasis of the central nervous system (CNS). We report that germ-free mice, beginning with intrauterine life, displayed increased BBB permeability compared to pathogen-free mice with a normal gut flora. The increased BBB permeability was maintained in germ-free mice after birth and during adulthood and was associated with reduced expression of the tight junction proteins occludin and claudin-5, which are known to regulate barrier function in endothelial tissues. Exposure of germ-free adult mice to a pathogen-free gut microbiota decreased BBB permeability and up-regulated the expression of tight junction proteins. Our results suggest that gut microbiota-BBB communication is initiated during gestation and propagated throughout life.

  10. Direct visualization of the arterial wall water permeability barrier using CARS microscopy.


    Lucotte, Bertrand M; Powell, Chloe; Knutson, Jay R; Combs, Christian A; Malide, Daniela; Yu, Zu-Xi; Knepper, Mark; Patel, Keval D; Pielach, Anna; Johnson, Errin; Borysova, Lyudmyla; Dora, Kim A; Balaban, Robert S


    The artery wall is equipped with a water permeation barrier that allows blood to flow at high pressure without significant water leak. The precise location of this barrier is unknown despite its importance in vascular function and its contribution to many vascular complications when it is compromised. Herein we map the water permeability in intact arteries, using coherent anti-Stokes Raman scattering (CARS) microscopy and isotopic perfusion experiments. Generation of the CARS signal is optimized for water imaging with broadband excitation. We identify the water permeation barrier as the endothelial basolateral membrane and show that the apical membrane is highly permeable. This is confirmed by the distribution of the AQP1 water channel within endothelial membranes. These results indicate that arterial pressure equilibrates within the endothelium and is transmitted to the supporting basement membrane and internal elastic lamina macromolecules with minimal deformation of the sensitive endothelial cell. Disruption of this pressure transmission could contribute to endothelial cell dysfunction in various pathologies.

  11. Redox-active media for permeable reactive barriers

    SciTech Connect

    Sivavec, T.M.; Mackenzie, P.D.; Horney, D.P.; Baghel, S.S.


    In this paper, three classes of redox-active media are described and evaluated in terms of their long-term effectiveness in treating TCE-contaminated groundwater in permeable reactive zones. Zero-valent iron, in the form of recycled cast iron filings, the first class, has received considerable attention as a reactive media and has been used in about a dozen pilot- and full-scale subsurface wall installations. Criteria used in selecting commercial sources of granular iron, will be discussed. Two other classes of redox-active media that have not yet seen wide use in pilot- or full-scale installations will also be described: Fe(II) minerals and bimetallic systems. Fe(II) minerals, including magnetite (Fe{sub 3}O{sub 4}), and ferrous sulfide (troilite, FeS), are redox-active and afford TCE reduction rates and product distributions that suggest that they react via a reductive mechanism similar to that which operates in the FeO system. Fe(II) species within the passive oxide layer coating the iron metal may act as electron transfer mediators, with FeO serving as the bulk reductant. Bimetallic systems, the third class of redox-active media, are commonly prepared by plating a second metal onto zero-valent iron (e.g., Ni/Fe and Pd/Fe) and have been shown to accelerate solvent degradation rates relative to untreated iron metal. The long-term effectiveness of this approach, however, has not yet been determined in groundwater treatability tests. The results of a Ni-plated iron column study using site groundwater indicate that a change in reduction mechanism (to catalytic dehydrohalogenation/hydrogenation) accounts for the observed rate enhancement. A significant loss in media reactivity was observed over time, attributable to Ni catalyst deactivation or poisoning. Zero-valent iron systems have not shown similar losses in reactivity in long-term laboratory, pilot or field investigations.

  12. Intracellular ascorbate tightens the endothelial permeability barrier through Epac1 and the tubulin cytoskeleton.


    Parker, William H; Rhea, Elizabeth Meredith; Qu, Zhi-Chao; Hecker, Morgan R; May, James M


    Vitamin C, or ascorbic acid, both tightens the endothelial permeability barrier in basal cells and also prevents barrier leak induced by inflammatory agents. Barrier tightening by ascorbate in basal endothelial cells requires nitric oxide derived from activation of nitric oxide synthase. Although ascorbate did not affect cyclic AMP levels in our previous study, there remains a question of whether it might activate downstream cyclic AMP-dependent pathways. In this work, we found in both primary and immortalized cultured endothelial cells that ascorbate tightened the endothelial permeability barrier by ∼30%. In human umbilical vein endothelial cells, this occurred at what are likely physiologic intracellular ascorbate concentrations. In so doing, ascorbate decreased measures of oxidative stress and also flattened the cells to increase cell-to-cell contact. Inhibition of downstream cyclic AMP-dependent proteins via protein kinase A did not prevent ascorbate from tightening the endothelial permeability barrier, whereas inhibition of Epac1 did block the ascorbate effect. Although Epac1 was required, its mediator Rap1 was not activated. Furthermore, ascorbate acutely stabilized microtubules during depolymerization induced by colchicine and nocodazole. Over several days in culture, ascorbate also increased the amount of stable acetylated α-tubulin. Microtubule stabilization was further suggested by the finding that ascorbate increased the amount of Epac1 bound to α-tubulin. These results suggest that physiologic ascorbate concentrations tighten the endothelial permeability barrier in unstimulated cells by stabilizing microtubules in a manner downstream of cyclic AMP that might be due both to increasing nitric oxide availability and to scavenging of reactive oxygen or nitrogen species.

  13. Use of jet grouting to create a low permeability horizontal barrier below an incinerator ash landfill

    SciTech Connect

    Furth, A.J.; Burke, G.K.; Deutsch, W.L. Jr.


    The City of Philadelphia`s Division of Aviation (DOA) has begun construction of a new commuter runway, designated as Runway 8-26, at the Philadelphia International Airport. A portion of this runway will be constructed over a former Superfund site known as the Enterprise Avenue Landfill, which for many years was used to dispose of solid waste incinerator ash and other hazardous materials. The site was clay capped in the 1980`s, but in order for the DOA to use the site, additional remediation was needed to meet US EPA final closure requirements. One component of the closure plan included installation of a low permeability horizontal barrier above a very thin (approximately 0.61 to 0.91 meters) natural clay stratum which underlies an approximately 1020 m{sup 2} area of the landfill footprint so as to insure that a minimum 1.52 meter thick low permeability barrier exists beneath the entire 150,000 m{sup 2} landfill. The new barrier was constructed using jet grouting techniques to achieve remote excavation and replacement of the bottom 0.91 meters of the waste mass with a low permeability grout. The grout was formulated to meet the low permeability, low elastic modulus and compressive strength requirements of the project design. This paper will discuss the advantages of using jet grouting for the work and details the development of the grout mixture, modeling of the grout zone under load, field construction techniques, performance monitoring and verification testing.

  14. Permeability of the blood-brain barrier to a rhenacarborane.


    Hawkins, Patrick M; Jelliss, Paul A; Nonaka, Naoko; Shi, Xiaoming; Banks, William A


    The treatment of brain malignancies with boron neutron capture therapy depends on their ability to cross the blood-brain barrier (BBB). An especially promising class of boron-containing compounds is the rhenacarboranes that, if able to cross the BBB, could act as delivery vehicles as well as a source of boron. Here, we examined the ability of the 3-NO-3,3-kappa(2)-(2,2'-N(2)C(10)H(6)(Me)[(CH(2))(7)(131)I]-4,4')-closo-3,1,2-ReC(2)B(9)H(11) (rhenacarborane) labeled with iodine-131 to be taken up into the bloodstream after subcutaneous administration and to cross the BBB. The (131)I-rhenacarborane was quickly absorbed from the injection site and reached a steady state in arterial serum of 2.59%/ml of the administered dose. Between 73 and 95% of the radioactivity in serum 6 h after administration represented intact (131)I-rhenacarborane. Its octanol/buffer partition coefficient was 1.74, showing it to be lipophilic. Tissue/serum ratios for brain, lung, and liver showed classic patterns for a lipid-soluble substance with high levels immediately achieved and rapid redistribution. For brain, a steady state of approximately 0.107% of the administered dose/gram-brain was rapidly reached, and 71% of the radioactivity in brain 6 h after subcutaneous administration represented intact (131)I-rhenacarborane. Steady-state values were 1.53 and 0.89% of the injected dose per gram for lung and liver, respectively. (131)I-Rhenacarborane was quickly effluxed from brain by a nonsaturable system after its injection into the lateral ventricle of the brain. In conclusion, these results show that a rhenacarborane was enzymatically resistant and able to cross the BBB by transmembrane diffusion and accumulate in brain in substantial amounts. This supports their use as therapeutic agents for targeting the central nervous system.

  15. Induced phytoextraction/soil washing of lead using biodegradable chelate and permeable barriers.


    Kos, Bostjan; Lestan, Domen


    Chelate-induced remediation has been proposed as an effective tool for the extraction of lead (Pb) from contaminated soils by plants. However, side-effects, mainly mobilization and leaching of Pb, raise environmental concerns. Biodegradable, synthetic organic chelate ethylenediaminedisuccinic acid (EDDS), and commonly used ethylenedimanetetraacetic acid (EDTA) were used for induced phytoextraction with a test plant Brassica rapa and in situ washing of soil contaminated with 1350 mg/kg of Pb. Horizontal permeable barriers were placed 20 cm deep in soil columns and tested for their ability to prevent leaching of Pb. The reactive materials in the barriers were nutrient enriched vermiculite, peat or agricultural hydrogel, and apatite. EDTA and EDDS addition increased Pb concentrations in the test plant by 158 and 89 times compared to the control, to 817 and 464 mg/kg, respectively. In EDTA treatments, approximately 25% or more of total initial soil Pb was leached in single cycle of chelate addition. In EDDS treatments, 20% of the initial Pb was leached from columns with no barrier, while barriers with vermiculite or hydrogel and apatite decreased leaching by more than 60 times, to 0.35%. 11.6% of total initial Pb was washed from the soil above the barrier with vermiculite and apatite, where almost all leached Pb was accumulated. Results indicate that use of biodegradable chelate EDDS and permeable barriers may lead to environmentally safe induced Pb phytoextraction and in situ washing of Pb.

  16. Nitric Oxide and Airway Epithelial Barrier Function: Regulation of Tight Junction Proteins and Epithelial Permeability

    PubMed Central

    Olson, Nels; Greul, Anne-Katrin; Hristova, Milena; Bove, Peter F.; Kasahara, David I.; van der Vliet, Albert


    Acute airway inflammation is associated with enhanced production of nitric oxide (NO•) and altered airway epithelial barrier function, suggesting a role of NO• or its metabolites in epithelial permeability. While high concentrations of S-nitrosothiols disrupted transepithelial resistance (TER) and increased permeability in 16HBE14o- cells, no significant barrier disruption was observed by NONOates, in spite of altered distribution and expression of some TJ proteins. Barrier disruption of mouse tracheal epithelial (MTE) cell monolayers in response to inflammatory cytokines was independent of NOS2, based on similar effects in MTE cells from NOS2-/- mice and a lack of effect of the NOS2-inhibitor 1400W. Cell pre-incubation with LPS protected MTE cells from TER loss and increased permeability by H2O2, which was independent of NOS2. However, NOS2 was found to contribute to epithelial wound repair and TER recovery after mechanical injury. Overall, our results demonstrate that epithelial NOS2 is not responsible for epithelial barrier dysfunction during inflammation, but may contribute to restoration of epithelial integrity. PMID:19100237

  17. Sebaceous gland, hair shaft, and epidermal barrier abnormalities in keratosis pilaris with and without filaggrin deficiency.


    Gruber, Robert; Sugarman, Jeffrey L; Crumrine, Debra; Hupe, Melanie; Mauro, Theodora M; Mauldin, Elizabeth A; Thyssen, Jacob P; Brandner, Johanna M; Hennies, Hans-Christian; Schmuth, Matthias; Elias, Peter M


    Although keratosis pilaris (KP) is common, its etiopathogenesis remains unknown. KP is associated clinically with ichthyosis vulgaris and atopic dermatitis and molecular genetically with filaggrin-null mutations. In 20 KP patients and 20 matched controls, we assessed the filaggrin and claudin 1 genotypes, the phenotypes by dermatoscopy, and the morphology by light and transmission electron microscopy. Thirty-five percent of KP patients displayed filaggrin mutations, demonstrating that filaggrin mutations only partially account for the KP phenotype. Major histologic and dermatoscopic findings of KP were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular permeability were found in both interfollicular and follicular stratum corneum of lesional KP, which correlated ultrastructurally with impaired extracellular lamellar bilayer maturation and organization. All these features were independent of filaggrin genotype. Moreover, ultrastructure of corneodesmosomes and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial barrier abnormalities.

  18. Sebaceous Gland, Hair Shaft, and Epidermal Barrier Abnormalities in Keratosis Pilaris with and without Filaggrin Deficiency

    PubMed Central

    Gruber, Robert; Sugarman, Jeffrey L.; Crumrine, Debra; Hupe, Melanie; Mauro, Theodora M.; Mauldin, Elizabeth A.; Thyssen, Jacob P.; Brandner, Johanna M.; Hennies, Hans-Christian; Schmuth, Matthias; Elias, Peter M.


    Although keratosis pilaris (KP) is common, its etiopathogenesis remains unknown. KP is associated clinically with ichthyosis vulgaris and atopic dermatitis and molecular genetically with filaggrin-null mutations. In 20 KP patients and 20 matched controls, we assessed the filaggrin and claudin 1 genotypes, the phenotypes by dermatoscopy, and the morphology by light and transmission electron microscopy. Thirty-five percent of KP patients displayed filaggrin mutations, demonstrating that filaggrin mutations only partially account for the KP phenotype. Major histologic and dermatoscopic findings of KP were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular permeability were found in both interfollicular and follicular stratum corneum of lesional KP, which correlated ultrastructurally with impaired extracellular lamellar bilayer maturation and organization. All these features were independent of filaggrin genotype. Moreover, ultrastructure of corneodesmosomes and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial barrier abnormalities. PMID:25660180

  19. Detection of blood-nerve barrier permeability by magnetic resonance imaging.


    Wessig, Carsten


    The blood-nerve barrier (BNB) separates the endoneurium from the endovascular space and the epineurial connective tissue. An intact BNB is very important for integrity and functions of the nerve fibers within the endoneurial space. Disruption of the BNB which leads to functional and structural impairment of the peripheral nerve plays an important role in many disorders of the peripheral nerve like Wallerian degeneration, inflammatory nerve disorders, and demyelination. So far, this increased BNB permeability can only be assessed ex vivo. Assessing BNB disruption in vivo would be of great value for studying disorders of the peripheral nervous system. Gadofluorine M (Gf), a new amphiphilic contrast agent for MRI, accumulates in rat nerves with increased permeability of the BNB. After application of Gf, T1-weighted MR images show contrast enhancement of nerves with a disrupted BNB. This new tool of assessing BNB permeability in vivo is described.

  20. Surfactant-modified zeolites as permeable barriers to organic and inorganic groundwater contaminants

    SciTech Connect

    Bowman, R.S.; Sullivan, E.J.


    We have shown in laboratory experiments that natural zeolites treated with hexadecyltrimethylammonium (HDTMA) are effective sorbents for nonpolar organics, inorganic cations, and inorganic anions. Due to their low cost ({approximately}$0.75/kg) and granular nature, HDTMA-zeolites appear ideal candidates for reactive, permeable subsurface barriers. The HDTMA-zeolites are stable over a wide range of pH (3-13), ionic strength (1 M Cs{sup +} or Ca{sup 2+}), and in organic solvents. Surfactant-modified zeolites sorb nonpolar organics (benzene, toluene, xylene, chlorinated aliphatics) via a partitioning mechanism, inorganic cations (Pb{sup 2+}) via ion exchange and surface complexation, and inorganic anions (CrO{sub 4}{sup 2-}, SeO{sub 4}{sup 2-}, SO{sub 4}{sup 2-}) via surface precipitation.The goal of this work is to demonstrate the use of surfactant-modified zeolite as a permeable barrier to ground water contaminants.

  1. Fluorescein Isothiocyanate (FITC)-Dextran Extravasation as a Measure of Blood-Brain Barrier Permeability.


    Natarajan, Reka; Northrop, Nicole; Yamamoto, Bryan


    The blood-brain barrier (BBB) is formed in part by vascular endothelial cells that constitute the capillaries and microvessels of the brain. The function of this barrier is to maintain homeostasis within the brain microenvironment and buffer the brain from changes in the periphery. A dysfunction of the BBB would permit circulating molecules and pathogens typically restricted to the periphery to enter the brain and interfere with normal brain function. As increased permeability of the BBB is associated with several neuropathologies, it is important to have a reliable and sensitive method that determines BBB permeability and the degree of BBB disruption. A detailed protocol is presented for assessing the integrity of the BBB by transcardial perfusion of a 10,000 Da FITC-labeled dextran molecule and its visualization to determine the degree of extravasation from brain microvessels. © 2017 by John Wiley & Sons, Inc.

  2. Bacillus cereus induces permeability of an in vitro blood-retina barrier.


    Moyer, A L; Ramadan, R T; Thurman, J; Burroughs, A; Callegan, M C


    Most Bacillus cereus toxin production is controlled by the quorum-sensing-dependent, pleiotropic global regulator plcR, which contributes to the organism's virulence in the eye. The purpose of this study was to analyze the effects of B. cereus infection and plcR-regulated toxins on the barrier function of retinal pigment epithelium (RPE) cells, the primary cells of the blood-retina barrier. Human ARPE-19 cells were apically inoculated with wild-type or quorum-sensing-deficient B. cereus, and cytotoxicity was analyzed. plcR-regulated toxins were not required for B. cereus-induced RPE cytotoxicity, but these toxins did increase the rate of cell death, primarily by necrosis. B. cereus infection of polarized RPE cell monolayers resulted in increased barrier permeability, independent of plcR-regulated toxins. Loss of both occludin and ZO-1 expression occurred by 8 h postinfection, but alterations in tight junctions appeared to precede cytotoxicity. Of the several proinflammatory cytokines analyzed, only interleukin-6 was produced in response to B. cereus infection. These results demonstrate the deleterious effects of B. cereus infection on RPE barrier function and suggest that plcR-regulated toxins may not contribute significantly to RPE barrier permeability during infection.

  3. A novel dual-flow bioreactor simulates increased fluorescein permeability in epithelial tissue barriers.


    Giusti, Serena; Sbrana, Tommaso; La Marca, Margherita; Di Patria, Valentina; Martinucci, Valentina; Tirella, Annalisa; Domenici, Claudio; Ahluwalia, Arti


    Permeability studies across epithelial barriers are of primary importance in drug delivery as well as in toxicology. However, traditional in vitro models do not adequately mimic the dynamic environment of physiological barriers. Here, we describe a novel two-chamber modular bioreactor for dynamic in vitro studies of epithelial cells. The fluid dynamic environment of the bioreactor was characterized using computational fluid dynamic models and measurements of pressure gradients for different combinations of flow rates in the apical and basal chambers. Cell culture experiments were then performed with fully differentiated Caco-2 cells as a model of the intestinal epithelium, comparing the effect of media flow applied in the bioreactor with traditional static transwells. The flow increases barrier integrity and tight junction expression of Caco-2 cells with respect to the static controls. Fluorescein permeability increased threefold in the dynamic system, indicating that the stimulus induced by flow increases transport across the barrier, closely mimicking the in vivo situation. The results are of interest for studying the influence of mechanical stimuli on cells, and underline the importance of developing more physiologically relevant in vitro tissue models. The bioreactor can be used to study drug delivery, chemical, or nanomaterial toxicity and to engineer barrier tissues.

  4. Permeability barrier of Gram-negative cell envelopes and approaches to bypass it


    Zgurskaya, Helen I.; López, Cesar A.; Gnanakaran, Sandrasegaram


    Gram-negative bacteria are intrinsically resistant to many antibiotics. Species that have acquired multidrug resistance and cause infections that are effectively untreatable present a serious threat to public health. The problem is broadly recognized and tackled at both the fundamental and applied levels. This article summarizes current advances in understanding the molecular bases of the low permeability barrier of Gram-negative pathogens, which is the major obstacle in discovery and development of antibiotics effective against such pathogens. Gaps in knowledge and specific strategies to break this barrier and to achieve potent activities against difficult Gram-negative bacteria are also discussed.

  5. Oxidation of trichloroethylene, toluene, and ethanol vapors by a partially saturated permeable reactive barrier

    NASA Astrophysics Data System (ADS)

    Mahmoodlu, Mojtaba G.; Hassanizadeh, S. Majid; Hartog, Niels; Raoof, Amir


    The mitigation of volatile organic compound (VOC) vapors in the unsaturated zone largely relies on the active removal of vapor by ventilation. In this study we considered an alternative method involving the use of solid potassium permanganate to create a horizontal permeable reactive barrier for oxidizing VOC vapors. Column experiments were carried out to investigate the oxidation of trichloroethylene (TCE), toluene, and ethanol vapors using a partially saturated mixture of potassium permanganate and sand grains. Results showed a significant removal of VOC vapors due to the oxidation. We found that water saturation has a major effect on the removal capacity of the permeable reactive layer. We observed a high removal efficiency and reactivity of potassium permanganate for all target compounds at the highest water saturation (Sw = 0.6). A change in pH within the reactive layer reduced oxidation rate of VOCs. The use of carbonate minerals increased the reactivity of potassium permanganate during the oxidation of TCE vapor by buffering the pH. Reactive transport of VOC vapors diffusing through the permeable reactive layer was modeled, including the pH effect on the oxidation rates. The model accurately described the observed breakthrough curve of TCE and toluene vapors in the headspace of the column. However, miscibility of ethanol in water in combination with produced water during oxidation made the modeling results less accurate for ethanol. A linear relationship was found between total oxidized mass of VOC vapors per unit volume of permeable reactive layer and initial water saturation. This behavior indicates that pH changes control the overall reactivity and longevity of the permeable reactive layer during oxidation of VOCs. The results suggest that field application of a horizontal permeable reactive barrier can be a viable technology against upward migration of VOC vapors through the unsaturated zone.

  6. Remediation of TNT and RDX in Groundwater Using Zero-Valent Iron Permeable Reactive Barriers

    DTIC Science & Technology


    outside diameter ORP oxidation reduction potential P&T pumping and treatment PRB permeable reactive barrier PTA Pilot Test Area PV present value PVC... States Environmental Protection Agency UHU ultra high vacuum UV ultraviolet XPS x-ray photoelectron spectroscopy ZVI zero-valent iron...groundwater typically involve groundwater extraction and treatment (pump-and-treat) with treatment by carbon adsorption or ultraviolet (UV) oxidation

  7. Applications of permeable barrier technology to ground water contamination at the Shiprock, NM, UMTRA site

    SciTech Connect

    Thomson, B.M.; Henry, E.J.; Thombre, M.S.


    The Shiprock uranium mill tailings pile in far northwestern New Mexico consists of approximately 1.5 million tons of uranium mill tailings from an acid leach mill which operated from 1954 to 1968. Located on land owned by the Navajo Nation, it was one of the first tailings piles stabilized under the Uranium Mill Tailings Remedial Action (UMTRA) project. Stabilization activities were completed in 1986 and consisted principally of consolidating the tailings, contouring the pile to achieve good drainage, and covering the pile with a multi-layer cap to control infiltration of water, radon emanation, and surface erosion. No ground water protection or remediation measures were implemented other than limiting infiltration of water through the pile, although a significant ground water contamination plume exists in the flood plain adjacent to the San Juan River. The major contaminants at the Shiprock site include high concentrations of sulfate, nitrate, arsenic, and uranium. One alternative for remediation may be the use of a permeable barrier in the flood plain aquifer. As proposed for the Shiprock site, the permeable barrier would be a trench constructed in the flood plain that would be backfilled with a media that is permeable to ground water, but would intercept or degrade the pollutants. Work to date has focused on use of a mixed microbial population of sulfate and nitrate reducing organisms. These organisms would produce strongly reducing conditions which would result in precipitation of the metal contaminants (i.e., Se(IV) and U(IV)) in the barrier. One of the first considerations in designing a permeable barrier is developing an understanding of ground water flow at the site. Accordingly, a steady state numerical model of the ground water flow at the site was developed using the MODFLOW code.

  8. Hydraulic performance of a permeable reactive barrier at Casey Station, Antarctica.


    Mumford, K A; Rayner, J L; Snape, I; Stevens, G W


    A permeable bio-reactive barrier (PRB) was installed at Casey Station, Antarctica in 2005/06 to intercept, capture and degrade petroleum hydrocarbons from a decade old fuel spill. A funnel and gate configuration was selected and implemented. The reactive gate was split into five separate cells to enable the testing of five different treatment combinations. Although different treatment materials were used in each cell, each treatment combination contained the following reactive zones: a zone for the controlled release of nutrients to enhance degradation, a zone for hydrocarbon capture and enhanced degradation, and a zone to capture excess nutrients. The materials selected for each of these zones had other requirements, these included; not having any adverse impact on the environment, being permeable enough to capture the entire catchment flow, and having sufficient residence time to fully capture migrating hydrocarbons. Over a five year period the performance of the PRB was extensively monitored and evaluated for nutrient concentration, fuel retention and permeability. At the end of the five year test period the material located within the reactive gate was excavated, total petroleum hydrocarbon concentrations present on the material determined and particle size analysis conducted. This work found that although maintaining media reactivity is obviously important, the most critical aspect of PRB performance is preserving the permeability of the barrier itself, in this case by maintaining appropriate particle size distribution. This is particularly important when PRBs are installed in regions that are subject to freeze thaw processes that may result in particle disintegration over time.

  9. Hypomyelination, memory impairment, and blood-brain barrier permeability in a model of sleep apnea.


    Kim, Lenise Jihe; Martinez, Denis; Fiori, Cintia Zappe; Baronio, Diego; Kretzmann, Nélson Alexandre; Barros, Helena Maria Tannhauser


    We investigated the effect of intermittent hypoxia, mimicking sleep apnea, on axonal integrity, blood-brain barrier permeability, and cognitive function of mice. Forty-seven C57BL mice were exposed to intermittent or sham hypoxia, alternating 30s of progressive hypoxia and 30s of reoxigenation, during 8h/day. The axonal integrity in cerebellum was evaluated by transmission electron microscopy. Short- and long-term memories were assessed by novel object recognition test. The levels of endothelin-1 were measured by ELISA. Blood-brain barrier permeability was quantified by Evans Blue dye. After 14 days, animals exposed to intermittent hypoxia showed hypomyelination in cerebellum white matter and higher serum levels of endothelin-1. The short and long-term memories in novel object recognition test was impaired in the group exposed to intermittent hypoxia as compared to controls. Blood-brain barrier permeability was similar between the groups. These results indicated that hypomyelination and impairment of short- and long-term working memories occurred in C57BL mice after 14 days of intermittent hypoxia mimicking sleep apnea.

  10. Major translocation of calcium upon epidermal barrier insult: imaging and quantification via FLIM/Fourier vector analysis

    PubMed Central

    Sanchez, Susana; Barry, Nicholas P.; Kirschner, Nina; Meyer, Wilfried; Mauro, Theodora M.; Moll, Ingrid; Gratton, Enrico


    Calcium controls an array of key events in keratinocytes and epidermis: localized changes in Ca2+ concentrations and their regulation are therefore especially important to assess when observing epidermal barrier homeostasis and repair, neonatal barrier establishment, in differentiation, signaling, cell adhesion, and in various pathological states. Yet, tissue- and cellular Ca2+ concentrations in physiologic and diseased states are only partially known, and difficult to measure. Prior observations on the Ca2+ distribution in skin were based on Ca2+ precipitation followed by electron microscopy, or proton-induced X-ray emission. Neither cellular and/or subcellular localization could be determined through these approaches. In cells in vitro, fluorescent dyes have been used extensively for ratiometric measurements of static and dynamic Ca2+ concentrations, also assessing organelle Ca2+ concentrations. For lack of better methods, these findings together build the basis for the current view of the role of Ca2+ in epidermis, their limitations notwithstanding. Here we report a method using Calcium Green 5N as the calcium sensor and the phasor-plot approach to separate raw lifetime components. Thus, fluorescence lifetime imaging (FLIM) enables us to quantitatively assess and visualize dynamic changes of Ca2+ at light-microscopic resolution in ex vivo biopsies of unfixed epidermis, in close to in vivo conditions. Comparing undisturbed epidermis with epidermis following a barrier insult revealed major shifts, and more importantly, a mobilization of high amounts of Ca2+ shortly following barrier disruption, from intracellular stores. These results partially contradict the conventional view, where barrier insults abrogate a Ca2+ gradient towards the stratum granulosum. Ca2+ FLIM overcomes prior limitations in the observation of epidermal Ca2+ dynamics, and will allow further insights into basic epidermal physiology. PMID:21193994

  11. Plasma from patients with HELLP syndrome increases blood-brain barrier permeability.


    Wallace, Kedra; Tremble, Sarah M; Owens, Michelle Y; Morris, Rachael; Cipolla, Marilyn J


    Circulating inflammatory factors and endothelial dysfunction have been proposed to contribute to the pathophysiology of hemolysis, elevated liver enzymes, and low platelet count (HELLP) syndrome. To date, the occurrence of neurological complications in these women has been reported, but few studies have examined whether impairment in blood-brain barrier (BBB) permeability or cerebrovascular reactivity is present in women having HELLP syndrome. We hypothesized that plasma from women with HELLP syndrome causes increased BBB permeability and cerebrovascular dysfunction. Posterior cerebral arteries from female nonpregnant rats were perfused with 20% serum from women with normal pregnancies (n = 5) or women with HELLP syndrome (n = 5), and BBB permeability and vascular reactivity were compared. Plasma from women with HELLP syndrome increased BBB permeability while not changing myogenic tone and reactivity to pressure. Addition of the nitric oxide (NO) synthase inhibitor N(ω)-nitro-L-arginine methyl ester caused constriction of arteries that was not different with the different plasmas nor was dilation to the NO donor sodium nitroprusside different between the 2 groups. However, dilation to the small- and intermediate-conductance, calcium-activated potassium channel activator NS309 was decreased in vessels exposed to HELLP plasma. Thus, increased BBB permeability in response to HELLP plasma was associated with selective endothelial dysfunction.

  12. Iron Sulfide as a Sustainable Reactive Material for Permeable Reactive Barriers

    NASA Astrophysics Data System (ADS)

    Henderson, A. D.; Demond, A. H.


    Permeable reactive barriers (PRBs) are gaining acceptance for groundwater remediation, as they operate in situ and do not require continuous energy input. The majority of PRBs use zero-valent iron (ZVI). However, some ZVI PRBs have hydraulically failed [1,2], due to the fact that ZVI may reduce not only contaminants but also water and non-contaminant solutes. These reactions may form precipitates or gas phases that reduce permeability. Therefore, there is a need to assess the hydraulic suitability of possible alternatives, such as iron sulfide (FeS). The capability of FeS to remove both metals and halogenated organics from aqueous systems has been demonstrated previously [3,4], and FeS formed in situ within a ZVI PRB has been linked to contaminant removal [5]. These results suggest possible applications in groundwater remediation as a permeable reactive barrier (PRB) material. However, the propensity of FeS for permeability loss, due to solids and gas production, must be evaluated in order to address its suitability for PRBs. The reduction in permeability for FeS-coated sands under the anoxic conditions often encountered at contaminated groundwater sites was examined through column experiments and geochemical modeling under conditions of high calcium and nitrate, which have been previously shown to cause significant permeability reduction in zero-valent iron (ZVI) systems [6]. The column experiments showed negligible production of both solids and gases. The geochemical model was used to estimate solid and gas volumes generated under conditions of varying FeS concentration. Then, the Kozeny-Carman equation and a power-law relationship was used to predict permeability reduction, with a maximum reduction in permeability of 1% due to solids and about 30% due to gas formation under conditions for which a complete loss of permeability was predicted for ZVI systems. This difference in permeability reduction is driven by the differences in thermodynamic stability of ZVI

  13. MicroRNA-143 inhibits IL-13-induced dysregulation of the epidermal barrier-related proteins in skin keratinocytes via targeting to IL-13Rα1.


    Zeng, Yue-Ping; Nguyen, Giang Huong; Jin, Hong-Zhong


    Atopic dermatitis is a chronic inflammatory skin disease characterized by the dysregulation of the epidermal barrier and the immune system. Interleukin (IL)-13, a key T helper 2 cytokine, has been shown to impair the epidermal barrier function via downregulating epidermal barrier proteins. MicroRNAs are small noncoding RNAs of approximately 22 nucleotides that act as negative regulators of gene expression at posttranscriptional levels. MicroRNA-143 is known to be a tumor suppressor in various tumors; however, its role in the regulation of allergic diseases including atopic dermatitis remains elusive. In this study, we investigated whether IL-13Rα1 was a microRNA-143 target to regulate the effects of IL-13 on epidermal barrier function. After the stimulation of IL-13 in human epidermal keratinocytes, the level of microRNA-143 was decreased. The luciferase activity of the vector containing 3'UTR of IL-13Rα1 was decreased in keratinocytes transfected with microRNA-143 mimic compared to those of the corresponding controls. The forced expression of microRNA-143 mimic blocked the IL-13-induced downregulation of filaggrin, loricrin, and involucrin in epidermal keratinocytes. Collectively, these data suggest that microRNA-143 suppresses IL-13 activity and inflammation through targeting of IL-13Rα1 in epidermal keratinocytes. MicroRNA-143 may serve as a potential preventive and therapeutic target in atopic dermatitis.

  14. Permeable bio-reactive barriers to address petroleum hydrocarbon contamination at subantarctic Macquarie Island.


    Freidman, Benjamin L; Terry, Deborah; Wilkins, Dan; Spedding, Tim; Gras, Sally L; Snape, Ian; Stevens, Geoffrey W; Mumford, Kathryn A


    A reliance on diesel generated power and a history of imperfect fuel management have created a legacy of petroleum hydrocarbon contamination at subantarctic Macquarie Island. Increasing environmental awareness and advances in contaminant characterisation and remediation technology have fostered an impetus to reduce the environmental risk associated with legacy sites. A funnel and gate permeable bio-reactive barrier (PRB) was installed in 2014 to address the migration of Special Antarctic Blend diesel from a spill that occurred in 2002, as well as older spills and residual contaminants in the soil at the Main Power House. The PRB gate comprised of granular activated carbon and natural clinoptilolite zeolite. Petroleum hydrocarbons migrating in the soil water were successfully captured on the reactive materials, with concentrations at the outflow of the barrier recorded as being below reporting limits. The nutrient and iron concentrations delivered to the barrier demonstrated high temporal variability with significant iron precipitation observed across the bed. The surface of the granular activated carbon was largely free from cell attachment while natural zeolite demonstrated patchy biofilm formation after 15 months following PRB installation. This study illustrates the importance of informed material selection at field scale to ensure that adsorption and biodegradation processes are utilised to manage the environmental risk associated with petroleum hydrocarbon spills. This study reports the first installation of a permeable bio-reactive barrier in the subantarctic.

  15. Role of lipids in the formation and maintenance of the cutaneous permeability barrier.


    Feingold, Kenneth R; Elias, Peter M


    The major function of the skin is to form a barrier between the internal milieu and the hostile external environment. A permeability barrier that prevents the loss of water and electrolytes is essential for life on land. The permeability barrier is mediated primarily by lipid enriched lamellar membranes that are localized to the extracellular spaces of the stratum corneum. These lipid enriched membranes have a unique structure and contain approximately 50% ceramides, 25% cholesterol, and 15% free fatty acids with very little phospholipid. Lamellar bodies, which are formed during the differentiation of keratinocytes, play a key role in delivering the lipids from the stratum granulosum cells into the extracellular spaces of the stratum corneum. Lamellar bodies contain predominantly glucosylceramides, phospholipids, and cholesterol and following the exocytosis of lamellar lipids into the extracellular space of the stratum corneum these precursor lipids are converted by beta glucocerebrosidase and phospholipases into the ceramides and fatty acids, which comprise the lamellar membranes. The lipids required for lamellar body formation are derived from de novo synthesis by keratinocytes and from extra-cutaneous sources. The lipid synthetic pathways and the regulation of these pathways are described in this review. In addition, the pathways for the uptake of extra-cutaneous lipids into keratinocytes are discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias.

  16. Organo-montmorillonite Barrier Layers Formed by Combustion: Nanostructure and Permeability

    SciTech Connect

    Fox, James B; Ambuken, Preejith V.; Stretz, Holly A; Meisner, Roberta Ann; Payzant, E Andrew


    Self-assembly of nanoparticles into barrier layers has been the most cited theoretical explanation for the significant reduction in flammability often noted for nanocomposites formed from polymers and montmorillonite organoclays. Both mass and heat transport reductions have been credited for such improvements, and in most cases a coupled mechanism is expected. To provide validation for early models, new model barrier layers were produced from organoclays, and these barrier layers subjected to novel permeability analysis to obtain a flux. The effects of surfactant, temperature and pressure on barrier layer structure were examined. XRD versus TGA results suggest that chemical degradation of four different organoclays and physical collapse on heating are not correlated. Addition of pressure as low as 7kPa also altered the structure produced. Permeability of Ar through the ash was found to be sensitive to structural change/self assembly of high aspect ratio MMT nanoparticles. Actual fluxes ranged from 0.139 to 0.151 mol(m2.sec)-1, values which will provide useful limits in verifying models for the coupled contribution of mass and heat transfer to flammability parameters such as peak heat release rate.


    EPA Science Inventory

    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating groundwater contamination that combine subsurface fluid flow management with a passive chemical treatment zone. The few pilot and commercial installations which have been implemented...

  18. Effect of some drugs on ethanol-induced changes in blood brain barrier permeability for /sup 14/C-tyrosine

    SciTech Connect

    Borisenko, S.A.; Burov, Yu.V.


    This investigation seeks to compare the effects of membrane stabilizers chlorpromazine and alpha-tocopherol, and also the dopaminergic antagonist haloperidol, in changes in permeability of the blood-brain barrier for carbon 14-labelled tyrosine.

  19. Interim Report: Field Demonstration Of Permeable Reactive Barriers To Remove Dissolved Uranium From Groundwater, Fry Canyon, Utah

    EPA Pesticide Factsheets

    The Fry Canyon site in southeastern Utah was selected in 1996 as a long-term field demonstration site to assess the performance of selected permeable reactive barriers for the removal of uranium (U) from groundwater.

  20. Long-Term Groundwater Monitoring Optimization, Clare Water Supply Superfund Site, Permeable Reactive Barrier and Soil Remedy Areas, Clare, Michigan

    EPA Pesticide Factsheets

    This report contains a review of the long-term groundwater monitoring network for the Permeable Reactive Barrier (PRB) and Soil Remedy Areas at the Clare Water Supply Superfund Site in Clare, Michigan.


    EPA Science Inventory

    Permeable reactive barriers (PRB's) are an emerging, alternative in-situ approach for remediating contaminated groundwater that combine subsurface fluid flow management with a passive chemical treatment zone. PRB's are a potentially more cost effective treatment option at seve...


    EPA Science Inventory

    Permeable reactive barrier technology is an in-situ approach for remediating groundwater contamination that combines subsurface fluid flow management with passive chemical treatment. Factors such as the buildup of mineral precipitates, buildup of microbial biomass (bio-fouling...

  3. Standardized diaper care regimen: a prospective, randomized pilot study on skin barrier function and epidermal IL-1α in newborns.


    Garcia Bartels, Natalie; Massoudy, Lida; Scheufele, Ramona; Dietz, Ekkehart; Proquitté, Hans; Wauer, Roland; Bertin, Christiane; Serrano, José; Blume-Peytavi, Ulrike


    Adaptation of skin barrier function and interleukin-1α (IL-1α) content in diapered and nondiapered skin are poorly characterized in newborns receiving standard skin care. In a monocentric, prospective pilot study 44 healthy, full-term neonates were randomly assigned to skin care with baby wipes (n = 21) or water-moistened washcloth (n = 23) at each diaper change. Transepidermal water loss (TEWL), skin hydration, skin-pH, IL-1α, and epidermal desquamation were measured on days 2, 14, and 28 postpartum. Microbiological colonization was evaluated at baseline and on day 28. Significantly lower TEWL was found on the buttock in the group using baby wipes compared to water. IL-1α and skin hydration significantly increased and pH decreased independent of skin care regimen. IL-1α was significantly higher in diapered skin compared to nondiapered skin. Although skin care with wipes seems to stabilize TEWL better than using water, the skin condition and microbiological colonization were comparable using both cleansing procedures. Increase of epidermal IL-1α may reflect postnatal skin barrier maturation. These data suggest that neither of the two cleansing procedures harms skin barrier maturation within the first four weeks postpartum. Longer observations on larger populations could provide more insight into postnatal skin barrier maturation.

  4. A Synthetic Peptide Corresponding to the Extracellular Domain of Occludin Perturbs the Tight Junction Permeability Barrier

    PubMed Central

    Wong, Vivian; Gumbiner, Barry M.


    Occludin, the putative tight junction integral membrane protein, is an attractive candidate for a protein that forms the actual sealing element of the tight junction. To study the role of occludin in the formation of the tight junction seal, synthetic peptides (OCC1 and OCC2) corresponding to the two putative extracellular domains of occludin were assayed for their ability to alter tight junctions in Xenopus kidney epithelial cell line A6. Transepithelial electrical resistance and paracellular tracer flux measurements indicated that the second extracellular domain peptide (OCC2) reversibly disrupted the transepithelial permeability barrier at concentrations of < 5 μM. Despite the increased paracellular permeability, there were no changes in gross epithelial cell morphology as determined by scanning EM. The OCC2 peptide decreased the amount of occludin present at the tight junction, as assessed by indirect immunofluorescence, as well as decreased total cellular content of occludin, as assessed by Western blot analysis. Pulse-labeling and metabolic chase analysis suggested that this decrease in occludin level could be attributed to an increase in turnover of cellular occludin rather than a decrease in occludin synthesis. The effect on occludin was specific because other tight junction components, ZO-1, ZO-2, cingulin, and the adherens junction protein E-cadherin, were unaltered by OCC2 treatment. Therefore, the peptide corresponding to the second extracellular domain of occludin perturbs the tight junction permeability barrier in a very specific manner. The correlation between a decrease in occludin levels and the perturbation of the tight junction permeability barrier provides evidence for a role of occludin in the formation of the tight junction seal. PMID:9015310

  5. Washing of Pb contaminated soil using [S,S] ethylenediamine disuccinate and horizontal permeable barriers.


    Finzgar, N; Kos, B; Lestan, D


    The feasibility of in situ washing of soil contaminated with Pb (6.83 mmol kg(-1)) using biodegradable chelator, [S,S] stereoisomere of ethylenediamine disuccinate ([S,S]-EDDS) and horizontal permeable barriers was examined in soil columns. After 4-cycles of 10 mmol kg(-1) soil [S,S]-EDDS applications, followed by irrigation, 24.7% of total initial Pb was washed from the contaminated soil and accumulated into the barrier. Sequential extractions indicated that washing removed most of the Pb from the organic soil fraction. Barriers were positioned 20 cm deep in the soil and consisted of a 2 cm layer of nutrient enriched vermiculite. Barriers reduced leaching of Pb in the first cycle of [S,S]-EDDS addition by more than 500-times compared to columns with no barrier. After four cycles of chelator addition, a total of 0.24% of the initial Pb was leached from the columns with barriers. Four cycles of in situ soil washing in soil columns were less effective than simulated ex situ soil washing with 40 mmol kg(-1) [S,S]-EDDS, where 51.0% of the Pb was removed after 48-h extraction. Ex situ soil washing with 10 mmol kg(-1) [S,S]-EDDS was equally effective as the first cycle of in situ soil washing (15.5% and 14.5% of removed Pb, respectively).

  6. Heterogeneous Blood-Tumor Barrier Permeability Determines Drug Efficacy in Experimental Brain Metastases of Breast Cancer

    PubMed Central

    Lockman, Paul R.; Mittapalli, Rajendar K.; Taskar, Kunal S.; Rudraraju, Vinay; Gril, Brunilde; Bohn, Kaci A.; Adkins, Chris E.; Roberts, Amanda; Thorsheim, Helen R.; Gaasch, Julie A.; Huang, Suyun; Palmieri, Diane; Steeg, Patricia S.; Smith, Quentin R.


    Purpose Brain metastases of breast cancer appear to be increasing in incidence, confer significant morbidity, and threaten to compromise gains made in systemic chemotherapy. The blood-tumor barrier (BTB) is compromised in many brain metastases, however, the extent to which this influences chemotherapeutic delivery and efficacy is unknown. Herein, we answer this question by measuring BTB passive integrity, chemotherapeutic drug uptake, and anticancer efficacy in vivo in two breast cancer models that metastasize preferentially to brain. Experimental Design Experimental brain metastasis drug uptake and BTB permeability were simultaneously measured using novel fluorescent and phosphorescent imaging techniques in immune compromised mice. Drug-induced apoptosis and vascular characteristics were assessed using immunofluorescent microscopy. Results Analysis of >2000 brain metastases from two models (human 231-BR-Her2 and murine 4T1-BR5) demonstrated partial BTB permeability compromise in >89% lesions, varying in magnitude within and between metastases. Brain metastasis uptake of 14C- paclitaxel and 14C- doxorubicin was generally greater than normal brain but <15% of that of other tissues or peripheral metastases, and only reached cytotoxic concentrations in a small subset (~10%) of the most permeable metastases. Neither drug significantly decreased the experimental brain metastatic ability of 231-BR-Her2 tumor cells. BTB permeability was associated with vascular remodeling and correlated with over expression of the pericyte protein, desmin. Conclusions This work demonstrates that the BTB remains a significant impediment to standard chemotherapeutic delivery and efficacy in experimental brain metastases of breast cancer. New brain permeable drugs will be needed. Evidence is presented for vascular remodeling in BTB permeability alterations. PMID:20829328

  7. Stress Induces Endotoxemia and Low-Grade Inflammation by Increasing Barrier Permeability

    PubMed Central

    de Punder, Karin; Pruimboom, Leo


    Chronic non-communicable diseases (NCDs) are the leading causes of work absence, disability, and mortality worldwide. Most of these diseases are associated with low-grade inflammation. Here, we hypothesize that stresses (defined as homeostatic disturbances) can induce low-grade inflammation by increasing the availability of water, sodium, and energy-rich substances to meet the increased metabolic demand induced by the stressor. One way of triggering low-grade inflammation is by increasing intestinal barrier permeability through activation of various components of the stress system. Although beneficial to meet the demands necessary during stress, increased intestinal barrier permeability also raises the possibility of the translocation of bacteria and their toxins across the intestinal lumen into the blood circulation. In combination with modern life-style factors, the increase in bacteria/bacterial toxin translocation arising from a more permeable intestinal wall causes a low-grade inflammatory state. We support this hypothesis with numerous studies finding associations with NCDs and markers of endotoxemia, suggesting that this process plays a pivotal and perhaps even a causal role in the development of low-grade inflammation and its related diseases. PMID:26029209

  8. Computational prediction of blood-brain barrier permeability using decision tree induction.


    Suenderhauf, Claudia; Hammann, Felix; Huwyler, Jörg


    Predicting blood-brain barrier (BBB) permeability is essential to drug development, as a molecule cannot exhibit pharmacological activity within the brain parenchyma without first transiting this barrier. Understanding the process of permeation, however, is complicated by a combination of both limited passive diffusion and active transport. Our aim here was to establish predictive models for BBB drug permeation that include both active and passive transport. A database of 153 compounds was compiled using in vivo surface permeability product (logPS) values in rats as a quantitative parameter for BBB permeability. The open source Chemical Development Kit (CDK) was used to calculate physico-chemical properties and descriptors. Predictive computational models were implemented by machine learning paradigms (decision tree induction) on both descriptor sets. Models with a corrected classification rate (CCR) of 90% were established. Mechanistic insight into BBB transport was provided by an Ant Colony Optimization (ACO)-based binary classifier analysis to identify the most predictive chemical substructures. Decision trees revealed descriptors of lipophilicity (aLogP) and charge (polar surface area), which were also previously described in models of passive diffusion. However, measures of molecular geometry and connectivity were found to be related to an active drug transport component.

  9. The Effect of Ovariectomy and Estrogen on Penetrating Brain Arterioles and Blood-brain Barrier Permeability

    PubMed Central

    Cipolla, Marilyn J.; Godfrey, Julie A.; Wiegman, Marchien J.


    Objective We investigated the effect of estrogen replacement on the structure and function of penetrating brain arterioles (PA) and blood-brain barrier (BBB) permeability. Methods Female ovariectomized Sprague Dawley rats were replaced with estradiol (E2) and estriol (E3) (OVX+E; N=13) and compared to ovariectomized animals without replacement (OVX; N=14) and intact controls (CTL, proestrous; N=13). Passive and active diameters, percent tone and passive distensibility of pressurized PA were compared. In addition, BBB permeability to Lucifer Yellow, a marker of transcellular transport, was compared in cerebral arteries. Results Ovariectomy increased myogenic tone in PA compared to CTL that was not ameliorated by estrogen treatment. Percent tone at 75 mmHg for CTL vs. OVX and OVX+E was 44 ± 3% vs. 51 ± 1% and 54 ± 3% (p<0.01 vs. CTL for both). No differences were found in passive diameters or distensibility between the groups. BBB permeability increased 500% in OVX vs. CTL animals, however, estrogen replacement restored barrier properties: flux of Lucifer Yellow for CTL, OVX and OVX+E was (ng/mL): 3.4 ± 1.2, 20.2 ± 5.3 (p<0.01 vs. CTL) and 6.15 ± 1.2 (n.s.). Conclusions These results suggest that estrogen replacement may not be beneficial for small vessel disease in the brain, but may limit BBB disruption and edema under conditions that cause it. PMID:19905968

  10. von-Willebrand factor influences blood brain barrier permeability and brain inflammation in experimental allergic encephalomyelitis.


    Noubade, Rajkumar; del Rio, Roxana; McElvany, Benjamin; Zachary, James F; Millward, Jason M; Wagner, Denisa D; Offner, Halina; Blankenhorn, Elizabeth P; Teuscher, Cory


    Weibel-Palade bodies within endothelial cells are secretory granules known to release von Willebrand Factor (VWF), P-selectin, chemokines, and other stored molecules following histamine exposure. Mice with a disrupted VWF gene (VWFKO) have endothelial cells that are deficient in Weibel-Palade bodies. These mice were used to evaluate the role of VWF and/or Weibel-Palade bodies in Bordetella pertussis toxin-induced hypersensitivity to histamine, a subphenotype of experimental allergic encephalomyelitis, the principal autoimmune model of multiple sclerosis. No significant differences in susceptibility to histamine between wild-type and VWFKO mice were detected after 3 days; however, histamine sensitivity persisted significantly longer in VWFKO mice. Correspondingly, encephalomyelitis onset was earlier, disease was more severe, and blood brain barrier (BBB) permeability was significantly increased in VWFKO mice, as compared with wild-type mice. Moreover, inflammation was selectively increased in the brains, but not spinal cords, of VWFKO mice as compared with wild-type mice. Early increases in BBB permeability in VWFKO mice were not due to increased encephalitogenic T-cell activity since BBB permeability did not differ in adjuvant-treated VWFKO mice as compared with littermates immunized with encephalitogenic peptide plus adjuvant. Taken together, these data indicate that VWF and/or Weibel-Palade bodies negatively regulate BBB permeability changes and autoimmune inflammatory lesion formation within the brain elicited by peripheral inflammatory stimuli.

  11. The food contaminant deoxynivalenol, decreases intestinal barrier permeability and reduces claudin expression

    SciTech Connect

    Pinton, Philippe; Nougayrede, Jean-Philippe; Del Rio, Juan-Carlos; Moreno, Carolina; Marin, Daniela E.; Ferrier, Laurent; Bracarense, Ana-Paula; Kolf-Clauw, Martine; Oswald, Isabelle P.


    'The gastrointestinal tract represents the first barrier against food contaminants as well as the first target for these toxicants. Deoxynivalenol (DON) is a mycotoxin that commonly contaminates cereals and causes various toxicological effects. Through consumption of contaminated cereals and cereal products, human and pigs are exposed to this mycotoxin. Using in vitro, ex vivo and in vivo approaches, we investigated the effects of DON on the intestinal epithelium. We demonstrated that, in intestinal epithelial cell lines from porcine (IPEC-1) or human (Caco-2) origin, DON decreases trans-epithelial electrical resistance (TEER) and increases in a time and dose-dependent manner the paracellular permeability to 4 kDa dextran and to pathogenic Escherichia coli across intestinal cell monolayers. In pig explants treated with DON, we also observed an increased permeability of intestinal tissue. These alterations of barrier function were associated with a specific reduction in the expression of claudins, which was also seen in vivo in the jejunum of piglets exposed to DON-contaminated feed. In conclusion, DON alters claudin expression and decreases the barrier function of the intestinal epithelium. Considering that high levels of DON may be present in food or feed, consumption of DON-contaminated food/feed may induce intestinal damage and has consequences for human and animal health.

  12. Breaking down the barriers: the gut microbiome, intestinal permeability and stress-related psychiatric disorders.


    Kelly, John R; Kennedy, Paul J; Cryan, John F; Dinan, Timothy G; Clarke, Gerard; Hyland, Niall P


    The emerging links between our gut microbiome and the central nervous system (CNS) are regarded as a paradigm shift in neuroscience with possible implications for not only understanding the pathophysiology of stress-related psychiatric disorders, but also their treatment. Thus the gut microbiome and its influence on host barrier function is positioned to be a critical node within the brain-gut axis. Mounting preclinical evidence broadly suggests that the gut microbiota can modulate brain development, function and behavior by immune, endocrine and neural pathways of the brain-gut-microbiota axis. Detailed mechanistic insights explaining these specific interactions are currently underdeveloped. However, the concept that a "leaky gut" may facilitate communication between the microbiota and these key signaling pathways has gained traction. Deficits in intestinal permeability may underpin the chronic low-grade inflammation observed in disorders such as depression and the gut microbiome plays a critical role in regulating intestinal permeability. In this review we will discuss the possible role played by the gut microbiota in maintaining intestinal barrier function and the CNS consequences when it becomes disrupted. We will draw on both clinical and preclinical evidence to support this concept as well as the key features of the gut microbiota which are necessary for normal intestinal barrier function.

  13. Breaking down the barriers: the gut microbiome, intestinal permeability and stress-related psychiatric disorders

    PubMed Central

    Kelly, John R.; Kennedy, Paul J.; Cryan, John F.; Dinan, Timothy G.; Clarke, Gerard; Hyland, Niall P.


    The emerging links between our gut microbiome and the central nervous system (CNS) are regarded as a paradigm shift in neuroscience with possible implications for not only understanding the pathophysiology of stress-related psychiatric disorders, but also their treatment. Thus the gut microbiome and its influence on host barrier function is positioned to be a critical node within the brain-gut axis. Mounting preclinical evidence broadly suggests that the gut microbiota can modulate brain development, function and behavior by immune, endocrine and neural pathways of the brain-gut-microbiota axis. Detailed mechanistic insights explaining these specific interactions are currently underdeveloped. However, the concept that a “leaky gut” may facilitate communication between the microbiota and these key signaling pathways has gained traction. Deficits in intestinal permeability may underpin the chronic low-grade inflammation observed in disorders such as depression and the gut microbiome plays a critical role in regulating intestinal permeability. In this review we will discuss the possible role played by the gut microbiota in maintaining intestinal barrier function and the CNS consequences when it becomes disrupted. We will draw on both clinical and preclinical evidence to support this concept as well as the key features of the gut microbiota which are necessary for normal intestinal barrier function. PMID:26528128

  14. A look at epidermal barrier function in atopic dermatitis: physiologic lipid replacement and the role of ceramides.


    Sajić, D; Asiniwasis, R; Skotnicki-Grant, S


    This review summarizes and discusses the role and efficacy of moisturizers, particularly the more recently introduced ceramide-based formulations, in the skin care regimen of patients with both active and quiescent atopic dermatitis (AD). It is now well established that a complex interplay of environmental and genetic factors are responsible for disease onset and chronicity. Indeed, several novel genetic mechanisms have been recently discovered to be associated with AD pathogenesis. Moreover, it is increasingly recognized that the epidermal barrier plays a critical role in the initiation, perpetuation, and exacerbation of AD. The skin of patients with AD harbors several defects in epidermal barrier function, including filaggrin and ceramides. An improved understanding of these etiopathogenic factors has led to the development of topical ceramide-dominant moisturizers to replace the deficient molecules and re-establish the integrity of barrier defenses. Some of these products have demonstrated efficacy in the treatment of adult and childhood AD that are similar to mid-potency topical steroids. More importantly, they have been shown to be safe with very few associated side-effects. We recommend the addition of such new agents as both the first step of treatment and in the maintenance of clinically quiescent skin of patients with AD.

