Science.gov

Sample records for epileptic human hippocampus

  1. Histopathology and reorganization of chandelier cells in the human epileptic sclerotic hippocampus.

    PubMed

    Arellano, J I; Muñoz, A; Ballesteros-Yáñez, I; Sola, R G; DeFelipe, J

    2004-01-01

    Impairment of GABA-mediated inhibition is one of the main hypotheses invoked to explain seizure activity, both in experimental models and in human epilepsy. We have studied the distribution and the neurochemical characteristics of certain GABAergic circuits in the normal and epileptic human sclerotic hippocampal formation. We have focused our attention mainly on chandelier cells because, together with basket cells, they are considered to have powerful effects on spike generation. Chandelier cells represent a unique type of interneuron whose axon terminals (Ch-terminals) form synapses with the axon initial segments of cortical pyramidal cells and granular cells of the dentate gyrus. Different neurochemical subpopulations of chandelier cells have been identified by immunocytochemistry, mainly in the neocortex. Markers for Ch-terminals include the GABA transporter 1 (GAT-1), the polysialylated form of the cell-surface glycoprotein neural cell adhesion molecule (PSA-NCAM) and the calcium-binding proteins parvalbumin (PV) and calbindin D-28k (CB). In the normal hippocampal formation, GAT-1- and PV-immunoreactive (-ir) Ch-terminals were identified in the granular and polymorphic layers of the dentate gyrus, in the strata pyramidale and oriens of the CA fields, and in the pyramidal layer of the subicular complex. In addition, and in contrast to the hippocampus and dentate gyrus, subsets of Ch-terminals in the upper pyramidal layer of the normal subiculum express CB and PSA-NCAM. The sclerotic hippocampus of epileptic patients presented an impressive morphological and neurochemical reorganization of Ch-terminals and basket formations. This was apparent in the dentate gyrus and hippocampal formation, but not in the subiculum, which appeared to remain unaltered. Principally, numerous and more complex PV- and CB-ir Ch-terminals, as well as dense PV-ir basket formations, appeared in some hippocampal segments, whereas in other regions there was a lack of labelled elements

  2. Differential Effect of Neuropeptides on Excitatory Synaptic Transmission in Human Epileptic Hippocampus.

    PubMed

    Ledri, Marco; Sørensen, Andreas T; Madsen, Marita G; Christiansen, Søren H; Ledri, Litsa Nikitidou; Cifra, Alessandra; Bengzon, Johan; Lindberg, Eva; Pinborg, Lars H; Jespersen, Bo; Gøtzsche, Casper R; Woldbye, David P D; Andersson, My; Kokaia, Merab

    2015-07-01

    Development of novel disease-modifying treatment strategies for neurological disorders, which at present have no cure, represents a major challenge for today's neurology. Translation of findings from animal models to humans represents an unresolved gap in most of the preclinical studies. Gene therapy is an evolving innovative approach that may prove useful for clinical applications. In animal models of temporal lobe epilepsy (TLE), gene therapy treatments based on viral vectors encoding NPY or galanin have been shown to effectively suppress seizures. However, how this translates to human TLE remains unknown. A unique possibility to validate these animal studies is provided by a surgical therapeutic approach, whereby resected epileptic tissue from temporal lobes of pharmacoresistant patients are available for neurophysiological studies in vitro. To test whether NPY and galanin have antiepileptic actions in human epileptic tissue as well, we applied these neuropeptides directly to human hippocampal slices in vitro. NPY strongly decreased stimulation-induced EPSPs in dentate gyrus and CA1 (up to 30 and 55%, respectively) via Y2 receptors, while galanin had no significant effect. Receptor autoradiographic binding revealed the presence of both NPY and galanin receptors, while functional receptor binding was only detected for NPY, suggesting that galanin receptor signaling may be impaired. These results underline the importance of validating findings from animal studies in human brain tissue, and advocate for NPY as a more appropriate candidate than galanin for future gene therapy trials in pharmacoresistant TLE patients.

  3. [Cell signaling in the epileptic hippocampus].

    PubMed

    Ferrer, I

    Cell signaling commanding death or survival in human epileptic hippocampus is difficult to trace because of the long interval between the beginning of symptoms and the sampling of damaged cerebral tissue for neuropathological examination. Intraperitoneal injection of the glutamate analogue kainic acid (KA) is a useful tool to analyze the effects of seizures and the excitotoxic damage in the rodent hippocampus. KA acts on NMDA and KA receptors, whereas it has little impact on AMPA receptors. Neurons of the hilus and CA3 neurons are primary targets of KA, although parvalbumin containing GABAergic neurons are less vulnerable than glutamatergic neurons. Immediate responses to KA are hsp 70 mRNA induction and HSP 70/72 protein expression, as well as c fos and c jun mRNA, and c Fos and c Jun protein expression in the hippocampus. Yet increased c Fos and c Jun expression is not a predictor of cell death or cell survival. In contrast, the tissular plasminogen activator (tPA) and the membrane Fas/Fas L signaling pathway probably have a role in facilitating cell death following KA injection. The involvement of other pathways remains controversial. Increased expression of the pro apoptotic Bax together with decreased Bcl 2 suggests Bax mediated apoptosis. Activation of the mitochondrial pathway includes leakage of citochrome c to the cytosol and activation of the caspase cascade leading to apoptosis. However, other studies have emphasized the limited expression of caspase 3, the main executioner of apoptosis, and the relevance of necrosis as the main form of cell death following KA excitotoxicity. Phosphorylation dependent activation of several kinases, including MAPK, p 38 and JNK/SAPK, and their substrates has been found in KA treated animals. Decreased CREBp expression is associated with cell death whereas increased ATF 2P and Elk 1P are associated with cell survival. Trophic factors probably do not play a significant role during the early stages of hippocanmpal damage but

  4. A Stereological Study of Synapse Number in the Epileptic Human Hippocampus

    PubMed Central

    Alonso-Nanclares, Lidia; Kastanauskaite, Asta; Rodriguez, Jose-Rodrigo; Gonzalez-Soriano, Juncal; DeFelipe, Javier

    2011-01-01

    Hippocampal sclerosis is the most frequent pathology encountered in resected mesial temporal structures from patients with intractable temporal lobe epilepsy (TLE). Here, we have used stereological methods to compare the overall density of synapses and neurons between non-sclerotic and sclerotic hippocampal tissue obtained by surgical resection from patients with TLE. Specifically, we examined the possible changes in the subiculum and CA1, regions that seem to be critical for the development and/or maintenance of seizures in these patients. We found a remarkable decrease in synaptic and neuronal density in the sclerotic CA1, and while the subiculum from the sclerotic hippocampus did not display changes in synaptic density, the neuronal density was higher. Since the subiculum from the sclerotic hippocampus displays a significant increase in neuronal density, as well as a various other neurochemical changes, we propose that the apparently normal subiculum from the sclerotic hippocampus suffers profound alterations in neuronal circuits at both the molecular and synaptic level that are likely to be critical for the development or maintenance of seizure activity. PMID:21390290

  5. Increased phase synchronization of spontaneous calcium oscillations in epileptic human versus normal rat astrocyte cultures

    NASA Astrophysics Data System (ADS)

    Balázsi, Gábor; Cornell-Bell, Ann H.; Moss, Frank

    2003-06-01

    Stochastic synchronization analysis is applied to intracellular calcium oscillations in astrocyte cultures prepared from epileptic human temporal lobe. The same methods are applied to astrocyte cultures prepared from normal rat hippocampus. Our results indicate that phase-repulsive coupling in epileptic human astrocyte cultures is stronger, leading to an increased synchronization in epileptic human compared to normal rat astrocyte cultures.

  6. K(+)-evoked [(3)H]-norepinephrine release in human brain slices from epileptic and non-epileptic patients is differentially modulated by gabapentin and pinacidil.

    PubMed

    Freiman, Thomas M; Surges, Rainer; Kukolja, Juraj; Heinemeyer, Jan; Klar, Maximilian; van Velthoven, Vera; Zentner, Josef

    2006-06-01

    The modulation of K(+)-evoked [(3)H]-norepinephrine ([(3)H]-NE) release by gabapentin (GBP) and pinacidil (PIN), a known K(ATP) agonist, was examined in human brain slices. We compared the pharmacological effects on NE-release in human epileptic neocortex and epileptic hippocampus to non-epileptic neocortex. GBP (100 microM) decreased [(3)H]-NE release by 22% in non-epileptic neocortical slices, whereas this inhibition was absent in slices from epileptic hippocampus and epileptic neocortex. PIN (10 microM) also reduced [(3)H]-NE release by 30% in non-epileptic neocortical slices and only by 5% in epileptic hippocampal slices. The blockade of voltage-gated calcium channels by omega-conotoxins MVIIA and MVIIC (0.1 microM) reduced [(3)H]-NE release in epileptic and non-epileptic neocortical slices to the same extend. The data show a marked reduction in K(+)-evoked [(3)H]-NE release by GBP and PIN in epileptic hippocampus and neocortex, suggesting an alteration of K(ATP) channel function, whereas the effects of the calcium channel modulators omega-conotoxins MVIIA and MVIIC are similar in both epileptic and non-epileptic neocortex.

  7. Doublecortin expression in the normal and epileptic adult human brain.

    PubMed

    Liu, Y W J; Curtis, M A; Gibbons, H M; Mee, E W; Bergin, P S; Teoh, H H; Connor, B; Dragunow, M; Faull, R L M

    2008-12-01

    Mesial temporal lobe epilepsy (MTLE) is a neurological disorder associated with spontaneous recurrent complex partial seizures and hippocampal sclerosis. Although increased hippocampal neurogenesis has been reported in animal models of MTLE, increased neurogenesis has not been reported in the hippocampus of adult human MTLE cases. Here we showed that cells expressing doublecortin (Dcx), a microtubule-associated protein expressed in migrating neuroblasts, were present in the hippocampus and temporal cortex of the normal and MTLE adult human brain. In particular, increased numbers of Dcx-positive cells were observed in the epileptic compared with the normal temporal cortex. Importantly, 56% of Dcx-expressing cells in the epileptic temporal cortex coexpressed both the proliferative cell marker, proliferating cell nuclear antigen and early neuronal marker, TuJ1, suggesting that they may be newly generated neurons. A subpopulation of Dcx-positive cells in the epileptic temporal cortex also coexpressed the mature neuronal marker, NeuN, suggesting that epilepsy may promote the generation of new neurons in the temporal cortex. This study has identified, for the first time, a novel population of Dcx-positive cells in the adult human temporal cortex that can be upregulated by epilepsy and thus, raises the possibility that these cells may have functional significance in the pathophysiology of epilepsy.

  8. Upregulation of 5-HT2C receptors in hippocampus of pilocarpine-induced epileptic rats: antagonism by Bacopa monnieri.

    PubMed

    Krishnakumar, Amee; Nandhu, M S; Paulose, C S

    2009-10-01

    Emotional disturbances, depressive mood, anxiety, aggressive behavior, and memory impairment are the common psychiatric features associated with temporal lobe epilepsy (TLE). The present study was carried out to investigate the role of Bacopa monnieri extract in hippocampus of pilocarpine-induced temporal lobe epileptic rats through the 5-HT(2C) receptor in relation to depression. Our results showed upregulation of 5-HT(2C) receptors with a decreased affinity in hippocampus of pilocarpine-induced epileptic rats. Also, there was an increase in 5-HT(2C) gene expression and inositol triphosphate content in epileptic hippocampus. Carbamazepine and B. monnieri treatments reversed the alterations in 5-HT(2C) receptor binding, gene expression, and inositol triphosphate content in treated epileptic rats as compared to untreated epileptic rats. The forced swim test confirmed the depressive behavior pattern during epilepsy that was nearly completely reversed by B. monnieri treatment.

  9. Behavioral deficit and decreased GABA receptor functional regulation in the hippocampus of epileptic rats: effect of Bacopa monnieri.

    PubMed

    Mathew, Jobin; Gangadharan, Gireesh; Kuruvilla, Korah P; Paulose, C S

    2011-01-01

    In the present study, alterations of the General GABA and GABA(A) receptors in the hippocampus of pilocarpine-induced temporal lobe epileptic rats and the therapeutic application of Bacopa monnieri and its active component Bacoside-A were investigated. Bacopa monnieri (Linn.) is a herbaceous plant belonging to the family Scrophulariaceae. Hippocampus is the major region of the brain belonging to the limbic system and plays an important role in epileptogenesis, memory and learning. Scatchard analysis of [³H]GABA and [³H]bicuculline in the hippocampus of the epileptic rat showed significant decrease in B(max) (P < 0.001) compared to control. Real Time PCR amplification of GABA(A) receptor sub-units such as GABA(Aά₁), GABA(Aά₅) GABA(Aδ), and GAD were down regulated (P < 0.001) in the hippocampus of the epileptic rats compared to control. GABA(Aγ) subunit was up regulated. Epileptic rats have deficit in the radial arm and Y maze performance. Bacopa monnieri and Bacoside-A treatment reverses all these changes near to control. Our results suggest that decreased GABA receptors in the hippocampus have an important role in epilepsy associated behavioral deficit, Bacopa monnieri and Bacoside-A have clinical significance in the management of epilepsy.

  10. Inhibiting cholesterol degradation induces neuronal sclerosis and epileptic activity in mouse hippocampus.

    PubMed

    Chali, Farah; Djelti, Fathia; Eugene, Emmanuel; Valderrama, Mario; Marquer, Catherine; Aubourg, Patrick; Duykaerts, Charles; Miles, Richard; Cartier, Nathalie; Navarro, Vincent

    2015-05-01

    Elevations in neuronal cholesterol have been associated with several degenerative diseases. An enhanced excitability and synchronous firing in surviving neurons are among the sequels of neuronal death in these diseases and also in some epileptic syndromes. Here, we attempted to increase neuronal cholesterol levels, using a short hairpin RNA to suppress expression of the enzyme cytochrome P450 family 46, subfamily A, polypeptide 1 gene (CYP46A1). This protein hydroxylates cholesterol and so facilitates transmembrane extrusion. A short hairpin RNA CYP46A1construction coupled to the adeno-associated virus type 5 was injected focally and unilaterally into mouse hippocampus. It was selectively expressed first in neurons of the cornu ammonis (hippocampus) (CA)3a region. Cytoplasmic and membrane cholesterol increased, and the neuronal soma volume increased and then decreased before pyramidal cells died. As CA3a pyramidal cells died, interictal electroencephalographic (EEG) events occurred during exploration and non-rapid eye movement sleep. With time, neuronal death spread to involve pyramidal cells and interneurons of the CA1 region. CA1 neuronal death was correlated with a delayed local expression of phosphorylated tau. Astrocytes were activated throughout the hippocampus and microglial activation was specific to regions of neuronal death. CA1 neuronal death was correlated with distinct aberrant EEG activity. During exploratory behaviour and rapid eye movement sleep, EEG oscillations at 7-10 Hz (theta) could accelerate to 14-21 Hz (beta) waves. They were accompanied by low-amplitude, high-frequency oscillations of peak power at ~300 Hz and a range of 250-350 Hz. Although episodes of EEG acceleration were not correlated with changes in exploratory behaviour, they were followed in some animals by structured seizure-like discharges. These data strengthen links between increased cholesterol, neuronal sclerosis and epileptic behaviour.

  11. [Electrical activities of bursting-firing neurons in epileptic network reestablishment of rat hippocampus].

    PubMed

    Wang, Wen-Ting; Qin, Xing-Kui; Yin, Shi-Jin; Han, Dan

    2003-12-25

    The purpose of our present work was to study the discharge of bursting-firing neurons (BFNs) in ipsilateral or contralateral hippocampus (HPC), and its relations to the reestablishment of local epileptic networks. The experiments were performed on 140 Sprague Dawley male rats (150-250 g). Acute tetanization (60 Hz, 2 s, 0.4 -0.6 mA) of the right posterior dorsal hippocampus (ATPDH) was administered to establish rat epilepsy model. The single unit discharges and the depth electrographs were simultaneously recorded from ipsilateral or contralateral HPC. In other experimental rats, acute tetanization of the right anterior dorsal HPC (ATADH) was used. Extracellular unit discharges in the CA1 region were simultaneously recorded from bilateral anterior dorsal hippocampi. Analysis of hippocampal BFN firing patterns before or after administration of the tetanization was focused on according to their location in the HPC epileptic networks in vivo. Single unit discharges of 138 hippocampal neurons were recorded from ipsilateral and/or contralateral anterior dorsal HPC. Of the 138 neurons recorded, 19 were BFNs. 13 BFNs were tetanus-evoked and the remaining 6 were spontaneous ones. The evoked reactions of the single hippocampal neuron induced by the tetanization mainly included: (1) the firing patterns of the BFNs in ipsilateral anterior dorsal HPC were obviously modulated by the ATPDH from tonic firing into rhythmic bursting. The bursting interspike intervals (BISI) decreased. (2) There were mild modulations of the firing patterns of the BFNs in contralateral anterior dorsal HPC following post-inhibition of the firing rate of single neuron induced by the ATPDH. The interspike intervals (ISI) increased obviously. (3) Post-facilitation of rhythmic bursting-firing of the BFNs in contralateral anterior dorsal HPC was induced by ATADH; both the ISI and the IBI increased. (4) Synchronous or asynchronous rhythmic bursting-firing of the BFNs and the network epileptiform events

  12. Hippocampus and epilepsy: findings from human tissues

    PubMed Central

    Huberfeld, Gilles; Blauwblomme, Thomas; Miles, Richard

    2015-01-01

    Surgical removal of the epileptogenic zone provides an effective therapy for several epileptic syndromes. This surgery offers the opportunity to study pathological activity in living human tissue for pharmacoresistant partial epilepsy syndromes including (1) temporal lobe epilepsies with hippocampal sclerosis, (2) cortical dysplasias, (3) epilepsies associated with tumors and (4) developmental malformations. Slices of tissue from patient with these syndromes retain functional neuronal networks and may generate epileptic activities. The properties of cells in this tissue may not be greatly changed, but excitatory synaptic transmission is often enhanced and GABAergic inhibition is preserved. Typically epileptic activity is not generated spontaneously by the neocortex, whether dysplastic or not, but can be induced by convulsants. The initiation of ictal discharges in neocortex depends on both GABAergic signaling and increased extracellular potassium. In contrast, a spontaneous interictal-like activity is generated by tissues from patients with temporal lobe epilepsies associated with hippocampal sclerosis. This activity is initiated, not in the hippocampus but in the subiculum an output region which projects to the entorhinal cortex. Interictal events seem to be triggered by GABAergic cells which paradoxically excite about 20% of subicular pyramidal cells while simultaneously inhibiting the majority. Interictal discharges thus depend on both GABAergic and glutamatergic signaling. The depolarizing effects of GABA depend on a pathological elevation in levels of chloride in some subicular cells, similar to those of developmentally immature cells. Such defect is caused by a perturbed expression of the cotransporters regulating intracellular chloride concentration, the importer NKCC1 and the extruder KCC2. Blockade of NKCC1 actions by the diuretic bumetanide, restores intracellular chloride and thus hyperpolarizing GABAergic actions so suppressing interictal activity. PMID

  13. Frequency interactions in human epileptic brain.

    PubMed

    Cotic, Marija; Zalay, Osbert; Valiante, Taufik; Carlen, Peter L; Bardakjian, Berj L

    2011-01-01

    We have used two algorithms, wavelet phase coherence (WPC) and modulation index (MI) analysis to study frequency interactions in the human epileptic brain. Quantitative analyses were performed on intracranial electroencephalographic (iEEG) segments from three patients with neocortical epilepsy. Interelectrode coherence was measured using WPC and intraelectrode frequency interactions were analyzed using MI. WPC was performed on electrode pairings and the temporal evolution of phase couplings in the following frequency ranges: 1-4 Hz, 4-8 Hz, 8-13 Hz, 13-30 Hz and 30-100 Hz was studied. WPC was strongest in the 1-4 Hz frequency range during both seizure and non-seizure activities; however, WPC values varied minimally between electrode pairings. The 13-30 Hz band showed the lowest WPC values during seizure activity. MI analysis yielded two prominent patterns of frequency-specific activity, during seizure and non-seizure activities, which were present across all patients.

  14. Inhibiting cholesterol degradation induces neuronal sclerosis and epileptic activity in mouse hippocampus

    PubMed Central

    Chali, Farah; Djelti, Fathia; Eugene, Emmanuel; Valderrama, Mario; Marquer, Catherine; Aubourg, Patrick; Duykaerts, Charles; Miles, Richard; Cartier, Nathalie; Navarro, Vincent

    2015-01-01

    Elevations in neuronal cholesterol have been associated with several degenerative diseases. An enhanced excitability and synchronous firing in surviving neurons are among the sequels of neuronal death in these diseases and also in some epileptic syndromes. Here, we attempted to increase neuronal cholesterol levels, using a short hairpin RNA (shRNA) to suppress expression of the enzyme CYP46A1. This protein hydroxylates cholesterol and so facilitates trans-membrane extrusion. A sh-RNA CYP46A1construction coupled to an adeno-associated virus (AAV5) was injected focally and unilaterally into mouse hippocampus. It was selectively expressed first in neurons of the CA3a region. Cytoplasmic and membrane cholesterol increased, neuronal soma volume increased and then decreased before pyramidal cells died. As CA3a pyramidal cells died, inter-ictal EEG events occurred during exploration and non-REM sleep. With time, neuronal death spread to involve pyramidal cells and interneurons of the CA1 region. CA1 neuronal death was correlated with a delayed local expression of phosphorylated tau. Astrocytes were activated throughout the hippocampus and microglial activation was specific to regions of neuronal death. CA1 neuronal death was correlated with distinct aberrant EEG activity. During exploratory behaviour and rapid eye movement sleep, EEG oscillations at 7-10 Hz (theta) could accelerate to 14-21 Hz (beta) waves. They were accompanied by low amplitude, high-frequency oscillations of peak power at ~300Hz and a range of 250-350 Hz. While episodes of EEG acceleration were not correlated with changes in exploratory behaviour, they were followed in some animals by structured seizure-like discharges. These data strengthen links between increased cholesterol, neuronal sclerosis and epileptic behavior PMID:25847620

  15. Synchronization analysis of cultured epileptic human astrocytes

    NASA Astrophysics Data System (ADS)

    Balazsi, Gabor; Cornell-Bell, Ann; Neiman, Alexander; Moss, Frank

    2001-03-01

    Astrocyte cultures from severely epileptic patients were cultured, and the fluctuations of the intracellular calcium ion concentration were visualized using the fluorescent dye Fluo-3. The resulting image sequences were analyzed by methods of stochastic synchronization. Increased synchronization was observed in the epileptic tissues, when compared to normal tissues from rats. The more pathological the tissue, the more synchronized the calcium oscillations. The results might lead to a better understanding of intracellular calcium dynamics and could help drug development.

  16. Concepts of Connectivity and Human Epileptic Activity

    PubMed Central

    Lemieux, Louis; Daunizeau, Jean; Walker, Matthew C.

    2011-01-01

    This review attempts to place the concept of connectivity from increasingly sophisticated neuroimaging data analysis methodologies within the field of epilepsy research. We introduce the more principled connectivity terminology developed recently in neuroimaging and review some of the key concepts related to the characterization of propagation of epileptic activity using what may be called traditional correlation-based studies based on EEG. We then show how essentially similar methodologies, and more recently models addressing causality, have been used to characterize whole-brain and regional networks using functional MRI data. Following a discussion of our current understanding of the neuronal system aspects of the onset and propagation of epileptic discharges and seizures, we discuss the most advanced and ambitious framework to attempt to fully characterize epileptic networks based on neuroimaging data. PMID:21472027

  17. Aspartic acid aminotransferase activity is increased in actively spiking compared with non-spiking human epileptic cortex.

    PubMed Central

    Kish, S J; Dixon, L M; Sherwin, A L

    1988-01-01

    Increased concentration of the excitatory neurotransmitter aspartic acid in actively spiking human epileptic cerebral cortex was recently described. In order to further characterise changes in the aspartergic system in epileptic brain, the behaviour of aspartic acid aminotransferase (AAT), a key enzyme involved in aspartic acid metabolism has now been examined. Electrocorticography performed during surgery was employed to identify cortical epileptic spike foci in 16 patients undergoing temporal lobectomy for intractable seizures. Patients with spontaneously spiking lateral temporal cortex (n = 8) were compared with a non-spiking control group (n = 8) of patients in whom the epileptic lesions were confined to the hippocampus sparing the temporal convexity. Mean activity of AAT in spiking cortex was significantly elevated by 16-18%, with aspartic acid concentration increased by 28%. Possible explanations for the enhanced AAT activity include increased proliferation of cortical AAT-containing astrocytes at the spiking focus and/or a generalised increase in neuronal or extraneuronal metabolism consequent to the ongoing epileptic discharge. It is suggested that the data provide additional support for a disturbance of central excitatory aspartic acid mechanisms in human epileptic brain. PMID:2898010

  18. Mnemonic convergence in the human hippocampus

    PubMed Central

    Backus, Alexander R.; Bosch, Sander E.; Ekman, Matthias; Grabovetsky, Alejandro Vicente; Doeller, Christian F.

    2016-01-01

    The ability to form associations between a multitude of events is the hallmark of episodic memory. Computational models have espoused the importance of the hippocampus as convergence zone, binding different aspects of an episode into a coherent representation, by integrating information from multiple brain regions. However, evidence for this long-held hypothesis is limited, since previous work has largely focused on representational and network properties of the hippocampus in isolation. Here we identify the hippocampus as mnemonic convergence zone, using a combination of multivariate pattern and graph-theoretical network analyses of functional magnetic resonance imaging data from humans performing an associative memory task. We observe overlap of conjunctive coding and hub-like network attributes in the hippocampus. These results provide evidence for mnemonic convergence in the hippocampus, underlying the integration of distributed information into episodic memory representations. PMID:27325442

  19. Lipofuscin Granules in the Epileptic Human Temporal Neocortex with Age.

    PubMed

    Merlo, Suélen; Nakayama, Ana Beatriz S; Brusco, Janaina; Rossi, Marcos A; Carlotti, Carlos G; Moreira, Jorge E

    2015-01-01

    Lipofuscin granules (LGs), the "age pigments", are autofluorescent cell products from lysosomes that diverge in number and size among brain regions. Human temporal cortex from 20- to 55-year-old epileptic subjects were studied with the fat soluble dye Sudan Black, under confocal and electron microscopy. Ultrastructural analysis showed that with age LGs increase in area, but not in number. Proportionally to the LGs area, the electron lucid portion increases and the electron dense reduces over time. The robust increase in lipid components is possibly due to modifications in the neuronal metabolism with age in physiological and pathological conditions.

  20. Abnormal GABAA receptors from the human epileptic hippocampal subiculum microtransplanted to Xenopus oocytes

    PubMed Central

    Palma, Eleonora; Spinelli, Gabriele; Torchia, Gregorio; Martinez-Torres, A.; Ragozzino, Davide; Miledi, Ricardo; Eusebi, Fabrizio

    2005-01-01

    We studied the properties of GABAA receptors microtransplanted from the human temporal lobe epilepsy (TLE)-associated brain regions to Xenopus oocytes. Cell membranes, isolated from surgically resected brain specimens of drug-resistant TLE patients, were injected into frog oocytes, which rapidly incorporated human GABAA receptors, and any associated proteins, into their surface membrane. The receptors originating from different epileptic brain regions had a similar run-down but an affinity for GABA that was ≈60% lower for the subiculum receptors than for receptors issuing from the hippocampus proper or the temporal lobe neocortex. Moreover, GABA currents recorded in oocytes injected with membranes from the subiculum had a more depolarized reversal potential compared with the hippocampus proper or neocortex of the same patients. Quantitative RT-PCR analysis was performed of the GABAA receptor α1- to α5-, β1- to β3-, γ2- to γ3-, and δ-subunit mRNAs. The levels of expression of the α3-, α5-, and β1- to β3- subunit mRNAs are significantly higher, with the exception of γ2-subunit whose expression is lower, in subiculum compared with neocortex specimens. Our results suggest that an abnormal GABA-receptor subunit transcription in the TLE subiculum leads to the expression of GABAA receptors with a relatively low affinity. This abnormal behavior of the subiculum GABAA receptors may contribute to epileptogenesis. PMID:15695331

  1. Altered expression of adrenocorticotropic hormone in the epileptic gerbil hippocampus following spontaneous seizure.

    PubMed

    Oh, Yun-Jung; Kim, Heung-No; Jeong, Ji-Heon; Park, Dae-Kyoon; Park, Kyung-Ho; Ko, Jeong-Sik; Kim, Duk-Soo

    2013-02-01

    We investigated the temporal alterations of adrenocorticotropic hormone (ACTH) immunoreactivity in the hippocampus after seizure onset. Expression of ACTH was observed within interneurons in the pre-seizure group of seizure sensitive gerbils, whereas its immunoreactivities were rarely detected in seizure resistant gerbil. Three hr after the seizure, ACTH immunoreactivity was significantly increased in interneurons within all hippocampal regions. On the basis of their localization and morphology through immunofluorescence staining, these cells were identified as GABAA α1-containing interneurons. At the 12 hr postictal period, ACTH expression in these regions was down-regulated, in a similar manner to the pre-seizure group of gerbils. These findings support the increase in ACTH synthesis that contributes to a reduction of corticotrophin-releasing factor via the negative feedback system which in turn provides an opportunity to enhance the excitability of GABAergic interneurons. Therefore, ACTH may play an important role in the reduction of excitotoxicity in all hippocampal regions.

  2. Dynamic release of amino acid transmitters induced by valproate in PTZ-kindled epileptic rat hippocampus.

    PubMed

    Li, Zhi-Ping; Zhang, Xu-Ying; Lu, Xiang; Zhong, Ming-Kang; Ji, Yong-Hua

    2004-03-01

    In the present communication, the dynamic release of amino acid (AA) transmitters induced by valproate (VPA) in pentylenetetrazol (PTZ)-kindled freely moving rats hippocampus has been determined. The results showed that glutamate and aspartate release were significantly increased during the seizure/interical periods, and markedly decreased after the application of 200mg/kg valproate. In contrast, gamma-aminobutyric acid and taurine release were markedly decreased during interical period, and significantly increased during the seizure period. Glycine release was similar to the case of glutamate and aspartate release. The increase of either gamma-aminobutyric acid/taurine or glycine releases during the seizure period could be inhibited by the application of valproate likewise. The results indicate that: (a) the imbalance between excitatory and inhibitory neurotransmitters is really involved in epilepsy; (b) the modulation of valproate on the major amino acid neurotransmitters certainly plays one of important roles on antiepilepsy efficacy; (c) the pentylenetetrazol-kindled epileptogenesis model is a fit one for approaching the mechanisms of valproate modulating amino acid neurotransmitters.