  15. Emerging Roles for Anionic Non-Bilayer Phospholipids in Fortifying the Outer Membrane Permeability Barrier

    PubMed Central


    Lately, researchers have been actively investigating Escherichia coli lptD mutants, which exhibit reduced transport of lipopolysaccharide to the cell surface. In this issue of the Journal of Bacteriology, Sutterlin et al. (H. A. Sutterlin, S. Zhang, and T. J. Silhavy, J. Bacteriol. 196:3214–3220, 2014) now reveal an important functional role for phosphatidic acid in fortifying the outer membrane permeability barrier in certain lptD mutant backgrounds. These findings come on the heels of the first reports of two LptD crystal structures, which now provide a structural framework for interpreting lptD genetics. PMID:25022852

  16. Long-Term Blood-Brain Barrier Permeability Changes in Binswanger’s Disease

    PubMed Central

    Huisa, Branko N; Caprihan, Arvind; Thompson, Jeffrey; Prestopnik, Jillian; Qualls, Clifford R; Rosenberg, Gary A


    Background and Purpose The blood brain-barrier (BBB) is disrupted in small vessel disease (SVD) patients with lacunes and white matter hyperintensities (WMHs). The relationship of WMHs and regional BBB permeability changes has not been studied. We hypothesized that BBB disruption occurs in normal appearing WM (NAWM) and regions near the WMHs. To test the hypothesis, we repeated BBB permeability measurements in patients with extensive WMHs related to Binswanger’s disease (BD). Methods We selected a subset of 22 BD subjects from a well-characterized larger prospective vascular cognitive impairment cohort. We used 16 age-matched controls for comparison. The abnormal WM permeability (WMP) was measured twice over several years using dynamic contrast-enhanced MRI (DCEMRI). WMP maps were constructed from voxels above a predetermined threshold. Scans from first and second visits were co-registered. WM was divided into 3 regions: NAWM, WMH ring and WMH core. The ring was defined as 2mm on each side of the WMH border. WMP was calculated in each of the three specific regions. We used paired t-test, ANOVA and Fisher’s exact test to compare individual changes. Results WMP was significantly higher in subjects than controls (p<0.001). There was no correlation between WMH load and WMP. High permeability regions had minimal overlap between first and second scans. Nine percent of WMP was within the WMHs, 49% within the NAWM, and 52% within the WMH ring (p<0.001; ANOVA). Conclusions Increased BBB permeability in NAWM and close to the WMH borders supports a relationship between BBB disruption and development of WMHs. PMID:26205374

  17. Adenosine receptor signaling modulates permeability of the blood-brain barrier.


    Carman, Aaron J; Mills, Jeffrey H; Krenz, Antje; Kim, Do-Geun; Bynoe, Margaret S


    The blood-brain barrier (BBB) is comprised of specialized endothelial cells that form the capillary microvasculature of the CNS and is essential for brain function. It also poses the greatest impediment in the treatment of many CNS diseases because it commonly blocks entry of therapeutic compounds. Here we report that adenosine receptor (AR) signaling modulates BBB permeability in vivo. A(1) and A(2A) AR activation facilitated the entry of intravenously administered macromolecules, including large dextrans and antibodies to β-amyloid, into murine brains. Additionally, treatment with an FDA-approved selective A(2A) agonist, Lexiscan, also increased BBB permeability in murine models. These changes in BBB permeability are dose-dependent and temporally discrete. Transgenic mice lacking A(1) or A(2A) ARs showed diminished dextran entry into the brain after AR agonism. Following treatment with a broad-spectrum AR agonist, intravenously administered anti-β-amyloid antibody was observed to enter the CNS and bind β-amyloid plaques in a transgenic mouse model of Alzheimer's disease (AD). Selective AR activation resulted in cellular changes in vitro including decreased transendothelial electrical resistance, increased actinomyosin stress fiber formation, and alterations in tight junction molecules. These results suggest that AR signaling can be used to modulate BBB permeability in vivo to facilitate the entry of potentially therapeutic compounds into the CNS. AR signaling at brain endothelial cells represents a novel endogenous mechanism of modulating BBB permeability. We anticipate these results will aid in drug design, drug delivery and treatment options for neurological diseases such as AD, Parkinson's disease, multiple sclerosis and cancers of the CNS.

  18. Iontophoresis and sonophoresis stimulate epidermal cytokine expression at energies that do not provoke a barrier abnormality: lamellar body secretion and cytokine expression are linked to altered epidermal calcium levels.


    Choi, Eung Ho; Kim, Min Jung; Yeh, Byung-Il; Ahn, Sung Ku; Lee, Seung Hun


    We performed this study to identify whether the expression of epidermal cytokines is altered by changes in epidermal calcium content, independent of skin barrier disruption. Iontophoresis and sonophoresis with the energies that do not disrupt the skin barrier, but induce changes in the epidermal calcium gradient, were applied to the skin of hairless mice. Immediately after iontophoresis and sonophoresis, immersion in a solution containing calcium was carried out, and iontophoresis in either high- or low-calcium solutions was performed. The biopsy specimens were taken for real-time quantitative RT-PCR to detect changes in mRNA level of interleukin-1alpha (IL-1alpha), tumor necrosis factor-alpha (TNF-alpha), and transforming growth factor-beta in the epidermis and for immunohistochemical stain with primary antibodies to IL-1alpha and TNF-alpha. The expression of each cytokine mRNA increased in the epidermis treated with iontophoresis and sonophoresis compared to a nontreated control as well as in tape-stripped skin used as a positive control and was lower after immersion in a high-calcium solution than in low-calcium solution. IL-1alpha and TNF-alpha immunohistochemical protein staining increased with iontophoresis at low calcium. These studies suggest that changes in epidermal calcium can directly signal expression of epidermal cytokines in vivo, independent of changes in barrier function.

  19. Heavy metals removal and hydraulic performance in zero-valent iron/pumice permeable reactive barriers.


    Moraci, Nicola; Calabrò, Paolo S


    Long-term behaviour is a major issue related to the use of zero-valent iron (ZVI) in permeable reactive barriers for groundwater remediation; in fact, in several published cases the hydraulic conductivity and removal efficiency were progressively reduced during operation, potentially compromising the functionality of the barrier. To solve this problem, the use of granular mixtures of ZVI and natural pumice has recently been proposed. This paper reports the results of column tests using aqueous nickel and copper solutions of various concentrations. Three configurations of reactive material (ZVI only, granular mixture of ZVI and pumice, and pumice and ZVI in series) are discussed. The results clearly demonstrate that iron-pumice granular mixtures perform well both in terms of contaminant removal and in maintaining the long-term hydraulic conductivity. Comparison with previous reports concerning copper removal by ZVI/sand mixtures reveals higher performance in the case of ZVI/pumice.

  20. Matriptase/MT-SP1 is required for postnatal survival, epidermal barrier function, hair follicle development, and thymic homeostasis.


    List, Karin; Haudenschild, Christian C; Szabo, Roman; Chen, WanJun; Wahl, Sharon M; Swaim, William; Engelholm, Lars H; Behrendt, Niels; Bugge, Thomas H


    Matriptase/MT-SP1 is a novel tumor-associated type II transmembrane serine protease that is highly expressed in the epidermis, thymic stroma, and other epithelia. A null mutation was introduced into the Matriptase/MT-SP1 gene of mice to determine the role of Matriptase/MT-SP1 in epidermal development and neoplasia. Matriptase/MT-SP1-deficient mice developed to term but uniformly died within 48 h of birth. All epidermal surfaces of newborn mice were grossly abnormal with a dry, red, shiny, and wrinkled appearance. Matriptase/MT-SP1-deficiency caused striking malformations of the stratum corneum, characterized by dysmorphic and pleomorphic corneocytes and the absence of vesicular bodies in transitional layer cells. This aberrant skin development seriously compromised both inward and outward epidermal barrier function, leading to the rapid and fatal dehydration of Matriptase/MT-SP1-deficient pups. Loss of Matriptase/MT-SP1 also seriously affected hair follicle development resulting in generalized follicular hypoplasia, absence of erupted vibrissae, lack of vibrissal hair canal formation, ingrown vibrissae, and wholesale abortion of vibrissal follicles. Furthermore, Matriptase/MT-SP1-deficiency resulted in dramatically increased thymocyte apoptosis, and depletion of thymocytes. This study demonstrates that Matriptase/MT-SP1 has pleiotropic functions in the development of the epidermis, hair follicles, and cellular immune system.

  1. Qualitative prediction of blood-brain barrier permeability on a large and refined dataset

    NASA Astrophysics Data System (ADS)

    Muehlbacher, Markus; Spitzer, Gudrun M.; Liedl, Klaus R.; Kornhuber, Johannes


    The prediction of blood-brain barrier permeation is vitally important for the optimization of drugs targeting the central nervous system as well as for avoiding side effects of peripheral drugs. Following a previously proposed model on blood-brain barrier penetration, we calculated the cross-sectional area perpendicular to the amphiphilic axis. We obtained a high correlation between calculated and experimental cross-sectional area (r = 0.898, n = 32). Based on these results, we examined a correlation of the calculated cross-sectional area with blood-brain barrier penetration given by logBB values. We combined various literature data sets to form a large-scale logBB dataset with 362 experimental logBB values. Quantitative models were calculated using bootstrap validated multiple linear regression. Qualitative models were built by a bootstrapped random forest algorithm. Both methods found similar descriptors such as polar surface area, pKa, log P, charges and number of positive ionisable groups to be predictive for logBB. In contrast to our initial assumption, we were not able to obtain models with the cross-sectional area chosen as relevant parameter for both approaches. Comparing those two different techniques, qualitative random forest models are better suited for blood-brain barrier permeability prediction, especially when reducing the number of descriptors and using a large dataset. A random forest prediction system (ntrees = 5) based on only four descriptors yields a validated accuracy of 88%.

  2. Influence of silver and titanium dioxide nanoparticles on in vitro blood-brain barrier permeability.


    Chen, I-Chieh; Hsiao, I-Lun; Lin, Ho-Chen; Wu, Chien-Hou; Chuang, Chun-Yu; Huang, Yuh-Jeen


    An in vitro blood-brain barrier (BBB) model being composed of co-culture with endothelial (bEnd.3) and astrocyte-like (ALT) cells was established to evaluate the toxicity and permeability of Ag nanoparticles (AgNPs; 8nm) and TiO2 nanoparticles (TiO2NPs; 6nm and 35nm) in normal and inflammatory central nervous system. Lipopolysaccharide (LPS) was pre-treated to simulate the inflammatory responses. Both AgNPs and Ag ions can decrease transendothelial electrical resistance (TEER) value, and cause discontinuous tight junction proteins (claudin-5 and zonula occludens-1) of BBB. However, only the Ag ions induced inflammatory cytokines to release, and had less cell-to-cell permeability than AgNPs, which indicated that the toxicity of AgNPs was distinct from Ag ions. LPS itself disrupted BBB, while co-treatment with AgNPs and LPS dramatically enhanced the disruption and permeability coefficient. On the other hand, TiO2NPs exposure increased BBB penetration by size, and disrupted tight junction proteins without size dependence, and many of TiO2NPs accumulated in the endothelial cells were observed. This study provided the new insight of toxic potency of AgNPs and TiO2NPs in BBB.

  3. Gyroxin increases blood-brain barrier permeability to Evans blue dye in mice.


    Alves da Silva, J A; Oliveira, K C; Camillo, M A P


    Gyroxin is a serine protease enzyme component of the South American rattlesnake (Crotalus durissus terrificus) venom. This toxin displays several activities, including the induction of blood coagulation (fibrinogenolytic activity), vasodilation and neurotoxicity, resulting in an effect called barrel rotation. The mechanisms involved in this neurotoxic activity are not well known. Because gyroxin is a member of a potentially therapeutic family of enzymes, including thrombin, ancrod, batroxobin, trypsin and kallicrein, the identification of the mechanism of gyroxin's action is extremely important. In this study, gyroxin was isolated from crude venom by affinity and molecular exclusion chromatography. Analysis of the isolated gyroxin via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) revealed a single protein band with a molecular weight of approximately 28 kDa, confirming the identity of the molecule. Furthermore, intravenous administration of purified gyroxin (0.25 μg/g of body weight) to mice resulted in symptoms compatible with barrel rotation syndrome, confirming the neurotoxic activity of the toxin. Mice treated with gyroxin showed an increase in the concentration of albumin-Evans blue in brain extracts, indicating an increase in the blood-brain barrier (BBB) permeability. This gyroxin-induced increase in BBB permeability was time-dependent, reaching a peak within 15 min after exposure, similar to the time span in which the neurotoxic syndrome (barrel rotation) occurs. This work provides the first evidence of gyroxin's capacity to temporarily alter the permeability of the BBB.

  4. Aging and sex influence the permeability of the blood-brain barrier in the rat

    SciTech Connect

    Saija, A.; Princi, P.; D'Amico, N.; De Pasquale, R.; Costa, G.


    The aim of the present study was to investigate the existence of aging- and sex-related alterations in the permeability of the blood-brain barrier (BBB) in the rat, by calculating a unidirectional blood-to-brain transfer constant (Ki) for the circulating tracer ({sup 14}C)-{alpha}-aminoisobutyric acid. The authors observed that: (a) the permeability of the BBB significantly increased within the frontal and temporo-parietal cortex, hypothalamus and cerebellum in 28-30 week old rats, in comparison with younger animals; (b) in several brain areas of female intact rats higher Ki values (even though not significantly different) were calculated at oestrus than at proestrus; (c) in 1-week ovariectomized rats there was a marked increase of Ki values at the level of the frontal, temporo-parietal and occipital cortex, cerebellum and brain-stem. One can speculate that aging and sex-related alterations in thee permeability of the BBB reflect respectively changes in brain neurochemical system activity and in plasma steroid hormone levels.

  5. Low Dosage of Chitosan Supplementation Improves Intestinal Permeability and Impairs Barrier Function in Mice

    PubMed Central

    Peng, Hanhui; Li, Guanya


    The purpose of this study was to explore relationships between low dose dietary supplementation with chitosan (COS) and body weight, feed intake, intestinal barrier function, and permeability in mice. Twenty mice were randomly assigned to receive an unadulterated control diet (control group) or a dietary supplementation with 30 mg/kg dose of chitosan (COS group) for two weeks. Whilst no significant differences were found between the conditions for body weight or food and water intake, mice in the COS group had an increased serum D-lactate content (P < 0.05) and a decreased jejunal diamine oxidase (DAO) activity (P < 0.05). Furthermore, mice in COS group displayed a reduced expression of occludin and ZO-1 (P < 0.05) and a reduced expression of occludin in the ileum (P < 0.05). The conclusion drawn from these findings showed that although 30 mg/kg COS-supplemented diet had no effect on body weight or feed intake in mice, this dosage may compromise intestinal barrier function and permeability. This research will contribute to the guidance on COS supplements. PMID:27610376

  6. Fungal permeable reactive barrier to remediate groundwater in an artificial aquifer.


    Folch, Albert; Vilaplana, Marcel; Amado, Leila; Vicent, Teresa; Caminal, Glòria


    Biobarriers, as permeable reactive barriers (PRBs), are a common technology that mainly uses bacteria to remediate groundwater in polluted aquifers. In this study, we propose to use Trametes versicolor, a white-rot fungus, as the reactive element because of its capacity to degrade a wide variety of highly recalcitrant and xenobiotic compounds. A laboratory-scale artificial aquifer was constructed to simulate groundwater flow under real conditions in shallow aquifers. Orange G dye was chosen as a contaminant to visually monitor the hydrodynamic behaviour of the system and any degradation of the dye by the fungus. Batch experiments at different pH values (6 and 7) and several temperatures (15 °C, 18 °C, 20 °C and 25 °C) were performed to select the appropriate residence time and glucose consumption rate required for continuous treatment. The maximum Orange G degradation was 97%. Continuous degradation over 85% was achieved for more than 8 days. Experimental results indicate for the first time that this fungus can potentially be used as a permeable reactive barrier in real aquifers.

  7. A2A adenosine receptor regulates the human blood brain barrier permeability

    PubMed Central

    Kim, Do-Geun; Bynoe, Margaret S.


    The blood brain barrier (BBB) symbolically represents the gateway to the central nervous system. It is a single layer of specialized endothelial cells that coats the central nervous system (CNS) vasculature and physically separates the brain environment from the blood constituents, to maintain the homeostasis of the CNS. However, this protective measure is a hindrance to the delivery of therapeutics to treat neurological diseases. Here, we show that activation of A2A adenosine receptor (AR) with an FDA-approved agonist potently permeabilizes an in vitro primary human brain endothelial barrier (hBBB) to the passage of chemotherapeutic drugs and T cells. T cell migration under AR signaling occurs primarily by paracellular transendothelial route. Permeabilization of the hBBB is rapid, time-dependent and reversible and is mediated by morphological changes in actin-cytoskeletal reorganization induced by RhoA signaling and a potent down-regulation of Claudin-5 and VE-Cadherin. Moreover, the kinetics of BBB permeability in mice closely overlaps with the permeability kinetics of the hBBB. These data suggest that activation of A2A AR is an endogenous mechanism that may be used for CNS drug delivery in human. PMID:25262373

  8. Heavy metal uptake and leaching from polluted soil using permeable barrier in DTPA-assisted phytoextraction.


    Zhao, Shulan; Shen, Zhiping; Duo, Lian


    Application of sewage sludge (SS) in agriculture is an alternative technique of disposing this waste. But unreasonable application of SS leads to excessive accumulation of heavy metals in soils. A column experiment was conducted to test the availability of heavy metals to Lolium perenne grown in SS-treated soils following diethylene triamine penta acetic acid (DTPA) application at rates of 0, 10 and 20 mmol kg(-1) soil. In order to prevent metal leaching in DTPA-assisted phytoextraction process, a horizontal permeable barrier was placed below the treated soil, and its effectiveness was also assessed. Results showed that DTPA addition significantly increased metal uptake by L. perenne shoots and metal leaching. Permeable barriers increased metal concentrations in plant shoots and effectively decreased metal leaching from the treated soil. Heavy metals in SS-treated soils could be gradually removed by harvesting L. perenne many times in 1 year and adding low dosage of DTPA days before each harvest.

  9. Development of permeable reactive barriers to prevent radionuclide migration from the nuclear waste repositories

    SciTech Connect

    Zakharova, E.; Kalmykov, S.; Batuk, O.; Kazakovskaya, T.; Shapovalov, V.; Haire, M.J.


    This paper is focused on three possible materials for permeable reactive barriers (PRB): 1) depleted uranium oxide that is accumulated as a residual product of the natural uranium enrichment process, 2) zero-valent iron and, 3) the composite material based on montmorillonite clay modified with different anion exchangers. The main aim of permeable reactive barriers is to prevent release of radionuclides emerging from a repository waste package containing spent nuclear fuel to outside the control area of the nuclear waste repository sites. The most experimentally developed material is depleted uranium oxide. It can be used both as a component of radiation shielding and as an absorbent for migrating long-lived radionuclides (especially {sup 237}Np and {sup 99}Tc). Experiments demonstrate the high sorption properties of depleted uranium oxide towards Np and Tc both from deionized water and from solution that simulates Yucca Mountain. Zero-valent iron, and the composite based on montmorillonite clay, also seem to be very promising to use in a PRB. Nano-particles of zero-valent iron with high surface will reduce high valency Np and Tc to the tetravalent state and thus immobilize them due to the extremely low solubility of corresponding hydroxides. The composite based on montmorillonite clay modified with different anion exchangers will possess high sorption affinity towards anionic and cationic species. (authors)

  10. Epidermal barrier abnormalities in exfoliative ichthyosis with a novel homozygous loss-of-function mutation in CSTA.


    Moosbrugger-Martinz, V; Jalili, A; Schossig, A S; Jahn-Bassler, K; Zschocke, J; Schmuth, M; Stingl, G; Eckl, K M; Hennies, H C; Gruber, R


    Autosomal recessive exfoliative ichthyosis (AREI) results from mutations in CSTA, encoding cysteine protease inhibitor A (cystatin A). We present a 25-year-old man from Iran with consanguineous parents, who presented with congenital erythroderma, hyperhidrosis and diffuse hyperkeratosis with coarse palmoplantar peeling of the skin, aggravated by exposure to water and by occlusion. Candidate gene analysis revealed a previously unknown homozygous loss-of-function mutation c.172C>T (p.Arg58Ter) in CSTA, and immunostaining showed absence of epidermal cystatin A, confirming the diagnosis of AREI. Ultrastructural analysis by transmission electron microscopy showed normal degradation of corneodesmosomes, mild intercellular oedema in the spinous layer but not in the basal layer, normal-appearing desmosomes, and prominent keratin filaments within basal keratinocytes. Thickness of cornified envelopes was reduced, lamellar lipid bilayers were disturbed, lamellar body secretion occurred prematurely and processing of secreted lamellar body contents was delayed. These barrier abnormalities were reminiscent of (albeit less severe than in) Netherton syndrome, which results from a deficiency of the serine protease inhibitor LEKTI. This work describes ultrastructural findings with evidence of epidermal barrier abnormalities in AREI.

  11. Heterogeneous vascular permeability and alternative diffusion barrier in sensory circumventricular organs of adult mouse brain.


    Morita, Shoko; Furube, Eriko; Mannari, Tetsuya; Okuda, Hiroaki; Tatsumi, Kouko; Wanaka, Akio; Miyata, Seiji


    Fenestrated capillaries of the sensory circumventricular organs (CVOs), including the organum vasculosum of the lamina terminalis, the subfornical organ and the area postrema, lack completeness of the blood-brain barrier (BBB) to sense a variety of blood-derived molecules and to convey the information into other brain regions. We examine the vascular permeability of blood-derived molecules and the expression of tight-junction proteins in sensory CVOs. The present tracer assays revealed that blood-derived dextran 10 k (Dex10k) having a molecular weight (MW) of 10,000 remained in the perivascular space between the inner and outer basement membranes, but fluorescein isothiocyanate (FITC; MW: 389) and Dex3k (MW: 3000) diffused into the parenchyma. The vascular permeability of FITC was higher at central subdivisions than at distal subdivisions. Neither FITC nor Dex3k diffused beyond the dense network of glial fibrillar acidic protein (GFAP)-positive astrocytes/tanycytes. The expression of tight-junction proteins such as occludin, claudin-5 and zonula occludens-1 (ZO-1) was undetectable at the central subdivisions of the sensory CVOs but some was expressed at the distal subdivisions. Electron microscopic observation showed that capillaries were surrounded with numerous layers of astrocyte processes and dendrites. The expression of occludin and ZO-1 was also observed as puncta on GFAP-positive astrocytes/tanycytes of the sensory CVOs. Our study thus demonstrates the heterogeneity of vascular permeability and expression of tight-junction proteins and indicates that the outer basement membrane and dense astrocyte/tanycyte connection are possible alternative mechanisms for a diffusion barrier of blood-derived molecules, instead of the BBB.

  12. Image-Guided Synthesis Reveals Potent Blood-Brain Barrier Permeable Histone Deacetylase Inhibitors

    PubMed Central


    Recent studies have revealed that several histone deacetylase (HDAC) inhibitors, which are used to study/treat brain diseases, show low blood-brain barrier (BBB) penetration. In addition to low HDAC potency and selectivity observed, poor brain penetrance may account for the high doses needed to achieve therapeutic efficacy. Here we report the development and evaluation of highly potent and blood-brain barrier permeable HDAC inhibitors for CNS applications based on an image-guided approach involving the parallel synthesis and radiolabeling of a series of compounds based on the benzamide HDAC inhibitor, MS-275 as a template. BBB penetration was optimized by rapid carbon-11 labeling and PET imaging in the baboon model and using the imaging derived data on BBB penetration from each compound to feed back into the design process. A total of 17 compounds were evaluated, revealing molecules with both high binding affinity and BBB permeability. A key element conferring BBB penetration in this benzamide series was a basic benzylic amine. These derivatives exhibited 1–100 nM inhibitory activity against recombinant human HDAC1 and HDAC2. Three of the carbon-11 labeled aminomethyl benzamide derivatives showed high BBB penetration (∼0.015%ID/cc) and regional binding heterogeneity in the brain (high in thalamus and cerebellum). Taken together this approach has afforded a strategy and a predictive model for developing highly potent and BBB permeable HDAC inhibitors for CNS applications and for the discovery of novel candidate molecules for small molecule probes and drugs. PMID:24780082

  13. Effect of fatty acids on the permeability barrier of model and biological membranes.


    Arouri, Ahmad; Lauritsen, Kira E; Nielsen, Henriette L; Mouritsen, Ole G


    Because of the amphipathicity and conical molecular shape of fatty acids, they can efficiently incorporate into lipid membranes and disturb membrane integrity, chain packing, and lateral pressure profile. These phenomena affect both model membranes as well as biological membranes. We investigated the feasibility of exploiting fatty acids as permeability enhancers in drug delivery systems for enhancing drug release from liposomal carriers and drug uptake by target cells. Saturated fatty acids, with acyl chain length from C8 to C20, were tested using model drug delivery liposomes of 1,2- dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and the breast cancer MCF-7 cell line as a model cell. A calcein release assay demonstrated reduction in the membrane permeability barrier of the DPPC liposomes, proportionally to the length of the fatty acid. Differential scanning calorimetry (DSC) and dynamic light scattering (DLS) experiments revealed that C12 to C20 fatty acids can stabilize DPPC liposomal bilayers and induce the formation of large structures, probably due to liposome aggregation and bilayer morphological changes. On the other hand, the short fatty acids C8 and C10 tend to destabilize the bilayers and only moderately cause the formation of large structures. The effect of fatty acids on DPPC liposomes was not completely transferrable to the MCF-7 cell line. Using cytotoxicity assays, the cells were found to be relatively insensitive to the fatty acids at apoptotic sub-millimolar concentrations. Increasing the fatty acid concentration to few millimolar substantially reduced the viability of the cells, most likely via the induction of necrosis and cell lysis. A bioluminescence living-cell-based luciferase assay showed that saturated fatty acids in sub-cytotoxic concentrations cannot reduce the permeability barrier of cell membranes. Our results confirm that the membrane perturbing effect of fatty acids on model membranes cannot simply be carried over to biological

  14. Effects of soybean agglutinin on intestinal barrier permeability and tight junction protein expression in weaned piglets.


    Zhao, Yuan; Qin, Guixin; Sun, Zewei; Che, Dongsheng; Bao, Nan; Zhang, Xiaodong


    This study was developed to provide further information on the intestinal barrier permeability and the tight junction protein expression in weaned piglets fed with different levels of soybean agglutinin (SBA). Twenty-five weaned crossbred barrows (Duroc × Landrace × Yorkshire) were selected and randomly allotted to five groups, each group with five replicates. The piglets in the control group were not fed with leguminous products. 0.05, 0.1, 0.15 and 0.2% SBA was added to the control diet to form four experimental diets, respectively. After the experimental period of 7 days (for each group), all the piglets were anesthetized with excess procaine and slaughtered. The d-lactic acid in plasma and the Ileal mucosa diamine oxidase (DAO) was analyzed to observe the change in the intestinal permeability. The tight junction proteins occludin and ZO-1 in the jejunum tissue distribution and relative expression were detected by immunohistochemistry and Western Blot. The results illustrated that a high dose of SBA (0.1-0.2%) could increase the intestinal permeability and reduce piglet intestinal epithelial tight junction protein occludin or ZO-1 expression, while low dose of SBA (0.05% of total diet) had no significant affects. The contents of DAO, d-lactic acid, occludin or ZO-1, had a linear relationship with the SBA levels (0-0.2%) in diets. The high dose SBA (0.1-0.2%) could increase the intestinal permeability and reduce piglet intestinal epithelial tight junction protein occludin or ZO-1 expression, while low dose of SBA (0.05% of total diet) had no affects.

  15. Tracer kinetic modelling for DCE-MRI quantification of subtle blood-brain barrier permeability.


    Heye, Anna K; Thrippleton, Michael J; Armitage, Paul A; Valdés Hernández, Maria del C; Makin, Stephen D; Glatz, Andreas; Sakka, Eleni; Wardlaw, Joanna M


    There is evidence that subtle breakdown of the blood-brain barrier (BBB) is a pathophysiological component of several diseases, including cerebral small vessel disease and some dementias. Dynamic contrast-enhanced MRI (DCE-MRI) combined with tracer kinetic modelling is widely used for assessing permeability and perfusion in brain tumours and body tissues where contrast agents readily accumulate in the extracellular space. However, in diseases where leakage is subtle, the optimal approach for measuring BBB integrity is likely to differ since the magnitude and rate of enhancement caused by leakage are extremely low; several methods have been reported in the literature, yielding a wide range of parameters even in healthy subjects. We hypothesised that the Patlak model is a suitable approach for measuring low-level BBB permeability with low temporal resolution and high spatial resolution and brain coverage, and that normal levels of scanner instability would influence permeability measurements. DCE-MRI was performed in a cohort of mild stroke patients (n=201) with a range of cerebral small vessel disease severity. We fitted these data to a set of nested tracer kinetic models, ranking their performance according to the Akaike information criterion. To assess the influence of scanner drift, we scanned 15 healthy volunteers that underwent a "sham" DCE-MRI procedure without administration of contrast agent. Numerical simulations were performed to investigate model validity and the effect of scanner drift. The Patlak model was found to be most appropriate for fitting low-permeability data, and the simulations showed vp and K(Trans) estimates to be reasonably robust to the model assumptions. However, signal drift (measured at approximately 0.1% per minute and comparable to literature reports in other settings) led to systematic errors in calculated tracer kinetic parameters, particularly at low permeabilities. Our findings justify the growing use of the Patlak model in low-permeability

  16. Tracer kinetic modelling for DCE-MRI quantification of subtle blood–brain barrier permeability

    PubMed Central

    Heye, Anna K.; Thrippleton, Michael J.; Armitage, Paul A.; Valdés Hernández, Maria del C.; Makin, Stephen D.; Glatz, Andreas; Sakka, Eleni; Wardlaw, Joanna M.


    There is evidence that subtle breakdown of the blood–brain barrier (BBB) is a pathophysiological component of several diseases, including cerebral small vessel disease and some dementias. Dynamic contrast-enhanced MRI (DCE-MRI) combined with tracer kinetic modelling is widely used for assessing permeability and perfusion in brain tumours and body tissues where contrast agents readily accumulate in the extracellular space. However, in diseases where leakage is subtle, the optimal approach for measuring BBB integrity is likely to differ since the magnitude and rate of enhancement caused by leakage are extremely low; several methods have been reported in the literature, yielding a wide range of parameters even in healthy subjects. We hypothesised that the Patlak model is a suitable approach for measuring low-level BBB permeability with low temporal resolution and high spatial resolution and brain coverage, and that normal levels of scanner instability would influence permeability measurements. DCE-MRI was performed in a cohort of mild stroke patients (n = 201) with a range of cerebral small vessel disease severity. We fitted these data to a set of nested tracer kinetic models, ranking their performance according to the Akaike information criterion. To assess the influence of scanner drift, we scanned 15 healthy volunteers that underwent a “sham” DCE-MRI procedure without administration of contrast agent. Numerical simulations were performed to investigate model validity and the effect of scanner drift. The Patlak model was found to be most appropriate for fitting low-permeability data, and the simulations showed vp and KTrans estimates to be reasonably robust to the model assumptions. However, signal drift (measured at approximately 0.1% per minute and comparable to literature reports in other settings) led to systematic errors in calculated tracer kinetic parameters, particularly at low permeabilities. Our findings justify the growing use of the Patlak model

  17. On the effects of preferential or barrier flow features on solute plumes in permeable porous media

    NASA Astrophysics Data System (ADS)

    Sebben, Megan L.; Werner, Adrian D.


    Despite that discrete flow features (DFFs, e.g. fractures and faults) are common features in the subsurface, few studies have explored the influence of DFFs on solute plumes in otherwise permeable rocks (e.g. sandstone, limestone), compared to low-permeability rock settings (e.g. granite and basalt). DFFs can provide preferential flow pathways (i.e. 'preferential flow features'; PFFs), or can act to impede flow (i.e. 'barrier flow features'; BFFs). This research uses a simple analytical expression and numerical modelling to explore how a single DFF influences the steady-state distributions of solute plumes in permeable aquifers. The analysis quantifies the displacement and widening (or narrowing) of a steady-state solute plume as it crosses a DFF in idealised, 1 × 1 m moderately permeable rock aquifers. Previous research is extended by accounting for DFFs as 2D flow features, and including BFF situations. A range of matrix-DFF permeability ratios (0.01 to 100) and DFF apertures (0.25 mm to 2 cm), typical of sedimentary aquifers containing medium-to-large fractures, are considered. The results indicate that for the conceptual models considered here, PFFs typically have a more significant influence on plume distributions than BFFs, and the impact of DFFs on solute plumes generally increases with increasing aperture. For example, displacement of peak solute concentration caused by DFFs exceeds 20 cm in some PFF cases, compared to a maximum of 0.64 cm in BFF cases. PFFs widen plumes up to 9.7 times, compared to a maximum plume widening of 2.0 times in BFF cases. Plumes crossing a PFF are less symmetrical, and peak solute concentrations beneath PFFs are up to two orders of magnitude lower than plumes in BFF cases. This study extends current knowledge of the attenuating influence of DFFs in otherwise permeable rocks on solute plume characteristics, through evaluation of 2D flow effects in DFFs for a variety of DFF apertures, and by considering BFF situations.

  18. An Injectable Apatite Permeable Reactive Barrier for In Situ 90Sr Immobilization

    SciTech Connect

    Vermeul, Vincent R.; Szecsody, James E.; Fritz, Brad G.; Williams, Mark D.; Moore, Robert C.; Fruchter, Jonathan S.


    An injectable permeable reactive barrier (PRB) technology was developed to sequester 90Sr in groundwater through the in situ formation of calcium-phosphate mineral phases, specifically apatite that incorporates 90Sr into the chemical structure. An integrated, multi-scale development and testing approach was used that included laboratory bench-scale experiments, an initial pilot-scale field test, and the emplacement and evaluation of a 300-ft-long treatability-test-scale PRB. Standard groundwater wells were used for emplacement of the treatment zone, allowing treatment of contaminants too deep below ground surface for trench-and-fill type PRB technologies. The apatite amendment formulation uses two separate precursor solutions, one containing a Ca-citrate complex and the other a Na-phosphate solution, to form apatite precipitate in situ. Citrate is needed to keep calcium in solution long enough to achieve a more uniform and areally extensive distribution of precipitate formation. In the summer of 2008, the apatite PRB technology was applied as a 91-m (300-ft) -long permeable reactive barrier on the downgradient edge of a 90Sr plume beneath the Hanford Site in Washington State. The technology was deployed to reduce 90Sr flux discharging to the Columbia River. Performance assessment monitoring data collected to date indicate the barrier is meeting performance objectives. The average reduction in 90Sr concentrations at four downgradient compliance monitoring locations was 95% relative to the high end of the baseline range approximately 1 year after treatment, and continues to meet remedial objectives more than 4 years after treatment.

  19. Remediation of TCE-contaminated groundwater by a permeable reactive barrier filled with plant mulch (Biowall).


    Lu, Xiaoxia; Wilson, John T; Shen, Hai; Henry, Bruce M; Kampbell, Donald H


    A pilot-scale permeable reactive barrier filled with plant mulch was installed at Altus Air Force Base in Oklahoma, USA to treat trichloroethylene (TCE) contamination in groundwater emanating from a landfill. The barrier was constructed in June 2002. It was 139 meters long, 7 meters deep, and 0.5 meters wide. The barrier is also called a Biowall because one of the mechanisms for removal of TCE is anaerobic biodegradation. This study aimed at evaluating the performance of the pilot-scale Biowall after its installation. Data from over four years' monitoring indicated that the Biowall greatly changed geochemistry in the study area and stimulated TCE removal. The concentration of TCE in the Biowall and downgradient of the Biowall was greatly reduced as compared to that in ground water upgradient of the Biowall, while the concentration of cis-DCE in the Biowall and downgradient of the Biowall was much higher than that observed upgradient of the Biowall. Over time, the concentration of vinyl chloride in the Biowall and downgradient of the Biowall increased. Dehalococcoides DNA was detected within and downgradient of the Biowall, corresponding to the observation that vinyl chloride was produced at these locations. Results from a tracer study indicated that the regional groundwater flow pattern ultimately determined the flow direction in the area around the Biowall. The natural groundwater velocity was estimated at an average of 0.060 +/- 0.015 m/d.

  20. Influence of antioxidants on blood-brain barrier permeability during adrenaline-induced hypertension.


    Oztaş, B; Erkin, E; Dural, E; Isbir, T


    We have examined the effect of antioxidants (vitamin E, and selenium) on the blood-brain barrier permeability during adreneline-induced acute hypertension in the female rats. The rats supplemented with nontoxic doses of sodium selenite in drinking water for three months or vitamin E was given intraperitoneally before adrenaline-induced acute hypertension. Evans-blue was used as a blood-brain barrier tracer. Mean values for Evans-blue dye were found to be 0.28 +/- 0.04 microg/g tissue in control animals and 1.0 +/- 0.2 microg tissue after adrenaline-induced acute hypertension (p < .01). Rats pretreated with selenium or vitamin E also showed macroscopic leakage of Evans-blue albumin after adrenaline injection i.e., there was no significant difference in protein extravasation between untreated and treated animals (p > .5). The mean value for Evans-blue dye was found to be 1.0 +/- 0.2 microg/g tissue in acute hypertension group, 0.9 +/- 0.2 microg/g tissue in selenium pretreated animals and 1.0 +/- 0.2 micrg/g tissue vitamin E injected animals after acute hypertension. The results show that antioxidants did not influence the blood-brain barrier breakdown during adrenaline-induced acute hypertension.

  1. Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice

    PubMed Central

    Okano, Junko; Kojima, Hideto; Katagi, Miwako; Nakagawa, Takahiko; Nakae, Yuki; Terashima, Tomoya; Kurakane, Takeshi; Kubota, Mamoru; Maegawa, Hiroshi; Udagawa, Jun


    Diabetes causes skin complications, including xerosis and foot ulcers. Ulcers complicated by infections exacerbate skin conditions, and in severe cases, limb/toe amputations are required to prevent the development of sepsis. Here, we hypothesize that hyperglycemia induces skin barrier dysfunction with alterations of epidermal integrity. The effects of hyperglycemia on the epidermis were examined in streptozotocin-induced diabetic mice with/without insulin therapy. The results showed that dye leakages were prominent, and transepidermal water loss after tape stripping was exacerbated in diabetic mice. These data indicate that hyperglycemia impaired skin barrier functions. Additionally, the distribution of the protein associated with the tight junction structure, tight junction protein-1 (ZO-1), was characterized by diffuse and significantly wider expression in the diabetic mice compared to that in the control mice. In turn, epidermal cell number was significantly reduced and basal cells were irregularly aligned with ultrastructural alterations in diabetic mice. In contrast, the number of corneocytes, namely, denucleated and terminally differentiated keratinocytes significantly increased, while their sensitivity to mechanical stress was enhanced in the diabetic mice. We found that cell proliferation was significantly decreased, while apoptotic cells were comparable in the skin of diabetic mice, compared to those in the control mice. In the epidermis, Keratin 5 and keratin 14 expressions were reduced, while keratin 10 and loricrin were ectopically induced in diabetic mice. These data suggest that hyperglycemia altered keratinocyte proliferation/differentiation. Finally, these phenotypes observed in diabetic mice were mitigated by insulin treatment. Reduction in basal cell number and perturbation of the proliferation/differentiation process could be the underlying mechanisms for impaired skin barrier functions in diabetic mice. PMID:27846299

  2. Hyperglycemia Induces Skin Barrier Dysfunctions with Impairment of Epidermal Integrity in Non-Wounded Skin of Type 1 Diabetic Mice.


    Okano, Junko; Kojima, Hideto; Katagi, Miwako; Nakagawa, Takahiko; Nakae, Yuki; Terashima, Tomoya; Kurakane, Takeshi; Kubota, Mamoru; Maegawa, Hiroshi; Udagawa, Jun


    Diabetes causes skin complications, including xerosis and foot ulcers. Ulcers complicated by infections exacerbate skin conditions, and in severe cases, limb/toe amputations are required to prevent the development of sepsis. Here, we hypothesize that hyperglycemia induces skin barrier dysfunction with alterations of epidermal integrity. The effects of hyperglycemia on the epidermis were examined in streptozotocin-induced diabetic mice with/without insulin therapy. The results showed that dye leakages were prominent, and transepidermal water loss after tape stripping was exacerbated in diabetic mice. These data indicate that hyperglycemia impaired skin barrier functions. Additionally, the distribution of the protein associated with the tight junction structure, tight junction protein-1 (ZO-1), was characterized by diffuse and significantly wider expression in the diabetic mice compared to that in the control mice. In turn, epidermal cell number was significantly reduced and basal cells were irregularly aligned with ultrastructural alterations in diabetic mice. In contrast, the number of corneocytes, namely, denucleated and terminally differentiated keratinocytes significantly increased, while their sensitivity to mechanical stress was enhanced in the diabetic mice. We found that cell proliferation was significantly decreased, while apoptotic cells were comparable in the skin of diabetic mice, compared to those in the control mice. In the epidermis, Keratin 5 and keratin 14 expressions were reduced, while keratin 10 and loricrin were ectopically induced in diabetic mice. These data suggest that hyperglycemia altered keratinocyte proliferation/differentiation. Finally, these phenotypes observed in diabetic mice were mitigated by insulin treatment. Reduction in basal cell number and perturbation of the proliferation/differentiation process could be the underlying mechanisms for impaired skin barrier functions in diabetic mice.

  3. iRHOM2-dependent regulation of ADAM17 in cutaneous disease and epidermal barrier function.


    Brooke, Matthew A; Etheridge, Sarah L; Kaplan, Nihal; Simpson, Charlotte; O'Toole, Edel A; Ishida-Yamamoto, Akemi; Marches, Olivier; Getsios, Spiro; Kelsell, David P


    iRHOM2 is a highly conserved, catalytically inactive member of the Rhomboid family, which has recently been shown to regulate the maturation of the multi-substrate ectodomain sheddase enzyme ADAM17 (TACE) in macrophages. Dominant iRHOM2 mutations are the cause of the inherited cutaneous and oesophageal cancer-susceptibility syndrome tylosis with oesophageal cancer (TOC), suggesting a role for this protein in epithelial cells. Here, using tissues derived from TOC patients, we demonstrate that TOC-associated mutations in iRHOM2 cause an increase in the maturation and activity of ADAM17 in epidermal keratinocytes, resulting in significantly upregulated shedding of ADAM17 substrates, including EGF-family growth factors and pro-inflammatory cytokines. This activity is accompanied by increased EGFR activity, increased desmosome processing and the presence of immature epidermal desmosomes, upregulated epidermal transglutaminase activity and heightened resistance to Staphylococcal infection in TOC keratinocytes. Many of these features are consistent with the presence of a constitutive wound-healing-like phenotype in TOC epidermis, which may shed light on a novel pathway in skin repair, regeneration and inflammation.

  4. Impromidine-induced changes in the permeability of the blood-brain barrier of normotensive and spontaneously hypertensive rats

    SciTech Connect

    Boertje, S.B.; Le Beau, D.; Ward, S. )


    Previous studies suggested histamine receptors mediate changes in the cerebrovascular permeability of rats. To test this, we investigated the effects of impromidine, a specific agonist at the histamine H2-receptor, on blood pressure and permeability of the blood-brain barrier (BBB). Impromidine produced dose-dependent hypotension in Wistar-Kyoto (WKY) and spontaneously hypertensive (SHR) rats. Two higher doses of impromidine increased BBB permeability to 99mTc-sodium pertechnetate in WKY rats; however, two lower doses decreased permeability in SHR rats. All doses of impromidine increased cerebrovascular permeability to 131I-labeled serum albumin in both species. Doses of the drug were 100 times greater than those required to produce similar alterations using histamine.


    EPA Science Inventory

    Reactive transport modeling has been conducted to describe the performance of the permeable reactive barrier at the Coast Guard Support Center near Elizabeth City, NC. The reactive barrier was installed to treat groundwater contaminated by hexavalent chromium and chlorinated org...

  6. Organic/inorganic nanocomposites, methods of making, and uses as a permeable reactive barrier


    Harrup, Mason K.; Stewart, Frederick F.


    Nanocomposite materials having a composition including an inorganic constituent, a preformed organic polymer constituent, and a metal ion sequestration constituent are disclosed. The nanocomposites are characterized by being single phase, substantially homogeneous materials wherein the preformed polymer constituent and the inorganic constituent form an interpenetrating network with each other. The inorganic constituent may be an inorganic oxide, such as silicon dioxide, formed by the in situ catalyzed condensation of an inorganic precursor in the presence of the solvated polymer and metal ion sequestration constituent. The polymer constituent may be any hydrophilic polymer capable of forming a type I nanocomposite such as, polyacrylonitrile (PAN), polyethyleneoxide (PEO), polyethylene glycol (PEG), polyvinyl acetate (PVAc), polyvinyl alcohol (PVA), and combinations thereof. Nanocomposite materials of the present invention may be used as permeable reactive barriers (PRBs) to remediate contaminated groundwater. Methods for making nanocomposite materials, PRB systems, and methods of treating groundwater are also disclosed.

  7. Hierarchical assembly of the eggshell and permeability barrier in C. elegans

    PubMed Central

    Olson, Sara K.; Greenan, Garrett; Desai, Arshad; Müller-Reichert, Thomas


    In metazoans, fertilization triggers the assembly of an extracellular coat that constitutes the interface between the embryo and its environment. In nematodes, this coat is the eggshell, which provides mechanical rigidity, prevents polyspermy, and is impermeable to small molecules. Using immunoelectron microscopy, we found that the Caenorhabditis elegans eggshell was composed of an outer vitelline layer, a middle chitin layer, and an inner layer containing chondroitin proteoglycans. The switch between the chitin and proteoglycan layers was achieved by internalization of chitin synthase coincident with exocytosis of proteoglycan-containing cortical granules. Inner layer assembly did not make the zygote impermeable as previously proposed. Instead, correlative light and electron microscopy demonstrated that the permeability barrier was a distinct envelope that formed in a separate step that required fatty acid synthesis, the sugar-modifying enzyme PERM-1, and the acyl chain transfer enzyme DGTR-1. These findings delineate the hierarchy of eggshell assembly and define key molecular mechanisms at each step. PMID:22908315

  8. Ground water remediation of chromium using zero-valent iron in a permeable reactive barrier

    SciTech Connect

    Puls, R.W.; Powell, R.M.; Paul, C.J.; Blowes, D.


    A series of laboratory experiments were performed to elucidate the chromium transformation and precipitation reactions caused by the corrosion of zero-valent iron in water-based systems. Reaction rates were determined for chromate reduction in the presence of different types of iron and in systems with iron mixed with aquifer materials. Various geochemical parameters were measured to confirm the proposed reactions. Laboratory experiments were scaled up to pilot and full-scale field demonstrations. Intensive geochemical sampling in the field tests corroborate laboratory results and successfully demonstrate the effectiveness of this innovative in situ approach to remediate chromate-contaminated ground water using a permeable reactive barrier composed of zero-valent iron.

  9. The Transmembrane Serine Protease HAT-like 4 Is Important for Epidermal Barrier Function to Prevent Body Fluid Loss

    PubMed Central

    Zhang, Zhiwei; Hu, Yae; Yan, Ruhong; Dong, Liang; Jiang, Yizhi; Zhou, Zhichao; Liu, Meng; Zhou, Tiantian; Dong, Ningzheng; Wu, Qingyu


    Membrane-bound proteases are essential for epidermal integrity. Human airway trypsin-like protease 4 (HAT-L4) is a type II transmembrane serine protease. Currently, its biochemical property, cellular distribution and physiological function remain unknown. Here we examined HAT-L4 expression and function in vitro and in vivo. In Western analysis, HAT-L4 expressed in transfected CHO cells appeared as a 48-kDa protein. Flow cytometry confirmed HAT-L4 expression on the cell surface with the expected membrane topology. RT-PCR and immunostaining experiments indicated that HAT-L4 was expressed in epithelial cells and exocrine glands in tissues including skin, esophagus, trachea, tongue, eye, bladder, testis and uterus. In the skin, HAT-L4 expression was abundant in keratinocytes and sebaceous glands. We generated HAT-L4 knockout mice by disrupting the Tmprss11f gene encoding HAT-L4. HAT-L4 knockout mice were viable and fertile. No defects were found in HAT-L4 knockout mice in hair growth, wound healing, water repulsion and body temperature regulation. Compared with wild-type controls, HAT-L4-deficient newborn mice had greater body fluid loss and higher mortality in a trans-epidermal body fluid loss test. In metabolic studies, HAT-L4-deficient adult mice drank water more frequently than wild-type controls did. These results indicate that HAT-L4 is important in epidermal barrier function to prevent body fluid loss. PMID:28338078

  10. Solvent-dependent on/off valving using selectively permeable barriers in paper microfluidics.


    Salentijn, G Ij; Hamidon, N N; Verpoorte, E


    We report on a new way to control solvent flows in paper microfluidic devices, based on the local patterning of paper with alkyl ketene dimer (AKD) to form barriers with selective permeability for different solvents. Production of the devices is a two-step process. In the first step, AKD-treated paper (hydrophobic) is exposed to oxygen plasma for re-hydrophilization. 3D-printed masks are employed to shield certain areas of this paper to preserve well-defined hydrophobic patterns. In the second step, concentrated AKD in hexane is selectively deposited onto already hydrophobic regions of the paper to locally increase the degree of hydrophobicity. Hydrophilic areas formed in the previous oxygen plasma step are protected from AKD by wetting them with water first to prevent the AKD hexane solution from entering them (hydrophilic exclusion). Characterization of the patterns after both steps shows that reproducible patterns are obtained with linear dependence on the dimensions of the 3D-printed masks. This two-step methodology leads to differential hydrophobicity on the paper: (i) hydrophilic regions, (ii) low-load AKD gates, and (iii) high-load AKD walls. The gates are impermeable to water, yet can be penetrated by most alcohol/water mixtures; the walls cannot. This concept for solvent-dependent on/off valving is demonstrated in two applications. In the first example, a device was developed for multi-step chemical reactions. Different compounds can be spotted separately (closed gates). Upon elution with an alcohol/water mixture, the gates become permeable and the contents are combined. In the second example, volume-defined sampling is introduced. Aqueous sample is allowed to wick into a device and fill a sample chamber. The contents of this sample chamber are eluted perpendicularly with an alcohol/water mixture through a selectively permeable gate. This system was tested with dye solution, and a linear dependence of magnitude of the signal on the sample chamber size was

  11. Blood-brain barrier permeability mechanisms in view of quantitative structure-activity relationships (QSAR).


    Bujak, Renata; Struck-Lewicka, Wiktoria; Kaliszan, Michał; Kaliszan, Roman; Markuszewski, Michał J


    The goal of the present paper was to develop a quantitative structure-activity relationship (QSAR) method using a simple statistical approach, such as multiple linear regression (MLR) for predicting the blood-brain barrier (BBB) permeability of chemical compounds. The "best" MLR models, comprised logP and either molecular mass (M) or isolated atomic energy (E(isol)), tested on a structurally diverse set of 66 compounds, is characterized the by correlation coefficients (R) around 0.8. The obtained models were validated using leave-one-out (LOO) cross-validation technique and the correlation coefficient of leave-one-out- R(LOO)(2) (Q(2)) was at least 0.6. Analysis of a case from legal medicine demonstrated informative value of our QSAR model. To best authors' knowledge the present study is a first application of the developed QSAR models of BBB permeability to case from the legal medicine. Our data indicate that molecular energy-related descriptors, in combination with the well-known descriptors of lipophilicity may have a supportive value in predicting blood-brain distribution, which is of utmost importance in drug development and toxicological studies.

  12. Edaravone-Encapsulated Agonistic Micelles Rescue Ischemic Brain Tissue by Tuning Blood-Brain Barrier Permeability

    PubMed Central

    Jin, Qu; Cai, Yu; Li, Sihan; Liu, Haoran; Zhou, Xingyu; Lu, Chunqiang; Gao, Xihui; Qian, Jun; Zhang, Jun; Ju, Shenghong; Li, Cong


    Thrombolysis has been a standard treatment for ischemic stroke. However, only 2-7% patients benefit from it because the thrombolytic agent has to be injected within 4.5 h after the onset of symptoms to avoid the increasing risk of intracerebral hemorrhage. As the only clinically approved neuroprotective drug, edaravone (EDV) rescues ischemic brain tissues by eradicating over-produced reactive oxygen species (ROS) without the limitation of therapeutic time-window. However, EDV's short circulation half-life and inadequate cerebral uptake attenuate its therapeutic efficacy. Here we developed an EDV-encapsulated agonistic micelle (EDV-AM) to specifically deliver EDV into brain ischemia by actively tuning blood-brain barrier (BBB) permeability. The EDV-AM actively up-regulated endothelial monolayer permeability in vitro. HPLC studies showed that EDV-AM delivered more EDV into brain ischemia than free EDV after intravenous injection. Magnetic resonance imaging also demonstrated that EDV-AM more rapidly salvaged ischemic tissue than free EDV. Diffusion tensor imaging indicated the highest efficiency of EDV-AM in accelerating axonal remodeling in the ipsilesional white matter and improving functional behaviors of ischemic stroke models. The agonistic micelle holds promise to improve the therapeutic efficiency of ischemic stroke patients who miss the thrombolytic treatment. PMID:28382161

  13. Influence of 50 Hz frequency sinusoidal magnetic field on the blood-brain barrier permeability of diabetic rats.


    Oztaş, Baria; Kalkan, Tunaya; Tuncel, Handan


    The combined effects of diabetes and a 50 Hz, 5 mT RMS flux density sinusoidal magnetic field for 8 h a day, for 21 consecutive days on the permeation of Evans-blue dye through the blood-brain barrier were studied in male Wistar albino rats. Our results suggest that magnetic field has no effect on the blood-brain barrier permeability in normoglycemic animals, but that diabetic rats are vulnerable to magnetic fields.

  14. Potentiation of neurotoxicity of Lathyrus sativus by manganese: alterations in blood-brain barrier permeability.


    Mishra, Geeta; Shukla, Rakesh; Hasan, Mahdi; Khanna, Subhash K; Das, Mukul


    Environmental factors have been speculated to play an important role in potentiating the neurotoxicity of Lathyrus sativus (LS). Hence, blood-brain barrier permeability and neurotoxicity studies were carried out in manganese- and LS-exposed animals. Dietary feeding of LS (80%) plus Mn (0.4 mg/100 g diet) for 90 days to guinea pigs showed significant (p < 0.05) decrease in brain nucleotidase and ATPase activities when compared to control or LS alone treated groups. Combined treatment of LS and Mn showed a significant (p < 0.05) decrease in neuronal aryl hydrocarbon hydroxylase (36-40%), ethoxyresorufin-O-deethylase (40-45%), glutathione-S-transferase (27-31%), and quinone reductase (24-25%) activities when compared to control and LS alone treated animals. Lipid peroxidation, a marker for membrane damage, was found to be relatively more enhanced (58-141%) along with significant (p < 0.05) depletion of GSH levels in LS+Mn-treated animals when compared to control, Mn alone, and LS alone treated groups. The neuronal catalase activity of lathyrus plus Mn-treated animals showed a pronounced decrease (37-49%) when compared to control, Mn, and lathyrus alone treated groups. On the contrary, glutathione peroxidase in brain of Mn and lathyrus alone treated animals indicated a respective increase (p < 0.05) of 18% and 20%, while the combined effect of lathyrus plus Mn exhibited an increase of almost 50% when compared to control guinea pigs. Single parenteral administration of Mn (15 mg/kg b.wt) to guinea pigs followed by single oral intubation of beta-N-oxalyl-L-alpha, beta-diamino propionic acid (ODAP, 75 mg/guinea pig) resulted in a significant increase (143%) in neuronal ODAP content. ODAP (50 mg/kg,iv) treatment to mice pretreated with MnCl2 (10 mg/kg b.wt for 3 days or 40 mg/kg b.wt for 1 day), caused an enhancement in blood-brain barrier (BBB) permeability (129-196%), while ODAP and Mn alone showed relatively less enhancement (66-87%). The lumbar region of LS+Mn showed a

  15. Iontophoresis itself on hairless mouse skin induces the loss of the epidermal calcium gradient without skin barrier impairment.


    Lee, S H; Choi, E H; Feingold, K R; Jiang, S; Ahn, S K


    Iontophoresis increases the delivery of drugs across the stratum corneum, but the pathway by which ionized drugs transit the stratum corneum is unknown. In this study we examined the effect of iontophoresis on the skin barrier and the epidermal calcium gradient. Hairless mice were subjected to iontophoresis for 5-120 min and skin specimens were prepared for electron microscopy. Neither positive nor negative iontophoresis affected transepidermal water loss. Lacunar dilatation and partial distention of the intercellular layers of the stratum corneum were observed in rough proportion to applied time in iontophoresis skin as well as control skin. Additionally, using calcium capture cytochemistry, we demonstrated that both positive and negative iontophoresis caused the disappearance of the epidermal calcium gradient with marked decrease in calcium content in the upper epidermis. Positive iontophoresis was associated with increased calcium in the stratum basale and dermis, whereas negative iontophoresis increased calcium in the stratum corneum. Moreover, as previously shown after barrier disruption and sonophoresis, the decrease in calcium content in the upper epidermis was associated with an increase in lamellar body secretion and the build up of lamellar material at the stratum corneum-stratum granulosum interface. In conclusion, iontophoresis on the skin of hairless mice may induce the change of ionized molecules in the epidermis, as the loss of the calcium gradient, which causes the decrease of skin impedence, gives charged drugs the ability to cross the skin more easily. Also, the structural changes, such as lacunar dilatation, whether they result from hydration or occlusion, may help the transport of charged drugs across the stratum corneum.

  16. Iron hydroxy carbonate formation in zerovalent iron permeable reactive barriers: Characterization and evaluation of phase stability

    SciTech Connect

    Wilkin, Richard T.; Lee, T.R.


    Predicting the long-term potential of permeable reactive barriers for treating contaminated groundwater relies on understanding the endpoints of biogeochemical reactions between influent groundwater and the reactive medium. Iron hydroxy carbonate (chukanovite) is frequently observed as a secondary mineral precipitate in granular iron PRBs. Mineralogical characterization was carried out using X-ray diffraction, scanning electron microscopy, thermogravimetric analysis, and X-ray absorption spectroscopy on materials collected from three field-based PRBs in the US (East Helena, MT; Elizabeth City, NC; Denver Federal Center, CO). These PRBs were installed to treat a range of contaminants, including chlorinated organics, hexavalent chromium, and arsenic. Results obtained indicate that chukanovite is a prevalent secondary precipitate in the PRBs. Laboratory experiments on high-purity chukanovite separates were carried out to constrain the room-temperature solubility for this mineral. An estimated Gibbs energy of formation ({Delta}{sub f}G{sup o}) for chukanovite is - 1174.4 {+-} 6 kJ/mol. A mineral stability diagram is consistent with observations from the field. Water chemistry from the three reactive barriers falls inside the predicted stability field for chukanovite, at inorganic carbon concentrations intermediate to the stability fields of siderite and ferrous hydroxide. These new data will aid in developing better predictive models of mineral accumulation in zerovalent iron PRBs.

  17. Activation of epidermal toll-like receptor 2 enhances tight junction function – Implications for atopic dermatitis and skin barrier repair

    PubMed Central

    Kuo, I-Hsin; Carpenter-Mendini, Amanda; Yoshida, Takeshi; McGirt, Laura Y.; Ivanov, Andrei I.; Barnes, Kathleen C.; Gallo, Richard L.; Borkowski, Andrew W.; Yamasaki, Kenshi; Leung, Donald Y.; Georas, Steve N.; De Benedetto, Anna; Beck, Lisa A.


    Atopic dermatitis (AD) is characterized by epidermal tight junction (TJ) defects and a propensity for Staphylococcus aureus (S. aureus) skin infections. S. aureus is sensed by many pattern recognition receptors including toll-like receptor (TLR) 2. We hypothesized that an effective innate immune response will include skin barrier repair and that this response is impaired in AD subjects. S. aureus-derived peptidoglycan (PGN) and synthetic TLR2 agonists enhanced TJ barrier and increased expression of TJ proteins, CLDN1, CLDN23, occludin and ZO-1 in primary human keratinocytes. A TLR2 agonist enhanced skin barrier recovery in human epidermis wounded by tape-stripping. Tlr2−/− mice had a delayed and incomplete barrier recovery following tape-stripping. AD subjects had reduced epidermal TLR2 expression as compared to nonatopic (NA) subjects, which inversely correlated (r= 0.654, P= 0.0004) with transepidermal water loss (TEWL). These observations indicate that TLR2 activation enhances skin barrier in murine and human skin and is an important part of a wound repair response. Reduced epidermal TLR2 expression observed in AD patients may play a role in their incompetent skin barrier. PMID:23223142


    EPA Science Inventory

    A pilot permeable reactive barrier (PRB) consisting of a mixture of leaf compost, zero-valent iron (ZVI) filings, limestone and pea gravel was evaluated at a former phosphate fertilizer manufacturing facility in Charleston, S.C. The PRB is designed to treat arsenic and heavy met...


    EPA Science Inventory

    Permeable iron reactive barriers have become a popular way to remediate contaminated ground water. Although this technology has been in use for about a decade, there is still little knowledge about long-term performance issues (l). One of the biggest concerns is the corrosion of ...

  20. Transformation of Reactive Iron Minerals in a Permeable Reactive Barrier (Biowall) Used to Treat TCE in Groundwater

    EPA Science Inventory

    Abstract: Iron and sulfur reducing conditions are generally created in permeable reactive barrier (PRB) systems constructed for groundwater treatment, which usually leads to formation of iron sulfide phases. Iron sulfides have been shown to play an important role in degrading ch...

  1. Fifteen-year Assessment of a Permeable Reactive Barrier for Treatment of Chromate and Trichloroethylene in Groundwater

    EPA Science Inventory

    The fifteen-year performance of a granular iron, permeable reactive barrier (PRB; Elizabeth City, North Carolina) is reviewed with respect to contaminant treatment (hexavalent chromium and trichloroethylene) and hydraulic performance. Due to in-situ treatment of the chromium sou...


    EPA Science Inventory

    Geochemical and microbiological factors that control long-term performance of subsurface permeable reactive barriers were evaluated at the Elizabeth City, NC and the Denver Federal Center, CO sites. These ground water treatment systems use zero-valent iron filings (Peerless Meta...

  3. Transcranial direct current stimulation transiently increases the blood-brain barrier solute permeability in vivo

    NASA Astrophysics Data System (ADS)

    Shin, Da Wi; Khadka, Niranjan; Fan, Jie; Bikson, Marom; Fu, Bingmei M.


    Transcranial Direct Current Stimulation (tDCS) is a non-invasive electrical stimulation technique investigated for a broad range of medical and performance indications. Whereas prior studies have focused exclusively on direct neuron polarization, our hypothesis is that tDCS directly modulates endothelial cells leading to transient changes in blood-brain-barrier (BBB) permeability (P) that are highly meaningful for neuronal activity. For this, we developed state-of-the-art imaging and animal models to quantify P to various sized solutes after tDCS treatment. tDCS was administered using a constant current stimulator to deliver a 1mA current to the right frontal cortex of rat (approximately 2 mm posterior to bregma and 2 mm right to sagittal suture) to obtain similar physiological outcome as that in the human tDCS application studies. Sodium fluorescein (MW=376), or FITC-dextrans (20K and 70K), in 1% BSA mammalian Ringer was injected into the rat (SD, 250-300g) cerebral circulation via the ipsilateral carotid artery by a syringe pump at a constant rate of ~3 ml/min. To determine P, multiphoton microscopy with 800-850 nm wavelength laser was applied to take the images from the region of interest (ROI) with proper microvessels, which are 100-200 micron below the pia mater. It shows that the relative increase in P is about 8-fold for small solute, sodium fluorescein, ~35-fold for both intermediate sized (Dex-20k) and large (Dex-70k) solutes, 10 min after 20 min tDCS pretreatment. All of the increased permeability returns to the control after 20 min post treatment. The results confirmed our hypothesis.

  4. Remediation of RDX- and HMX-contaminated groundwater using organic mulch permeable reactive barriers.


    Ahmad, Farrukh; Schnitker, Stephen P; Newell, Charles J


    Organic mulch is a complex organic material that is typically populated with its own consortium of microorganisms. The organisms in mulch breakdown complex organics to soluble carbon, which can then be used by these and other microorganisms as an electron donor for treating RDX and HMX via reductive pathways. A bench-scale treatability study with organic mulch was conducted for the treatment of RDX- and HMX-contaminated groundwater obtained from a plume at the Pueblo Chemical Depot (PCD) in Pueblo, Colorado. The site-specific cleanup criteria of 0.55 ppb RDX and 602 ppb HMX were used as the logical goals of the study. Column flow-through tests were run to steady-state at the average site seepage velocity, using a 70%:30% (vol.:vol.) mulch:pea gravel packing to approach the formation's permeability. Significant results included: (1) Complete removal of 90 ppb influent RDX and 8 ppb influent HMX in steady-state mulch column effluent; (2) pseudo-first-order steady-state kinetic rate constant, k, of 0.20 to 0.27 h(-1) based on RDX data, using triplicate parallel column runs; (3) accumulation of reduced RDX intermediates in the steady-state column effluent at less than 2% of the influent RDX mass; (4) no binding of RDX to the column fill material; and (5) no leaching of RDX, HMX or reduction intermediates from the column fill material. The results of the bench-scale study will be used to design and implement a pilot-scale organic mulch/pea gravel permeable reactive barrier (PRB) at the site.

  5. Application of Blood-Brain Barrier Permeability Imaging in Global Cerebral Edema

    PubMed Central

    Ivanidze, Jana; Kallas, Omar N.; Gupta, Ajay; Weidman, Elizabeth; Baradaran, Hediyeh; Mir, Danial; Giambrone, Ashley; Segal, Alan Z.; Claassen, Jan; Sanelli, Pina C.


    Background and Purpose Blood brain barrier permeability (BBBP) is not presently routinely evaluated in the clinical setting. Global cerebral edema (GCE) occurs after SAH and is associated with BBB disruption. Detection of GCE is challenging using current imaging techniques. Our purpose was to apply BBBP imaging in patients with GCE using extended pass CT Perfusion (CTP). Methods SAH patients underwent CTP in the early phase after aneurysmal rupture (days 0-3) and were classified as GCE or non-GCE using established non-contrast CT criteria. CTP were post-processed into BBBP quantitative maps of PS (permeability surface area product), K-trans (volume transfer constant from blood plasma to extravascular extracellular space, EES), Kep (washout rate constant of the contrast agent from EES to intravascular space), VE (EES volume per unit of tissue volume), VP (plasmatic volume per unit of tissue volume) and F (plasma flow) using Olea Sphere software. Mean values were compared using t-tests. Results 22 patients were included in the analysis. Kep (1.32 versus 1.52, p < 0.0001), K-trans (0.15 versus 0.19, p < 0.0001), VP (0.51 versus 0.57, p = 0.0007) and F (1176 versus 1329, p = 0.0001) were decreased in GCE compared to non-GCE while VE (0.81 versus 0.39, p < 0.0001) was increased. Conclusion Extended CTP was utilized to evaluate BBBP in SAH patients with and without GCE. Kep is an important indicator of altered BBBP in patients with decreased blood flow, as Kep is flow-independent. Further study of BBBP is needed to improve diagnosis and monitoring of GCE. PMID:27127002

  6. Application Of Immobilized Sulfate Reducing Bacteria For Permeable Reactive Barriers In Abandoned Coal Mines

    NASA Astrophysics Data System (ADS)

    Kim, K.; Hur, W.; Choi, S.; Min, K.; Baek, H.


    The decline of the Korean coal industry has been drastic in production and consumption. This has been resulted mainly from the environmental concern and the collapse of commercial viability, which has eventually necessitated the government to implement the coal industry rationalization policies to reduce coal production and close down uneconomical mines. The overall drainage rates from abandoned coal mines reaches up to 80,000 ton/day. As a measure of controlling the acid mine drainage from abandoned coal mines, reactive materials in the pathways of drainage, designed to intercept and to transform the contaminants into environmentally acceptable forms can be applied at mines with small drainage rates. The main objective of this study is to design a permeable reactive barrier(PRB) to treat low flow and/or low contaminant loads of acid mine drainage. The PRB is comprised of immobilized sulfate reducing bacteria in hard beads and limestone to remove heavy metals and to raise the pH of AMD. A laboratory reactor was used to prepare a mixed culture of sulfate reducing bacteria. The microbes were separated and mixed with biodegradable matrix to form spherical beads. In order to maintain the viability of micro-organisms for a prolonged period, substrates such as saw dust, polysaccharide or glycerol was supplemented for the beads preparation. The strength of beads fortified by powered limestone to control the permeability of PRB. Different mixtures of limestone and the immobilized beads were tested to determine hydraulic conductivity and AMD treatment capacities. The characteristics of the spherical beads at various pH of AMD was investigated.

  7. Evaluation of a permeable reactive barrier technology for use at Rocky Flats Environmental Technology Site (RFETS)

    SciTech Connect



    Three reactive materials were evaluated at laboratory scale to identify the optimum treatment reagent for use in a Permeable Reactive Barrier Treatment System at Rocky Flats Environmental Technology Site (RFETS). The contaminants of concern (COCS) are uranium, TCE, PCE, carbon tetrachloride, americium, and vinyl chloride. The three reactive media evaluated included high carbon steel iron filings, an iron-silica alloy in the form of a foam aggregate, and a peculiar humic acid based sorbent (Humasorb from Arctech) mixed with sand. Each material was tested in the laboratory at column scale using simulated site water. All three materials showed promise for the 903 Mound Site however, the iron filings were determined to be the least expensive media. In order to validate the laboratory results, the iron filings were further tested at a pilot scale (field columns) using actual site water. Pilot test results were similar to laboratory results; consequently, the iron filings were chosen for the fill-scale demonstration of the reactive barrier technology. Additional design parameters including saturated hydraulic conductivity, treatment residence time, and head loss across the media were also determined and provided to the design team in support of the final design. The final design was completed by the Corps of Engineers in 1997 and the system was constructed in the summer of 1998. The treatment system began fill operation in December, 1998 and despite a few problems has been operational since. Results to date are consistent with the lab and pilot scale findings, i.e., complete removal of the contaminants of concern (COCs) prior to discharge to meet RFETS cleanup requirements. Furthermore, it is fair to say at this point in time that laboratory developed design parameters for the reactive barrier technology are sufficient for fuel scale design; however,the treatment system longevity and the long-term fate of the contaminants are questions that remain unanswered. This

  8. A keratin scaffold regulates epidermal barrier formation, mitochondrial lipid composition, and activity

    PubMed Central

    Kumar, Vinod; Bouameur, Jamal-Eddine; Bär, Janina; Rice, Robert H.; Hornig-Do, Hue-Tran; Roop, Dennis R.; Schwarz, Nicole; Brodesser, Susanne; Thiering, Sören; Leube, Rudolf E.; Wiesner, Rudolf J.; Vijayaraj, Preethi; Brazel, Christina B.; Heller, Sandra; Binder, Hans; Löffler-Wirth, Henry; Seibel, Peter


    Keratin intermediate filaments (KIFs) protect the epidermis against mechanical force, support strong adhesion, help barrier formation, and regulate growth. The mechanisms by which type I and II keratins contribute to these functions remain incompletely understood. Here, we report that mice lacking all type I or type II keratins display severe barrier defects and fragile skin, leading to perinatal mortality with full penetrance. Comparative proteomics of cornified envelopes (CEs) from prenatal KtyI−/− and KtyII−/−K8 mice demonstrates that absence of KIF causes dysregulation of many CE constituents, including downregulation of desmoglein 1. Despite persistence of loricrin expression and upregulation of many Nrf2 targets, including CE components Sprr2d and Sprr2h, extensive barrier defects persist, identifying keratins as essential CE scaffolds. Furthermore, we show that KIFs control mitochondrial lipid composition and activity in a cell-intrinsic manner. Therefore, our study explains the complexity of keratinopathies accompanied by barrier disorders by linking keratin scaffolds to mitochondria, adhesion, and CE formation. PMID:26644517

  9. Monitoring Performance of a Dual Wall Permeable Reactive Barrier for Treating Perchlorate and TCE

    NASA Astrophysics Data System (ADS)

    Dowman, C. E.; Hashimoto, Y.; Warner, S.; Bennett, P.; Gandhi, D.; Szerdy, F.; Neville, S.; Fennessy, C.; Scow, K. M.


    AMEC Geomatrix, through collaboration with Aerojet General Corporation and the University of California, Davis (UCD), has performed work leading to the installation of a dual wall permeable reactive barrier (PRB) system capable of treating perchlorate and chlorinated aliphatic hydrocarbon compounds (CAHs), including trichloroethylene (TCE), at Aerojet's Area 40 site in Sacramento, California. This unique system consisted of an upgradient zero-valent iron (ZVI) permeable reactive barrier (PRB) that is intended to not only degrade CAHs, but also, provide hydrogen generated from the ZVI corrosion process, to a downgradient bio-effective PRB (carbohydrate solution circulated through a gravel-packed trench) for destroying perchlorate. The subsurface was characterized during a site investigation, and numerous logistical and site-specific challenges of installation were addressed. The site-specific challenges included installation of a passive remediation system in a remote location with no access to electricity. The selected remediation system was keyed into the undulating bedrock 20 to 25 feet below the ground surface without the use of shoring. Under a collaborative effort, UCD provided initial bench testing. AMEC Geomatrix designed and installed the dual wall system consisting of two approximately parallel 50-foot long by 2-foot thick by 25-foot deep PRB segments which are separated by about 8 feet perpendicular to the approximate direction of groundwater flow. AMEC Geomatrix performed the installation of performance monitoring network, which consisted of 21 wells, and monitored these points for a 6-month period. Monitoring and sampling techniques were designed to measure water levels and water quality parameters in the subsurface during sampling events, to better assess the hydrologic and chemical processes. The monitoring results indicate that the upgradient ZVI PRB effectively treats groundwater with TCE concentrations approaching 60 mg/L, and in addition, may

  10. ZEB2-transgene expression in the epidermis compromises the integrity of the epidermal barrier through the repression of different tight junction proteins.


    Tatari, Marianthi N; De Craene, Bram; Soen, Bieke; Taminau, Joachim; Vermassen, Petra; Goossens, Steven; Haigh, Katharina; Cazzola, Silvia; Lambert, Jo; Huylebroeck, Danny; Haigh, Jody J; Berx, Geert


    Epithelial homeostasis within the epidermis is maintained by means of multiple cell-cell adhesion complexes such as adherens junctions, tight junctions, gap junctions, and desmosomes. These complexes co-operate in the formation and the regulation of the epidermal barrier. Disruption of the epidermal barrier through the deregulation of the above complexes is the cause behind a number of skin disorders such as psoriasis, dermatitis, keratosis, and others. During epithelial-to-mesenchymal transition (EMT), epithelial cells lose their adhesive capacities and gain mesenchymal properties. ZEB transcription factors are key inducers of EMT. In order to gain a better understanding of the functional role of ZEB2 in epidermal homeostasis, we generated a mouse model with conditional overexpression of Zeb2 in the epidermis. Our analysis revealed that Zeb2 expression in the epidermis leads to hyperproliferation due to the combined downregulation of different tight junction proteins compromising the epidermal barrier. Using two epidermis-specific in vivo models and in vitro promoter assays, we identified occludin as a new Zeb2 target gene. Immunohistological analysis performed on human skin biopsies covering various pathogeneses revealed ZEB2 expression in the epidermis of pemphigus vulgaris. Collectively, our data support the notion for a potential role of ZEB2 in intracellular signaling of this disease.

  11. Permeable Reactive Barriers Designed To Mitigate Eutrophication Alter Bacterial Community Composition and Aquifer Redox Conditions.


    Hiller, Kenly A; Foreman, Kenneth H; Weisman, David; Bowen, Jennifer L


    Permeable reactive barriers (PRBs) consist of a labile carbon source that is positioned to intercept nitrate-laden groundwater to prevent eutrophication. Decomposition of carbon in the PRB drives groundwater anoxic, fostering microbial denitrification. Such PRBs are an ideal habitat to examine microbial community structure under high-nitrate, carbon-replete conditions in coastal aquifers. We examined a PRB installed at the Waquoit Bay National Estuarine Research Reserve in Falmouth, MA. Groundwater within and below the PRB was depleted in oxygen compared to groundwater at sites upgradient and at adjacent reference sites. Nitrate concentrations declined from a high of 25 μM upgradient and adjacent to the barrier to <0.1 μM within the PRB. We analyzed the total and active bacterial communities filtered from groundwater flowing through the PRB using amplicons of 16S rRNA and of the 16S rRNA genes. Analysis of the 16S rRNA genes collected from the PRB showed that the total bacterial community had high relative abundances of bacteria thought to have alternative metabolisms, such as fermentation, including candidate phyla OD1, OP3, TM7, and GN02. In contrast, the active bacteria had lower abundances of many of these bacteria, suggesting that the bacterial taxa that differentiate the PRB groundwater community were not actively growing. Among the environmental variables analyzed, dissolved oxygen concentration explained the largest proportion of total community structure. There was, however, no significant correlation between measured environmental parameters and the active microbial community, suggesting that controls on the active portion may differ from the community as a whole.

  12. Effects of ionizing radiation on the blood brain barrier permeability to pharmacologically active substances

    SciTech Connect

    Trnovec, T.; Kallay, Z.; Bezek, S. )


    Ionizing radiation can impair the integrity of the blood brain barrier (BBB). Data on early and late damage after brain irradiation are usually reported separately, yet a gradual transition between these two types has become evident. Signs appearing within 3 weeks after irradiation are considered to be early manifestations. The mechanism of radiation-effected integrity impairment of the BBB is discussed in relation to changes in morphological structures forming the BBB, the endothelium of intracerebral vessels, and in the surrounding astrocytes. Alterations in the function of the BBB are manifested in the endothelium by changes in the ultrastructural location of the activity of phosphatases and by the activation of pinocytotic vesicular transport, and in astrocyte cytoplasm by glycogen deposition. The changes in ultrastructure were critically surveyed with regard to increasing doses of radiation to the brain in the range of 5 Gy to 960 Gy. The qualitative as well as the semiquantitative and quantitative observations on the passage of substances across the damaged BBB were treated separately. Qualitative changes are based mainly on findings of extravasation of vital stains and of labelled proteins. The quantitative studies established differences in radiation-induced changes in the permeability of the BBB depending on the structure and physico-chemical properties of the barrier penetrating tracers. Indirect evaluation of radiation-induced BBB changes is based on studies of pharmacological effects of substances acting on the CNS. In conclusion, radiation impairs significantly the integrity of the BBB following single irradiation of the brain with a dose exceeding 10-15 Gy. The response of the BBB to ionizing radiation is dependent both on the dose to which the brain is exposed and on specific properties of the tracer. 68 references.

  13. Differential permeability of the blood-brain barrier in experimental brain metastases produced by human neoplasms implanted into nude mice.

    PubMed Central

    Zhang, R. D.; Price, J. E.; Fujimaki, T.; Bucana, C. D.; Fidler, I. J.


    This study clarified whether and when the blood-brain barrier in experimental brain metastases is impaired by using hydrosoluble sodium fluorescein (MW 376) as a blood-brain barrier function indicator. Cells from eight human tumor lines (four melanomas, two breast carcinomas, one colon carcinoma, and one renal carcinoma) were inoculated into the internal carotid artery of nude mice. Brain metastases at different stages of development were sampled and the permeability of the blood-brain barrier around the metastases determined. Histologic examination showed two patterns of tumor growth. In the first, tumor cells formed isolated, well-defined nodules in the parenchyma of the brain. In lesions smaller than 0.2 mm2, the blood-brain barrier was intact. In the second, small diffuse nests of tumor cells were distributed throughout the brain parenchyma. The blood-brain barrier was intact until the small tumor cell colonies coalesced to form large tumor masses. These results suggest that the permeability of the blood-brain barrier varies among different experimental brain metastases and that its function is related to the growth pattern and size of the lesions. Images Figure 1 Figure 5 Figure 6 PMID:1443046

  14. The Use of Permeable Barriers to Inhibit Virus Migration in the Subsurface

    NASA Astrophysics Data System (ADS)

    Schulze-Makuch, D.; Guan, H.; Totten, J.; Couroux, E.; Endley, S.; Hielscher, F.; Emmert, S.; Pillai, S. D.


    Ground water is susceptible to fecal contamination due to leaking sewer lines, faulty septic tanks and careless disposal of septic wastes; a problem especially common in low-income areas with no public sewage system. Under these conditions, viral and bacterial infection rates have been shown to increase. However, potential for viral infections can be reduced if the viruses are prevented from reaching the drinking water wells. Laboratory and field studies were conducted to determine whether iron-coated sand (ICS), pure zeolite (PZ) and surfactant modified zeolites (SMZ) could be used to retard virus migration in soils. In the laboratory, using a model aquifer and MS2 bacteriophage (as an enteric virus indicator) we showed that ICS and especially SMZ was able to remove more than 90 % of the injected viruses under various conditions. The removal efficiency of viruses was also tested under field conditions using septic effluent and a constructed submerged wetland. The performance of the wetland was greatly enhanced when using SMZ as filter pack for a pumping well that withdrew water at a downstream location from the wetland. Our results suggest that submerged wetlands, particularly if combined with a pumping well that has a filter pack consisting of surfactant modified zeolite (rather than the usual sand and gravel pack), are efficient in removing viruses from septic effluent. The permeable barrier materials tested here are economical and could significantly reduce the potential for viral contamination of drinking water wells. >

  15. Ammonium removal from groundwater using a zeolite permeable reactive barrier: a pilot-scale demonstration.


    Li, Shengpin; Huang, Guoxin; Kong, Xiangke; Yang, Yingzhao; Liu, Fei; Hou, Guohua; Chen, Honghan


    In situ remediation of ammonium-contaminated groundwater is possible through a zeolite permeable reactive barrier (PRB); however, zeolite's finite sorption capacity limits the long-term field application of PRBs. In this paper, a pilot-scale PRB was designed to achieve sustainable use of zeolite in removing ammonium (NH(4)(+)-N) through sequential nitrification, adsorption, and denitrification. An oxygen-releasing compound was added to ensure aerobic conditions in the upper layers of the PRB where NH(4)(+)-N was microbially oxidized to nitrate. Any remaining NH(4)(+)-N was removed abiotically in the zeolite layer. Under lower redox conditions, nitrate formed during nitrification was removed by denitrifying bacteria colonizing the zeolite. During the long-term operation (328 days), more than 90% of NH(4)(+)-N was consistently removed, and approximately 40% of the influent NH(4)(+)-N was oxidized to nitrate. As much as 60% of the nitrate formed in the PRB was reduced in the zeolite layer after 300 days of operation. Removal of NH(4)(+)-N from groundwater using a zeolite PRB through bacterial nitrification and abiotic adsorption is a promising approach. The zeolite PRB has the advantage of achieving sustainable use of zeolite and immediate NH(4)(+)-N removal.

  16. Efficient Enhancement of Blood-Brain Barrier Permeability Using Acoustic Cluster Therapy (ACT)

    PubMed Central

    Åslund, Andreas K.O.; Snipstad, Sofie; Healey, Andrew; Kvåle, Svein; Torp, Sverre H.; Sontum, Per C.; Davies, Catharina de Lange; van Wamel, Annemieke


    The blood-brain barrier (BBB) is a major obstacle in drug delivery for diseases of the brain, and today there is no standardized route to surpass it. One technique to locally and transiently disrupt the BBB, is focused ultrasound in combination with gas-filled microbubbles. However, the microbubbles used are typically developed for ultrasound imaging, not BBB disruption. Here we describe efficient opening of the BBB using the promising novel Acoustic Cluster Therapy (ACT), that recently has been used in combination with Abraxane® to successfully treat subcutaneous tumors of human prostate adenocarcinoma in mice. ACT is based on the conjugation of microbubbles to liquid oil microdroplets through electrostatic interactions. Upon activation in an ultrasound field, the microdroplet phase transfers to form a larger bubble that transiently lodges in the microvasculature. Further insonation induces volume oscillations of the activated bubble, which in turn induce biomechanical effects that increase the permeability of the BBB. ACT was able to safely and temporarily permeabilize the BBB, using an acoustic power 5-10 times lower than applied for conventional microbubbles, and successfully deliver small and large molecules into the brain. PMID:28042313

  17. Mineral Precipitation Upgradient from a Zero-Valent Iron Permeable Reactive Barrier

    SciTech Connect

    Johnson, R. L.; Thoms, R. B.; Johnson, R. O.; Nurmi, J. T.; Tratnyek, Paul G.


    Core samples taken from a zero-valent iron permeable reactive barrier (ZVI PRB) at Cornhusker Army Ammunition Plant, Nebraska, were analyzed for physical and chemical characteristics. Precipitates containing iron and sulfide were present at much higher concentrations in native aquifer materials just upgradient of the PRB than in the PRB itself. Sulfur mass balance on core solids coupled with trends in ground water sulfate concentrations indicates that the average ground water flow after 20 months of PRB operation was approximately twenty fold less than the regional ground water velocity. Transport and reaction modeling of the aquifer PRB interface suggests that, at the calculated velocity, both iron and hydrogen could diffuse upgradient against ground water flow and thereby contribute to precipitation in the native aquifer materials. The initial hydraulic conductivity (K) of the native materials is less than that of the PRB and, given the observed precipitation in the upgradient native materials, it is likely that K reduction occurred upgradient to rather than within the PRB. Although not directly implicated, guar gum used during installation of the PRB is believed to have played a role in the precipitation and flow reduction processes by enhancing microbial activity.

  18. Life-cycle case study comparison of permeable reactive barrier versus pump-and-treat remediation.


    Higgins, Monica R; Olson, Terese M


    A permeable reactive barrier (PRB) is a passive remediation technology, which over decades of use, may reduce lifetime environmental impacts when compared with a conventional pump-and-treat system (PTS). Greater material production requirements to install PRBs may offset the expected reductions in operational phase impacts and the trade-offs can be investigated in a life-cycle assessment (LCA). The life-cycle environmental impacts of a zerovalent iron (ZVI) containing PRB with a funnel and gate configuration and a PTS were compared in a case study. Potential impacts of the model PRB are driven by the ZVI reactive medium and the energy usage during construction, while for the PTS they are driven by the operational energy demand. Medium longevity governed the magnitude of the potential PRB impacts and the extent to which it was optimal relative to the PTS. Even at conservatively low estimates of longevity, the PRB offers significant environmental advantages in impact categories of human health and ozone depletion. The minimum ZVI longevity for PRB benefit over the PTS system in all impact categories was 10 years. Suggested PRB design innovations to reduce environmental impacts include the development of alternative reactive media and construction methods.

  19. Assessment of a Hydroxyapatite Permeable Reactive Barrier to Remediate Uranium at the Old Rifle Site Colorado.

    SciTech Connect

    Moore, Robert C.; Szecsody, James; Rigali, Mark J.; Vermuel, Vince; Leullen, Jon


    We have performed an initial evaluation and testing program to assess the effectiveness of a hydroxyapatite (Ca10(PO4)6(OH)2) permeable reactive barrier and source area treatment to decrease uranium mobility at the Department of Energy (DOE) former Old Rifle uranium mill processing site in Rifle, western Colorado. Uranium ore was processed at the site from the 1940s to the 1970s. The mill facilities at the site as well as the uranium mill tailings previously stored there have all been removed. Groundwater in the alluvial aquifer beneath the site still contains elevated concentrations of uranium, and is currently used for field tests to study uranium behavior in groundwater and investigate potential uranium remediation technologies. The technology investigated in this work is based on in situ formation of apatite in sediment to create a subsurface apatite PRB and also for source area treatment. The process is based on injecting a solution containing calcium citrate and sodium into the subsurface for constructing the PRB within the uranium plume. As the indigenous sediment micro-organisms biodegrade the injected citrate, the calcium is released and reacts with the phosphate to form hydroxyapatite (precipitate). This paper reports on proof-of-principle column tests with Old Rifle sediment and synthetic groundwater.

  20. Benzene and toluene biodegradation down gradient of a zero-valent iron permeable reactive barrier.


    Chen, Liang; Liu, Fei; Liu, Yulong; Dong, Hongzhong; Colberg, Patricia J S


    This study simulated benzene and toluene biodegradation down gradient of a zero-valent iron permeable reactive barrier (ZVI PRB) that reduces trichloroethylene (TCE). The effects of elevated pH (10.5) and the presence of a common TCE dechlorination by product [cis-1,2-dichloroethene (cis-1,2-DCE)] on benzene and toluene biodegradation were evaluated in batch experiments. The data suggest that alkaline pH (pH 10.5), often observed down gradient of ZVI PRBs, inhibits Fe(III)-mediated biotransformation of both benzene and toluene. Removal was reduced by 43% for benzene and 26% for toluene as compared to the controls. The effect of the addition of cis-1,2-DCE on benzene and toluene biodegradation was positive and resulted in removal that was greater than or equal to the controls. These results suggest that, at least for cis-1,2-DCE, its formation may not be toxic to iron-reducing benzene and toluene degrading bacteria; however, for microbial benzene and toluene removal down gradient of a ZVI PRB, it may be necessary to provide pH control, especially in the case of a biological PRB that is downstream from a ZVI PRB.

  1. Reevaluation of the non-lesional dry skin in atopic dermatitis by acute barrier disruption: an abnormal permeability barrier homeostasis with defective processing to generate ceramide.


    Sugiura, Ayumi; Nomura, Tsuyoshi; Mizuno, Atsuko; Imokawa, Genji


    Atopic dermatitis is characterized by disruption of the cutaneous barrier due to reduced ceramide levels even in non-lesional dry skin. Following further acute barrier disruption by repeated tape strippings, we re-characterized the non-lesional dry skin of subjects with atopic dermatitis, which shows significantly reduced levels of barrier function and ceramide but not of beta-glucocerebrosidase activity. For the first time, we report an abnormal trans-epidermal water loss homeostasis in which delayed recovery kinetics of trans-epidermal water loss occurred on the first day during the 4 days after acute barrier disruption compared with healthy control skin. Interestingly, whereas the higher ceramide level in the stratum corneum of healthy control skin was further significantly up-regulated at 4 days post-tape stripping, the lower ceramide level in the stratum corneum of subjects with atopic dermatitis was not significantly changed. In a parallel study, whereas beta-glucocerebrosidase activity at 4 days post-tape stripping was significantly up-regulated in healthy control skin compared with before tape stripping, the level of that activity remained substantially unchanged in atopic dermatitis. These findings indicate that subjects with atopic dermatitis have a defect in sphingolipid-metabolic processing that generates ceramide in the interface between the stratum corneum and the epidermis. The results also support the notion that the continued disruption of barrier function in atopic dermatitis non-lesional skin is associated with the impaired homeostasis of a ceramide-generating process, which underscores an atopy-specific inflammation-triggered ceramide deficiency that is distinct from other types of dermatitis.

  2. Tight junction regulates epidermal calcium ion gradient and differentiation

    SciTech Connect

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki


    Research highlights: {yields} We disrupted epidermal tight junction barrier in reconstructed epidermis. {yields} It altered Ca{sup 2+} distribution and consequentially differentiation state as well. {yields} Tight junction should affect epidermal homeostasis by maintaining Ca{sup 2+} gradient. -- Abstract: It is well known that calcium ions (Ca{sup 2+}) induce keratinocyte differentiation. Ca{sup 2+} distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca{sup 2+} gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca{sup 2+} gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca{sup 2+} flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca{sup 2+} gradient.

  3. Effects of GSM modulated radio-frequency electromagnetic radiation on permeability of blood-brain barrier in male & female rats.


    Sırav, Bahriye; Seyhan, Nesrin


    With the increased use of mobile phones, their biological and health effects have become more important. Usage of mobile phones near the head increases the possibility of effects on brain tissue. This study was designed to investigate the possible effects of pulse modulated 900MHz and 1800MHz radio-frequency radiation on the permeability of blood-brain barrier of rats. Study was performed with 6 groups of young adult male and female wistar albino rats. The permeability of blood-brain barrier to intravenously injected evans blue dye was quantitatively examined for both control and radio-frequency radiarion exposed groups. For male groups; Evans blue content in the whole brain was found to be 0.08±0.01mg% in the control, 0.13±0.03mg% in 900MHz exposed and 0.26±0.05mg% in 1800MHz exposed animals. In both male radio-frequency radiation exposed groups, the permeability of blood-brain barrier found to be increased with respect to the controls (p<0.01). 1800MHz pulse modulated radio-frequency radiation exposure was found more effective on the male animals (p<0.01). For female groups; dye contents in the whole brains were 0.14±0.01mg% in the control, 0.24±0.03mg% in 900MHz exposed and 0.14±0.02mg% in 1800MHz exposed animals. No statistical variance found between the control and 1800MHz exposed animals (p>0.01). However 900MHz pulse modulated radio-frequency exposure was found effective on the permeability of blood-brain barrier of female animals. Results have shown that 20min pulse modulated radio-frequency radiation exposure of 900MHz and 1800MHz induces an effect and increases the permeability of blood-brain barrier of male rats. For females, 900MHz was found effective and it could be concluded that this result may due to the physiological differences between female and male animals. The results of this study suggest that mobile phone radation could lead to increase the permeability of blood-brain barrier under non-thermal exposure levels. More studies are needed

  4. Design, installation, and performance of a multi-layered permeable reactive barrier, Los Alamos National Laboratory

    SciTech Connect

    Kaszuba, J. P.; Longmire, P. A.; Strietelmeier, E. A.; Taylor, T. P.; Den-Baars, P. S.


    A multi-layered permeable reactive barrier (PRB) has been installed in Mortandad Canyon, on the Pajarito Plateau in the north-central part of LANL, to demonstrate in-situ treatment of a suite of contaminants with dissimilar geochemical properties. The PRB will also mitigate possible vulnerabilities from downgradient contaminant movement within alluvial and deeper perched groundwater. Mortandad Canyon was selected as the location for this demonstration project because the flow of alluvial groundwater is constrained by the geology of the canyon, a large network of monitoring wells already were installed along the canyon reach, and the hydrochemistry and contaminant history of the canyon is well-documented. The PRB uses a funnel-and-gate system with a series of four reactive media cells to immobilize or destroy contaminants present in alluvial groundwater, including strontium-90, plutonium-238,239,240, americium-241, perchlorate, and nitrate. The four cells, ordered by sequence of contact with the groundwater, consist of gravel-sized scoria (for colloid removal); phosphate rock containing apatite (for metals and radionuclides); pecan shells and cotton seed admixed with gravel (bio-barrier, to deplete dissolved oxygen and destroy potential RCRA organic compounds, nitrate and perchlorate); and limestone (pH buffering and anion adsorption). Design elements of the PRB are based on laboratory-scale treatability studies and on a field investigation of hydrologic, geochemical, and geotechnical parameters. The PRB was designed with the following criteria: 1-day residence time within the biobarrier, 10-year lifetime, minimization of surface water infiltration and erosion, optimization of hydraulic capture, and minimization of excavated material requiring disposal. Each layer has been equipped with monitoring wells or ports to allow sampling of groundwater and reactive media, and monitor wells are located immediately adjacent to the up- and down-gradient perimeter of the

  5. The role of the skin barrier in modulating the effects of common skin microbial species on the inflammation, differentiation and proliferation status of epidermal keratinocytes

    PubMed Central


    Background Skin resident microbial species are often thought of either as pathogenic or commensal. However, little is known about the role of the skin barrier in modulating their potential for causing disease. To investigate this question we measured the effects of three microbial species commonly found on the skin (Staphylococcus epidermidis, Staphylococcus aureus, and Propionibacterium acnes) on a reconstructed human epidermal model by either applying the bacteria on the model surface (intact barrier) or adding them to the culture medium (simulating barrier breach). Results When added to the medium, all of the tested species induced inflammatory responses and keratinocyte cell death with species-specific potency. P. acnes and S. epidermidis induced specific alterations in the expression of keratinocyte differentiation and proliferation markers, suggesting a barrier reparation response. S. aureus induced complete keratinocyte cell death. On the contrary, topically applied S. epidermidis and P. acnes caused no inflammatory response even when tested at high concentrations, while topical S. aureus induced a weak reaction. None of the tested species were able to alter the expression of keratinocyte differentiation or expression markers, when applied topically. Conclusions We show that the skin barrier prevents the effects of common skin bacteria on epidermal keratinocyte inflammation, differentiation and proliferation and highlight the importance of skin barrier in defending against the pathogenic effects of common skin bacteria. PMID:24245826

  6. Bifidobacterium animalis ssp. lactis CNCM-I2494 Restores Gut Barrier Permeability in Chronically Low-Grade Inflamed Mice.


    Martín, Rebeca; Laval, Laure; Chain, Florian; Miquel, Sylvie; Natividad, Jane; Cherbuy, Claire; Sokol, Harry; Verdu, Elena F; van Hylckama Vlieg, Johan; Bermudez-Humaran, Luis G; Smokvina, Tamara; Langella, Philippe


    Growing evidence supports the efficacy of many probiotic strains in the management of gastrointestinal disorders associated with deregulated intestinal barrier function and/or structure. In particular, bifidobacteria have been studied for their efficacy to both prevent and treat a broad spectrum of animal and/or human gut disorders. The aim of the current work was thus to evaluate effects on intestinal barrier function of Bifidobacterium animalis ssp. lactis CNCM-I2494, a strain used in fermented dairy products. A chronic dinitrobenzene sulfonic acid (DNBS)-induced low-grade inflammation model causing gut dysfunction in mice was used in order to study markers of inflammation, intestinal permeability, and immune function in the presence of the bacterial strain. In this chronic low-grade inflammation mice model several parameters pointed out the absence of an over active inflammation process. However, gut permeability, lymphocyte populations, and colonic cytokines were found to be altered. B. animalis ssp. lactis CNCM-I2494 was able to protect barrier functions by restoring intestinal permeability, colonic goblet cell populations, and cytokine levels. Furthermore, tight junction (TJ) proteins levels were also measured by qRT-PCR showing the ability of this strain to specifically normalize the level of several TJ proteins, in particular for claudin-4. Finally, B. lactis strain counterbalanced CD4(+) lymphocyte alterations in both spleen and mesenteric lymphoid nodes. It restores the Th1/Th2 ratio altered by the DNBS challenge (which locally augments CD4(+) Th1 cells) by increasing the Th2 response as measured by the increase in the production of major representative Th2 cytokines (IL-4, IL-5, and IL-10). Altogether, these data suggest that B. animalis ssp. lactis CNCM-I2494 may efficiently prevent disorders associated with increased barrier permeability.

  7. Bifidobacterium animalis ssp. lactis CNCM-I2494 Restores Gut Barrier Permeability in Chronically Low-Grade Inflamed Mice

    PubMed Central

    Martín, Rebeca; Laval, Laure; Chain, Florian; Miquel, Sylvie; Natividad, Jane; Cherbuy, Claire; Sokol, Harry; Verdu, Elena F.; van Hylckama Vlieg, Johan; Bermudez-Humaran, Luis G.; Smokvina, Tamara; Langella, Philippe


    Growing evidence supports the efficacy of many probiotic strains in the management of gastrointestinal disorders associated with deregulated intestinal barrier function and/or structure. In particular, bifidobacteria have been studied for their efficacy to both prevent and treat a broad spectrum of animal and/or human gut disorders. The aim of the current work was thus to evaluate effects on intestinal barrier function of Bifidobacterium animalis ssp. lactis CNCM-I2494, a strain used in fermented dairy products. A chronic dinitrobenzene sulfonic acid (DNBS)-induced low-grade inflammation model causing gut dysfunction in mice was used in order to study markers of inflammation, intestinal permeability, and immune function in the presence of the bacterial strain. In this chronic low-grade inflammation mice model several parameters pointed out the absence of an over active inflammation process. However, gut permeability, lymphocyte populations, and colonic cytokines were found to be altered. B. animalis ssp. lactis CNCM-I2494 was able to protect barrier functions by restoring intestinal permeability, colonic goblet cell populations, and cytokine levels. Furthermore, tight junction (TJ) proteins levels were also measured by qRT-PCR showing the ability of this strain to specifically normalize the level of several TJ proteins, in particular for claudin-4. Finally, B. lactis strain counterbalanced CD4+ lymphocyte alterations in both spleen and mesenteric lymphoid nodes. It restores the Th1/Th2 ratio altered by the DNBS challenge (which locally augments CD4+ Th1 cells) by increasing the Th2 response as measured by the increase in the production of major representative Th2 cytokines (IL-4, IL-5, and IL-10). Altogether, these data suggest that B. animalis ssp. lactis CNCM-I2494 may efficiently prevent disorders associated with increased barrier permeability. PMID:27199937

  8. Simulation of Two Strategies to Limit the Impact of Fouling in Permeable Reactive Barriers

    NASA Astrophysics Data System (ADS)

    Li, L.; Benson, C.


    Ground water flow (MODFLOW) and geochemical reactive transport models (RT3D) were used to assess the effectiveness of two strategies in limiting mineral fouling and its impact on hydraulic behavior of continuous- wall permeable reactive barriers (PRBs) employing granular zero valent iron (ZVI). A geochemical algorithm including kinetic expressions of oxidation-reduction and mineral precipitation-dissolution was developed for RT3D. The two strategies that were evaluated are (i) adding pea gravel equalization zones upgradient and down gradient of the reactive zone and (ii) placement of sacrificial pretreatment zones upgradient of the reactive zone. The PRB locates at a three-dimensional heterogeneous sandy aquifer. The sacrificial pretreatment zone contains mixtures of pea gravel and ZVI. Results of simulations show that installation of pea gravel zones provides a more conductive path for ground water flow through the ZVI, which enhances preferential flow and causes greater porosity reductions and shorter residence time in the PRB. After installation of pea gravel zones, the residence time decreases which is caused by short travel distances in the ZVI due to short circuit of preferential flow. Sacrificial pretreatment zones can be used to elevate the ground water pH and consume many of the mineral forming ions to form secondary minerals in before the reactive zone is reached. The remaining mineral forming ions that pass into the reactive zone cause less mineral fouling. However, mineral fouling by Fe(OH)2 still occurs, and this mineral is formed regardless of the influent mineral forming ions. Addition of the sacrificial pretreatment zone slightly decreases the initial median residence time. However, the pretreatment zone retains higher residence time after 30 yrs due to less mineral fouling in the pure ZVI zone.

  9. Simulation of Two Strategies to Enhance Permeable Reactive Barriers in Heterogeneous Aquifer

    NASA Astrophysics Data System (ADS)

    Li, L.; Benson, C.


    Ground water flow (MODFLOW) and geochemical reactive transport models (RT3D) were used to assess the effectiveness of two strategies in limiting mineral fouling and its impact on hydraulic behavior of continuous-wall permeable reactive barriers (PRBs) employing granular zero valent iron (ZVI). A geochemical algorithm including kinetic expressions of oxidation-reduction and mineral precipitation-dissolution was developed for RT3D. The two strategies that were evaluated are (i) adding pea gravel equalization zones upgradient and down gradient of the reactive zone and (ii) placement of sacrificial pretreatment zones upgradient of the reactive zone. The PRB locates at a three-dimensional heterogeneous sandy aquifer. The sacrificial pretreatment zone contains mixtures of pea gravel and ZVI. Results of simulations show that installation of pea gravel zones provides a more conductive path for ground water flow through the ZVI, which enhances preferential flow and causes greater porosity reductions and shorter residence time in the PRB. After installation of pea gravel zones, the esidence time decreases which is caused by short travel distances in the ZVI due to short circuit of preferential flow. Sacrificial pretreatment zones can be used to elevate the ground water pH and consume many of the mineral forming ions to form secondary minerals in before the reactive zone is reached. The remaining mineral forming ions that pass into the reactive zone cause less mineral fouling. However, mineral fouling by Fe(OH)2 still occurs, and this mineral is formed regardless of the influent mineral forming ions. Addition of the sacrificial pretreatment zone slightly decreases the initial median residence time. However, the pretreatment zone retains higher residence time after 30 yrs due to less mineral fouling in the pure ZVI zone.

  10. Remediation of MSW landfill leachate by permeable reactive barrier with vegetation.


    Chiemchaisri, Chart; Chiemchaisri, Wilai; Witthayapirom, Chayanid


    This research was conducted to investigate in situ treatment of leachate by pilot-scale permeable reactive barrier (PRB) with vegetation. Two different types of PRB media, with and without the presence of ferric chloride sludge, for the removal of pollutants were examined. The composite media of PRB comprised a clay and sand mixture of 40:60%w/w (system 1) and a clay, ferric chloride sludge and sand mixture of 30:10:60%w/w (system 2). The system was operated at a hydraulic loading rate of 0.028 m3/m2.d and hydraulic retention time of 10 days. The results showed that the performance of system 2 was better in terms of pollutant removal efficiencies, with average biochemical oxygen demand, chemical oxygen demand and total Kjeldahl nitrogen removals of 76.1%, 68.5% and 73.5%, respectively. Fluorescence excitation-emission matrix analyses of water samples and sequential extraction of PRB media suggested the removal of humic substances through the formation of iron-organic complex. Greenhouse gas (GHG) emissions during the treatment of PRB were 8.2-52.1 mgCH4/m2.d, 69.1-601.8 mgCO2/m2.d and 0.04-0.99 mgN2O/m2.d. The use of system 2 with vegetation resulted in lower GHG emissions. The results show that PRB with vegetation could be used as a primary treatment for leachate from closed landfill sites.

  11. Predicting longevity of iron permeable reactive barriers using multiple iron deactivation models

    NASA Astrophysics Data System (ADS)

    Carniato, L.; Schoups, G.; Seuntjens, P.; Van Nooten, T.; Simons, Q.; Bastiaens, L.


    In this study we investigate the model uncertainties involved in predicting long-term permeable reactive barrier (PRB) remediation efficiency based on a lab-scale column experiment under accelerated flow conditions. A PRB consisting of 20% iron and 80% sand was simulated in a laboratory-scale column and contaminated groundwater was pumped into the column for approximately 1 year at an average groundwater velocity of 3.7E - 1 m d- 1. Dissolved contaminants (PCE, TCE, cis-DCE, trans-DCE and VC) and inorganic (Ca2 +, Fe2 +, TIC and pH) concentrations were measured in groundwater sampled at different times and at eight different distances along the column. These measurements were used to calibrate a multi-component reactive transport model, which subsequently provided predictions of long-term PRB efficiency under reduced flow conditions (i.e., groundwater velocity of 1.4E - 3 m d- 1), representative of a field site of interest in this study. Iron reactive surface reduction due to mineral precipitation and iron dissolution was simulated using four different models. All models were able to reasonably well reproduce the column experiment measurements, whereas the extrapolated long-term efficiency under different flow rates was significantly different between the different models. These results highlight significant model uncertainties associated with extrapolating long-term PRB performance based on lab-scale column experiments. These uncertainties should be accounted for at the PRB design phase, and may be reduced by independent experiments and field observations aimed at a better understanding of reactive surface deactivation mechanisms in iron PRBs.

  12. Chromium-Removal Processes during Groundwater Remediation by a Zerovalent Iron Permeable Reactive Barrier

    SciTech Connect

    Wilkin, Richard T.; Su, Chunming; Ford, Robert G.; Paul, Cynthia J.


    Solid-phase associations of chromium were examined in core materials collected from a full-scale, zerovalent iron permeable reactive barrier (PRB) at the U.S. Coast Guard Support Center located near Elizabeth City, NC. The PRB was installed in 1996 to treat groundwater contaminated with hexavalent chromium. After eight years of operation, the PRB remains effective at reducing concentrations of Cr from average values >1500 {micro}g L{sup -1} in groundwater hydraulically upgradient of the PRB to values <1 {micro}g L{sup -1} in groundwater within and hydraulically downgradient of the PRB. Chromium removal from groundwater occurs at the leading edge of the PRB and also within the aquifer immediately upgradient of the PRB. These regions also witness the greatest amount of secondary mineral formation due to steep geochemical gradients that result from the corrosion of zerovalent iron. X-ray absorption near-edge structure (XANES) spectroscopy indicated that chromium is predominantly in the trivalent oxidation state, confirming that reductive processes are responsible for Cr sequestration. XANES spectra and microscopy results suggest that Cr is, in part, associated with iron sulfide grains formed as a consequence of microbially mediated sulfate reduction in and around the PRB. Results of this study provide evidence that secondary iron-bearing mineral products may enhance the capacity of zerovalent iron systems to remediate Cr in groundwater, either through redox reactions at the mineral-water interface or by the release of Fe(II) to solution via mineral dissolution and/or metal corrosion.

  13. Novel Nrf2 activators from microbial transformation products inhibit blood–retinal barrier permeability in rabbits

    PubMed Central

    Nakagami, Yasuhiro; Masuda, Kayoko; Hatano, Emiko; Inoue, Tatsuya; Matsuyama, Takuya; Iizuka, Mayumi; Ono, Yasunori; Ohnuki, Takashi; Murakami, Yoko; Iwasaki, Masaru; Yoshida, Kazuhiro; Kasuya, Yuji; Komoriya, Satoshi


    Background and Purpose Nuclear factor erythroid 2-related factor 2 (Nrf2) is a redox-sensitive transcription factor that binds to antioxidant response elements located in the promoter region of genes encoding many antioxidant enzymes and phase II detoxifying enzymes. Activation of the Nrf2 pathway seems protective for many organs, and although a well-known Nrf2 activator, bardoxolone methyl, was evaluated clinically for treating chronic kidney disease, it was found to induce adverse events. Many bardoxolone methyl derivatives, mostly derived by chemical modifications, have already been studied. However, we adopted a biotransformation technique to obtain a novel Nrf2 activator. Experimental Approach The potent novel Nrf2 activator, RS9, was obtained from microbial transformation products. Its Nrf2 activity was evaluated by determining NADPH:quinone oxidoreductase-1 induction activity in Hepa1c1c7 cells. We also investigated the effects of RS9 on oxygen-induced retinopathy in rats and glycated albumin-induced blood–retinal barrier permeability in rabbits because many ocular diseases are associated with oxidative stress and inflammation. Key Results Bardoxolone methyl doubled the specific activity of Nrf2 in Hepa1c1c7 cells at a much higher concentration than RS9. Moreover, the induction of Nrf2-targeted genes was observed at a one-tenth lower concentration of RS9. Interestingly, the cytotoxicity of RS9 was substantially reduced compared with bardoxolone methyl. Oral and intravitreal administration of RS9 ameliorated the pathological scores and leakage in the models of retinopathy in rats and ocular inflammation in rabbits respectively. Conclusion and Implications Nrf2 activators are applicable for treating ocular diseases and novel Nrf2 activators have potential as a unique method for prevention and treatment of retinovascular disease. PMID:25363737

  14. Monitoring the removal of phosphate from ground water discharging through a pond-bottom permeable reactive barrier

    USGS Publications Warehouse

    McCobb, T.D.; LeBlanc, D.R.; Massey, A.J.


    Installation of a permeable reactive barrier to intercept a phosphate (PO4) plume where it discharges to a pond provided an opportunity to develop and test methods for monitoring the barrier's performance in the shallow pond-bottom sediments. The barrier is composed of zero-valent-iron mixed with the native sediments to a 0.6-m depth over a 1100-m2 area. Permanent suction, diffusion, and seepage samplers were installed to monitor PO 4 and other chemical species along vertical transects through the barrier and horizontal transects below and near the top of the barrier. Analysis of pore water sampled at about 3-cm vertical intervals by using multilevel diffusion and suction samplers indicated steep decreases in PO4 concentrations in ground water flowing upward through the barrier. Samples from vertically aligned pairs of horizontal multiport suction samplers also indicated substantial decreases in PO4 concentrations and lateral shifts in the plume's discharge area as a result of varying pond stage. Measurements from Lee-style seepage meters indicated substantially decreased PO4 concentrations in discharging ground water in the treated area; temporal trends in water flux were related to pond stage. The advantages and limitations of each sampling device are described. Preliminary analysis of the first 2 years of data indicates that the barrier reduced PO4 flux by as much as 95%. ?? 2009 National Ground Water Association.

  15. The long noncoding RNA TUG1 regulates blood-tumor barrier permeability by targeting miR-144

    PubMed Central

    Cai, Heng; Xue, Yixue; Wang, Ping; Wang, Zhenhua; Li, Zhen; Hu, Yi; Li, Zhiqing; Shang, Xiuli; Liu, Yunhui


    Blood-tumor barrier (BTB) limits the delivery of chemotherapeutic agent to brain tumor tissues. Long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in various biologic processes of tumors. However, the role of lncRNAs in BTB permeability is unclear. LncRNA TUG1 (taurine upregulated gene 1) was highly expressed in glioma vascular endothelial cells from glioma tissues. It also upregulated in glioma co-cultured endothelial cells (GEC) from BTB model in vitro. Knockdown of TUG1 increased BTB permeability, and meanwhile down-regulated the expression of the tight junction proteins ZO-1, occludin, and claudin-5. Both bioinformatics and luciferase reporter assays demonstrated that TUG1 influenced BTB permeability via binding to miR-144. Furthermore, Knockdown of TUG1 also down-regulated Heat shock transcription factor 2 (HSF2), a transcription factor of the heat shock transcription factor family, which was defined as a direct and functional downstream target of miR-144. HSF2 up-regulated the promoter activities and interacted with the promoters of ZO-1, occludin, and claudin-5 in GECs. In conclusion, our results indicate that knockdown of TUG1 increased BTB permeability via binding to miR-144 and then reducing EC tight junction protein expression by targeting HSF2. Thus, TUG1 may represent a useful future therapeutic target for enhancing BTB permeability. PMID:26078353

  16. Effects of Exposure to Blast Overpressure on Intracranial Pressure and Blood-Brain Barrier Permeability in a Rat Model

    PubMed Central

    Kawoos, Usmah; Gu, Ming; Lankasky, Jason; McCarron, Richard M.; Chavko, Mikulas


    Exposure to blast overpressure (BOP) activates a cascade of pathological processes including changes in intracranial pressure (ICP) and blood-brain barrier (BBB) permeability resulting in traumatic brain injury (TBI). In this study the effect of single and multiple exposures at two intensities of BOP on changes in ICP and BBB permeability in Sprague-Dawley rats was evaluated. Animals were exposed to a single or three repetitive (separated by 0.5 h) BOPs at 72 kPa or 110 kPa. ICP was monitored continuously via telemetry for 6 days after exposure to BOP. The alteration in the permeability of BBB was determined by extravasation of Evans Blue (EB) into brain parenchyma. A significant increase in ICP was observed in all groups except the single 72 kPa BOP group. At the same time a marked increase in BBB permeability was also seen in various parts of the brain. The extent of ICP increase as well as BBB permeability change was dependent on intensity and frequency of blast. PMID:27907158

  17. Roundabout 4 regulates blood-tumor barrier permeability through the modulation of ZO-1, Occludin, and Claudin-5 expression.


    Cai, Heng; Liu, Wenjing; Xue, Yixue; Shang, Xiuli; Liu, Jing; Li, Zhen; Wang, Ping; Liu, Libo; Hu, Yi; Liu, Yunhui


    The blood-tumor barrier (BTB) restricts the delivery of chemotherapeutic drug molecules to tumor tissues. We found that the endothelial cell (EC) receptor molecule Roundabout 4 (Robo4) is endogenously expressed in human brain microvascular ECs and that it is upregulated in a BTB model of glioma cocultured ECs. Knockdown of Robo4 in this BTB model increased permeability; short hairpin RNA targeting Robo4 (shRobo4) led to decreased transendothelial electric resistance values, increased BTB permeability, and downregulated expression of the EC tight junction proteins ZO-1, occludin, and claudin-5. Roundabout 4 influenced BTB permeability via binding with its ligand, Slit2. Short hairpin RNA targeting Robo4 also increased matrix metalloproteinase-9 (MMP-9) activity and expression in glioma cocultured ECs; pretreatment with the MMP inhibitor GM6001 partially blocked the effects of shRobo4 on the transendothelial electric resistance values and ZO-1 and occludin expression. Short hairpin RNA targeting Robo4 also upregulated the phosphorylation of Src and Erk1/2; the Src inhibitor PP2 and the Erk1/2 inhibitor PD98059 blocked shRobo4-mediated alteration in ZO-1 and occludin expression. Together, our results indicate that knockdown of Robo4 increased BTB permeability by reducing EC tight junction protein expression, and that the Src-Erk1/2-MMP-9 signal pathways are involved in this process. Thus, Robo4 may represent a useful future therapeutic target for enhancing BTB permeability.

  18. Transendothelial permeability changes induced by free radicals in an in vitro model of the blood-brain barrier.


    Lagrange, P; Romero, I A; Minn, A; Revest, P A


    In the present study, we investigated the changes in blood-brain barrier (BBB) permeability following brain endothelial cell exposure to different xenobiotics able to promote free radical generation during their metabolism. Our in vitro BBB model consisted of confluent monolayers of immortalized rat brain capillary endothelial cells (RBE4) grown on collagen-coated filters in the presence of C6 glioma cells grown in the lower compartment. We have recently shown that a range of xenobiotics, including menadione, nitrofurazone, and methylviologen (paraquat) may undergo monoelectronic redox cycling in isolated brain capillaries, giving rise to reactive oxygen species. In this study, addition of 100 microM menadione to the culture medium for 30 min significantly increased the permeability of endothelial cell monolayers to radiolabeled sucrose. The effect on endothelial permeability induced by menadione was dose-dependent and reversible. These permeability changes preceded the onset of cell death, as assessed by the Trypan blue exclusion method. Pre-incubation with superoxide dismutase and catalase blocked changes in sucrose permeability to control levels in a dose-dependent manner, suggesting the involvement of reactive oxygen species in menadione-induced BBB opening.