  3. Chronic deficit in the expression of voltage-gated potassium channel Kv3.4 subunit in the hippocampus of pilocarpine-treated epileptic rats.

    PubMed

    Pacheco Otalora, Luis F; Skinner, Frank; Oliveira, Mauro S; Farrell, Bianca; Arshadmansab, Massoud F; Pandari, Tarun; Garcia, Ileana; Robles, Leslie; Rosas, Gerardo; Mello, Carlos F; Ermolinsky, Boris S; Garrido-Sanabria, Emilio R

    2011-01-12

    Voltage gated K(+) channels (Kv) are a highly diverse group of channels critical in determining neuronal excitability. Deficits of Kv channel subunit expression and function have been implicated in the pathogenesis of epilepsy. In this study, we investigate whether the expression of the specific subunit Kv3.4 is affected during epileptogenesis following pilocarpine-induced status epilepticus. For this purpose, we used immunohistochemistry, Western blotting assays and comparative analysis of gene expression using TaqMan-based probes and delta-delta cycle threshold (ΔΔCT) method of quantitative real-time polymerase chain reaction (qPCR) technique in samples obtained from age-matched control and epileptic rats. A marked down-regulation of Kv3.4 immunoreactivity was detected in the stratum lucidum and hilus of dentate gyrus in areas corresponding to the mossy fiber system of chronically epileptic rats. Correspondingly, a 20% reduction of Kv3.4 protein levels was detected in the hippocampus of chronic epileptic rats. Real-time quantitative PCR analysis of gene expression revealed that a significant 33% reduction of transcripts for Kv3.4 (gene Kcnc4) occurred after 1 month of pilocarpine-induced status epilepticus and persisted during the chronic phase of the model. These data indicate a reduced expression of Kv3.4 channels at protein and transcript levels in the epileptic hippocampus. Down-regulation of Kv3.4 in mossy fibers may contribute to enhanced presynaptic excitability leading to recurrent seizures in the pilocarpine model of temporal lobe epilepsy.

  4. Chronic deficit in the expression of voltage-gated potassium channel Kv3.4 subunit in the hippocampus of pilocarpine-treated epileptic rats

    PubMed Central

    Pacheco Otalora, Luis F.; Skinner, Frank; Oliveira, Mauro S.; Dotson, Bianca Farrel; Arshadmansab, Massoud F.; Pandari, Tarun; Garcia, Ileana; Robles, Leslie; Rosas, Gerardo; Mello, Carlos F.; Ermolinsky, Boris S.; Garrido-Sanabria, Emilio R.

    2010-01-01

    Voltage gated K+ channels (Kv) are a highly diverse group of channels critical in determining neuronal excitability. Deficits of Kv channel subunit expression and function have been implicated in the pathogenesis of epilepsy. In this study, we investigate whether the expression of the specific subunit Kv3.4 is affected during epileptogenesis following pilocarpine-induced status epilepticus. For this purpose, we used immunohistochemistry, Western blotting assays and comparative analysis of gene expression using TaqMan-based probes and delta-delta cycle threshold (Δ ΔCT) method of quantitative real-time polymerase chain reaction (qPCR) technique in samples obtained from age-matched control and epileptic rats. A marked down-regulation of Kv3.4 immunoreactivity was detected in the stratum lucidum and hilus of dentate gyrus in areas corresponding to the mossy fiber system of chronically epileptic rats. Correspondingly, a 20% reduction of Kv3.4 protein levels was detected in the hippocampus of chronic epileptic rats. Real-time quantitative PCR analysis of gene expression revealed that a significant 33% reduction of transcripts for Kv3.4 (gene Kcnc4) occurred after 1 month of pilocarpine-induced status epilepticus and persisted during the chronic phase of the model. These data indicate a reduced expression of Kv3.4 channels at protein and transcript levels in the epileptic hippocampus. Down-regulation of Kv3.4 in mossy fibers may contribute to enhanced presynaptic excitability leading to recurrent seizures in the pilocarpine model of temporal lobe epilepsy. PMID:20971086

  5. Memory, scene construction, and the human hippocampus.

    PubMed

    Kim, Soyun; Dede, Adam J O; Hopkins, Ramona O; Squire, Larry R

    2015-04-14

    We evaluated two different perspectives about the function of the human hippocampus--one that emphasizes the importance of memory and another that emphasizes the importance of spatial processing and scene construction. We gave tests of boundary extension, scene construction, and memory to patients with lesions limited to the hippocampus or large lesions of the medial temporal lobe. The patients were intact on all of the spatial tasks and impaired on all of the memory tasks. We discuss earlier studies that associated performance on these spatial tasks to hippocampal function. Our results demonstrate the importance of medial temporal lobe structures for memory and raise doubts about the idea that these structures have a prominent role in spatial cognition.

  6. Navigating the human hippocampus without a GPS.

    PubMed

    Zucker, Halle R; Ranganath, Charan

    2015-06-01

    The award of the Nobel Prize to Professors John O'Keefe, May-Britt Moser, and Edvard Moser brings global recognition to one of the most significant success stories in modern neuroscience. Here, we consider how their findings, along with related studies of spatial cognition in rodents, have informed our understanding of the human hippocampus. Rather than identifying a "GPS" in the brain, we emphasize that these researchers helped to establish a fundamental role for cortico-hippocampal networks in the guidance of behavior based on a representation of the current place, time, and situation. We conclude by highlighting the major questions that remain to be addressed in future research.

  7. Decreased glutamate receptor binding and NMDA R1 gene expression in hippocampus of pilocarpine-induced epileptic rats: neuroprotective role of Bacopa monnieri extract.

    PubMed

    Khan, Reas; Krishnakumar, Amee; Paulose, C S

    2008-01-01

    The potential for antiepileptic drugs to negatively impact cognitive abilities has generated renewed interest in herbal drugs and formulations in the treatment of epilepsy. Bacopa monnieri is one such widely used revitalizing herb that purportedly strengthens nervous function and also possesses memory-enhancing, antioxidative, antiepileptic, and anti-inflammatory properties. We investigated the neuroprotective role of B. monnieri extract in alteration of glutamate receptor binding and gene expression of NMDA R1 in hippocampus of temporal lobe epileptic rats. In association with pilocarpine-induced epilepsy, there was significant downregulation of NMDA R1 gene expression and glutamate receptor binding without any change in its affinity. B. monnieri treatment of epileptic rats significantly reversed the expression of NMDA R1 and glutamate receptor binding alterations to near-control levels. Also, in the epileptic rats, we measured a significant increase in the activity of glutamate dehydrogenase, which neared the control level after B. monnieri treatment. The therapeutic effect of B. monnieri was also observed in the Morris water maze experiment. These data together indicate the neuroprotective role of B. monnieri extract in glutamate-mediated excitotoxicity during seizures and cognitive damage occurring in association with pilocarpine-induced epilepsy.

  8. Detecting and localizing the foci in human epileptic seizures

    NASA Astrophysics Data System (ADS)

    Ben-Jacob, Eshel; Boccaletti, Stefano; Pomyalov, Anna; Procaccia, Itamar; Towle, Vernon L.

    2007-12-01

    We consider the electrical signals recorded from a subdural array of electrodes placed on the pial surface of the brain for chronic evaluation of epileptic patients before surgical resection. A simple and computationally fast method to analyze the interictal phase synchrony between such electrodes is introduced and developed with the aim of detecting and localizing the foci of the epileptic seizures. We evaluate the method by comparing the results of surgery to the localization predicted here. We find an indication of good correspondence between the success or failure in the surgery and the agreement between our identification and the regions actually operated on.

  9. Effect of hydroalcoholic extract of Anethum graveolens leaves on the dentate gyrus of the hippocampus in the epileptic mice: a histopathological and immunohistochemical study.

    PubMed

    Golmohammadi, Rahim; Sabaghzadeh, Fatemeh; Mojadadi, Mohammad Shafi

    2016-01-01

    Anethum graveolens or Dill (local name: Shevid) belongs to the family of Apiaceae (Umbelliferae) and is used traditionally for the treatment of convulsion and diabetes in Iran. This study aimed to investigate the effect of hydroalcoholic extract of A. graveolens leaves on the histology of the dentate gyrus of the hippocampus in the epileptic mice kindled by Pentylenetetrazole (PTZ). In this experimental study, the epileptic BALB/c mice kindled by PTZ were randomly divided into four groups of 10 animals each. Three experimental groups received 250, 500 and 750 mg/kg/day of A. graveolens extract for 21 days. The control group received phosphate-buffered saline (PBS). After the treatment period, the mice were anesthetized, and their hippocampi were dissected for the histopathological analysis, and immunohistochemical analysis for caspase-3 activity. Histopathological examinations showed that the mean numbers of the healthy neuronal cells in the dentate gyrus of the mice received 500 mg/kg/day of A. graveolens extracts were significantly higher than those of the mice received 250 and 750 mg/kg/day of the extracts as well as the control group (P < 0.05 and P < 0.001, respectively). In addition, the results of immunohistochemical analysis revealed that in mice treated with 500 mg/kg/day of A. graveolens; the numbers of caspase-3-positive cells in the dentate gyrus were significantly lower than those of the two other test and the control groups. The findings of this study suggest that 500 mg/kg/day of the A. graveolens extract could have protective effect on the dentate gyrus of the hippocampus in the epileptic mice.

  10. Effect of hydroalcoholic extract of Anethum graveolens leaves on the dentate gyrus of the hippocampus in the epileptic mice: a histopathological and immunohistochemical study

    PubMed Central

    Golmohammadi, Rahim; Sabaghzadeh, Fatemeh; Mojadadi, Mohammad Shafi

    2016-01-01

    Anethum graveolens or Dill (local name: Shevid) belongs to the family of Apiaceae (Umbelliferae) and is used traditionally for the treatment of convulsion and diabetes in Iran. This study aimed to investigate the effect of hydroalcoholic extract of A. graveolens leaves on the histology of the dentate gyrus of the hippocampus in the epileptic mice kindled by Pentylenetetrazole (PTZ). In this experimental study, the epileptic BALB/c mice kindled by PTZ were randomly divided into four groups of 10 animals each. Three experimental groups received 250, 500 and 750 mg/kg/day of A. graveolens extract for 21 days. The control group received phosphate-buffered saline (PBS). After the treatment period, the mice were anesthetized, and their hippocampi were dissected for the histopathological analysis, and immunohistochemical analysis for caspase-3 activity. Histopathological examinations showed that the mean numbers of the healthy neuronal cells in the dentate gyrus of the mice received 500 mg/kg/day of A. graveolens extracts were significantly higher than those of the mice received 250 and 750 mg/kg/day of the extracts as well as the control group (P < 0.05 and P < 0.001, respectively). In addition, the results of immunohistochemical analysis revealed that in mice treated with 500 mg/kg/day of A. graveolens; the numbers of caspase-3-positive cells in the dentate gyrus were significantly lower than those of the two other test and the control groups. The findings of this study suggest that 500 mg/kg/day of the A. graveolens extract could have protective effect on the dentate gyrus of the hippocampus in the epileptic mice. PMID:27499792

  11. Memory, scene construction, and the human hippocampus

    PubMed Central

    Kim, Soyun; Dede, Adam J. O.; Hopkins, Ramona O.; Squire, Larry R.

    2015-01-01

    We evaluated two different perspectives about the function of the human hippocampus–one that emphasizes the importance of memory and another that emphasizes the importance of spatial processing and scene construction. We gave tests of boundary extension, scene construction, and memory to patients with lesions limited to the hippocampus or large lesions of the medial temporal lobe. The patients were intact on all of the spatial tasks and impaired on all of the memory tasks. We discuss earlier studies that associated performance on these spatial tasks to hippocampal function. Our results demonstrate the importance of medial temporal lobe structures for memory and raise doubts about the idea that these structures have a prominent role in spatial cognition. PMID:25825712

  12. Bumetanide, an NKCC1 antagonist, does not prevent formation of epileptogenic focus but blocks epileptic focus seizures in immature rat hippocampus.

    PubMed

    Nardou, Romain; Ben-Ari, Yehezkel; Khalilov, Ilgam

    2009-06-01

    Excitatory GABA action induced by high [Cl(-)](i) is thought to contribute to seizure generation in neonatal neurons although the mechanism of this effect remains unclear. We report that bumetanide, a NKCC1 antagonist, reduces driving force of GABA-mediated currents (DF(GABA)) in neonatal hippocampal neurons and blocks the giant depolarizing potentials (GDPs), a spontaneous pattern of network activity. In the preparation composed of two intact interconnected hippocampi, bumetanide did not prevent generation of kainate-induced seizures, their propagation to the contralateral hippocampus, and formation of an epileptogenic mirror focus. However, in the isolated mirror focus, bumetanide effectively blocked spontaneous epileptiform activity transforming it to the GDP-like activity pattern. Bumetanide partially reduced DF(GABA) and therefore the excitatory action of GABA in epileptic neurons. Therefore bumetanide is a potent anticonvulsive agent although it cannot prevent formation of the epileptogenic mirror focus. We suggest that an additional mechanism other than NKCC1-mediated contributes to the persistent increase of DF(GABA) in epileptic neurons.

  13. Nonlinear times series analysis of epileptic human electroencephalogram (EEG)

    NASA Astrophysics Data System (ADS)

    Li, Dingzhou

    The problem of seizure anticipation in patients with epilepsy has attracted significant attention in the past few years. In this paper we discuss two approaches, using methods of nonlinear time series analysis applied to scalp electrode recordings, which is able to distinguish between epochs temporally distant from and just prior to, the onset of a seizure in patients with temporal lobe epilepsy. First we describe a method involving a comparison of recordings taken from electrodes adjacent to and remote from the site of the seizure focus. In particular, we define a nonlinear quantity which we call marginal predictability. This quantity is computed using data from remote and from adjacent electrodes. We find that the difference between the marginal predictabilities computed for the remote and adjacent electrodes decreases several tens of minutes prior to seizure onset, compared to its value interictally. We also show that these difl'crcnc es of marginal predictability intervals are independent of the behavior state of the patient. Next we examine the please coherence between different electrodes both in the long-range and the short-range. When time is distant from seizure onsets ("interictally"), epileptic patients have lower long-range phase coherence in the delta (1-4Hz) and beta (18-30Hz) frequency band compared to nonepileptic subjects. When seizures approach (''preictally"), we observe an increase in phase coherence in the beta band. However, interictally there is no difference in short-range phase coherence between this cohort of patients and non-epileptic subjects. Preictally short-range phase coherence also increases in the alpha (10-13Hz) and the beta band. Next we apply the quantity marginal predictability on the phase difference time series. Such marginal predictabilities are lower in the patients than in the non-epileptic subjects. However, when seizure approaches, the former moves asymptotically towards the latter.

  14. Low distribution of synaptic vesicle protein 2A and synaptotagimin-1 in the cerebral cortex and hippocampus of spontaneously epileptic rats exhibiting both tonic convulsion and absence seizure.

    PubMed

    Hanaya, R; Hosoyama, H; Sugata, S; Tokudome, M; Hirano, H; Tokimura, H; Kurisu, K; Serikawa, T; Sasa, M; Arita, K

    2012-09-27

    The spontaneously epileptic rat (SER) is a double mutant (zi/zi, tm/tm) which begins to exhibit tonic convulsions and absence seizures after 6 weeks of age, and repetitive tonic seizures over time induce sclerosis-like changes in SER hippocampus with high brain-derived neurotrophic factor (BDNF) expression. Levetiracetam, which binds to synaptic vesicle protein 2A (SV2A), inhibited both tonic convulsions and absence seizures in SERs. We studied SER brains histologically and immunohistochemically after verification by electroencephalography (EEG), as SERs exhibit seizure-related alterations in the cerebral cortex and hippocampus. SERs did not show interictal abnormal spikes and slow waves typical of focal epilepsy or symptomatic generalized epilepsy. The difference in neuronal density of the cerebral cortex was insignificant between SER and Wistar rats, and apoptotic neurons did not appear in SERs. BDNF distributions portrayed higher values in the entorhinal and piriform cortices which would relate with hippocampal sclerosis-like changes. Similar synaptophysin expression in the cerebral cortex and hippocampus was found in both animals. Low and diffuse SV2A distribution portrayed in the cerebral cortex and hippocampus of SERs was significantly less than that of all cerebral lobes and inner molecular layer (IML) of the dentate gyrus (DG) of Wistar rats. The extent of low SV2A expression/distribution in SERs was particularly remarkable in the frontal (51% of control) and entorhinal cortices (47%). Lower synaptotagmin-1 expression (vs Wistar rats) was located in the frontal (31%), piriform (13%) and entorhinal (39%) cortices, and IML of the DG (38%) in SER. Focal low distribution of synaptotagmin-1 accompanying low SV2A expression may contribute to epileptogenesis and seizure propagation in SER.

  15. Patterns of human local cerebral glucose metabolism during epileptic seizures

    SciTech Connect

    Engel, J. Jr.; Kuhl, D.E.; Phelps, M.E.

    1982-10-01

    Ictal patterns of local cerebral metabolic rate have been studied in epileptic patients by positron computed tomography with /sup 18/F-labeled 2-fluoro-2-deoxy-D-glucose. Partial seizures were associated with activation of anatomic structures unique to each patient studied. Ictal increases and decreases in local cerebral metabolism were observed. Scans performed during generalized convulsions induced by electroshock demonstrated a diffuse ictal increase and postictal decrease in cerebral metabolism. Petit mal absences were associated with a diffuse increase in cerebral metabolic rate. The ictal fluorodeoxyglucose patterns obtained from patients do not resemble autoradiographic patterns obtained from common experimental animal models of epilepsy.

  16. Fatty acid amidohydrolase in human neocortex-activity in epileptic and non-epileptic brain tissue and inhibition by putative endocannabinoids.

    PubMed

    Steffens, Marc; Schulze-Bonhage, Andreas; Surges, Rainer; Feuerstein, Thomas J

    2005-09-02

    Increased levels of the endocannabinoid anandamide (AEA) have been observed in connection with neuronal disorders like epilepsy. In order to investigate whether an impaired enzymatic AEA hydrolysis contributes to this phenomenon, the present study determined the activity of fatty acid amidohydrolase (FAAH) in epileptic and non-epileptic human neocortical brain tissue. Additionally, we investigated whether other putative endocannabinoids (2-arachidonylglycerol (2-AG), noladin ether, virodhamine) may also interact with FAAH. AEA hydrolysis was measured by the formation of the product [(3)H]-ethanolamine after separation from the substrate using activated charcoal. FAAH activity was found to be similar in epileptic and non-epileptic human neocortex (0.29 and 0.37 nmol ethanolamine/mg protein/min, respectively). FAAH activity was about 55% higher in rat neocortex. While in human, neocortex noladin ether did not influence AEA hydrolysis, FAAH activity was concentration-dependently inhibited by AEA, 2-AG and virodhamine (IC(50) values 3.3, 3.5 and 13.8 microM, respectively). Our results suggest that, in the course of epilepsy, increased AEA levels are likely due to enhanced formation and not due to decreased hydrolysis. To further increase endocannabinoid activity, the application of FAAH inhibitors might be therapeutically useful in the treatment of neuronal hyperexcitability. Whereas noladin ether did not interact with AEA hydrolysis, this compound, 2-AG and virodhamine may share common enzymatic inactivation mechanisms in human neocortex.

  17. Two different mechanisms associated with ripple-like oscillations (100-250 Hz) in the human epileptic subiculum in vitro

    PubMed Central

    Alvarado-Rojas, C; Huberfeld, G; Baulac, M; Clemenceau, S; Charpier, S; Miles, R; Menendez de la Prida, L; Le Van Quyen, M

    2015-01-01

    Transient high-frequency oscillations (150-600 Hz) in local field potential generated by human hippocampal and parahippocampal areas have been related to both physiological and pathological processes. The cellular basis and effects of normal and abnormal forms of high-frequency oscillations (HFO) has been controversial. Here, we searched for HFOs in slices of the subiculum prepared from human hippocampal tissue resected for treatment of pharmacoresistant epilepsy. HFOs occurred spontaneously in extracellular field potentials during interictal discharges (IID) and also during pharmacologically induced preictal discharges (PID) preceding ictal-like events. While most of these events might be considered pathological since they invaded the fast ripple band (>250 Hz), others were spectrally similar to physiological ripples (150-250 Hz). Do similar cellular mechanisms underly IID-ripples and PID-ripples? Are ripple-like oscillations a valid proxy of epileptogenesis in human TLE? With combined intra- or juxta-cellular and extracellular recordings, we showed that, despite overlapping spectral components, ripple-like IID and PID oscillations were associated with different cellular and synaptic mechanisms. IID-ripples were associated with rhythmic GABAergic and glutamatergic synaptic potentials with moderate neuronal firing. In contrast, PID-ripples were associated with depolarizing synaptic inputs frequently reaching the threshold for bursting in most cells. Thus ripple-like oscillations (100-250 Hz) in the human epileptic hippocampus are associated with different mechanisms for synchrony reflecting distinct dynamic changes in inhibition and excitation during interictal and pre-ictal states. PMID:25448920

  18. Preservation of perisomatic inhibitory input of granule cells in the epileptic human dentate gyrus.

    PubMed

    Wittner, L; Maglóczky, Z; Borhegyi, Z; Halász, P; Tóth, S; Eross, L; Szabó, Z; Freund, T F

    2001-01-01

    Temporal lobe epilepsy is known to be associated with hyperactivity that is likely to be generated or amplified in the hippocampal formation. The majority of granule cells, the principal cells of the dentate gyrus, are found to be resistant to damage in epilepsy, and may serve as generators of seizures if their inhibition is impaired. Therefore, the parvalbumin-containing subset of interneurons, known to provide the most powerful inhibitory input to granule cell somata and axon initial segments, were examined in human control and epileptic dentate gyrus. A strong reduction in the number of parvalbumin-containing cells was found in the epileptic samples especially in the hilar region, although in some patches of the granule cell layer parvalbumin-positive terminals that form vertical clusters characteristic of axo-axonic cells were more numerous than in controls. Analysis of the postsynaptic target elements of parvalbumin-positive axon terminals showed that they form symmetric synapses with somata, dendrites, axon initial segments and spines as in the control, but the ratio of axon initial segment synapses was increased in the epileptic tissue (control: 15.9%, epileptic: 31.3%). Furthermore, the synaptic coverage of granule cell axon initial segments increased more than three times (control: 0.52, epileptic: 2.10 microm synaptic length/100 microm axon initial segment membrane) in the epileptic samples, whereas the amount of somatic symmetric synapses did not change significantly. Although the number of parvalbumin-positive interneurons is decreased, the perisomatic inhibitory input of dentate granule cells is preserved in temporal lobe epilepsy. Basket and axo-axonic cell terminals - whether positive or negative for parvalbumin - are present, moreover, the axon collaterals targeting axon initial segments sprout in the epileptic dentate gyrus. We suggest that perisomatic inhibitory interneurons survive in epilepsy, but their somadendritic compartment and partly the

  19. Neurofunctional topography of the human hippocampus

    PubMed Central

    Robinson, Jennifer L.; Barron, Daniel S.; Kirby, Lauren A. J.; Bottenhorn, Katherine L.; Hill, Ashley C.; Murphy, Jerry E.; Katz, Jeffrey S.; Salibi, Nouha; Eickhoff, Simon B.; Fox, Peter T.

    2015-01-01

    Much of what we assume about the functional topography of the hippocampus was derived from a single case study over half a century ago. Given advances in the imaging sciences, a new era of discovery is underway, with potential to transform our understanding of healthy processing as well as our ability to treat disorders. We employed coactivation based parcellation, a meta-analytic approach, and ultra-high field, high-resolution functional and structural neuroimaging to characterize the neurofunctional topography of the hippocampus. Data revealed strong support for an evolutionarily preserved topography along the long-axis. Specifically, the left hippocampus was segmented into three distinct clusters: an emotional processing cluster supported by structural and functional connectivity to the amygdala and parahippocampal gyrus, a cognitive operations cluster, with functional connectivity to the anterior cingulate and inferior frontal gyrus, and a posterior perceptual cluster with distinct structural connectivity patterns to the occipital lobe coupled with functional connectivity to the precuneus and angular gyrus. The right hippocampal segmentation was more ambiguous, with plausible 2- and 5-cluster solutions plausible. Segmentations shared connectivity with brain regions known to support the correlated processes. This represents the first neurofunctional topographic model of the hippocampus using a robust, bias-free, multi-modal approach. PMID:26350954

  20. Musical Training Induces Functional Plasticity in Human Hippocampus

    PubMed Central

    Esposito, Fabrizio; di Salle, Francesco; Boller, Christian; Hilti, Caroline C.; Habermeyer, Benedikt; Scheffler, Klaus; Wetzel, Stephan; Seifritz, Erich; Cattapan-Ludewig, Katja

    2010-01-01

    Training can change the functional and structural organization of the brain, and animal models demonstrate that the hippocampus formation is particularly susceptible to training-related neuroplasticity. In humans, however, direct evidence for functional plasticity of the adult hippocampus induced by training is still missing. Here, we used musicians' brains as a model to test for plastic capabilities of the adult human hippocampus. By using functional magnetic resonance imaging optimized for the investigation of auditory processing, we examined brain responses induced by temporal novelty in otherwise isochronous sound patterns in musicians and musical laypersons, since the hippocampus has been suggested previously to be crucially involved in various forms of novelty detection. In the first cross-sectional experiment, we identified enhanced neural responses to temporal novelty in the anterior left hippocampus of professional musicians, pointing to expertise-related differences in hippocampal processing. In the second experiment, we evaluated neural responses to acoustic temporal novelty in a longitudinal approach to disentangle training-related changes from predispositional factors. For this purpose, we examined an independent sample of music academy students before and after two semesters of intensive aural skills training. After this training period, hippocampal responses to temporal novelty in sounds were enhanced in musical students, and statistical interaction analysis of brain activity changes over time suggests training rather than predisposition effects. Thus, our results provide direct evidence for functional changes of the adult hippocampus in humans related to musical training. PMID:20107063

  1. Epilepsy but not mobile phone frequency (900 MHz) induces apoptosis and calcium entry in hippocampus of epileptic rat: involvement of TRPV1 channels.

    PubMed

    Nazıroğlu, Mustafa; Özkan, Fatma Feyza; Hapil, Seher Rabia; Ghazizadeh, Vahid; Çiğ, Bilal

    2015-02-01

    Electromagnetic radiation (EMR) and epilepsy are reported to mediate the regulation of apoptosis and oxidative stress through Ca(2+) influx. Results of recent reports indicated that EMR can increase temperature and oxidative stress of body cells, and TRPV1 channel is activated by noxious heat, oxidative stress, and capsaicin (CAP). We investigated the effects of mobile phone (900 MHz) EMR exposure on Ca(2+) influx, apoptosis, oxidative stress, and TRPV1 channel activations in the hippocampus of pentylenetetrazol (PTZ)-induced epileptic rats. Freshly isolated hippocampal neurons of twenty-one rats were used in study within three groups namely control, PTZ, and PTZ + EMR. The neurons in the three groups were stimulated by CAP. Epilepsy was induced by PTZ administration. The neurons in PTZ + EMR group were exposed to the 900 MHz EMR for 1 h. The apoptosis, mitochondrial membrane depolarization, intracellular reactive oxygen species (ROS), and caspase-3 and caspase-9 values were higher in PTZ and PTZ + EMR groups than in control. However, EMR did not add additional increase effects on the values in the hippocampal neurons. Intracellular-free Ca(2+) concentrations in fura-2 analyses were also higher in PTZ + CAP group than in control although their concentrations were decreased by TRPV1 channel blocker, capsazepine. However, there were no statistical changes on the Ca(2+) concentrations between epilepsy and EMR groups. In conclusion, apoptosis, mitochondrial, ROS, and Ca(2+) influx via TRPV1 channel were increased in the hippocampal neurons by epilepsy induction although the mobile phone did not change the values. The results indicated that TRPV1 channels in hippocampus may possibly be a novel target for effective target of epilepsy.

  2. A quantitative transcriptome reference map of the normal human hippocampus.

    PubMed

    Caracausi, Maria; Rigon, Vania; Piovesan, Allison; Strippoli, Pierluigi; Vitale, Lorenza; Pelleri, Maria Chiara

    2016-01-01

    We performed an innovative systematic meta-analysis of 41 gene expression profiles of normal human hippocampus to provide a quantitative transcriptome reference map of it, i.e. a reference typical value of expression for each of the 30,739 known mapped and the 16,258 uncharacterized (unmapped) transcripts. For this aim, we used the software called TRAM (Transcriptome Mapper), which is able to generate transcriptome maps based on gene expression data from multiple sources. We also analyzed differential expression by comparing the hippocampus with the whole brain transcriptome map to identify a typical expression pattern of this subregion compared with the whole organ. Finally, due to the fact that the hippocampus is one of the main brain region to be severely affected in trisomy 21 (the best known genetic cause of intellectual disability), a particular attention was paid to the expression of chromosome 21 (chr21) genes. Data were downloaded from microarray databases, processed, and analyzed using TRAM software. Among the main findings, the most over-expressed loci in the hippocampus are the expressed sequence tag cluster Hs.732685 and the member of the calmodulin gene family CALM2. The tubulin folding cofactor B (TBCB) gene is the best gene at behaving like a housekeeping gene. The hippocampus vs. the whole brain differential transcriptome map shows the over-expression of LINC00114, a long non-coding RNA mapped on chr21. The hippocampus transcriptome map was validated in vitro by assaying gene expression through several magnitude orders by "Real-Time" reverse transcription polymerase chain reaction (RT-PCR). The highly significant agreement between in silico and experimental data suggested that our transcriptome map may be a useful quantitative reference benchmark for gene expression studies related to human hippocampus. Furthermore, our analysis yielded biological insights about those genes that have an intrinsic over-/under-expression in the hippocampus.