  19. Permeability assessment of the focused ultrasound-induced blood-brain barrier opening using dynamic contrast-enhanced MRI

    NASA Astrophysics Data System (ADS)

    Vlachos, F.; Tung, Y.-S.; Konofagou, E. E.


    Focused ultrasound (FUS) in conjunction with microbubbles has been shown to successfully open the blood-brain barrier (BBB) in the mouse brain. In this study, we compute the BBB permeability after opening in vivo. The spatial permeability of the BBB-opened region was assessed using dynamic contrast-enhanced MRI (DCE-MRI). The DCE-MR images were post-processed using the general kinetic model (GKM) and the reference region model (RRM). Permeability maps were generated and the Ktrans values were calculated for a predefined volume of interest in the sonicated and the control area for each mouse. The results demonstrated that Ktrans in the BBB-opened region (0.02 ± 0.0123 for GKM and 0.03 ± 0.0167 min-1 for RRM) was at least two orders of magnitude higher when compared to the contra-lateral (control) side (0 and 8.5 × 10-4 ± 12 × 10-4 min-1, respectively). The permeability values obtained with the two models showed statistically significant agreement and excellent correlation (R2 = 0.97). At histological examination, it was concluded that no macroscopic damage was induced. This study thus constitutes the first permeability assessment of FUS-induced BBB opening using DCE-MRI, supporting the fact that the aforementioned technique may constitute a safe, non-invasive and efficacious drug delivery method.

  20. Evolution of blood-brain-barrier permeability after acute ischemic stroke

    PubMed Central


    The dynamics of BBB permeability after AIS in humans are not well understood. In the present study we measured the evolution of BBB permeability after AIS in humans using MRI. Patients presenting to our institution with a diagnosis of AIS underwent a single dynamic contrast-enhanced MRI (DCE-MRI) sequence to measure BBB permeability during their initial workup. Forty-two patients were included in the final analysis. The patient sample underwent DCE-MRI at a mean time of 23.8hrs after the onset of AIS symptoms (range: 1.3–90.7hrs). At all time-points the BBB permeability within the infarct region of the brain as defined on DWI/ADC was higher compared to the homologous region of the contralateral hemisphere (p<0.005). BBB permeability, expressed as a ratio of infarct permeability to contralateral permeability, was greatest at 6-48hrs after the onset of AIS. Although the data was not acquired longitudinally, these findings suggest that the permeability of the BBB is continually elevated following AIS, which contradicts previous assertions that BBB permeability after AIS follows a biphasic course. Knowledge of BBB dynamics following AIS may provide insight into future treatments for AIS, especially BBB stabilizing agents. PMID:28207745

  1. Documentation of impaired epidermal barrier in mild and moderate diaper dermatitis in vivo using noninvasive methods.


    Stamatas, Georgios N; Zerweck, Charles; Grove, Gary; Martin, Katharine M


    The presence of irritants from feces and urine with the concurrent mechanical friction and occlusion creates an environment in the diapered area that renders the skin prone to diaper dermatitis. Besides being a source of discomfort to the infant, these skin irritations pose a risk of secondary infections. In this study, we used noninvasive in vivo techniques to define measurable parameters that correlate with diaper dermatitis pathophysiology. In 35 infants (16 with mild or moderate and 19 without diaper dermatitis) we compared skin of diapered areas afflicted with diaper dermatitis to lesion-free diapered sites and to skin outside the diapered area (thigh). Our findings show significantly elevated cutaneous erythema, pH, and hydration, with significantly compromised water barrier function in involved areas compared to nonlesional sites both within and outside the diapered area. Furthermore, skin pH in nonlesional diapered skin for the diaper dermatitis cohort was significantly higher compared to the nondiapered sites. These observations are consistent with the current understanding of pathological skin changes in diaper dermatitis. In this study, we demonstrate that noninvasive methods can document relevant parameters to diaper dermatitis in vivo.

  2. Cardiotoxic drugs Herceptin and doxorubicin inhibit cardiac microvascular endothelial cell barrier formation resulting in increased drug permeability

    PubMed Central

    Wilkinson, Emma L.; Sidaway, James E.


    ABSTRACT Cardiotoxicity induced by anti-cancer therapeutics is a severe, and potentially fatal, adverse reaction of the heart in response to certain drugs. Current in vitro approaches to assess cardiotoxicity have focused on analysing cardiomyocytes. More recently it has become apparent that non-cardiomyocyte cells of the heart can potentially contribute to cardiotoxicity. Herceptin and doxorubicin are known to induce cardiotoxicity in the clinic. The effect of these drugs on the endothelial tight junction barrier was tested by analysing tight junction formation and zona occludens-1 (ZO-1) levels, revealing that Herceptin and doxorubicin are able to induce barrier perturbment and decrease barrier function in human cardiac microvascular endothelial cells (HCMECs) leading to increased permeability. Herceptin treatment had no effect on the tight junction barrier function in human dermal and human brain microvascular endothelial cells. HCMECs showed detectable levels of HER2 compared with the other endothelial cells suggesting that Herceptin binding to HER2 in these cells may interfere with tight junction formation. Our data suggests that doxorubicin and Herceptin can affect tight junction formation in the cardiac microvasculature leading to increased drug permeability and adverse effects on the cardiac myocytes. PMID:27543060

  3. Zero-Valent Iron Permeable Reactive Barriers: A Review of Performance

    SciTech Connect

    Korte, NE


    This report briefly reviews issues regarding the implementation of the zero-valent iron permeable reactive barrier (PRB) technology at sites managed by the U.S. Department of Energy (DOE). Initially, the PRB technology, using zero-valent iron for the reactive media, was received with great enthusiasm, and DOE invested millions of dollars testing and implementing PRBs. Recently, a negative perception of the technology has been building. This perception is based on the failure of some deployments to satisfy goals for treatment and operating expenses. The purpose of this report, therefore, is to suggest reasons for the problems that have been encountered and to recommend whether DOE should invest in additional research and deployments. The principal conclusion of this review is that the most significant problems have been the result of insufficient characterization, which resulted in poor engineering implementation. Although there are legitimate concerns regarding the longevity of the reactive media, the ability of zero-valent iron to reduce certain chlorinated hydrocarbons and to immobilize certain metals and radionuclides is well documented. The primary problem encountered at some DOE full-scale deployments has been an inadequate assessment of site hydrology, which resulted in misapplication of the technology. The result is PRBs with higher than expected flow velocities and/or incomplete plume capture. A review of the literature reveals that cautions regarding subsurface heterogeneity were published several years prior to the full-scale implementations. Nevertheless, design and construction have typically been undertaken as if the subsurface was homogeneous. More recently published literature has demonstrated that hydraulic heterogeneity can cause so much uncertainty in performance that use of a passive PRB is precluded. Thus, the primary conclusion of this review is that more attention must be given to site-specific issues. Indeed, the use of a passive PRB requires

  4. Experimental and Theoretical Assessment of the Lifetime of a Gaseous-Reduced Vadose Zone Permeable Reactive Barrier

    SciTech Connect

    Thornton, Edward C.; Zhong, Lirong; Oostrom, Mart; Deng, Baolin


    The feasibility of using gaseous reduction to establish a vadose zone permeable reactive barrier was evaluated through a combination of laboratory testing activities and consideration of fundamental vadose zone transport concepts. For the experimental evaluation, a series of laboratory column tests were conducted in which sediment was first treated with diluted hydrogen sulfide. Water containing dissolved oxygen was then pumped through the columns at different flow rates to determine the reoxidation rate and the reductive capacity of the treated sediment. The results indicated that the treated sediment has a significant reductive capacity consistent with the basic reactions associated with the treatment and reoxidation processes. The observed reductive capacity was found to be dependent on the flow rate of water during the reoxidation phase of the tests. At lower flow rates, the reductive capacity approached the maximum value predicted on the basis of the treatment reaction. Thus, laboratory treatment tests should reliably predict the reductive capacity of the barrier under field conditions. A theoretical approach was undertaken to estimate the lifetime of the vadose zone barrier. An initial model assumed that the barrier lifetime is determined by the reoxidation of the barrier owing to the transport of oxygen through a vadose zone interval in which all sediment is unsaturated. The results of this evaluation suggest that barrier reoxidation is primarily related to diffusion of oxygen through the gas-filled portion of the sediment pore space. If so, the barrier lifetime could be fairly short (several years). However, the presence of finer grained strata with higher moisture content could potentially increase the barrier lifetime to 100 years or more owing to a decrease in the effective diffusion coefficient for oxygen. Thus, detailed stratagraphic characterization and modeling is needed to provide an accurate assessment of barrier lifetime at specific sites.

  5. Overview on backfill materials and permeable reactive barriers for nuclear waste disposal facilities.

    SciTech Connect

    Moore, Robert Charles; Hasan, Ahmed Ali Mohamed; Holt, Kathleen Caroline; Hasan, Mahmoud A. (Egyptian Atomic Energy Authority, Cairo, Egypt)


    A great deal of money and effort has been spent on environmental restoration during the past several decades. Significant progress has been made on improving air quality, cleaning up and preventing leaching from dumps and landfills, and improving surface water quality. However, significant challenges still exist in all of these areas. Among the more difficult and expensive environmental problems, and often the primary factor limiting closure of contaminated sites following surface restoration, is contamination of ground water. The most common technology used for remediating ground water is surface treatment where the water is pumped to the surface, treated and pumped back into the ground or released at a nearby river or lake. Although still useful for certain remediation scenarios, the limitations of pump-and-treat technologies have recently been recognized, along with the need for innovative solutions to ground-water contamination. Even with the current challenges we face there is a strong need to create geological repository systems for dispose of radioactive wastes containing long-lived radionuclides. The potential contamination of groundwater is a major factor in selection of a radioactive waste disposal site, design of the facility, future scenarios such as human intrusion into the repository and possible need for retrieving the radioactive material, and the use of backfills designed to keep the radionuclides immobile. One of the most promising technologies for remediation of contaminated sites and design of radioactive waste repositories is the use of permeable reactive barriers (PRBs). PRBs are constructed of reactive material(s) to intercept and remove the radionuclides from the water and decontaminate the plumes in situ. The concept of PRBs is relatively simple. The reactive material(s) is placed in the subsurface between the waste or contaminated area and the groundwater. Reactive materials used thus far in practice and research include zero valent iron

  6. Permeability of ergot alkaloids across the blood-brain barrier in vitro and influence on the barrier integrity

    PubMed Central

    Mulac, Dennis; Hüwel, Sabine; Galla, Hans-Joachim; Humpf, Hans-Ulrich


    Scope Ergot alkaloids are secondary metabolites of Claviceps spp. and they have been in the focus of research for many years. Experiments focusing on ergotamine as a former migraine drug referring to the ability to reach the brain revealed controversial results. The question to which extent ergot alkaloids are able to cross the blood-brain barrier is still not answered. Methods and results In order to answer this question we have studied the ability of ergot alkaloids to penetrate the blood-brain barrier in a well established in vitro model system using primary porcine brain endothelial cells. It could clearly be demonstrated that ergot alkaloids are able to cross the blood-brain barrier in high quantities in only a few hours. We could further identify an active transport for ergometrine as a substrate for the BCRP/ABCG2 transporter. Investigations concerning barrier integrity properties have identified ergocristinine as a potent substance to accumulate in these cells ultimately leading to a weakened barrier function. Conclusion For the first time we could show that the so far as biologically inactive described 8-(S) isomers of ergot alkaloids seem to have an influence on barrier integrity underlining the necessity for a risk assessment of ergot alkaloids in food and feed. PMID:22147614

  7. In vivo assessment of the permeability of the blood-brain barrier and blood-retinal barrier to fluorescent indoline derivatives in zebrafish

    PubMed Central


    Background Successful delivery of compounds to the brain and retina is a challenge in the development of therapeutic drugs and imaging agents. This challenge arises because internalization of compounds into the brain and retina is restricted by the blood–brain barrier (BBB) and blood-retinal barrier (BRB), respectively. Simple and reliable in vivo assays are necessary to identify compounds that can easily cross the BBB and BRB. Methods We developed six fluorescent indoline derivatives (IDs) and examined their ability to cross the BBB and BRB in zebrafish by in vivo fluorescence imaging. These fluorescent IDs were administered to live zebrafish by immersing the zebrafish larvae at 7-8 days post fertilization in medium containing the ID, or by intracardiac injection. We also examined the effect of multidrug resistance proteins (MRPs) on the permeability of the BBB and BRB to the ID using MK571, a selective inhibitor of MRPs. Results The permeability of these barriers to fluorescent IDs administered by simple immersion was comparable to when administered by intracardiac injection. Thus, this finding supports the validity of drug administration by simple immersion for the assessment of BBB and BRB permeability to fluorescent IDs. Using this zebrafish model, we demonstrated that the length of the methylene chain in these fluorescent IDs significantly affected their ability to cross the BBB and BRB via MRPs. Conclusions We demonstrated that in vivo assessment of the permeability of the BBB and BRB to fluorescent IDs could be simply and reliably performed using zebrafish. The structure of fluorescent IDs can be flexibly modified and, thus, the permeability of the BBB and BRB to a large number of IDs can be assessed using this zebrafish-based assay. The large amount of data acquired might be useful for in silico analysis to elucidate the precise mechanisms underlying the interactions between chemical structure and the efflux transporters at the BBB and BRB. In turn

  8. Qualitative and quantitative structure-activity relationship modelling for predicting blood-brain barrier permeability of structurally diverse chemicals.


    Gupta, S; Basant, N; Singh, K P


    In this study, structure-activity relationship (SAR) models have been established for qualitative and quantitative prediction of the blood-brain barrier (BBB) permeability of chemicals. The structural diversity of the chemicals and nonlinear structure in the data were tested. The predictive and generalization ability of the developed SAR models were tested through internal and external validation procedures. In complete data, the QSAR models rendered ternary classification accuracy of >98.15%, while the quantitative SAR models yielded correlation (r(2)) of >0.926 between the measured and the predicted BBB permeability values with the mean squared error (MSE) <0.045. The proposed models were also applied to an external new in vitro data and yielded classification accuracy of >82.7% and r(2) > 0.905 (MSE < 0.019). The sensitivity analysis revealed that topological polar surface area (TPSA) has the highest effect in qualitative and quantitative models for predicting the BBB permeability of chemicals. Moreover, these models showed predictive performance superior to those reported earlier in the literature. This demonstrates the appropriateness of the developed SAR models to reliably predict the BBB permeability of new chemicals, which can be used for initial screening of the molecules in the drug development process.

  9. Contributions of altered permeability of intestinal barrier and defecation behavior to toxicity formation from graphene oxide in nematode Caenorhabditis elegans.


    Wu, Qiuli; Yin, Li; Li, Xing; Tang, Meng; Zhang, Tao; Wang, Dayong


    Graphene oxide (GO) has been extensively studied for potential biomedical applications. Meanwhile, potential GO toxicity arises in both biomedical applications and non-biomedical products where environmental exposures may occur. In the present study, we examined the potential adverse effects of GO and the underlying mechanism using nematode Caenorhabditis elegans as the assay system. We compared the in vivo effects of GO between acute exposure and prolonged exposure, and found that prolonged exposure to 0.5-100 mg L(-1) of GO caused damage on functions of both primary (intestine) and secondary (neuron and reproductive organ) targeted organs. In the intestine, ROS production was significantly correlated with the formation of adverse effects on functions of both primary and secondary targeted organs. GO could be translocated into intestinal cells with loss of microvilli, and distributed to be adjacent to or surrounding mitochondria. Prolonged exposure to GO resulted in a hyper-permeable state of the intestinal barrier, an increase in mean defecation cycle length, and alteration of genes required for intestinal development and defecation behavior. Thus, our data suggest that prolonged exposure to GO may cause potential risk to environmental organisms after release into the environment. GO toxicity may be due to the combinational effects of oxidative stress in the intestinal barrier, enhanced permeability of the biological barrier, and suppressed defecation behavior in C. elegans.

  10. In vivo two-photon imaging measuring the blood-brain barrier permeability during early postnatal brain development in rodent

    NASA Astrophysics Data System (ADS)

    Shi, Lingyan; Rodríguez-Contreras, Adrián.


    The blood-brain barrier (BBB) is a unique structure between the cerebral blood circulation and the delicate neural environment that is important in regulating the movement of molecules and ions involved in brain development and function. However, little is known about the physiological permeability of molecules and ions across the BBB during brain development. In this study we applied an innovative approach to examine the development of BBB properties quantitatively. Two-photon microscopy was employed to measure BBB permeability in real time in vivo. Vascular growth and specific interactions between astrocyte end feet and microvessels were studied by using a combination of IB4 histochemistry, immunohistochemistry, confocal microscopy and 3D analysis.

  11. Hyperosmolar opening of the blood-brain barrier in the energy-depleted rat brain. Part 1. Permeability studies

    SciTech Connect

    Greenwood, J.; Luthert, P.J.; Pratt, O.E.; Lantos, P.L.


    A simple saline perfusion system was used to investigate the effects of hyperosmolar solutions of arabinose and mannitol upon the permeability of the blood-brain barrier. The small, polar molecule (/sup 14/C)mannitol and the larger, visual marker Evans blue were used as indicators of barrier integrity in the perfused energy-depleted brain. One-minute perfusion of hyperosmolar solutions consistently opened the barrier suggesting that the mechanism of osmotic barrier opening is independent of energy-producing metabolism. The accumulation of radiolabel in the brain was expressed as the ratio of tissue to perfusate radioactivity (Rt/Rp) and, for cerebrum, this increased from a control value of 0.0022 +/- 0.0007 (mean +/- SEM; n = 4) to a value of 0.0124 +/- 0.0008 (n = 4) following 0.9 M arabinose and to 0.0495 +/- 0.0072 (n = 4) following 1.8 M arabinose. There was a significant reduction of water content of hyperosmolar perfused brains. These findings support the hypothesis that osmotic barrier opening is the result of the passive shrinkage of endothelial cells and the surrounding tissue.

  12. A Method to Predict Blood-Brain Barrier Permeability of Drug-Like Compounds Using Molecular Dynamics Simulations

    PubMed Central

    Carpenter, Timothy S.; Kirshner, Daniel A.; Lau, Edmond Y.; Wong, Sergio E.; Nilmeier, Jerome P.; Lightstone, Felice C.


    The blood-brain barrier (BBB) is formed by specialized tight junctions between endothelial cells that line brain capillaries to create a highly selective barrier between the brain and the rest of the body. A major problem to overcome in drug design is the ability of the compound in question to cross the BBB. Neuroactive drugs are required to cross the BBB to function. Conversely, drugs that target other parts of the body ideally should not cross the BBB to avoid possible psychotropic side effects. Thus, the task of predicting the BBB permeability of new compounds is of great importance. Two gold-standard experimental measures of BBB permeability are logBB (the concentration of drug in the brain divided by concentration in the blood) and logPS (permeability surface-area product). Both methods are time-consuming and expensive, and although logPS is considered the more informative measure, it is lower throughput and more resource intensive. With continual increases in computer power and improvements in molecular simulations, in silico methods may provide viable alternatives. Computational predictions of these two parameters for a sample of 12 small molecule compounds were performed. The potential of mean force for each compound through a 1,2-dioleoyl-sn-glycero-3-phosphocholine bilayer is determined by molecular dynamics simulations. This system setup is often used as a simple BBB mimetic. Additionally, one-dimensional position-dependent diffusion coefficients are calculated from the molecular dynamics trajectories. The diffusion coefficient is combined with the free energy landscape to calculate the effective permeability (Peff) for each sample compound. The relative values of these permeabilities are compared to experimentally determined logBB and logPS values. Our computational predictions correlate remarkably well with both logBB (R2 = 0.94) and logPS (R2 = 0.90). Thus, we have demonstrated that this approach may have the potential to provide reliable

  13. Developing Enhanced Blood–Brain Barrier Permeability Models: Integrating External Bio-Assay Data in QSAR Modeling

    PubMed Central

    Wang, Wenyi; Kim, Marlene T.; Sedykh, Alexander


    Purpose Experimental Blood–Brain Barrier (BBB) permeability models for drug molecules are expensive and time-consuming. As alternative methods, several traditional Quantitative Structure-Activity Relationship (QSAR) models have been developed previously. In this study, we aimed to improve the predictivity of traditional QSAR BBB permeability models by employing relevant public bio-assay data in the modeling process. Methods We compiled a BBB permeability database consisting of 439 unique compounds from various resources. The database was split into a modeling set of 341 compounds and a validation set of 98 compounds. Consensus QSAR modeling workflow was employed on the modeling set to develop various QSAR models. A five-fold cross-validation approach was used to validate the developed models, and the resulting models were used to predict the external validation set compounds. Furthermore, we used previously published membrane transporter models to generate relevant transporter profiles for target compounds. The transporter profiles were used as additional biological descriptors to develop hybrid QSAR BBB models. Results The consensus QSAR models have R2=0.638 for fivefold cross-validation and R2=0.504 for external validation. The consensus model developed by pooling chemical and transporter descriptors showed better predictivity (R2=0.646 for five-fold cross-validation and R2=0.526 for external validation). Moreover, several external bio-assays that correlate with BBB permeability were identified using our automatic profiling tool. Conclusions The BBB permeability models developed in this study can be useful for early evaluation of new compounds (e.g., new drug candidates). The combination of chemical and biological descriptors shows a promising direction to improve the current traditional QSAR models. PMID:25862462

  14. Characterization of passive permeability at the blood-tumor barrier in five preclinical models of brain metastases of breast cancer.


    Adkins, Chris E; Mohammad, Afroz S; Terrell-Hall, Tori B; Dolan, Emma L; Shah, Neal; Sechrest, Emily; Griffith, Jessica; Lockman, Paul R


    The blood-brain barrier (BBB) is compromised in brain metastases, allowing for enhanced drug permeation into brain. The extent and heterogeneity of BBB permeability in metastatic lesions is important when considering the administration of chemotherapeutics. Since permeability characteristics have been described in limited experimental models of brain metastases, we sought to define these changes in five brain-tropic breast cancer cell lines: MDA-MB-231BR (triple negative), MDA-MB-231BR-HER2, JIMT-1-BR3, 4T1-BR5 (murine), and SUM190 (inflammatory HER2 expressing). Permeability was assessed using quantitative autoradiography and fluorescence microscopy by co-administration of the tracers (14)C-aminoisobutyric acid (AIB) and Texas red conjugated dextran prior to euthanasia. Each experimental brain metastases model produced variably increased permeability to both tracers; additionally, the magnitude of heterogeneity was different among each model with the highest ranges observed in the SUM190 (up to 45-fold increase in AIB) and MDA-MB-231BR-HER2 (up to 33-fold in AIB) models while the lowest range was observed in the JIMT-1-BR3 (up to 5.5-fold in AIB) model. There was no strong correlation observed between lesion size and permeability in any of these preclinical models of brain metastases. Interestingly, the experimental models resulting in smaller mean metastases size resulted in shorter median survival while models producing larger lesions had longer median survival. These findings strengthen the evidence of heterogeneity in brain metastases of breast cancer by utilizing five unique experimental models and simultaneously emphasize the challenges of chemotherapeutic approaches to treat brain metastases.

  15. Excess soluble CD40L contributes to blood brain barrier permeability in vivo: implications for HIV-associated neurocognitive disorders.


    Davidson, Donna C; Hirschman, Michael P; Sun, Anita; Singh, Meera V; Kasischke, Karl; Maggirwar, Sanjay B


    Despite the use of anti-retroviral therapies, a majority of HIV-infected individuals still develop HIV-Associated Neurocognitive Disorders (HAND), indicating that host inflammatory mediators, in addition to viral proteins, may be contributing to these disorders. Consistently, we have previously shown that levels of the inflammatory mediator soluble CD40L (sCD40L) are elevated in the circulation of HIV-infected, cognitively impaired individuals as compared to their infected, non-impaired counterparts. Recent studies from our group suggest a role for the CD40/CD40L dyad in blood brain barrier (BBB) permeability and interestingly, sCD40L is thought to regulate BBB permeability in other inflammatory disorders of the CNS. Using complementary multiphoton microscopy and quantitative analyses in wild-type and CD40L deficient mice, we now reveal that the HIV transactivator of transcription (Tat) can induce BBB permeability in a CD40L-dependent manner. This permeability of the BBB was found to be the result of aberrant platelet activation induced by Tat, since depletion of platelets prior to treatment reversed Tat-induced BBB permeability. Furthermore, Tat treatment led to an increase in granulocyte antigen 1 (Gr1) positive monocytes, indicating an expansion of the inflammatory subset of cells in these mice, which were found to adhere more readily to the brain microvasculature in Tat treated animals. Exploring the mechanisms by which the BBB becomes compromised during HIV infection has the potential to reveal novel therapeutic targets, thereby aiding in the development of adjunct therapies for the management of HAND, which are currently lacking.

  16. Excess Soluble CD40L Contributes to Blood Brain Barrier Permeability In Vivo: Implications for HIV-Associated Neurocognitive Disorders

    PubMed Central

    Davidson, Donna C.; Hirschman, Michael P.; Sun, Anita; Singh, Meera V.; Kasischke, Karl; Maggirwar, Sanjay B.


    Despite the use of anti-retroviral therapies, a majority of HIV-infected individuals still develop HIV-Associated Neurocognitive Disorders (HAND), indicating that host inflammatory mediators, in addition to viral proteins, may be contributing to these disorders. Consistently, we have previously shown that levels of the inflammatory mediator soluble CD40L (sCD40L) are elevated in the circulation of HIV-infected, cognitively impaired individuals as compared to their infected, non-impaired counterparts. Recent studies from our group suggest a role for the CD40/CD40L dyad in blood brain barrier (BBB) permeability and interestingly, sCD40L is thought to regulate BBB permeability in other inflammatory disorders of the CNS. Using complementary multiphoton microscopy and quantitative analyses in wild-type and CD40L deficient mice, we now reveal that the HIV transactivator of transcription (Tat) can induce BBB permeability in a CD40L-dependent manner. This permeability of the BBB was found to be the result of aberrant platelet activation induced by Tat, since depletion of platelets prior to treatment reversed Tat-induced BBB permeability. Furthermore, Tat treatment led to an increase in granulocyte antigen 1 (Gr1) positive monocytes, indicating an expansion of the inflammatory subset of cells in these mice, which were found to adhere more readily to the brain microvasculature in Tat treated animals. Exploring the mechanisms by which the BBB becomes compromised during HIV infection has the potential to reveal novel therapeutic targets, thereby aiding in the development of adjunct therapies for the management of HAND, which are currently lacking. PMID:23251626

  17. Selected hydrologic data for the field demonstration of three permeable reactive barriers near Fry Canyon, Utah, 1996-2000

    USGS Publications Warehouse

    Wilkowske, Chris D.; Rowland, Ryan C.; Naftz, David L.


    Three permeable reactive barriers (PRBs) were installed near Fry Canyon, Utah, in August 1997 to demonstrate the use of PRBs to control the migration of uranium in ground water. Reactive material included (1) bone-char phosphate, (2) zero-valent iron pellets, and (3) amorphous ferric oxyhydroxide coated gravel. An extensive monitoring network was installed in and around each PRB for collection of water samples, analysis of selected water-quality parameters, and monitoring of water levels. Water temperature, specific conductance, pH, Eh (oxidation-reduction potential), and dissolved oxygen were measured continuously within three different barrier materials, and in two monitoring wells. Water temperature and water level below land surface were electronically recorded every hour with pressure transducers. Data were collected from ground-water monitoring wells installed in and around the PRBs during 1996-98 and from surface-water sites in Fry Creek.

  18. The effects of polar excipients transcutol and dexpanthenol on molecular mobility, permeability, and electrical impedance of the skin barrier.


    Björklund, Sebastian; Pham, Quoc Dat; Jensen, Louise Bastholm; Knudsen, Nina Østergaard; Nielsen, Lars Dencker; Ekelund, Katarina; Ruzgas, Tautgirdas; Engblom, Johan; Sparr, Emma


    In the development of transdermal and topical products it is important to understand how formulation ingredients interact with the molecular components of the upper layer of the skin, the stratum corneum (SC), and thereby influence its macroscopic barrier properties. The aim here was to investigate the effect of two commonly used excipients, transcutol and dexpanthenol, on the molecular as well as the macroscopic properties of the skin membrane. Polarization transfer solid-state NMR methods were combined with steady-state flux and impedance spectroscopy measurements to investigate how these common excipients influence the molecular components of SC and its barrier function at strictly controlled hydration conditions in vitro with excised porcine skin. The NMR results provide completely new molecular insight into how transcutol and dexpanthenol affect specific molecular segments of both SC lipids and proteins. The presence of transcutol or dexpanthenol in the formulation at fixed water activity results in increased effective skin permeability of the model drug metronidazole. Finally, impedance spectroscopy data show clear changes of the effective skin capacitance after treatment with transcutol or dexpanthenol. Based on the complementary data, we are able to draw direct links between effects on the molecular properties and on the macroscopic barrier function of the skin barrier under treatment with formulations containing transcutol or dexpanthenol.

  19. No Dynamic Changes in Blood-brain Barrier Permeability Occur in Developing Rats During Local Cortex Exposure to Microwaves.


    Masuda, Hiroshi; Hirota, Shogo; Ushiyama, Akira; Hirata, Akimasa; Arima, Takuji; Kawai, Hiroki; Wake, Kanako; Watanabe, Soichi; Taki, Masao; Nagai, Akiko; Ohkubo, Chiyoji


    Little information is available about the effects of exposure to radiofrequency electromagnetic fields (RF) on cerebral microcirculation during rat developmental stages. We investigated whether the permeability of the blood-brain barrier (BBB) in juvenile and young adult rats was modified during local cortex exposure to RF under non-thermal conditions. The cortex tissue targeted was locally exposed to 1457 MHz RF at an average specific absorption rate of 2.0 W/kg in the target area for 50 min and permeability changes in the BBB of the pia mater were measured directly, using intravital fluorescence microscopy. There was no significant difference in extravasation of intravenously-injected dye between exposed and sham-exposed groups of either category of rats. No histological evidence of albumin leakage was found in any of the brains just after exposure, indicating that no traces of BBB disruption remained. These findings suggest that no dynamic changes occurred in BBB permeability of the rats at either of these developmental stages, even during local RF exposure at non-thermal levels.

  20. Unexpected effects of peripherally administered kynurenic acid on cortical spreading depression and related blood–brain barrier permeability

    PubMed Central

    Oláh, Gáspár; Herédi, Judit; Menyhárt, Ákos; Czinege, Zsolt; Nagy, Dávid; Fuzik, János; Kocsis, Kitti; Knapp, Levente; Krucsó, Erika; Gellért, Levente; Kis, Zsolt; Farkas, Tamás; Fülöp, Ferenc; Párdutz, Árpád; Tajti, János; Vécsei, László; Toldi, József


    Cortical spreading depression (CSD) involves a slowly-propagating depolarization wave in the cortex, which can appear in numerous pathophysiological conditions, such as migraine with aura, stroke, and traumatic brain injury. Neurons and glial cells are also depolarized transiently during the phenomena. CSD is followed by a massive increase in glutamate release and by changes in the brain microcirculation. The aim of this study was to investigate the effects of two N-methyl-D-aspartate receptor antagonists, endogenous kynurenic acid (KYNA) and dizocilpine, on CSD and the related blood–brain barrier (BBB) permeability in rats. In intact animals, KYNA hardly crosses the BBB but has some positive features as compared with its precursor L-Kynurenine, which is frequently used in animal studies (KYNA cannot be metabolized to excitotoxic agents such as 3-hydroxy-L-kynurenine and quinolinic acid). We therefore investigated the possible effects of peripherally administered KYNA. Repetitive CSD waves were elicited by the application of 1 M KCl solution to the cortex. Direct current-electrocorticograms were measured for 1 hour. Four parameters of the waves were compared. Evans blue dye and fluorescent microscopy were used to study the possible changes in the permeability of the BBB. The results demonstrated that N-methyl-D-aspartate receptor antagonists can reduce the number of CSD waves and decrease the permeability of the BBB during CSD. These results suggest that KYNA itself or its derivatives may offer a new approach in the therapy of migraines. PMID:24068867

  1. MiR-181a regulates blood-tumor barrier permeability by targeting Krüppel-like factor 6

    PubMed Central

    Ma, Jun; Yao, Yilong; Wang, Ping; Liu, Yunhui; Zhao, Lini; Li, Zhen; Li, Zhiqing; Xue, Yixue


    Blood–tumor barrier (BTB) constitutes an efficient organization of tight junctions that impairs the delivery of therapeutic drugs. However, the methods and molecular mechanisms underlying the BTB opening remain elusive. MicroRNAs (miRNAs) have recently emerged as key regulators of various biologic processes and therapeutic targets. In this study, we have identified microRNA-181a (miR-181a) as a critical miRNA in opening BTB. MicroRNA-181a expression was upregulated in glioma endothelial cells (GECs), which were obtained by coculturing endothelial cells (ECs) with glioma cells. Overexpression of miR-181a resulted in an impaired and permeability increased BTB, and meanwhile reduced the expression of zonula occluden (ZO)-1, occludin, and claudin-5. Kruppel-like factor 6 (KLF6), a transcription factor of the zinc-finger family, was downregulated in GECs. Mechanistic investigations defined it as a direct and functional downstream target of miR-181a, which was involved in the regulation of BTB permeability and the expression of ZO-1, occludin, and claudin-5. Furthermore, luciferase assays and chromatin immunoprecipitation assays showed that KLF6 upregulated the promoter activities and interacted with the promoters of ZO-1, occludin, and claudin-5 in GECs. Collectively, we showed the possibility that overexpression of miR-181a contributes to the increased permeability of BTB by targeting KLF6, thereby revealing potential therapeutic targets for the treatment of brain gliomas. PMID:25182666

  2. Placental ischemia in pregnant rats impairs cerebral blood flow autoregulation and increases blood–brain barrier permeability

    PubMed Central

    Warrington, Junie P.; Fan, Fan; Murphy, Sydney R.; Roman, Richard J.; Drummond, Heather A.; Granger, Joey P.; Ryan, Michael J.


    Abstract Cerebrovascular events contribute to ~40% of preeclampsia/eclampsia‐related deaths, and neurological symptoms are common among preeclamptic patients. We previously reported that placental ischemia, induced by reducing utero‐placental perfusion pressure, leads to impaired myogenic reactivity and cerebral edema in the pregnant rat. Whether the impaired myogenic reactivity is associated with altered cerebral blood flow (CBF) autoregulation and the edema is due to altered blood–brain barrier (BBB) permeability remains unclear. Therefore, we tested the hypothesis that placental ischemia leads to impaired CBF autoregulation and a disruption of the BBB. CBF autoregulation, measured in vivo by laser Doppler flowmetry, was significantly impaired in placental ischemic rats. Brain water content was increased in the anterior cerebrum of placental ischemic rats and BBB permeability, assayed using the Evans blue extravasation method, was increased in the anterior cerebrum. The expression of the tight junction proteins: claudin‐1 was increased in the posterior cerebrum, while zonula occludens‐1, and occludin, were not significantly altered in either the anterior or posterior cerebrum. These results are consistent with the hypothesis that placental ischemia mediates anterior cerebral edema through impaired CBF autoregulation and associated increased transmission of pressure to small vessels that increases BBB permeability leading to cerebral edema. PMID:25168877

  3. Increased blood-brain barrier permeability is associated with dementia and diabetes but not amyloid pathology or APOE genotype.


    Janelidze, Shorena; Hertze, Joakim; Nägga, Katarina; Nilsson, Karin; Nilsson, Christer; Wennström, Malin; van Westen, Danielle; Blennow, Kaj; Zetterberg, Henrik; Hansson, Oskar


    Blood-brain barrier (BBB) dysfunction might be an important component of many neurodegenerative disorders. In this study, we investigated its role in dementia using large clinical cohorts. The cerebrospinal fluid (CSF)/plasma albumin ratio (Qalb), an indicator of BBB (and blood-CSF barrier) permeability, was measured in a total of 1015 individuals. The ratio was increased in patients with Alzheimer's disease, dementia with Lewy bodies or Parkinson's disease dementia, subcortical vascular dementia, and frontotemporal dementia compared with controls. However, this measure was not changed during preclinical or prodromal Alzheimer's disease and was not associated with amyloid positron emission tomography or APOE genotype. The Qalb was increased in diabetes mellitus and correlated positively with CSF biomarkers of angiogenesis and endothelial dysfunction (vascular endothelial growth factor, intracellular adhesion molecule 1, and vascular cell adhesion molecule 1). In healthy elderly, high body mass index and waist-hip ratio predicted increased Qalb 20 years later. In summary, BBB permeability is increased in major dementia disorders but does not relate to amyloid pathology or APOE genotype. Instead, BBB impairment may be associated with diabetes and brain microvascular damage.

  4. Evaluation of a horizontal permeable reactive barrier for preventing upward diffusion of volatile organic compounds through the unsaturated zone.


    Mahmoodlu, Mojtaba G; Hassanizadeh, S Majid; Hartog, Niels; Raoof, Amir; van Genuchten, Martinus Th


    Permeable reactive barriers are commonly used to treat contaminant plumes in the saturated zone. However, no known applications of horizontal permeable reactive barriers (HPRBs) exist for oxidizing volatile organic compounds (VOCs) in the unsaturated zone. In this study, laboratory column experiments were carried out to investigate the ability of a HPRB containing solid potassium permanganate, to oxidize the vapors of trichloroethylene (TCE), toluene, and ethanol migrating upward from a contaminated saturated zone. Results revealed that an increase in initial water saturation and HPRB thickness strongly affected the removal efficiency of the HPRB. Installing the HPRB relatively close to the water table was more effective due to the high background water content and enhanced diffusion of protons and/or hydroxides away from the HPRB. Inserting the HPRB far above the water table caused rapid changes in pH within the HPRB, leading to lower oxidation rates. The pH effects were included in a reactive transport model, which successfully simulated the TCE and toluene experimental observations. Simulations for ethanol were not affected by pH due to condensation of water during ethanol oxidation, which caused some dilution in the HRPB.

  5. Activation of Alpha 7 Cholinergic Nicotinic Receptors Reduce Blood–Brain Barrier Permeability following Experimental Traumatic Brain Injury

    PubMed Central

    Zhao, Jing; Kobori, Nobuhide; Redell, John B.; Hylin, Michael J.; Hood, Kimberly N.; Moore, Anthony N.


    Traumatic brain injury (TBI) is a major human health concern that has the greatest impact on young men and women. The breakdown of the blood–brain barrier (BBB) is an important pathological consequence of TBI that initiates secondary processes, including infiltration of inflammatory cells, which can exacerbate brain inflammation and contribute to poor outcome. While the role of inflammation within the injured brain has been examined in some detail, the contribution of peripheral/systemic inflammation to TBI pathophysiology is largely unknown. Recent studies have implicated vagus nerve regulation of splenic cholinergic nicotinic acetylcholine receptor α7 (nAChRa7) signaling in the regulation of systemic inflammation. However, it is not known whether this mechanism plays a role in TBI-triggered inflammation and BBB breakdown. Following TBI, we observed that plasma TNF-α and IL-1β levels, as well as BBB permeability, were significantly increased in nAChRa7 null mice (Chrna7−/−) relative to wild-type mice. The administration of exogenous IL-1β and TNF-α to brain-injured animals worsened Evans Blue dye extravasation, suggesting that systemic inflammation contributes to TBI-triggered BBB permeability. Systemic administration of the nAChRa7 agonist PNU-282987 or the positive allosteric modulator PNU-120596 significantly attenuated TBI-triggered BBB compromise. Supporting a role for splenic nAChRa7 receptors, we demonstrate that splenic injection of the nicotinic receptor blocker α-bungarotoxin increased BBB permeability in brain-injured rats, while PNU-282987 injection decreased such permeability. These effects were not seen when α-bungarotoxin or PNU-282987 were administered to splenectomized, brain-injured rats. Together, these findings support the short-term use of nAChRa7-activating agents as a strategy to reduce TBI-triggered BBB permeability. SIGNIFICANCE STATEMENT Breakdown of the blood–brain barrier (BBB) in response to traumatic brain injury (TBI

  6. Altered composition of epidermal lipids correlates with Staphylococcus aureus colonization status in Atopic Dermatitis.


    Li, S; Villarreal, M; Stewart, S; Choi, J; Indra, G; Babineau, D C; Philpot, C; David, G; Yoshida, T; Boguniewicz, M; Hanifin, J; Beck, L A; Leung, D; Simpson, E; Indra, A K


    Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by disrupted epidermal barrier functions.(1) Stratum corneum (SC) consists of corneocytes and a lipid-rich extracellular matrix, which plays a key role in epidermal permeability barrier (EPB) functions.(2,3) Major lipid constituents of the SC are ceramides (CERs), free fatty acids (FFAs), cholesterol and triglycerides (TGs).(2,3) Staphylococcus aureus (S.aureus) colonization is an important trigger of AD.(4) Comprehensive profiling of SC lipids using S.aureus colonization status, and association between S.aureus colonization and skin lipid composition, has never been documented. This article is protected by copyright. All rights reserved.

  7. Transcriptional profiling of epidermal differentiation.


    Radoja, Nada; Gazel, Alix; Banno, Tomohiro; Yano, Shoichiro; Blumenberg, Miroslav


    In epidermal differentiation basal keratinocytes detach from the basement membrane, stop proliferating, and express a new set of structural proteins and enzymes, which results in an impermeable protein/lipid barrier that protects us. To define the transcriptional changes essential for this process, we purified large quantities of basal and suprabasal cells from human epidermis, using the expression of beta4 integrin as the discriminating factor. The expected expression differences in cytoskeletal, cell cycle, and adhesion genes confirmed the effective separation of the cell populations. Using DNA microarray chips, we comprehensively identify the differences in genes expressed in basal and differentiating layers of the epidermis, including the ECM components produced by the basal cells, the proteases in both the basal and suprabasal cells, and the lipid and steroid metabolism enzymes in suprabasal cells responsible for the permeability barrier. We identified the signaling pathways specific for the two populations and found two previously unknown paracrine and one juxtacrine signaling pathway operating between the basal and suprabasal cells. Furthermore, using specific expression signatures, we identified a new set of late differentiation markers and mapped their chromosomal loci, as well as a new set of melanocyte-specific markers. The data represent a quantum jump in understanding the mechanisms of epidermal differentiation.

  8. Krüppel-like factor 4 regulates blood-tumor barrier permeability via ZO-1, occludin and claudin-5.


    Ma, Jun; Wang, Ping; Liu, Yunhui; Zhao, Lini; Li, Zhen; Xue, Yixue


    Blood-tumor barrier (BTB) constitutes an efficient organization of tight junctions which significantly reduce permeability for chemotherapy drugs. Krüppel-like factor 4 (KLF4), a member of the Krüppel-like family, has been documented in endothelial cells and may serve as an essential regulator of endothelial barrier function. However, our knowledge about the expression and function of KLF4 in the endothelial cells of BTB still remains unclear. In this study, we sought to investigate the role of KLF4 in regulation of BTB function as well as the potential molecular mechanisms. Quantitative RT-PCR, Western blot, and immunofluorescence assays demonstrated that KLF4 was down-regulated in the glioma endothelial cells (GECs) which were obtained through endothelial cells co-cultured with glioma cells. Short hairpin RNA targeting KLF4 impaired the integrity of BTB detected by trans-endothelial electric resistance assay, and meanwhile reduced the expression of ZO-1, occludin and claudin-5, demonstrated by quantitative RT-PCR, Western blot, and immunofluorescence assays. Depletion of KLF4 increased BTB permeability to small molecules detected by permeability assays. Furthermore, luciferase assays and chromatin immunoprecipitation assays showed that KLF4 up-regulated the promoter activities and interacted with "CACCC" DNA sequence presented in the promoters of ZO-1, occludin, and claudin-5. GATA-1, GATA-6, Sp1, and Sp3 factors participated in KLF4 regulation of promoter activities through binding to the promoters of tight junctions related proteins. Collectively, our results indicated that KLF4 is a key transcriptional regulator of BTB function by regulating expressions of tight junction related proteins, which would draw growing attention to KLF4 as a potential target for glioma therapy.

  9. Permeability dependence study of the focused ultrasound-induced blood-brain barrier opening at distinct pressures and microbubble diameters using DCE-MRI.


    Vlachos, Fotios; Tung, Yao-Sheng; Konofagou, Elisa


    Blood-brain barrier opening using focused ultrasound and microbubbles has been experimentally established as a noninvasive and localized brain drug delivery technique. In this study, the permeability of the opening is assessed in the murine hippocampus after the application of focused ultrasound at three different acoustic pressures and microbubble sizes. Using dynamic contrast-enhanced MRI, the transfer rates were estimated, yielding permeability maps and quantitative K(trans) values for a predefined region of interest. The volume of blood-brain barrier opening according to the K(trans) maps was proportional to both the pressure and the microbubble diameter. A K(trans) plateau of ∼0.05 min(-1) was reached at higher pressures (0.45 and 0.60 MPa) for the larger sized bubbles (4-5 and 6-8 μm), which was on the same order as the K(trans) of the epicranial muscle (no barrier). Smaller bubbles (1-2 μm) yielded significantly lower permeability values. A small percentage (7.5%) of mice showed signs of damage under histological examination, but no correlation with permeability was established. The assessment of the blood-brain barrier permeability properties and their dependence on both the pressure and the microbubble diameter suggests that K(trans) maps may constitute an in vivo tool for the quantification of the efficacy of the focused ultrasound-induced blood-brain barrier opening.

  10. Utilizing Ultrasound to Transiently Increase Blood-Brain Barrier Permeability, Modulate of the Tight Junction Proteins, and Alter Cytoskeletal Structure.


    Bae, Mi Jung; Lee, Young Mi; Kim, Yeoun Hee; Han, Hyung Soo; Lee, Hak Jong


    The central nervous system is protected by the blood-brain barrier (BBB). The tight junction (TJ) proteins claudin-5 and zonula occludens-1 (ZO-1) as well as the cytoskeletal component F-actin play key roles in maintaining homeostasis of the BBB. Increases in BBB permeability may be beneficial for the delivery of pharmacological substances into the brain. Therefore, here, we assessed the use of ultrasound to induce transient enhancement of BBB permeability. We used fluorescein isothiocyanate (FITC)-dextran 40 to detect changes in the membrane permeability of bEnd.3 cells during ultrasound treatment. Ultrasound increased FITC-dextran 40 uptake into bEnd.3 cells for 2-6 h after treatment; however, normal levels returned after 24 h. An insignificant increase in lactate dehydrogenase (LDH) leakage also occurred 3 and 6 h after ultrasound treatment, whereas at 24 h, LDH leakage was indistinguishable between the control and treatment groups. Expression of claudin-5, ZO-1, and F-actin at the messenger RNA (mRNA) and protein levels was assessed with real-time polymerase chain reaction and western blotting. Ultrasound induced a transient decrease in claudin-5 mRNA and protein expression within 2 h of treatment; however, no significant changes in ZO-1 and F-actin expression were observed. Claudin-5, ZO-1, and F-actin immunofluorescence demonstrated that the cellular structures incorporating these proteins were transiently impaired by ultrasound. In conclusion, our ultrasound technique can temporarily increase BBB permeability without cytotoxicity to exposed cells, and the method can be exploited in the delivery of drugs to the brain with minimal damage.

  11. Remediation of groundwater contaminated with the lead-phenol binary system by granular dead anaerobic sludge-permeable reactive barrier.


    Faisal, Ayad A H; Abd Ali, Ziad T


    Computer solutions (COMSOL) Multiphysics 3.5a software was used for simulating the one-dimensional equilibrium transport of the lead-phenol binary system including the sorption process through saturated sandy soil as the aquifer and granular dead anaerobic sludge (GDAS) as the permeable reactive barrier. Fourier-transform infrared spectroscopy analysis proved that the carboxylic and alcohol groups are responsible for the bio-sorption of lead onto GDAS, while phosphines, aromatic and alkane are the functional groups responsible for the bio-sorption of phenol. Batch tests have been performed to characterize the equilibrium sorption properties of the GDAS and sandy soil in lead and/or phenol containing aqueous solutions. Numerical and experimental results proved that the barrier plays a potential role in the restriction of the contaminant plume migration and there is a linear relationship between longevity and thickness of the barrier. A good agreement between these results was recognized with root mean squared error not exceeding 0.04.

  12. Role of AT1 receptors in permeability of the blood-brain barrier in diabetic hypertensive rats.


    Awad, Azza S


    The precise mechanisms of vascular diseases in patients with diabetic hypertensive are not clearly understood. There are evidences of alteration in permeability of blood-brain barrier (BBB) in diabetic hypertensive rats. This study sought to examine the effect of candesartan on the systolic blood pressure and the brain endothelial barrier function and antioxidant enzymes in rat brain. Five groups of eight male Sprague-Dawley rats include: control group (gpI), diabetic hypertensive group (gpII), diabetic hypertensive group treated with candesartan (gpIII), diabetic hypertensive rats with epinephrine (gpIV) and diabetic hypertensive rats with epinephrine treated with candesartan (gpV). Diabetes was induced by single injection of 55 mg kg(-1) streptozotocin (STZ) i.p. Blood glucose was measured, rats with blood glucose higher than 300 mg/dl were identified as diabetic. After induction of diabetes, rats received L-NAME (0.5 mg/ml in drinking water for 1 week) starting on the day 4 after STZ injection. Systolic blood pressure (SBP) was recorded two times, at day 0 (before starting L-NAME) and at day 7 (after L-NAME treatment). Also, body weight was measured two times, at initial time (before STZ injection) and terminal (at the last day in the experiment). On the day of acute experiment, rats were anesthetized with sodium pentobarbital (35 mg/kg, i.p.). The integrity of the BBB was investigated using Evans blue (EB) dye (4 ml/kg, 2%). Epinephrine was used (40 micro g/kg) to increase the permeability of the brain. After decapitation, first the brain was removed, next homogenized and then the content of EB dye in the brain was measured. Another five groups of rats manipulated with the same manner except EB dye injection. These second group to evaluate antioxidant enzymes, reduced glutathione (GSH), lipid peroxides and superoxide dismutase (SOD) in brain homogenate. This study indicates that, in diabetic hypertensive rats, epinephrine administration leads to increase in

  13. Electrical Properties of Reacted Iron Cores Extracted From a Permeable Reactive Barrier Installation

    NASA Astrophysics Data System (ADS)

    Wu, Y.; Slater, L.; Korte, N.


    We conducted experiments to investigate the application of non-invasive electrical method for monitoring iron corrosion and mineral precipitation processes on angle cores recovered from the Kansas City Plant reactive iron barrier. Electrical measurements showed continuous changes from the soil/iron interface into the barrier for all three cores. Scanning electron microscopy (SEM) identified iron surface alteration with thickest corrosion rind, indicating most severe corrosion, occurred close to upgradient soil/iron interface relative to locations further into the cores. Nitrogen adsorption measurements showed decreases in specific surface area of iron minerals from upgradient soil/iron interface into the barrier. X-ray diffractometry (XRD) identified precipitation of iron oxide/hydroxide, carbonate minerals, iron sulfide as well as green rusts in all three cores, and magnetite was identified as the dominant phase. Electrical measurements correlated well with solid phase analysis and illustrated the sensitivity of low frequency electrical method to iron corrosion and mineral precipitation processes. Electrical signature changes are attributed to (1) higher complex interfacial conductivity due to increased surface area and mineralogical alteration, and (2) increased electronic conduction due to enhanced electron transfer across the iron-fluid interface facilitated by mineralogical alternation and increased specific surface area during iron corrosion and mineral precipitation. Electrical measurements along with solid phase analysis also revealed more severe corrosion occurred at north end relative to south end of the barrier correlated with more groundwater flow through north end of the barrier. Our results on field cores are consistent with laboratory studies on synthetic iron columns presented previously and demonstrate that electrical measurements are a proxy indicator of Fe0 surface alteration and could be implemented for field barrier corrosion process monitoring.

  14. Acoustic cavitation-based monitoring of the reversibility and permeability of ultrasound-induced blood-brain barrier opening

    NASA Astrophysics Data System (ADS)

    Sun, Tao; Samiotaki, Gesthimani; Wang, Shutao; Acosta, Camilo; Chen, Cherry C.; Konofagou, Elisa E.


    Cavitation events seeded by microbubbles have been previously reported to be associated with MR- or fluorescent-contrast enhancement after focused ultrasound (FUS)-induced blood-brain barrier (BBB) opening. However, it is still unknown whether bubble activity can be correlated with the reversibility (the duration of opening and the likelihood of safe reinstatement) and the permeability of opened BBB, which is critical for the clinical translation of using passive cavitation detection to monitor, predict and control the opening. In this study, the dependence of acoustic cavitation on the BBB opening duration, permeability coefficient and histological damage occurrence were thus investigated. Transcranial pulsed FUS at 1.5 MHz in the presence of systemically circulating microbubbles was applied in the mouse hippocampi (n  =  60). The stable and inertial cavitation activities were monitored during sonication. Contrast-enhanced MRI was performed immediately after sonication and every 24 h up to 6 d thereafter, to assess BBB opening, brain tissue permeability and potential edema. Histological evaluations were used to assess the occurrence of neurovascular damages. It was found that stable cavitation was well correlated with: (1) the duration of the BBB opening (r2  =  0.77) (2) the permeability of the opened BBB (r2  =  0.82) (3) the likelihood of safe opening (P  <  0.05, safe opening compared to cases of damage; P  <  0.0001, no opening compared to safe opening). The inertial cavitation dose was correlated with the resulting BBB permeability (r2  =  0.72). Stable cavitation was found to be more reliable than inertial cavitation at assessing the BBB opening within the pressure range used in this study. This study demonstrates that the stable cavitation response during BBB opening holds promise for predicting and controlling the restoration and pharmacokinetics of FUS-opened BBB. The stable cavitation response therefore

  15. Acoustic cavitation-based monitoring of the reversibility and permeability of ultrasound-induced blood-brain barrier opening.


    Sun, Tao; Samiotaki, Gesthimani; Wang, Shutao; Acosta, Camilo; Chen, Cherry C; Konofagou, Elisa E


    Cavitation events seeded by microbubbles have been previously reported to be associated with MR- or fluorescent-contrast enhancement after focused ultrasound (FUS)-induced blood-brain barrier (BBB) opening. However, it is still unknown whether bubble activity can be correlated with the reversibility (the duration of opening and the likelihood of safe reinstatement) and the permeability of opened BBB, which is critical for the clinical translation of using passive cavitation detection to monitor, predict and control the opening. In this study, the dependence of acoustic cavitation on the BBB opening duration, permeability coefficient and histological damage occurrence were thus investigated. Transcranial pulsed FUS at 1.5 MHz in the presence of systemically circulating microbubbles was applied in the mouse hippocampi (n  =  60). The stable and inertial cavitation activities were monitored during sonication. Contrast-enhanced MRI was performed immediately after sonication and every 24 h up to 6 d thereafter, to assess BBB opening, brain tissue permeability and potential edema. Histological evaluations were used to assess the occurrence of neurovascular damages. It was found that stable cavitation was well correlated with: (1) the duration of the BBB opening (r(2)  =  0.77); (2) the permeability of the opened BBB (r(2)  =  0.82); (3) the likelihood of safe opening (P  <  0.05, safe opening compared to cases of damage; P  <  0.0001, no opening compared to safe opening). The inertial cavitation dose was correlated with the resulting BBB permeability (r(2)  =  0.72). Stable cavitation was found to be more reliable than inertial cavitation at assessing the BBB opening within the pressure range used in this study. This study demonstrates that the stable cavitation response during BBB opening holds promise for predicting and controlling the restoration and pharmacokinetics of FUS-opened BBB. The stable cavitation response

  16. Evaluating the Longevity and Hydraulic Performance of Permeable Reactive Barriers at Department of Defense Sites

    DTIC Science & Technology


    sand- fracking ) Naval Weapons CRB Industrial Reserve Plant, TX (a) PRB is not keyed in to aquitard. CRB =Continuous reactive barrier. JAG= Jet...of 5 months. Pumps may be damaged by biofouling due to polysaccharide contained in fracking tluids. Reduced average perchlorate concentrations


    EPA Science Inventory

    A major goal of research on the long-term performance of subsurface reactive barriers is to identify standard ground-water monitoring parameters that may be useful indicators of declining performance or impending system failure. Results are presented from studies conducted over ...


    EPA Science Inventory

    A major goal of research on the long-term performance of subsurface reactive barriers is to identify standard ground water monitoring parameters that may be useful indicators of declining performance or impending system failure. Results are presented from ground water monitoring ...

  19. Organic substrates as electron donors in permeable reactive barriers for removal of heavy metals from acid mine drainage.


    Kijjanapanich, P; Pakdeerattanamint, K; Lens, P N L; Annachhatre, A P


    This research was conducted to select suitable natural organic substrates as potential carbon sources for use as electron donors for biological sulphate reduction in a permeable reactive barrier (PRB). A number of organic substrates were assessed through batch and continuous column experiments under anaerobic conditions with acid mine drainage (AMD) obtained from an abandoned lignite coal mine. To keep the heavy metal concentration at a constant level, the AMD was supplemented with heavy metals whenever necessary. Under anaerobic conditions, sulphate-reducing bacteria (SRB) converted sulphate into sulphide using the organic substrates as electron donors. The sulphide that was generated precipitated heavy metals as metal sulphides. Organic substrates, which yielded the highest sulphate reduction in batch tests, were selected for continuous column experiments which lasted over 200 days. A mixture of pig-farm wastewater treatment sludge, rice husk and coconut husk chips yielded the best heavy metal (Fe, Cu, Zn and Mn) removal efficiencies of over 90%.

  20. Highly organic natural media as permeable reactive barriers: TCE partitioning and anaerobic degradation profile in eucalyptus mulch and compost.


    Öztürk, Zuhal; Tansel, Berrin; Katsenovich, Yelena; Sukop, Michael; Laha, Shonali


    Batch and column experiments were conducted with eucalyptus mulch and commercial compost to evaluate suitability of highly organic natural media to support anaerobic decomposition of trichloroethylene (TCE) in groundwater. Experimental data for TCE and its dechlorination byproducts were analyzed with Hydrus-1D model to estimate the partitioning and kinetic parameters for the sequential dechlorination reactions during TCE decomposition. The highly organic natural media allowed development of a bioactive zone capable of decomposing TCE under anaerobic conditions. The first order TCE biodecomposition reaction rates were 0.23 and 1.2d(-1) in eucalyptus mulch and compost media, respectively. The retardation factors in the eucalyptus mulch and compost columns for TCE were 35 and 301, respectively. The results showed that natural organic soil amendments can effectively support the anaerobic bioactive zone for remediation of TCE contaminated groundwater. The natural organic media are effective environmentally sustainable materials for use in permeable reactive barriers.

  1. Observations of Anomalous Subcrustal Reflections Along the East Pacific Rise: Possible Detection of a Melt Permeability Barrier

    NASA Astrophysics Data System (ADS)

    Arnoux, G. M.; Toomey, D. R.


    Crustal accretion at mid-ocean ridges primarily occurs within the narrow neovolcanic zone at the spreading axis, with supplementary lower crustal accumulation thought to originate from the crystallization of magma bodies at the base of the crust. The narrowness of the neovolcanic zone requires melt focusing - a process that has been proposed to arise from the presence of melt impermeable boundaries, or permeability barriers, within the thermal boundary layer near the base of the lithosphere that inhibit the upward migration of melt, effectively focusing it laterally to the ridge axis. Numerical simulations, as well as structural and petrological characteristics of the Oman ophiolite, suggest the existence of such melt impermeable boundaries. A recent analysis of seismic data from the East Pacific Rise (EPR) between the Siqueiros and Clipperton transform faults (8°15'N-10°20'N) reveals anomalous subcrustal reflections ~20 km east of the rise axis and ~20-50 km south of the Clipperton transform. The reflections are characterized by large amplitudes, high frequency content on the order of 20-30 Hz, and a travel time curve that is parabolic with arrival times increasing rapidly at ranges <20 km from the receiver. The approximate depth, slope, and geographical extent of the reflector are estimated by back projecting the onset times of the anomalous reflections into a predefined velocity model. This method reveals that the reflector dips both away from the ridge axis and northward toward the Clipperton transform with a minimum depth below seafloor of ~7.2 km (0.7 km below the Moho) nearest to the ridge. Further off-axis and roughly 20 km to the north, closest to the Clipperton transform, the depth of the reflector increases to ~10.6 km (4 km below the Moho). The slope of the observed reflector thus conforms to the base of the thermal boundary layer (i.e. the 1200-1300° C isotherms) in thermal models adjacent to oceanic transform faults (Roland et al., 2010). The 1240

  2. Creation of a subsurface permeable treatment barrier using in situ redox manipulation

    SciTech Connect

    Fruchter, J.S.; Cole, C.R.; Williams, M.D.


    The goal of in situ redox manipulation is to create a permeable treatment zone in the subsurface for remediating redox-sensitive contaminants in groundwater. The permeable treatment zone is created just downstream of the contaminant plume or contaminant source through the injection of reagents and/or microbial nutrients to alter the redox potential of the aquifer fluids and sediments. Contaminant plumes migrating through this manipulated zone can then be destroyed or immobilized. In a field test at the Hanford Site, {approximately}77,000 L of buffered sodium dithionite solution were successfully injected into the unconfined aquifer at the 100-H Area in September 1995. The target contaminant was chromate. No significant plugging of the well screen or the formation was detected during any phase of the test. Dithionite was detected in monitoring wells at least 7.5 m from the injection point. Data were obtained from all three phases of the test (i.e., injection, reaction, withdrawal). Preliminary core data show that from 60% to 100% of the available reactive iron in the targeted aquifer sediments was reduced by the injected dithionite. One year after the injection, groundwater in the treatment zone remains anoxic. Total and hexavalent chromium levels in groundwater have been reduced from a preexperiment concentration of {approximately}60 {mu}g/L to below the detection limit of the analytical methods.

  3. The permeability and transport mechanism of graphene quantum dots (GQDs) across the biological barrier.


    Wang, Xin-Yi; Lei, Rong; Huang, Hong-Duang; Wang, Na; Yuan, Lan; Xiao, Ru-Yue; Bai, Li-Dan; Li, Xue; Li, Li-Mei; Yang, Xiao-da


    As an emerging nanomaterial, graphene quantum dots (GQDs) have shown enormous potential in theranostic applications. However, many aspects of the biological properties of GQDs require further clarification. In the present work, we prepared two sizes of GQDs and for the first time investigated their membrane permeabilities, one of the key factors of all biomedical applications, and transport mechanisms on a Madin Darby Canine Kidney (MDCK) cell monolayer. The experimental results revealed that under ∼300 mg L(-1), GQDs were innoxious to MDCK and did not affect the morphology and integrity of the cell monolayer. The Papp values were determined to be 1-3 × 10(-6) cm s(-1) for the 12 nm GQDs and 0.5-1.5 × 10(-5) cm s(-1) for the 3 nm GQDs, indicating that the 3 nm GQDs are well-transported species while the 12 nm GQDs have a moderate membrane permeability. The transport and uptake of GQDs by MDCK cells were both time and concentration-dependent. Moreover, the incubation of cells with GQDs enhanced the formation of lipid rafts, while inhibition of lipid rafts with methyl-β-cyclodextrin almost eliminated the membrane transport of GQDs. Overall, the experimental results suggested that GQDs cross the MDCK cell monolayer mainly through a lipid raft-mediated transcytosis. The present work has indicated that GQDs are a novel, low-toxic, highly-efficient general carrier for drugs and/or diagnostic agents in biomedical applications.

  4. Designing low permeability, optical-grade silicone systems: guidelines for choosing a silicone based on transmission rates for barrier applications

    NASA Astrophysics Data System (ADS)

    Velderrain, Michelle


    Unprotected electronic components exposed to moisture from high humidity may fail due to corrosion of metal leads or other unfavorable reactions on chemically sensitive components. This is of high interest for silicones that encapsulate Light Emitting Diodes (LEDs) dies. For these applications, moisture and oxygen may react with materials, such as phosphor, used to make white LEDs for back-lighting applications and decrease or change the light output and color over time. Of the polymeric adhesives and sealants commercially available, silicones are used for their thermal stability, clarity, and comparably low modulus that provides stress relief during thermal cycling. In addition, silicones are also known to be very permeable to low molecular weight gases such as water vapor and oxygen. Recently, several types of silicones were tested for the oxygen and water vapor transmission rates, and it was found that they can have drastically different results. Silicone properties strongly affecting permeability are polymer backbone chemistry, crosslink density and fillers. Phenyl (C6H5) and trifluoropropyl (CF3CH2) groups are used to optimize the refractive index of optically clear silicones. The effect of chemical composition on the water vapor transfer rate (WVTR) and the oxygen transfer rate (OTR) at 400 C and 90% Relative Humidity was investigated on several silicones with various refractive indices and compared to polydimethylsiloxane (PDMS) with similar durometers. It was found that polymer backbone chemistry had a significant influence on the permeation rates and will assist in material selection when designing for low-permeable barriers to improve package reliability.

  5. Permeability of endothelial and astrocyte cocultures: in vitro blood-brain barrier models for drug delivery studies.


    Li, Guanglei; Simon, Melissa J; Cancel, Limary M; Shi, Zhong-Dong; Ji, Xinying; Tarbell, John M; Morrison, Barclay; Fu, Bingmei M


    The blood-brain barrier (BBB) is a major obstacle for drug delivery to the brain. To seek for in vitro BBB models that are more accessible than animals for investigating drug transport across the BBB, we compared four in vitro cultured cell models: endothelial monoculture (bEnd3 cell line), coculture of bEnd3 and primary rat astrocytes (coculture), coculture with collagen type I and IV mixture, and coculture with Matrigel. The expression of the BBB tight junction proteins in these in vitro models was assessed using RT-PCR and immunofluorescence. We also quantified the hydraulic conductivity (L (p)), transendothelial electrical resistance (TER) and diffusive solute permeability (P) of these models to three solutes: TAMRA, Dextran 10K and Dextran 70K. Our results show that L (p) and P of the endothelial monoculture and coculture models are not different from each other. Compared with in vivo permeability data from rat pial microvessels, P of the endothelial monoculture and coculture models are not significantly different from in vivo data for Dextran 70K, but they are 2-4 times higher for TAMRA and Dextran 10K. This suggests that the endothelial monoculture and all of the coculture models are fairly good models for studying the transport of relatively large solutes across the BBB.

  6. Controllable permeability of blood-brain barrier and reduced brain injury through low-intensity pulsed ultrasound stimulation.


    Su, Wei-Shen; Tsai, Min-Lan; Huang, Sin-Luo; Liu, Shing-Hwa; Yang, Feng-Yi


    It has been shown that the blood-brain barrier (BBB) can be locally disrupted by focused ultrasound (FUS) in the presence of microbubbles (MB) while sustaining little damage to the brain tissue. Thus, the safety issue associated with FUS-induced BBB disruption (BBBD) needs to be investigated for future clinical applications. This study demonstrated the neuroprotective effects induced by low-intensity pulsed ultrasound (LIPUS) against brain injury in the sonicated brain. Rats subjected to a BBB disruption injury received LIPUS exposure for 5 min after FUS/MB application. Measurements of BBB permeability, brain water content, and histological analysis were then carried out to evaluate the effects of LIPUS. The permeability and time window of FUS-induced BBBD can be effectively modulated with LIPUS. LIPUS also significantly reduced brain edema, neuronal death, and apoptosis in the sonicated brain. Our results show that brain injury in the FUS-induced BBBD model could be ameliorated by LIPUS and that LIPUS may be proposed as a novel treatment modality for controllable release of drugs into the brain.

  7. The role of multidrug resistance protein (MRP-1) as an active efflux transporter on blood-brain barrier (BBB) permeability.


    Lingineni, Karthik; Belekar, Vilas; Tangadpalliwar, Sujit R; Garg, Prabha


    Drugs acting on central nervous system (CNS) may take longer duration to reach the market as these compounds have a higher attrition rate in clinical trials due to the complexity of the brain, side effects, and poor blood-brain barrier (BBB) permeability compared to non-CNS-acting compounds. The roles of active efflux transporters with BBB are still unclear. The aim of the present work was to develop a predictive model for BBB permeability that includes the MRP-1 transporter, which is considered as an active efflux transporter. A support vector machine model was developed for the classification of MRP-1 substrates and non-substrates, which was validated with an external data set and Y-randomization method. An artificial neural network model has been developed to evaluate the role of MRP-1 on BBB permeation. A total of nine descriptors were selected, which included molecular weight, topological polar surface area, ClogP, number of hydrogen bond donors, number of hydrogen bond acceptors, number of rotatable bonds, P-gp, BCRP, and MRP-1 substrate probabilities for model development. We identified 5 molecules that fulfilled all criteria required for passive permeation of BBB, but they all have a low logBB value, which suggested that the molecules were effluxed by the MRP-1 transporter.

  8. Comparison of blood brain barrier permeability in normal and ovariectomized female rats that demonstrate right or left paw preference.


    Kutlu, N; Mutlu, F; Vural, K; Cezayirli, E


    We explored the relations among paw preference, cerebral asymmetry and asymmetrical disruption of blood-brain barrier (BBB) permeability in normal and ovariectomized female rats with known paw preference. A high dose of pentylenetetrazol was used to disrupt the BBB and induce acute hypertension. To determine the areas of macroscopic infarct, samples were stained with 2,3,5-triphenyltetrazolium chloride. Histological staining techniques were used to show the areas of infarct microscopically on paraffin sections. Sixty-two percent of the rats demonstrated right paw preference, 24% demonstrated left paw preference and 14% were ambidextrous. Areas of infarct, which indicated destruction of the BBB, were determined microscopically and macroscopically in rats that demonstrated right and left paw preference. We found a relation between permeability of the BBB and paw preference. There may be a relation between paw preference, cerebral asymmetry and asymmetrical destruction of the BBB in rats. Asymmetrical destruction of the BBB in experimental rats was similar to the control group, which had asymmetrically disrupted BBB with respect to paw preference. Like the control rats, asymmetrical areas of infarct consistent with cerebral asymmetry were observed in ovariectomized rats.

  9. Towards a Quantitative Theory of Epidermal Calcium Profile Formation in Unwounded Skin

    PubMed Central

    Adams, Matthew P.; Mallet, Daniel G.; Pettet, Graeme J.


    We propose and mathematically examine a theory of calcium profile formation in unwounded mammalian epidermis based on: changes in keratinocyte proliferation, fluid and calcium exchange with the extracellular fluid during these cells’ passage through the epidermal sublayers, and the barrier functions of both the stratum corneum and tight junctions localised in the stratum granulosum. Using this theory, we develop a mathematical model that predicts epidermal sublayer transit times, partitioning of the epidermal calcium gradient between intracellular and extracellular domains, and the permeability of the tight junction barrier to calcium ions. Comparison of our model’s predictions of epidermal transit times with experimental data indicates that keratinocytes lose at least 87% of their volume during their disintegration to become corneocytes. Intracellular calcium is suggested as the main contributor to the epidermal calcium gradient, with its distribution actively regulated by a phenotypic switch in calcium exchange between keratinocytes and extracellular fluid present at the boundary between the stratum spinosum and the stratum granulosum. Formation of the extracellular calcium distribution, which rises in concentration through the stratum granulosum towards the skin surface, is attributed to a tight junction barrier in this sublayer possessing permeability to calcium ions that is less than 15 nm s−1 in human epidermis and less than 37 nm s−1 in murine epidermis. Future experimental work may refine the presented theory and reduce the mathematical uncertainty present in the model predictions. PMID:25625723

  10. The rights and wrongs of blood-brain barrier permeability studies: a walk through 100 years of history

    PubMed Central

    Saunders, Norman R.; Dreifuss, Jean-Jacques; Dziegielewska, Katarzyna M.; Johansson, Pia A.; Habgood, Mark D.; Møllgård, Kjeld; Bauer, Hans-Christian


    Careful examination of relevant literature shows that many of the most cherished concepts of the blood-brain barrier are incorrect. These include an almost mythological belief in its immaturity that is unfortunately often equated with absence or at least leakiness in the embryo and fetus. The original concept of a blood-brain barrier is often attributed to Ehrlich; however, he did not accept that permeability of cerebral vessels was different from other organs. Goldmann is often credited with the first experiments showing dye (trypan blue) exclusion from the brain when injected systemically, but not when injected directly into it. Rarely cited are earlier experiments of Bouffard and of Franke who showed methylene blue and trypan red stained all tissues except the brain. The term “blood-brain barrier” “Blut-Hirnschranke” is often attributed to Lewandowsky, but it does not appear in his papers. The first person to use this term seems to be Stern in the early 1920s. Studies in embryos by Stern and colleagues, Weed and Wislocki showed results similar to those in adult animals. These were well-conducted experiments made a century ago, thus the persistence of a belief in barrier immaturity is puzzling. As discussed in this review, evidence for this belief, is of poor experimental quality, often misinterpreted and often not properly cited. The functional state of blood-brain barrier mechanisms in the fetus is an important biological phenomenon with implications for normal brain development. It is also important for clinicians to have proper evidence on which to advise pregnant women who may need to take medications for serious medical conditions. Beliefs in immaturity of the blood-brain barrier have held the field back for decades. Their history illustrates the importance of taking account of all the evidence and assessing its quality, rather than selecting papers that supports a preconceived notion or intuitive belief. This review attempts to right the wrongs

  11. The permeability and transport mechanism of graphene quantum dots (GQDs) across the biological barrier

    NASA Astrophysics Data System (ADS)

    Wang, Xin-Yi; Lei, Rong; Huang, Hong-Duang; Wang, Na; Yuan, Lan; Xiao, Ru-Yue; Bai, Li-Dan; Li, Xue; Li, Li-Mei; Yang, Xiao-Da


    As an emerging nanomaterial, graphene quantum dots (GQDs) have shown enormous potential in theranostic applications. However, many aspects of the biological properties of GQDs require further clarification. In the present work, we prepared two sizes of GQDs and for the first time investigated their membrane permeabilities, one of the key factors of all biomedical applications, and transport mechanisms on a Madin Darby Canine Kidney (MDCK) cell monolayer. The experimental results revealed that under ~300 mg L-1, GQDs were innoxious to MDCK and did not affect the morphology and integrity of the cell monolayer. The Papp values were determined to be 1-3 × 10-6 cm s-1 for the 12 nm GQDs and 0.5-1.5 × 10-5 cm s-1 for the 3 nm GQDs, indicating that the 3 nm GQDs are well-transported species while the 12 nm GQDs have a moderate membrane permeability. The transport and uptake of GQDs by MDCK cells were both time and concentration-dependent. Moreover, the incubation of cells with GQDs enhanced the formation of lipid rafts, while inhibition of lipid rafts with methyl-β-cyclodextrin almost eliminated the membrane transport of GQDs. Overall, the experimental results suggested that GQDs cross the MDCK cell monolayer mainly through a lipid raft-mediated transcytosis. The present work has indicated that GQDs are a novel, low-toxic, highly-efficient general carrier for drugs and/or diagnostic agents in biomedical applications.As an emerging nanomaterial, graphene quantum dots (GQDs) have shown enormous potential in theranostic applications. However, many aspects of the biological properties of GQDs require further clarification. In the present work, we prepared two sizes of GQDs and for the first time investigated their membrane permeabilities, one of the key factors of all biomedical applications, and transport mechanisms on a Madin Darby Canine Kidney (MDCK) cell monolayer. The experimental results revealed that under ~300 mg L-1, GQDs were innoxious to MDCK and did not affect

  12. Radiation-induced permeability and leukocyte adhesion in the rat blood-brain barrier: modulation with anti-ICAM-1 antibodies.


    Yuan, Hong; Gaber, M Waleed; McColgan, Tamara; Naimark, Michael D; Kiani, Mohammad F; Merchant, Thomas E


    We assessed the acute effects of radiation on the rat blood-brain barrier. A cranial window model and intravital microscopy were used to measure changes in permeability and leukocyte adhesion in pial vessels after a localized, single dose of 20 Gy. Permeability was assessed using five sizes of fluorescein isothiocyanate (FITC)-dextran molecules (4.4-, 10-, 38.2-, 70-, and 150-kDa) with measurements performed before and 2, 24, 48, 72 and 96 h after irradiation for the 4.4 and 38.2-kDa molecules and before and 24 h after irradiation for the other three molecules. To demonstrate the nature of blood-brain barrier permeability, we concurrently studied the permeability of microvessels in the cremaster muscle. In both tissues, permeability to FITC-dextran was significantly greater 24 h after irradiation than before (P<0.05). The exception was that radiation did not affect the permeability of pial vessels to the 150-kDa molecule. The particle-size dependence of the permeability changes in the brain were indicative of altered integrity of endothelial tight junctions and occurred concomitantly with an increase in cell adhesion which was determined by fluorescent labeling of leukocytes with rhodamine 6G. An early inflammatory response to irradiation was apparent in the brain 2 h after irradiation. The numbers of rolling and adherent leukocytes increased significantly and peaked at 24 h. Injection with the anti-ICAM-1 mAb significantly reduced leukocyte adhesion and permeability thereby linking the two processes. These findings provide a target to reduce radiation-related permeability and cell adhesion and potentially the side effects of radiation in the CNS.

  13. Use of lanthanum to detect changes in the permeability barrier of rat skin after dermal exposure to organic chemicals

    SciTech Connect

    Mattie, D.R.; McDougal, J.N.; Chase, M.R.; Hixson, C.J.


    Occupational dermal exposures to organic solvents are of importance due to local effects in the skin and systematic toxicity if penetration occurs through the skin. Repeated or prolonged contact with organic solvents have been shown to penetrate the skin; little information is available however, concerning effects on the barrier properties of skin after dermal exposure to solvents. This investigation examines the ultrastructural changes in rat skin after exposure of 3 organic chemicals and to correlate changes with the location of an electron-dense tracer, lanthanum, which is normally excluded by the permeability barrier in the stratum corneum. Male rats were exposed for 24 h to sterile saline, trichloroethylene (TCE), perchloroethylene (PERC), or toluene using dermal-exposure cells developed in this laboratory. Rat skin exposed to saline for 24 h appeared normal. Rat skin exposed to neat TCE, PERC or toluene for 24 h caused acute, coagulative necrosis of the epidermis and upper 1/2 to 1/3 of the dermis.

  14. Laboratory and Pilot Scale Evaluation of a Permeable Reactive Barrier Technology for Use at Rocky Flats Environmental Technology Site (RFETS)

    SciTech Connect

    Dwyer, B.P.; Hankins, M.G.


    Three reactive materials were evaluated to identify the optimum treatment reagent for use in a Permeable Reactive Barrier Treatment System at Rocky Flats Environmental Technology Site (RFETS). The three reactive media evaluated included high carbon steel iron filings, an iron-silica alloy in the form of a foam aggregate, and a pellicular humic acid based sorbent (Humasorb from Arctech) mixed with sand. Each material was tested in the laboratory at column scale using simulated site water. All three materials showed promise for the 903 Mound Site; however, the iron filings were determined to be the most cost effective media. In order to validate the laboratory results, the iron filings were further tested at a pilot scale (field columns) using actual site water. Pilot test results were similar to laboratory results; consequently, the iron filings were chosen for the full scale demonstration of this reactive barrier technology. Design parameters including saturated hydraulic conductivity, treatment residence time, and head loss across the media were provided to the design team in support of the final design.


    EPA Science Inventory

    This presentation will provide an overview of permeable reactive barrier performance for field sites in the U.S. evaluated over the last 10 years by the U.S. Environmental Protection Agency's Office of Research and Development (EPA-ORD) in collaboration with other U.S. federal ag...


    EPA Science Inventory

    Geochemical and microbiological factors that control long-term performance of subsurface permeable reactive barriers were evaluated at the Elizabeth City, NC and the Denver Federal Center, CO sites. These groundwater treatment systems use zero-valent iron filings to intercept an...


    EPA Science Inventory

    Recent research has shown that carbonaceous solid materials and zerovalent iron (Fe0) may potentially be used as media in permeable reactive barriers (PRBs) to degrade groundwater nitrate via heterotrophic denitrification in the solid carbon system, and via abiotic reduction and ...


    EPA Science Inventory

    An overview of permeable reactive barrier (PRB) performance for field sites in the U.S. was evaluated over the last 10 years by the U.S. Environmental Protection Agencys Office of Research and Development (EPA-ORD) in collaboration with other U.S. federal agencies, consulting co...

  19. Essential role of the cytochrome P450 CYP4F22 in the production of acylceramide, the key lipid for skin permeability barrier formation.


    Ohno, Yusuke; Nakamichi, Shota; Ohkuni, Aya; Kamiyama, Nozomi; Naoe, Ayano; Tsujimura, Hisashi; Yokose, Urara; Sugiura, Kazumitsu; Ishikawa, Junko; Akiyama, Masashi; Kihara, Akio


    A skin permeability barrier is essential for terrestrial animals, and its impairment causes several cutaneous disorders such as ichthyosis and atopic dermatitis. Although acylceramide is an important lipid for the skin permeability barrier, details of its production have yet to be determined, leaving the molecular mechanism of skin permeability barrier formation unclear. Here we identified the cytochrome P450 gene CYP4F22 (cytochrome P450, family 4, subfamily F, polypeptide 22) as the long-sought fatty acid ω-hydroxylase gene required for acylceramide production. CYP4F22 has been identified as one of the autosomal recessive congenital ichthyosis-causative genes. Ichthyosis-mutant proteins exhibited reduced enzyme activity, indicating correlation between activity and pathology. Furthermore, lipid analysis of a patient with ichthyosis showed a drastic decrease in acylceramide production. We determined that CYP4F22 was a type I membrane protein that locates in the endoplasmic reticulum (ER), suggesting that the ω-hydroxylation occurs on the cytoplasmic side of the ER. The preferred substrate of the CYP4F22 was fatty acids with a carbon chain length of 28 or more (≥C28). In conclusion, our findings demonstrate that CYP4F22 is an ultra-long-chain fatty acid ω-hydroxylase responsible for acylceramide production and provide important insights into the molecular mechanisms of skin permeability barrier formation. Furthermore, based on the results obtained here, we proposed a detailed reaction series for acylceramide production.


    EPA Science Inventory

    A small-scale field test was initiated in September 1994 to evaluate the in situ remediation of groundwater contaminated with chromate using a permeable reactive barrier composed of a mixture of zero-valent Fe, sand and aquifer sediment. The site used was an old chrome-plating f...

  1. Mechanism of action of collagenase on the blood-brain barrier permeability. Increase of endothelial cell pinocytotic activity as shown with horse-radish peroxidase as a tracer.


    Godeau, G; Robert, A M


    The ultrastructural mechanism of the protease induced blood-brain barrier permeability-increase was studied with horse-radish peroxidase as a tracer. After intravenous injection of collagenase or pronase, a significantly increased number of pinocytotic vesicles was found in brain capillary endothelial cells. alpha-Chymotrypsine did not exert such an action.


    EPA Science Inventory

    The purpose of this document is to provide detailed performance monitoring data on full-scale Permeable Reactive Barriers (PRBs) installed to treat contaminated ground water at two different sites. This report will fill a need for a readily available source of information for si...

  3. Effect of regular sauna on epidermal barrier function and stratum corneum water-holding capacity in vivo in humans: a controlled study.


    Kowatzki, D; Macholdt, C; Krull, K; Schmidt, D; Deufel, T; Elsner, P; Fluhr, J W


    During the last few years, sauna has become the epitome of wellness. Besides studies in general medicine evaluating the health benefit of sauna, e.g. on the cardiovascular system, no systematic study regarding skin physiology has been published. The present exploratory study was intended to analyse the effect of regular Finnish sauna on skin physiology. The effect of regular sauna bathing was assessed with non-invasive instruments: stratum corneum water-holding capacity, skin redness, transepidermal water loss and surface skin pH were analysed in 41 healthy volunteers, aged 20-49 years, in a group with regular sauna exposure compared to a control group with no regular sauna exposure. A more stable epidermal barrier function, an increase in stratum corneum hydration, a faster recovery of both elevated water loss and skin pH after exposure to 2 x 15 min sauna at 80 degrees C could be demonstrated in volunteers with regular sauna. Heart beat rate and ionic concentration in sweat as well as epidermal blood perfusion showed a training effect under regular sauna. A decrease in casual skin sebum content on the skin surface of the forehead was observed in these volunteers. The present data suggest a protective effect of regular sauna on skin physiology, especially surface pH and stratum corneum water-holding capacity.

  4. Pharmacological modulation of blood-brain barrier increases permeability of doxorubicin into the rat brain.


    Sardi, Iacopo; la Marca, Giancarlo; Cardellicchio, Stefania; Giunti, Laura; Malvagia, Sabrina; Genitori, Lorenzo; Massimino, Maura; de Martino, Maurizio; Giovannini, Maria G


    Our group recently demonstrated in a rat model that pretreatment with morphine facilitates doxorubicin delivery to the brain in the absence of signs of increased acute systemic toxicity. Morphine and other drugs such as dexamethasone or ondansetron seem to inhibit MDR proteins localized on blood-brain barrier, neurons and glial cells increasing the access of doxorubicin to the brain by efflux transporters competition. We explored the feasibility of active modification of the blood-brain barrier protection, by using morphine dexamethasone or ondansetron pretreatment, to allow doxorubicin accumulation into the brain in a rodent model. Rats were pretreated with morphine (10 mg/kg, i.p.), dexamethasone (2 mg/kg, i.p.) or ondansetron (2 mg/kg, i.p.) before injection of doxorubicin (12 mg/kg, i.p.). Quantitative analysis of doxorubicin was performed by mass spectrometry. Acute hearth and kidney damage was analyzed by measuring doxorubicin accumulation, LDH activity and malondialdehyde plasma levels. The concentration of doxorubicin was significantly higher in all brain areas of rats pretreated with morphine (P < 0.001) or ondansetron (P < 0.05) than in control tissues. The concentration of doxorubicin was significantly higher in cerebral hemispheres and brainstem (P < 0.05) but not in cerebellum of rats pretreated with dexamethasone than in control tissues. Pretreatment with any of these drugs did not increase LDH activity or lipid peroxidation compared to controls. Our data suggest that morphine, dexamethasone or ondansetron pretreatment is able to allow doxorubicin penetration inside the brain by modulating the BBB. This effect is not associated with acute cardiac or renal toxicity. This finding might provide the rationale for clinical applications in the treatment of refractory brain tumors and pave the way to novel applications of active but currently inapplicable chemotherapeutic drugs.

  5. Analytical characterization and comparison of the blood-brain barrier permeability of eight opioid peptides.


    Van Dorpe, Sylvia; Adriaens, Antita; Polis, Ingeborgh; Peremans, Kathelijne; Van Bocxlaer, Jan; De Spiegeleer, Bart


    Opioid drugs, including the newly developed peptides, should penetrate the blood-brain barrier (BBB) for pain management activity. Although BBB transport is fragmentarily described for some mu-opioid peptides, a complete and comparative overview is currently lacking. In this study, the BBB transport of eight opioid peptides (EM-1, EM-2, CTAP, CTOP, DAMGO, dermorphin, TAPP and TAPS) is described and compared. In addition, the metabolic stability in plasma and brain was evaluated. The highest influx rate was obtained for dermorphin (K(in)=2.18 microl/(g x min)), followed by smaller rates for EM-1, EM-2 and TAPP (K(in)=1.06-1.14 microl/(g x min)). Negligible influx was observed for DAMGO, CTOP and TAPS (K(in)=0.18-0.40 microl/(g x min)) and no influx for CTAP. Capillary depletion revealed that all peptides reached brain parenchyma for over 75%. Efflux was shown for TAPP (t(1/2)=2.82 min) and to a lesser extent for EM-1, EM-2 and DAMGO (t(1/2)=10.66-21.98 min), while no significant efflux was observed for the other peptides. All peptides were stable in mouse plasma and brain, with generally higher stability in brain, except for EM-1 and EM-2 which showed plasma half-life stabilities of a few minutes only.

  6. Tight junction regulation by morphine and HIV-1 tat modulates blood-brain barrier permeability.


    Mahajan, Supriya D; Aalinkeel, Ravikumar; Sykes, Donald E; Reynolds, Jessica L; Bindukumar, B; Fernandez, Stanley F; Chawda, Ramnik; Shanahan, Thomas C; Schwartz, Stanley A


    Human immunodeficiency virus (HIV)-1 patients who abuse opiates are at a greater risk of developing neurological complications of AIDS. Alterations in blood-brain barrier (BBB) integrity are associated with cytoskeletal disorganization and disruption of tight junction (TJ) integrity. We hypothesize that opiates in combination with HIV-1 viral proteins can modulate TJ expression in primary brain microvascular endothelial cells (BMVEC), thereby compromising BBB integrity and exacerbating HIV-1 neuropathogenesis. We investigated the effect of morphine and/or tat on the expression of TJ proteins ZO-1, JAM-2, Occludin and P-glycoprotein and the functional effects of TJ modulation in BMVEC. Morphine and/or tat, via the activation of pro-inflammatory cytokines, intracellular Ca(2+) release, and activation of myosin light chain kinase, modulated TJ expression resulting in decreased transendothelial electric resistance and enhanced transendothelial migration across the BBB. These studies may lead to the development of novel anti-HIV-1 therapeutics that target specific TJ proteins, thus preventing TJ disruption in opiate using HIV-1 patients.

  7. Permeability barrier of the gram-negative bacterial outer membrane with special reference to nisin.


    Helander, I M; Mattila-Sandholm, T


    The effect of nisin pretreatment on organic acid-induced permeability increase in strains of Escherichia coli, Pseudomonas aeruginosa, P. marginalis, and Salmonella enterica sv. Typhimurium was investigated, using assays based on the uptake of a fluorescent dye 1-N-phenylnaphthylamine (NPN) and on the bacterial susceptibility to detergent-induced bacteriolysis. The outer membrane of bacteria which had been pretreated with nisin was shown to be less stable against 1 mM EDTA, as indicated by their significantly higher NPN uptake levels as compared to untreated bacteria. Upon challenge with a tenfold lower concentration of EDTA (0.1 mM) some nisin-treated strains (Typhimurium, P. marginalis) exhibited, however, NPN uptake levels which were lower than those seen in control bacteria, suggesting that nisin had stabilized their outer membrane. Nisin pretreatment also decreased the NPN uptake induced by citric or lactic acid or both in E. coli, P. marginalis, and Typhimurium, whereas in P. aeruginosa the pretreatment resulted in increased NPN uptake in response to citric and lactic acid. These results suggest that, with the exception of P. aeruginosa, nisin could protect bacteria from the outer membrane-disrupting effect caused by the acids. P. aeruginosa was, however, shown to be protected against bacteriolysis induced by the detergents sodium dodecylsulfate and Triton X-100. With a pair of isogenic mutants of Typhimurium differing in their cell surface charge it was shown that the NPN uptake response to I mM EDTA of the abnormally cationic strain was not significantly affected by nisin, whereas in the normal anionic strain nisin strongly strengthened the uptake. Our hypothesis based on these findings is that the normally anionic cell surface of Gram-negative bacteria has a tendency to bind the cationic nisin. The binding of nisin to the surface does not proceed to the cytoplasmic membrane, but in the outer membrane the bound nisin actually stabilizes its structure

  8. [The role of LSF/Grainyhead transcription factors in development and function of epidermal barrier in animals].


    Kikulska, Agnieszka; Mlacki, Michał; Wilanowski, Tomasz


    The LSF/Grainyhead family of transcription factors consists of proteins whose structure and functions have been preserved in the course of eukaryotic evolution--from primitive unicellular life forms to complex multicellular organisms. In the latter, these factors display tissue specificity and are active mainly in the covering epithelium. The roles of GRH factors are associated with regulation of expression of genes essential for correct differentiation and functioning of the epithelia of ectodermal origin. The Grh gene expression profiles are diverse and variable, especially during embryonic development. Research on the role of GRHL transcription factors is carried out on cellular and organismal level. In experimental animals, aberrant Grh gene expression leads to many diseases, including failure of epidermal wound healing and neural tube defects. Changes of these genes' expression levels are also linked to carcinogenesis. GRHL transcription factors participate in signaling pathways involved in cellular proliferation and apoptosis.

  9. Semi-analytical Solution of One-dimensional Multispecies Reactive Transport in a Permeable Reactive Barrier-aquifer System

    NASA Astrophysics Data System (ADS)

    Mieles, J. M.; Zhan, H.


    Permeable reactive barriers (PRBs) have been accepted by the EPA as an effective groundwater remediation technology. Effective implementation of this in-situ technology requires accurate site characterization to identify the chemicals of concern (COCs) present, their interactions (if any), and their required residence time in the PRB to achieve regulatory concentrations at the point of compliance (POC). Therefore, minimizing performance uncertainties in the design phase is key. Among these uncertainties determining the required PRB thickness is the most important and has been examined in other studies. Less attention, however, has been devoted to developing a practical yet rigorous tool for modeling multi-species reactive transport in the barrier-aquifer system. In this study Park and Zhan’s [2009] mass conservative semi-analytical solution - developed to calculate the required PRB thickness based on the decay of one species - is expanded to four reactive species. For example, the expanded solution could be used to model the degradation pathway from tetrachloroethylene (PCE) to vinyl chloride (VC). The solution is presented in two forms: The steady-state solution programmed into Excel can quickly assist designers in determining the required PRB thickness so that all COCs involved in the degradation pathway achieve regulatory limits at the POC. The second form is the transient solution which is solved by numerically inverting the Laplace transform. The semi-analytical solution presented in this study has several advantages over prior solutions. For example, the influent and effluent boundary conditions of the PRB are mass conservative and both dispersion and decay rate differences between the PRB and aquifer are considered. In addition, the transient solution allows for different retardation factors to be considered in both transport media and for each species.

  10. Development of modified flyash as a permeable reactive barrier medium for a former manufactured gas plant site, Northern Ireland

    NASA Astrophysics Data System (ADS)

    Doherty, R.; Phillips, D. H.; McGeough, K. L.; Walsh, K. P.; Kalin, R. M.


    A sequential biological permeable reactive barrier (PRB) was determined to be the best option for remediating groundwater that has become contaminated with a wide range of organic contaminants (i.e., benzene, toluene, ethylbenzene, xylene and polyaromatic hydrocarbons), heavy metals (i.e., lead and arsenic), and cyanide at a former manufactured gas plant after 150 years of operation in Portadown, Northern Ireland. The objective of this study was to develop a modified flyash that could be used in the initial cell within a sequential biological PRB to filter complex contaminated groundwater containing ammonium. Flyash modified with lime (CaOH) and alum was subjected to a series of batch tests which investigated the modified cation exchange capacity (CEC) and rate of removal of anions and cations from the solution. These tests showed that a high flyash composition medium (80%) could remove 8.65 mol of ammonium contaminant for every kilogram of medium. The modified CEC procedure ruled out the possibility of cation exchange as the major removal mechanism. The medium could also adsorb anions as well as cations (i.e., Pb and Cr), but not with the same capacity. The initial mechanism for Pb and Cr removal is probably precipitation. This is followed by sorption, which is possibly the only mechanism for the removal of dichromate anions. Scanning electron microscopic analysis revealed very small (<1 μm) cubic highly crystalline precipitates on the flyash, although this new crystalline zeolite growth did not occur rapidly enough to enable productive zeolite formation. Surface area measurements showed that biofilm growth on the medium could be a major factor in the comparative reduction of surface area between real and synthetic contaminant groundwaters. The modified flyash was found to be a highly sorptive granular material that did not inhibit microbiological activity, however, leaching tests revealed that the medium would fail as a long-term barrier material.

  11. Transforming Growth Factor-β Regulation of Epithelial Tight Junction Proteins Enhances Barrier Function and Blocks Enterohemorrhagic Escherichia coli O157:H7-Induced Increased Permeability

    PubMed Central

    Howe, Kathryn L.; Reardon, Colin; Wang, Arthur; Nazli, Aisha; McKay, Derek M.


    Enterohemorrhagic Escherichia coli O157:H7 (EHEC) is an enteric pathogen that causes potentially fatal symptoms after intimate adhesion, modulation of intestinal epithelial signal transduction, and alteration of epithelial function (eg, barrier disruption). Although the epithelial barrier is critical to gut homeostasis, only a few agents, such as transforming growth factor (TGF)-β, can enhance or protect epithelial barrier function. Our aims were to delineate the mechanism(s) behind TGF-β-induced barrier enhancement and to determine whether TGF-β could prevent EHEC-induced barrier disruption. Using monolayers of the human T84 colonic epithelial cell line, we found that TGF-β induced a significant increase in transepithelial electrical resistance (a measure of paracellular permeability) through activation of ERK MAPK and SMAD signaling pathways and up-regulation of the tight junction protein claudin-1. Additionally, TGF-β pretreatment of epithelia blocked the decrease in transepithelial electrical resistance and the increase in transepithelial passage of [3H]-mannitol caused by EHEC infection. EHEC infection was associated with reduced expression of zonula occludens-1, occludin, and claudin-2 (but not claudin-1 or claudin-4); TGF-β pretreatment prevented these changes. These studies provide insight into EHEC pathogenesis by illustrating the mechanisms underlying TGF-β-induced epithelial barrier enhancement and identifying TGF-β as an agent capable of blocking EHEC-induced increases in epithelial permeability via maintenance of claudin-2, occludin, and zonula occludens-1 levels. PMID:16314472

  12. Lactobacillus rhamnosus CNCM I-3690 and the commensal bacterium Faecalibacterium prausnitzii A2-165 exhibit similar protective effects to induced barrier hyper-permeability in mice

    PubMed Central

    Laval, L; Martin, R; Natividad, JN; Chain, F; Miquel, S; de Maredsous, C Desclée; Capronnier, S; Sokol, H; Verdu, EF; van Hylckama Vlieg, JET; Bermúdez-Humarán, LG; Smokvina, T; Langella, P


    Impaired gut barrier function has been reported in a wide range of diseases and syndromes and in some functional gastrointestinal disorders. In addition, there is increasing evidence that suggests the gut microbiota tightly regulates gut barrier function and recent studies demonstrate that probiotic bacteria can enhance barrier integrity. Here, we aimed to investigate the effects of Lactobacillus rhamnosus CNCM I-3690 on intestinal barrier function. In vitro results using a Caco-2 monolayer cells stimulated with TNF-α confirmed the anti-inflammatory nature of the strain CNCM I-3690 and pointed out a putative role for the protection of the epithelial function. Next, we tested the protective effects of L. rhamnosus CNCM I-3690 in a mouse model of increased colonic permeability. Most importantly, we compared its performance to that of the well-known beneficial human commensal bacterium Faecalibacterium prauznitzii A2-165. Increased colonic permeability was normalized by both strains to a similar degree. Modulation of apical tight junction proteins expression was then analyzed to decipher the mechanism underlying this effect. We showed that CNCM I-3690 partially restored the function of the intestinal barrier and increased the levels of tight junction proteins Occludin and E-cadherin. The results indicate L. rhamnosus CNCM I-3690 is as effective as the commensal anti-inflammatory bacterium F. prausnitzii to treat functional barrier abnormalities. PMID:25517879

  13. Lactobacillus rhamnosus CNCM I-3690 and the commensal bacterium Faecalibacterium prausnitzii A2-165 exhibit similar protective effects to induced barrier hyper-permeability in mice.


    Laval, L; Martin, R; Natividad, J N; Chain, F; Miquel, S; Desclée de Maredsous, C; Capronnier, S; Sokol, H; Verdu, E F; van Hylckama Vlieg, J E T; Bermúdez-Humarán, L G; Smokvina, T; Langella, P


    Impaired gut barrier function has been reported in a wide range of diseases and syndromes and in some functional gastrointestinal disorders. In addition, there is increasing evidence that suggests the gut microbiota tightly regulates gut barrier function and recent studies demonstrate that probiotic bacteria can enhance barrier integrity. Here, we aimed to investigate the effects of Lactobacillus rhamnosus CNCM I-3690 on intestinal barrier function. In vitro results using a Caco-2 monolayer cells stimulated with TNF-α confirmed the anti-inflammatory nature of the strain CNCM I-3690 and pointed out a putative role for the protection of the epithelial function. Next, we tested the protective effects of L. rhamnosus CNCM I-3690 in a mouse model of increased colonic permeability. Most importantly, we compared its performance to that of the well-known beneficial human commensal bacterium Faecalibacterium prauznitzii A2-165. Increased colonic permeability was normalized by both strains to a similar degree. Modulation of apical tight junction proteins expression was then analyzed to decipher the mechanism underlying this effect. We showed that CNCM I-3690 partially restored the function of the intestinal barrier and increased the levels of tight junction proteins Occludin and E-cadherin. The results indicate L. rhamnosus CNCM I-3690 is as effective as the commensal anti-inflammatory bacterium F. prausnitzii to treat functional barrier abnormalities.

  14. Melatonin Preserves Blood-Brain Barrier Integrity and Permeability via Matrix Metalloproteinase-9 Inhibition

    PubMed Central

    Alluri, Himakarnika; Wilson, Rickesha L.; Anasooya Shaji, Chinchusha; Wiggins-Dohlvik, Katie; Patel, Savan; Liu, Yang; Peng, Xu; Beeram, Madhava R.; Davis, Matthew L.; Huang, Jason H.; Tharakan, Binu


    Microvascular hyperpermeability that occurs at the level of the blood-brain barrier (BBB) often leads to vasogenic brain edema and elevated intracranial pressure following traumatic brain injury (TBI). At a cellular level, tight junction proteins (TJPs) between neighboring endothelial cells maintain the integrity of the BBB via TJ associated proteins particularly, zonula occludens-1 (ZO-1) that binds to the transmembrane TJPs and actin cytoskeleton intracellularly. The pro-inflammatory cytokine, interleukin-1β (IL-1β) as well as the proteolytic enzymes, matrix metalloproteinase-9 (MMP-9) are key mediators of trauma-associated brain edema. Recent studies indicate that melatonin a pineal hormone directly binds to MMP-9 and also might act as its endogenous inhibitor. We hypothesized that melatonin treatment will provide protection against TBI-induced BBB hyperpermeability via MMP-9 inhibition. Rat brain microvascular endothelial cells grown as monolayers were used as an in vitro model of the BBB and a mouse model of TBI using a controlled cortical impactor was used for all in vivo studies. IL-1β (10 ng/mL; 2 hours)-induced endothelial monolayer hyperpermeability was significantly attenuated by melatonin (10 μg/mL; 1 hour), GM6001 (broad spectrum MMP inhibitor; 10 μM; 1 hour), MMP-9 inhibitor-1 (MMP-9 specific inhibitor; 5 nM; 1 hour) or MMP-9 siRNA transfection (48 hours) in vitro. Melatonin and MMP-9 inhibitor-1 pretreatment attenuated IL-1β-induced MMP-9 activity, loss of ZO-1 junctional integrity and f-actin stress fiber formation. IL-1β treatment neither affected ZO-1 protein or mRNA expression or cell viability. Acute melatonin treatment attenuated BBB hyperpermeability in a mouse controlled cortical impact model of TBI in vivo. In conclusion, one of the protective effects of melatonin against BBB hyperpermeability occurs due to enhanced BBB integrity via MMP-9 inhibition. In addition, acute melatonin treatment provides protection against BBB

  15. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes

    PubMed Central

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan


    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing. PMID:25866745

  16. Biological permeable reactive barriers coupled with electrokinetic soil flushing for the treatment of diesel-polluted clay soil.


    Mena, Esperanza; Ruiz, Clara; Villaseñor, José; Rodrigo, Manuel A; Cañizares, Pablo


    Removal of diesel from spiked kaolin has been studied in the laboratory using coupled electrokinetic soil flushing (EKSF) and bioremediation through an innovative biological permeable reactive barriers (Bio-PRBs) positioned between electrode wells. The results show that this technology is efficient in the removal of pollutants and allows the soil to maintain the appropriate conditions for microorganism growth in terms of pH, temperature, and nutrients. At the same time, EKSF was demonstrated to be a very interesting technology for transporting pollutants, microorganisms and nutrients, although results indicate that careful management is necessary to avoid the depletion of nutrients, which are effectively transported by electro-migration. After two weeks of operation, 30% of pollutants are removed and energy consumption is under 70 kWh m(-3). Main fluxes (electroosmosis and evaporation) and changes in the most relevant parameters (nutrients, diesel, microorganisms, surfactants, moisture conductivity and pH) during treatment and in a complete post-study analysis are studied to give a comprehensive description of the most relevant processes occurring in the soil (pollutant transport and biodegradation).

  17. Comparison of permeable reactive barrier, funnel and gate, nonpumped wells, and low-capacity wells for groundwater remediation.


    Hudak, Paul F


    This modeling study compared the performance of a no-action and four active groundwater remediation alternatives: a permeable reactive barrier, a funnel and gate, nonpumped wells with filter media, and a low-capacity extraction and injection well. The simulated aquifer had an average seepage velocity of 0.04 m d(-1), and the initial contaminant plume was 58 m long and 13 m wide. For each active alternative, mass transport modeling identified the smallest structure necessary to contain and remove the contaminant plume. Although the no-action alternative did not contain the plume, each active alternative did contain and remove the plume, but with significantly different installation and operation requirements. Low-capacity pumping wells required the least infrastructure, with one extraction well and one injection well each discharging only 1.7 m(3) d(-1). The amount of time necessary to remove the contaminant plume was similar among active alternatives, except for the funnel and gate, which required much more time. Results of this study suggest that, for a modest seepage velocity and relatively narrow contaminant plume, low-capacity wells may be an effective alternative for groundwater remediation.

  18. Laboratory column study for evaluating a multimedia permeable reactive barrier for the remediation of ammonium contaminated groundwater.


    Kong, Xiangke; Bi, Erping; Liu, Fei; Huang, Guoxin; Ma, Jianfei


    In order to remediate ammonium contaminated groundwater, an innovative multimedia permeable reactive barrier (M-PRB) was proposed, which consisted of sequential columns combining oxygen releasing compound (ORC), zeolite, spongy iron and pine bark in the laboratory scale. Results showed that both ammonium and nitrate could be reduced to levels below the regulatory discharge limits through ion exchange and microbial degradation (nitrification and denitrification) in different compartments of the M-PRB system. The concentration of dissolved oxygen (DO) increased from 2 to above 20 mg/L after the simulated groundwater flowed through the oxygen releasing column packed with ORC, demonstrating that ORC could supply sufficient oxygen for subsequent microbial nitrification. Ammonium was efficiently removed from about 10 to below 0.5 mg N/L in the aerobic reaction column which was filled with biological zeolite. After 54 operating days, more than 70% ammonium could be removed by microbial nitrification in the aerobic reaction column, indicating that the combined use of ion exchange and nitrification by biological zeolite could ensure high and sustainable ammonium removal efficiency. To avoid the second pollution of nitrate produced by the former nitrification, spongy iron and pine bark were used to remove oxygen and supply organic carbon for heterotrophic denitrification in the oxygen removal column and anaerobic reaction column separately. The concentration of nitrate decreased from 14 to below 5 mg N/L through spongy iron-based chemical reduction and microbial denitrification.

  19. Fifteen-year assessment of a permeable reactive barrier for treatment of chromate and trichloroethylene in groundwater.


    Wilkin, Richard T; Acree, Steven D; Ross, Randall R; Puls, Robert W; Lee, Tony R; Woods, Leilani L


    The fifteen-year performance of a granular iron, permeable reactive barrier (PRB; Elizabeth City, North Carolina) is reviewed with respect to contaminant treatment (hexavalent chromium and trichloroethylene) and hydraulic performance. Due to in-situ treatment of the chromium source zone, reactive and hydraulic longevity of the PRB has outlived the mobile chromate plume. Chromium concentrations exceeding 3 μg/L have not been detected in regions located hydraulically down-gradient of the PRB. Trichloroethylene treatment has also been effective, although non-constant influent concentrations of trichloroethylene have at times resulted in incomplete dechlorination. Daughter products: cis-1,2-dichloroethylene, vinyl chloride, ethene, and ethane have been observed within and down-gradient of the PRB at levels <10% of the influent trichloroethylene. Analysis of potentiometric surfaces up-gradient and across the PRB suggests that the PRB may currently represent a zone of reduced hydraulic conductivity; however, measurements of the in-situ hydraulic conductivity provide values in excess of 200 m/d in some intervals and indicate no discernible loss of bulk hydraulic conductivity within the PRB. The results presented here are particularly significant because they provide the longest available record of performance of a PRB. The longevity of the Elizabeth City PRB is principally the result of favorable groundwater geochemistry and hydrologic properties of the site.

  20. Heavy metal removal from MSWI fly ash by electrokinetic remediation coupled with a permeable activated charcoal reactive barrier

    NASA Astrophysics Data System (ADS)

    Huang, Tao; Li, Dongwei; Kexiang, Liu; Zhang, Yuewei


    This paper presents the investigations into the feasibility of the application of a remediation system that couples electrokinetic remediation (EKR) with the permeable reactive barrier (PRB) concept for municipal solid waste incineration (MSWI) fly ash with activated charcoal as the PRB material. The experimental results of this study showed that the proposed combined method can effectively improve the remediation efficiency and that the addition of the oxalic acid to the PRB media before the coupled system can further enhance the remediation process. In the optimization tests, the maximum removals of Zn, Pb, Cu and Cd were achieved under different experimental conditions. The voltage gradient and processing time were shown to have significant effects on the removal of Cu and Cd, whereas the addition of the oxalic acid had a more significant influence on the removal of Pb. Generally, the processing time is the most significant factor in changing the removal rates of HMs in the enhanced coupled system. In terms of the leaching toxicity, the specimen remediated by ENEKR + PRB showed the lowest leaching value for each HM in the S2 and S3 regions.

  1. Column test-based optimization of the permeable reactive barrier (PRB) technique for remediating groundwater contaminated by landfill leachates.


    Zhou, Dan; Li, Yan; Zhang, Yinbo; Zhang, Chang; Li, Xiongfei; Chen, Zhiliang; Huang, Junyi; Li, Xia; Flores, Giancarlo; Kamon, Masashi


    We investigated the optimum composition of permeable reactive barrier (PRB) materials for remediating groundwater heavily contaminated by landfill leachate, in column tests using various mixtures of zero-valent iron (ZVI), zeolite (Zeo) and activated carbon (AC) with 0.01-0.25, 3.0-5.0 and 0.7-1.0mm grain sizes, respectively. The main contributors to the removal of organic/inorganic contaminants were ZVI and AC, and the optimum weight ratio of the three PRB materials for removing the contaminants and maintaining adequate hydraulic conductivity was found to be 5:1:4. Average reductions in chemical oxygen demand (COD) and contents of total nitrogen (TN), ammonium, Ni, Pb and 16 polycyclic aromatic hydrocarbons (PAHs) from test samples using this mixture were 55.8%, 70.8%, 89.2%, 70.7%, 92.7% and 94.2%, respectively. We also developed a systematic method for estimating the minimum required thickness and longevity of the PRB materials. A ≥ 309.6 cm layer with the optimum composition is needed for satisfactory longevity, defined here as meeting the Grade III criteria (the Chinese National Bureau of Standards: GB/T14848/93) for in situ treatment of the sampled groundwater for ≥ 10 years.

  2. Heavy metal removal from MSWI fly ash by electrokinetic remediation coupled with a permeable activated charcoal reactive barrier.


    Huang, Tao; Li, Dongwei; Kexiang, Liu; Zhang, Yuewei


    This paper presents the investigations into the feasibility of the application of a remediation system that couples electrokinetic remediation (EKR) with the permeable reactive barrier (PRB) concept for municipal solid waste incineration (MSWI) fly ash with activated charcoal as the PRB material. The experimental results of this study showed that the proposed combined method can effectively improve the remediation efficiency and that the addition of the oxalic acid to the PRB media before the coupled system can further enhance the remediation process. In the optimization tests, the maximum removals of Zn, Pb, Cu and Cd were achieved under different experimental conditions. The voltage gradient and processing time were shown to have significant effects on the removal of Cu and Cd, whereas the addition of the oxalic acid had a more significant influence on the removal of Pb. Generally, the processing time is the most significant factor in changing the removal rates of HMs in the enhanced coupled system. In terms of the leaching toxicity, the specimen remediated by ENEKR + PRB showed the lowest leaching value for each HM in the S2 and S3 regions.

  3. Feasibility Study of the Permeability and Uptake of Mesoporous Silica Nanoparticles across the Blood-Brain Barrier.


    Baghirov, Habib; Karaman, Didem; Viitala, Tapani; Duchanoy, Alain; Lou, Yan-Ru; Mamaeva, Veronika; Pryazhnikov, Evgeny; Khiroug, Leonard; de Lange Davies, Catharina; Sahlgren, Cecilia; Rosenholm, Jessica M


    Drug delivery into the brain is impeded by the blood-brain-barrier (BBB) that filters out the vast majority of drugs after systemic administration. In this work, we assessed the transport, uptake and cytotoxicity of promising drug nanocarriers, mesoporous silica nanoparticles (MSNs), in in vitro models of the BBB. RBE4 rat brain endothelial cells and Madin-Darby canine kidney epithelial cells, strain II, were used as BBB models. We studied spherical and rod-shaped MSNs with the following modifications: bare MSNs and MSNs coated with a poly(ethylene glycol)-poly(ethylene imine) (PEG-PEI) block copolymer. In transport studies, MSNs showed low permeability, whereas the results of the cellular uptake studies suggest robust uptake of PEG-PEI-coated MSNs. None of the MSNs showed significant toxic effects in the cell viability studies. While the shape effect was detectable but small, especially in the real-time surface plasmon resonance measurements, coating with PEG-PEI copolymers clearly facilitated the uptake of MSNs. Finally, we evaluated the in vivo detectability of one of the best candidates, i.e. the copolymer-coated rod-shaped MSNs, by two-photon in vivo imaging in the brain vasculature. The particles were clearly detectable after intravenous injection and caused no damage to the BBB. Thus, when properly designed, the uptake of MSNs could potentially be utilized for the delivery of drugs into the brain via transcellular transport.

  4. Feasibility Study of the Permeability and Uptake of Mesoporous Silica Nanoparticles across the Blood-Brain Barrier

    PubMed Central

    Baghirov, Habib; Karaman, Didem; Viitala, Tapani; Duchanoy, Alain; Lou, Yan-Ru; Mamaeva, Veronika; Pryazhnikov, Evgeny; Khiroug, Leonard; de Lange Davies, Catharina; Sahlgren, Cecilia; Rosenholm, Jessica M.


    Drug delivery into the brain is impeded by the blood-brain-barrier (BBB) that filters out the vast majority of drugs after systemic administration. In this work, we assessed the transport, uptake and cytotoxicity of promising drug nanocarriers, mesoporous silica nanoparticles (MSNs), in in vitro models of the BBB. RBE4 rat brain endothelial cells and Madin-Darby canine kidney epithelial cells, strain II, were used as BBB models. We studied spherical and rod-shaped MSNs with the following modifications: bare MSNs and MSNs coated with a poly(ethylene glycol)-poly(ethylene imine) (PEG-PEI) block copolymer. In transport studies, MSNs showed low permeability, whereas the results of the cellular uptake studies suggest robust uptake of PEG-PEI-coated MSNs. None of the MSNs showed significant toxic effects in the cell viability studies. While the shape effect was detectable but small, especially in the real-time surface plasmon resonance measurements, coating with PEG-PEI copolymers clearly facilitated the uptake of MSNs. Finally, we evaluated the in vivo detectability of one of the best candidates, i.e. the copolymer-coated rod-shaped MSNs, by two-photon in vivo imaging in the brain vasculature. The particles were clearly detectable after intravenous injection and caused no damage to the BBB. Thus, when properly designed, the uptake of MSNs could potentially be utilized for the delivery of drugs into the brain via transcellular transport. PMID:27547955

  5. Trichloroethylene removal from groundwater in flow-through columns simulating a permeable reactive barrier constructed with plant mulch.