  3. Correlation Between IL-10 and microRNA-187 Expression in Epileptic Rat Hippocampus and Patients with Temporal Lobe Epilepsy

    PubMed Central

    Alsharafi, Walid A.; Xiao, Bo; Abuhamed, Mutasem M.; Bi, Fang-Fang; Luo, Zhao-Hui

    2015-01-01

    Accumulating evidence is emerging that microRNAs (miRNAs) are key regulators in controlling neuroinflammatory responses that are known to play a potential role in the pathogenesis of temporal lobe epilepsy (TLE). The aim of the present study was to investigate the dynamic expression pattern of interleukin (IL)-10 as an anti-inflammatory cytokine and miR-187 as a post-transcriptional inflammation-related miRNA in the hippocampus of a rat model of status epilepticus (SE) and patients with TLE. We performed a real-time quantitative PCR and western blot on rat hippocampus 2 h, 7 days, 21 days and 60 days following pilocarpine-induced SE, and on hippocampus obtained from TLE patients and normal controls. To detect the relationship between IL-10 and miR-187 on neurons, lipopolysaccharide (LPS) and IL-10-stimulated neurons were performed. Furthermore, we identified the effect of antagonizing miR-187 by its antagomir on IL-10 secretion. Here, we reported that IL-10 secretion and miR-187 expression levels are inversely correlated after SE. In patients with TLE, the expression of IL-10 was also significantly upregulated, whereas miR-187 expression was significantly downregulated. Moreover, miR-187 expression was significantly reduced following IL-10 stimulation in an IL-10–dependent manner. On the other hand, antagonizing miR-187 promoted the production of IL-10 in hippocampal tissues of rat model of SE. Our findings demonstrate a critical role of miR-187 in the physiological regulation of IL-10 anti-inflammatory responses and elucidate the role of neuroinflammation in the pathogenesis of TLE. Therefore, modulation of the IL-10 / miR-187 axis may be a new therapeutic approach for TLE. PMID:26696826

  4. Potassium Channels and Human Epileptic Phenotypes: An Updated Overview

    PubMed Central

    Villa, Chiara; Combi, Romina

    2016-01-01

    Potassium (K+) channels are expressed in almost every cells and are ubiquitous in neuronal and glial cell membranes. These channels have been implicated in different disorders, in particular in epilepsy. K+ channel diversity depends on the presence in the human genome of a large number of genes either encoding pore-forming or accessory subunits. More than 80 genes encoding the K+ channels were cloned and they represent the largest group of ion channels regulating the electrical activity of cells in different tissues, including the brain. It is therefore not surprising that mutations in these genes lead to K+ channels dysfunctions linked to inherited epilepsy in humans and non-human model animals. This article reviews genetic and molecular progresses in exploring the pathogenesis of different human epilepsies, with special emphasis on the role of K+ channels in monogenic forms. PMID:27064559

  5. Potassium Channels and Human Epileptic Phenotypes: An Updated Overview.

    PubMed

    Villa, Chiara; Combi, Romina

    2016-01-01

    Potassium (K(+)) channels are expressed in almost every cells and are ubiquitous in neuronal and glial cell membranes. These channels have been implicated in different disorders, in particular in epilepsy. K(+) channel diversity depends on the presence in the human genome of a large number of genes either encoding pore-forming or accessory subunits. More than 80 genes encoding the K(+) channels were cloned and they represent the largest group of ion channels regulating the electrical activity of cells in different tissues, including the brain. It is therefore not surprising that mutations in these genes lead to K(+) channels dysfunctions linked to inherited epilepsy in humans and non-human model animals. This article reviews genetic and molecular progresses in exploring the pathogenesis of different human epilepsies, with special emphasis on the role of K(+) channels in monogenic forms.

  6. Dopamine regulates stimulus generalization in the human hippocampus.

    PubMed

    Kahnt, Thorsten; Tobler, Philippe N

    2016-02-02

    The ability to generalize previously learned information to novel situations is fundamental for adaptive behavior. However, too wide or too narrow generalization is linked to neuropsychiatric disorders. Previous research suggests that interactions between the dopaminergic system and the hippocampus may play a role in generalization, but whether and how the degree of generalization can be modulated via these pathways is currently unknown. Here, we addressed this question in humans using pharmacology, functional magnetic resonance imaging, and computational modeling. Blocking dopamine D2-receptors (D2R) altered generalization behavior as revealed by an increased kurtosis of the generalization gradient, and a decreased width of model-derived generalization parameters. Moreover, D2R-blockade modulated similarity-based responses in the hippocampus and decreased midbrain-hippocampal connectivity, which in turn correlated with individual differences in generalization. These results suggest that dopaminergic activity in the hippocampus may relate to the degree of generalization and highlight a potential target for treatment.

  7. Long-term electrical stimulation at ear and electro-acupuncture at ST36-ST37 attenuated COX-2 in the CA1 of hippocampus in kainic acid-induced epileptic seizure rats.

    PubMed

    Liao, En-Tzu; Tang, Nou-Ying; Lin, Yi-Wen; Liang Hsieh, Ching

    2017-03-28

    Seizures produce brain inflammation, which in turn enhances neuronal excitability. Therefore, anti-inflammation has become a therapeutic strategy for antiepileptic treatment. Cycloxygenase-2 (COX-2) plays a critical role in postseizure brain inflammation and neuronal hyperexcitability. Our previous studies have shown that both electrical stimulation (ES) at the ear and electro-acupuncture (EA) at the Zusanli and Shangjuxu acupoints (ST36-ST37) for 6 weeks can reduce mossy fiber sprouting, spike population, and high-frequency hippocampal oscillations in kainic acid (KA)-induced epileptic seizure rats. This study further investigated the effect of long-term ear ES and EA at ST36-ST37 on the inflammatory response in KA-induced epileptic seizure rats. Both the COX-2 levels in the hippocampus and the number of COX-2 immunoreactive cells in the hippocampal CA1 region were increased after KA-induced epileptic seizures, and these were reduced through the 6-week application of ear ES or EA at ST36-ST37. Thus, long-term ear ES or long-term EA at ST36-ST37 have an anti-inflammatory effect, suggesting that they are beneficial for the treatment of epileptic seizures.

  8. The dynamics of adult neurogenesis in human hippocampus

    PubMed Central

    Ihunwo, Amadi O.; Tembo, Lackson H.; Dzamalala, Charles

    2016-01-01

    The phenomenon of adult neurogenesis is now an accepted occurrence in mammals and also in humans. At least two discrete places house stem cells for generation of neurons in adult brain. These are olfactory system and the hippocampus. In animals, newly generated neurons have been directly or indirectly demonstrated to generate a significant amount of new neurons to have a functional role. However, the data in humans on the extent of this process is still scanty and such as difficult to comprehend its functional role in humans. This paper explores the available data on as extent of adult hippocampal neurogenesis in humans and makes comparison to animal data. PMID:28197172

  9. Predicting novel histopathological microlesions in human epileptic brain through transcriptional clustering.

    PubMed

    Dachet, Fabien; Bagla, Shruti; Keren-Aviram, Gal; Morton, Andrew; Balan, Karina; Saadat, Laleh; Valyi-Nagy, Tibor; Kupsky, William; Song, Fei; Dratz, Edward; Loeb, Jeffrey A

    2015-02-01

    Although epilepsy is associated with a variety of abnormalities, exactly why some brain regions produce seizures and others do not is not known. We developed a method to identify cellular changes in human epileptic neocortex using transcriptional clustering. A paired analysis of high and low spiking tissues recorded in vivo from 15 patients predicted 11 cell-specific changes together with their 'cellular interactome'. These predictions were validated histologically revealing millimetre-sized 'microlesions' together with a global increase in vascularity and microglia. Microlesions were easily identified in deeper cortical layers using the neuronal marker NeuN, showed a marked reduction in neuronal processes, and were associated with nearby activation of MAPK/CREB signalling, a marker of epileptic activity, in superficial layers. Microlesions constitute a common, undiscovered layer-specific abnormality of neuronal connectivity in human neocortex that may be responsible for many 'non-lesional' forms of epilepsy. The transcriptional clustering approach used here could be applied more broadly to predict cellular differences in other brain and complex tissue disorders.

  10. Predicting novel histopathological microlesions in human epileptic brain through transcriptional clustering

    PubMed Central

    Dachet, Fabien; Bagla, Shruti; Keren-Aviram, Gal; Morton, Andrew; Balan, Karina; Saadat, Laleh; Valyi-Nagy, Tibor; Kupsky, William; Song, Fei; Dratz, Edward; Loeb, Jeffrey A.

    2015-01-01

    Although epilepsy is associated with a variety of abnormalities, exactly why some brain regions produce seizures and others do not is not known. We developed a method to identify cellular changes in human epileptic neocortex using transcriptional clustering. A paired analysis of high and low spiking tissues recorded in vivo from 15 patients predicted 11 cell-specific changes together with their ‘cellular interactome’. These predictions were validated histologically revealing millimetre-sized ‘microlesions’ together with a global increase in vascularity and microglia. Microlesions were easily identified in deeper cortical layers using the neuronal marker NeuN, showed a marked reduction in neuronal processes, and were associated with nearby activation of MAPK/CREB signalling, a marker of epileptic activity, in superficial layers. Microlesions constitute a common, undiscovered layer-specific abnormality of neuronal connectivity in human neocortex that may be responsible for many ‘non-lesional’ forms of epilepsy. The transcriptional clustering approach used here could be applied more broadly to predict cellular differences in other brain and complex tissue disorders. PMID:25516101

  11. Prospective representation of navigational goals in the human hippocampus.

    PubMed

    Brown, Thackery I; Carr, Valerie A; LaRocque, Karen F; Favila, Serra E; Gordon, Alan M; Bowles, Ben; Bailenson, Jeremy N; Wagner, Anthony D

    2016-06-10

    Mental representation of the future is a fundamental component of goal-directed behavior. Computational and animal models highlight prospective spatial coding in the hippocampus, mediated by interactions with the prefrontal cortex, as a putative mechanism for simulating future events. Using whole-brain high-resolution functional magnetic resonance imaging and multi-voxel pattern classification, we tested whether the human hippocampus and interrelated cortical structures support prospective representation of navigational goals. Results demonstrated that hippocampal activity patterns code for future goals to which participants subsequently navigate, as well as for intervening locations along the route, consistent with trajectory-specific simulation. The strength of hippocampal goal representations covaried with goal-related coding in the prefrontal, medial temporal, and medial parietal cortex. Collectively, these data indicate that a hippocampal-cortical network supports prospective simulation of navigational events during goal-directed planning.

  12. Developing an Animal Model of Human Amnesia: The Role of the Hippocampus

    ERIC Educational Resources Information Center

    Kesner, Raymond P.; Goodrich-Hunsaker, Naomi J.

    2010-01-01

    This review summarizes a series of experiments aimed at answering the question whether the hippocampus in rats can serve as an animal model of amnesia. It is recognized that a comparison of the functions of the rat hippocampus with human hippocampus is difficult, because of differences in methodology, differences in complexity of life experiences,…

  13. Dopamine regulates stimulus generalization in the human hippocampus

    PubMed Central

    Kahnt, Thorsten; Tobler, Philippe N

    2016-01-01

    The ability to generalize previously learned information to novel situations is fundamental for adaptive behavior. However, too wide or too narrow generalization is linked to neuropsychiatric disorders. Previous research suggests that interactions between the dopaminergic system and the hippocampus may play a role in generalization, but whether and how the degree of generalization can be modulated via these pathways is currently unknown. Here, we addressed this question in humans using pharmacology, functional magnetic resonance imaging, and computational modeling. Blocking dopamine D2-receptors (D2R) altered generalization behavior as revealed by an increased kurtosis of the generalization gradient, and a decreased width of model-derived generalization parameters. Moreover, D2R-blockade modulated similarity-based responses in the hippocampus and decreased midbrain-hippocampal connectivity, which in turn correlated with individual differences in generalization. These results suggest that dopaminergic activity in the hippocampus may relate to the degree of generalization and highlight a potential target for treatment. DOI: http://dx.doi.org/10.7554/eLife.12678.001 PMID:26830462

  14. Expression of human epileptic temporal lobe neurotransmitter receptors in Xenopus oocytes: An innovative approach to study epilepsy

    PubMed Central

    Palma, Eleonora; Esposito, Vincenzo; Mileo, Anna Maria; Di Gennaro, Giancarlo; Quarato, Pierpaolo; Giangaspero, Felice; Scoppetta, Ciriaco; Onorati, Paolo; Trettel, Flavia; Miledi, Ricardo; Eusebi, Fabrizio

    2002-01-01

    Poly(A+) RNA was extracted from the temporal lobe (TL) of medically intractable epileptic patients which underwent surgical TL resection. Injection of this mRNA into Xenopus oocytes led to the expression of ionotropic receptors for γ-aminobutyric acid (GABA), kainate (KAI) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA). Membrane currents elicited by GABA inverted polarity at −15 mV, close to the oocyte's chloride equilibrium potential, were inhibited by bicuculline, and were potentiated by pentobarbital and flunitrazepam. These basic characteristics were also displayed by GABA currents elicited in oocytes injected with mRNAs isolated from human TL glioma (TLG) or from mouse TL. However, the GABA receptors expressed by the epileptic TL mRNA exhibited some unusual properties, consisting in a rapid current run-down after repetitive GABA applications and a large EC50 (125 μM). AMPA alone evoked very small or nil currents, whereas KAI induced larger currents. Nevertheless, upon cyclothiazide treatment, AMPA elicited substantial currents that, like the KAI currents, were inhibited by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX). Furthermore, the glutamate receptor 5 (GluR5) agonist, ATPA, failed to evoke an obvious current although both RT-PCR and Western blot analyses showed GluR5 expression in the epileptic TL. Oocytes injected with mouse TL or human TLG mRNAs generated KAI and AMPA currents similar to those evoked in oocytes injected with epileptic TL mRNA but, in contrast to these, the mouse TL and human TLG oocytes were also responsive to ATPA. Our findings are in accord with the concept that both a depression of GABA inhibition and a dysfunction of the KAI-receptor system maintain a high neuronal excitability that results in epileptic seizures. PMID:12409614

  15. Synaptic Reorganization of the Perisomatic Inhibitory Network in Hippocampi of Temporal Lobe Epileptic Patients

    PubMed Central

    Wittner, Lucia

    2017-01-01

    GABAergic inhibition and particularly perisomatic inhibition play a crucial role in controlling the firing properties of large principal cell populations. Furthermore, GABAergic network is a key element in the therapy attempting to reduce epileptic activity. Here, we present a review showing the synaptic changes of perisomatic inhibitory neuronal subtypes in the hippocampus of temporal lobe epileptic patients, including parvalbumin- (PV-) containing and cannabinoid Type 1 (CB1) receptor-expressing (and mainly cholecystokinin-positive) perisomatic inhibitory cells, known to control hippocampal synchronies. We have examined the synaptic input of principal cells in the dentate gyrus and Cornu Ammonis region in human control and epileptic hippocampi. Perisomatic inhibitory terminals establishing symmetric synapses were found to be sprouted in the dentate gyrus. Preservation of perisomatic input was found in the Cornu Ammonis 1 and Cornu Ammonis 2 regions, as long as pyramidal cells are present. Higher density of CB1-immunostained terminals was found in the epileptic hippocampus of sclerotic patients, especially in the dentate gyrus. We concluded that both types of (PV- and GABAergic CB1-containing) perisomatic inhibitory cells are mainly preserved or showed sprouting in epileptic samples. The enhanced perisomatic inhibitory signaling may increase principal cell synchronization and contribute to generation of epileptic seizures and interictal spikes. PMID:28116310

  16. Rhythmic Working Memory Activation in the Human Hippocampus.

    PubMed

    Leszczyński, Marcin; Fell, Juergen; Axmacher, Nikolai

    2015-11-10

    Working memory (WM) maintenance is assumed to rely on a single sustained process throughout the entire maintenance period. This assumption, although fundamental, has never been tested. We used intracranial electroencephalography (EEG) recordings from the human hippocampus in two independent experiments to investigate the neural dynamics underlying WM maintenance. We observed periodic fluctuations between two different oscillatory regimes: Periods of "memory activation" were reflected by load-dependent alpha power reductions and lower levels of cross-frequency coupling (CFC). They occurred interleaved with periods characterized by load-independent high levels of alpha power and CFC. During memory activation periods, a relevant CFC parameter (load-dependent changes of the peak modulated frequency) correlated with individual WM capacity. Fluctuations between these two periods predicted successful performance and were locked to the phase of endogenous delta oscillations. These results show that hippocampal maintenance is a dynamic rather than constant process and depends critically on a hierarchy of oscillations.

  17. Cellular localization and functional significance of CYP3A4 in the human epileptic brain

    PubMed Central

    Ghosh, Chaitali; Marchi, Nicola; Desai, Nirav K.; Puvenna, Vikram; Hossain, Mohammed; Gonzalez-Martinez, Jorge; Alexopoulos, Andreas V.; Janigro, Damir

    2011-01-01

    Summary Purpose Compelling evidence supports the presence of P450 enzymes (CYPs) in the central nervous system (CNS). However, little information is available on the localization and function of CYPs in the drug-resistant epileptic brain. We have evaluated the pattern of expression of the specific enzyme CYP3A4 and studied its co-localization with MDR1. We also determined whether an association exists between CYP3A4 expression and cell survival. Methods Brain specimens were obtained from eight patients undergoing resection to relieve drug-resistant seizures or to remove a cavernous angioma. Each specimen was partitioned for either immunostaining or primary culture of human endothelial cells and astrocytes. Immunostaining was performed using anti-CYP3A4, MDR1, GFAP, or NeuN antibodies. High performance liquid chromatography–ultraviolet (HPLC-UV) analysis was used to quantify carbamazepine (CBZ) metabolism by these cells. CYP3A4 expression was correlated to DAPI condensation, a marker of cell viability. Human embryonic kidney (HEK) cells were transfected with CYP3A4 to further evaluate the link between CYP3A4 levels, CBZ metabolism, and cell viability. Key Findings CYP3A4 was expressed by blood–brain barrier (BBB) endothelial cells and by the majority of neurons (75 ± 10%). Fluorescent immunostaining showed coexpression of CYP3A4 and MDR1 in endothelial cells and neurons. CYP3A4 expression inversely correlated with DAPI nuclear condensation. CYP3A4 overexpression in HEK cells conferred resistance to cytotoxic levels of carbamazepine. CYP3A4 levels positively correlated with the amount of CBZ metabolized. Significance CYP3A4 brain expression is not only associated with drug metabolism but may also represent a cytoprotective mechanism. Coexpression of CYP3A4 and MDR1 may be involved in cell survival in the diseased brain. PMID:21294720

  18. Adenosine receptor antagonists alter the stability of human epileptic GABAA receptors

    PubMed Central

    Roseti, Cristina; Martinello, Katiuscia; Fucile, Sergio; Piccari, Vanessa; Mascia, Addolorata; Di Gennaro, Giancarlo; Quarato, Pier Paolo; Manfredi, Mario; Esposito, Vincenzo; Cantore, Gianpaolo; Arcella, Antonella; Simonato, Michele; Fredholm, Bertil B.; Limatola, Cristina; Miledi, Ricardo; Eusebi, Fabrizio

    2008-01-01

    We examined how the endogenous anticonvulsant adenosine might influence γ-aminobutyric acid type A (GABAA) receptor stability and which adenosine receptors (ARs) were involved. Upon repetitive activation (GABA 500 μM), GABAA receptors, microtransplanted into Xenopus oocytes from neurosurgically resected epileptic human nervous tissues, exhibited an obvious GABAA-current (IGABA) run-down, which was consistently and significantly reduced by treatment with the nonselective adenosine receptor antagonist CGS15943 (100 nM) or with adenosine deaminase (ADA) (1 units/ml), that inactivates adenosine. It was also found that selective antagonists of A2B (MRS1706, 10 nM) or A3 (MRS1334, 30 nM) receptors reduced IGABA run-down, whereas treatment with the specific A1 receptor antagonist DPCPX (10 nM) was ineffective. The selective A2A receptor antagonist SCH58261 (10 nM) reduced or potentiated IGABA run-down in ≈40% and ≈20% of tested oocytes, respectively. The ADA-resistant, AR agonist 2-chloroadenosine (2-CA) (10 μM) potentiated IGABA run-down but only in ≈20% of tested oocytes. CGS15943 administration again decreased IGABA run-down in patch-clamped neurons from either human or rat neocortex slices. IGABA run-down in pyramidal neurons was equivalent in A1 receptor-deficient and wt neurons but much larger in neurons from A2A receptor-deficient mice, indicating that, in mouse cortex, GABAA-receptor stability is tonically influenced by A2A but not by A1 receptors. IGABA run-down from wt mice was not affected by 2-CA, suggesting maximal ARs activity by endogenous adenosine. Our findings strongly suggest that cortical A2–A3 receptors alter the stability of GABAA receptors, which could offer therapeutic opportunities. PMID:18809912

  19. Human fetal brain-derived neural stem/progenitor cells grafted into the adult epileptic brain restrain seizures in rat models of temporal lobe epilepsy.

    PubMed

    Lee, Haejin; Yun, Seokhwan; Kim, Il-Sun; Lee, Il-Shin; Shin, Jeong Eun; Park, Soo Chul; Kim, Won-Joo; Park, Kook In

    2014-01-01

    Cell transplantation has been suggested as an alternative therapy for temporal lobe epilepsy (TLE) because this can suppress spontaneous recurrent seizures in animal models. To evaluate the therapeutic potential of human neural stem/progenitor cells (huNSPCs) for treating TLE, we transplanted huNSPCs, derived from an aborted fetal telencephalon at 13 weeks of gestation and expanded in culture as neurospheres over a long time period, into the epileptic hippocampus of fully kindled and pilocarpine-treated adult rats exhibiting TLE. In vitro, huNSPCs not only produced all three central nervous system neural cell types, but also differentiated into ganglionic eminences-derived γ-aminobutyric acid (GABA)-ergic interneurons and released GABA in response to the depolarization induced by a high K+ medium. NSPC grafting reduced behavioral seizure duration, afterdischarge duration on electroencephalograms, and seizure stage in the kindling model, as well as the frequency and the duration of spontaneous recurrent motor seizures in pilocarpine-induced animals. However, NSPC grafting neither improved spatial learning or memory function in pilocarpine-treated animals. Following transplantation, grafted cells showed extensive migration around the injection site, robust engraftment, and long-term survival, along with differentiation into β-tubulin III+ neurons (∼34%), APC-CC1+ oligodendrocytes (∼28%), and GFAP+ astrocytes (∼8%). Furthermore, among donor-derived cells, ∼24% produced GABA. Additionally, to explain the effect of seizure suppression after NSPC grafting, we examined the anticonvulsant glial cell-derived neurotrophic factor (GDNF) levels in host hippocampal astrocytes and mossy fiber sprouting into the supragranular layer of the dentate gyrus in the epileptic brain. Grafted cells restored the expression of GDNF in host astrocytes but did not reverse the mossy fiber sprouting, eliminating the latter as potential mechanism. These results suggest that human fetal

  20. Human Fetal Brain-Derived Neural Stem/Progenitor Cells Grafted into the Adult Epileptic Brain Restrain Seizures in Rat Models of Temporal Lobe Epilepsy

    PubMed Central

    Lee, Haejin; Yun, Seokhwan; Kim, Il-Sun; Lee, Il-Shin; Shin, Jeong Eun; Park, Soo Chul; Kim, Won-Joo; Park, Kook In

    2014-01-01

    Cell transplantation has been suggested as an alternative therapy for temporal lobe epilepsy (TLE) because this can suppress spontaneous recurrent seizures in animal models. To evaluate the therapeutic potential of human neural stem/progenitor cells (huNSPCs) for treating TLE, we transplanted huNSPCs, derived from an aborted fetal telencephalon at 13 weeks of gestation and expanded in culture as neurospheres over a long time period, into the epileptic hippocampus of fully kindled and pilocarpine-treated adult rats exhibiting TLE. In vitro, huNSPCs not only produced all three central nervous system neural cell types, but also differentiated into ganglionic eminences-derived γ-aminobutyric acid (GABA)-ergic interneurons and released GABA in response to the depolarization induced by a high K+ medium. NSPC grafting reduced behavioral seizure duration, afterdischarge duration on electroencephalograms, and seizure stage in the kindling model, as well as the frequency and the duration of spontaneous recurrent motor seizures in pilocarpine-induced animals. However, NSPC grafting neither improved spatial learning or memory function in pilocarpine-treated animals. Following transplantation, grafted cells showed extensive migration around the injection site, robust engraftment, and long-term survival, along with differentiation into β-tubulin III+ neurons (∼34%), APC-CC1+ oligodendrocytes (∼28%), and GFAP+ astrocytes (∼8%). Furthermore, among donor-derived cells, ∼24% produced GABA. Additionally, to explain the effect of seizure suppression after NSPC grafting, we examined the anticonvulsant glial cell-derived neurotrophic factor (GDNF) levels in host hippocampal astrocytes and mossy fiber sprouting into the supragranular layer of the dentate gyrus in the epileptic brain. Grafted cells restored the expression of GDNF in host astrocytes but did not reverse the mossy fiber sprouting, eliminating the latter as potential mechanism. These results suggest that human fetal

  1. Impaired Action Potential Initiation in GABAergic Interneurons Causes Hyperexcitable Networks in an Epileptic Mouse Model Carrying a Human NaV1.1 Mutation

    PubMed Central

    Hedrich, Ulrike B.S.; Liautard, Camille; Kirschenbaum, Daniel; Pofahl, Martin; Lavigne, Jennifer; Liu, Yuanyuan; Theiss, Stephan; Slotta, Johannes; Escayg, Andrew; Dihné, Marcel; Beck, Heinz

    2014-01-01

    Mutations in SCN1A and other ion channel genes can cause different epileptic phenotypes, but the precise mechanisms underlying the development of hyperexcitable networks are largely unknown. Here, we present a multisystem analysis of an SCN1A mouse model carrying the NaV1.1-R1648H mutation, which causes febrile seizures and epilepsy in humans. We found a ubiquitous hypoexcitability of interneurons in thalamus, cortex, and hippocampus, without detectable changes in excitatory neurons. Interestingly, somatic Na+ channels in interneurons and persistent Na+ currents were not significantly changed. Instead, the key mechanism of interneuron dysfunction was a deficit of action potential initiation at the axon initial segment that was identified by analyzing action potential firing. This deficit increased with the duration of firing periods, suggesting that increased slow inactivation, as recorded for recombinant mutated channels, could play an important role. The deficit in interneuron firing caused reduced action potential-driven inhibition of excitatory neurons as revealed by less frequent spontaneous but not miniature IPSCs. Multiple approaches indicated increased spontaneous thalamocortical and hippocampal network activity in mutant mice, as follows: (1) more synchronous and higher-frequency firing was recorded in primary neuronal cultures plated on multielectrode arrays; (2) thalamocortical slices examined by field potential recordings revealed spontaneous activities and pathological high-frequency oscillations; and (3) multineuron Ca2+ imaging in hippocampal slices showed increased spontaneous neuronal activity. Thus, an interneuron-specific generalized defect in action potential initiation causes multisystem disinhibition and network hyperexcitability, which can well explain the occurrence of seizures in the studied mouse model and in patients carrying this mutation. PMID:25378155

  2. Context conditioning and extinction in humans: differential contribution of the hippocampus, amygdala and prefrontal cortex

    PubMed Central

    Lang, Simone; Kroll, Alexander; Lipinski, Slawomira J; Wessa, Michèle; Ridder, Stephanie; Christmann, Christoph; Schad, Lothar R; Flor, Herta

    2009-01-01

    Functional magnetic resonance imaging was used to investigate the role of the hippocampus, amygdala and medial prefrontal cortex (mPFC) in a contextual conditioning and extinction paradigm provoking anxiety. Twenty-one healthy persons participated in a differential context conditioning procedure with two different background colours as contexts. During acquisition increased activity to the conditioned stimulus (CS+) relative to the CS− was found in the left hippocampus and anterior cingulate cortex (ACC). The amygdala, insula and inferior frontal cortex were differentially active during late acquisition. Extinction was accompanied by enhanced activation to CS+ vs. CS− in the dorsal anterior cingulate cortex (dACC). The results are in accordance with animal studies and provide evidence for the important role of the hippocampus in contextual learning in humans. Connectivity analyses revealed correlated activity between the left posterior hippocampus and dACC (BA32) during early acquisition and the dACC, left posterior hippocampus and right amygdala during extinction. These data are consistent with theoretical models that propose an inhibitory effect of the mPFC on the amygdala. The interaction of the mPFC with the hippocampus may reflect the context-specificity of extinction learning. PMID:19200075

  3. Pharmacoresistant temporal lobe epilepsy modifies histamine turnover and H3 receptor function in the human hippocampus and temporal neocortex.

    PubMed

    Bañuelos-Cabrera, Ivette; Cuéllar-Herrera, Manola; Velasco, Ana Luisa; Velasco, Francisco; Alonso-Vanegas, Mario; Carmona, Francia; Guevara, Rosalinda; Arias-Montaño, José-Antonio; Rocha, Luisa

    2016-04-01

    Experiments were designed to evaluate the tissue content of tele-methylhistamine (t-MeHA) and histamine as well as H3 receptor (H3 Rs) binding and activation of the heterotrimeric guanine nucleotide binding αi/o proteins (Gαi/o) coupled to these receptors in the hippocampus and temporal neocortex of patients (n = 10) with pharmacoresistant mesial temporal lobe epilepsy (MTLE). Patients with MTLE showed elevated tissue content of t-MeHA in the hippocampus. Analyses revealed that a younger age at seizure onset was correlated with a higher tissue content of t-MeHA, lower H3 R binding, and lower efficacy of Gαi/o protein activation in the hippocampus. We conclude that the hippocampus shows a reduction in the H3 R function associated with enhanced histamine. In contrast, the temporal neocortex displayed a high efficacy of H3 Rs Gαi/o protein activation that was associated with low tissue contents of histamine and t-MeHA. These results indicate an overactivation of H3 Rs leading to decreased histamine in the temporal neocortex. However, this situation was lessened in circumstances such as a longer duration of epilepsy or higher seizure frequency. It is concluded that decrease in H3 Rs function and enhanced levels of histamine may contribute to the epileptic activity in the hippocampus and temporal neocortex of patients with pharmacoresistant MTLE.

  4. Phosphatase inhibitors remove the run-down of γ-aminobutyric acid type A receptors in the human epileptic brain

    PubMed Central

    Palma, E.; Ragozzino, D. A.; Di Angelantonio, S.; Spinelli, G.; Trettel, F.; Martinez-Torres, A.; Torchia, G.; Arcella, A.; Di Gennaro, G.; Quarato, P. P.; Esposito, V.; Cantore, G.; Miledi, R.; Eusebi, F.

    2004-01-01

    The properties of γ-aminobutyric acid (GABA) type A receptors (GABAA receptors) microtransplanted from the human epileptic brain to the plasma membrane of Xenopus oocytes were compared with those recorded directly from neurons, or glial cells, in human brains slices. Cell membranes isolated from brain specimens, surgically obtained from six patients afflicted with drug-resistant temporal lobe epilepsy (TLE) were injected into frog oocytes. Within a few hours, these oocytes acquired GABAA receptors that generated GABA currents with an unusual run-down, which was inhibited by orthovanadate and okadaic acid. In contrast, receptors derived from membranes of a nonepileptic hippocampal uncus, membranes from mouse brain, or recombinant rat α1β2γ2-GABA receptors exhibited a much less pronounced GABA-current run-down. Moreover, the GABAA receptors of pyramidal neurons in temporal neocortex slices from the same six epileptic patients exhibited a stronger run-down than the receptors of rat pyramidal neurons. Interestingly, the GABAA receptors of neighboring glial cells remained substantially stable after repetitive activation. Therefore, the excessive GABA-current run-down observed in the membrane-injected oocytes recapitulates essentially what occurs in neurons, rather than in glial cells. Quantitative RT-PCR analyses from the same TLE neocortex specimens revealed that GABAA-receptor β1, β2, β3, and γ2 subunit mRNAs were significantly overexpressed (8- to 33-fold) compared with control autopsy tissues. Our results suggest that an abnormal GABA-receptor subunit transcription in the TLE brain leads to the expression of run-down-enhanced GABAA receptors. Blockage of phosphatases stabilizes the TLE GABAA receptors and strengthens GABAergic inhibition. It may be that this process can be targeted to develop new treatments for intractable epilepsy. PMID:15218107

  5. Role of low- and high-frequency oscillations in the human hippocampus for encoding environmental novelty during a spatial navigation task.

    PubMed

    Park, Jinsick; Lee, Hojong; Kim, Taekyung; Park, Ga Young; Lee, Eun Mi; Baek, Seunghee; Ku, Jeonghun; Kim, In Young; Kim, Sun I; Jang, Dong Pyo; Kang, Joong Koo

    2014-11-01

    The hippocampus plays a key role in the encoding and retrieval of information related to novel environments during spatial navigation. However, the neural basis for these processes in the human hippocampus remains unknown because it is difficult to directly measure neural signals in the human hippocampus. This study investigated hippocampal neural oscillations involved in encoding novel environments during spatial navigation in a virtual environment. Seven epileptic patients with implanted intracranial hippocampal depth electrodes performed three sessions of virtual environment navigation. Each session consisted of a navigation task and a location-recall task. The navigation task consisted of eight blocks, and in each block, the participant navigated to the location of four different objects and was instructed to remember the location of the objects. After the eight blocks were completed, a location-recall task was performed for each of the four objects. Intracranial electroencephalography data were monitored during the navigation tasks. Theta (5-8 Hz) and delta (1-4 Hz) oscillations were lower in the first block (novel environment) than in the eighth block (familiar environment) of the navigation task, and significantly increased from block one to block eight. By contrast, low-gamma (31-50 Hz) oscillations were higher in the first block than in the eighth block of the navigation task, and significantly decreased from block one to block eight. Comparison of sessions with high recall performance (low error between identified and actual object location) and low recall performance revealed that high-gamma (51-100 Hz) oscillations significantly decreased from block one to block eight only in sessions with high recall performance. These findings suggest that delta, theta, and low-gamma oscillations were associated with encoding of environmental novelty and high-gamma oscillations were important for the successful encoding of environmental novelty.

  6. Intrinsic connectivity between the hippocampus, nucleus accumbens, and ventral tegmental area in humans.

    PubMed

    Kahn, I; Shohamy, D

    2013-03-01

    Recent studies suggest that memory formation in the hippocampus is modulated by the motivational significance of events, allowing past experience to adaptively guide behavior. The effects of motivation on memory are thought to depend on interactions between the hippocampus, the ventral tegmental area (VTA), and the nucleus accumbens (NAcc). Indeed, animal studies reveal anatomical pathways for circuit-level interaction between these regions. However, a homologue circuit connectivity in humans remains to be shown. We characterized this circuitry in humans by exploiting spontaneous low-frequency modulations in the fMRI signal (termed resting-state functional connectivity), which are thought to reflect functionally related regions and their organization into functional networks in the brain. We examined connectivity in this network across two datasets (hi-resolution, n = 100; standard resolution, n = 894). Results reveal convergent connectivity between the hippocampus, and both the NAcc and the VTA centered on ventral regions in the body of the hippocampus. Additionally, we found individual differences in the strength of connectivity within this network. Together, these results provide a novel task-independent characterization of circuitry underlying interactions between the hippocampus, NAcc, and VTA and provide a framework with which to understand how connectivity might reflect and constrain the effects of motivation on memory.

  7. Hippocampus, Perirhinal Cortex, and Complex Visual Discriminations in Rats and Humans

    ERIC Educational Resources Information Center

    Hales, Jena B.; Broadbent, Nicola J.; Velu, Priya D.; Squire, Larry R.; Clark, Robert E.

    2015-01-01

    Structures in the medial temporal lobe, including the hippocampus and perirhinal cortex, are known to be essential for the formation of long-term memory. Recent animal and human studies have investigated whether perirhinal cortex might also be important for visual perception. In our study, using a simultaneous oddity discrimination task, rats with…

  8. Physical Exercise Habits Correlate with Gray Matter Volume of the Hippocampus in Healthy Adult Humans

    NASA Astrophysics Data System (ADS)

    Killgore, William D. S.; Olson, Elizabeth A.; Weber, Mareen

    2013-12-01

    Physical activity facilitates neurogenesis of dentate cells in the rodent hippocampus, a brain region critical for memory formation and spatial representation. Recent findings in humans also suggest that aerobic exercise can lead to increased hippocampal volume and enhanced cognitive functioning in children and elderly adults. However, the association between physical activity and hippocampal volume during the period from early adulthood through middle age has not been effectively explored. Here, we correlated the number of minutes of self-reported exercise per week with gray matter volume of the hippocampus using voxel-based morphometry (VBM) in 61 healthy adults ranging from 18 to 45 years of age. After controlling for age, gender, and total brain volume, total minutes of weekly exercise correlated significantly with volume of the right hippocampus. Findings highlight the relationship between regular physical exercise and brain structure during early to middle adulthood.

  9. Memory, visual discrimination performance, and the human hippocampus.

    PubMed

    Kim, Soyun; Jeneson, Annette; van der Horst, Anna S; Frascino, Jennifer C; Hopkins, Ramona O; Squire, Larry R

    2011-02-16

    We evaluated recent proposals that the hippocampus supports certain kinds of visual discrimination performance, for example, when spatial processing is required and the stimuli have a high degree of feature overlap. Patients with circumscribed hippocampal lesions tried to discriminate between images of similar faces or images of similar scenes. In one condition, elements of the stimulus display repeated from trial to trial, and in another condition every trial was unique. In the repeated condition for both faces and scenes, controls gradually improved their performance across testing. In the trial-unique condition, no improvement occurred. The patients were impaired for both faces and scenes in the repeated condition where controls could benefit from learning. However, the patients were fully intact in the trial-unique condition. The results suggest that previous reports of impaired discrimination performance after medial temporal lobe damage may reflect impaired learning rather than impaired visual perception. The findings support the fundamental idea that memory is a distinct cerebral function separable from other perceptual and cognitive abilities.

  10. Julius Caesar Arantius (Giulio Cesare Aranzi, 1530-1589) and the hippocampus of the human brain: history behind the discovery.

    PubMed

    Bir, Shyamal C; Ambekar, Sudheer; Kukreja, Sunil; Nanda, Anil

    2015-04-01

    Julius Caesar Arantius is one of the pioneer anatomists and surgeons of the 16th century who discovered the different anatomical structures of the human body. One of his prominent discoveries is the hippocampus. At that time, Arantius originated the term hippocampus, from the Greek word for seahorse (hippos ["horse"] and kampos ["sea monster"]). Arantius published his description of the hippocampus in 1587, in the first chapter of his work titled De Humano Foetu Liber. Numerous nomenclatures of this structure, including "white silkworm," "Ammon's horn," and "ram's horn" were proposed by different scholars at that time. However, the term hippocampus has become the most widely used in the literature.

  11. Synaptic vesicle protein2A decreases in amygdaloid-kindling pharmcoresistant epileptic rats.

    PubMed

    Shi, Jing; Zhou, Feng; Wang, Li-kun; Wu, Guo-feng

    2015-10-01

    Synaptic vesicle protein 2A (SV2A) involvement has been reported in the animal models of epilepsy and in human intractable epilepsy. The difference between pharmacosensitive epilepsy and pharmacoresistant epilepsy remains poorly understood. The present study aimed to observe the hippocampus SV2A protein expression in amygdale-kindling pharmacoresistant epileptic rats. The pharmacosensitive epileptic rats served as control. Amygdaloid-kindling model of epilepsy was established in 100 healthy adult male Sprague-Dawley rats. The kindled rat model of epilepsy was used to select pharmacoresistance by testing their seizure response to phenytoin and phenobarbital. The selected pharmacoresistant rats were assigned to a pharmacoresistant epileptic group (PRE group). Another 12 pharmacosensitive epileptic rats (PSE group) served as control. Immunohistochemistry, real-time PCR and Western blotting were used to determine SV2A expression in the hippocampus tissue samples from both the PRE and the PSE rats. Immunohistochemistry staining showed that SV2A was mainly accumulated in the cytoplasm of the neurons, as well as along their dendrites throughout all subfields of the hippocampus. Immunoreactive staining level of SV2A-positive cells was 0.483 ± 0.304 in the PRE group and 0.866 ± 0.090 in the PSE group (P < 0.05). Real-time PCR analysis demonstrated that 2(-ΔΔCt) value of SV2A mRNA was 0.30 ± 0.43 in the PRE group and 0.76 ± 0.18 in the PSE group (P < 0.05). Western blotting analysis obtained the similar findings (0.27 ± 0.21 versus 1.12 ± 0.21, P < 0.05). PRE rats displayed a significant decrease of SV2A in the brain. SV2A may be associated with the pathogenesis of intractable epilepsy of the amygdaloid-kindling rats.

  12. Gene expression in human hippocampus from cocaine abusers identifies genes which regulate extracellular matrix remodeling.

    PubMed

    Mash, Deborah C; ffrench-Mullen, Jarlath; Adi, Nikhil; Qin, Yujing; Buck, Andrew; Pablo, John

    2007-11-14

    The chronic effects of cocaine abuse on brain structure and function are blamed for the inability of most addicts to remain abstinent. Part of the difficulty in preventing relapse is the persisting memory of the intense euphoria or cocaine "rush". Most abused drugs and alcohol induce neuroplastic changes in brain pathways subserving emotion and cognition. Such changes may account for the consolidation and structural reconfiguration of synaptic connections with exposure to cocaine. Adaptive hippocampal plasticity could be related to specific patterns of gene expression with chronic cocaine abuse. Here, we compare gene expression profiles in the human hippocampus from cocaine addicts and age-matched drug-free control subjects. Cocaine abusers had 151 gene transcripts upregulated, while 91 gene transcripts were downregulated. Topping the list of cocaine-regulated transcripts was RECK in the human hippocampus (FC = 2.0; p<0.05). RECK is a membrane-anchored MMP inhibitor that is implicated in the coordinated regulation of extracellular matrix integrity and angiogenesis. In keeping with elevated RECK expression, active MMP9 protein levels were decreased in the hippocampus from cocaine abusers. Pathway analysis identified other genes regulated by cocaine that code for proteins involved in the remodeling of the cytomatrix and synaptic connections and the inhibition of blood vessel proliferation (PCDH8, LAMB1, ITGB6, CTGF and EphB4). The observed microarray phenotype in the human hippocampus identified RECK and other region-specific genes that may promote long-lasting structural changes with repeated cocaine abuse. Extracellular matrix remodeling in the hippocampus may be a persisting effect of chronic abuse that contributes to the compulsive and relapsing nature of cocaine addiction.

  13. Low-frequency theta oscillations in the human hippocampus during real-world and virtual navigation.

    PubMed

    Bohbot, Véronique D; Copara, Milagros S; Gotman, Jean; Ekstrom, Arne D

    2017-02-14

    Low-Frequency Oscillations (LFO) in the range of 7-9 Hz, or theta rhythm, has been recorded in rodents ambulating in the real world. However, intra-hippocampus EEG recordings during virtual navigation in humans have consistently reported LFO that appear to predominate around 3-4 Hz. Here we report clear evidence of 7-9 Hz rhythmicity in raw intra-hippocampus EEG traces during real as well as virtual movement. Oscillations typically occur at a lower frequency in virtual than real world navigation. This study highlights the possibility that human and rodent hippocampal EEG activity are not as different as previously reported and this difference may arise, in part, due to the lack of actual movement in previous human navigation studies, which were virtual.

  14. Low-frequency theta oscillations in the human hippocampus during real-world and virtual navigation

    PubMed Central

    Bohbot, Véronique D.; Copara, Milagros S.; Gotman, Jean; Ekstrom, Arne D.

    2017-01-01

    Low-Frequency Oscillations (LFO) in the range of 7–9 Hz, or theta rhythm, has been recorded in rodents ambulating in the real world. However, intra-hippocampus EEG recordings during virtual navigation in humans have consistently reported LFO that appear to predominate around 3–4 Hz. Here we report clear evidence of 7–9 Hz rhythmicity in raw intra-hippocampus EEG traces during real as well as virtual movement. Oscillations typically occur at a lower frequency in virtual than real world navigation. This study highlights the possibility that human and rodent hippocampal EEG activity are not as different as previously reported and this difference may arise, in part, due to the lack of actual movement in previous human navigation studies, which were virtual. PMID:28195129

  15. Direct Electrical Stimulation of the Human Entorhinal Region and Hippocampus Impairs Memory.

    PubMed

    Jacobs, Joshua; Miller, Jonathan; Lee, Sang Ah; Coffey, Tom; Watrous, Andrew J; Sperling, Michael R; Sharan, Ashwini; Worrell, Gregory; Berry, Brent; Lega, Bradley; Jobst, Barbara C; Davis, Kathryn; Gross, Robert E; Sheth, Sameer A; Ezzyat, Youssef; Das, Sandhitsu R; Stein, Joel; Gorniak, Richard; Kahana, Michael J; Rizzuto, Daniel S

    2016-12-07

    Deep brain stimulation (DBS) has shown promise for treating a range of brain disorders and neurological conditions. One recent study showed that DBS in the entorhinal region improved the accuracy of human spatial memory. Based on this line of work, we performed a series of experiments to more fully characterize the effects of DBS in the medial temporal lobe on human memory. Neurosurgical patients with implanted electrodes performed spatial and verbal-episodic memory tasks. During the encoding periods of both tasks, subjects received electrical stimulation at 50 Hz. In contrast to earlier work, electrical stimulation impaired memory performance significantly in both spatial and verbal tasks. Stimulation in both the entorhinal region and hippocampus caused decreased memory performance. These findings indicate that the entorhinal region and hippocampus are causally involved in human memory and suggest that refined methods are needed to use DBS in these regions to improve memory.

  16. Human hippocampus represents space and time during retrieval of real-world memories

    PubMed Central

    Nielson, Dylan M.; Smith, Troy A.; Sreekumar, Vishnu; Dennis, Simon; Sederberg, Per B.

    2015-01-01

    Memory stretches over a lifetime. In controlled laboratory settings, the hippocampus and other medial temporal lobe brain structures have been shown to represent space and time on the scale of meters and seconds. It remains unclear whether the hippocampus also represents space and time over the longer scales necessary for human episodic memory. We recorded neural activity while participants relived their own experiences, cued by photographs taken with a custom lifelogging device. We found that the left anterior hippocampus represents space and time for a month of remembered events occurring over distances of up to 30 km. Although previous studies have identified similar drifts in representational similarity across space or time over the relatively brief time scales (seconds to minutes) that characterize individual episodic memories, our results provide compelling evidence that a similar pattern of spatiotemporal organization also exists for organizing distinct memories that are distant in space and time. These results further support the emerging view that the anterior, as opposed to posterior, hippocampus integrates distinct experiences, thereby providing a scaffold for encoding and retrieval of autobiographical memories on the scale of our lives. PMID:26283350

  17. Defining the human hippocampus in cerebral magnetic resonance images—An overview of current segmentation protocols

    PubMed Central

    Konrad, C.; Ukas, T.; Nebel, C.; Arolt, V.; Toga, A.W.; Narr, K.L.

    2011-01-01

    Due to its crucial role for memory processes and its relevance in neurological and psychiatric disorders, the hippocampus has been the focus of neuroimaging research for several decades. In vivo measurement of human hippocampal volume and shape with magnetic resonance imaging has become an important element of neuroimaging research. Nevertheless, volumetric findings are still inconsistent and controversial for many psychiatric conditions including affective disorders. Here we review the wealth of anatomical protocols for the delineation of the hippocampus in MR images, taking into consideration 71 different published protocols from the neuroimaging literature, with an emphasis on studies of affective disorders. We identified large variations between protocols in five major areas. 1) The inclusion/exclusion of hippocampal white matter (alveus and fimbria), 2) the definition of the anterior hippocampal–amygdala border, 3) the definition of the posterior border and the extent to which the hippocampal tail is included, 4) the definition of the inferior medial border of the hippocampus, and 5) the use of varying arbitrary lines. These are major sources of variance between different protocols. In contrast, the definitions of the lateral, superior, and inferior borders are less disputed. Directing resources to replication studies that incorporate characteristics of the segmentation protocols presented herein may help resolve seemingly contradictory volumetric results between prior neuroimaging studies and facilitate the appropriate selection of protocols for manual or automated delineation of the hippocampus for future research purposes. PMID:19447182

  18. Do Single Seizures Cause Neuronal Death in the Human Hippocampus?

    PubMed Central

    Rocha, Luisa L; Lopez-Meraz, Maria-Leonor; Niquet, Jerome; Wasterlain, Claude G

    2007-01-01

    The question of whether repeated single seizures cause neuronal death in the adult human brain is of great clinical importance and might have broad therapeutic implications. Reviewed here are recent studies on the effects of repeated single seizures (in the absence of status epilepticus) on hippocampal volume and on neuronal death markers in blood and in surgically ablated hippocampi. PMID:17520081

  19. Prestimulus theta in the human hippocampus predicts subsequent recognition but not recall.

    PubMed

    Merkow, Maxwell B; Burke, John F; Stein, Joel M; Kahana, Michael J

    2014-12-01

    Human theta (4-8 Hz) activity in the medial temporal lobe correlates with memory formation; however, the precise role that theta plays in the memory system remains elusive (Hanslmayr and Staudigl, ). Recently, prestimulus theta activity has been associated with successful memory formation, although its specific cognitive role remains unknown (e.g., Fell et al., 2011). In this report, we demonstrate that prestimulus theta in the hippocampus indexes encoding that supports old-new recognition memory but not recall. These findings suggest that human hippocampal prestimulus theta may preferentially participate in the encoding of item information, as opposed to associative information.

  20. Prestimulus theta in the human hippocampus predicts subsequent recognition but not recall

    PubMed Central

    Merkow, Maxwell B.; Burke, John F.; Stein, Joel M.; Kahana, Michael J.

    2014-01-01

    Human theta (4−8 Hz) activity in the medial temporal lobe correlates with memory formation; however, the precise role that theta plays in the memory system remains elusive (Hanslmayr and Staudigl, 2013). Recently, prestimulus theta activity has been associated with successful memory formation, although its specific cognitive role remains unknown (e.g. Fell et al., 2011). In this report, we demonstrate that prestimulus theta in the hippocampus indexes encoding that supports old–new recognition memory but not recall. These findings suggest that human hippocampal prestimulus theta may preferentially participate in the encoding of item information, as opposed to associative information. PMID:25074395

  1. Counselling the Epileptic Patient

    PubMed Central

    Jones, Barry

    1983-01-01

    Today, most epileptics can participate freely in a wide range of activities. However, their epilepsy does create some special problems. The degree to which they participate in sports is governed by their degree of seizure control, as are their employment opportunities and driving privileges. Epilepsy does not appear to be a major stress factor in marriage as long as the spouse is knowledgeable about the condition. Epileptic women usually have normal pregnancies though their relative risks are perhaps double those for the non-epileptic population. Children of epileptic women have about four times the general population's risk of seizure but the absolute level of risk is not high. PMID:21286585

  2. Firing Behavior and Network Activity of Single Neurons in Human Epileptic Hypothalamic Hamartoma

    PubMed Central

    Steinmetz, Peter N.; Wait, Scott D.; Lekovic, Gregory P.; Rekate, Harold L.; Kerrigan, John F.

    2013-01-01

    Objective: Human hypothalamic hamartomas (HH) are intrinsically epileptogenic and are associated with treatment-resistant gelastic seizures. The basic cellular mechanisms responsible for seizure onset within HH are unknown. We used intra-operative microwire recordings of single neuron activity to measure the spontaneous firing rate of neurons and the degree of functional connection between neurons within the tumor. Technique: Fourteen patients underwent transventricular endoscopic resection of HH for treatment-resistant epilepsy. Prior to surgical resection, single neuron recordings from bundled microwires (total of nine contacts) were obtained from HH tissue. Spontaneous activity was recorded for two or three 5-min epochs under steady-state general anesthesia. Off-line analysis included cluster analysis of single unit activity and probability analysis of firing relationships between pairs of neurons. Results: Altogether, 222 neurons were identified (mean 6 neurons per recording epoch). Cluster analysis of single neuron firing utilizing a mixture of Gaussians model identified two distinct populations on the basis of firing rate (median firing frequency 0.6 versus 15.0 spikes per second; p < 10−5). Cluster analysis identified three populations determined by levels of burst firing (median burst indices of 0.015, 0.18, and 0.39; p < 10−15). Unbiased analysis of spontaneous single unit behavior showed that 51% of all possible neuron pairs within each recording epoch had a significant level of firing synchrony (p < 10−15). The subgroup of neurons with higher median firing frequencies was more likely to demonstrate synchronous firing (p < 10−7). Conclusion: Hypothalamic hamartoma tissue in vivo contains neurons which fire spontaneously. The activity of single neurons is diverse but distributes into at least two electrophysiological phenoytpes. Functional linkage between single neurons suggests that HH neurons exist within local networks that may

  3. Dynamic Expression Patterns of Progenitor and Pyramidal Neuron Layer Markers in the Developing Human Hippocampus.

    PubMed

    Cipriani, Sara; Nardelli, Jeannette; Verney, Catherine; Delezoide, Anne-Lise; Guimiot, Fabien; Gressens, Pierre; Adle-Biassette, Homa

    2016-03-01

    The molecular mechanisms underlying the formation of hippocampus are unknown in humans. To improve our knowledge of molecules that potentially regulate pyramidal neurogenesis and layering in various hippocampal fields, we investigated the expression of progenitor markers and cell fate molecules from gestational week (GW) 9 to GW 20. At GW 9, the progenitor cell compartment of the hippocampal formation mainly consisted of PAX6(+) cells in the ventricular zone. Between GW 9 and 11, a second germinal area, the subventricular zone (SVZ), was formed, as shown by TBR2 labeling. Postmitotic markers (TBR1, CTIP2, SATB2, and CUX1) might reflect the inside-out layering of the plate from GW 11 onwards. TBR1(+) neurons appeared in the deep plate, whereas CTIP2(+), SATB2(+), and CUX1(+) neurons occupied the upper layers. From GW 16, differences in layer segregation were observed between the ammonic and subicular plates. Moreover, an ammonic-to-subicular maturation gradient was observed in germinal/postmitotic areas. Taken together, these findings demonstrate for the first time the presence of an SVZ in the hippocampus of human fetuses and laminar differences in transcription factor expression in the pyramidal layer of the human ammonic and subicular plate, and provide new information to further investigate the connectivity of the hippocampal formation.

  4. Functional contributions and interactions between the human hippocampus and subregions of the striatum during arbitrary associative learning and memory.

    PubMed

    Mattfeld, Aaron T; Stark, Craig E L

    2015-08-01

    The hippocampus and striatum are thought to have different functional roles in learning and memory. It is unknown under what experimental conditions their contributions are dissimilar or converge, and the extent to which they interact over the course of learning. In order to evaluate both the functional contributions of as well as the interactions between the human hippocampus and striatum, the present study used high-resolution functional magnetic resonance imaging (fMRI) and variations of a conditional visuomotor associative learning task that either taxed arbitrary associative learning (Experiment 1) or stimulus-response learning (Experiment 2). In the first experiment, we observed changes in activity in the hippocampus and anterior caudate that reflect differences between the two regions consistent with distinct computational principles. In the second experiment, we observed activity in the putamen that reflected content specific representations during the learning of arbitrary conditional visuomotor associations. In both experiments, the hippocampus and ventral striatum demonstrated dynamic functional coupling during the learning of new arbitrary associations, but not during retrieval of well-learned arbitrary associations using control variants of the tasks that did not preferentially tax one system versus the other. These findings suggest that both the hippocampus and subregions of the dorsal striatum contribute uniquely to the learning of arbitrary associations while the hippocampus and ventral striatum interact over the course of learning.

  5. Multivoxel pattern analysis reveals 3D place information in the human hippocampus.

    PubMed

    Kim, Misun; Jeffery, Kate J; Maguire, Eleanor A

    2017-03-20

    The spatial world is three-dimensional (3D), and humans and other animals move both horizontally and vertically within it. Extant neuroscientific studies have typically investigated spatial navigation on a horizontal two-dimensional plane, leaving much unknown about how 3D spatial information is represented in the brain. Specifically, horizontal and vertical information may be encoded in the same or different neural structures with equal or unequal sensitivity. Here, we investigated these possibilities using functional MRI (fMRI) while participants were passively moved within a 3D lattice structure as if riding a rollercoaster. Multivoxel pattern analysis was used to test for the existence of information relating to where and in which direction participants were heading in this virtual environment. Behaviorally, participants had similarly accurate memory for vertical and horizontal locations, and the right anterior hippocampus expressed place information that was sensitive to changes along both horizontal and vertical axes. This is suggestive of isotropic 3D place encoding. By contrast, participants indicated their heading direction faster and more accurately when they were heading in a tilted-up or tilted-down direction. This direction information was expressed in the right retrosplenial cortex and posterior hippocampus, and was only sensitive to vertical pitch, which could reflect the importance of the vertical (gravity) axis as a reference frame. Overall, our findings extend previous knowledge of how we represent the spatial world and navigate within it, by taking into account the important third dimension.SIGNIFICANCE STATEMENTThe spatial world is three-dimensional (3D) -- we can move horizontally across surfaces, but also vertically, going up slopes or stairs. Little is known about how the brain supports representations of 3D space. A key question is whether or not horizontal and vertical information is equally well represented. Here we measured functional MRI

  6. Property of Regenerating Serotonin Fibers in the Hippocampus of Human Migration Disorders Model

    NASA Astrophysics Data System (ADS)

    Ueda, Shuichi; Ehara, Ayuka; Ohmomo, Hideki

    Individual mood and mental conditions exert a great influence on one's own kansei. Abnormality or dysfunction of the 5-HT neuron system in the developing and/or adult brain is closely associated with their conditions. Thus, the 5-HT neuron system may play an important role in the neuronal mechanisms underlying kansei. Interestingly, previous studies have shown that heterotopic clusters in the hippocampus (hippocampal heterotopia), deriving from neocortical neurons, after prenatally treated with methylazoxymethanol acetate in rat (MAM rat), exhibit abundant 5-HT innervation. After neonatal intracisternal 5, 7-dihydroxytryptamine (DHT) injection, these 5-HT fibers degenerate and disappear throughout the forebrain, and then regenerating 5-HT fibers densely innervate in the hippocampal heterotopia. The 5-HT fiber system in the hippocampal heterotopia of MAM rat provides useful experimental models for study the plasticity of human migration disorder. In the present study, to evaluate the properties of regenerating 5-HT fibers in the hippocampal heterotopia of MAM rats, we examined the origin of these projections by combined retrograde transport and immunohistochemical methods. Prenatal exposure to MAM resulted in the formation of hippocampal heterotopia in the dorsal hippocampus. Regenerating 5-HT fibers formed a dense innervation within the hippocampal heterotopia after neonatal DHT injection. These projections appeared to arise mainly from 5-HT neurons in the median raphe nucleus, with a small portion from 5-HT neurons in the dorsal raphe nucleus. These findings suggest a specific profile of regenerating 5-HT fibers, providing the new insights for serotonergic plasticity.

  7. Adult-onset focal expression of mutated human tau in the hippocampus impairs spatial working memory of rats.

    PubMed

    Mustroph, Martina L; King, Michael A; Klein, Ronald L; Ramirez, Julio J

    2012-07-15

    Tauopathy in the hippocampus is one of the earliest cardinal features of Alzheimer's disease (AD), a condition characterized by progressive memory impairments. In fact, density of tau neurofibrillary tangles (NFTs) in the hippocampus strongly correlates with severity of cognitive impairments in AD. In the present study, we employed a somatic cell gene transfer technique to create a rodent model of tauopathy by injecting a recombinant adeno-associated viral vector with a mutated human tau gene (P301L) into the hippocampus of adult rats. The P301L mutation is causal for frontotemporal dementia with parkinsonism-17 (FTDP-17), but it has been used for studying memory effects characteristic of AD in transgenic mice. To ascertain if P301L-induced mnemonic deficits are persistent, animals were tested for 6 months. It was hypothesized that adult-onset, spatially restricted tau expression in the hippocampus would produce progressive spatial working memory deficits on a learned alternation task. Rats injected with the tau vector exhibited persistent impairments on the hippocampal-dependent task beginning at about 6 weeks post-transduction compared to rats injected with a green fluorescent protein vector. Histological analysis of brains for expression of human tau revealed hyperphosphorylated human tau and NFTs in the hippocampus in experimental animals only. Thus, adult-onset, vector-induced tauopathy spatially restricted to the hippocampus progressively impaired spatial working memory in rats. We conclude that the model faithfully reproduces histological and behavioral findings characteristic of dementing tauopathies. The rapid onset of sustained memory impairment establishes a preclinical model particularly suited to the development of potential tauopathy therapeutics.

  8. Similarity in form and function of the hippocampus in rodents, monkeys, and humans

    PubMed Central

    Clark, Robert E.; Squire, Larry R.

    2013-01-01

    We begin by describing an historical scientific debate in which the fundamental idea that species are related by evolutionary descent was challenged. The challenge was based on supposed neuroanatomical differences between humans and other primates with respect to a structure known then as the hippocampus minor. The debate took place in the early 1860s, just after the publication of Darwin’s famous book. We then recount the difficult road that was traveled to develop an animal model of human memory impairment, a matter that also turned on questions about similarities and differences between humans and other primates. We then describe how the insight that there are multiple memory systems helped to secure the animal model and how the animal model was ultimately used to identify the neuroanatomy of long-term declarative memory (sometimes termed explicit memory). Finally, we describe a challenge to the animal model and to cross-species comparisons by considering the case of the concurrent discrimination task, drawing on findings from humans and monkeys. We suggest that analysis of such cases, based on the understanding that there are multiple memory systems with different properties, has served to emphasize the similarities in memory function across mammalian species. PMID:23754372

  9. Painful laser stimuli induce directed functional interactions within and between the human amygdala and hippocampus

    PubMed Central

    Liu, C.C.; Shi, C-Q; Franaszczuk, P.J.; Crone, N.E.; Schretlen, D.; Ohara, S.; Lenz, F.A.