    Shen, Hai; Wilson, John T


    Groundwater contaminated with TCE is commonly treated with a permeable reactive barrier (PRB) constructed with zero-valence iron. The cost of iron has driven a search for less costly alternatives, and composted plant mulch has been used as an alternative at several sites. A column study was conducted that simulated conditions in a PRB at Altus Air Force Base, Oklahoma. The reactive matrix was 50% (v/v) shredded tree mulch, 10% cotton gin trash, and 40% sand. The mean residence time of groundwater in the columns was 17 days. The estimated retardation factor for TCE was 12. TCE was supplied at concentrations near 20 microM. Over 793 days of operation, concentrations of TCE in the column effluents varied from 0.1% to 2% of the column influents. Concentrations of cis-DCE, vinyl chloride, ethylene, ethane, and acetylene could account for 1% of the TCE that was removed; however, up to 56% of 13C added as [1,2-13C] TCE in the column influents was recovered as 13C in carbon dioxide. After 383 and 793 d of operation, approximately one-half of the TCE removal was associated with abiotic reactions with FeS that accumulated in the reactive matrix.

  6. Improving Low-Dose Blood-Brain Barrier Permeability Quantification Using Sparse High-Dose Induced Prior for Patlak Model

    PubMed Central

    Fang, Ruogu; Karlsson, Kolbeinn; Chen, Tsuhan; Sanelli, Pina C.


    Blood-brain-barrier permeability (BBBP) measurements extracted from the perfusion computed tomography (PCT) using the Patlak model can be a valuable indicator to predict hemorrhagic transformation in patients with acute stroke. Unfortunately, the standard Patlak model based PCT requires excessive radiation exposure, which raised attention on radiation safety. Minimizing radiation dose is of high value in clinical practice but can degrade the image quality due to the introduced severe noise. The purpose of this work is to construct high quality BBBP maps from low-dose PCT data by using the brain structural similarity between different individuals and the relations between the high- and low-dose maps. The proposed sparse high-dose induced (shd-Patlak) model performs by building a high-dose induced prior for the Patlak model with a set of location adaptive dictionaries, followed by an optimized estimation of BBBP map with the prior regularized Patlak model. Evaluation with the simulated low-dose clinical brain PCT datasets clearly demonstrate that the shd-Patlak model can achieve more significant gains than the standard Patlak model with improved visual quality, higher fidelity to the gold standard and more accurate details for clinical analysis. PMID:24200529

  7. Formation of ferrihydrite and associated iron corrosion products in permeable reactive barriers of zero-valent iron

    NASA Technical Reports Server (NTRS)

    Furukawa, Yoko; Kim, Jin-Wook; Watkins, Janet; Wilkin, Richard T.


    Ferrihydrite, which is known to form in the presence of oxygen and to be stabilized by the adsorption of Si, PO4 and SO4, is ubiquitous in the fine-grained fractions of permeable reactive barrier (PRB) samples from the U.S. Coast Guard Support Center (Elizabeth City, NC) and the Denver Federal Center (Lakewood, CO) studied by high-resolution transmission electron microscopy and selected area electron diffraction. The concurrent energy-dispersive X-ray data indicate a strong association between ferrihydrite and metals such as Si, Ca, and Cr. Magnetite, green rust 1, aragonite, calcite, mackinawite, greigite and lepidocrocite were also present, indicative of a geochemical environment that is temporally and spatially heterogeneous. Whereas magnetite, which is known to form due to anaerobic Fe0 corrosion, passivates the Fe0 surface, ferrihydrite precipitation occurs away from the immediate Fe0 surface, forming small (<0.1 microm) discrete clusters. Consequently, Fe0-PRBs may remain effective for a longer period of time in slightly oxidized groundwater systems where ferrihydrite formation occurs compared to oxygen-depleted systems where magnetite passivation occurs. The ubiquitous presence of ferrihydrite suggests that the use of Fe0-PRBs may be extended to applications that require contaminant adsorption rather than, or in addition to, redox-promoted contaminant degradation.

  8. Examples of Department of Energy Successes for Remediation of Contaminated Groundwater: Permeable Reactive Barrier and Dynamic Underground Stripping ASTD Projects

    SciTech Connect

    Purdy, C.; Gerdes, K.; Aljayoushi, J.; Kaback, D.; Ivory, T.


    Since 1998, the Department of Energy's (DOE) Office of Environmental Management has funded the Accelerated Site Technology Deployment (ASTD) Program to expedite deployment of alternative technologies that can save time and money for the environmental cleanup at DOE sites across the nation. The ASTD program has accelerated more than one hundred deployments of new technologies under 76 projects that focus on a broad spectrum of EM problems. More than 25 environmental restoration projects have been initiated to solve the following types of problems: characterization of the subsurface using chemical, radiological, geophysical, and statistical methods; treatment of groundwater contaminated with DNAPLs, metals, or radionuclides; and other projects such as landfill covers, purge water management systems, and treatment of explosives-contaminated soils. One of the major goals of the ASTD Program is to deploy a new technology or process at multiple DOE sites. ASTD projects are encouraged to identify subsequent deployments at other sites. Some of the projects that have successfully deployed technologies at multiple sites focusing on cleanup of contaminated groundwater include: Permeable Reactive Barriers (Monticello, Rocky Flats, and Kansas City), treating uranium and organics in groundwater; and Dynamic Underground Stripping (Portsmouth, and Savannah River), thermally treating DNAPL source zones. Each year more and more new technologies and approaches are being used at DOE sites due to the ASTD program. DOE sites are sharing their successes and communicating lessons learned so that the new technologies can replace the baseline or standard approaches at DOE sites, thus expediting cleanup and saving money.

  9. Microbial and mineral evolution in zero valent iron-based permeable reactive barriers during long-term operations.


    Kumar, Naresh; Millot, Romain; Battaglia-Brunet, Fabienne; Omoregie, Enoma; Chaurand, Perrine; Borschneck, Daniel; Bastiaens, Leen; Rose, Jérôme


    Impacts of subsurface biogeochemical processes over time have always been a concern for the long-term performance of zero valent iron (Fe(0))-based permeable reactive barriers (PRBs). To evaluate the biogeochemical impacts, laboratory experiments were performed using flow-through glass columns for 210 days at controlled temperature (20 °C). Two different particle sizes of Fe(0) were used in the columns, and to simulate indigenous microbial activity, extra carbon source was provided in the two columns (biotic columns) and the remaining two columns were kept abiotic using gamma radiations. Heavy metals (Zn, As) were removed efficiently in all the columns, and no exhaustion of treatment capability or clogging was observed during our experimental duration. Newly formed Fe mineral phases and precipitates were characterized using X-ray diffraction (XRD), scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM-EDX), and micro-XRF techniques in solid phase at the end of the experiment. In addition, 16S rRNA gene extraction was used for microbial community identification in biotic columns. During the incubation, microbial population shifted in favor of Desulfosporosinus species (sulfate-reducing bacteria) from initial dominance of Acidithiobacillus ferrooxidans in sediments. Dominant mineral phases detected in biotic columns were mackinawite (FeS) and sulfate green rust, while in abiotic columns, magnetite/maghemite phases were more prevalent.

  10. Column test-based optimization of the permeable reactive barrier (PRB) technique for remediating groundwater contaminated by landfill leachates

    NASA Astrophysics Data System (ADS)

    Zhou, Dan; Li, Yan; Zhang, Yinbo; Zhang, Chang; Li, Xiongfei; Chen, Zhiliang; Huang, Junyi; Li, Xia; Flores, Giancarlo; Kamon, Masashi


    We investigated the optimum composition of permeable reactive barrier (PRB) materials for remediating groundwater heavily contaminated by landfill leachate, in column tests using various mixtures of zero-valent iron (ZVI), zeolite (Zeo) and activated carbon (AC) with 0.01-0.25, 3.0-5.0 and 0.7-1.0 mm grain sizes, respectively. The main contributors to the removal of organic/inorganic contaminants were ZVI and AC, and the optimum weight ratio of the three PRB materials for removing the contaminants and maintaining adequate hydraulic conductivity was found to be 5:1:4. Average reductions in chemical oxygen demand (COD) and contents of total nitrogen (TN), ammonium, Ni, Pb and 16 polycyclic aromatic hydrocarbons (PAHs) from test samples using this mixture were 55.8%, 70.8%, 89.2%, 70.7%, 92.7% and 94.2%, respectively. We also developed a systematic method for estimating the minimum required thickness and longevity of the PRB materials. A ≥ 309.6 cm layer with the optimum composition is needed for satisfactory longevity, defined here as meeting the Grade III criteria (the Chinese National Bureau of Standards: GB/T14848/93) for in situ treatment of the sampled groundwater for ≥ 10 years.

  11. Acute effects of focused ultrasound-induced increases in blood-brain barrier permeability on rat microvascular transcriptome

    PubMed Central

    McMahon, Dallan; Bendayan, Reina; Hynynen, Kullervo


    Therapeutic treatment options for central nervous system diseases are greatly limited by the blood-brain barrier (BBB). Focused ultrasound (FUS), in conjunction with circulating microbubbles, can be used to induce a targeted and transient increase in BBB permeability, providing a unique approach for the delivery of drugs from the systemic circulation into the brain. While preclinical research has demonstrated the utility of FUS, there remains a large gap in our knowledge regarding the impact of sonication on BBB gene expression. This work is focused on investigating the transcriptional changes in dorsal hippocampal rat microvessels in the acute stages following sonication. Microarray analysis of microvessels was performed at 6 and 24 hrs post-FUS. Expression changes in individual genes and bioinformatic analysis suggests that FUS may induce a transient inflammatory response in microvessels. Increased transcription of proinflammatory cytokine genes appears to be short-lived, largely returning to baseline by 24 hrs. This observation may help to explain some previously observed bioeffects of FUS and may also be a driving force for the angiogenic processes and reduced drug efflux suggested by this work. While further studies are necessary, these results open up intriguing possibilities for novel FUS applications and suggest possible routes for pharmacologically modifying the technique. PMID:28374753

  12. Improving low-dose blood-brain barrier permeability quantification using sparse high-dose induced prior for Patlak model.


    Fang, Ruogu; Karlsson, Kolbeinn; Chen, Tsuhan; Sanelli, Pina C


    Blood-brain barrier permeability (BBBP) measurements extracted from the perfusion computed tomography (PCT) using the Patlak model can be a valuable indicator to predict hemorrhagic transformation in patients with acute stroke. Unfortunately, the standard Patlak model based PCT requires excessive radiation exposure, which raised attention on radiation safety. Minimizing radiation dose is of high value in clinical practice but can degrade the image quality due to the introduced severe noise. The purpose of this work is to construct high quality BBBP maps from low-dose PCT data by using the brain structural similarity between different individuals and the relations between the high- and low-dose maps. The proposed sparse high-dose induced (shd-Patlak) model performs by building a high-dose induced prior for the Patlak model with a set of location adaptive dictionaries, followed by an optimized estimation of BBBP map with the prior regularized Patlak model. Evaluation with the simulated low-dose clinical brain PCT datasets clearly demonstrate that the shd-Patlak model can achieve more significant gains than the standard Patlak model with improved visual quality, higher fidelity to the gold standard and more accurate details for clinical analysis.

  13. Heavy metal removal from MSWI fly ash by electrokinetic remediation coupled with a permeable activated charcoal reactive barrier

    PubMed Central

    Huang, Tao; Li, Dongwei; Kexiang, Liu; Zhang, Yuewei


    This paper presents the investigations into the feasibility of the application of a remediation system that couples electrokinetic remediation (EKR) with the permeable reactive barrier (PRB) concept for municipal solid waste incineration (MSWI) fly ash with activated charcoal as the PRB material. The experimental results of this study showed that the proposed combined method can effectively improve the remediation efficiency and that the addition of the oxalic acid to the PRB media before the coupled system can further enhance the remediation process. In the optimization tests, the maximum removals of Zn, Pb, Cu and Cd were achieved under different experimental conditions. The voltage gradient and processing time were shown to have significant effects on the removal of Cu and Cd, whereas the addition of the oxalic acid had a more significant influence on the removal of Pb. Generally, the processing time is the most significant factor in changing the removal rates of HMs in the enhanced coupled system. In terms of the leaching toxicity, the specimen remediated by ENEKR + PRB showed the lowest leaching value for each HM in the S2 and S3 regions. PMID:26486449

  14. Remediation of arsenic-contaminated groundwater using media-injected permeable reactive barriers with a modified montmorillonite: sand tank studies.


    Luo, Ximing; Liu, Haifei; Huang, Guoxin; Li, Ye; Zhao, Yan; Li, Xu


    A modified montmorillonite (MMT) was prepared using an acid activation-sodium activation-iron oxide coating method to improve the adsorption capacities of natural MMTs. For MMT, its interlamellar distance increased from 12.29 to 13.36 Å, and goethite (α-FeOOH) was intercalated into its clay layers. Two novel media-injected permeable reactive barrier (MI-PRB) configurations were proposed for removing arsenic from groundwater. Sand tank experiments were conducted to investigate the performance of the two MI-PRBs: Tank A was filled with quartz sand. Tank B was packed with quartz sand and zero-valent iron (ZVI) in series, and the MMT slurry was respectively injected into them to form reactive zones. The results showed that for tank A, total arsenic (TA) removal of 98.57% was attained within the first 60 mm and subsequently descended slowly to 88.84% at the outlet. For tank B, a similar spatial variation trend was observed in the quartz sand layer, and subsequently, TA removal increased to ≥99.80% in the ZVI layer. TA removal by MMT mainly depended on both surface adsorption and electrostatic adhesion. TA removal by ZVI mainly relied on coagulation/precipitation and adsorption during the iron corrosion. The two MI-PRBs are feasible alternatives for in situ remediation of groundwater with elevated As levels.

  15. Characterization of Sertoli cells cultured in the bicameral chamber system: relationship between formation of permeability barriers and polarized secretion of transferrin.


    Onoda, M; Suárez-Quian, C A; Djakiew, D; Dym, M


    Sertoli cells from immature rats (18 days old) were cultured on Millipore filters impregnated with reconstituted basement membrane in bicameral chambers. Three types of cultures were obtained: 1) confluent monolayer cultures that formed a permeability barrier (impermeable), 2) confluent monolayer cultures that did not form a permeability barrier (permeable), and 3) subconfluent cultures (permeable). The relationships among fluid equilibrium, electrical resistance, and [3H]inulin transport between the apical and basal reservoirs of the chambers were examined. An impermeable confluent monolayer is defined when the cells of the Sertoli cell epithelial sheet are able to prevent hydrodynamic equilibration of fluid levels between the apical and basal reservoirs of a bicameral chamber. That is, a permeability barrier is present between the two sides of the chamber when fluid levels (volumes) do not change. In the impermeable confluent Sertoli cell monolayers, 7.5 +/- 0.6% of added [3H]inulin diffused across the monolayer during a 6-h collection period versus 13.7 +/- 0.5% in permeable cultures. Conversely, the electrical resistance was higher in the impermeable monolayers (41-71 ohm.cm2) than in the permeable layers (less than 33 ohm.cm2). A reciprocal linear relationship (Y = -4.68(X) + 91.50, r = 0.808) exists between inulin flux and electrical resistance, and this relationship is a function of cell density. Transferrin (Tf) was one of a few proteins detected in the basal medium of bicameral chambers, whereas most de novo synthesized proteins were secreted into the apical reservoir of the chamber. No significant differences in the total amount of Tf secreted by impermeable or permeable monolayers of Sertoli cells were observed. However, the Sertoli cell secretion ratios (apical/basal) of Tf during a 15-20-h collection period were 2.03 and 1.57 for impermeable monolayers plated at 2.4 x 10(6) and 3.6 x 10(6) cells/well, respectively, but less than 1.0 in permeable layers

  16. Cell-based in vitro blood-brain barrier model can rapidly evaluate nanoparticles' brain permeability in association with particle size and surface modification.


    Hanada, Sanshiro; Fujioka, Kouki; Inoue, Yuriko; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji


    The possibility of nanoparticle (NP) uptake to the human central nervous system is a major concern. Recent reports showed that in animal models, nanoparticles (NPs) passed through the blood-brain barrier (BBB). For the safe use of NPs, it is imperative to evaluate the permeability of NPs through the BBB. Here we used a commercially available in vitro BBB model to evaluate the permeability of NPs for a rapid, easy and reproducible assay. The model is reconstructed by culturing both primary rat brain endothelial cells and pericytes to support the tight junctions of endothelial cells. We used the permeability coefficient (P(app)) to determine the permeability of NPs. The size dependency results, using fluorescent silica NPs (30, 100, and 400 nm), revealed that the Papp for the 30 nm NPs was higher than those of the larger silica. The surface charge dependency results using Qdots® (amino-, carboxyl-, and PEGylated-Qdots), showed that more amino-Qdots passed through the model than the other Qdots. Usage of serum-containing buffer in the model resulted in an overall reduction of permeability. In conclusion, although additional developments are desired to elucidate the NPs transportation, we showed that the BBB model could be useful as a tool to test the permeability of nanoparticles.

  17. The Blood-Brain Barrier Permeability of Lignans and Malabaricones from the Seeds of Myristica fragrans in the MDCK-pHaMDR Cell Monolayer Model.


    Wu, Ni; Xu, Wei; Cao, Gui-Yun; Yang, Yan-Fang; Yang, Xin-Bao; Yang, Xiu-Wei


    The blood-brain barrier (BBB) permeability of twelve lignans and three phenolic malabaricones from the seeds of Myristica fragrans (nutmeg) were studied with the MDCK-pHaMDR cell monolayer model. The samples were measured by high-performance liquid chromatography and the apparent permeability coefficients (Papp) were calculated. Among the fifteen test compounds, benzonfuran-type, dibenzylbutane-type and arylnaphthalene-type lignans showed poor to moderate permeabilities with Papp values at 10(-8)-10(-6) cm/s; those of 8-O-4'-neolignan and tetrahydrofuran-lignan were at 10(-6)-10(-5) cm/s, meaning that their permeabilities are moderate to high; the permeabilities of malabaricones were poor as their Papp values were at 10(-8)-10(-7) cm/s. To 5-methoxy-dehydrodiisoeugenol (2), erythro-2-(4-allyl-2,6-dimethoxyphenoxy)-1-(3,4-dimethoxyphenyl)-propan-1-ol acetate (6), verrucosin (8), and nectandrin B (9), an efflux way was involved and the main transporter for 6, 8 and 9 was demonstrated to be P-glycoprotein. The time and concentration dependency experiments indicated the main transport mechanism for neolignans dehydrodiisoeugenol (1), myrislignan (7) and 8 was passive diffusion. This study summarized the relationship between the BBB permeability and structure parameters of the test compounds, which could be used to preliminarily predict the transport of a compound through BBB. The results provide a significant molecular basis for better understanding the potential central nervous system effects of nutmeg.

  18. A new PAMPA model using an in-house brain lipid extract for screening the blood-brain barrier permeability of drug candidates.


    Bicker, Joana; Alves, Gilberto; Fortuna, Ana; Soares-da-Silva, Patrício; Falcão, Amílcar


    The determination of the permeability of drug candidates across the blood-brain barrier (BBB) is a fundamental step during drug discovery programs. The parallel artificial membrane permeability assay (PAMPA) is a high throughput screening tool applied to evaluate the passive permeability and adapted to predict BBB penetration. Herein, a new PAMPA model was developed using an in-house brain lipid extract capable of discriminating BBB permeable from non-permeable compounds. The apparent permeability (Papp) of 18 reference molecules and 10 test compounds was assessed and compared with phosphatidylcholine and commercial porcine polar brain lipid (PBL). The physicochemical selectivity of the in-house brain lipid extract was demonstrated by correlating Papp values with physicochemical properties and its predictive capacity estimated by establishing in vitro-in vivo correlations. The strong correlations achieved between 2% (w/v) in-house lipid extract and PBL for reference (r(2)=0.77) and test compounds (r(2)=0.94) support an equivalent discriminatory capacity and validate the presented model. Moreover, PAMPA studies performed with PBL and in-house lipid extract exhibited a higher correlation with the in vivo parameter logBB (r(2)=0.76 and r(2)=0.72, respectively) than phosphatidylcholine (r(2)=0.51). Overall, the applied lipid extraction process was reproducible, economical and provided lipid extracts that can be used to reliably assess BBB permeation.

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  20. MRI blood-brain barrier permeability measurements to predict hemorrhagic transformation in a rat model of ischemic stroke.


    Hoffmann, Angelika; Bredno, Jörg; Wendland, Michael F; Derugin, Nikita; Hom, Jason; Schuster, Tibor; Zimmer, Claus; Su, Hua; Ohara, Peter T; Young, William L; Wintermark, Max


    Permeability imaging might add valuable information in the risk assessment of hemorrhagic transformation. This study evaluates the predictive value of blood-brain barrier permeability (BBBP) measurements extracted from dynamic contrast-enhanced MRI for hemorrhagic transformation in ischemic stroke. Spontaneously hypertensive and Wistar rats with 2 h filament occlusion of the right MCA underwent MRI during occlusion, at 4 and 24 h post reperfusion. BBBP was imaged by DCE imaging and quantified by Patlak analysis. Cresyl-violet staining was used to characterize hemorrhage in sacrificed rats at 24 h, immediately following the last imaging study. BBBP changes were evaluated at baseline, 4 and 24 h after reperfusion. Receiver-operating characteristic (ROC) analysis was performed to determine the most accurate BBBP threshold to predict hemorrhagic transformation. In animals showing macroscopic hemorrhage at 24 h, 95th BBBP percentile values ipsilateral were 0.323 [0.260, 0.387], 0.685 [0.385, 0.985], and 0.412 [0.210, 0.613] ml/min·100 g (marginal mean [95%CI]) during occlusion, at 4 and 24 h post reperfusion, respectively. The BBBP values on the infarcted and contralateral side were significantly different at 4 (p = 0.034) and 24 h post reperfusion (p = 0.031). The predictive value of BBBP in terms of macroscopic hemorrhage was highest 4 h after reperfusion (ROC area under the curve = 84 %) with a high negative predictive value (98.3 %) and limited positive predictive value (14.9 %) for a threshold of 0.35 ml/min·100g. Altered BBBP is a necessary but not sufficient condition to cause hemorrhagic transformation in rats with an infarct. Further research is needed to identify those additional risk factors that are required for hemorrhagic transformation to develop in the setting of ischemic stroke.

  1. Influences of follicle-stimulating hormone, proteases, and antiproteases on permeability of the barrier generated by Sertoli cells in a two-chambered assembly

    SciTech Connect

    Ailenberg, M.; Fritz, I.B.


    Factors have been identified that influence the integrity of the barrier generated by Sertoli cells (SC) in culture in a two-chambered assembly. The permeability of the barrier was assessed by determining rates of equilibration of (3H)methoxyinulin or (86Rb)Cl across the Sertoli cell monolayer. The complete system consisted of a confluent monolayer of SC maintained on an extracellular matrix (Matrigel)-coated filter together with peritubular cells on the opposite side of the filter. In confirmation of previous results, levels of plasminogen activator (PA) activity secreted were increased by treatment of SC with FSH or with cAMP derivatives ((Bu)2cAMP (dbcAMP)). PA levels in the culture medium were inversely related to times required for 50% equilibration of (3H)methoxyinulin across the SC monolayer. Thus, elevated PA levels, elicited by stimulation with FSH or dbcAMP, were associated with a decreased integrity of the barrier generated by SC preparations maintained in serum-free medium in the complete system. The increase in permeability of the barrier in SC elicited by FSH dbcAMP could be prevented, however, by the addition of various antiproteases. FSH actions on barrier function were complex. Effects of FSH that favored barrier integrity were most readily detected when proteolytic activity was inhibited. The addition of intact serum increased the integrity of the barrier, but acid-treated serum depleted of antiproteases had no such effect. We advance the hypothesis that proteases are implicated in modulation of the formation and maintenance of the seminiferous tubule barrier by SC.

  2. Cement kiln dust (CKD)-filter sand permeable reactive barrier for the removal of Cu(II) and Zn(II) from simulated acidic groundwater.


    Sulaymon, Abbas H; Faisal, Ayad A H; Khaliefa, Qusey M


    The hydraulic conductivity and breakthrough curves of copper and zinc contaminants were measured in a set of continuous column experiments for 99 days using cement kiln dust (CKD)-filter sand as the permeable reactive barrier. The results of these experiments proved that the weight ratios of the cement kiln dust-filter sand (10:90 and 20:80) are adequate in preventing the loss of reactivity and hydraulic conductivity and, in turn, avoiding reduction in the groundwater flow. These results reveal a decrease in the hydraulic conductivity, which can be attributed to an accumulation of most of the quantity of the contaminant masses in the first sections of the column bed. Breakthrough curves for the description of the temporal contaminant transport within the barrier were found to be more representative by the Belter-Cussler-Hu and Yan models based on the coefficient of determination and Nash-Sutcliffe efficiency. The longevity of the barrier was simulated for the field scale, based on the laboratory column tests and the values verified that cement kiln dust can be effectively used in the future, as the reactive material in permeable reactive barrier technology. These results signify that the longevity of the barrier is directly proportional to its thickness and inversely to the percentage of the CKD used.

  3. Combining Nitrilotriacetic Acid and Permeable Barriers for Enhanced Phytoextraction of Heavy Metals from Municipal Solid Waste Compost by and Reduced Metal Leaching.


    Zhao, Shulan; Jia, Lina; Duo, Lian


    Phytoextraction has the potential to remove heavy metals from contaminated soil, and chelants can be used to improve the capabilities of phytoextraction. However, environmentally persistent chelants can cause metal leaching and groundwater pollution. A column experiment was conducted to evaluate the viability of biodegradable nitrilotriacetic acid (NTA) to increase the uptake of heavy metals (Cd, Cr, Ni, Pb, Cu, and Zn) by L. in municipal solid waste (MSW) compost and to evaluate the effect of two permeable barrier materials, bone meal and crab shell, on metal leaching. The application of NTA significantly increased the concentrations and uptake of heavy metals in . The enhancement was more pronounced at higher dosages of NTA. In the 15 mmol kg NTA treatment using a crab shell barrier, the Cr and Ni concentrations in the plant shoots increased by approximately 8- and 10-fold, respectively, relative to the control. However, the addition of NTA also caused significant heavy metal leaching from the MSW compost. Bone meal and crab shell barriers positioned between the compost and the subsoil were effective in preventing metal leaching down through the soil profile by the retention of metals in the barrier. The application of a biodegradable chelant and the use of permeable barriers is a viable form of enhanced phytoextraction to increase the removal of metals and to reduce possible leaching.

  4. Effects of fractionated radiation on the brain vasculature in a murine model: Blood-brain barrier permeability, astrocyte proliferation, and ultrastructural changes

    SciTech Connect

    Yuan Hong; Gaber, M. Waleed . E-mail:; Boyd, Kelli; Wilson, Christy M.; Kiani, Mohammad F.; Merchant, Thomas E.


    Purpose: Radiation therapy of CNS tumors damages the blood-brain barrier (BBB) and normal brain tissue. Our aims were to characterize the short- and long-term effects of fractionated radiotherapy (FRT) on cerebral microvasculature in mice and to investigate the mechanism of change in BBB permeability in mice. Methods and Materials: Intravital microscopy and a cranial window technique were used to measure BBB permeability to fluorescein isothiocyanate (FITC)-dextran and leukocyte endothelial interactions before and after cranial irradiation. Daily doses of 2 Gy were delivered 5 days/week (total, 40 Gy). We immunostained the molecules to detect the expression of glial fibrillary acidic protein and to demonstrate astrocyte activity in brain parenchyma. To relate the permeability changes to endothelial ultrastructural changes, we used electron microscopy. Results: Blood-brain barrier permeability did not increase significantly until 90 days after FRT, at which point it increased continuously until 180 days post-FRT. The number of adherent leukocytes did not increase during the study. The number of astrocytes in the cerebral cortex increased significantly; vesicular activity in endothelial cells increased beginning 90 days after irradiation, and most tight junctions stayed intact, although some were shorter and less dense at 120 and 180 days. Conclusions: The cellular and microvasculature response of the brain to FRT is mediated through astrogliosis and ultrastructural changes, accompanied by an increase in BBB permeability. The response to FRT is delayed as compared with single-dose irradiation treatment, and does not involve leukocyte adhesion. However, FRT induces an increase in the BBB permeability, as in the case of single-dose irradiation.

  5. The effect of an NK1 receptor antagonist on blood spinal cord barrier permeability following balloon compression-induced spinal cord injury.


    Leonard, Anna V; Vink, Robert


    The blood spinal cord barrier (BSCB) is disrupted following spinal cord injury (SCI) resulting in vasogenic edema and increased intrathecal pressure (ITP). The neuropeptide substance P (SP) has been implicated in the development of blood-brain barrier (BBB) disruption, edema, and increased intracranial pressure following brain injury, although it has not been investigated in SCI. The balloon compression model of experimental SCI has many advantages in that it replicates the "closed" environment observed clinically. Accordingly, this study characterized whether this model produces an increase in BSCB permeability and edema, and whether a SP, NK1 tachykinin receptor antagonist, N-acetyl-L-tryptophan (NAT) reduces such BSCB disruption and edema formation. At 30 min post-injury, animals were administered 2.5 mg/kg NAT or saline. Subgroups of animals were assessed for BSCB permeability (Evan's Blue) and spinal cord edema (wet weight/dry weight). BSCB permeability and edema were significantly increased in injured groups compared with sham (p < 0.001). There was no significant difference between vehicle and NAT treatment. We conclude that the balloon compression model of SCI produces significant BSCB disruption although NAT treatment did not attenuate BSCB permeability or edema. Further studies are required to fully elucidate the role of SP following SCI.

  6. Linkage of Mineral Precipitation to the Development of Heterogeneity in Permeable Reactive Barrier: a Field Column Study

    NASA Astrophysics Data System (ADS)

    Kamolpornwijit, W.; Liang, L.; Liang, L.; Moline, G. R.; Sullivan, A. B.; West, O. R.


    A column study was conducted on site at Y-12, Oak Ridge, TN, to investigate the rate of mineral accumulation in relation to the hydraulic change as a result of heterogeneity development in a Fe(0) permeable reactive barrier (PRB). To better simulate the fluctuation in groundwater characteristics and the least disturbance to gas-water equilibrium, two columns filled with zero valent iron (mesh size 8-50 obtained from Peerless Industries) were set up with direct connections to a groundwater well. Water samples were taken periodically to observe iron deterioration, ionic species removal, mineral precipitation, and hydrological properties under both accelerated- and normal-groundwater flow conditions. According to the ionic species analysis and the hydraulic tracer tests, the initially established plug flow behavior in the accelerated-flow column was maintained after 150 pore volumes (PVs); the porosity loss due to mineral precipitation was estimated to be 6.2-8.7%. The precipitate volumes were calculated from mass balance with assumed precipitate species and densities of precipitates as pure compounds. As a result, this calculation represents the upper bound on precipitate amounts and porosity loss. Using literature published corrosion rate at 0.7 mM/, the estimated lower bound for porosity loss is 2.3%. With time, the deviation from plug flow behavior was observed as the columns underwent complex heterogeneity development, which was reflected in both ionic species removals and hydrological performance. The development of preferential flow paths was caused by mineral precipitation and gas production. After 490 PVs, 4900 liters of groundwater, 215 days of column study, with an estimate of 16.7-24.7% porosity loss, the breakthrough time was shortened from 270 to 50 minutes. According to the resident time obtained from hydraulic tracer tests, the 215 days of column operation is equivalent to 9.5 years operation at a field site, based on 0.3m/d flow of 1-meter thick

  7. An update of the defensive barrier function of skin.


    Lee, Seung Hun; Jeong, Se Kyoo; Ahn, Sung Ku


    Skin, as the outermost organ in the human body, continuously confronts the external environment and serves as a primary defense system. The protective functions of skin include UV-protection, anti-oxidant and antimicrobial functions. In addition to these protections, skin also acts as a sensory organ and the primary regulator of body temperature. Within these important functions, the epidermal permeability barrier, which controls the transcutaneous movement of water and other electrolytes, is probably the most important. This permeability barrier resides in the stratum corneum, a resilient layer composed of corneocytes and stratum corneum intercellular lipids. Since the first realization of the structural and biochemical diversities involved in the stratum corneum, a tremendous amount of work has been performed to elucidate its roles and functions in the skin, and in humans in general. The perturbation of the epidermal permeability barrier, previously speculated to be just a symptom involved in skin diseases, is currently considered to be a primary pathophysiologic factor for many skin diseases. In addition, much of the evidence provides support for the idea that various protective functions in the skin are closely related or even co-regulated. In this review, the recent achievements of skin researchers focusing on the functions of the epidermal permeability barrier and their importance in skin disease, such as atopic dermatitis and psoriasis, are introduced.

  8. An Update of the Defensive Barrier Function of Skin

    PubMed Central

    Jeong, Se Kyoo; Ahn, Sung Ku


    Skin, as the outermost organ in the human body, continuously confronts the external environment and serves as a primary defense system. The protective functions of skin include UV-protection, anti-oxidant and antimicrobial functions. In addition to these protections, skin also acts as a sensory organ and the primary regulator of body temperature. Within these important functions, the epidermal permeability barrier, which controls the transcutaneous movement of water and other electrolytes, is probably the most important. This permeability barrier resides in the stratum corneum, a resilient layer composed of corneocytes and stratum corneum intercellular lipids. Since the first realization of the structural and biochemical diversities involved in the stratum corneum, a tremendous amount of work has been performed to elucidate its roles and functions in the skin, and in humans in general. The perturbation of the epidermal permeability barrier, previously speculated to be just a symptom involved in skin diseases, is currently considered to be a primary pathophysiologic factor for many skin diseases. In addition, much of the evidence provides support for the idea that various protective functions in the skin are closely related or even co-regulated. In this review, the recent achievements of skin researchers focusing on the functions of the epidermal permeability barrier and their importance in skin disease, such as atopic dermatitis and psoriasis, are introduced. PMID:16807977

  9. Verification and monitoring of deep granular iron permeable reactive barriers emplaced by vertical hydraulic fracturing and injection for groundwater remediation

    NASA Astrophysics Data System (ADS)

    Hubble, David Wallace

    This study evaluated the use of vertical hydraulic fracturing and injection (VHFI) to emplace granular iron as a deep passive treatment system to remove organic contaminants from groundwater at the Massachusetts Military Reservation on Cape Cod, Massachusetts. It was the first permeable reactive barrier (PRB) constructed at a depth greater than 15 m below the ground surface. VHFI propagates a vertical fracture from a slot cut through the injection-well casing at a selected depth and orientation. Granular iron is suspended in a viscous fluid using a biodegradable guar polymer and pumped through the slot to form a thin vertical sheet. Two PRBs were emplaced 6 m apart and perpendicular to the groundwater flow direction with mid-depths of about 30 m below the ground surface. Due to the depth, all of the emplacement and verification methods used down-hole tools. Resistivity imaging used salt added to the guar as an electrical tracer to map the spread of the VHFI fluid for propagation control and to estimate the extent of the completed PRB. Radar tomography before and after emplacement also provided images of the PRBs and hydraulic pulse testing and electromagnetic logging provided additional data. One PRB consisted of 40 tonnes of granular iron and was estimated to be an average of 80 mm thick. Based on geophysical imaging, the 100% iron PRB was 15 m long and extended from about 24.5 to 35.5 m depth. The second PRB consisted of a mixture of 5.6 tonnes of well sand and 4.4 tonnes of iron, but was only partially completed. Based on imaging, the sand/iron PRB comprised an area 9 m long extending from about 27 to 34.5 m below the ground surface. The proximity of screened wells, which deviated significantly from vertical toward the PRB alignment, resulted in loss of VHFI control. A sub-horizontal layer of iron formed between the 100% iron PRB and several of the wells. Similarly, piping failure zones formed between the sand/iron PRB and two geophysical wells. Selected

  10. Design of a multifunctional permeable reactive barrier for the treatment of landfill leachate contamination: laboratory column evaluation.


    Van Nooten, Thomas; Diels, Ludo; Bastiaens, Leen


    This study describes a laboratory-scale multifunctional permeable reactive barrier (multibarrier) for the removal of ammonium (NH4+: 313 +/- 51 mg N L(-1)), adsorbable organic halogens (AOX: 0.71 +/- 0.25 mg Cl L(-1)), chemical oxygen demand (COD: 389 +/- 36 mg L(-1)), and toxicity from leachate originating from a 40-year-old Belgian landfill. The complexity of the contamination required a sequential setup combining different reactive materials and removal processes. All target contaminants could be removed to levels below the regulatory discharge limits. Ammonium was efficiently removed in a first microbial nitrification compartment, which was equipped with diffusive oxygen emitters to ensure a sufficient oxygen supply. Ammonium was mainly oxidized to nitrite and to a lesser extent to nitrate, with an average mass recovery of 96%. Remaining ammonium concentrations could be further removed by ion exchange in a second compartment filled with clinoptilolite, exhibiting a total ammonium removal capacity of 46.7 mg N per g of clinoptilolite. Athird microbial denitrification compartment fed with sodium butyrate as a carbon source, was used to remove nitrate and nitrite formed in the first compartment. Maximum nitrification and denitrification rates at 12 degrees C indicated that hydraulic retention times of approximately 62 h and approximately 32 h were required in the columns to remove 400 mg N L(-1) by nitrification and denitrification, respectively. Leachate toxicity decreased to background levelstogetherwiththe removal of ammonium and its oxidation products. AOX and COD were efficiently removed by sorption in an additional compartment filled with granular activated carbon.

  11. FeS-coated sand for removal of arsenic(III) under anaerobic conditions in permeable reactive barriers

    USGS Publications Warehouse

    Han, Y.-S.; Gallegos, T.J.; Demond, A.H.; Hayes, K.F.


    Iron sulfide (as mackinawite, FeS) has shown considerable promise as a material for the removal of As(III) under anoxic conditions. However, as a nanoparticulate material, synthetic FeS is not suitable for use in conventional permeable reactive barriers (PRBs). This study developed a methodology for coating a natural silica sand to produce a material of an appropriate diameter for a PRB. Aging time, pH, rinse time, and volume ratios were varied, with a maximum coating of 4.0 mg FeS/g sand achieved using a pH 5.5 solution at a 1:4 volume ratio (sand: 2 g/L FeS suspension), three days of aging and no rinsing. Comparing the mass deposited on the sand, which had a natural iron-oxide coating, with and without chemical washing showed that the iron-oxide coating was essential to the formation of a stable FeS coating. Scanning electron microscopy images of the FeS-coated sand showed a patchwise FeS surface coating. X-ray photoelectron spectroscopy showed a partial oxidation of the Fe(II) to Fe(III) during the coating process, and some oxidation of S to polysulfides. Removal of As(III) by FeS-coated sand was 30% of that by nanoparticulate FeS at pH 5 and 7. At pH 9, the relative removal was 400%, perhaps due to the natural oxide coating of the sand or a secondary mineral phase from mackinawite oxidation. Although many studies have investigated the coating of sands with iron oxides, little prior work reports coating with iron sulfides. The results suggest that a suitable PRB material for the removal of As(III) under anoxic conditions can be produced through the deposition of a coating of FeS onto natural silica sand with an iron-oxide coating. ?? 2010 Elsevier Ltd.

  12. Enhanced chitosan beads-supported Fe(0)-nanoparticles for removal of heavy metals from electroplating wastewater in permeable reactive barriers.


    Liu, Tingyi; Yang, Xi; Wang, Zhong-Liang; Yan, Xiaoxing


    The removal of heavy metals from electroplating wastewater is a matter of paramount importance due to their high toxicity causing major environmental pollution problems. Nanoscale zero-valent iron (NZVI) became more effective to remove heavy metals from electroplating wastewater when enhanced chitosan (CS) beads were introduced as a support material in permeable reactive barriers (PRBs). The removal rate of Cr (VI) decreased with an increase of pH and initial Cr (VI) concentration. However, the removal rates of Cu (II), Cd (II) and Pb (II) increased with an increase of pH while decreased with an increase of their initial concentrations. The initial concentrations of heavy metals showed an effect on their removal sequence. Scanning electron microscope images showed that CS-NZVI beads enhanced by ethylene glycol diglycidyl ether (EGDE) had a loose and porous surface with a nucleus-shell structure. The pore size of the nucleus ranged from 19.2 to 138.6 μm with an average aperture size of around 58.6 μm. The shell showed a tube structure and electroplating wastewaters may reach NZVI through these tubes. X-ray photoelectron spectroscope (XPS) demonstrated that the reduction of Cr (VI) to Cr (III) was complete in less than 2 h. Cu (II) and Pb (II) were removed via predominant reduction and auxiliary adsorption. However, main adsorption and auxiliary reduction worked for the removal of Cd (II). The removal rate of total Cr, Cu (II), Cd (II) and Pb (II) from actual electroplating wastewater was 89.4%, 98.9%, 94.9% and 99.4%, respectively. The findings revealed that EGDE-CS-NZVI-beads PRBs had the capacity to remediate actual electroplating wastewater and may become an effective and promising technology for in situ remediation of heavy metals.

  13. Hydraulic and geochemical performance of a permeable reactive barrier containing zero-valent iron, Denver Federal Center

    USGS Publications Warehouse

    McMahon, P.B.; Dennehy, K.F.; Sandstrom, M.W.


    The hydraulic and geochemical performance of a 366 m long permeable reactive barrier (PRB) at the Denver Federal Center; Denver, Colorado, was evaluated. The funnel and gate system, which was installed in 1996 to intercept and remediate ground water contaminated with chlorinated aliphatic hydrocarbons (CAHs), contained four 12.2 m wide gates filled with zero-valent iron. Ground water mounding on the upgradient side of the PRB resulted in a tenfold increase in the hydraulic gradient and ground water velocity through the gates compared to areas of the aquifer unaffected by the PRB. Water balance calculations for April 1997 indicate that about 75% of the ground water moving toward the PRB from upgradient areas moved through the gates. The rest of the water either accumulated on the upgradient side of the PRB or bypassed the PRB. Chemical data from monitoring wells screened down-gradient, beneath, and at the ends of the PRB indicate that contaminants had not bypassed the PRB, except in a few isolated areas. Greater than 99% of the CAH mass entering the gates was retained by the iron. Fifty-one percent of the CAH carbon entering one gate was accounted for in dissolved C1 and C2 hydrocarbons, primarily ethane and ethene, which indicates that CAHs may adsorb to the iron prior to being dehalogenated. Treated water exiting the gates displaced contaminated ground water at a distance of at least 3 m downgradient from the PRB by the end of 1997. Measurements of dissolved inorganic ions in one gate indicate that calcite and siderite precipitation in the gate could reduce gate porosity by about 0.35% per year. Results from this study indicate that funnel and gate systems containing zero-valent iron can effectively treat ground water contaminated with CAHs. However, the hydrologic impacts of the PRB on the flow system need to be fully understood to prevent contaminants from bypassing the PRB.

  14. Evaluation of removal of orthophosphate and ammonia from rainfall runoff using aboveground permeable reactive barrier composed of limestone and zeolite.


    Srinivasan, Rajani; Hoffman, Dennis W; Wolfe, June E; Prcin, Lisa J


    This paper evaluates the design and performance of an Aboveground Permeable Reactive Barrier (APRB) system made of polyethylene mesh bags (FlowBags) containing crushed limestone and zeolite for adsorption of orthophosphate-P (PO4-P) and ammonia-N (NH4-N) from rainfall runoff. Laboratory batch experiments, simulated runoff experiments and actual APRB implementations were performed to evaluate the performance of the APRB. Batch experiments were performed to determine adsorption efficiency of crushed zeolite and limestone as reactive materials in APRB for removal of dissolved ammonium nitrogen and orthophosphate phosphorus from aqueous solutions under controlled laboratory conditions. Adsorption efficiencies of zeolite and limestone were tested individually and in combination. Results show adsorption efficiency increases when the materials are used in combination. Effects of particle size, contact time, pH, and temperature were studied. Major emphasis was given to short contact times because the contact of rainfall runoff water under field conditions with APRBs would be approximately 5 minutes. Maximum removal of approximately 70% PO4-P and NH4-N was seen at 45 degrees C in 5 minutes within a pH range of 8-11. Optimum adsorbent concentration was 0.3 ppm with 20 g limestone and 10 g of zeolites. Simulated field experiments and actual APRB field installations showed variable results. Results from field evaluations of APRB showed mixed results from very high to negligible removal of orthophosphate-P and ammonia-N at different monitoring sites and storm events. Such variability may be due to the design of the bags, other biotic and abiotic factors and various physical factors, which are absent in the laboratory conditions. Some APRB design problems were also observed under field conditions and solutions are suggested. Overall results indicate that APRBs composed of combinations of crushed zeolite and limestone will offer an effective low maintenance and green alternative

  15. Elevated concentrations of morphine 6-beta-D-glucuronide in brain extracellular fluid despite low blood–brain barrier permeability

    PubMed Central

    Stain-Texier, Frédérique; Boschi, Gabrielle; Sandouk, Pierre; Scherrmann, Jean-Michel


    This study was done to find out how morphine 6-beta-D-glucuronide (M6G) induces more potent central analgesia than morphine, despite its poor blood–brain barrier (BBB) permeability. The brain uptake and disposition of these compounds were investigated in plasma and in various brain compartments: extracellular fluid (ECF), intracellular space (ICS) and cerebrospinal fluid (CSF). Morphine or M6G was given to rats at 10 mg kg−1 s.c. Transcortical microdialysis was used to assess their distributions in the brain ECF. Conventional tissue homogenization was used to determine the distribution in the cortex and whole brain. These two procedures were combined to estimate drug distribution in the brain ICS. The blood and CSF pharmacokinetics were also determined. Plasma concentration data for M6G were much higher than those of morphine, with Cmax and AUC 4–5 times more higher, Tmax shorter, and VZf−1 (volume of distribution) and CL f−1 (clearance) 4–6 times lower. The concentrations of the compounds in various brain compartments also differed: AUC values for M6G were lower than those of morphine in tissue and CSF and higher in brain ECF. AUC values in brain show that morphine levels were four times higher in ICS than in ECF, whereas M6G levels were 125 higher in ECF than in ICS. Morphine entered brain cells, whereas M6G was almost exclusively extracellular. This high extracellular concentration, coupled with extremely slow diffusion into the CSF, indicates that M6G was predominantly trapped in the extracellular fluid and therefore durably available to bind at opioid receptors. PMID:10556926

  16. Uptake Mechanisms of Eu(III) on Hydroxyapatite: A Potential Permeable Reactive Barrier Backfill Material for Trapping Trivalent Minor Actinides.


    Xu, Lin; Zheng, Tao; Yang, Shitong; Zhang, Linjuan; Wang, Jianqiang; Liu, Wei; Chen, Lanhua; Diwu, Juan; Chai, Zhifang; Wang, Shuao


    The permeable reactive barrier (PRB) technique has attracted an increasing level of attention for the in situ remediation of contaminated groundwater. In this study, the macroscopic uptake behaviors and microscopic speciation of Eu(III) on hydroxyapatite (HAP) were investigated by a combination of theoretical modeling, batch experiments, powder X-ray diffraction (PXRD) fitting, and X-ray absorption spectroscopy (XAS). The underlying removal mechanisms were identified to further assess the application potential of HAP as an effective PRB backfill material. The macroscopic analysis revealed that nearly all dissolved Eu(III) in solution was removed at pH 6.5 within an extremely short reaction time of 5 min. In addition, the thermodynamic calculations, desorption experiments, and PXRD and XAS analyses definitely confirmed the formation of the EuPO4·H2O(s) phase during the process of uptake of dissolved Eu(III) by HAP via the dissolution-precipitation mechanism. A detailed comparison of the present experimental findings and related HAP-metal systems suggests that the relative contribution of precipitation to the total Eu(III) removal increases as the P:Eu ratio decreases. The dosage of HAP-based PRB for the remediation of groundwater polluted by Eu(III) and analogous trivalent actinides [e.g., Am(III) and Cm(III)] should be strictly controlled depending on the dissolved Eu(III) concentration to obtain an optimal P:M (M represents Eu, Am, or Cm) ratio and treatment efficiency.

  17. Risk mitigation by waste-based permeable reactive barriers for groundwater pollution control at e-waste recycling sites.


    Beiyuan, Jingzi; Tsang, Daniel C W; Yip, Alex C K; Zhang, Weihua; Ok, Yong Sik; Li, Xiang-Dong


    Permeable reactive barriers (PRBs) have proved to be a promising passive treatment to control groundwater contamination and associated human health risks. This study explored the potential use of low-cost adsorbents as PRBs media and assessed their longevity and risk mitigation against leaching of acidic rainfall through an e-waste recycling site, of which Cu, Zn, and Pb were the major contaminants. Batch adsorption experiments suggested a higher adsorption capacity of inorganic industrial by-products [acid mine drainage sludge (AMDS) and coal fly ash (CFA)] and carbonaceous recycled products [food waste compost (FWC) and wood-derived biochar] compared to natural inorganic minerals (limestone and apatite). Continuous leaching tests of sand columns with 10 wt% low-cost adsorbents were then conducted to mimic the field situation of acidic rainfall infiltration through e-waste-contaminated soils (collected from Qingyuan, China) by using synthetic precipitation leaching procedure (SPLP) solution. In general, Zn leached out first, followed by Cu, and finally delayed breakthrough of Pb. In the worst-case scenario (e.g., at initial concentrations equal to 50-fold of average SPLP result), the columns with limestone, apatite, AMDS, or biochar were effective for a relatively short period of about 20-40 pore volumes of leaching, after which Cu breakthrough caused non-cancer risk concern and later-stage Pb leaching considerably increased both non-cancer and lifetime cancer risk associated with portable use of contaminated water. In contrast, the columns with CFA or FWC successfully mitigated overall risks to an acceptable level for a prolonged period of 100-200 pore volumes. Therefore, with proper selection of low-cost adsorbents (or their mixture), waste-based PRBs is a technically feasible and economically viable solution to mitigate human health risk due to contaminated groundwater at e-waste recycling sites.

  18. Long-term performance of permeable reactive barriers using zero-valent iron: geochemical and microbiological effects.


    Wilkin, Richard T; Puls, Robert W; Sewell, Guy W


    Geochemical and microbiological factors that control long-term performance of subsurface permeable reactive barriers were evaluated at the Elizabeth City, North Carolina, and the Denver Federal Center, Colorado, sites. These ground water treatment systems use zero-valent iron filings (Peerless Metal Powders Inc.) to intercept and remediate chlorinated hydrocarbon compounds at the Denver Federal Center (funnel-and-gate system) and overlapping plumes of hexavalent chromium and chlorinated hydrocarbons at Elizabeth City (continuous wall system). Zero-valent iron at both sites is a long-term sink for carbon, sulfur, calcium, silicon, nitrogen, and magnesium. After about four years of operation, the average rates of inorganic carbon (IC) and sulfur (S) accumulation are 0.09 and 0.02 kg/m2/year, respectively, at Elizabeth City where upgradient waters contain <400 mg/L of total dissolved solids (TDS). At the Denver Federal Center site, upgradient ground water contains 1000 to 1200 mg/L TDS and rates of IC and S accumulation are as high as 2.16 and 0.80 kg/m2/year, respectively. At both sites, consistent patterns of spatially variable mineral precipitation and microbial activity are observed. Mineral precipitates and microbial biomass accumulate the fastest near the upgradient aquifer-Fe0 interface. Maximum net reductions in porosity due to the accumulation of sulfur and inorganic carbon precipitates range from 0.032 at Elizabeth City to 0.062 at the Denver Federal Center (gate 2) after about four years. Although pore space has been lost due the accumulation of authigenic components, neither site shows evidence of pervasive pore clogging after four years of operation.

  19. Measurement of blood-brain barrier permeability with t1-weighted dynamic contrast-enhanced MRI in brain tumors: a comparative study with two different algorithms.


    Bergamino, Maurizio; Saitta, Laura; Barletta, Laura; Bonzano, Laura; Mancardi, Giovanni Luigi; Castellan, Lucio; Ravetti, Jean Louis; Roccatagliata, Luca


    The purpose of this study was to assess the feasibility of measuring different permeability parameters with T1-weighted dynamic contrast-enhanced (DCE) magnetic resonance imaging (MRI) in order to investigate the blood brain-barrier permeability associated with different brain tumors. The Patlak algorithm and the extended Tofts-Kety model were used to this aim. Twenty-five adult patients with tumors of different histological grades were enrolled in this study. MRI examinations were performed at 1.5 T. Multiflip angle, fast low-angle shot, and axial 3D T1-weighted images were acquired to calculate T1 maps, followed by a DCE acquisition. A region of interest was placed within the tumor of each patient to calculate the mean value of different permeability parameters. Differences in permeability measurements were found between different tumor grades, with higher histological grades characterized by higher permeability values. A significant difference in transfer constant (K (trans)) values was found between the two methods on high-grade tumors; however, both techniques revealed a significant correlation between the histological grade of tumors and their K (trans) values. Our results suggest that DCE acquisition is feasible in patients with brain tumors and that K (trans) maps can be easily obtained by these two algorithms, even if the theoretical model adopted could affect the final results.

  20. P-Glycoprotein Deficient Mouse in situ Blood-Brain Barrier Permeability and its Prediction using an in combo PAMPA Model⋆

    PubMed Central

    Dagenais, Claude; Avdeef, Alex; Tsinman, Oksana; Dudley, Adam; Beliveau, Richard


    The purpose of the study was to assess the permeability of mouse blood-brain barrier (BBB) to a diverse set of compounds in the absence of P-glycoprotein (Pgp) mediated efflux, to predict it using an in combo PAMPA model, and to explore its role in brain penetration classification (BPC). The initial brain uptake (Kin) of 19 compounds in both wild-type and Pgp mutant [mdr1a(−/−)] CF-1 mice was determined by the in situ brain perfusion technique. PAMPA measurements were performed, and the values were used to develop an in combo model, including Abraham descriptors. Published rodent Kin values were used to enhance the dataset and validate the model. The model predicted 92% of the variance of the training set permeability. In all, 182 Kin values were considered in this study, spanning four log orders of magnitude and where Pgp decreased brain uptake by as much as 14-fold. The calculated permeability-surface area (PS) values along with literature reported brain tissue binding were used to group molecules in terms of their brain penetration classification. The in situ BBB permeability can be predicted by the in combo PAMPA model to a satisfactory degree, and can be used as a lower-cost, high throughput first-pass screening method for BBB passive permeability. PMID:19591928

  1. Influence of glioma cells on a new co-culture in vitro blood-brain barrier model for characterization and validation of permeability.


    Mendes, Bárbara; Marques, Cláudia; Carvalho, Isabel; Costa, Paulo; Martins, Susana; Ferreira, Domingos; Sarmento, Bruno


    The blood-brain barrier plays an important role in protecting the brain from injury and diseases, but also restrains the delivery of potential therapeutic drugs for the treatment of brain illnesses, such as tumors. Glioma is most common cancer type of central nervous system in adults and the most lethal in children. The treatment is normally poor and ineffective. To better understand the ability of drug delivery systems to permeate this barrier, a blood-brain barrier model using human brain endothelial cells and a glioma cell line is herein proposed. The consistent trans-endothelial electrical values, immunofluorescence and scanning electronic microscopy showed a confluent endothelial cell monolayer with high restrictiveness. Upon inclusion of glioma cell line, the trans-endothelial electrical resistance decreased, with consequent increase of apparent permeability of fluorescein isothiocyanate dextran used as model drug, revealing a reduction of the barrier robustness. In addition, it was demonstrated a cell shape modification in the co-culture, with loss of tight junctions. The microenvironment of co-cultured model presented significant increase of of CCL2/MCP-1 and IL-6 production, correlating with the modulation of permeation. The results encourage the use of the proposed in vitro model as a screening tool when performing drugs permeability for the treatment of disorders among the central nervous system.

  2. Exposure to vehicle emissions results in altered blood brain barrier permeability and expression of matrix metalloproteinases and tight junction proteins in mice

    PubMed Central


    Background Traffic-generated air pollution-exposure is associated with adverse effects in the central nervous system (CNS) in both human exposures and animal models, including neuroinflammation and neurodegeneration. While alterations in the blood brain barrier (BBB) have been implicated as a potential mechanism of air pollution-induced CNS pathologies, pathways involved have not been elucidated. Objectives To determine whether inhalation exposure to mixed vehicle exhaust (MVE) mediates alterations in BBB permeability, activation of matrix metalloproteinases (MMP) -2 and −9, and altered tight junction (TJ) protein expression. Methods Apolipoprotein (Apo) E−/− and C57Bl6 mice were exposed to either MVE (100 μg/m3 PM) or filtered air (FA) for 6 hr/day for 30 days and resulting BBB permeability, expression of ROS, TJ proteins, markers of neuroinflammation, and MMP activity were assessed. Serum from study mice was applied to an in vitro BBB co-culture model and resulting alterations in transport and permeability were quantified. Results MVE-exposed Apo E−/− mice showed increased BBB permeability, elevated ROS and increased MMP-2 and −9 activity, compared to FA controls. Additionally, cerebral vessels from MVE-exposed mice expressed decreased levels of TJ proteins, occludin and claudin-5, and increased levels of inducible nitric oxide synthase (iNOS) and interleukin (IL)-1β in the parenchyma. Serum from MVE-exposed animals also resulted in increased in vitro BBB permeability and altered P-glycoprotein transport activity. Conclusions These data indicate that inhalation exposure to traffic-generated air pollutants promotes increased MMP activity and degradation of TJ proteins in the cerebral vasculature, resulting in altered BBB permeability and expression of neuroinflammatory markers. PMID:24344990

  3. Molecular-scale characterization of uranium sorption by bone apatite materials for a permeable reactive barrier demonstration.