    2011-01-01

    The pathways by which painful stimuli are signaled within the human medial temporal lobe are unknown. Rodent studies have shown that nociceptive inputs are transmitted from the brainstem or thalamus through one of two pathways to the central nucleus of the amygdala. The indirect pathway projects from the basal and lateral nuclei of the amygdala to the central nucleus, while the direct pathway projects directly to the central nucleus. We now test the hypothesis that the human ventral amygdala (putative basal and lateral nuclei) exerts a causal influence upon the dorsal amygdala (putative central nucleus), during the application of a painful laser stimulus. Local field potentials (LFPs) were recorded from depth electrode contacts implanted in the medial temporal lobe for the treatment of epilepsy, and causal influences were analyzed by Granger causality (GRC). This analysis indicates that the dorsal amygdala exerts a pre-stimulus causal influence upon the hippocampus, consistent with an attention-related response to the painful laser. Within the amygdala, the analysis indicates that the ventral contacts exert a causal influence upon dorsal contacts, consistent with the human (putative) indirect pathway. Potentials evoked by the laser (LEPs) were not recorded in the ventral nuclei, but were recorded at dorsal amygdala contacts which were not preferentially those receiving causal influences from the ventral contacts. Therefore, it seems likely that the putative indirect pathway is associated with causal influences from the ventral to the dorsal amygdala, and is distinct from the human (putative) indirect pathway which mediates LEPs in the dorsal amygdala. PMID:21256929

  10. Hippocampus, perirhinal cortex, and complex visual discriminations in rats and humans

    PubMed Central

    Hales, Jena B.; Broadbent, Nicola J.; Velu, Priya D.

    2015-01-01

    Structures in the medial temporal lobe, including the hippocampus and perirhinal cortex, are known to be essential for the formation of long-term memory. Recent animal and human studies have investigated whether perirhinal cortex might also be important for visual perception. In our study, using a simultaneous oddity discrimination task, rats with perirhinal lesions were impaired and did not exhibit the normal preference for exploring the odd object. Notably, rats with hippocampal lesions exhibited the same impairment. Thus, the deficit is unlikely to illuminate functions attributed specifically to perirhinal cortex. Both lesion groups were able to acquire visual discriminations involving the same objects used in the oddity task. Patients with hippocampal damage or larger medial temporal lobe lesions were intact in a similar oddity task that allowed participants to explore objects quickly using eye movements. We suggest that humans were able to rely on an intact working memory capacity to perform this task, whereas rats (who moved slowly among the objects) needed to rely on long-term memory. PMID:25593294

  11. In-vivo Dynamics of the Human Hippocampus across the Menstrual Cycle

    PubMed Central

    Barth, Claudia; Steele, Christopher J; Mueller, Karsten; Rekkas, Vivien P.; Arélin, Katrin; Pampel, Andre; Burmann, Inga; Kratzsch, Jürgen; Villringer, Arno; Sacher, Julia

    2016-01-01

    Sex hormones fluctuate during the menstrual cycle. Evidence from animal studies suggests similar subtle fluctuations in hippocampal structure, predominantly linked to estrogen. Hippocampal abnormalities have been observed in several neuropsychiatric pathologies with prominent sexual dimorphism. Yet, the potential impact of subtle sex-hormonal fluctuations on human hippocampal structure in health is unclear. We tested the feasibility of longitudinal neuroimaging in conjunction with rigorous menstrual cycle monitoring to evaluate potential changes in hippocampal microstructure associated with physiological sex-hormonal changes. Thirty longitudinal diffusion weighted imaging scans of a single healthy female subject were acquired across two full menstrual cycles. We calculated hippocampal fractional anisotropy (FA), a measure sensitive to changes in microstructural integrity, and investigated potential correlations with estrogen. We observed a significant positive correlation between FA values and estrogen in the hippocampus bilaterally, revealing a peak in FA closely paralleling ovulation. This exploratory, single-subject study demonstrates the feasibility of a longitudinal DWI scanning protocol across the menstrual cycle and is the first to link subtle endogenous hormonal fluctuations to changes in FA in vivo. In light of recent attempts to neurally phenotype single humans, our findings highlight menstrual cycle monitoring in parallel with highly sampled individual neuroimaging data to address fundamental questions about the dynamics of plasticity in the adult brain. PMID:27713470

  12. Hippocampus duality: Memory and novelty detection are subserved by distinct mechanisms.

    PubMed

    Barbeau, Emmanuel J; Chauvel, Patrick; Moulin, Christopher J A; Regis, Jean; Liégeois-Chauvel, Catherine

    2017-04-01

    The hippocampus plays a pivotal role both in novelty detection and in long-term memory. The physiological mechanisms underlying these behaviors have yet to be understood in humans. We recorded intracerebral evoked potentials within the hippocampus of epileptic patients (n = 10) during both memory and novelty detection tasks (targets in oddball tasks). We found that memory and detection tasks elicited late local field potentials in the hippocampus during the same period, but of opposite polarity (negative during novelty detection tasks, positive during memory tasks, ∼260-600 ms poststimulus onset, P < 0.05). Critically, these potentials had maximal amplitude on the same contact in the hippocampus for each patient. This pattern did not depend on the task as different types of memory and novelty detection tasks were used. It did not depend on the novelty of the stimulus or the difficulty of the task either. Two different hypotheses are discussed to account for this result: it is either due to the activation of CA1 pyramidal neurons by two different pathways such as the monosynaptic and trisynaptic entorhinal-hippocampus pathways, or to the activation of different neuronal populations, that is, differing either functionally (e.g., novelty/familiarity neurons) or located in different regions of the hippocampus (e.g., CA1/subiculum). In either case, these activities may integrate the activity of two distinct large-scale networks implementing externally or internally oriented, mutually exclusive, brain states. © 2017 Wiley Periodicals, Inc.

  13. Functional cross-hemispheric shift between object-place paired associate memory and spatial memory in the human hippocampus.

    PubMed

    Lee, Choong-Hee; Ryu, Jungwon; Lee, Sang-Hun; Kim, Hakjin; Lee, Inah

    2016-08-01

    The hippocampus plays critical roles in both object-based event memory and spatial navigation, but it is largely unknown whether the left and right hippocampi play functionally equivalent roles in these cognitive domains. To examine the hemispheric symmetry of human hippocampal functions, we used an fMRI scanner to measure BOLD activity while subjects performed tasks requiring both object-based event memory and spatial navigation in a virtual environment. Specifically, the subjects were required to form object-place paired associate memory after visiting four buildings containing discrete objects in a virtual plus maze. The four buildings were visually identical, and the subjects used distal visual cues (i.e., scenes) to differentiate the buildings. During testing, the subjects were required to identify one of the buildings when cued with a previously associated object, and when shifted to a random place, the subject was expected to navigate to the previously chosen building. We observed that the BOLD activity foci changed from the left hippocampus to the right hippocampus as task demand changed from identifying a previously seen object (object-cueing period) to searching for its paired-associate place (object-cued place recognition period). Furthermore, the efficient retrieval of object-place paired associate memory (object-cued place recognition period) was correlated with the BOLD response of the left hippocampus, whereas the efficient retrieval of relatively pure spatial memory (spatial memory period) was correlated with the right hippocampal BOLD response. These findings suggest that the left and right hippocampi in humans might process qualitatively different information for remembering episodic events in space. © 2016 The Authors Hippocampus Published by Wiley Periodicals, Inc.

  14. Functional cross‐hemispheric shift between object‐place paired associate memory and spatial memory in the human hippocampus

    PubMed Central

    Lee, Choong‐Hee; Ryu, Jungwon; Lee, Sang‐Hun; Kim, Hakjin

    2016-01-01

    ABSTRACT The hippocampus plays critical roles in both object‐based event memory and spatial navigation, but it is largely unknown whether the left and right hippocampi play functionally equivalent roles in these cognitive domains. To examine the hemispheric symmetry of human hippocampal functions, we used an fMRI scanner to measure BOLD activity while subjects performed tasks requiring both object‐based event memory and spatial navigation in a virtual environment. Specifically, the subjects were required to form object‐place paired associate memory after visiting four buildings containing discrete objects in a virtual plus maze. The four buildings were visually identical, and the subjects used distal visual cues (i.e., scenes) to differentiate the buildings. During testing, the subjects were required to identify one of the buildings when cued with a previously associated object, and when shifted to a random place, the subject was expected to navigate to the previously chosen building. We observed that the BOLD activity foci changed from the left hippocampus to the right hippocampus as task demand changed from identifying a previously seen object (object‐cueing period) to searching for its paired‐associate place (object‐cued place recognition period). Furthermore, the efficient retrieval of object‐place paired associate memory (object‐cued place recognition period) was correlated with the BOLD response of the left hippocampus, whereas the efficient retrieval of relatively pure spatial memory (spatial memory period) was correlated with the right hippocampal BOLD response. These findings suggest that the left and right hippocampi in humans might process qualitatively different information for remembering episodic events in space. © 2016 The Authors Hippocampus Published by Wiley Periodicals, Inc. PMID:27009679

  15. Pyramidal neurons in the septal and temporal CA1 field of the human and hedgehog tenrec hippocampus.

    PubMed

    Liagkouras, Ioannis; Michaloudi, Helen; Batzios, Christos; Psaroulis, Dimitrios; Georgiadis, Marios; Künzle, Heinz; Papadopoulos, Georgios C

    2008-07-07

    The present study examines comparatively the cellular density of disector-counted/Nissl-stained CA1 pyramidal neurons and the morphometric characteristics (dendritic number/length, spine number/density and Sholl-counted dendritic branch points/20 microm) of the basal and apical dendritic systems of Golgi-impregnated CA1 neurons, in the septal and temporal hippocampus of the human and hedgehog tenrec brain. The obtained results indicate that in both hippocampal parts the cellular density of the CA1 pyramidal neurons is lower in human than in tenrec. However, while the human pyramidal cell density is higher in the septal hippocampal part than in the temporal one, in the tenrec the density of these cells is higher in the temporal part. The dendritic tree of the CA1 pyramidal cells, more developed in the septal than in temporal hippocampus in both species studied, is in general more complex in the human hippocampus. The basal and the apical dendritic systems exhibit species related morphometric differences, while dendrites of different orders exhibit differences in their number and length, and in their spine density. Finally, in both species, as well as hippocampal parts and dendritic systems, changes of dendritic morphometric features along ascending dendritic orders fluctuate in a similar way, as do the number of dendritic branch points in relation to the distance from the neuron soma.

  16. CA1 neurons in the human hippocampus are critical for autobiographical memory, mental time travel, and autonoetic consciousness

    PubMed Central

    Bartsch, Thorsten; Döhring, Juliane; Rohr, Axel; Jansen, Olav; Deuschl, Günther

    2011-01-01

    Autobiographical memories in our lives are critically dependent on temporal lobe structures. However, the contribution of CA1 neurons in the human hippocampus to the retrieval of episodic autobiographical memory remains elusive. In patients with a rare acute transient global amnesia, highly focal lesions confined to the CA1 field of the hippocampus can be detected on MRI. We studied the effect of these lesions on autobiographical memory using a detailed autobiographical interview including the remember/know procedure. In 14 of 16 patients, focal lesions in the CA1 sector of the hippocampal cornu ammonis were detected. Autobiographical memory was significantly affected over all time periods, including memory for remote periods. Impairment of episodic memory and autonoetic consciousness exhibited a strong temporal gradient extending 30 to 40 y into the past. These results highlight the distinct and critical role of human hippocampal CA1 neurons in autobiographical memory retrieval and for re-experiencing detailed episodic memories. PMID:21987814

  17. Epileptic homocide: a case report.

    PubMed

    Gunn, J

    1978-05-01

    This case report augments a paper published in 1971 (Gunn and Fenton) in which it was indicated that automatic behaviour is a rare explanation for the crimes of epileptic patients. It was claimed that although two possible "automatic" crimes were committed by two epileptic patients among the 46 male epileptics at Broadmoor there were no such crimes committed by any of the 158 male epileptic prisoners who came into a national sample. Since then it has become clear that one man serving life imprisonment, exluded from the epileptic prisoner sample in 1967 because of a doubt about his diagnosis, is definitely epileptic and probably killed his wife during an epileptic attack or its immediate sequela.

  18. Pathophysiology of epileptic encephalopathies.

    PubMed

    Lado, Fred A; Rubboli, Guido; Capovilla, Giuseppe; Capovilla, Pippo; Avanzini, Giuliano; Moshé, Solomon L

    2013-11-01

    The application of metabolic imaging and genetic analysis, and now the development of appropriate animal models, has generated critical insights into the pathogenesis of epileptic encephalopathies. In this article we present ideas intended to move from the lesions associated with epileptic encephalopathies toward understanding the effects of these lesions on the functioning of the brain, specifically of the cortex. We argue that the effects of focal lesions may be magnified through the interaction between cortical and subcortical structures, and that disruption of subcortical arousal centers that regulate cortex early in life may lead to alterations of intracortical synapses that affect a critical period of cognitive development. Impairment of interneuronal function globally through the action of a genetic lesion similarly causes widespread cortical dysfunction manifesting as increased delta slow waves on electroencephalography (EEG) and as developmental delay or arrest clinically. Finally, prolonged focal epileptic activity during sleep (as occurring in the syndrome of continuous spike-wave in slow sleep, or CSWSS) might interfere with local slow wave activity at the site of the epileptic focus, thereby impairing the neural processes and, possibly, the local plastic changes associated with learning and other cognitive functions. Seizures may certainly add to these pathologic processes, but they are likely not necessary for the development of the cognitive pathology. Nevertheless, although seizures may be either a consequence or symptom of the underlying lesion, their effective treatment can improve outcomes as both clinical and experimental studies may suggest. Understanding their substrates may lead to novel, effective treatments for all aspects of the epileptic encephalopathy phenotype.

  19. Differential recruitment of the hippocampus, medial prefrontal cortex, and the human motion complex during path integration in humans.

    PubMed

    Wolbers, Thomas; Wiener, Jan M; Mallot, Hanspeter A; Büchel, Christian

    2007-08-29

    Path integration, the ability to sense self-motion for keeping track of changes in orientation and position, constitutes a fundamental mechanism of spatial navigation and a keystone for the development of cognitive maps. Whereas animal path integration is predominantly supported by the head-direction, grid, and place cell systems, the neural foundations are not well understood in humans. Here we used functional magnetic resonance imaging and a virtual rendition of a triangle completion paradigm to test whether human path integration recruits a cortical system similar to that of rodents and nonhuman primates. Participants traveled along two legs of a triangle before pointing toward the starting location. In accordance with animal models, stronger right hippocampal activation predicted more accurate updating of the starting location on a trial-by-trial basis. Moreover, between-subjects fluctuations in response consistency were negatively correlated with bilateral hippocampal and medial prefrontal activation, and bilateral recruitment of the human motion complex (hMT+) covaried with individual path integration capability. Given that these effects were absent in a perceptual control task, the present study provides the first evidence that visual path integration is related to the dynamic interplay of self-motion processing in hMT+, higher-level spatial processes in the hippocampus, and spatial working memory in medial prefrontal cortex.

  20. The representation of space and the hippocampus in rats, robots and humans.

    PubMed

    Burgess, N; Donnett, J G; O'Keefe, J

    1998-01-01

    Experimental evidence suggests that the hippocampus represents locations within an allocentric representation of space. The environmental inputs that underlie the rat's representation of its own location within an environment (in the firing of place cells) are the distances to walls, and different walls are identified by their allocentric direction from the rat. We propose that the locations of goals in an environment is stored downstream of the place cells, in the subiculum. In addition to firing rate coding, place cells may use phase coding relative to the theta rhythm of the EEG. In some circumstances path integration may be used, in addition to environmental information, as an input to the hippocampal system. A detailed computational model of the hippocampus successfully guides the navigation of a mobile robot. The model's behaviour is compared to electrophysiological and behavioural data in rats, and implications for the role of the hippocampus in primates are explored.

  1. The human hippocampus contributes to both the recollection and familiarity components of recognition memory

    PubMed Central

    Merkow, Maxwell B.; Burke, John F.; Kahana, Michael J.

    2015-01-01

    Despite a substantial body of work comprising theoretical modeling, the effects of medial temporal lobe lesions, and electrophysiological signal analysis, the role of the hippocampus in recognition memory remains controversial. In particular, it is not known whether the hippocampus exclusively supports recollection or both recollection and familiarity—the two latent cognitive processes theorized to underlie recognition memory. We studied recognition memory in a large group of patients undergoing intracranial electroencephalographic (iEEG) monitoring for epilepsy. By measuring high-frequency activity (HFA)—a signal associated with precise spatiotemporal properties—we show that hippocampal activity during recognition predicted recognition memory performance and tracked both recollection and familiarity. Through the lens of dual-process models, these results indicate that the hippocampus supports both the recollection and familiarity processes. PMID:26578784

  2. The human hippocampus contributes to both the recollection and familiarity components of recognition memory.

    PubMed

    Merkow, Maxwell B; Burke, John F; Kahana, Michael J

    2015-11-17

    Despite a substantial body of work comprising theoretical modeling, the effects of medial temporal lobe lesions, and electrophysiological signal analysis, the role of the hippocampus in recognition memory remains controversial. In particular, it is not known whether the hippocampus exclusively supports recollection or both recollection and familiarity--the two latent cognitive processes theorized to underlie recognition memory. We studied recognition memory in a large group of patients undergoing intracranial electroencephalographic (iEEG) monitoring for epilepsy. By measuring high-frequency activity (HFA)--a signal associated with precise spatiotemporal properties--we show that hippocampal activity during recognition predicted recognition memory performance and tracked both recollection and familiarity. Through the lens of dual-process models, these results indicate that the hippocampus supports both the recollection and familiarity processes.

  3. Distribution patterns of estrogen receptor alpha and beta in the human cortex and hippocampus during development and adulthood.

    PubMed

    González, Miriam; Cabrera-Socorro, Alfredo; Pérez-García, Carlos G; Fraser, James D; López, Francisco J; Alonso, Rafael; Meyer, Gundela

    2007-08-20

    The expression of estrogen receptors (ERs) in the developing and adult human brain has not been clearly established, although estrogens are crucial for neuronal differentiation, synapse formation, and cognitive functions. By using immunohistochemistry, we have studied the distribution of ER alpha and ER beta in human cerebral cortex and hippocampus from early prenatal stages to adult life. ER alpha was detected in the cortex at 9 gestational weeks (GW), with a high expression in proliferating zones and the cortical plate. The staining intensity decreased gradually during prenatal development but increased again from birth to adulthood. In contrast, ER beta was first detected at 15 GW in proliferating zones, and at 16/17 GW, numerous ER beta immunopositive cells were also observed in the cortical plate. ER beta expression persisted in the adult cortex, being widely distributed throughout cortical layers II-VI. In addition, from around 15 GW to adulthood, ER alpha and ER beta were expressed in human hippocampus mainly in pyramidal cells of Ammon's horn and in the dentate gyrus. Western blotting and immunohistochemistry in the adult cerebral cortex and hippocampus revealed lower protein expression of ER alpha compared with ER beta. Double immunostaining showed that during fetal life both ERs are expressed in neurons as well as in radial glia, although only ER alpha is expressed in the Cajal-Retzius neurons of the marginal zone. These observations demonstrate that the expression of ER alpha and ER beta displays different spatial-temporal patterns during human cortical and hippocampal development and suggest that both ERs may play distinct roles in several processes related to prenatal brain development.

  4. [Occupational health problems in epileptics].

    PubMed

    Romankow, Jacek

    2005-01-01

    From the point of view of occupational medicine some questions are important for epileptics; amongst others: falling, behavior during the paroxysm, shift work dependence of attack, behaviour after an epileptic episode. Occupational capacity depends on the process of epileptic episodes and their frequency. The development of neurology has rendered numerous cures from epilepsy, but the the occupational stigma is difficult in many professions--electrical engineering, working with machinery, milling machines and others. In some professions a care must be taken when hiring epileptics--for instance professions with a fall hazard, jobs connected with public transport or involving crane or excavator operation.

  5. Harnessing gene expression networks to prioritize candidate epileptic encephalopathy genes.

    PubMed

    Oliver, Karen L; Lukic, Vesna; Thorne, Natalie P; Berkovic, Samuel F; Scheffer, Ingrid E; Bahlo, Melanie

    2014-01-01

    We apply a novel gene expression network analysis to a cohort of 182 recently reported candidate Epileptic Encephalopathy genes to identify those most likely to be true Epileptic Encephalopathy genes. These candidate genes were identified as having single variants of likely pathogenic significance discovered in a large-scale massively parallel sequencing study. Candidate Epileptic Encephalopathy genes were prioritized according to their co-expression with 29 known Epileptic Encephalopathy genes. We utilized developing brain and adult brain gene expression data from the Allen Human Brain Atlas (AHBA) and compared this to data from Celsius: a large, heterogeneous gene expression data warehouse. We show replicable prioritization results using these three independent gene expression resources, two of which are brain-specific, with small sample size, and the third derived from a heterogeneous collection of tissues with large sample size. Of the nineteen genes that we predicted with the highest likelihood to be true Epileptic Encephalopathy genes, two (GNAO1 and GRIN2B) have recently been independently reported and confirmed. We compare our results to those produced by an established in silico prioritization approach called Endeavour, and finally present gene expression networks for the known and candidate Epileptic Encephalopathy genes. This highlights sub-networks of gene expression, particularly in the network derived from the adult AHBA gene expression dataset. These networks give clues to the likely biological interactions between Epileptic Encephalopathy genes, potentially highlighting underlying mechanisms and avenues for therapeutic targets.

  6. Evaluation of cytochrome P450 inductions by anti-epileptic drug oxcarbazepine, 10-hydroxyoxcarbazepine, and carbamazepine using human hepatocytes and HepaRG cells.

    PubMed

    Sugiyama, Ikuo; Murayama, Norie; Kuroki, Ayaka; Kota, Jagannath; Iwano, Shunsuke; Yamazaki, Hiroshi; Hirota, Takashi

    2016-09-01

    Anti-epileptic drug oxcarbazepine is structurally related to carbamazepine, but has reportedly different metabolic pathway. Auto-induction potentials of oxcarbazepine, its pharmacologically active metabolite 10-hydroxyoxcarbazepine and carbamazepine were evaluated by cytochrome P450 (CYP) 1A2, CYP2B6 and CYP3A4 mRNA levels and primary metabolic rates using human hepatocytes and HepaRG cells. For the CYP1A2 the induction potential determined as the fold change in mRNA levels was 7.2 (range: 2.3-11.5) and 10.0 (6.2-13.7) for oxcarbazepine and carbamazepine, respectively, while 10-hydroxyoxcarbazepine did not induce. The fold change in mRNA levels for CYP2B6 was 11.5 (3.2-19.3), 7.0 (2.5-10.8) and 14.8 (3.1-29.1) for oxcarbazepine, 10-hydroxyoxcarbazepine and carbamazepine, respectively. The fold change for CYP3A4 induction level by oxcarbazepine, 10-hydroxyoxcarbazepine and carbamazepine was 3.5 (1.2-7.4), 2.7 (0.8-5.7) and 8.3 (3.5-14.5), respectively. The data suggest lower induction potential of oxcarbazepine and 10-hydroxyoxcarbazepine relative to carbamazepine. The results in HepaRG cells showed similar trend as the human hepatocytes. After incubation for 72 h in hepatocytes and HepaRG cells, auto-induction was evident for only carbamazepine metabolism. The 10-keto group instead of double bond at C10 position is evidently a determinant factor for limited auto-induction of P450 enzymes by oxcarbazepine.

  7. Slow-Theta-to-Gamma Phase–Amplitude Coupling in Human Hippocampus Supports the Formation of New Episodic Memories

    PubMed Central

    Lega, Bradley; Burke, John; Jacobs, Joshua; Kahana, Michael J.

    2016-01-01

    Phase–amplitude coupling (PAC) has been proposed as a neural mechanism for coordinating information processing across brain regions. Here we sought to characterize PAC in the human hippocampus, and in temporal and frontal cortices, during the formation of new episodic memories. Intracranial recordings taken as 56 neurosurgical patients studied and recalled lists of words revealed significant hippocampal PAC, with slow-theta activity (2.5–5 Hz) modulating gamma band activity (34–130 Hz). Furthermore, a significant number of hippocampal electrodes exhibited greater PAC during successful than unsuccessful encoding, with the gamma activity at these sites coupled to the trough of the slow-theta oscillation. These same conditions facilitate LTP in animal models, providing a possible mechanism of action for this effect in human memory. Uniquely in the hippocampus, phase preference during item encoding exhibited a biphasic pattern. Overall, our findings help translate between the patterns identified during basic memory tasks in animals and those present during complex human memory encoding. We discuss the unique properties of human hippocampal PAC and how our findings relate to influential theories of information processing based on theta–gamma interactions. PMID:25316340

  8. The human myosin light chain kinase (MLCK) from hippocampus: Cloning, sequencing, expression, and localization to 3qcen-q21

    SciTech Connect

    Potier, M.C.; Rossier, J.; Turnell, W.G.; Pekarsky, Y.; Gardiner, K.

    1995-10-10

    Myosin light chain kinase (MLCK), a key enzyme in muscle contraction, has been shown by immunohistology to be present in neurons and glia. We describe here the cloning of the cDNA for human MLCK from hippocampus, encoding a protein sequence 95% similar to smooth muscle MLCKs but less than 60% similar to skeletal muscle MLCKs. The cDNA clone detected two RNA transcripts in human frontal and entorhinal cortex, in hippocampus, and in jejunum, one corresponding to MLCK and the other probably to telokin, the carboxy-terminal 154 codons of MLCK expressed as an independent protein in smooth muscle. Levels of expression were lower in brain compared to smooth muscle. We show that within the protein sequence, a motif of 28 or 24 residues is repeated five times, the second repeat ending with the putative methionine start codon. These repeats overlap with a second previously reported module of 12 residues repeated five times in the human sequence. In addition, the acidic C-terminus of all MLCKs from both brain and smooth muscle resembles the C-terminus of tubulins. The chromosomal localization of the gene for human MLCK is shown to be at 3qcen-q21, as determined by PCR and Southern blotting using two somatic cell hybrid panels. 33 refs., 8 figs.

  9. [Transient epileptic amnesia].

    PubMed

    Muramatsu, Kazuhiro; Yoshizaki, Takahito

    2016-03-01

    Transient amnesia is one of common clinical phenomenon of epilepsy that are encountered by physicians. The amnestic attacks are often associated with persistent memory disturbances. Epilepsy is common among the elderly, with amnesia as a common symptom and convulsions relatively uncommon. Therefore, amnesia due to epilepsy can easily be misdiagnosed as dementia. The term 'transient epileptic amnesia (TEA)' was introduced in the early 1990s by Kapur, who highlighted that amnestic attacks caused by epilepsy can be similar to those occurring in 'transient global amnesia', but are distinguished by features brevity and recurrence. In 1998, Zeman et al. proposed diagnostic criteria for TEA.

  10. Using state-trace analysis to dissociate the functions of the human hippocampus and perirhinal cortex in recognition memory.

    PubMed

    Staresina, Bernhard P; Fell, Juergen; Dunn, John C; Axmacher, Nikolai; Henson, Richard N

    2013-02-19

    A recurring issue in neuroscience concerns evidence as to whether two or more brain regions implement qualitatively different functions. Here we introduce the application of state-trace analysis to measures of neural activity, illustrating how this analysis can furnish compelling evidence for qualitatively different functions, even when the precise "neurometric" mapping between function and brain measure is unknown. In doing so, we address a long-standing debate about the brain systems supporting human memory: whether the hippocampus and the perirhinal cortex, two key components of the medial temporal lobe memory system, provide qualitatively different contributions to recognition memory. An alternative account has been that both regions support a single shared function, such as memory strength, with the apparent dissociations obtained by previous neuroimaging studies merely reflecting different, nonlinear neurometric mappings across regions. To adjudicate between these scenarios, we analyze intracranial electroencephalographic data obtained directly from human hippocampus and perirhinal cortex during a recognition paradigm and apply state-trace analysis to responses evoked by the retrieval cue as a function of different types of memory judgment. Assuming only that the neurometric mapping in each region is monotonic, any unidimensional theory (such as the memory-strength account) will produce a monotonic state trace. Critically, results showed a nonmonotonic state trace; that is, activity levels in the two regions did not show the same relative ordering across memory conditions. This nonmonotonic state trace demonstrates that there are at least two different functions implemented across the hippocampus and perirhinal cortex, allowing formal rejection of a single-process account of medial temporal lobe contributions to recognition memory.

  11. A critical role of the human hippocampus in an electrophysiological measure of implicit memory

    PubMed Central

    Addante, Richard James

    2015-01-01

    The hippocampus has traditionally been thought to be critical for conscious explicit memory but not necessary for unconscious implicit memory processing. In a recent study of a group of mild amnesia patients with evidence of MTL damage limited to the hippocampus, subjects were tested on a direct test of item recognition confidence while electroencephalogram (EEG) was acquired, and revealed intact measures of explicit memory from 400–600ms (mid-frontal old-new effect, FN400). The current investigation re-analyzed this data to study event-related potentials (ERPs) of implicit memory, using a recently developed procedure that eliminated declarative memory differences. Prior ERP findings from this technique were first replicated in two independent matched control groups, which exhibited reliable implicit memory effects in posterior scalp regions from 400–600 msec, which were topographically dissociated from the explicit memory effects of familiarity. However, patients were found to be dramatically impaired in implicit memory effects relative to control subjects, as quantified by a reliable condition × group interaction. Several control analysis were conducted to consider alternative factors that could account for the results, including outliers, sample size, age, or contamination by explicit memory, and each of these factors were systematically ruled out. Results suggest that the hippocampus plays a fundamental role in aspects of memory processing that is beyond conscious awareness. The current findings therefore indicate that both memory systems of implicit and explicit memory may rely upon the same neural structures – but function in different physiological ways. PMID:25562828

  12. β-amyloid disrupts human NREM slow waves and related hippocampus-dependent memory consolidation

    PubMed Central

    Mander, Bryce A.; Marks, Shawn M.; Vogel, Jacob W.; Rao, Vikram; Lu, Brandon; Saletin, Jared M.; Ancoli-Israel, Sonia; Jagust, William J.; Walker, Matthew P.