    Fuller, C C; Bargar, J R; Davis, J A


    Uranium binding to bone charcoal and bone meal apatite materials was investigated using U L(III)-edge EXAFS spectroscopy and synchrotron source XRD measurements of laboratory batch preparations in the absence and presence of dissolved carbonate. Pelletized bone char apatite recovered from a permeable reactive barrier (PRB) at Fry Canyon, UT, was also studied. EXAFS analyses indicate that U(VI) sorption in the absence of dissolved carbonate occurred by surface complexation of U(VI) for sorbed concentrations < or = 5500 microg U(VI)/g for all materials with the exception of crushed bone char pellets. Either a split or a disordered equatorial oxygen shell was observed, consistent with complexation of uranyl by the apatite surface. A second shell of atoms at a distance of 2.9 A was required to fit the spectra of samples prepared in the presence of dissolved carbonate (4.8 mM total) and is interpreted as formation of ternary carbonate complexes with sorbed U(VI). A U-P distance at 3.5-3.6 A was found for most samples under conditions where uranyl phosphate phases did not form, which is consistent with monodentate coordination of uranyl by phosphate groups in the apatite surface. At sorbed concentrations > or = 5500 microg U(VI)/g in the absence of dissolved carbonate, formation of the uranyl phosphate solid phase, chernikovite, was observed. The presence of dissolved carbonate (4.8 mM total) suppressed the formation of chernikovite, which was not detected even with sorbed U(VI) up to 12,300 microg U(VI)/g in batch samples of bone meal, bone charcoal, and reagent-grade hydroxyapatite. EXAFS spectra of bone char samples recovered from the Fry Canyon PRB were comparable to laboratory samples in the presence of dissolved carbonate where U(VI) sorption occurred by surface complexation. Our findings demonstrate that uranium uptake by bone apatite will probably occur by surface complexation instead of precipitation of uranyl phosphate phases under the groundwater conditions

  4. Enhancing the Attenuation of Acid-Mine Drainage at Davis Mine, Rowe, Massachusetts via Installation of a Permeable Reactive Barrier.

    NASA Astrophysics Data System (ADS)

    Gillmor, A. M.; Yuretich, R. F.


    Acid Mine Drainage affects thousands of streams in the United States, sustaining the need for low-cost passive treatment options. Davis Mine, a 100 years-abandoned FeS2 mine in Western Massachusetts, is representative of the types of mines best suited for passive treatments; fairly remote, abandoned, and discharging moderately affected water (pH <3, Fe >100mg/L, SO42- >500mg/L) and is a good candidate for a 'starting point' of low-cost, low environmental impact remediation. We here report the shifts in pH, SO42-, and Fe following placement of reactive fill (50% CaMg(CO3)2, 25% cow manure, 25% seaweed compost) in a permeable reactive barrier placed below ground mid-way along the acidic effluent's path. Yearlong monitoring of water from 1 multi-level well (with ports in the shallow groundwater, middle groundwater, and bedrock) placed within the tailings pile over a previous year (2003-2004) showed for the three levels, respectively; pH 3.16, 4.24, and 4.04, Fe average concentrations of 4.5 mg/L, 6.5 mg/L, and 3.2 mg/L, and SO42- average concentrations of 235mg/L, 330mg/L, and 292 mg/L. One year (2007-2008) after placement of remediation mix, the three levels now average respectively; pH 4.16, 4.60, and 4.53, Fe concentrations of 0.7 mg/L, 4.8 mg/L, and 1.4 mg/L, and SO42- concentrations of 217 mg/L, 294 mg/L, and 266 mg/L. The most noticeable improvement in pH is seen in the shallow groundwater, consistent with its proximity to the reactive fill depth. Although complex microbial communities have been characterized at the site, uncertainty remains as to whether they are active in this case, and it is possible that these results may be explained solely by neutralization reactions. Results of this study indicate a good likelihood that this low environmental impact remediation could be effective.

  5. Molecular-scale characterization of uranium sorption by bone apatite materials for a permeable reactive barrier demonstration

    USGS Publications Warehouse

    Fuller, C.C.; Bargar, J.R.; Davis, J.A.


    Uranium binding to bone charcoal and bone meal apatite materials was investigated using U LIII-edge EXAFS spectroscopy and synchrotron source XRD measurements of laboratory batch preparations in the absence and presence of dissolved carbonate. Pelletized bone char apatite recovered from a permeable reactive barrier (PRB) at Fry Canyon, UT, was also studied. EXAFS analyses indicate that U(VI) sorption in the absence of dissolved carbonate occurred by surface complexation of U(VI) for sorbed concentrations ??? 5500 ??g U(VI)/g for all materials with the exception of crushed bone char pellets. Either a split or a disordered equatorial oxygen shell was observed, consistent with complexation of uranyl by the apatite surface. A second shell of atoms at a distance of 2.9 A?? was required to fit the spectra of samples prepared in the presence of dissolved carbonate (4.8 mM total) and is interpreted as formation of ternary carbonate complexes with sorbed U(VI). A U-P distance at 3.5-3.6 A?? was found for most samples under conditions where uranyl phosphate phases did not form, which is consistent with monodentate coordination of uranyl by phosphate groups in the apatite surface. At sorbed concentrations ??? 5500 ??g U(VI)/g in the absence of dissolved carbonate, formation of the uranyl phosphate solid phase, chernikovite, was observed. The presence of dissolved carbonate (4.8 mM total) suppressed the formation of chernikovite, which was not detected even with sorbed U(VI) up to 12 300 ??g U(VI)/g in batch samples of bone meal, bone charcoal, and reagent-grade hydroxyapatite. EXAFS spectra of bone char samples recovered from the Fry Canyon PRB were comparable to laboratory samples in the presence of dissolved carbonate where U(VI) sorption occurred by surface complexation. Our findings demonstrate that uranium uptake by bone apatite will probably occur by surface complexation instead of precipitation of uranyl phosphate phases under the groundwater conditions found at many U

  6. Development of a blood-brain barrier model in a membrane-based microchip for characterization of drug permeability and cytotoxicity for drug screening.


    Shao, Xiaojian; Gao, Dan; Chen, Yongli; Jin, Feng; Hu, Guangnan; Jiang, Yuyang; Liu, Hongxia


    Since most of the central nervous system (CNS) drug candidates show poor permeability across the blood-brain barrier (BBB), development of a reliable platform for permeability assay will greatly accelerate drug discovery. Herein, we constructed a microfluidic BBB model to mimic drug delivery into the brain to induce cytotoxicity at target cells. To reconstitute the in vivo BBB properties, human cerebral microvessel endothelial cells (hCMEC/D3) were dynamically cultured in a membrane-based microchannel. Sunitinib, a model drug, was then delivered into the microchannel and forced to permeate through the BBB model. The permeated amount was directly quantified by an electrospray ionization quadrupole time-of-flight mass spectrometer (ESI-Q-TOF MS) after on-chip SPE (μSPE) pretreatment. Moreover, the permeated drug was incubated with glioma cells (U251) cultured inside agarose gel in the downstream to investigate drug-induced cytotoxicity. The resultant permeability of sunitinib was highly correlated with literature reported value, and it only required 30 min and 5 μL of sample solution for each permeation experiment. Moreover, after 48 h of treatment, the survival rate of U251 cells cultured in 3D scaffolds was nearly 6% higher than that in 2D, which was in accordance with the previously reported results. These results demonstrate that this platform provides a valid tool for drug permeability and cytotoxicity assays which have great value for the research and development of CNS drugs.

  7. Evaluation of a highly skin permeable low-molecular-weight protamine conjugated epidermal growth factor for novel burn wound healing therapy.


    Lee, Ji Hae; Bae, Il-Hong; Choi, Jin Kyu; Park, Jin Woo


    We evaluated the laser induced burn wound healing efficacy of a recombinant low-molecular-weight protamine conjugated epidermal growth factor (rLMWP-EGF). rLMWP-EGF was prepared by genetically combining LMWP with the N-terminal sequence of EGF; we obtained a homogeneous modified EGF without reduced biological activity. Because of the protein transduction domain of LMWP, rLMWP-EGF showed enhanced drug penetration across artificial skin constructs and excised mouse skin layers versus EGF and showed significantly improved burn wound healing efficacy, with accelerated wound closure and minimized eschar and scar formation, compared with EGF or no treatment. Histological examination also revealed that rLMWP-EGF permeated through the intact skin around the wound and facilitated residual epithelial cell proliferation in an integrated manner to reform an intact epidermis. Radiofrequency microwound formation was effective for reducing large hypertrophic scars formed after severe laser burning by collagen remodeling but rLMWP-EGF did not show a meaningful synergistic effect in burn scar reduction. However, rLMWP-EGF was helpful for forming skin with a more normal appearance and texture. Thus, rLMWP-EGF demonstrated therapeutic potential as a novel topical burn wound healing drug with no obvious toxic effect.

  8. Magnetic resonance imaging of blood-brain barrier permeability in ischemic stroke using diffusion-weighted arterial spin labeling in rats.


    Tiwari, Yash V; Lu, Jianfei; Shen, Qiang; Cerqueira, Bianca; Duong, Timothy Q


    Diffusion-weighted arterial spin labeling magnetic resonance imaging has recently been proposed to quantify the rate of water exchange (Kw) across the blood-brain barrier in humans. This study aimed to evaluate the blood-brain barrier disruption in transient (60 min) ischemic stroke using Kw magnetic resonance imaging with cross-validation by dynamic contrast-enhanced magnetic resonance imaging and Evans blue histology in the same rats. The major findings were: (i) at 90 min after stroke (30 min after reperfusion), group Kw magnetic resonance imaging data showed no significant blood-brain barrier permeability changes, although a few animals showed slightly abnormal Kw. Dynamic contrast-enhanced magnetic resonance imaging confirmed this finding in the same animals. (ii) At two days after stroke, Kw magnetic resonance imaging revealed significant blood-brain barrier disruption. Regions with abnormal Kw showed substantial overlap with regions of hyperintense T2 (vasogenic edema) and hyperperfusion. Dynamic contrast-enhanced magnetic resonance imaging and Evans blue histology confirmed these findings in the same animals. The Kw values in the normal contralesional hemisphere and the ipsilesional ischemic core two days after stroke were: 363 ± 17 and 261 ± 18 min(-1), respectively (P < 0.05, n = 9). Kw magnetic resonance imaging is sensitive to blood-brain barrier permeability changes in stroke, consistent with dynamic contrast-enhanced magnetic resonance imaging and Evans blue extravasation. Kw magnetic resonance imaging offers advantages over existing techniques because contrast agent is not needed and repeated measurements can be made for longitudinal monitoring or averaging.

  9. A method to predict different mechanisms for blood-brain barrier permeability of CNS activity compounds in Chinese herbs using support vector machine.


    Jiang, Ludi; Chen, Jiahua; He, Yusu; Zhang, Yanling; Li, Gongyu


    The blood-brain barrier (BBB), a highly selective barrier between central nervous system (CNS) and the blood stream, restricts and regulates the penetration of compounds from the blood into the brain. Drugs that affect the CNS interact with the BBB prior to their target site, so the prediction research on BBB permeability is a fundamental and significant research direction in neuropharmacology. In this study, we combed through the available data and then with the help of support vector machine (SVM), we established an experiment process for discovering potential CNS compounds and investigating the mechanisms of BBB permeability of them to advance the research in this field four types of prediction models, referring to CNS activity, BBB permeability, passive diffusion and efflux transport, were obtained in the experiment process. The first two models were used to discover compounds which may have CNS activity and also cross the BBB at the same time; the latter two were used to elucidate the mechanism of BBB permeability of those compounds. Three optimization parameter methods, Grid Search, Genetic Algorithm (GA), and Particle Swarm Optimization (PSO), were used to optimize the SVM models. Then, four optimal models were selected with excellent evaluation indexes (the accuracy, sensitivity and specificity of each model were all above 85%). Furthermore, discrimination models were utilized to study the BBB properties of the known CNS activity compounds in Chinese herbs and this may guide the CNS drug development. With the relatively systematic and quick approach, the application rationality of traditional Chinese medicines for treating nervous system disease in the clinical practice will be improved.

  10. The inner foreskin of healthy males at risk of HIV infection harbors epithelial CD4+ CCR5+ cells and has features of an inflamed epidermal barrier.


    Lemos, Maria P; Lama, Javier R; Karuna, Shelly T; Fong, Youyi; Montano, Silvia M; Ganoza, Carmela; Gottardo, Raphael; Sanchez, Jorge; McElrath, M Juliana


    Male circumcision provides partial protection against multiple sexually transmitted infections (STIs), including HIV, but the mechanisms are not fully understood. To examine potential vulnerabilities in foreskin epithelial structure, we used Wilcoxon paired tests adjusted using the false discovery rate method to compare inner and outer foreskin samples from 20 healthy, sexually active Peruvian males who have sex with males or transgender females, ages 21-29, at elevated risk of HIV infection. No evidence of epithelial microtrauma was identified, as assessed by keratinocyte activation, fibronectin deposition, or parakeratosis. However, multiple suprabasal tight junction differences were identified: 1) inner foreskin stratum corneum was thinner than outer (p = 0.035); 2) claudin 1 had extended membrane-bound localization throughout inner epidermis stratum spinosum (p = 0.035); 3) membrane-bound claudin 4 was absent from inner foreskin stratum granulosum (p = 0.035); and 4) occludin had increased membrane deposition in inner foreskin stratum granulosum (p = 0.042) versus outer. Together, this suggests subclinical inflammation and paracellular transport modifications to the inner foreskin. A setting of inflammation was further supported by inner foreskin epithelial explant cultures secreting higher levels of GM-CSF (p = 0.029), IP-10 (p = 0.035) and RANTES (p = 0.022) than outer foreskin, and also containing an increased density of CCR5+ and CD4+ CCR5+ cells (p = 0.022). Inner foreskin dermis also secreted more RANTES than outer (p = 0.036), and had increased density of CCR5+ cells (p = 0.022). In conclusion, subclinical changes to the inner foreskin of sexually active males may support an inflammatory state, with availability of target cells for HIV infection and modifications to epidermal barriers, potentially explaining the benefits of circumcision for STI prevention.


    PubMed Central



    Systemic application of the muscarinic agonist, pilocarpine, is commonly utilized to induce an acute status epilepticus that evolves into a chronic epileptic condition characterized by spontaneous seizures. Recent findings suggest that the status epilepticus induced by pilocarpine may be triggered by changes in the blood–brain barrier (BBB) permeability. We tested the role of the BBB in an acute pilocarpine model by using the in vitro model brain preparation and compared our finding with in vivo data. Arterial perfusion of the in vitro isolated guinea-pig brain with <1 mM pilocarpine did not cause epileptiform activity, but rather reduced synaptic transmission and induced steady fast (20–25 Hz) oscillatory activity in limbic cortices. These effects were reversibly blocked by co-perfusion of the muscarinic antagonist atropine sulfate (5 μM). Brain pilocarpine measurements in vivo and in vitro suggested modest BBB penetration. Pilocarpine induced epileptiform discharges only when perfused with compounds that enhance BBB permeability, such as bradykinin (n=2) or histamine (n=10). This pro-epileptic effect was abolished when the BBB-impermeable muscarinic antagonist atropine methyl bromide (5 μM) was co-perfused with histamine and pilocarpine. In the absence of BBB permeability enhancing drugs, pilocarpine induced epileptiform activity only after arterial perfusion at concentrations >10 mM. Ictal discharges correlated with a high intracerebral pilocarpine concentration measured by high pressure liquid chromatography. We propose that acute epileptiform discharges induced by pilocarpine treatment in the in vitro isolated brain preparation are mediated by a dose-dependent, atropine-sensitive muscarinic effect promoted by an increase in BBB permeability. Pilocarpine accumulation secondary to BBB permeability changes may contribute to in vivo ictogenesis in the pilocarpine epilepsy model. PMID:18082973

  12. Prediction of blood-brain barrier permeation of α-adrenergic and imidazoline receptor ligands using PAMPA technique and quantitative-structure permeability relationship analysis.


    Vucicevic, Jelica; Nikolic, Katarina; Dobričić, Vladimir; Agbaba, Danica


    Imidazoline receptor ligands are a numerous family of biologically active compounds known to produce central hypotensive effect by interaction with both α2-adrenoreceptors (α2-AR) and imidazoline receptors (IRs). Recent hypotheses connect those ligands with several neurological disorders. Therefore some IRs ligands are examined as novel centrally acting antihypertensives and drug candidates for treatment of various neurological diseases. Effective Blood-Brain Barrier (BBB) permeability (P(e)) of 18 IRs/α-ARs ligands and 22 Central Nervous System (CNS) drugs was experimentally determined using Parallel Artificial Membrane Permeability Assay (PAMPA) and studied by the Quantitative-Structure-Permeability Relationship (QSPR) methodology. The dominant molecules/cations species of compounds have been calculated at pH = 7.4. The analyzed ligands were optimized using Density Functional Theory (B3LYP/6-31G(d,p)) included in ChemBio3D Ultra 13.0 program and molecule descriptors for optimized compounds were calculated using ChemBio3D Ultra 13.0, Dragon 6.0 and ADMET predictor 6.5 software. Effective permeability of compounds was used as dependent variable (Y), while calculated molecular parametres were used as independent variables (X) in the QSPR study. SIMCA P+ 12.0 was used for Partial Least Square (PLS) analysis, while the stepwise Multiple Linear Regression (MLR) and Artificial Neural Networks (ANN) modeling were performed using STASTICA Neural Networks 4.0. Predictive potential of the formed models was confirmed by Leave-One-Out Cross- and external-validation and the most reliable models were selected. The descriptors that are important for model building are identified as well as their influence on BBB permeability. Results of the QSPR studies could be used as time and cost efficient screening tools for evaluation of BBB permeation of novel α-adrenergic/imidazoline receptor ligands, as promising drug candidates for treatment of hypertension or neurological diseases.

  13. Drug delivery to the brain by focused ultrasound induced blood-brain barrier disruption: quantitative evaluation of enhanced permeability of cerebral vasculature using two-photon microscopy.


    Nhan, Tam; Burgess, Alison; Cho, Eunice E; Stefanovic, Bojana; Lilge, Lothar; Hynynen, Kullervo


    Reversible and localized blood-brain barrier disruption (BBBD) using focused ultrasound (FUS) in combination with intravascularly administered microbubbles (MBs) has been established as a non-invasive method for drug delivery to the brain. Using two-photon fluorescence microscopy (2 PFM), we imaged the cerebral vasculature during BBBD and observed the extravasation of fluorescent dye in real-time in vivo. We measured the enhanced permeability upon BBBD for both 10 kDa and 70 kDa dextran conjugated Texas Red (TR) at the acoustic pressure range of 0.2-0.8 MPa and found that permeability constants of TR10 kDa and TR70 kDa vary from 0.0006 to 0.0359 min(-1) and from 0.0003 to 0.0231 min(-1), respectively. For both substances, a linear regression was applied on the permeability constant against the acoustic pressure and the slope from best-fit was found to be 0.039 ± 0.005 min(-1)/MPa and 0.018 ± 0.005 min(-1)/MPa, respectively. In addition, the pressure threshold for successfully induced BBBD was confirmed to be 0.4-0.6MPa. Finally, we identified two types of leakage kinetics (fast and slow) that exhibit distinct permeability constants and temporal disruption onsets, as well as demonstrated their correlations with the applied acoustic pressure and vessel diameter. Direct assessment of vascular permeability and insights on its dependency on acoustic pressure, vessel size and leakage kinetics are important for treatment strategies of BBBD-based drug delivery.

  14. Sizing nanomaterials in bio-fluids by cFRAP enables protein aggregation measurements and diagnosis of bio-barrier permeability

    NASA Astrophysics Data System (ADS)

    Xiong, Ranhua; Vandenbroucke, Roosmarijn E.; Broos, Katleen; Brans, Toon; van Wonterghem, Elien; Libert, Claude; Demeester, Jo; de Smedt, Stefaan C.; Braeckmans, Kevin


    Sizing nanomaterials in complex biological fluids, such as blood, remains a great challenge in spite of its importance for a wide range of biomedical applications. In drug delivery, for instance, it is essential that aggregation of protein-based drugs is avoided as it may alter their efficacy or elicit immune responses. Similarly it is of interest to determine which size of molecules can pass through biological barriers in vivo to diagnose pathologies, such as sepsis. Here, we report on continuous fluorescence recovery after photobleaching (cFRAP) as a analytical method enabling size distribution measurements of nanomaterials (1-100 nm) in undiluted biological fluids. We demonstrate that cFRAP allows to measure protein aggregation in human serum and to determine the permeability of intestinal and vascular barriers in vivo. cFRAP is a new analytical technique that paves the way towards exciting new applications that benefit from nanomaterial sizing in bio-fluids.

  15. Sizing nanomaterials in bio-fluids by cFRAP enables protein aggregation measurements and diagnosis of bio-barrier permeability

    PubMed Central

    Xiong, Ranhua; Vandenbroucke, Roosmarijn E.; Broos, Katleen; Brans, Toon; Van Wonterghem, Elien; Libert, Claude; Demeester, Jo; De Smedt, Stefaan C.; Braeckmans, Kevin


    Sizing nanomaterials in complex biological fluids, such as blood, remains a great challenge in spite of its importance for a wide range of biomedical applications. In drug delivery, for instance, it is essential that aggregation of protein-based drugs is avoided as it may alter their efficacy or elicit immune responses. Similarly it is of interest to determine which size of molecules can pass through biological barriers in vivo to diagnose pathologies, such as sepsis. Here, we report on continuous fluorescence recovery after photobleaching (cFRAP) as a analytical method enabling size distribution measurements of nanomaterials (1–100 nm) in undiluted biological fluids. We demonstrate that cFRAP allows to measure protein aggregation in human serum and to determine the permeability of intestinal and vascular barriers in vivo. cFRAP is a new analytical technique that paves the way towards exciting new applications that benefit from nanomaterial sizing in bio-fluids. PMID:27653841

  16. Ultradeformable lipid vesicles can penetrate the skin and other semi-permeable barriers unfragmented. Evidence from double label CLSM experiments and direct size measurements.


    Cevc, Gregor; Schätzlein, Andreas; Richardsen, Holger


    The stability of various aggregates in the form of lipid bilayer vesicles was tested by three different methods before and after crossing different semi-permeable barriers. First, polymer membranes with pores significantly smaller than the average aggregate diameter were used as the skin barrier model; dynamic light scattering was employed to monitor vesicle size changes after barrier passage for several lipid mixtures with different bilayer elasticities. This revealed that vesicles must adapt their size and/or shape, dependent on bilayer stability and elasto-mechanics, to overcome an otherwise confining pore. For the mixed lipid aggregates with highly flexible bilayers (Transfersomes), the change is transient and only involves vesicle shape and volume adaptation. The constancy of ultradeformable vesicle size before and after pores penetration proves this. This is remarkable in light of the very strong aggregate deformation during an enforced barrier passage. Simple phosphatidylcholine vesicles, with less flexible bilayers, lack such capability and stability. Conventional liposomes are therefore fractured during transport through a semi-permeable barrier; as reported by other researchers, liposomes are fragmented to the size of a narrow pore if sufficient pressure is applied across the barrier; otherwise, liposomes clog the pores. The precise outcome depends on trans-barrier flux and/or on relative vesicle vs. pore size. Lipid vesicles applied on the skin behave accordingly. Mixed lipid vesicles penetrate the skin if they are sufficiently deformable. If this is the case, they cross inter-cellular constrictions in the organ without significant composition or size modification. To prove this, we labelled vesicles with two different fluorescent markers and applied the suspension on intact murine skin without occlusion. The confocal laser scanning microscopy (CLSM) of the skin then revealed a practically indistinguishable distribution of both labels in the stratum

  17. The blood-brain barrier-permeable catechol-O-methyltransferase inhibitor dinitrocatechol suppresses experimental autoimmune encephalomyelitis.


    Polak, Paul E; Lin, Shao Xia; Pelligrino, Dale; Feinstein, Douglas L


    Reduced levels of noradrenaline (NA) in CNS of multiple sclerosis patients could be due to metabolism by catechol-O-methyltransferase (COMT). In mice immunized with myelin oligodendrocyte glycoprotein peptide, the BBB-permeable COMT inhibitor dinitrocatechol (DNC) reduced clinical signs, while entacapone, a non-BBB-permeable inhibitor, had no effect. Spinal cord NA levels were slightly increased by DNC, and there was an inverse correlation between NA levels and average clinical signs. Spinal cord COMT mRNA levels were not increased during EAE, but were found increased in the frontal cortex of MS patients. These results suggest that COMT inhibitors could provide benefit to MS patients.

  18. Impact of microbial activities on the mineralogy and performance of column-scale permeable reactive iron barriers operated under two different redox conditions.


    Van Nooten, Thomas; Lieben, François; Dries, Jan; Pirard, Eric; Springael, Dirk; Bastiaens, Leen


    The present study focuses on the impact of microbial activities on the performance of various long-term operated laboratory-scale permeable reactive barriers. The barriers contained both aquifer and Fe0 compartments and had received either sulfate or iron(III)-EDTA to promote sulfate-reducing and iron(III)-reducing bacteria, respectively. After dismantlement of the compartments after almost 3 years of operation, DNA-based PCR-DGGE analysis revealed the presence of methanogenic, sulfate-reducing, metal-reducing, and denitrifying bacteria within as well as up- and downgradient of the Fe0 matrix. Under all imposed conditions, the main secondary phases were vivianite, siderite, ferrous hydroxy carbonate, and carbonate green rust as found by scanning electron microscopy (SEM) combined with energy dispersive X-ray analysis (EDX), and X-ray diffraction (XRD). Under sulfate-reduction promoting conditions, iron sulfides were formed in addition, resulting in 7 and 10 times higher degradation rates for PCE and TCE, respectively, compared to unreacted iron. These results indicate that the presence of sulfate-reducing bacteria in or around iron barriers and the subsequent formation of iron sulfides might increase the barrier reactivity.

  19. Using dissolved gas analysis to investigate the performance of an organic carbon permeable reactive barrier for the treatment of mine drainage

    USGS Publications Warehouse

    Williams, R.L.; Mayer, K.U.; Amos, R.T.; Blowes, D.W.; Ptacek, C.J.; Bain, J.G.


    The strongly reducing nature of permeable reactive barrier (PRB) treatment materials can lead to gas production, potentially resulting in the formation of gas bubbles and ebullition. Degassing in organic C based PRB systems due to the production of gases (primarily CO2 and CH4) is investigated using the depletion of naturally occurring non-reactive gases Ar and N2, to identify, confirm, and quantify chemical and physical processes. Sampling and analysis of dissolved gases were performed at the Nickel Rim Mine Organic Carbon PRB, which was designed for the treatment of groundwater contaminated by low quality mine drainage characterized by slightly acidic pH, and elevated Fe(II) and SO4 concentrations. A simple 4-gas degassing model was used to analyze the dissolved gas data, and the results indicate that SO4 reduction is by far the dominant process of organic C consumption within the barrier. The data provided additional information to delineate rates of microbially mediated SO4 reduction and confirm the presence of slow and fast flow zones within the barrier. Degassing was incorporated into multicomponent reactive transport simulations for the barrier and the simulations were successful in reproducing observed dissolved gas trends.


    SciTech Connect



    The objective of this field test instruction is to provide technical guidance for aqueous injection emplacement of an extension apatite permeable reactive barrier (PRE) for the sequestration of strontium-90 (Sr-90) using a high concentration amendment formulation. These field activities will be conducted according to the guidelines established in DOE/RL-2010-29, 100-NR-2 Design Optimization Study, hereafter referred to as the DOS. The DOS supports the Federal Facility Agreement Consent Order (EPA et al., 1989), Milestone M-16-06-01, and 'Complete Construction of a Permeable Reactive Barrier at 100-N.' Injections of apatite precursor chemicals will occur at an equal distance intervals on each end of the existing PRE to extend the PRB from the existing 91 m (300 ft) to at least 274 m (900 ft). Field testing at the 100-N Area Apatite Treatability Test Site, as depicted on Figure 1, shows that the barrier is categorized by two general hydrologic conceptual models based on overall well capacity and contrast between the Hanford and Ringold hydraulic conductivities. The upstream portion of the original barrier, shown on Figure 1, is characterized by relatively low overall well specific capacity. This is estimated from well development data and a lower contrast in hydraulic conductivity between the Hanford formation and Ringold Formations. Comparison of test results from these two locations indicate that permeability contrast between the Hanford formation and Ringold Formation is significantly less over the upstream one-third of the barrier. The estimated hydraulic conductivity for the Hanford formation and Ringold Formation over the upstream portion of the barrier based on observations during emplacement of the existing 91 m (300 ft) PRB is approximately 12 and 10 m/day (39 and 32 ft/day), respectively (PNNL-17429). However, these estimates should be used as a rough guideline only, as significant variability in hydraulic conductivity is likely to be observed in the

  1. Limitations to effect of alpha-MSH on permeability of blood-brain barrier to IV /sup 99m/Tc-pertechnetate

    SciTech Connect

    Kastin, A.J.; Fabre, L.A.


    The effects of several variables on the permeability of the blood-brain barrier (BBB) to /sup 99m/Tc-labeled sodium pertechnetate after IV administration of alpha-MSH were investigated. Doses of alpha-MSH of about 200 micrograms/kg were generally more effective in increasing the brain:blood ratio of radioactivity than the smaller doses that had previously been shown to affect behavior and the EEG. Pulsatile administration of a total of 200 micrograms/kg alpha-MSH over 90 min did not change the permeability of the BBB to the pertechnetate anion. Infusion of the same dose over 90 min significantly increased the brain:blood ratio of radioactivity in one of two experiments: no significant effects were seen with infusion for shorter times, lower concentrations, or with a 4-9 analog (Org 2766). In another experiment, bolus injection of 200 micrograms/kg alpha-MSH resulted in a significantly increased ratio 90 min later as compared with controls. Although the effects of a peptide on the permeability of the BBB to other compounds remains intriguing, limitations appear to exist in experiments with /sup 99m/Tc-pertechnetate.

  2. Sex-dependent changes in blood-brain barrier permeability and brain NA(+),K(+) ATPase activity in rats following acute water intoxication.


    Oztaş, B; Koçak, H; Oner, P; Küçük, M


    To understand the increased susceptibility of the development of serious complications to hypoosmotic hyponatremia in young females, we examined the resistance of blood brain barrier (BBB) permeability to water along with the synaptosomal Na(+),K(+)ATPase activity in both sexes of rats during acute water intoxication. Four groups of rats were used: Group I and II were normal female and male rats injected with only Evans-blue. Group III and IV were water intoxicated female and male rats respectively. BBB permeability in female rats was found to be increased following acute water intoxication. In contrast, synaptosomal Na(+),K(+)ATPase activities in both water intoxicated male and female rats were found significantly lower than those in control rats. But inhibition in enzyme activity in synaptosomes from water intoxicated female rats was more pronounced than those of corresponding male rats. Our results concluded that female sex steroids may be responsible for the highly significant decrease in synaptosomal Na(+),K(+)ATPase activity and increased BBB permeability in female rats following water intoxication.


    EPA Science Inventory

    Accumulation of mineral precipitates and microbial biomass are key factors that impact the long-term performance of PRBs. Both processes can impact remedial performance by affecting zero-valent iron reactivity and permeability. Results will be presented from solid-phase and gro...

  4. dNP2 is a blood–brain barrier-permeable peptide enabling ctCTLA-4 protein delivery to ameliorate experimental autoimmune encephalomyelitis

    PubMed Central

    Lim, Sangho; Kim, Won-Ju; Kim, Yeon-Ho; Lee, Sohee; Koo, Ja-Hyun; Lee, Jung-Ah; Yoon, Heeseok; Kim, Do-Hyun; Park, Hong-Jai; Kim, Hye-Mi; Lee, Hong-Gyun; Yun Kim, Ji; Lee, Jae-Ung; Hun Shin, Jae; Kyun Kim, Lark; Doh, Junsang; Kim, Hongtae; Lee, Sang-Kyou; Bothwell, Alfred L. M.; Suh, Minah; Choi, Je-Min


    Central nervous system (CNS)-infiltrating effector T cells play critical roles in the development and progression of multiple sclerosis (MS). However, current drugs for MS are very limited due to the difficulty of delivering drugs into the CNS. Here we identify a cell-permeable peptide, dNP2, which efficiently delivers proteins into mouse and human T cells, as well as various tissues. Moreover, it enters the brain tissue and resident cells through blood vessels by penetrating the tightly organized blood–brain barrier. The dNP2-conjugated cytoplasmic domain of cytotoxic T-lymphocyte antigen 4 (dNP2-ctCTLA-4) negatively regulates activated T cells and shows inhibitory effects on experimental autoimmune encephalomyelitis in both preventive and therapeutic mouse models, resulting in the reduction of demyelination and CNS-infiltrating T helper 1 and T helper 17 cells. Thus, this study demonstrates that dNP2 is a blood–brain barrier-permeable peptide and dNP2-ctCTLA-4 could be an effective agent for treating CNS inflammatory diseases such as MS. PMID:26372309

  5. Monitoring stroke progression: in vivo imaging of cortical perfusion, blood-brain barrier permeability and cellular damage in the rat photothrombosis model.


    Schoknecht, Karl; Prager, Ofer; Vazana, Udi; Kamintsky, Lyn; Harhausen, Denise; Zille, Marietta; Figge, Lena; Chassidim, Yoash; Schellenberger, Eyk; Kovács, Richard; Heinemann, Uwe; Friedman, Alon


    Focal cerebral ischemia is among the main causes of death and disability worldwide. The ischemic core often progresses, invading the peri-ischemic brain; however, assessing the propensity of the peri-ischemic brain to undergo secondary damage, understanding the underlying mechanisms, and adjusting treatment accordingly remain clinically unmet challenges. A significant hallmark of the peri-ischemic brain is dysfunction of the blood-brain barrier (BBB), yet the role of disturbed vascular permeability in stroke progression is unclear. Here we describe a longitudinal in vivo fluorescence imaging approach for the evaluation of cortical perfusion, BBB dysfunction, free radical formation and cellular injury using the photothrombosis vascular occlusion model in male Sprague Dawley rats. Blood-brain barrier dysfunction propagated within the peri-ischemic brain in the first hours after photothrombosis and was associated with free radical formation and cellular injury. Inhibiting free radical signaling significantly reduced progressive cellular damage after photothrombosis, with no significant effect on blood flow and BBB permeability. Our approach allows a dynamic follow-up of cellular events and their response to therapeutics in the acutely injured cerebral cortex.

  6. The transporter and permeability interactions of asymmetric dimethylarginine (ADMA) and L-arginine with the human blood-brain barrier in vitro.


    Watson, Christopher P; Pazarentzos, Evangelos; Fidanboylu, Mehmet; Padilla, Beatriz; Brown, Rachel; Thomas, Sarah A


    The blood-brain barrier (BBB) is a biological firewall that carefully regulates the cerebral microenvironment by acting as a physical, metabolic and transport barrier. This selectively permeable interface was modelled using the immortalised human cerebral microvascular endothelial cell line (hCMEC/D3) to investigate interactions with the cationic amino acid (CAA) L-arginine, the precursor for nitric oxide (NO), and with asymmetric dimethylarginine (ADMA), an endogenously derived analogue of L-arginine that potently inhibits NO production. The transport mechanisms utilised by L-arginine are known but they are not fully understood for ADMA, particularly at the BBB. This is of clinical significance giving the emerging role of ADMA in many brain and cerebrovascular diseases and its potential as a therapeutic target. We discovered that high concentrations of ADMA could induce endothelial dysfunction in the hCMEC/D3s BBB permeability model, leading to an increase in paracellular permeability to the paracellular marker FITC-dextran (40kDa). We also investigated interactions of ADMA with a variety of transport mechanisms, comparing the data with L-arginine interactions. Both molecules are able to utilise the CAA transport system y(+). Furthermore, the expression of CAT-1, the best known protein from this group, was confirmed in the hCMEC/D3s. It is likely that influx systems, such as y(+)L and b(0,+), have an important physiological role in ADMA transport at the BBB. These data are not only important with regards to the brain, but apply to other microvascular endothelia where ADMA is a major area of investigation.

  7. Oxidative Stress Increases the Blood Brain Barrier Permeability Resulting in Increased Incidence of Brain Metastasis in BRCA Mutation Carriers

    DTIC Science & Technology


    permeability and integrity of the brain endothelium using in vitro and in vivo models. 3) Determine the protective effects of PARP inhibitors and/or selenium preventing BBB-induced damage by oxidative stress, and in inhibiting breast cancer metastasis to the brain. Further, since selenium has anti...inhibitor and ROS inhibitor of BMEC-TJs HBMEC cocultures were preincubated with PARP inhibitor (30mM) or with ROS inhibitor (10mM selenium ) for 6

  8. Increased blood-brain barrier permeability in mammalian brain 7 days after exposure to the radiation from a GSM-900 mobile phone.


    Nittby, Henrietta; Brun, Arne; Eberhardt, Jacob; Malmgren, Lars; Persson, Bertil R R; Salford, Leif G


    Microwaves were for the first time produced by humans in 1886 when radio waves were broadcasted and received. Until then microwaves had only existed as a part of the cosmic background radiation since the birth of universe. By the following utilization of microwaves in telegraph communication, radars, television and above all, in the modern mobile phone technology, mankind is today exposed to microwaves at a level up to 10(20) times the original background radiation since the birth of universe. Our group has earlier shown that the electromagnetic radiation emitted by mobile phones alters the permeability of the blood-brain barrier (BBB), resulting in albumin extravasation immediately and 14 days after 2h of exposure. In the background section of this report, we present a thorough review of the literature on the demonstrated effects (or lack of effects) of microwave exposure upon the BBB. Furthermore, we have continued our own studies by investigating the effects of GSM mobile phone radiation upon the blood-brain barrier permeability of rats 7 days after one occasion of 2h of exposure. Forty-eight rats were exposed in TEM-cells for 2h at non-thermal specific absorption rates (SARs) of 0mW/kg, 0.12mW/kg, 1.2mW/kg, 12mW/kg and 120mW/kg. Albumin extravasation over the BBB, neuronal albumin uptake and neuronal damage were assessed. Albumin extravasation was enhanced in the mobile phone exposed rats as compared to sham controls after this 7-day recovery period (Fisher's exact probability test, p=0.04 and Kruskal-Wallis, p=0.012), at the SAR-value of 12mW/kg (Mann-Whitney, p=0.007) and with a trend of increased albumin extravasation also at the SAR-values of 0.12mW/kg and 120mW/kg. There was a low, but significant correlation between the exposure level (SAR-value) and occurrence of focal albumin extravasation (r(s)=0.33; p=0.04). The present findings are in agreement with our earlier studies where we have seen increased BBB permeability immediately and 14 days after

  9. The neuroprotective effect of olive leaf extract is related to improved blood-brain barrier permeability and brain edema in rat with experimental focal cerebral ischemia.


    Mohagheghi, Fatemeh; Bigdeli, Mohammad Reza; Rasoulian, Bahram; Hashemi, Payman; Pour, Marzyeh Rashidi


    Recent studies suggest that olive extracts suppress inflammation and reduce stress oxidative injury. We sought to extend these observations in an in vivo study of rat cerebral ischemia-reperfusion injury. Four groups, each of 18 Wister rats, were studied. One (control) group received distilled water, while three treatment groups received oral olive leaf extract (50, 75 and 100mg/kg/day respectively). After 30 days, blood lipid profiles were determined, before a 60 min period of middle cerebral artery occlusion (MCAO). After 24h reperfusion, neurological deficit scores, infarct volume, brain edema, and blood-brain barrier permeability were each assessed in subgroups of six animals drawn from each main group. Olive leaf extract reduced the LDL/HDL ratio in doses 50, 75, and 100mg/kg/day in comparison to the control group (P<0.001), and offered cerebroprotection from ischemia-reperfusion. For controls vs. doses of 50mg/kg/day vs. 75 mg/kg/day vs. 100mg/kg/day, attenuated corrected infarct volumes were 209.79 ± 33.05 mm(3) vs. 164.36 ± 13.44 mm(3) vs. 123.06 ± 28.83 mm(3) vs. 94.71 ± 33.03 mm(3); brain water content of the infarcted hemisphere 82.33 ± 0.33% vs. 81.33 ± 0.66% vs. 80.75 ± 0.6% vs. 80.16 ± 0.47%, and blood-brain barrier permeability of the infarcted hemisphere 11.22 ± 2.19 μg/g vs. 9.56 ± 1.74 μg/g vs. 6.99 ± 1.48 μg/g vs. 5.94 ± 1.73 μg/g tissue (P<0.05 and P<0.01 for measures in doses 75 and 100mg/kg/day vs. controls respectively). Oral administration of olive leaf extract reduces infarct volume, brain edema, blood-brain barrier permeability, and improves neurologic deficit scores after transient middle cerebral artery occlusion in rats.

  10. MiRNA-200b Regulates RMP7-Induced Increases in Blood-Tumor Barrier Permeability by Targeting RhoA and ROCKII

    PubMed Central

    Ma, Teng; Xue, Yi-xue


    The primary goals of this study were to investigate the potential roles of miR-200b in regulating RMP7-induced increases in blood-tumor barrier (BTB) permeability and some of the possible molecular mechanisms associated with this effect. Microarray analysis revealed 34 significantly deregulated miRNAs including miR-200b in the BTB as induced by RMP7 and 8 significantly up-regulated miRNAs in the BTB by RMP7. RMP7 induced tight junction (TJ) opening of the BTB, thereby increasing BTB permeability. Associated with this effect of RMP7 was a decrease in miR-200b expression within the human cerebral microvascular endothelial cells line hCMEC/D3 (ECs) of the BTB. Overexpression of miR-200b inhibited endothelial leakage and restored normal transendothelial electric resistance values. A simultaneous shift in occludin and claudin-5 distributions from insoluble to soluble fractions were observed to be significantly reduced. In addition, overexpression of miR-200b inhibited the relocation of occludin and claudin-5 from cellular borders into the cytoplasm as well as the production of stress fiber formation in GECs (ECs with U87 glioma cells co-culturing) of the BTB. MiR-200b silencing produced opposite results as that obtained from that of the miR-200b overexpression group. Overexpression of miR-200b was also associated with a down-regulation in RhoA and ROCKII expression, concomitant with a decrease in BTB permeability. Again, results which were opposite to that obtained with the miR-200b silencing group. We further found that miR-200b regulated BTB permeability by directly targeting RhoA and ROCKII. Collectively, these results suggest that miR-200b's contribution to the RMP7-induced increase in BTB permeability was associated with stress fiber formation and TJ disassembly as achieved by directly targeting RhoA and ROCKII. PMID:26903801

  11. Intestinal and Blood-Brain Barrier Permeability of Ginkgolides and Bilobalide: In Vitro and In Vivo Approaches

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this study intestinal and blood brain barrier (BBB) transport of ginkgolides A, B, C, J and bilobalide, isolated from Ginkgo biloba (Family-Ginkgoaceae), was evaluated in Caco-2 and MDR1-MDCK cell monolayer models. Transepithelial transport was examined for 2 hours in both absorptive and secretor...


    EPA Science Inventory

    Ground water contaminated with TCE is commonly treated with a passive reactive barrier (PRB) constructed with zero-valence iron. The cost of iron as the reactive matrix has driven a search for less costly alternatives, and composted plant mulch has been used as an alternative re...

  13. In vitro porcine blood-brain barrier model for permeability studies: pCEL-X software pKa(FLUX) method for aqueous boundary layer correction and detailed data analysis.


    Yusof, Siti R; Avdeef, Alex; Abbott, N Joan


    In vitro blood-brain barrier (BBB) models from primary brain endothelial cells can closely resemble the in vivo BBB, offering valuable models to assay BBB functions and to screen potential central nervous system drugs. We have recently developed an in vitro BBB model using primary porcine brain endothelial cells. The model shows expression of tight junction proteins and high transendothelial electrical resistance, evidence for a restrictive paracellular pathway. Validation studies using small drug-like compounds demonstrated functional uptake and efflux transporters, showing the suitability of the model to assay drug permeability. However, one limitation of in vitro model permeability measurement is the presence of the aqueous boundary layer (ABL) resulting from inefficient stirring during the permeability assay. The ABL can be a rate-limiting step in permeation, particularly for lipophilic compounds, causing underestimation of the permeability. If the ABL effect is ignored, the permeability measured in vitro will not reflect the permeability in vivo. To address the issue, we explored the combination of in vitro permeability measurement using our porcine model with the pKa(FLUX) method in pCEL-X software to correct for the ABL effect and allow a detailed analysis of in vitro (transendothelial) permeability data, Papp. Published Papp using porcine models generated by our group and other groups are also analyzed. From the Papp, intrinsic transcellular permeability (P0) is derived by simultaneous refinement using a weighted nonlinear regression, taking into account permeability through the ABL, paracellular permeability and filter restrictions on permeation. The in vitro P0 derived for 22 compounds (35 measurements) showed good correlation with P0 derived from in situ brain perfusion data (r(2)=0.61). The analysis also gave evidence for carrier-mediated uptake of naloxone, propranolol and vinblastine. The combination of the in vitro porcine model and the software

  14. Examination of blood-brain barrier permeability in dementia of the Alzheimer type with (68Ga)EDTA and positron emission tomography

    SciTech Connect

    Schlageter, N.L.; Carson, R.E.; Rapoport, S.I.


    Positron emission tomography with (/sup 68/Ga)ethylenediaminetetraacetic acid ((/sup 68/Ga)EDTA) was used to examine the integrity of the blood-brain barrier (BBB) in five patients with dementia of the Alzheimer type and in five healthy age-matched controls. Within a scanning time of 90 min, there was no evidence that measurable intravascular tracer entered the brain in either the dementia or the control group. An upper limit for the cerebrovascular permeability-surface area product of (68Ga)EDTA was estimated as 2 X 10(-6) s-1 in both groups. The results provide no evidence for breakdown of the BBB in patients with dementia of the Alzheimer type.

  15. Estimate of the optimum weight ratio in zero-valent iron/pumice granular mixtures used in permeable reactive barriers for the remediation of nickel contaminated groundwater.


    Calabrò, P S; Moraci, N; Suraci, P


    This paper presents the results of laboratory column tests aimed at defining the optimum weight ratio of zero-valent iron (ZVI)/pumice granular mixtures to be used in permeable reactive barriers (PRBs) for the removal of nickel from contaminated groundwater. The tests were carried out feeding the columns with aqueous solutions of nickel nitrate at concentrations of 5 and 50 mg/l using three ZVI/pumice granular mixtures at various weight ratios (10/90, 30/70 and 50/50), for a total of six column tests; two additional tests were carried out using ZVI alone. The most successful compromise between reactivity (higher ZVI content) and long-term hydraulic performance (higher Pumice content) seems to be given by the ZVI/pumice granular mixture with a 30/70 weight ratio.

  16. A permeable reactive barrier (PRB) media sequence for the remediation of heavy metal and hydrocarbon contaminated water: A field assessment at Casey Station, Antarctica.


    Statham, Tom M; Stark, Scott C; Snape, Ian; Stevens, Geoffrey W; Mumford, Kathryn A


    A field trial was conducted at Casey Station, Antarctica to assess the suitability of a permeable reactive barrier (PRB) media sequence for the remediation of sites containing both hydrocarbon and heavy metal contamination. An existing PRB was modified to assess a sequence consisting of three sections: (i) Nutrient release/hydrocarbon sorption using ZeoPro™ and granular activated carbon; (ii) Phosphorus and heavy metal capture by granular iron and sand; (iii) Nutrient and excess iron capture by zeolite. The media sequence achieved a greater phosphorus removal capacity than previous Antarctic PRB configurations installed on site. Phosphorus concentrations were reduced during flow through the iron/sand section and iron concentrations were reduced within the zeolite section. However, non-ideal flow was detected during a tracer test and supported by analysis of media and liquid samples from the second summer of operation. Results indicate that the PRB media sequence trialled might be appropriate for other locations, especially less environmentally challenging contaminated sites.

  17. The permeation of dynorphin A 1-6 across the blood brain barrier and its effect on bovine brain microvessel endothelial cell monolayer permeability.


    Sloan, Courtney D Kuhnline; Audus, Kenneth L; Aldrich, Jane V; Lunte, Susan M


    Dynorphin A 1-17 (Dyn A 1-17) is an endogenous neuropeptide known to act at the kappa opioid receptor; it has been implicated in a number of neurological disorders, including neuropathic pain, stress, depression, and Alzheimer's and Parkinson's diseases. The investigation of Dyn A 1-17 metabolism at the blood-brain barrier (BBB) is important since the metabolites exhibit unique biological functions compared to the parent compound. In this work, Dyn A 1-6 is identified as a metabolite of Dyn A 1-17 in the presence of bovine brain microvessel endhothelial cells (BBMECs), using LC-MS/MS. The transport of Dyn A 1-6 at the BBB was examined using this in vitro cell culture model of the BBB. Furthermore, the permeation of the BBB by the low molecular weight permeability marker fluorescein was characterized in the presence and absences of Dyn A 1-6.

  18. Time-dependent diffusion in skeletal muscle with the random permeable barrier model (RPBM): Application to normal controls and chronic exertional compartment syndrome patients

    PubMed Central

    Sigmund, Eric E.; Novikov, Dmitry S.; Sui, Dabang; Ukpebor, Obehi; Baete, Steven; Babb, James S.; Liu, Kecheng; Feiweier, Thorsten; Kwon, Jane; Mcgorty, KellyAnne; Bencardino, Jenny; Fieremans, Els


    Purpose To collect diffusion tensor imaging (DTI) at multiple diffusion times Td in skeletal muscle in normal subjects and chronic exertional compartment syndrome (CECS) patients and analyze the data with the random permeable barrier model (RPBM) for biophysical specificity. Materials and Methods Using an IRB-approved HIPAA-compliant protocol, seven patients with clinical suspicion of CECS and eight healthy volunteers underwent DTI of the calf muscle in a Siemens MAGNETOM Verio 3-T scanner at rest and after treadmill exertion at 4 different diffusion times. Radial diffusion values λrad were computed for each of 7 different muscle compartments and analyzed with RPBM to produce estimates of free diffusivity D0, fiber diameter a, and permeability κ. Fiber diameter estimates were compared with measurements from literature autopsy reference for several compartments. Response factors (post/pre-exercise ratios) were computed and compared between normal controls and CECS patients using a mixed-model two-way analysis of variance. Results All subjects and muscle compartments showed nearly time-independent diffusion along and strongly time-dependent diffusion transverse to the muscle fibers. RPBM estimates of fiber diameter correlated well with corresponding autopsy reference. D0 showed significant (p<0.05) increases with exercise for volunteers, and a increased significantly (p<0.05) in volunteers. At the group level, response factors of all three parameters showed trends differentiating controls from CECS patients, with patients showing smaller diameter changes (p=0.07), and larger permeability increases (p=0.07) than controls. Conclusions Time-dependent diffusion measurements combined with appropriate tissue modeling can provide enhanced microstructural specificity for in vivo tissue characterization. In CECS patients, our results suggest that high-pressure interfiber edema elevates free diffusion and restricts exercise-induced fiber dilation. Such specificity may be

  19. Methamphetamine transiently increases the blood-brain barrier permeability in the hippocampus: role of tight junction proteins and matrix metalloproteinase-9.


    Martins, Tânia; Baptista, Sofia; Gonçalves, Joana; Leal, Ermelindo; Milhazes, Nuno; Borges, Fernanda; Ribeiro, Carlos F; Quintela, Oscar; Lendoiro, Elena; López-Rivadulla, Manuel; Ambrósio, António F; Silva, Ana P


    Methamphetamine (METH) is a powerful stimulant drug of abuse that has steadily gained popularity worldwide. It is known that METH is highly neurotoxic and causes irreversible damage of brain cells leading to neurological and psychiatric abnormalities. Recent studies suggested that METH-induced neurotoxicity might also result from its ability to compromise blood-brain barrier (BBB) function. Due to the crucial role of BBB in the maintenance of brain homeostasis and protection against toxic molecules and pathogenic organisms, its dysfunction could have severe consequences. In this study, we investigated the effect of an acute high dose of METH (30mg/kg) on BBB permeability after different time points and in different brain regions. For that, young adult mice were sacrificed 1h, 24h or 72h post-METH administration. METH increased BBB permeability, but this effect was detected only at 24h after administration, being therefore a transitory effect. Interestingly, we also found that the hippocampus was the most susceptible brain region to METH, comparing to frontal cortex and striatum. Moreover, in an attempt to identify the key players in METH-induced BBB dysfunction we further investigated potential alterations in tight junction (TJ) proteins and matrix metalloproteinase-9 (MMP-9). METH was able to decrease the protein levels of zonula occludens (ZO)-1, claudin-5 and occludin in the hippocampus 24h post-injection, and increased the activity and immunoreactivity of MMP-9. The pre-treatment with BB-94 (30mg/kg), a matrix metalloproteinase inhibitor, prevented the METH-induced increase in MMP-9 immunoreactivity in the hippocampus. Overall, the present data demonstrate that METH transiently increases the BBB permeability in the hippocampus, which can be explained by alterations on TJ proteins and MMP-9.

  20. Loss of occludin expression and impairment of blood-testis barrier permeability in rats with autoimmune orchitis: effect of interleukin 6 on Sertoli cell tight junctions.


    Pérez, Cecilia Valeria; Sobarzo, Cristian Marcelo; Jacobo, Patricia Verónica; Pellizzari, Eliana Herminia; Cigorraga, Selva Beatriz; Denduchis, Berta; Lustig, Livia


    Inflammation of the male reproductive tract is accepted as being an important etiological factor of infertility. Experimental autoimmune orchitis (EAO) is characterized by interstitial lymphomononuclear cell infiltration and severe damage of seminiferous tubules with germ cells that undergo apoptosis and sloughing. Because the blood-testis barrier (BTB) is relevant for the protection of haploid germ cells against immune attack, the aim of this study was to analyze BTB permeability and the expression of tight junction proteins (occludin, claudin 11, and tight junction protein 1 [TJP1]) in rats during development of autoimmune orchitis. The role of IL6 as modulator of tight junction dynamics was also evaluated because intratesticular content of this cytokine is increased in EAO rats. Orchitis was induced in Sprague-Dawley adult rats by active immunization with testicular homogenate and adjuvants. Control rats (C) were injected with saline solution and adjuvants. Untreated (N) rats were also studied. Concomitant with early signs of germ cell sloughing, a reduced expression of occludin and delocalization of claudin 11 and TJP1 were detected in the testes of rats with EAO compared to C and N groups. The use of tracers showed increased BTB permeability in EAO rats. Intratesticular injection of IL6 induced focal testicular inflammation, which is associated with damaged seminiferous tubules. Rat Sertoli cells cultured in the presence of IL6 exhibited a redistribution of tight junction proteins and reduced transepithelial electrical resistance. These data indicate the possibility that IL6 might be involved in the downregulation of occludin expression and in the modulation of BTB permeability that occur in rats undergoing autoimmune orchitis.

  1. Hurdles with using in vitro models to predict human blood-brain barrier drug permeability: a special focus on transporters and metabolizing enzymes.


    Shawahna, Ramzi; Decleves, Xavier; Scherrmann, Jean-Michel


    The penetration of drugs into the human brain through the blood-brain barrier (BBB) is a major obstacle limiting the development of successful neuropharmaceuticals. This restricted permeability is due to the delicate intercellular junctions, efflux transporters and metabolizing enzymes present at the BBB. The pharmaceutical industry and academic research relies heavily on permeability studies conducted in animals and in vitro models of the BBB. This text reviews the available animal and in vitro BBB models with special emphasis on the situation in freshly isolated human brain microvessels and the unique tightness between brain endothelial cells, drug transport pathways and metabolic capacity. We first outline the delicate structure of the intercellular junctions and the particular interaction between the brain endothelial cells and other components of the neurovascular unit. We then examine the differences in transporters and metabolizing enzymes between species and in vitro systems and those found in isolated brain microvessels. Finally, we review the possibilities of benchmarking in vitro models of the BBB in terms of gene and protein expression.

  2. Acute exposure to sarin increases blood brain barrier permeability and induces neuropathological changes in the rat brain: dose-response relationships.


    Abdel-Rahman, A; Shetty, A K; Abou-Donia, M B


    We hypothesize that a single exposure to an LD(50) dose of sarin induces widespread early neuropathological changes in the adult brain. In this study, we evaluated the early changes in the adult brain after a single exposure to different doses of sarin. Adult male rats were exposed to sarin by a single intramuscular injection at doses of 1, 0.5, 0.1 and 0.01 x LD(50). Twenty-four hours after the treatment, both sarin-treated and vehicle-treated (controls) animals were analyzed for: (i) plasma butyrylcholinesterase (BChE) activity; (ii) brain acetylcholinesterase (AChE) activity, (iii) m2 muscarinic acetylcholine receptor (m2 mAChR) ligand binding; (iv) blood brain barrier (BBB) permeability using [H(3)]hexamethonium iodide uptake assay and immunostaining for endothelial barrier antigen (EBA); and (v) histopathological changes in the brain using H&E staining, and microtubule-associated protein (MAP-2) and glial fibrillary acidic protein immunostaining. In animals treated with 1 x LD(50) sarin, the significant changes include a decreased plasma BChE, a decreased AChE in the cerebrum, brainstem, midbrain and the cerebellum, a decreased m2 mAChR ligand binding in the cerebrum, an increased BBB permeability in the cerebrum, brainstem, midbrain and the cerebellum associated with a decreased EBA expression, a diffuse neuronal cell death and a decreased MAP-2 expression in the cerebral cortex and the hippocampus, and degeneration of Purkinje neurons in the cerebellum. Animals treated with 0.5 x LD(50) sarin however exhibited only a few alterations, which include decreased plasma BChE, an increased BBB permeability in the midbrain and the brain stem but without a decrease in EBA expression, and degeneration of Purkinje neurons in the cerebellum. In contrast, animals treated with 0.1 and 0.01 x LD(50) did not exhibit any of the above changes. However, m2 mAChR ligand binding in the brainstem was increased after exposure to all doses of the sarin.Collectively, the above

  3. Increasing of Blood-Brain Tumor Barrier Permeability through Transcellular and Paracellular Pathways by Microbubble-Enhanced Diagnostic Ultrasound in a C6 Glioma Model

    PubMed Central

    Zhang, Jinlong; Liu, Heng; Du, Xuesong; Guo, Yu; Chen, Xiao; Wang, Shunan; Fang, Jingqin; Cao, Peng; Zhang, Bo; Liu, Zheng; Zhang, Weiguo


    Most of the anticancer agents cannot be efficiently delivered into the brain tumor because of the existence of blood-brain tumor barrier (BTB). The objective of this study was to explore the effect of microbubble-enhanced diagnostic ultrasound (MEUS) on the BTB permeability and the possible mechanism. Glioma-bearing rats were randomized into three groups as follows: the microbubble-enhanced continued diagnostic ultrasound (MECUS) group; the microbubble-enhanced intermittent diagnostic ultrasound (MEIUS) group and the control group. The gliomas were insonicated through the skull with a diagnostic ultrasound and injected with microbubbles through the tail veins. Evans Blue (EB) and dynamic contrast-enhanced-MRI were used to test changes in the BTB permeability. Confocal laser scanning microscopy was used to observe the deposition of the EB in the tumor tissues. The distribution and expression of junctional adhesion molecule-A (JAM-A) and calcium-activated potassium channels (KCa channels) were detected by a Western blot, qRT-PCR, and immunohistochemical staining. In the MEUS groups, the EB extravasation (11.0 ± 2.2 μg/g in MECUS group and 17.9 ± 2.3 μg/g in MEIUS group) exhibited a significant increase compared with the control group (5.3 ± 0.9 μg/g). The MEIUS group had more EB extravasation than the MECUS group. The Ktrans value of the dynamic contrast-enhanced-MRI in the MEUS groups was higher than that of the control group and correlated strongly with the EB extravasation in the tumor (R2 = 0.97). This showed that the Ktrans value might be a non-invasive method to evaluate the BTB permeability in rat glioma after microbubble-enhanced ultrasound treatment.Western blot, qRT-PCR and immunohistochemical staining revealed that MEUS increased the KCa channels expression and reduced JAM-A expression in glioma. This change was more obvious in the MEIUS group than in the MECUS group. The results demonstrated that MEUS effectively increased the BTB permeability in

  4. Predicting Efflux Ratios and Blood-Brain Barrier Penetration from Chemical Structure: Combining Passive Permeability with Active Efflux by P-Glycoprotein

    PubMed Central


    In order to reach their pharmacologic targets, successful central nervous system (CNS) drug candidates have to cross a complex protective barrier separating brain from the blood. Being able to predict a priori which molecules can successfully penetrate this barrier could be of significant value in CNS drug discovery. Herein we report a new computational approach that combines two mechanism-based models, for passive permeation and for active efflux by P-glycoprotein, to provide insight into the multiparameter optimization problem of designing small molecules able to access the CNS. Our results indicate that this approach is capable of distinguishing compounds with high/low efflux ratios as well as CNS+/CNS– compounds and provides advantage over estimating P-glycoprotein efflux or passive permeability alone when trying to predict these emergent properties. We also demonstrate that this method could be useful for rank-ordering chemically similar compounds and that it can provide detailed mechanistic insight into the relationship between chemical structure and efflux ratios and/or CNS penetration, offering guidance as to how compounds could be modified to improve their access into the brain. PMID:23421687

  5. Evaluation of permeability, doxorubicin delivery, and drug retention in a rat brain tumor model after ultrasound-induced blood-tumor barrier disruption.