    2015-01-01

    Independent evidence associates β-amyloid pathology with both NREM sleep disruption and memory impairment in older adults. However, whether the influence of β-amyloid pathology on hippocampus-dependent memory is, in part, driven by impairments of NREM slow wave activity (SWA) and associated overnight memory consolidation is unknown. Here, we show that β-amyloid burden within medial prefrontal cortex (mPFC) is significantly correlated with the severity of impairment in NREM SWA generation. Moreover, reduced NREM SWA generation was further associated with impaired overnight memory consolidation and impoverished hippocampal-neocortical memory transformation. Furthermore, structural equation models revealed that the association between mPFC β-amyloid pathology and impaired hippocampus-dependent memory consolidation is not direct, but instead, statistically depends on the intermediary factor of diminished NREM SWA. By linking β-amyloid pathology with impaired NREM SWA, these data implicate sleep disruption as a novel mechanistic pathway through which β-amyloid pathology may contribute to hippocampus-dependent cognitive decline in the elderly. PMID:26030850

  13. Kinin B1 and B2 receptors are overexpressed in the hippocampus of humans with temporal lobe epilepsy.

    PubMed

    Perosa, Sandra Regina; Argañaraz, Gustavo Adolfo; Goto, Eduardo Massatoshi; Costa, Luciana Gilbert Pessoa; Konno, Ana Carla; Varella, Pedro Paulo Vasconcellos; Santiago, Joselita Ferreira Carvalho; Pesquero, João Bosco; Canzian, Mauro; Amado, Debora; Yacubian, Elza Marcia; Carrete, Henrique; Centeno, Ricardo Silva; Cavalheiro, Esper Abrão; Silva, Jose Antonio; Mazzacoratti, Maria da Graça Naffah

    2007-01-01

    Molecular biology tools have been employed to investigate the participation of peptides in human temporal lobe epilepsy (TLE). Active polypeptides and their receptors have been related to several brain processes, such as inflammation, apoptosis, brain development, K(+) and Ca(2+) channels' activation, cellular growth, and induction of neuronal differentiation. Previous works have shown a neuroprotector effect for kinin B2 receptor and a deleterious, pro-epileptogenic action for kinin B1 receptor in animal models of TLE. The present work was delineated to analyze the kinin B1 and B2 receptors expression in the hippocampus of patients presenting refractory mesial TLE. The hippocampi were removed during the patients surgery in a procedure used for seizure control and compared with tissues obtained after autopsy. Nissl staining was performed to study the tissue morphology and immunohistochemistry, and Western blot was used to compare the distribution and levels of both receptors in the hippocampus. In addition, real time PCR was employed to analyze the gene expression of these receptors. Nissl staining showed sclerotic hippocampi with hilar, granular, and pyramidal cell loss in TLE patients. Immunohistochemistry and Western blot analyses showed increased expression of kinin B1 and B2 receptors but the real-time PCR data demonstrated increased mRNA level only for kinin B2 receptors, when compared with controls. These data show for the first time a relationship between human TLE and the kallikrein-kinin system, confirming ours previous results, obtained from experimental models of epilepsy.

  14. Epileptic seizure after treatment with thiocolchicoside

    PubMed Central

    Giavina-Bianchi, Pedro; Giavina-Bianchi, Mara; Tanno, Luciana Kase; Ensina, Luis Felipe Chiaverini; Motta, Antôno Abílio; Kalil, Jorge

    2009-01-01

    Background: Adverse drug reactions are important determinants of inpatient and outpatient morbidity. Thiocolchicoside is a semisynthetic derivate of naturally occurring colchicoside, which is largely used in humans as a centrally acting muscle relaxant. Epileptic seizures after thiocolchicoside intake have been reported in individuals with a history of epilepsy, acute brain injury or possible blood–brain barrier disruption. Case report: We report the case of a 66-year-old male patient presenting a sudden epileptic seizure temporally related to the intake of thiocolchicoside for muscle contracture and pain. The probably causes of the seizures were thiocolchicoside intake and cerebral microhemorrhages attributed to cerebral amyloid angiopathy. Discussion: Drugs only rarely cause focal seizures. Our case indicates that thiocolchicoside can precipitate seizures in predisposed patients, and that its use should be avoided in patients with brain diseases (and therefore lower seizure thresholds) or blood–brain barrier disruption. This information should be provided in the drug package insert. PMID:19707540

  15. In vivo detection of epileptic brain tissue using static fluorescence and diffuse reflectance spectroscopy

    NASA Astrophysics Data System (ADS)

    Yadav, Nitin; Bhatia, Sanjiv; Ragheb, John; Mehta, Rupal; Jayakar, Prasanna; Yong, William; Lin, Wei-Chiang

    2013-02-01

    Diffuse reflectance and fluorescence spectroscopy are used to detect histopathological abnormalities of an epileptic brain in a human subject study. Static diffuse reflectance and fluorescence spectra are acquired from normal and epileptic brain areas, defined by electrocorticography (ECoG), from pediatric patients undergoing epilepsy surgery. Biopsy specimens are taken from the investigated sites within an abnormal brain. Spectral analysis reveals significant differences in diffuse reflectance spectra and the ratio of fluorescence and diffuse reflectance spectra from normal and epileptic brain areas defined by ECoG and histology. Using these spectral differences, tissue classification models with accuracy above 80% are developed based on linear discriminant analysis. The differences between the diffuse reflectance spectra from the normal and epileptic brain areas observed in this study are attributed to alterations in the static hemodynamic characteristics of an epileptic brain, suggesting a unique association between the histopathological and the hemodynamic abnormalities in an epileptic brain.

  16. Single-trial learning of novel stimuli by individual neurons of the human hippocampus-amygdala complex.

    PubMed

    Rutishauser, Ueli; Mamelak, Adam N; Schuman, Erin M

    2006-03-16

    The ability to distinguish novel from familiar stimuli allows nervous systems to rapidly encode significant events following even a single exposure to a stimulus. This detection of novelty is necessary for many types of learning. Neurons in the medial temporal lobe (MTL) are critically involved in the acquisition of long-term declarative memories. During a learning task, we recorded from individual MTL neurons in vivo using microwire electrodes implanted in human epilepsy surgery patients. We report here the discovery of two classes of neurons in the hippocampus and amygdala that exhibit single-trial learning: novelty and familiarity detectors, which show a selective increase in firing for new and old stimuli, respectively. The neurons retain memory for the stimulus for 24 hr. Thus, neurons in the MTL contain information sufficient for reliable novelty-familiarity discrimination and also show rapid plasticity as a result of single-trial learning.

  17. The human hippocampus beyond the cognitive map: evidence from a densely amnesic patient.

    PubMed

    Banta Lavenex, Pamela A; Colombo, Françoise; Ribordy Lambert, Farfalla; Lavenex, Pierre

    2014-01-01

    We tested a densely amnesic patient (P9), with bilateral hippocampal damage resulting from an autoimmune disorder, and 12 age- and sex-matched controls on a series of memory tasks designed to characterize allocentric spatial learning and memory abilities. We compared P9's ability to perform spatial memory tasks with her ability to perform non-spatial, color memory tasks. First, P9's performance was impaired as compared to controls even in the simplest versions of an allocentric spatial memory task, in which she had to find repeatedly over 10 trials the same location(s) of one, two or three illuminating foot pad(s) among 23 pads distributed in an open-field arena. In contrast, she performed as well as controls when she had to find repeatedly over 10 trials the same one, two or three pad(s) marked by color cue(s), whose locations varied between trials. Second, P9's performance was severely impaired in working memory tasks, when she had to learn on a trial-unique basis and remember the location(s) or the color(s) of one, two or three pad(s), while performing an interfering task during the 1-min interval separating encoding and retrieval. Without interference during the retention interval of the trial-unique tasks, P9's performance was partially preserved in the color tasks, whereas it remained severely impaired in the allocentric spatial tasks. Detailed behavioral analyses indicate that P9's memory representations are more limited than those of controls both in their precision (metric coding) and in the number of items that can be maintained in memory (capacity). These findings are consistent with the theory that the hippocampus contributes to the integration or binding of multiple items, in order to produce high-resolution/high-capacity representations of spatial and non-spatial information in the service of short-term/working and long-term memory.

  18. The human hippocampus beyond the cognitive map: evidence from a densely amnesic patient

    PubMed Central

    Banta Lavenex, Pamela A.; Colombo, Françoise; Ribordy Lambert, Farfalla; Lavenex, Pierre

    2014-01-01

    We tested a densely amnesic patient (P9), with bilateral hippocampal damage resulting from an autoimmune disorder, and 12 age- and sex-matched controls on a series of memory tasks designed to characterize allocentric spatial learning and memory abilities. We compared P9's ability to perform spatial memory tasks with her ability to perform non-spatial, color memory tasks. First, P9's performance was impaired as compared to controls even in the simplest versions of an allocentric spatial memory task, in which she had to find repeatedly over 10 trials the same location(s) of one, two or three illuminating foot pad(s) among 23 pads distributed in an open-field arena. In contrast, she performed as well as controls when she had to find repeatedly over 10 trials the same one, two or three pad(s) marked by color cue(s), whose locations varied between trials. Second, P9's performance was severely impaired in working memory tasks, when she had to learn on a trial-unique basis and remember the location(s) or the color(s) of one, two or three pad(s), while performing an interfering task during the 1-min interval separating encoding and retrieval. Without interference during the retention interval of the trial-unique tasks, P9's performance was partially preserved in the color tasks, whereas it remained severely impaired in the allocentric spatial tasks. Detailed behavioral analyses indicate that P9's memory representations are more limited than those of controls both in their precision (metric coding) and in the number of items that can be maintained in memory (capacity). These findings are consistent with the theory that the hippocampus contributes to the integration or binding of multiple items, in order to produce high-resolution/high-capacity representations of spatial and non-spatial information in the service of short-term/working and long-term memory. PMID:25309387

  19. Yes/no recognition, forced-choice recognition, and the human hippocampus.

    PubMed

    Bayley, P J; Wixted, J T; Hopkins, R O; Squire, L R

    2008-03-01

    Two recent studies reported that yes/no recognition can be more impaired by hippocampal lesions than forced-choice recognition when the targets and foils are highly similar. This finding has been taken in support of two fundamental proposals: (1) yes/no recognition tests depend more on recollection than do forced-choice tests; and (2) the hippocampus selectively supports the recollection process. Using the same stimulus materials as in the earlier studies, we tested five memory-impaired patients with circumscribed hippocampal lesions and 15 controls. As in the earlier studies, participants studied 12 pictures of objects and then took either a 12-item forced-choice test with four alternatives or a 60-item yes/no test. Patients were impaired on both tests but did more poorly on the yes/no test. However, a yes/no test based on 12 study items would conventionally involve only 24 test items (i.e., 12 study items and 12 foil items). When we scored only the first 24 test items, the patients performed identically on the yes/no and forced-choice tests. Examination of the data in blocks of 12 trials indicated that the scores of the patients declined as testing continued. We suggest that a yes/no test of 60 items is difficult relative to a 12-item forced-choice test due to the increased study-test delay and due to increased interference, not because of any fundamental difference between the yes/no and forced-choice formats. We conclude that hippocampal lesions impair yes/no and forced-choice recognition to the same extent.

  20. The rat brain hippocampus proteome.

    PubMed

    Fountoulakis, Michael; Tsangaris, George T; Maris, Antony; Lubec, Gert

    2005-05-05

    The hippocampus is crucial in memory storage and retrieval and plays an important role in stress response. In humans, the CA1 area of hippocampus is one of the first brain areas to display pathology in Alzheimer's disease. A comprehensive analysis of the hippocampus proteome has not been accomplished yet. We applied proteomics technologies to construct a two-dimensional database for rat brain hippocampus proteins. Hippocampus samples from eight months old animals were analyzed by two-dimensional electrophoresis and the proteins were identified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. The database comprises 148 different gene products, which are in the majority enzymes, structural proteins and heat shock proteins. It also includes 39 neuron specific gene products. The database may be useful in animal model studies of neurological disorders.

  1. Complex dynamics of epileptic EEG.

    PubMed

    Kannathal, N; Puthusserypady, Sadasivan K; Choo Min, Lim

    2004-01-01

    Electroencephalogram (EEG) - the recorded representation of electrical activity of the brain contain useful information about the state of the brain. Recent studies indicate that nonlinear methods can extract valuable information from neuronal dynamics. We compare the dynamical properties of EEG signals of healthy subjects with epileptic subjects using nonlinear time series analysis techniques. Chaotic invariants like correlation dimension (D2) , largest Lyapunov exponent (lambda1), Hurst exponent (H) and Kolmogorov entropy (K) are used to characterize the signal. Our study showed clear differences in dynamical properties of brain electrical activity of the normal and epileptic subjects with a confidence level of more than 90%. Furthermore to support this claim fractal dimension (FD) analysis is performed. The results indicate reduction in value of FD for epileptic EEG indicating reduction in system complexity.

  2. Astrocytes in the epileptic brain.

    PubMed

    Wetherington, Jonathon; Serrano, Geidy; Dingledine, Ray

    2008-04-24

    The roles that astrocytes play in the evolution of abnormal network excitability in chronic neurological disorders involving brain injury, such as acquired epilepsy, are receiving renewed attention due to improved understanding of the molecular events underpinning the physiological functions of astrocytes. In epileptic tissue, evidence is pointing to enhanced chemical signaling and disrupted linkage between water and potassium balance by reactive astrocytes, which together conspire to enhance local synchrony in hippocampal microcircuits. Reactive astrocytes in epileptic tissue both promote and oppose seizure development through a variety of specific mechanisms; the new findings suggest several novel astrocyte-related targets for drug development.

  3. Astrocytes in the Epileptic Brain

    PubMed Central

    Wetherington, Jonathon; Serrano, Geidy; Dingledine, Ray

    2014-01-01

    The roles that astrocytes play in the evolution of abnormal network excitability in chronic neurological disorders involving brain injury, such as acquired epilepsy, are receiving renewed attention due to improved understanding of the molecular events underpinning the physiological functions of astrocytes. In epileptic tissue, evidence is pointing to enhanced chemical signaling and disrupted linkage between water and potassium balance by reactive astrocytes, which together conspire to enhance local synchrony in hippocampal microcircuits. Reactive astrocytes in epileptic tissue both promote and oppose seizure development through a variety of specific mechanisms; the new findings suggest several novel astrocyte-related targets for drug development. PMID:18439402

  4. Multivariate pattern analysis of the human medial temporal lobe revealed representationally categorical cortex and representationally agnostic hippocampus.

    PubMed

    Huffman, Derek J; Stark, Craig E L

    2014-11-01

    Contemporary theories of the medial temporal lobe (MTL) suggest that there are functional differences between the MTL cortex and the hippocampus. High-resolution functional magnetic resonance imaging and multivariate pattern analysis were utilized to study whether MTL subregions could classify categories of images, with the hypothesis that the hippocampus would be less representationally categorical than the MTL cortex. Results revealed significant classification accuracy for faces versus objects and faces versus scenes in MTL cortical regions-parahippocampal cortex (PHC) and perirhinal cortex (PRC)-with little evidence for category discrimination in the hippocampus. MTL cortical regions showed significantly greater classification accuracy than the hippocampus. The hippocampus showed significant classification accuracy for images compared to a nonmnemonic baseline task, suggesting that it responded to the images. Classification accuracy in a region of interest encompassing retrosplenial cortex (RSC) and the posterior cingulate cortex (PCC) posterior to RSC, showed a similar pattern of results to PHC, supporting the hypothesis that these regions are functionally related. The results suggest that PHC, PRC, and RSC/PCC are representationally categorical and the hippocampus is more representationally agnostic, which is concordant with the hypothesis of the role of the hippocampus in pattern separation.

  5. Fractal Dimension in Epileptic EEG Signal Analysis

    NASA Astrophysics Data System (ADS)

    Uthayakumar, R.

    Fractal Analysis is the well developed theory in the data analysis of non-linear time series. Especially Fractal Dimension is a powerful mathematical tool for modeling many physical and biological time signals with high complexity and irregularity. Fractal dimension is a suitable tool for analyzing the nonlinear behaviour and state of the many chaotic systems. Particularly in analysis of chaotic time series such as electroencephalograms (EEG), this feature has been used to identify and distinguish specific states of physiological function.Epilepsy is the main fatal neurological disorder in our brain, which is analyzed by the biomedical signal called Electroencephalogram (EEG). The detection of Epileptic seizures in the EEG Signals is an important tool in the diagnosis of epilepsy. So we made an attempt to analyze the EEG in depth for knowing the mystery of human consciousness. EEG has more fluctuations recorded from the human brain due to the spontaneous electrical activity. Hence EEG Signals are represented as Fractal Time Series.The algorithms of fractal dimension methods have weak ability to the estimation of complexity in the irregular graphs. Divider method is widely used to obtain the fractal dimension of curves embedded into a 2-dimensional space. The major problem is choosing initial and final step length of dividers. We propose a new algorithm based on the size measure relationship (SMR) method, quantifying the dimensional behaviour of irregular rectifiable graphs with minimum time complexity. The evidence for the suitability (equality with the nature of dimension) of the algorithm is illustrated graphically.We would like to demonstrate the criterion for the selection of dividers (minimum and maximum value) in the calculation of fractal dimension of the irregular curves with minimum time complexity. For that we design a new method of computing fractal dimension (FD) of biomedical waveforms. Compared to Higuchi's algorithm, advantages of this method include

  6. Effects of TRPV1 on the hippocampal synaptic plasticity in the epileptic rat brain.

    PubMed

    Saffarzadeh, Fatemeh; Eslamizade, Mohammad J; Ghadiri, Tahereh; Modarres Mousavi, Sayed Mostafa; Hadjighassem, Mahmoudreza; Gorji, Ali

    2015-07-01

    Temporal lobe epilepsy is often presented by medically intractable recurrent seizures due to dysfunction of temporal lobe structures, mostly the temporomesial structures. The role of transient receptor potential vaniloid 1 (TRPV1) activity on synaptic plasticity of the epileptic brain tissues was investigated. We studied hippocampal TRPV1 protein content and distribution in the hippocampus of epileptic rats. Furthermore, the effects of pharmacologic modulation of TRPV1 receptors on field excitatory postsynaptic potentials have been analyzed after induction of long term potentiation (LTP) in the hippocampal CA1 and CA3 areas after 1 day (acute phase) and 3 months (chronic phase) of pilocarpine-induced status epilepticus (SE). A higher expression of TRPV1 protein in the hippocampus as well as a higher distribution of this channel in CA1 and CA3 areas in both acute and chronic phases of pilocarpine-induced SE was observed. Activation of TRPV1 using capsaicin (1 µM) enhanced LTP induction in CA1 region in non-epileptic rats. Inhibition of TRPV1 by capsazepine (10 µM) did not affect LTP induction in non-epileptic rats. In acute phase of SE, activation of TRPV1 enhanced LTP in both CA1 and CA3 areas but TRPV1 inhibition did not affect LTP. In chronic phase of SE, application of TRPV1 antagonist enhanced LTP induction in CA1 and CA3 regions but TRPV1 activation had no effect on LTP. These findings indicate that a higher expression of TRPV1 in epileptic conditions is accompanied by a functional impact on the synaptic plasticity in the hippocampus. This suggests TRPV1 as a potential target in treatment of seizure attacks.

  7. Multimodality localization of epileptic foci

    NASA Astrophysics Data System (ADS)

    Desco, Manuel; Pascau, Javier; Pozo, M. A.; Santos, Andres; Reig, Santiago; Gispert, Juan D.; Garcia-Barreno, Pedro

    2001-05-01

    This paper presents a multimodality approach for the localization of epileptic foci using PET, MRI and EEG combined without the need of external markers. Mutual Information algorithm is used for MRI-PET registration. Dipole coordinates (provided by BESA software) are projected onto the MRI using a specifically developed algorithm. The four anatomical references used for electrode positioning (nasion, inion and two preauricular points) are located on the MRI using a triplanar viewer combined with a surface-rendering tool. Geometric transformation using deformation of the ideal sphere used for dipole calculations is then applied to match the patient's brain size and shape. Eight treatment-refractory epileptic patients have been studied. The combination of the anatomical information from the MRI, hipoperfusion areas in PET and dipole position and orientation helped the physician in the diagnosis of epileptic focus location. Neurosurgery was not indicated for patients where PET and dipole results were inconsistent; in two cases it was clinically indicated despite the mismatch, showing a negative follow up. The multimodality approach presented does not require external markers for dipole projection onto the MRI, this being the main difference with previous methods. The proposed method may play an important role in the indication of surgery for treatment- refractory epileptic patients.

  8. Dental problems in epileptic patients.

    PubMed

    Zioło, Anna; Mielnik-Błaszczak, Maria

    2004-01-01

    On the grounds of literature and own clinical experience, pathological changes in epilepitic patients have been described. Dental management procedures in these patients have also been presented. The unquestionable importance of prophylaxis, which may markedly minimize the impact of epilepsy on the incidence of mouth diseases, has been emphasised. It has also been stated that epileptic patients should receive specialised and integrated dental treatment.

  9. Involvement of Thalamus in Initiation of Epileptic Seizures Induced by Pilocarpine in Mice

    PubMed Central

    Li, Yong-Hua; Li, Jia-Jia; Lu, Qin-Chi; Gong, Hai-Qing; Liang, Pei-Ji

    2014-01-01

    Studies have suggested that thalamus is involved in temporal lobe epilepsy, but the role of thalamus is still unclear. We obtained local filed potentials (LFPs) and single-unit activities from CA1 of hippocampus and parafascicular nucleus of thalamus during the development of epileptic seizures induced by pilocarpine in mice. Two measures, redundancy and directionality index, were used to analyze the electrophysiological characters of neuronal activities and the information flow between thalamus and hippocampus. We found that LFPs became more regular during the seizure in both hippocampus and thalamus, and in some cases LFPs showed a transient disorder at seizure onset. The variation tendency of the peak values of cross-correlation function between neurons matched the variation tendency of the redundancy of LFPs. The information tended to flow from thalamus to hippocampus during seizure initiation period no matter what the information flow direction was before the seizure. In some cases the information flow was symmetrically bidirectional, but none was found in which the information flowed from hippocampus to thalamus during the seizure initiation period. In addition, inactivation of thalamus by tetrodotoxin (TTX) resulted in a suppression of seizures. These results suggest that thalamus may play an important role in the initiation of epileptic seizures. PMID:24778885

  10. A novel genetic programming approach for epileptic seizure detection.

    PubMed

    Bhardwaj, Arpit; Tiwari, Aruna; Krishna, Ramesh; Varma, Vishaal

    2016-02-01

    The human brain is a delicate mix of neurons (brain cells), electrical impulses and chemicals, known as neurotransmitters. Any damage has the potential to disrupt the workings of the brain and cause seizures. These epileptic seizures are the manifestations of epilepsy. The electroencephalograph (EEG) signals register average neuronal activity from the cerebral cortex and label changes in activity over large areas. A detailed analysis of these electroencephalograph (EEG) signals provides valuable insights into the mechanisms instigating epileptic disorders. Moreover, the detection of interictal spikes and epileptic seizures in an EEG signal plays an important role in the diagnosis of epilepsy. Automatic seizure detection methods are required, as these epileptic seizures are volatile and unpredictable. This paper deals with an automated detection of epileptic seizures in EEG signals using empirical mode decomposition (EMD) for feature extraction and proposes a novel genetic programming (GP) approach for classifying the EEG signals. Improvements in the standard GP approach are made using a Constructive Genetic Programming (CGP) in which constructive crossover and constructive subtree mutation operators are introduced. A hill climbing search is integrated in crossover and mutation operators to remove the destructive nature of these operators. A new concept of selecting the Globally Prime offspring is also presented to select the best fitness offspring generated during crossover. To decrease the time complexity of GP, a new dynamic fitness value computation (DFVC) is employed to increase the computational speed. We conducted five different sets of experiments to evaluate the performance of the proposed model in the classification of different mixtures of normal, interictal and ictal signals, and the accuracies achieved are outstandingly high. The experimental results are compared with the existing methods on same datasets, and these results affirm the potential use of

  11. Exploratory Metabolomic Analyses Reveal Compounds Correlated with Lutein Concentration in Frontal Cortex, Hippocampus, and Occipital Cortex of Human Infant Brain

    PubMed Central

    Lieblein-Boff, Jacqueline C.; Johnson, Elizabeth J.; Kennedy, Adam D.; Lai, Chron-Si; Kuchan, Matthew J.

    2015-01-01

    Lutein is a dietary carotenoid well known for its role as an antioxidant in the macula, and recent reports implicate a role for lutein in cognitive function. Lutein is the dominant carotenoid in both pediatric and geriatric brain tissue. In addition, cognitive function in older adults correlated with macular and postmortem brain lutein concentrations. Furthermore, lutein was found to preferentially accumulate in the infant brain in comparison to other carotenoids that are predominant in diet. While lutein is consistently related to cognitive function, the mechanisms by which lutein may influence cognition are not clear. In an effort to identify potential mechanisms through which lutein might influence neurodevelopment, an exploratory study relating metabolite signatures and lutein was completed. Post-mortem metabolomic analyses were performed on human infant brain tissues in three regions important for learning and memory: the frontal cortex, hippocampus, and occipital cortex. Metabolomic profiles were compared to lutein concentration, and correlations were identified and reported here. A total of 1276 correlations were carried out across all brain regions. Of 427 metabolites analyzed, 257 were metabolites of known identity. Unidentified metabolite correlations (510) were excluded. In addition, moderate correlations with xenobiotic relationships (2) or those driven by single outliers (3) were excluded from further study. Lutein concentrations correlated with lipid pathway metabolites, energy pathway metabolites, brain osmolytes, amino acid neurotransmitters, and the antioxidant homocarnosine. These correlations were often brain region—specific. Revealing relationships between lutein and metabolic pathways may help identify potential candidates on which to complete further analyses and may shed light on important roles of lutein in the human brain during development. PMID:26317757

  12. Proteolysis of calcineurin is increased in human hippocampus during mild cognitive impairment and is stimulated by oligomeric Abeta

    PubMed Central

    Abdul, Hafiz Mohmmad; Baig, Irfan; LeVine, Harry; Guttmann, Rodney P; Norris, Christopher M.

    2011-01-01

    Summary Recent reports demonstrate that the activation and interaction of the protease calpain (CP) and the protein phosphatase calcineurin (CN) are elevated in the late stages of Alzheimer’s disease (AD). However, the extent to which CPs and CN interact during earlier stages of disease progression remains unknown. Here, we investigated CP and CN protein levels in cytosolic, nuclear, and membrane fractions prepared from human postmortem hippocampal tissue from aged non-demented subjects, and subjects diagnosed with mild cognitive impairment (MCI). The results revealed a parallel increase in CP I and the 48 kDa CN-Aα (ΔCN-Aα48) proteolytic fragment in cytosolic fractions during MCI. In primary rat hippocampal cultures, CP-dependent proteolysis and activation of CN was stimulated by application of oligomeric Aβ(1-42) peptides. Deleterious effects of Aβ on neuronal morphology were reduced by blockade of either CP or CN. NMDA-type glutamate receptors, which help regulate cognition and neuronal viability, and are modulated by CPs and CN, were also investigated in human hippocampus. Relative to controls, MCI subjects showed significantly greater proteolytic levels of the NR2B subunit. Within subjects, the extent of NR2B proteolysis was strongly correlated with the generation of ΔCN-Aα48 in the cytosol. A similar proteolytic pattern for NR2B was also observed in primary rat hippocampal cultures treated with oligomeric Aβ and prevented by inhibition of CP or CN. Together, the results demonstrate that the activation and interaction of CPs and CN are increased early in cognitive decline associated with AD and may help drive other pathologic processes during disease progression. PMID:20969723

  13. Exploratory Metabolomic Analyses Reveal Compounds Correlated with Lutein Concentration in Frontal Cortex, Hippocampus, and Occipital Cortex of Human Infant Brain.

    PubMed

    Lieblein-Boff, Jacqueline C; Johnson, Elizabeth J; Kennedy, Adam D; Lai, Chron-Si; Kuchan, Matthew J

    2015-01-01

    Lutein is a dietary carotenoid well known for its role as an antioxidant in the macula, and recent reports implicate a role for lutein in cognitive function. Lutein is the dominant carotenoid in both pediatric and geriatric brain tissue. In addition, cognitive function in older adults correlated with macular and postmortem brain lutein concentrations. Furthermore, lutein was found to preferentially accumulate in the infant brain in comparison to other carotenoids that are predominant in diet. While lutein is consistently related to cognitive function, the mechanisms by which lutein may influence cognition are not clear. In an effort to identify potential mechanisms through which lutein might influence neurodevelopment, an exploratory study relating metabolite signatures and lutein was completed. Post-mortem metabolomic analyses were performed on human infant brain tissues in three regions important for learning and memory: the frontal cortex, hippocampus, and occipital cortex. Metabolomic profiles were compared to lutein concentration, and correlations were identified and reported here. A total of 1276 correlations were carried out across all brain regions. Of 427 metabolites analyzed, 257 were metabolites of known identity. Unidentified metabolite correlations (510) were excluded. In addition, moderate correlations with xenobiotic relationships (2) or those driven by single outliers (3) were excluded from further study. Lutein concentrations correlated with lipid pathway metabolites, energy pathway metabolites, brain osmolytes, amino acid neurotransmitters, and the antioxidant homocarnosine. These correlations were often brain region-specific. Revealing relationships between lutein and metabolic pathways may help identify potential candidates on which to complete further analyses and may shed light on important roles of lutein in the human brain during development.

  14. Nonlinear analysis of EEG for epileptic seizures

    SciTech Connect

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.; Eisenstadt, M.L.

    1995-04-01

    We apply chaotic time series analysis (CTSA) to human electroencephalogram (EEG) data. Three epoches were examined: epileptic seizure, non-seizure, and transition from non-seizure to seizure. The CTSA tools were applied to four forms of these data: raw EEG data (e-data), artifact data (f-data) via application of a quadratic zero-phase filter of the raw data, artifact-filtered data (g- data) and that was the residual after subtracting f-data from e-data, and a low-pass-filtered version (h-data) of g-data. Two different seizures were analyzed for the same patient. Several nonlinear measures uniquely indicate an epileptic seizure in both cases, including an abrupt decrease in the time per wave cycle in f-data, an abrupt increase in the Kolmogorov entropy and in the correlation dimension for e-h data, and an abrupt increase in the correlation dimension for e-h data. The transition from normal to seizure state also is characterized by distinctly different trends in the nonlinear measures for each seizure and may be potential seizure predictors for this patient. Surrogate analysis of e-data shows that statistically significant nonlinear structure is present during the non-seizure, transition , and seizure epoches.

  15. Epileptic Seizure Forewarning by Nonlinear Techniques

    SciTech Connect

    Hively, L.M.

    2002-04-19

    This report describes work that was performed under a Cooperative Research and Development Agreement (CRADA) between UT-Battelle, LLC (Contractor) and a commercial participant, VIASYS Healthcare Inc. (formerly Nicolet Biomedical, Inc.). The Contractor has patented technology that forewarns of impending epileptic events via scalp electroencephalograph (EEG) data and successfully demonstrated this technology on 20 datasets from the Participant under pre-CRADA effort. This CRADA sought to bridge the gap between the Contractor's existing research-class software and a prototype medical device for subsequent commercialization by the Participant. The objectives of this CRADA were (1) development of a combination of existing computer hardware and Contractor-patented software into a clinical process for warning of impending epileptic events in human patients, and (2) validation of the epilepsy warning methodology. This work modified the ORNL research-class FORTRAN for forewarning to run under a graphical user interface (GUI). The GUI-FORTRAN software subsequently was installed on desktop computers at five epilepsy monitoring units. The forewarning prototypes have run for more than one year without any hardware or software failures. This work also reported extensive analysis of model and EEG datasets to demonstrate the usefulness of the methodology. However, the Participant recently chose to stop work on the CRADA, due to a change in business priorities. Much work remains to convert the technology into a commercial clinical or ambulatory device for patient use, as discussed in App. H.

  16. From superstitious behavior to delusional thinking: the role of the hippocampus in misattributions of causality.

    PubMed

    Brugger, P; Dowdy, M A; Graves, R E

    1994-12-01

    Nearly half a century ago B. F. Skinner proposed the hypothesis that human superstitiousness would be equivalent to the 'superstitious' behavior displayed by animals in operant situations involving response-independent reinforcement. Surprisingly, no attempt has ever been made to test this equivalence hypothesis experimentally. In the light of recent evidence for a common neurological basis of both superstitious beliefs held by normal subjects and delusional ideas of psychotic patients, Skinner's hypothesis has become topical again. We present an extension of the hypothesis which assumes dysfunction of the medial temporal lobe, in particular of the hippocampus, to be responsible for conditioned superstitions in animals, for common everyday superstitions, and for schizophrenic delusions. This hypothesis is based on (1) the observation of an enhanced 'superstitious' reactivity in hippocampectomized animals, (2) findings of an increased occurrence of popular superstitions in patients with a temporal-limbic epileptic focus, and (3) morphological and pharmacological evidence for schizophrenic delusions to be causally related to hippocampal damage.

  17. Human neural stem cell transplantation provides long-term restoration of neuronal plasticity in the irradiated hippocampus.

    PubMed

    Acharya, Munjal M; Rosi, Susanna; Jopson, Timothy; Limoli, Charles L

    2015-01-01

    For the majority of CNS malignancies, radiotherapy provides the best option for forestalling tumor growth, but is frequently associated with debilitating and progressive cognitive dysfunction. Despite the recognition of this serious side effect, satisfactory long-term solutions are not currently available and have prompted our efforts to explore the potential therapeutic efficacy of cranial stem cell transplants. We have demonstrated that intrahippocampal transplantation of human neural stem cells (hNSCs) can provide long-lasting cognitive benefits using an athymic rat model subjected to cranial irradiation. To explore the possible mechanisms underlying the capability of engrafted cells to ameliorate radiation-induced cognitive dysfunction we analyzed the expression patterns of the behaviorally induced activity-regulated cytoskeleton-associated protein (Arc) in the hippocampus at 1 and 8 months postgrafting. While immunohistochemical analyses revealed a small fraction (4.5%) of surviving hNSCs in the irradiated brain that did not express neuronal or astroglial makers, hNSC transplantation impacted the irradiated microenvironment of the host brain by promoting the expression of Arc at both time points. Arc is known to play key roles in the neuronal mechanisms underlying long-term synaptic plasticity and memory and provides a reliable marker for detecting neurons that are actively engaged in spatial and contextual information processing associated with memory consolidation. Cranial irradiation significantly reduced the number of pyramidal (CA1) and granule neurons (DG) expressing behaviorally induced Arc at 1 and 8 months postirradiation. Transplantation of hNSCs restored the expression of plasticity-related Arc in the host brain to control levels. These findings suggest that hNSC transplantation promotes the long-term recovery of host hippocampal neurons and indicates that one mechanism promoting the preservation of cognition after irradiation involves trophic

  18. Immunolocalization of pro- and mature-brain derived neurotrophic factor (BDNF) and receptor TrkB in the human brainstem and hippocampus.

    PubMed

    Tang, Samantha; Machaalani, Rita; Waters, Karen A

    2010-10-01

    Brain-derived neurotrophic factor (BDNF) and its receptor TrkB are essential in promoting normal development of the central nervous system. Specific functions that are affected in knockout models include respiratory control, coordination of movement and balance, and feeding activities. The expression of these markers has not yet been studied in the human infant brain. This study provides a detailed account of the distribution and localization of both pro- and mature-recombinant human (rh) forms of BDNF, and of TrkB in the human infant brainstem and hippocampus, and qualitatively compares this expression to that seen in the human adult. Using commercially available antibodies, we applied immunohistochemistry on formalin fixed and paraffin embedded human brain tissue [n=8 for infant, n=6 for adult], and qualitatively analyzed the expression of proBDNF, rhBDNF and TrkB. Amongst the brainstem regions studied, the greatest expression of the markers was in the mesencephalic trigeminal of the pons, and in the medulla, the inferior olive and arcuate nucleus. The lowest expression was in the substantia nigra of the midbrain and pontine locus coeruleus. Compared to adults, all the studied markers had a higher expression in the infant brainstem nuclei of the hypoglossal, vestibular, dorsal motor nucleus of the vagus, prepositus, cuneate, and dorsal raphe. In the hippocampus, only TrkB showed a higher expression in infants compared to adults. We conclude that BDNF and TrkB play important roles in controlling respiration, movement, balance and feeding in the brainstem and that the TrkB receptor is the most age-sensitive component of this system, especially in the hippocampus.

  19. Neuroethological approach to frontolimbic epileptic seizures and parasomnias: The same central pattern generators for the same behaviours.

    PubMed

    Tassinari, C A; Cantalupo, G; Högl, B; Cortelli, P; Tassi, L; Francione, S; Nobili, L; Meletti, S; Rubboli, G; Gardella, E

    2009-10-01

    The aim of this report is not to make a differential diagnosis between epileptic nocturnal seizures and non-epileptic sleep-related movement disorders, or parasomnias. On the contrary, our goal is to emphasize the commonly shared semiological features of some epileptic seizures and parasomnias. Such similar features might be explained by the activation of the same neuronal networks (so-called 'central pattern generators' or CPG). These produce the stereotypical rhythmic motor sequences - in other words, behaviours - that are adaptive and species-specific (such as eating/alimentary, attractive/aversive, locomotor and nesting habits). CPG are located at the subcortical level (mainly in the brain stem and spinal cord) and, in humans, are under the control of the phylogenetically more recent neomammalian neocortical structures, according to a simplified Jacksonian model. Based on video-polygraphic recordings of sleep-related epileptic seizures and non-epileptic events (parasomnias), we have documented how a transient "neomammalian brain" dysfunction - whether epileptic or not - can 'release' (disinhibition?) the CPG responsible for involuntary motor behaviours. Thus, in both epileptic seizures and parasomnias, we can observe: (a) oroalimentary automatisms, bruxism and biting; (b) ambulatory behaviours, ranging from the classical bimanual-bipedal activity of 'frontal' hypermotor seizures, epileptic and non-epileptic wanderings, and somnambulism to periodic leg movements (PLM), alternating leg muscle activation (ALMA) and restless legs syndrome (RLS); and (c) various sleep-related events such as ictal fear, sleep terrors, nightmares and violent behaviour.

  20. Epileptic Encephalopathies in Adults and Childhood

    PubMed Central

    Kural, Zekiye; Ozer, Ali Fahir

    2012-01-01

    Epileptic encephalopathies are motor-mental retardations or cognitive disorders secondary to epileptic seizures or epileptiform activities. Encephalopaties due to brain damage, medications, or systemic diseases are generally not in the scope of this definition, but they may rarely accompany the condition. Appropriate differential diagnosis of epileptic seizures as well as subclinical electroencephalographic discharges are crucial for management of seizures and epileptiform discharges and relative regression of cognitive deterioration in long-term followup. Proper antiepileptic drug, hormonal treatment, or i.v. immunoglobulin choice play major role in prognosis. In this paper, we evaluated the current treatment approaches by reviewing clinical electrophysiological characteristics of epileptic encephalopathies. PMID:23056934

  1. Transient epileptic amnesia: a concise review.

    PubMed

    Asadi-Pooya, Ali A

    2014-02-01

    Transient epileptic amnesia (TEA) is a distinctive syndrome and comprises episodic transient amnesia with an epileptic basis, without impairment of other aspects of cognitive function. Additional interictal memory deficits are common in TEA. An epileptic origin, after other etiologies have been excluded, should be considered and carefully investigated in patients complaining of isolated memory disturbances, particularly with recurrent short-lasting amnesic attacks. In all suspected cases of epilepsy, a detailed clinical history is of paramount importance, but ancillary tests including EEG and MRI could be very helpful. Transient epileptic amnesia is typically a benign and treatable condition. Future studies should investigate the exact mechanism(s) of this unique syndrome.

  2. Effects of 5-HT receptor agonists on depolarization-induced [3H]-noradrenaline release in rabbit hippocampus and human neocortex.

    PubMed Central

    Allgaier, C.; Warnke, P.; Stangl, A. P.; Feuerstein, T. J.

    1995-01-01

    1. The present study attempted to determine whether noradrenaline (NA) release in rabbit hippocampus and human neocortex is modulated by presynaptic 5-hydroxytryptamine (5-HT) receptors. 2. Slices of rabbit hippocampus and human neocortex, loaded with [3H]-noradrenaline ([3H]-NA) were superfused and the effects of 5-hydroxytryptamine (5-HT) receptor ligands on electrically evoked [3H]-NA release were investigated. 3. In rabbit hippocampus, 5-HT, 5-carboxamidotryptamine (5-CT; 32 microM) and 2-CH3-5-HT (32 microM) increased [3H]-NA release elicited with 360 pulses/3 Hz. Facilitation of transmitter release was not influenced by the 5-HT3 receptor antagonist, tropisetron but was prevented by the alpha 2-adrenoceptor antagonist, rauwolscine. When autoinhibition was avoided by stimulating the tissue with 4 pulses/100 Hz (pseudo-one pulse-(POP) stimulation), 2-CH3-5-HT decreased evoked transmitter release, whereas 5-HT and 5-CT had no effect. Inhibition caused by 2-CH3-5-HT was not affected by tropisetron but counteracted by the alpha 2-adrenoceptor ligands, clonidine and rauwolscine. Inhibition caused by clonidine was diminished in the presence of 5-CT or 2-CH3-5-HT. 4. In human neocortex, [3H]-NA release elicited with 360 pulses/3 Hz was increased by 10 microM 5-HT and 32 microM 5-CT, whereas 2-CH3-5-HT was ineffective. [3H]-NA release evoked with a modified POP stimulation (2 bursts of 4 pulses/100 Hz, 3.5 min apart) was not affected by 2-CH3-5-HT or 5-CT. 5. The present results indicate that 5-HT, 2-CH3-5-HT and 5-CT can act on presynaptic alpha 2-autoreceptors as partial agonists (2-CH3-5-HT; in rabbit hippocampal tissue) or antagonists (5-HT and 5-CT; in tissue of rabbit hippocampus and human neocortex). Furthermore the existence of autoinhibition dictates whether these drugs cause facilitation of release, inhibition or have no effect. PMID:8528558

  3. EPILEPTIC PSYCHOSIS: A RETROSPECTIVE STUDY

    PubMed Central

    Fernandez, Antony; Khanna, Sumant; Channabasavanna, S.M.

    1988-01-01

    SUMMARY The files of 60 cases who received a diagnosis of epileptic psychosis in the period 1980-1985 were reviewed. Unclassifiable psychosis and paranoid hallucinatory states were the most common presentations. Except for the gap between onset of epilepsy and psychosis, there were no other predictors of type of psychosis. Shorter psychotic episodes tended to be characterised by pressure of speech, inappropriate affect, generalised epilepsy and more past episodes. Memory deficits were more often associated with a longer gap between onset of epilepsy and psychosis, and the presence of hallucinations. PMID:21927290

  4. Mechanisms of physiological and epileptic HFO generation

    PubMed Central

    Jefferys, John G.R.; de la Prida, Liset Menendez; Wendling, Fabrice; Bragin, Anatol; Avoli, Massimo; Timofeev, Igor; Lopes da Silva, Fernando H.

    2016-01-01

    High frequency oscillations (HFO) have a variety of characteristics: band-limited or broad-band, transient burst-like phenomenon or steady-state. HFOs may be encountered under physiological or under pathological conditions (pHFO). Here we review the underlying mechanisms of oscillations, at the level of cells and networks, investigated in a variety of experimental in vitro and in vivo models. Diverse mechanisms are described, from intrinsic membrane oscillations to network processes involving different types of synaptic interactions, gap junctions and ephaptic coupling. HFOs with similar frequency ranges can differ considerably in their physiological mechanisms. The fact that in most cases the combination of intrinsic neuronal membrane oscillations and synaptic circuits are necessary to sustain network oscillations is emphasized. Evidence for pathological HFOs, particularly fast ripples, in experimental models of epilepsy and in human epileptic patients is scrutinized. The underlying mechanisms of fast ripples are examined both in the light of animal observations, in vivo and in vitro, and in epileptic patients, with emphasis on single cell dynamics. Experimental observations and computational modeling have led to hypotheses for these mechanisms, several of which are considered here, namely the role of out-of-phase firing in neuronal clusters, the importance of strong excitatory AMPA-synaptic currents and recurrent inhibitory connectivity in combination with the fast time scales of IPSPs, ephaptic coupling and the contribution of interneuronal coupling through gap junctions. The statistical behaviour of fast ripple events can provide useful information on the underlying mechanism and can help to further improve classification of the diverse forms of HFOs. PMID:22420980

  5. Nutritional Aspects of Treatment in Epileptic Patients

    PubMed Central

    SOLTANI, Danesh; GHAFFAR POUR, Majid; TAFAKHORI, Abbas; SARRAF, Payam; BITARAFAN, Sama

    2016-01-01

    Epilepsy is a neurological disorder characterized by interruption of normal neuronal functions that is manifested by behavioral disorders, changing of awareness level, and presence of some sensory, autonomic and motor symptoms or signs. It is resulted from many different causes. Many antiepileptic drugs (AEDs) are considered to manage epileptic attacks. Some of them change metabolism and absorption of many nutrients. Therefore, epileptic patients may be in higher risk of nutrient deficiency and its unwelcome effects. In the present paper, we intend to review the relationship between nutrition and epilepsy in two aspects. In one aspect we discuss the nutritional status in epileptic patients, the causes of nutritional deficiencies and the way of compensation of the nutrient deficiencies. It will guide these patients to have a healthy life. In another aspect we explain the role of some nutrients and specific diets in management of epileptic attacks. It can help to better control of epileptic attacks in these patients. PMID:27375750

  6. Nutritional Aspects of Treatment in Epileptic Patients.

    PubMed

    Soltani, Danesh; Ghaffar Pour, Majid; Tafakhori, Abbas; Sarraf, Payam; Bitarafan, Sama

    2016-01-01

    Epilepsy is a neurological disorder characterized by interruption of normal neuronal functions that is manifested by behavioral disorders, changing of awareness level, and presence of some sensory, autonomic and motor symptoms or signs. It is resulted from many different causes. Many antiepileptic drugs (AEDs) are considered to manage epileptic attacks. Some of them change metabolism and absorption of many nutrients. Therefore, epileptic patients may be in higher risk of nutrient deficiency and its unwelcome effects. In the present paper, we intend to review the relationship between nutrition and epilepsy in two aspects. In one aspect we discuss the nutritional status in epileptic patients, the causes of nutritional deficiencies and the way of compensation of the nutrient deficiencies. It will guide these patients to have a healthy life. In another aspect we explain the role of some nutrients and specific diets in management of epileptic attacks. It can help to better control of epileptic attacks in these patients.

  7. Progress in autoimmune epileptic encephalitis

    PubMed Central

    Wright, S.; Vincent, A.

    2016-01-01

    Purpose of review Autoimmune epileptic encephalopathy is a potentially treatable neurological syndrome characterized by the coexistence of a neuronal antibody in the CSF and serum. Patients present with combinations of seizures, neuropsychiatric features, movement disorder and cognitive decline, but some patients have isolated seizures either at first presentation or during their illness. This review summarises our current understanding of the roles of specific neuronal antibodies in epilepsy-related syndromes and aims to aid the clinician in diagnosis and treatment. Recent findings Antigen discovery methods in three neuroimmunology centres independently identified antibodies to different subunits of the GABAA receptor; high levels of these antibodies were found mainly in patients with severe refractory seizures. These and other antibodies were also found in a proportion (<10%) of children and adults with epilepsy. A clinical study comparing immunotherapy in patients with autoantibodies or without an identified target antigen found neuroinflammatory features were predictive of a therapeutic response. New in-vitro and in-vivo studies, and spontaneous animal models, have confirmed the pathogenicity and epileptogenicity of neuronal antibodies and their relevance to other mammals. Summary Neuronal antibodies are an important cause of autoimmune epileptic encephalopathy, early recognition is important as there may be an underlying tumour, and early treatment is associated with a better outcome. In the absence of an antibody, the clinician should adopt a pragmatic approach and consider a trial of immunotherapy when other causes have been excluded. PMID:26886357

  8. Metabolic Causes of Epileptic Encephalopathy

    PubMed Central

    Pearl, Phillip L.

    2013-01-01

    Epileptic encephalopathy can be induced by inborn metabolic defects that may be rare individually but in aggregate represent a substantial clinical portion of child neurology. These may present with various epilepsy phenotypes including refractory neonatal seizures, early myoclonic encephalopathy, early infantile epileptic encephalopathy, infantile spasms, and generalized epilepsies which in particular include myoclonic seizures. There are varying degrees of treatability, but the outcome if untreated can often be catastrophic. The importance of early recognition cannot be overemphasized. This paper provides an overview of inborn metabolic errors associated with persistent brain disturbances due to highly active clinical or electrographic ictal activity. Selected diseases are organized by the defective molecule or mechanism and categorized as small molecule disorders (involving amino and organic acids, fatty acids, neurotransmitters, urea cycle, vitamers and cofactors, and mitochondria) and large molecule disorders (including lysosomal storage disorders, peroxisomal disorders, glycosylation disorders, and leukodystrophies). Details including key clinical features, salient electrophysiological and neuroradiological findings, biochemical findings, and treatment options are summarized for prominent disorders in each category. PMID:23762547

  9. Adrenocorticotropic hormone protects learning and memory function in epileptic Kcna1-null mice.

    PubMed

    Scantlebury, Morris H; Chun, Kyoung-Chul; Ma, Shun-Chieh; Rho, Jong M; Kim, Do Young

    2017-04-03

    ACTH, a member of the melanocortin family of peptides, is often used in the treatment of the developmental epileptic encephalopathy spectrum disorders including, Ohtahara, West, Lennox Gastaut and Landau-Kleffner Syndromes and electrical status epilepticus of sleep. In these disorders, although ACTH is often successful in controlling the seizures and/or inter-ictal EEG abnormalities, it is unknown whether ACTH possesses other beneficial effects independent of seizure control. We tested whether ACTH can ameliorate the intrinsic impairment of hippocampal-based learning and memory in epileptic Kcna1-null (KO) mice. We found that ACTH - administered in the form of Acthar Gel given i.p. four times daily at a dose of 4 IU/kg (16 IU/kg/day) for 7days - prevented impairment of long-term potentiation (LTP) evoked with high-frequency stimulation in CA1 hippocampus and also restored spatial learning and memory on the Barnes maze test. However, with this treatment regimen, ACTH did not exert a significant effect on the frequency of spontaneous recurrent seizures. Together, our findings indicate that ACTH can ameliorate memory impairment in epileptic Kcna1-null mice separate from seizure control, and suggest that this widely used peptide may exert direct nootropic effects in the epileptic brain.

  10. Transient epileptic amnesia: Update on a slowly emerging epileptic syndrome.

    PubMed

    Felician, O; Tramoni, E; Bartolomei, F

    2015-03-01

    Transient epileptic amnesia (TEA) is a recently individualized, late-onset, pharmaco-sensitive form of mesial temporal lobe epilepsy with recurrent episodes of acute memory loss, but also interictal memory disturbances characterized by autobiographical and topographical memory impairment and a long-term consolidation deficit. In this article, we review the main clinical and electrophysiological characteristics of TEA, discuss its putative neuroanatomical substrate and mechanisms, common features and how it differs from related concepts, with the overall aim to defend the idea that TEA deserves to be recognized as a distinct epilepsy syndrome. While the pathophysiological basis remains largely unknown, emotional and/or dysimmune factors may have a potential influence. Most importantly, the concept of TEA is highly relevant to tertiary epilepsy and memory clinics, but also to routine neurology practice, leading to an adequate diagnosis and management of epilepsy-related, acute and long-standing memory deficits.

  11. Long-term expression of human contextual fear and extinction memories involves amygdala, hippocampus and ventromedial prefrontal cortex: a reinstatement study in two independent samples.

    PubMed

    Lonsdorf, Tina B; Haaker, Jan; Kalisch, Raffael

    2014-12-01

    Human context conditioning studies have focused on acquisition and extinction. Subsequent long-term changes in fear behaviors not only depend on associative learning processes during those phases but also on memory consolidation processes and the later ability to retrieve and express fear and extinction memories. Clinical theories explain relapse after successful exposure-based treatment with return of fear memories and remission with stable extinction memory expression. We probed contextual fear and extinction memories 1 week (Day8) after conditioning (Day1) and subsequent extinction (Day2) by presenting conditioned contexts before (Test1) and after (Test2) a reinstatement manipulation. We find consistent activation patterns in two independent samples: activation of a subgenual part of the ventromedial prefrontal cortex before reinstatement (Test1) and (albeit with different temporal profiles between samples) of the amygdala after reinstatement (Test2) as well as up-regulation of anterior hippocampus activity after reinstatement (Test2 > Test1). These areas have earlier been implicated in the expression of cued extinction and fear memories. The present results suggest a general role for these structures in defining the balance between fear and extinction memories, independent of the conditioning mode. The results are discussed in the light of hypotheses implicating the anterior hippocampus in the processing of situational ambiguity.

  12. Treadmill exercise prevents GABAergic neuronal loss with suppression of neuronal activation in the pilocarpine-induced epileptic rats

    PubMed Central

    Lim, Baek-Vin; Shin, Mal-Soon; Lee, Jae-Min; Seo, Jin-Hee

    2015-01-01

    Epilepsy is a common neurological disorder characterized by seizure and loss of neuronal cells by abnormal rhythmic firing of neurons in the brain. In the present study, we investigated the effect of treadmill exercise on gamma-aminobutyric acid (GABA)ergic neuronal loss in relation with neuronal activation using pilocarpine-induced epileptic rats. The rats were divided into four groups: control group, control and treadmill exercise group, pilocarpine-induced epilepsy group, and pilocarpine-induced epilepsy and treadmill exercise group. Epilepsy was induced by intraperitoneal injection of 320 mg/kg pilocarpine hydrochloride. The rats in the exercise groups were forced to run on a motorized treadmill for 30 min once a day for 2 weeks. In the present results, neuronal loss in the hippocampal CA1 region was increased after pilocarpine-induced seizure. Treadmill exercise inhibited hippocampal neuronal loss in the epileptic rats. Glutamic acid decarboxylase (GAD67) expression in the hippocampal CA1 region was reduced by pilocarpine-induced seizure. Treadmill exercise increased GAD67 expression in the epileptic rats. c-Fos expression in the hippocampal CA1 region was increased in response to epileptic seizure. Treadmill exercise inhibited c-Fos expression in the epileptic rats. Epileptic seizure increased brain-derived neurotrophic factor (BDNF) and tyrosine kinase receptor B (TrkB) expressions in the hippocampus. Treadmill exercise suppressed BDNF and TrkB expressions in the epileptic rats. In the present study, treadmill exercise prevented GABAergic neuronal loss and inhibited neuronal activation in the hippocampal CA1 region through the down-regulation of BDNF-TrkB signaling pathway. PMID:25960980

  13. Clinical review of genetic epileptic encephalopathies

    PubMed Central

    Noh, Grace J.; Asher, Y. Jane Tavyev; Graham, John M.

    2012-01-01

    Seizures are a frequently encountered finding in patients seen for clinical genetics evaluations. The differential diagnosis for the cause of seizures is quite diverse and complex, and more than half of all epilepsies have been attributed to a genetic cause. Given the complexity of such evaluations, we highlight the more common causes of genetic epileptic encephalopathies and emphasize the usefulness of recent technological advances. The purpose of this review is to serve as a practical guide for clinical geneticists in the evaluation and counseling of patients with genetic epileptic encephalopathies. Common syndromes will be discussed, in addition to specific seizure phenotypes, many of which are refractory to anti-epileptic agents. Divided by etiology, we overview the more common causes of infantile epileptic encephalopathies, channelopathies, syndromic, metabolic, and chromosomal entities. For each condition, we will outline the diagnostic evaluation and discuss effective treatment strategies that should be considered. PMID:22342633

  14. Delayed cell death in the contralateral hippocampus following kainate injection into the CA3 subfield.

    PubMed

    Maglóczky, Z; Freund, T F

    1995-06-01

    A model of epileptic cell death has been developed employing unilateral injections of kainic acid, a glutamate agonist, into the CA3 subfield of the hippocampus. The contralateral hippocampus, where neuronal damage is induced by hyperactivity in afferent pathways, served as the model structure. The pattern of cell death in this model was shown earlier to correspond to the vulnerable regions in human temporal lobe epilepsy. In the present time-course study we demonstrated that the different subpopulations of vulnerable cells in the contralateral hippocampus of the rat degenerate at different times following kainate injection. Spiny calretinin-containing cells in the hilus and CA3 stratum lucidum disappear at 12-24 h, other types of hilar neurons and CA3c pyramidal cells show shrinkage and argyrophilia at two days, whereas CA1 pyramidal cells degenerate at three days postinjection. The majority of cells destined to die showed a transient expression of the heatshock protein 72, approximately one day (for hilar-CA3c) or two days (for CA1) before degeneration. Parvalbumin-immunoreactivity transiently disappeared from the soma and dendrites of interneurons between the first and the fourth day. The results suggest that seizure-induced cell death is delayed, therefore acute oedema, even if it occurs, is insufficient to kill neurons. The only exception is the population of calretinin-containing interneurons degenerating at 12-24 h. The further one day delay between hilar-CA3c and CA1 cell death is likely to be due to differences in the relative density of glutamate receptor types (kainate versus NMDA) and the source of afferent input of these subfields. Thus, simple pharmacotherapy targeting only one of the excitotoxic mechanisms (i.e. acute oedema of calretinin cells versus delayed death of hilar-CA3c and CA1 cells at different time points) is likely to fail.

  15. Music and its association with epileptic disorders.

    PubMed

    Maguire, Melissa

    2015-01-01

    The association between music and epileptic seizures is complex and intriguing. Musical processing within the human brain recruits a network which involves many cortical areas that could activate as part of a temporal lobe seizure or become hyperexcitable on musical exposure as in the case of musicogenic epilepsy. The dichotomous effect of music on seizures may be explained by modification of dopaminergic circuitry or counteractive cognitive and sensory input in ictogenesis. Research has explored the utility of music as a therapy in epilepsy and while limited studies show some evidence of an effect on seizure activity; further work is required to ascertain its clinical potential. Sodium channel-blocking antiepileptic drugs, e.g., carbamazepine and oxcarbazepine, appear to effect pitch perception particularly in native-born Japanese, a rare but important adverse effect, particularly if a professional musician. Temporal lobe surgery for right lateralizing epilepsy has the capacity to effect all facets of musical processing, although risk and correlation to resection area need further research. There is a need for the development of investigative tools of musical processing that could be utilized along the surgical pathway. Similarly, work is also required in devising a musical paradigm as part of electroencephalography to improve surveillance of musicogenic seizures. These clinical applications could aid the management of epilepsy and preservation of musical ability.

  16. Epileptogenesis and epileptic maturation in phosphorylation site-specific SNAP-25 mutant mice.

    PubMed

    Watanabe, Shigeru; Yamamori, Saori; Otsuka, Shintaro; Saito, Masanori; Suzuki, Eiji; Kataoka, Masakazu; Miyaoka, Hitoshi; Takahashi, Masami

    2015-09-01

    Snap25(S187A/S187A) mouse is a knock-in mouse with a single amino acid substitution at a protein kinase C-dependent phosphorylation site of the synaptosomal-associated protein of 25 kDa (SNAP-25), which is a target-soluble NSF attachment protein receptor (t-SNARE) protein essential for neurotransmitter release. Snap25(S187A/S187A) mice exhibit several distinct phenotypes, including reductions in dopamine and serotonin release in the brain, anxiety-like behavior, and cognitive dysfunctions. Homozygous mice show spontaneous epileptic convulsions, and about 15% of the mice die around three weeks after birth. The remaining mice survive for almost two years and exhibit spontaneous recurrent seizures throughout their lifetime. Here, we conducted long-term continuous video electroencephalogram recording of the mice and analyzed the process of epileptogenesis and epileptic maturation in detail. Spikes and slow-wave discharges (SWDs) were observed in the cerebral cortex and thalamus before epileptic convulsions began. SWDs showed several properties similar to those observed in absence seizures including (1) lack of in the hippocampus, (2) movement arrest during SWDs, and (3) inhibition by ethosuximide. Multiple generalized seizures occurred in all homozygous mice around three weeks after birth. However, seizure generation stopped within several days, and a seizure-free latent period began. Following a spike-free quiet period, the number of spikes increased gradually, and epileptic seizures reappeared. Subsequently, spontaneous seizures occurred cyclically throughout the life of the mice, and several progressive changes in seizure frequency, seizure duration, seizure cycle interval, seizure waveform, and the number and waveform of epileptic discharges during slow-wave sleep occurred with different time courses over 10 weeks. Anxiety-related behaviors appeared suddenly within three days after epileptic seizures began and were delayed markedly by oral administration of

  17. [Lateralization of the epileptic process and psychology].