    Park, Juyoung; Aryal, Muna; Vykhodtseva, Natalia; Zhang, Yong-Zhi; McDannold, Nathan


    Drug delivery in brain tumors is challenging because of the presence of blood-brain barrier (BBB) and the blood-tumor barrier (BTB). Focused ultrasound (FUS) combined with microbubbles can enhance the permeability of the BTB in brain tumors, as well as disrupting the BBB in the surrounding tissue. In this study, dynamic contrast-enhanced Magnetic Resonance Imaging (DCE-MRI) was used to characterize FUS-induced permeability changes in a rat glioma model and in the normal brain and to investigate the relationship between these changes and the resulting concentration of the chemotherapy agent doxorubicin (DOX). 9L gliosarcoma cells were implanted in both hemispheres in male rats. At day 10-12 after implantation, FUS-induced BTB disruption using 690kHz ultrasound and Definity microbubbles was performed in one of the tumors and in a normal brain region in each animal. After FUS, DOX was administered at a dose of 5.67mg/kg. The resulting DOX concentration was measured via fluorometry at 1 or 24h after FUS. The transfer coefficient Ktrans describing extravasation of the MRI contrast agent Gd-DTPA was significantly increased in both the sonicated tumors and in the normal brain tissue (P<0.001) between the two DCE-MRI acquisitions obtained before and after FUS, while no significant difference was found in the controls (non-sonicated tumor/normal brain tissue). DOX concentrations were also significantly larger than controls in both the sonicated tumors and in the normal tissue volumes at 1 and 24h after sonication. The DOX concentrations were significantly larger (P<0.01) in the control tumors harvested 1h after FUS than in those harvested at 24h, when the tumor concentrations were not significantly different than in the non-sonicated normal brain. In contrast, there was no significant difference in the DOX concentrations between the tumors harvested at 1 and 24h after FUS or in the concentrations measured in the brain at these time points. The transfer coefficient Ktrans


    EPA Science Inventory

    This report discusses soil and ground-water sampling methods and procedures used to evaluate the long-term performance of permeable reactive barriers (PRBS) at two sites, Elizabeth City, NC, and the Denver Federal Center near Lakewood, CO. Both PRBs were installed in 1996 and hav...

  7. Noninvasive in vivo optical assessment of blood brain barrier permeability and brain tissue drug deposition in rabbits

    NASA Astrophysics Data System (ADS)

    Ergin, Aysegul; Wang, Mei; Zhang, Jane; Bigio, Irving; Joshi, Shailendra


    Osmotic disruption of the blood brain barrier (BBB) by intraarterial mannitol injection is sometimes the key step for the delivery of chemotherapeutic drugs to brain tissue. BBB disruption (BBBD) with mannitol, however, can be highly variable and could impact local drug deposition. We use optical pharmacokinetics, which is based on diffuse reflectance spectroscopy, to track in vivo brain tissue concentrations of indocyanine green (ICG), an optical reporter used to monitor BBBD, and mitoxantrone (MTX), a chemotherapy agent that does not deposit in brain tissue without BBBD, in anesthetized New Zealand white rabbits. Results show a significant increase in the tissue ICG concentrations with BBBD, and our method is able to track the animal-to-animal variation in tissue ICG and MTX concentrations after BBBD. The tissue concentrations of MTX increase with barrier disruption and are found to be correlated to the degree of disruption, as assessed by the ICG prior to the injection of the drug. These findings should encourage the development of tracers and optical methods capable of quantifying the degree of BBBD, with the goal of improving drug delivery.

  8. Mice lacking epidermal PPARγ exhibit a marked augmentation in photocarcinogenesis associated with increased UVB-induced apoptosis, inflammation and barrier dysfunction

    PubMed Central

    Sahu, Ravi P.; DaSilva, Sonia C.; Rashid, Badri; Martel, Kellie Clay; Jernigan, Danielle; Mehta, Shama R.; Mohamed, Deena R.; Rezania, Samin; Bradish, Joshua R.; Armstrong, Andrew B.; Warren, Simon; Konger, Raymond L.


    Recent studies suggest that peroxisome proliferator-activated receptor gamma (PPARγ) agonists may have cancer chemopreventive activity. Other studies have shown that loss of epidermal PPARγ results in enhanced chemical carcinogenesis in mice via unknown mechanisms. However, ultraviolet B (UVB) exposure represents the primary etiological agent for skin cancer formation and the role of PPARγ in photobiology and photocarcinogenesis is unknown. In previous studies, we demonstrated that UVB irradiation of cells results in the formation of oxidized glycerophosphocholines that exhibit PPARγ ligand activity. We therefore hypothesized that PPARγ would prove to be a chemopreventive target in photocarcinogenesis. We first showed that UVB irradiation of mouse skin causes generation of PPARγ agonist species in vivo. We then generated SKH-1 hairless, albino mice deficient in epidermal Pparg (Pparg−/−epi) using a cytokeratin 14 driven Cre-LoxP strategy. Using a chronic model of UVB photocarcinogenesis, we next showed that Pparg−/−epi mice exhibit an earlier onset of tumor formation, increased tumor burden, and tumor progression. Increased tumor burden in Pparg−/−epi mice was accompanied by a significant increase in epidermal hyperplasia and p53 positive epidermal cells in surrounding skin lacking tumors. Following acute UVB irradiation, Pparg−/−epi mice exhibited an augmentation of both UVB-induced caspase 3/7 activity and inflammation. Increased apoptosis and inflammation was also observed following treatment with the PPARγ antagonist GW9662. With chronic UVB irradiation, Pparg−/−epi mice exhibited a sustained increase in erythema and transepidermal water loss relative to wildtype littermates. This suggests that PPARγ agonists could have possible chemopreventive activity in non-melanoma skin cancer. PMID:22467332

  9. Carbonylation and disassembly of the F-actin cytoskeleton in oxidant induced barrier dysfunction and its prevention by epidermal growth factor and transforming growth factor α in a human colonic cell line

    PubMed Central

    Banan, A; Zhang, Y; Losurdo, J; Keshavarzian, A


    BACKGROUND—Intestinal barrier dysfunction concomitant with high levels of reactive oxygen metabolites (ROM) in the inflamed mucosa have been observed in inflammatory bowel disease (IBD). The cytoskeletal network has been suggested to be involved in the regulation of barrier function. Growth factors (epidermal growth factor (EGF) and transforming growth factor α (TGF-α)) protect gastrointestinal barrier integrity against a variety of noxious agents. However, the underlying mechanisms of oxidant induced disruption and growth factor mediated protection remain elusive.
AIMS—To determine: (1) if oxidation and disassembly of actin (a key cytoskeletal component) plays a major role in ROM induced epithelial monolayer barrier dysfunction; and (2) if growth factor mediated protection involves prevention of theses alterations.
METHODS—Caco-2 monolayers were preincubated with EGF, TGF-α, or vehicle before incubation with ROM (H2O2 or HOCl). Effects on cell integrity, barrier function, and G- and F-actin (oxidation, disassembly, and assembly) were determined.
RESULTS—ROM dose dependently and significantly increased F- and G-actin oxidation (carbonylation), decreased the stable F-actin fraction (index of stability), and increased the monomeric G-actin fraction (index of disassembly). Concomitant with these changes were disruption of the actin cytoskeleton and loss of the monolayer barrier function. In contrast, growth factor pretreatment decreased actin oxidation and enhanced the stable F-actin, while in concert prevented actin disruption and restored normal barrier function of monolayers exposed to ROM. Cytochalasin-D, an inhibitor of actin assembly, not only caused actin disassembly and barrier dysfunction but also abolished the protective action of growth factors. Moreover, an actin stabilising agent, phalloidin, mimicked the protective actions of the growth factors.
CONCLUSIONS—Oxidation, disassembly, and instability of the actin cytoskeleton appears to

  10. Nuclear hormone receptor functions in keratinocyte and melanocyte homeostasis, epidermal carcinogenesis and melanomagenesis

    PubMed Central

    Hyter, Stephen; Indra, Arup K


    Skin homeostasis is maintained, in part, through regulation of gene expression orchestrated by type II nuclear hormone receptors in a cell and context specific manner. This group of transcriptional regulators is implicated in various cellular processes including epidermal proliferation, differentiation, permeability barrier formation, follicular cycling and inflammatory responses. Endogenous ligands for the receptors regulate actions during skin development and maintenance of tissue homeostasis. Type II nuclear receptor signaling is also important for cellular crosstalk between multiple cell types in the skin. Overall, these nuclear receptors are critical players in keratinocyte and melanocyte biology and present targets for cutaneous disease management. PMID:23395795

  11. Development of Blood-Brain Barrier Permeable Nanoparticles as Potential Carriers for Salvianolic Acid B to CNS.


    Grossi, Cristina; Guccione, Clizia; Isacchi, Benedetta; Bergonzi, Maria Camilla; Luccarini, Ilaria; Casamenti, Fiorella; Bilia, Anna Rita


    The blood-brain barrier hinders the passage of systemically delivered therapeutics and the brain extracellular matrix limits the distribution and durability of locally delivered agents. Drug-loaded nanocarriers represent a promising strategy to overcome these barriers and address specific drug delivery challenges due to their small size and versatile design. We synthetized [fluorescent poly(ethyl-cyanoacrylate) nanoparticles coated with Tween 80 by an emulsion polymerization method to target and reach the brain after intravenous and intraperitoneal administration. Nanoparticles were characterized in terms of dimensional analysis, polydispersity and zeta potential (ζ-potential), morphology, encapsulation efficacy, and loading capacity. After intracerebral injection in healthy rats, nanoparticles were distributed within the injected hemisphere and mainly interacted with microglial cells, presumably involved in their clearance by phagocytosis. Furthermore, nanoparticles were able to pass the blood-brain barrier after systemic administration in rats, and the lack of toxicity in C57/B6 mice chronically administered was highlighted. The data obtained helped to clarify the nanoparticles distribution, accumulation, fate, and toxicity into the brain. The selected nanoparticles may represent a biocompatible promising carrier to be further investigated as brain delivery systems. Salvianolic acid B from Salvia miltiorrhiza is a promising molecule in the protection of degeneration in several animal models by various biological mechanisms, but its poor chemical stability and low bioavailability limits its clinical application for central nervous system neuronal injury and degeneration. Nanoparticles were loaded with salvianolic acid B obtaining an encapsulation efficacy and loading capacities of 98.70 % ± 0.45 and 53.3 % ± 0.24, respectively. They were suitable for parental administration because their mean diameter was smaller than 300 nm, with a polydispersity of

  12. Development of Blood-Brain Barrier Permeable Nitrocatechol-Based Catechol O-Methyltransferase Inhibitors with Reduced Potential for Hepatotoxicity.


    Silva, Tiago; Mohamed, Tarek; Shakeri, Arash; Rao, Praveen P N; Martínez-González, Loreto; Pérez, Daniel I; Martínez, Ana; Valente, Maria João; Garrido, Jorge; Uriarte, Eugenio; Serrão, Paula; Soares-da-Silva, Patrício; Remião, Fernando; Borges, Fernanda


    Recent efforts have been focused on the development of centrally active COMT inhibitors, which can be valuable assets for neurological disorders such as Parkinson's disease, due to the severe hepatotoxicity risk associated with tolcapone. New nitrocatechol COMT inhibitors based on naturally occurring caffeic acid and caffeic acid phenethyl ester were developed. All nitrocatechol derivatives displayed potent inhibition of peripheral and cerebral COMT within the nanomolar range. Druglike derivatives 13, 15, and 16 were predicted to cross the blood-brain barrier in vitro and were significantly less toxic than tolcapone and entacapone when incubated at 50 μM with rat primary hepatocytes. Moreover, their unique acidity and electrochemical properties decreased the chances of formation of reactive quinone-imines and, as such, the potential for hepatotoxicity. The binding mode of 16 confirmed that the major interactions with COMT were established via the nitrocatechol ring, allowing derivatization of the side chain for future lead optimization efforts.

  13. Induction of selective blood-tumor barrier permeability and macromolecular transport by a biostable kinin B1 receptor agonist in a glioma rat model.


    Côté, Jérôme; Bovenzi, Veronica; Savard, Martin; Dubuc, Céléna; Fortier, Audrey; Neugebauer, Witold; Tremblay, Luc; Müller-Esterl, Werner; Tsanaclis, Ana-Maria; Lepage, Martin; Fortin, David; Gobeil, Fernand


    Treatment of malignant glioma with chemotherapy is limited mostly because of delivery impediment related to the blood-brain tumor barrier (BTB). B1 receptors (B1R), inducible prototypical G-protein coupled receptors (GPCR) can regulate permeability of vessels including possibly that of brain tumors. Here, we determine the extent of BTB permeability induced by the natural and synthetic peptide B1R agonists, LysdesArg(9)BK (LDBK) and SarLys[dPhe(8)]desArg(9)BK (NG29), in syngeneic F98 glioma-implanted Fischer rats. Ten days after tumor inoculation, we detected the presence of B1R on tumor cells and associated vasculature. NG29 infusion increased brain distribution volume and uptake profiles of paramagnetic probes (Magnevist and Gadomer) at tumoral sites (T(1)-weighted imaging). These effects were blocked by B1R antagonist and non-selective cyclooxygenase inhibitors, but not by B2R antagonist and non-selective nitric oxide synthase inhibitors. Consistent with MRI data, systemic co-administration of NG29 improved brain tumor delivery of Carboplatin chemotherapy (ICP-Mass spectrometry). We also detected elevated B1R expression in clinical samples of high-grade glioma. Our results documented a novel GPCR-signaling mechanism for promoting transient BTB disruption, involving activation of B1R and ensuing production of COX metabolites. They also underlined the potential value of synthetic biostable B1R agonists as selective BTB modulators for local delivery of different sized-therapeutics at (peri)tumoral sites.

  14. Effect of acute poly(ADP-ribose) polymerase inhibition by 3-AB on blood-brain barrier permeability and edema formation after focal traumatic brain injury in rats.


    Lescot, Thomas; Fulla-Oller, Laurence; Palmier, Bruno; Po, Christelle; Beziaud, Tiphaine; Puybasset, Louis; Plotkine, Michel; Gillet, Brigitte; Meric, Philippe; Marchand-Leroux, Catherine


    Recent evidence supports a crucial role for matrix metalloproteinase-9 (MMP-9) in blood-brain barrier (BBB) disruption and vasogenic edema formation after traumatic brain injury (TBI). Although the exact causes of MMP-9 upregulation after TBI are not fully understood, several arguments suggest a contribution of the enzyme poly(ADP-ribose)polymerase (PARP) in the neuroinflammatory response leading to MMP-9 activation. The objectives of this study were to evaluate the effect of PARP inhibition by 3-aminobenzamide (3-AB) (1) on MMP-9 upregulation and BBB integrity, (2) on edema formation as assessed by magnetic resonance imaging (MRI), (3) on neuron survival as assessed by (1)H magnetic resonance spectroscopy ((1)H-MRS), and (4) on neurological deficits at the acute phase of TBI. Western blots and zymograms showed blunting of MMP-9 upregulation 6 h after TBI. BBB permeability was decreased at the same time point in 3-AB-treated rats compared to vehicle-treated rats. Cerebral MRI showed less "free" water in 3-AB-treated than in vehicle-treated rats 6 h after TBI. MRI findings 24 h after TBI indicated predominant cytotoxic edema, and at this time point no significant differences were found between 3-AB- and vehicle-treated rats with regard to MMP-9 upregulation, BBB permeability, or MRI changes. At both 6 and 24 h, neurological function was better in the 3-AB-treated than in the vehicle-treated rats. These data suggest that PARP inhibition by 3-AB protected the BBB against hyperpermeability induced by MMP-9 upregulation, thereby decreasing vasogenic edema formation 6 h after TBI. Furthermore, our data confirm the neuroprotective effect of 3-AB at the very acute phase of TBI.

  15. Long-term performance monitoring for a permeable reactive barrier at the U.S. Coast Guard Support Center, Elizabeth City, North Carolina.


    Puls, R W; Blowes, D W; Gillham, R W


    A continuous hanging iron wall was installed in June, 1996, at the U. S. Coast Guard (USCG) Support Center near Elizabeth City, NC, United States, to treat overlapping plumes of chromate and chlorinated solvent compounds. The wall was emplaced using a continuous trenching machine whereby native soil and aquifer sediment was removed and the iron simultaneously emplaced in one continuous excavation and fill operation. To date, there have been seven rounds (November 1996, March 1997, June 1997, September 1997, December 1997, March 1998, and June 1998) of performance monitoring of the wall. At this time, this is the only full-scale continuous 'hanging' wall installed as a permeable reactive barrier to remediate both chlorinated solvent compounds and chromate in groundwater. Performance monitoring entails the following: sampling of 10-5 cm PVC compliance wells and 15 multi-level samplers for the following constituents: TCE, cis-dichloroethylene (c-DCE), vinyl chloride, ethane, ethene, acetylene, methane, major anions, metals, Cr(VI), Fe(II), total sulfides, dissolved H(2), Eh, pH, dissolved oxygen, specific conductance, alkalinity, and turbidity. Electrical conductivity profiles have been conducted using a Geoprobe to verify emplacement of the continuous wall as designed and to locate upgradient and downgradient wall interfaces for coring purposes. Coring has been conducted in November, 1996, in June and September, 1997, and March, 1998, to evaluate the rate of corrosion on the iron surfaces, precipitate buildup (particularly at the upgradient interface), and permeability changes due to wall emplacement. In addition to several continuous vertical cores, angled cores through the 0.6-m thick wall have been collected to capture upgradient and downgradient wall interfaces along approximate horizontal flow paths for mineralogic analyses.

  16. Induction of Selective Blood-Tumor Barrier Permeability and Macromolecular Transport by a Biostable Kinin B1 Receptor Agonist in a Glioma Rat Model

    PubMed Central

    Côté, Jérôme; Bovenzi, Veronica; Savard, Martin; Dubuc, Céléna; Fortier, Audrey; Neugebauer, Witold; Tremblay, Luc; Müller-Esterl, Werner; Tsanaclis, Ana-Maria; Lepage, Martin; Fortin, David; Gobeil, Fernand


    Treatment of malignant glioma with chemotherapy is limited mostly because of delivery impediment related to the blood-brain tumor barrier (BTB). B1 receptors (B1R), inducible prototypical G-protein coupled receptors (GPCR) can regulate permeability of vessels including possibly that of brain tumors. Here, we determine the extent of BTB permeability induced by the natural and synthetic peptide B1R agonists, LysdesArg9BK (LDBK) and SarLys[dPhe8]desArg9BK (NG29), in syngeneic F98 glioma-implanted Fischer rats. Ten days after tumor inoculation, we detected the presence of B1R on tumor cells and associated vasculature. NG29 infusion increased brain distribution volume and uptake profiles of paramagnetic probes (Magnevist and Gadomer) at tumoral sites (T1-weighted imaging). These effects were blocked by B1R antagonist and non-selective cyclooxygenase inhibitors, but not by B2R antagonist and non-selective nitric oxide synthase inhibitors. Consistent with MRI data, systemic co-administration of NG29 improved brain tumor delivery of Carboplatin chemotherapy (ICP-Mass spectrometry). We also detected elevated B1R expression in clinical samples of high-grade glioma. Our results documented a novel GPCR-signaling mechanism for promoting transient BTB disruption, involving activation of B1R and ensuing production of COX metabolites. They also underlined the potential value of synthetic biostable B1R agonists as selective BTB modulators for local delivery of different sized-therapeutics at (peri)tumoral sites. PMID:22629405

  17. Assessment of Blood-Brain Barrier Permeability by Dynamic Contrast-Enhanced MRI in Transient Middle Cerebral Artery Occlusion Model after Localized Brain Cooling in Rats

    PubMed Central

    Kim, Eun Soo; Kwon, Mi Jung; Lee, Phil Hye; Ju, Young-Su; Yoon, Dae Young; Kim, Hye Jeong; Lee, Kwan Seop


    Objective The purpose of this study was to evaluate the effects of localized brain cooling on blood-brain barrier (BBB) permeability following transient middle cerebral artery occlusion (tMCAO) in rats, by using dynamic contrast-enhanced (DCE)-MRI. Materials and Methods Thirty rats were divided into 3 groups of 10 rats each: control group, localized cold-saline (20℃) infusion group, and localized warm-saline (37℃) infusion group. The left middle cerebral artery (MCA) was occluded for 1 hour in anesthetized rats, followed by 3 hours of reperfusion. In the localized saline infusion group, 6 mL of cold or warm saline was infused through the hollow filament for 10 minutes after MCA occlusion. DCE-MRI investigations were performed after 3 hours and 24 hours of reperfusion. Pharmacokinetic parameters of the extended Tofts-Kety model were calculated for each DCE-MRI. In addition, rotarod testing was performed before tMCAO, and on days 1-9 after tMCAO. Myeloperoxidase (MPO) immunohisto-chemistry was performed to identify infiltrating neutrophils associated with the inflammatory response in the rat brain. Results Permeability parameters showed no statistical significance between cold and warm saline infusion groups after 3-hour reperfusion 0.09 ± 0.01 min-1 vs. 0.07 ± 0.02 min-1, p = 0.661 for Ktrans; 0.30 ± 0.05 min-1 vs. 0.37 ± 0.11 min-1, p = 0.394 for kep, respectively. Behavioral testing revealed no significant difference among the three groups. However, the percentage of MPO-positive cells in the cold-saline group was significantly lower than those in the control and warm-saline groups (p < 0.05). Conclusion Localized brain cooling (20℃) does not confer a benefit to inhibit the increase in BBB permeability that follows transient cerebral ischemia and reperfusion in an animal model, as compared with localized warm-saline (37℃) infusion group. PMID:27587960

  18. Enhancement in blood-tumor barrier permeability and delivery of liposomal doxorubicin using focused ultrasound and microbubbles: evaluation during tumor progression in a rat glioma model

    PubMed Central

    Aryal, Muna; Park, Juyoung; Vykhodtseva, Natalia; Zhang, Yong-Zhi; McDannold, Nathan


    Effective drug delivery to brain tumors is often challenging because of the heterogeneous permeability of the “blood tumor barrier” (BTB) along with other factors such as increased interstitial pressure and drug efflux pumps. Focused ultrasound (FUS) combined with microbubbles can enhance the permeability of the BTB in brain tumors, as well as the blood-brain barrier in the surrounding tissue. In this study, dynamic contrast-enhanced MRI (DCE-MRI) was used to characterize the FUS-induced permeability changes of the BTB in a rat glioma model at different times after implantation. 9L gliosarcoma cells were implanted in both hemispheres in male rats. At day 9, 14, or 17 days after implantation, FUS-induced BTB disruption using 690 kHz ultrasound and Definity microbubbles was performed in one tumor in each animal. Before FUS, liposomal doxorubicin was administered at a dose of 5.67 mg/kg. This chemotherapy agent was shown previously to improve survival in animal glioma models. The transfer coefficient Ktrans describing extravasation of the MRI contrast agent Gd-DTPA was measured via DCE-MRI before and after sonication. We found that tumor doxorubicin concentrations increased monotonically (823±600, 1817±732 and 2432±448 ng/g) in the control tumors at 9, 14 and 17 days. With FUS-induced BTB disruption, the doxorubicin concentrations were enhanced significantly (P<0.05, P<0.01, and P<0.0001 at days 9, 14, and 17, respectively) and were greater than the control tumors by a factor of two or more (2222±784, 3687±796 and 5658±821 ng/g) regardless of the stage of tumor growth. The transfer coefficient Ktrans was significantly (p<0.05) enhanced compared to control tumors only at day 9 but not at day 14 or 17. These results suggest that FUS-induced enhancements in tumor drug delivery are relatively consistent over time, at least in this tumor model. These results are encouraging for the use of large drug carriers, as they suggest that even large/late-stage tumors can

  19. In vivo EPR pharmacokinetic evaluation of the redox status and the blood brain barrier permeability in the SOD1(G93A) ALS rat model.


    Stamenković, Stefan; Pavićević, Aleksandra; Mojović, Miloš; Popović-Bijelić, Ana; Selaković, Vesna; Andjus, Pavle; Bačić, Goran


    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder affecting the motor pathways of the central nervous system. Although a number of pathophysiological mechanisms have been described in the disease, post mortem and animal model studies indicate blood-brain barrier (BBB) disruption and elevated production of reactive oxygen species as major contributors to disease pathology. In this study, the BBB permeability and the brain tissue redox status of the SOD1(G93A) ALS rat model in the presymptomatic (preALS) and symptomatic (ALS) stages of the disease were investigated by in vivo EPR spectroscopy using three aminoxyl radicals with different cell membrane and BBB permeabilities, Tempol, 3-carbamoyl proxyl (3CP), and 3-carboxy proxyl (3CxP). Additionally, the redox status of the two brain regions previously implicated in disease pathology, brainstem and hippocampus, was investigated by spectrophotometric biochemical assays. The EPR results indicated that among the three spin probes, 3CP is the most suitable for reporting the intracellular redox status changes, as Tempol was reduced in vivo within minutes (t1/2 =2.0±0.5min), thus preventing reliable kinetic modeling, whereas 3CxP reduction kinetics gave divergent conclusions, most probably due to its membrane impermeability. It was observed that the reduction kinetics of 3CP in vivo, in the head of preALS and ALS SOD1(G93A) rats was altered compared to the controls. Pharmacokinetic modeling of 3CP reduction in vivo, revealed elevated tissue distribution and tissue reduction rate constants indicating an altered brain tissue redox status, and possibly BBB disruption in these animals. The preALS and ALS brain tissue homogenates also showed increased nitrilation, superoxide production, lipid peroxidation and manganese superoxide dismutase activity, and a decreased copper-zinc superoxide dismutase activity. The present study highlights in vivo EPR spectroscopy as a reliable tool for the investigation of

  20. Modulation of Intercellular Junctions by Cyclic-ADT Peptides as a Method to Reversibly Increase Blood-Brain Barrier Permeability

    PubMed Central

    Laksitorini, Marlyn D.; Kiptoo, Paul K.; On, Ngoc H.; Thliveris, James A.; Miller, Donald W.; Siahaan, Teruna J.


    It is challenging to deliver molecules to the brain for diagnosis and treatment of brain diseases. This is primarily due to the presence of the blood-brain barrier (BBB), which restricts the entry of many molecules into the brain. In this study, cyclic ADT peptides (ADTC1, ADTC5, and ADTC6) have been shown to modify the BBB to enhance the delivery of marker molecules (e.g., 14C-mannitol, Gd-DTPA) to the brain via the paracellular pathways of the BBB. The hypothesis is that these peptides modulate cadherin interactions in the adherens junctions of the vascular endothelial cells forming the BBB to increase paracellular drug permeation. In vitro studies indicated that ADTC5 had the best profile to inhibit adherens junction resealing in MDCK cell monolayers in a concentration-dependent manner (IC50 = 0.3 mM) with a maximal response at 0.4 mM. Under the current experimental conditions, ADTC5 improved the delivery of 14C-mannitol to the brain about twofold compared to the negative control in the in situ rat brain perfusion model. Furthermore, ADTC5 peptide increased in vivo delivery of Gd-DTPA to the brain of Balb/c mice when administered intravenously (i.v.). In conclusion, ADTC5 has the potential to improve delivery of diagnostic and therapeutic agents to the brain. PMID:25640479

  1. Modulation of intercellular junctions by cyclic-ADT peptides as a method to reversibly increase blood-brain barrier permeability.


    Laksitorini, Marlyn D; Kiptoo, Paul K; On, Ngoc H; Thliveris, James A; Miller, Donald W; Siahaan, Teruna J


    It is challenging to deliver molecules to the brain for diagnosis and treatment of brain diseases. This is primarily because of the presence of the blood-brain barrier (BBB), which restricts the entry of many molecules into the brain. In this study, cyclic-ADT peptides (ADTC1, ADTC5, and ADTC6) have been shown to modify the BBB to enhance the delivery of marker molecules [e.g., (14) C-mannitol, gadolinium-diethylenetriaminepentacetate (Gd-DTPA)] to the brain via the paracellular pathways of the BBB. The hypothesis is that these peptides modulate cadherin interactions in the adherens junctions of the vascular endothelial cells forming the BBB to increase paracellular drug permeation. In vitro studies indicated that ADTC5 had the best profile to inhibit adherens junction resealing in Madin-Darby canine kidney cell monolayers in a concentration-dependent manner (IC50 = 0.3 mM) with a maximal response at 0.4 mM. Under the current experimental conditions, ADTC5 improved the delivery of (14) C-mannitol to the brain about twofold compared with the negative control in the in situ rat brain perfusion model. Furthermore, ADTC5 peptide increased in vivo delivery of Gd-DTPA to the brain of Balb/c mice when administered intravenously. In conclusion, ADTC5 has the potential to improve delivery of diagnostic and therapeutic agents to the brain.

  2. Hypoxia modulates the barrier and coagulant function of cultured bovine endothelium. Increased monolayer permeability and induction of procoagulant properties.

    PubMed Central

    Ogawa, S; Gerlach, H; Esposito, C; Pasagian-Macaulay, A; Brett, J; Stern, D


    Exposure of cultured endothelium to environments with low concentrations of oxygen, in the range of those observed in pathophysiologic hypoxemic states in vivo, compromises cellular barrier and coagulant function. An atmosphere with PO2 approximately 14 mm Hg was not lethally toxic to endothelial cultures, but cells became larger and exhibited small intercellular gaps. At low oxygen concentrations, passage of macromolecular tracers through hypoxic endothelial monolayers was accelerated in a time- and dose-dependent manner, presumably by a paracellular pathway via the gaps. Cell surface coagulant properties of the endothelium were also perturbed. At PO2 approximately 14 mm Hg thrombomodulin antigen and functional activity on the cell surface were diminished by 80-90%, and Northern blots demonstrated suppression of thrombomodulin mRNA. The decrease in thrombomodulin was twice as great compared with the general decline in total protein synthesis in hypoxia. In addition, expression of a direct Factor X activator developed under hypoxic conditions; the activator was membrane-associated and expressed on the surface of intact cultures, Ca-dependent, inhibited by HgCl2 but not PMSF, and had Km approximately 25 micrograms/ml for the substrate at pH 7.4. Synthesis of the activator was blocked by inclusion of cycloheximide, but not warfarin, in the culture medium. These results demonstrate that endothelial function is perturbed in a selective manner in the presence of low concentrations of oxygen, providing insights into mechanisms which may contribute to vascular dysfunction in hypoxemic states. Images PMID:2156893

  3. Non-invasive in vivo methods for investigation of the skin barrier physical properties.


    Darlenski, R; Sassning, S; Tsankov, N; Fluhr, J W


    Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. Novel methods such as in vivo confocal Raman microspectroscopy offer the possibility for precise and detailed characterization of the skin barrier. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.

  4. Matrix Metalloproteinase-2 and -9 Secreted by Leukemic Cells Increase the Permeability of Blood-Brain Barrier by Disrupting Tight Junction Proteins

    PubMed Central

    Feng, Saran; Cen, Jiannong; Huang, Yihong; Shen, Hongjie; Yao, Li; Wang, Yuanyuan; Chen, Zixing


    Central nervous system (CNS) involvement remains an important cause of morbidity and mortality in acute leukemia, the mechanisms of leukemic cell infiltration into the CNS have not yet been elucidated. The blood-brain barrier (BBB) makes CNS become a refugee to leukemic cells and serves as a resource of cells that seed extraneural sites. How can the leukemic cells disrupt this barrier and invasive the CNS, even if many of the currently available chemotherapies can not cross the BBB? Tight junction in endothelial cells occupies a central role in the function of the BBB. Except the well known role of degrading extracellular matrix in metastasis of cancer cells, here we show matrix metalloproteinase (MMP)-2 and -9, secreted by leukemic cells, mediate the BBB opening by disrupting tight junction proteins in the CNS leukemia. We demonstrated that leukemic cells impaired tight junction proteins ZO-1, claudin-5 and occludin resulting in increased permeability of the BBB. However, these alterations reduced when MMP-2 and -9 activities were inhibited by RNA interference strategy or by MMP inhibitor GM6001 in an in vitro BBB model. We also found that the disruption of the BBB in company with the down-regulation of ZO-1, claudin-5 and occludin and the up-regulation of MMP-2 and -9 in mouse brain tissues with leukemic cell infiltration by confocal imaging and the assay of in situ gelatin zymography. Besides, GM6001 protected all mice against CNS leukemia. Our findings suggest that the degradation of tight junction proteins ZO-1, claudin-5 and occludin by MMP-2 and -9 secreted by leukemic cells constitutes an important mechanism in the BBB breakdown which contributes to the invasion of leukemic cells to the CNS in acute leukemia. PMID:21857898

  5. Differential blood-brain barrier permeabilities to (/sup 14/C)sucrose and (/sup 3/H)inulin after osmotic opening in the rat

    SciTech Connect

    Ziylan, Y.Z.; Robinson, P.J.; Rapoport, S.I.


    The blood-brain barrier (B-BB) in 3-month-old rats was opened unilaterally by infusing 1.8 m L(+)arabinose in water into the internal carotid artery through a catheter in the external carotid. Two poorly penetrating uncharged test radiotracers of differing molecular weight and size, (/sup 14/C)sucrose (340 daltons, radius 5 A) and (/sup 3/H)inulin (5500 daltons, radius 15 A), were simultaneously injected i.v. in untreated rats, or rats at 1, 30, or 50 min after infusion of hypertonic arabinose solution. Evans-blue solution was injected 5 min prior to osmotic treatment as a visual indicator of barrier integrity. In regions of uninfused control brains, the (/sup 14/C)sucrose permeability-surface area (PA) product approximated 10(-5) s-1, whereas PA was not measurable for (/sup 3/H)inulin. In arabinose-infused animals, PA products on the ipsilateral hemisphere for both (/sup 14/C)sucrose and (/sup 3/H)inulin were markedly elevated 6 min after infusion, but decreased by 35 and 55 min. In nearly all regions, statistically significant differences were not found between 6-min (/sup 14/C)sucrose- and (/sup 3/H)inulin-PA values (P greater than 0.05). However, at 35 and 55 min in most regions, the PA for (/sup 3/H)inulin was significantly lower (P less than 0.05) than PA for (/sup 14/C)sucrose. The results indicated that the B-BB closed more rapidly to larger than to smaller molecules after osmotic treatment and were consistent with a pore model for osmotic B-BB opening.

  6. Cerebrospinal fluid indices of blood-brain barrier permeability following adrenal-brain transplantation in patients with Parkinson's disease.


    Ahlskog, J E; Tyce, G M; Kelly, P J; van Heerden, J A; Stoddard, S L; Carmichael, S W


    Cerebrospinal fluid (CSF) and serum or plasma concentrations of albumin, IgG and carbidopa were measured before and after adrenal-brain transplantation in patients with Parkinson's disease to indirectly assess blood-brain barrier (BBB) integrity. Previous studies in animals have suggested that the BBB is compromised by cerebral transplantation. CSF and plasma levodopa was also measured to permit comparison with the carbidopa values, recognizing that levodopa readily crosses the BBB via facilitated transport. Our patients underwent adrenal-brain transplantation in accordance with the method of Madrazo et al. (I. Madrazo, R. Drucker-Colin, V. Diaz, J. Martinez-Mata, C. Torres, and J. J. Becerril, 1987, N. Engl. J. Med. 316: 831-834) in which adrenal medullary pieces are implanted in the head of the caudate nucleus, in contact with the cerebrospinal fluid. All patients were maintained on oral carbidopa/levodopa therapy after surgery. CSF albumin/serum albumin and CSF IgG/serum IgG ratios were initially elevated above the preoperative baseline 6 weeks after the surgery; however, these values returned to the preoperative baseline by 6 months following the operation in six of seven patients. This suggested that the BBB was sufficiently intact to exclude these larger protein molecules from the CSF of these six patients. On the other hand, exogenously administered carbidopa, which normally is largely excluded from the cerebrospinal fluid by the BBB, was modestly increased in the CSF in four of the five patients in which it was measured. This suggests that the transplant BBB might be partially patent to small molecules for at least 6 months after the surgery. Whether increased passage of carbidopa into CSF and perhaps the transplant is of clinical significance has yet to be determined. Median CSF levodopa did not increase after surgery, probably because a limited defect in the BBB would be likely to be overshadowed by the effects of facilitated transport. CT scans performed

  7. Cr(VI)-contaminated groundwater remediation with simulated permeable reactive barrier (PRB) filled with natural pyrite as reactive material: Environmental factors and effectiveness.


    Liu, Yuanyuan; Mou, Haiyan; Chen, Liqun; Mirza, Zakaria A; Liu, Li


    Permeable reactive barriers (PRBs) are efficient technologies for in situ remediation of contaminated groundwater, the effectiveness of which greatly depends on the reactive media filled. Natural pyrite is an iron sulfide material with a very low content of iron and sulfur, and a mining waste which is a potential material for Cr(VI) immobilization. In this study, we conducted a series of batch tests to research the effects of typical environmental factors on Cr(VI) removal and also simulated PRB filled with natural pyrite to investigate its effectiveness, in order to find a both environmentally and economically fine method for groundwater remediation. Batch tests showed that pH had the significant impact on Cr(VI) removal with an apparently higher efficiency under acidic conditions, and dissolved oxygen (DO) would inhibit Cr(VI) reduction; a relatively high initial Cr(VI) concentration would decrease the rate of Cr(VI) sorption; ionic strength and natural organic matter resulted in no significant effects on Cr(VI) removal. Column tests demonstrated that the simulated PRB with natural pyrite as the reactive media was considerably effective for removing Cr(VI) from groundwater, with a sorption capability of 0.6222 mg Cr per gram of natural pyrite at an initial Cr(VI) concentration of 10mg/L at pH 5.5 in an anoxic environment.

  8. Blood-brain barrier permeability and nerve cell damage in rat brain 14 and 28 days after exposure to microwaves from GSM mobile phones.


    Eberhardt, Jacob L; Persson, Bertil R R; Brun, Arne E; Salford, Leif G; Malmgren, Lars O G


    We investigated the effects of global system for mobile communication (GSM) microwave exposure on the permeability of the blood-brain barrier and signs of neuronal damage in rats using a real GSM programmable mobile phone in the 900 MHz band. Ninety-six non-anaesthetized rats were either exposed to microwaves or sham exposed in TEM-cells for 2 h at specific absorption rates of average whole-body Specific Absorption Rates (SAR) of 0.12, 1.2, 12, or 120 mW/kg. The rats were sacrificed after a recovery time of either 14 or 28 d, following exposure and the extravazation of albumin, its uptake into neurons, and occurrence of damaged neurons was assessed. Albumin extravazation and also its uptake into neurons was seen to be enhanced after 14 d (Kruskal Wallis test: p = 0.02 and 0.002, respectively), but not after a 28 d recovery period. The occurrence of dark neurons in the rat brains, on the other hand, was enhanced later, after 28 d (p = 0.02). Furthermore, in the 28-d brain samples, neuronal albumin uptake was significantly correlated to occurrence of damaged neurons (Spearman r = 0.41; p < 0.01).

  9. Microbially mediated clinoptilolite regeneration in a multifunctional permeable reactive barrier used to remove ammonium from landfill leachate contamination: laboratory column evaluation.


    Nooten, Thomas Van; Diels, Ludo; Bastiaens, Leen


    This study focuses on multifunctional permeable reactive barrier (multibarrier) technology, combining microbial degradation and abiotic ion exchange processes for removal of ammonium from landfill leachate contamination. The sequential multibarrier concept relies on the use of a clinoptilolite-filled buffer compartment to ensure a robust ammonium removal in case of temporary insufficient microbial activities. An innovative strategy was developed to allow in situ clinoptilolite regeneration. Laboratory-scale clinoptilolite-filled columns were first saturated with ammonium, using real landfill leachate as well as synthetic leachates as feed media. Other inorganic metal cations, typically present in landfill leachate, had a detrimental influence on the ammonium removal capacity by competing for clinoptilolite exchange sites. On the other hand, the metals had a highly favorable impact on regeneration of the saturated material. Feeding the columns with leachate deprived from ammonium (e.g., by microbial nitrification in an upgradient compartment), resulted in a complete release of the previously sorbed ammonium from the clinoptilolite, due to exchange with metal cations present in the leachate. The released ammonium is then available for microbial consumption in a downgradient compartment. The regeneration process resulted in a slightly increased ammonium exchange capacity afterward. The described strategy throws a new light on sustainable use of sorption materials for in situ groundwater remediation, by avoiding the need for material replacement and the use of external chemical regenerants.

  10. Removal of ammonium-nitrogen from groundwater using a fully passive permeable reactive barrier with oxygen-releasing compound and clinoptilolite.


    Huang, Guoxin; Liu, Fei; Yang, Yingzhao; Deng, Wei; Li, Shengpin; Huang, Yuanying; Kong, Xiangke


    A novel fully passive permeable reactive barrier (PRB) with oxygen-releasing compound (ORC) and clinoptilolite was proposed for the removal of ammonium-nitrogen from groundwater. The PRB involves a combination of oxygen release, biological nitrification, ion exchange, and bioregeneration. A pilot-scale performance comparison experiment was carried out employing three parallel columns to assess the proposed PRB. The results showed that the PRB achieved nearly complete [Formula: see text] depletion (>99%). [Formula: see text] of 5.23-10.88 mg/L was removed, and [Formula: see text] of <1.93 mg/L and [Formula: see text] of 2.03-19.67 mg/L were generated. Ion exchange and biological nitrification both contributed to [Formula: see text] removal, and the latter played a dominant role under the condition of sufficient oxygen. Biological nitrification favored a delay in sorption saturation and a release of exchange sites. The ORC could sufficiently, efficiently supply oxygen for approximately 120 pore volumes. The clinoptilolite ensured a robust [Formula: see text] removal in case of temporary insufficient biological activities. No external alkalinity sources had to be supplied and no inhibition of aerobic metabolism occurred. The ceramicite had a negligible effect on the biomass growth. Based on the research findings, a full-scale continuous wall PRB was installed in Shenyang, China in 2012.

  11. Age-dependent increase of blood-brain barrier permeability and neuron-binding autoantibodies in S100B knockout mice.


    Wu, Hao; Brown, Eric V; Acharya, Nimish K; Appelt, Denah M; Marks, Alexander; Nagele, Robert G; Venkataraman, Venkat


    S100B is a calcium-sensor protein that impacts multiple signal transduction pathways. It is widely considered to be an important biomarker for several neuronal diseases as well as blood-brain barrier (BBB) breakdown. In this report, we demonstrate a BBB deficiency in mice that lack S100B through detection of leaked Immunoglobulin G (IgG) in the brain parenchyma. IgG leaks and IgG-binding to selected neurons were observed in S100B knockout (S100BKO) mice at 6 months of age but not at 3 months. By 9 months, IgG leaks persisted and the density of IgG-bound neurons increased significantly. These results reveal a chronic increase in BBB permeability upon aging in S100BKO mice for the first time. Moreover, coincident with the increase in IgG-bound neurons, autoantibodies targeting brain proteins were detected in the serum via western blots. These events were concurrent with compromise of neurons, increase of activated microglia and lack of astrocytic activation as evidenced by decreased expression of microtubule-associated protein type 2 (MAP2), elevated number of CD68 positive cells and unaltered expression of glial fibrillary acidic protein (GFAP) respectively. Results suggest a key role for S100B in maintaining BBB functional integrity and, further, propose the S100BKO mouse as a valuable model system to explore the link between chronic functional compromise of the BBB, generation of brain-reactive autoantibodies and neuronal dysfunctions.

  12. Α-aryl-N-alkyl nitrones, as potential agents for stroke treatment: synthesis, theoretical calculations, antioxidant, anti-inflammatory, neuroprotective, and brain-blood barrier permeability properties.


    Chioua, Mourad; Sucunza, David; Soriano, Elena; Hadjipavlou-Litina, Dimitra; Alcázar, Alberto; Ayuso, Irene; Oset-Gasque, María Jesús; González, María Pilar; Monjas, Leticia; Rodríguez-Franco, María Isabel; Marco-Contelles, José; Samadi, Abdelouahid


    We report the synthesis, theoretical calculations, the antioxidant, anti-inflammatory, and neuroprotective properties, and the ability to cross the blood-brain barrier (BBB) of (Z)-α-aryl and heteroaryl-N-alkyl nitrones as potential agents for stroke treatment. The majority of nitrones compete with DMSO for hydroxyl radicals, and most of them are potent lipoxygenase inhibitors. Cell viability-related (MTT assay) studies clearly showed that nitrones 1-3 and 10 give rise to significant neuroprotection. When compounds 1-11 were tested for necrotic cell death (LDH release test) nitrones 1-3, 6, 7, and 9 proved to be neuroprotective agents. In vitro evaluation of the BBB penetration of selected nitrones 1, 2, 10, and 11 using the PAMPA-BBB assay showed that all of them cross the BBB. Permeable quinoline nitrones 2 and 3 show potent combined antioxidant and neuroprotective properties and, therefore, can be considered as new lead compounds for further development in specific tests for potential stroke treatment.

  13. Blood-brain barrier permeability of gefitinib in patients with brain metastases from non-small-cell lung cancer before and during whole brain radiation therapy

    PubMed Central

    Zhang, Li; Wei, Wei-dong; Liang, Jian-zhong; Xu, Fei; Dinglin, Xiao-xiao; Ma, Shu-xiang; Chen, Li-kun


    Introduction To explore the ability of gefitinib to penetrate blood brain barrier (BBB) during whole brain radiation therapy (WBRT). Patients and Methods Enrolled in this study were eligible patients who were diagnosed with BM from NSCLC. Gefitinib was given at 250 mg/day for 30 days, then concurrently with WBRT (40 Gy/20 F/4 w), followed by maintenance. Serial CSF and blood samples were collected on 30 day after gefitinib administration, and at the time of 10, 20, 30 and 40 Gy following WBRT. CSF and plasma samples of 13 patients without BM who were treated with gefitinib were collected as control. CSF and plasma gefitinib levels were measured by LC-MS/MS. Results Fifteen BM patients completed gefitinib plus WBRT. The CSF-to-plasma ratio of gefitinib in patients with BM was higher than that in patients without BM (1.34% vs. 0.36%, P < 0.001). The CSF-to-plasma ratio of gefitinib increased with the increased dose of WBRT and reached the peak (1.87 ± 0.72%) at 30 Gy, which was significantly higher than that 1.34 ± 0.49% at 0 Gy (P = 0.01). The median time to progression of brain lesions and the median overall survival were 7.07 and 15.4 months, respectively. Conclusion The BBB permeability of gefitinib increased in accordance with escalated dose of WBRT. PMID:25788260

  14. Probable involvement of serotonin in the increased permeability of the blood-brain barrier by forced swimming. An experimental study using Evans blue and 131I-sodium tracers in the rat.


    Sharma, H S; Westman, J; Navarro, J C; Dey, P K; Nyberg, F


    The possibility that endogenous serotonin (5-hydroxytryptamine, 5-HT) participates in alteration of the blood-brain barrier (BBB) following short-term forced swimming (FS) exercise was examined in a rat model. Subjection of conscious young (age 8-9 weeks, 80-90 g) animals to continuous FS (at a water temperature of 30 +/- 1 degrees C) for 30 min, increased the permeability of the BBB to Evans blue albumin (EBA) and 131I-sodium in six and nine brain regions, respectively. The EBA staining was noted in posterior cingulate cortex, parietal, occipital cortices, cerebellar vermis, medial lateral cerebellar cortices and dorsal surface of hippocampus. In addition to these brain regions, the BBB permeability to 131I-sodium was further extended to caudate nucleus, thalamus and hypothalamus. This effect of FS on the BBB permeability was absent in adult (age 24-30 weeks, 300-400 g) animals. Measurement of 5-HT showed a profound increase of plasma and brain in young rats by 180% and 250%, respectively, from the control group. Adult animals showed only a minor increase in brain and plasma 5-HT levels. In young animals, pretreatment with p-CPA (a 5-HT synthesis inhibitor) and indomethacin (a prostaglandin synthesis inhibitor) prevented the FS induced increase in BBB permeability and 5-HT levels. Destruction of serotonergic neurons with 5,7-dihydroxytryptamine (5,7-DHT) reduced the breakdown of the BBB and attenuated the brain 5-HT level without affecting the plasma 5-HT. Cyproheptadine, ketanserin (5-HT2 receptor antagonists) and vinblastine (a vesicular transport inhibitor) prevented the increased permeability of the BBB alone. The plasma and brain 5-HT continued to remain high. These observations suggest that (i) 5-HT plays an important role in the breakdown of BBB permeability in FS, (ii) this effect of 5-HT on BBB permeability is mediated by 5-HT2 receptors, and (iii) FS induced increase in BBB permeability is age dependent.

  15. Remediation of the Highland Drive South Ravine, Port Hope, Ontario: Contaminated Groundwater Discharge Management Using Permeable Reactive Barriers and Contaminated Sediment Removal - 13447

    SciTech Connect

    Smyth, David; Roos, Gillian; Ferguson Jones, Andrea; Case, Glenn; Yule, Adam


    The Highland Drive South Ravine (HDSR) is the discharge area for groundwater originating from the Highland Drive Landfill, the Pine Street North Extension (PSNE) roadbed parts of the Highland Drive roadbed and the PSNE Consolidation Site that contain historical low-level radioactive waste (LLRW). The contaminant plume from these LLRW sites contains elevated concentrations of uranium and arsenic and discharges with groundwater to shallow soils in a wet discharge area within the ravine, and directly to Hunt's Pond and Highland Drive South Creek, which are immediately to the south of the wet discharge area. Remediation and environmental management plans for HDSR have been developed within the framework of the Port Hope Project and the Port Hope Area Initiative. The LLRW sites will be fully remediated by excavation and relocation to a new Long-Term Waste Management Facility (LTWMF) as part of the Port Hope Project. It is projected, however, that the groundwater contaminant plume between the remediated LLRW sites and HDSR will persist for several hundreds of years. At the HDSR, sediment remediation within Hunt's Ponds and Highland Drive South Creek, excavation of the existing and placement of clean fill will be undertaken to remove current accumulations of solid-phase uranium and arsenic associated with the upper 0.75 m of soil in the wet discharge area, and permeable reactive barriers (PRBs) will be used for in situ treatment of contaminated groundwater to prevent the ongoing discharge of uranium and arsenic to the area in HDSR where shallow soil excavation and replacement has been undertaken. Bench-scale testing using groundwater from HDSR has confirmed excellent treatment characteristics for both uranium and arsenic using permeable reactive mixtures containing granular zero-valent iron (ZVI). A sequence of three PRBs containing ZVI and sand in backfilled trenches has been designed to intercept the groundwater flow system prior to its discharge to the ground surface

  16. Involvement of cytoskeletal proteins in the barrier function of the human erythrocyte membrane. III. Permeability of spectrin-depleted inside-out membrane vesicles to hydrophilic nonelectrolytes. Formation of leaks by chemical or enzymatic modification of membrane proteins.


    Klonk, S; Deuticke, B


    Spectrin-depleted inside-out vesicles (IOV's) prepared from human erythrocyte membranes were characterized in terms of size, ground permeability to hydrophilic nonelectrolytes and their sensitivity to modification by SH reagents, DIDS and trypsin. IOV's proved to have the same permeability of their lipid domain to erythritol as native erythrocytes, in contrast to resealed ghosts (Klonk, S. and Deuticke, B. (1992) Biochim. Biophys. Acta 1106, 126-136 (Part I in this series)), which have a residual leak. On the other hand, IOV's have a slightly elevated permeability for mannitol and sucrose, nonelectrolytes which are almost (mannitol) or fully (sucrose) impermeant in the native membrane. These increased fluxes, which have a high activation energy and can be stimulated by phloretin, are, however, also much smaller than the corresponding leak fluxes observed in resealed ghosts. In view of these differences, formation of IOV's can be concluded to go along with partial annealing of barrier defects persisting in the erythrocyte membrane after preparation of resealed ghosts. Oxidation of SH groups of the IOV membrane by diamide produces an enhancement of permeability for hydrophilic nonelectrolytes which is much less pronounced than that induced by a similar treatment of erythrocytes or ghosts (Klonk, S. and Deuticke, B. (1992) Biochim. Biophys. Acta 1106, 126-136 (Part I in this series)). Moreover, proteolytic treatment of the vesicle membrane, although leading to a marked digestion of integral membrane proteins, only induces a minor, saturating increase of permeability, much lower than that in trypsinized resealed ghosts (Klonk, S. and Deuticke, B. (1992) Biochim. Biophys. Acta 1106, 137-142 (Part II of this series)). Since absence of the cytoskeletal proteins, spectrin and actin, is the major difference between IOV's and resealed ghosts, these results may be taken as further evidence for a dependence of the barrier properties of the erythrocyte membrane bilayer domain

  17. Effect of Ca2+ on programmed death of guard and epidermal cells of pea leaves.


    Kiselevsky, D B; Kuznetsova, Yu E; Vasil'ev, L A; Lobysheva, N V; Zinovkin, R A; Nesov, A V; Shestak, A A; Samuilov, V D


    The effect of Ca2+ on programmed death of guard cells (GC) and epidermal cells (EC) determined from destruction of the cell nucleus was investigated in epidermis of pea leaves. Ca2+ at concentrations of 1-100 microM increased and at a concentration of 1 mM prevented the CN(-)-induced destruction of the nucleus in GC, disrupting the permeability barrier of GC plasma membrane for propidium iodide (PI). Ca2+ at concentrations of 0.1-1 mM enhanced drastically the number of EC nuclei stained by PI in epidermis treated with chitosan, an inducer of programmed cell death. The internucleosomal DNA fragmentation caused by CN(-) was suppressed by 2 mM Ca2+ on 6 h incubation, but fragmentation was stimulated on more prolonged treatment (16 h). Presumably, the disruption of the permeability barrier of plasma membrane for PI is not a sign of necrosis in plant cells. Quinacrine and diphenylene iodonium at 50 microM concentration prevented GC death induced by CN(-) or CN(-) + 0.1 mM Ca2+ but had no influence on respiration and photosynthetic O2 evolution in pea leaf slices. The generation of reactive oxygen species determined from 2',7'-dichlorofluorescein fluorescence was promoted by Ca2+ in epidermal peels from pea leaves.

  18. The integration of physiologically-targeted skin care in the management of atopic dermatitis: focus on the use of a cleanser and moisturizer system incorporating a ceramide precursor, filaggrin degradation products, and specific "skin-barrier-friendly" excipients.


    Del Rosso, James Q; Kircik, Leon H


    Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.

  19. Differentiation of epidermal keratinocytes is dependent on glucosylceramide:ceramide processing.


    Amen, Nicole; Mathow, Daniel; Rabionet, Mariona; Sandhoff, Roger; Langbein, Lutz; Gretz, Norbert; Jäckel, Carsten; Gröne, Hermann-Josef; Jennemann, Richard


    Skin barrier function is primarily assigned to the outer epidermal layer, the stratum corneum (SC), mainly composed of corneocytes and lipid-enriched extracellular matrix. Epidermal ceramides (Cers) are essential barrier lipids, containing ultra-long-chain (ULC) fatty acids (FAs) with a unique ω-hydroxy group, which is necessary for binding to corneocyte proteins. In the SC, Cers are believed to derive from glucosylated intermediates, namely glucosylceramides (GlcCers), as surmised from human Gaucher's disease and related mouse models. Tamoxifen (TAM)-induced deletion of the endogenous GlcCer-synthesizing enzyme UDP-glucose:ceramide glucosyltransferase (UGCG) in keratin K14-positive cells resulted in epidermal GlcCer depletion. Although free extractable Cers were elevated in total epidermis and as well in SC, protein-bound Cers decreased significantly in Ugcg(f/fK14CreERT2) mice, indicating glucosylation to be required for regular Cer processing as well as arrangement and extrusion of lipid lamellae. The almost complete loss of protein-bound Cers led to a disruption of the water permeability barrier (WPB). UGCG-deficient