    PubMed

    Preiss, J; Kristof, M

    1989-04-01

    In a group of 70 patients with a unilateral epileptic process in the temporal limbic structures, localized in the left half of the brain in 38 patients (26 men, 12 women) and in the right half of the brain in 32 patients (17 men, 15 women) the lateralization of motor functions, asymmetry of emotional mimicry, conjugated deviation of the eye bulbs, intellect, memory, psychomotor rate and personality (laterality test of Matĕjcek--Zlab, Wechsler's intellect and memory scale, Benton, Stroop, VAROS, SUPOS, DSF, Washington Psychosocial--Seizure Inventory WPSI was investigated. Patient with a left-sided epileptic process had only insignificantly lower contact with psychiatry (31.6% as compared with 40.6%). Significantly lower contacts with psychiatry were recorded in 35 patients with a predominance of emotional mimicry (while smiling) on the left (25.0% as compared with 47.1%, p less than 0.05) and particularly significantly low in 18 patients with a combination of signs left-sided epileptic process + predominance of emotional mimicry on the left + deviation of the eyeballs on the right (mathematical stimulus) + genotypical righthandedness (16.7% as compared with 42.3%, p less than 0.025). Men with a left-sided epileptic process displayed a significantly greater anxiety, in women this trend was only indicated. Four women with a left-sided epileptic process anticipating regulation of behaviour was typical, for women with a right-sided epileptic process lower autoregulating inhibitions. A left-sided epileptic process had significantly more often a favourable course of epilepsy (in 65.8% as compared with 25.0%, p less than 0.005). In psychological tests, however, the differentiating criteria were much more than the course of the disease invalid pension, contact with psychiatry and subjective need of assistance from a psychiatrist or psychologist.

  18. The bumps on the hippocampus

    NASA Astrophysics Data System (ADS)

    Gao, Yi; Ver Hoef, Lawrence

    2016-03-01

    The hippocampus has been the focus of more imaging research than any other subcortical structure in the human brain. However a feature that has been almost universally overlooked are the bumpy ridges on the inferior aspect of the hippocampus, which we refer to as hippocampal dentation. These bumps arise from folds in the CA1 layer of Ammon's horn. Similar to the folding of the cerebral cortex, hippocampal dentation allows for greater surface area in a confined space. However, while quantitative studies of radiologic brain images have been advancing for decades, examining numerous approaches to hippocampal segmentation and morphology analysis, virtually all published 3D renderings of the hippocampus show the under surface to be quite smooth or mildly irregular; we have rarely seen the characteristic bumpy structure in the reconstructed 3D scene, one exception being the 9.4T postmortem study. This is presumably due to the fact that, based on our experience with high resolution images, there is a dramatic degree of variability in hippocampal dentation between individuals from very smooth to highly dentated. An apparent question is, does this indicate that this specific morphological signature can only be captured using expensive ultra-high field techniques? Or, is such information buried in the data we commonly acquire, awaiting a computation technique that can extract and render it clearly? In this study, we propose a super-resolution technique that captures the fine scale morphometric features of the hippocampus based on common T1-weighted 3T MR images.

  19. Enhanced hippocampus-dependent memory and reduced anxiety in mice over-expressing human catalase in mitochondria.

    PubMed

    Olsen, Reid H J; Johnson, Lance A; Zuloaga, Damian G; Limoli, Charles L; Raber, Jacob

    2013-04-01

    Oxidative stress (OS) and reactive oxygen species (ROS) play a modulatory role in synaptic plasticity and signaling pathways. Mitochondria (MT), a major source of ROS because of their involvement in energy metabolism, are important for brain function. MT-generated ROS are proposed to be responsible for a significant proportion of OS and are associated with developmental abnormalities and aspects of cellular aging. The role of ROS and MT function in cognition of healthy individuals is relatively understudied. In this study, we characterized behavioral and cognitive performance of 5- to 6-month-old mice over-expressing mitochondrial catalase (MCAT). MCAT mice showed enhancements in hippocampus-dependent spatial learning and memory in the water maze and contextual fear conditioning, and reduced measures of anxiety in the elevated zero maze. Catalase activity was elevated in MCAT mice in all brain regions examined. Measures of oxidative stress (glutathione, protein carbonyl content, lipid peroxidation, and 8-hydroxyguanine) did not significantly differ between the groups. The lack of differences in these markers of oxidative stress suggests that the differences observed in this study may be due to altered redox signaling. Catalase over-expression might be sufficient to enhance cognition and reduce measures of anxiety even in the absence of alteration in levels of OS.

  20. Quantitative Measurements in the Human Hippocampus and Related Areas: Correspondence between Ex-Vivo MRI and Histological Preparations

    PubMed Central

    Delgado-González, José Carlos; Mansilla-Legorburo, Francisco; Florensa-Vila, José; Insausti, Ana María; Viñuela, Antonio; Tuñón-Alvarez, Teresa; Cruz, Marcos; Mohedano-Moriano, Alicia; Insausti, Ricardo; Artacho-Pérula, Emilio

    2015-01-01

    The decrease of volume estimates in different structures of the medial temporal lobe related to memory correlate with the decline of cognitive functions in neurodegenerative diseases. This study presents data on the association between MRI quantitative parameters of medial temporal lobe structures and their quantitative estimate in microscopic examination. Twelve control cases had ex-vivo MRI, and thereafter, the temporal lobe of both hemispheres was sectioned from the pole as far as the level of the splenium of the corpus callosum. Nissl stain was used to establish anatomical boundaries between structures in the medial temporal lobe. The study included morphometrical and stereological estimates of the amygdaloid complex, hippocampus, and temporal horn of the lateral ventricle, as well as different regions of grey and white matter in the temporal lobe. Data showed a close association between morphometric MRI images values and those based on the histological determination of boundaries. Only values in perimeter and circularity of the piamater were different. This correspondence is also revealed by the stereological study, although irregular compartments resulted in a lesser agreement. Neither age (< 65 yr and > 65yr) nor hemisphere had any effect. Our results indicate that ex-vivo MRI is highly associated with quantitative information gathered by histological examination, and these data could be used as structural MRI biomarker in neurodegenerative diseases. PMID:26098887

  1. Downregulation of gephyrin in temporal lobe epilepsy neurons in humans and a rat model.

    PubMed

    Fang, Min; Shen, Lan; Yin, Huan; Pan, Yu-Min; Wang, Liang; Chen, Dan; Xi, Zhi-Qin; Xiao, Zheng; Wang, Xue-Feng; Zhou, Sheng-Nian

    2011-10-01

    Gephyrin, which is a postsynaptic scaffolding protein participated in clustering GABA(A) receptors at inhibitory synapses, has been reported to be involved in temporal lobe epilepsy (TLE) recently. Here, we investigate gephyrin protein expression in the temporal lobe epileptic foci in epileptic patients and experimental animals in order to explore the probable relationship between gephyrin expression and TLE. Using immunohistochemistry, immunofluorescence, and western blot analysis, gephyrin expression was examined in 30 human temporal neocortex samples from patients who underwent surgery to treat drug-refractory TLE and 10 histological normal temporal neocortex from the controls. Meanwhile, we investigated the gephyrin expression in the hippocampus and adjacent neocortex from experimental rats on 24 h, 48 h, 1 week, 2 weeks, 1 month, and 2 months postseizure and from control rats. Gephyrin protein was mainly expressed in the membrane and cytoplasm of neurons in temporal lobe epileptic foci in humans and experimental rats. Gephyrin expression was significantly lower in the temporal neocortex of TLE patients compared to the controls. In experimental rats, the expression of gephyrin in temporal lobe was downregulated in epileptic groups compared to the control group. Gephyrin expression gradually decreased during the acute period and the latent period, but then began to increase below the levels seen in controls during the chronic phase. Our findings suggest that gephyrin may be involved in the development of TLE.

  2. Predicting Epileptic Seizures in Advance

    PubMed Central

    Moghim, Negin; Corne, David W.

    2014-01-01

    Epilepsy is the second most common neurological disorder, affecting 0.6–0.8% of the world's population. In this neurological disorder, abnormal activity of the brain causes seizures, the nature of which tend to be sudden. Antiepileptic Drugs (AEDs) are used as long-term therapeutic solutions that control the condition. Of those treated with AEDs, 35% become resistant to medication. The unpredictable nature of seizures poses risks for the individual with epilepsy. It is clearly desirable to find more effective ways of preventing seizures for such patients. The automatic detection of oncoming seizures, before their actual onset, can facilitate timely intervention and hence minimize these risks. In addition, advance prediction of seizures can enrich our understanding of the epileptic brain. In this study, drawing on the body of work behind automatic seizure detection and prediction from digitised Invasive Electroencephalography (EEG) data, a prediction algorithm, ASPPR (Advance Seizure Prediction via Pre-ictal Relabeling), is described. ASPPR facilitates the learning of predictive models targeted at recognizing patterns in EEG activity that are in a specific time window in advance of a seizure. It then exploits advanced machine learning coupled with the design and selection of appropriate features from EEG signals. Results, from evaluating ASPPR independently on 21 different patients, suggest that seizures for many patients can be predicted up to 20 minutes in advance of their onset. Compared to benchmark performance represented by a mean S1-Score (harmonic mean of Sensitivity and Specificity) of 90.6% for predicting seizure onset between 0 and 5 minutes in advance, ASPPR achieves mean S1-Scores of: 96.30% for prediction between 1 and 6 minutes in advance, 96.13% for prediction between 8 and 13 minutes in advance, 94.5% for prediction between 14 and 19 minutes in advance, and 94.2% for prediction between 20 and 25 minutes in advance. PMID:24911316

  3. Neuropsychological approaches to epileptic encephalopathies.

    PubMed

    Filippini, Melissa; Arzimanoglou, Alexis; Gobbi, Giuseppe

    2013-11-01

    The International League Against Epilepsy (ILAE) Commission report on classification and terminology indicates that "diagnosing an individual as having an encephalopathic course requires demonstration of a failure to develop as expected relative to the same-aged peers or to regress in abilities." In this chapter, basing our discussion on the theoretical framework of neuroconstructivism, on the latest results deriving from functional neuroimaging and on the concept of system epilepsy, we use continuous spike-waves during slow-wave sleep (CSWS) as an example of how non-rapid eye movement (NREM) sleep spikes interfere with the organization and consolidation of neuropsychological networks in the sensitive phase of development, affecting also interconnected systems. Indeed, recent discoveries show that the normal overnight downscaling of slow wave activity (SWA) from the first to the last hours of sleep is absent in electrical status epilepticus during sleep (ESES) patients, thus impairing the neural process and possibly the local plastic changes associated with learning and other cognitive functions. Moreover, specific patterns of spike-induced activation (especially in perisylvian and/or prefrontal areas) and deactivation of default mode network (DMN) have been shown in patients with CSWS. Consequently, to date, we may conceive that the possible mechanisms underlying neuropsychological disorders in encephalopathic epilepsy (EE) may be double, since NREM sleep interictal epileptic discharges (IEDs) induce both a pathologic activation in epileptogenic areas and a pathologic deactivation of DMN beyond the epileptogenic zone. The growing body of literature on the effects of ESES in CSWS provides us with increasing knowledge on the complexity of brain development and a better understanding of plasticity, enlightening the pathogenesis of damage on developing neuropsychological functions. Finally, the need for an individually tailored interpretation of the neuropsychological

  4. COALESCENCE OF DEEP AND SUPERFICIAL EPILEPTIC FOCI INTO LARGER DISCHARGE UNITS IN ADULT RAT NEOCORTEX

    PubMed Central

    SERAFINI, RUGGERO; ANDRADE, RODRIGO; LOEB, JEFFREY A.

    2016-01-01

    Epilepsy is a disease of neuronal hyper-synchrony that can involve both neocortical and hippocampal brain regions. While much is known about the network properties of the hippocampus little is known of how epileptic neocortical hyper-synchrony develops. We aimed at characterizing the properties of epileptic discharges of a neocortical epileptic focus. We established a multi-electrode-array method to record the spatial patterns of epileptiform potentials in acute adult rat brain slices evoked by 4-Aminopyridine in the absence of magnesium. Locations of discharges mapped to two anatomical regions over the somatosensory cortex and over the lateral convexity separated by a gap at a location matching the dysgranular zone. Focal epileptiform discharges were recorded in superficial and deep neocortical layers but over superficial layers, they exhibited larger surface areas. They were often independent even when closely spaced to one another but they became progressively coupled resulting in larger zones of coherent discharge. The gradual coupling of multiple, independent, closely spaced, spatially restricted, focal discharges between deep and superficial neocortical layers represents a possible mechanism of the development of an epileptogenic zone. PMID:25701714

  5. Psychological approach of non-epileptic to epileptic patients: the dynamics of attitude changes during hospitalization.

    PubMed

    Jedrzejczak, J; Owczarek, K; Majkowski, J

    1999-09-01

    Measures of interpersonal relations of non-epileptic patients to epileptic patients were studied in search of answers to two questions: what is the initial attitude of non-epileptic patients to epileptic patients; and, do any changes in attitude occur during time spent together in hospital? In order to study these personal relations, a formal analysis of preferences was carried out. Twenty-two non-epileptic patients admitted to the Neurology and Epileptology Department, Medical Centre for Postgraduate Education, Warsaw were studied. Subjects were asked to rank-order (from 1 to 9 points) suggested ways of distributing the profits of a hypothetical joint (e.g., with a room-mate) money-earning venture. The experimental procedure for each patient was repeated for all three room-mates. Preferences were assessed three times - the day after admission to hospital, after 11 days and after 21 days in hospital. Following this procedure, it was possible to trace the dynamics of the patients' interpersonal relations. The data were correlated (Spearman's r(s)) and submitted to analysis of variance (MANOVA) with repeated measures. Analysis of the attitudes of patients with non-epileptic neurological disorders towards epileptic patients revealed a dynamic tendency - from negative (measures one and partly two) to positive attitudes after three weeks spent together in hospital (measure three).

  6. Epileptic seizure induced by fennel essential oil.

    PubMed

    Skalli, Souad; Soulaymani Bencheikh, Rachida

    2011-09-01

    An epileptic seizure is reported in a 38-year-old woman, known to be an epileptic patient. Although she was under antiepileptic treatment and had well-controlled epilepsy, she developed a typical generalised tonic-clonic seizure and remained unconscious for 45 minutes following ingestion of a number of cakes containing an unknown quantity of fennel essential oil. Involuntary diarrhoea accompanied her epileptic seizure. This reported case recalls the fact that fennel essential oil can induce seizures and that this oil should probably be avoided by patients with epilepsy. Labelling of products with fennel essential oil should refer to the risk of seizures, particularly for patients with epilepsy. An awareness programme should involve all stakeholders affected by this issue.

  7. Sudden unexpected death in epileptics following sudden, intense, increases in geomagnetic activity: Prevalence of effect and potential mechanisms

    NASA Astrophysics Data System (ADS)

    Persinger, M. A.; Psych, C.

    1995-12-01

    Abrupt, intense increases in global geomagnetic activity during the local night may precipitate a significant proportion of sudden unexpected (or unexplained) deaths (SUD) in epileptics. Over a 2-year period SUD in healthy chronic epileptic rats occurred when the average daily geomagnetic activity exceeded 50 nT (nanoTesla) and suddenly began during local night. Other experiments demonstrated that epileptic rats displayed more spontaneous seizures per night if there had been sudden increases in geomagnetic activity. Analyses of previously published data indicated that the number of SUDs/month in a population of human epileptics was positively associated with the number of days/month when the average geomagnetic activity exceeded 50 nT. The results support the hypothesis that suppression of the nocturnal concentrations of the endogenous anticonvulsant melatonin by sudden increases in geomagnetic activity may encourage fatal cardiac arrhythmias by uncoupling the insular/amygdaloid-paraventricular hypothalamic-solitary nucleus pathways.

  8. Epileptogenic actions of GABA and fast oscillations in the developing hippocampus.

    PubMed

    Khalilov, Ilgam; Le Van Quyen, Michel; Gozlan, Henri; Ben-Ari, Yehezkel

    2005-12-08

    GABA excites immature neurons and inhibits adult ones, but whether this contributes to seizures in the developing brain is not known. We now report that in the developing, but not the adult, hippocampus, seizures beget seizures only if GABAergic synapses are functional. In the immature hippocampus, seizures generated with functional GABAergic synapses include fast oscillations that are required to transform a naive network to an epileptic one: blocking GABA receptors prevents the long-lasting sequels of seizures. In contrast, in adult neurons, full blockade of GABA(A) receptors generates epileptogenic high-frequency seizures. Therefore, purely glutamatergic seizures are not epileptogenic in the developing hippocampus. We suggest that the density of glutamatergic synapses is not sufficient for epileptogenesis in immature neurons; excitatory GABAergic synapses are required for that purpose. We suggest that the synergistic actions of GABA and NMDA receptors trigger the cascades involved in epileptogenesis in the developing hippocampus.

  9. Prevention of epileptic seizures by taurine.

    PubMed

    El Idrissi, Abdeslem; Messing, Jeffrey; Scalia, Jason; Trenkner, Ekkhart

    2003-01-01

    Parenteral injection of kainic acid (KA), a glutamate receptor agonist, causes severe and stereotyped behavioral convulsions in mice and is used as a rodent model for human temporal lobe epilepsy. The goal of this study is to examine the potential anti-convulsive effects of the neuro-active amino acid taurine, in the mouse model of KA-induced limbic seizures. We found that taurine (43 mg/Kg, s.c.) had a significant antiepileptic effect when injected 10 min prior to KA. Acute injection of taurine increased the onset latency and reduced the occurrence of tonic seizures. Taurine also reduced the duration of tonic-clonic convulsions and mortality rate following KA-induced seizures. Furthermore, taurine significantly reduced neuronal cell death in the CA3 region of the hippocampus, the most susceptible region to KA in the limbic system. On the other hand, supplementation of taurine in drinking water (0.05%) for 4 continuous weeks failed to decrease the number or latency of partial or tonic-clonic seizures. To the contrary, we found that taurine-fed mice showed increased susceptibility to KA-induced seizures, as demonstrated by a decreased latency for clonic seizures, an increased incidence and duration of tonic-clonic seizures, increased neuronal death in the CA3 region of the hippocampus and a higher post-seizure mortality of the animals. We suggest that the reduced susceptibility to KA-induced seizures in taurine-injected mice is due to an increase in GABA receptor function in the brain which increases the inhibitory drive within the limbic system. This is supported by our in vitro data obtained in primary neuronal cultures showing that taurine acts as a low affinity agonist for GABA(A) receptors, protects neurons against kainate excitotoxic insults and modulates calcium homeostasis. Therefore, taurine is potentially capable of treating seizure-associated brain damage.

  10. Mesial temporal lobe epilepsy lateralization using SPHARM-based features of hippocampus and SVM

    NASA Astrophysics Data System (ADS)

    Esmaeilzadeh, Mohammad; Soltanian-Zadeh, Hamid; Jafari-Khouzani, Kourosh

    2012-02-01

    This paper improves the Lateralization (identification of the epileptogenic hippocampus) accuracy in Mesial Temporal Lobe Epilepsy (mTLE). In patients with this kind of epilepsy, usually one of the brain's hippocampi is the focus of the epileptic seizures, and resection of the seizure focus is the ultimate treatment to control or reduce the seizures. Moreover, the epileptogenic hippocampus is prone to shrinkage and deformation; therefore, shape analysis of the hippocampus is advantageous in the preoperative assessment for the Lateralization. The method utilized for shape analysis is the Spherical Harmonics (SPHARM). In this method, the shape of interest is decomposed using a set of bases functions and the obtained coefficients of expansion are the features describing the shape. To perform shape comparison and analysis, some pre- and post-processing steps such as "alignment of different subjects' hippocampi" and the "reduction of feature-space dimension" are required. To this end, first order ellipsoid is used for alignment. For dimension reduction, we propose to keep only the SPHARM coefficients with maximum conformity to the hippocampus shape. Then, using these coefficients of normal and epileptic subjects along with 3D invariants, specific lateralization indices are proposed. Consequently, the 1536 SPHARM coefficients of each subject are summarized into 3 indices, where for each index the negative (positive) value shows that the left (right) hippocampus is deformed (diseased). Employing these indices, the best achieved lateralization accuracy for clustering and classification algorithms are 85% and 92%, respectively. This is a significant improvement compared to the conventional volumetric method.

  11. [Research advances in circadian rhythm of epileptic seizures].

    PubMed

    Yang, Wen-Qi; Li, Hong

    2017-01-01

    The time phase of epileptic seizures has attracted more and more attention. Epileptic seizures have their own circadian rhythm. The same type of epilepsy has different seizure frequencies in different time periods and states (such as sleeping/awakening state and natural day/night cycle). The circadian rhythm of epileptic seizures has complex molecular and endocrine mechanisms, and currently there are several hypotheses. Clarification of the circadian rhythm of epileptic seizures and prevention and administration according to such circadian rhythm can effectively control seizures and reduce the adverse effects of drugs. The research on the circadian rhythm of epileptic seizures provides a new idea for the treatment of epilepsy.

  12. Magnetoencephalography in pediatric neurology and in epileptic syndromes.

    PubMed

    Verrotti, Alberto; Pizzella, Vittorio; Trotta, Daniela; Madonna, Laura; Chiarelli, Francesco; Romani, Gian Luca

    2003-04-01

    In recent years, great advances in the knowledge of neuromagnetism have permitted the application of Superconducting Quantum Interference Devices to the pathophysiologic study of the human brain. In particular, in pediatric neurology, the integration of biomagnetism with magnetic resonance imaging and other techniques for medical imaging have allowed for precise neuromagnetic measurements of the human brain. The more frequently used technique is magnetoencephalography. Recent data have illustrated the usefulness of magnetoencephalography in mapping activity of sensory and motor areas and in studying the spatiotemporal pattern of brain activation specific to somatosensory function. Moreover, magnetoencephalography is an important tool to localize epileptic activity; magnetic source imaging superimposes magnetoencephalographic localizations on the magnetic resonance imaging and yields improved spatial resolution as compared with surface electroencephalography. The role of magnetoencephalography in evaluating patients with epilepsy continues to evolve; in fact, it seems to be very useful in the localization of the epileptogenic zone in patients with partial epilepsy. This application of magnetoencephalography is essential in the selection of epileptic children candidates to surgical treatment of seizures.

  13. Epileptic fits under intravenous midazolam sedation.

    PubMed

    Robb, N D

    1996-09-07

    A case is presented of a patient who suffered from recurrent epileptic fits while being treated under intravenous sedation with midazolam. Those using sedation are advised to beware of the patient who gives a history of fits being provoked in the dental environment.

  14. Chewing Maintains Hippocampus-Dependent Cognitive Function

    PubMed Central

    Chen, Huayue; Iinuma, Mitsuo; Onozuka, Minoru; Kubo, Kin-Ya

    2015-01-01

    Mastication (chewing) is important not only for food intake, but also for preserving and promoting the general health. Recent studies have showed that mastication helps to maintain cognitive functions in the hippocampus, a central nervous system region vital for spatial memory and learning. The purpose of this paper is to review the recent progress of the association between mastication and the hippocampus-dependent cognitive function. There are multiple neural circuits connecting the masticatory organs and the hippocampus. Both animal and human studies indicated that cognitive functioning is influenced by mastication. Masticatory dysfunction is associated with the hippocampal morphological impairments and the hippocampus-dependent spatial memory deficits, especially in elderly. Mastication is an effective behavior for maintaining the hippocampus-dependent cognitive performance, which deteriorates with aging. Therefore, chewing may represent a useful approach in preserving and promoting the hippocampus-dependent cognitive function in older people. We also discussed several possible mechanisms involved in the interaction between mastication and the hippocampal neurogenesis and the future directions for this unique fascinating research. PMID:26078711

  15. Hippocampus and consciousness.

    PubMed

    Behrendt, Ralf-Peter

    2013-01-01

    An important assumption concerning the physiology of consciousness is that all varieties of conscious experience are closely related to each other and, hence, are subserved by the same neural mechanism. There are several considerations that lead us to implicate the hippocampus in the generation of conscious perception and, ultimately, of conscious experiences of all kinds. Firstly, conscious perception of external events is intricately linked with the formation of episodic (declarative) memories, a key function attributed to the hippocampus. Secondly, conscious experience is allocentric and contextualized. Consciousness creates or simulates an image of the world that appears to surround us and to be independent of our observation of it. What is characteristic of wakeful consciousness and dreaming alike is that objects or events are experienced as being embedded in an external, that is, allocentric, frame of space and time. The hippocampus has been implicated in the rapid formation and memorization of allocentric representations that embed objects or events in a world context. Thirdly, the hippocampus is ideally positioned to bind information processed in different sensory association cortices. It is argued that rapidly forming patterns of neuronal ensemble firing in the hippocampus, particularly in region CA3, which encode arbitrary associations between objects and their spatiotemporal and emotional context, that is, associations between information derived from different neocortical processing streams, define the informational content of consciousness. Evidence suggestive of an important contribution of the hippocampus to conscious observation, mental imagery, dreaming, conscious anticipation of outcomes, and hallucinations will be reviewed.

  16. Impaired dendritic inhibition leads to epileptic activity in a computer model of CA3.

    PubMed

    Sanjay, M; Neymotin, Samuel A; Krothapalli, Srinivasa B

    2015-11-01

    Temporal lobe epilepsy (TLE) is a common type of epilepsy with hippocampus as the usual site of origin. The CA3 subfield of hippocampus is reported to have a low epileptic threshold and hence initiates the disorder in patients with TLE. This study computationally investigates how impaired dendritic inhibition of pyramidal cells in the vulnerable CA3 subfield leads to generation of epileptic activity. A model of CA3 subfield consisting of 800 pyramidal cells, 200 basket cells (BC) and 200 Oriens-Lacunosum Moleculare (O-LM) interneurons was used. The dendritic inhibition provided by O-LM interneurons is reported to be selectively impaired in some TLEs. A step-wise approach is taken to investigate how alterations in network connectivity lead to generation of epileptic patterns. Initially, dendritic inhibition alone was reduced, followed by an increase in the external inputs received at the distal dendrites of pyramidal cells, and finally additional changes were made at the synapses between all neurons in the network. In the first case, when the dendritic inhibition of pyramidal cells alone was reduced, the local field potential activity changed from a theta-modulated gamma pattern to a prominently gamma frequency pattern. In the second case, in addition to this reduction of dendritic inhibition, with a simultaneous large increase in the external excitatory inputs received by pyramidal cells, the basket cells entered a state of depolarization block, causing the network to generate a typical ictal activity pattern. In the third case, when the dendritic inhibition onto the pyramidal cells was reduced and changes were simultaneously made in synaptic connectivity between all neurons in the network, the basket cells were again observed to enter depolarization block. In the third case, impairment of dendritic inhibition required to generate an ictal activity pattern was lesser than the two previous cases. Moreover, the ictal like activity began earlier in the third case

  17. Pattern Separation Deficits Following Damage to the Hippocampus

    ERIC Educational Resources Information Center

    Kirwan, C. Brock; Hartshorn, Andrew; Stark, Shauna M.; Goodrich-Hunsaker, Naomi J.; Hopkins, Ramona O.; Stark, Craig E. L.

    2012-01-01

    Computational models of hippocampal function propose that the hippocampus is capable of rapidly storing distinct representations through a process known as pattern separation. This prediction is supported by electrophysiological data from rodents and neuroimaging data from humans. Here, we test the prediction that damage to the hippocampus would…

  18. Role of the Dorsal Hippocampus in Object Memory Load

    ERIC Educational Resources Information Center

    Sannino, Sara; Russo, Fabio; Torromino, Giulia; Pendolino, Valentina; Calabresi, Paolo; De Leonibus, Elvira

    2012-01-01

    The dorsal hippocampus is crucial for mammalian spatial memory, but its exact role in item memory is still hotly debated. Recent evidence in humans suggested that the hippocampus might be selectively involved in item short-term memory to deal with an increasing memory load. In this study, we sought to test this hypothesis. To this aim we developed…

  19. [Liposteroid therapy for refractory epileptic spasms].

    PubMed

    Shimono, Kuriko Kagitani; Imai, Katsumi; Idoguchi, Rie; Kamio, Noriko; Okinaga, Takeshi; Ozono, Keiichi

    2003-11-01

    Liposteroid was administered intravenously to 6 patients with refractory epileptic spasms. In one case, the spasms initially disappeared but then reappeared after three months. Another case had a transient and slight decrease of epileptic spasms. In the only patient in whom spasms disappeared, EEG abnormalities were greatly improved with diffuse spikes and waves changing into focal spikes. Two cases displayed hyperexcitability, insomnia and acting out behavior, and the therapy was discontinued in one of them. One case had appetite loss and another showed an increase in tonic seizures. No patient had serious adverse effects such as infection, edema, subdural hematoma and brain shrinkage. Although liposteroid therapy has been recommended as an easy, useful and safe alternative for ACTH, we found considerable adverse effects and only a small effect on refractory spasms, and conclude that the regimen should be modified.

  20. Surgical Treatment of Pediatric Epileptic Encephalopathies

    PubMed Central

    Fridley, J.; Reddy, G.; Curry, D.; Agadi, S.

    2013-01-01

    Pediatric epileptiform encephalopathies are a group of neurologically devastating disorders related to uncontrolled ictal and interictal epileptic activity, with a poor prognosis. Despite the number of pharmacological options for treatment of epilepsy, many of these patients are drug resistant. For these patients with uncontrolled epilepsy, motor and/or neuropsychological deterioration is common. To prevent these secondary consequences, surgery is often considered as either a curative or a palliative option. Magnetic resonance imaging to look for epileptic lesions that may be surgically treated is an essential part of the workup for these patients. Many surgical procedures for the treatment of epileptiform encephalopathies have been reported in the literature. In this paper the evidence for these procedures for the treatment of pediatric epileptiform encephalopathies is reviewed. PMID:24288601

  1. Prosthetic management of an epileptic patient.

    PubMed

    Akeredolu, P A; Temisanren, O T; Danesi, M A

    2005-12-01

    This case report illustrates the problems of tooth loss in an epileptic patient. The patient presented with a broken denture following a seizure. She gave a history of breaking and swallowing her dentures during seizures. Before presentation she had worn five upper removable partial dentures. An upper removable partial denture with increased thickness of the acrylic palatal was fabricated and fitted satisfactorily. The patient was taught how to insert and remove the prosthesis as quickly as possible. Epileptic patients can use dentures but run the risk of frequently breaking and swallowing them during seizures. The risk can be reduced if patients and relatives are taught how to remove the dentures prior to or during seizures.

  2. Focal epileptic seizures mimicking sleep paralysis.

    PubMed

    Galimberti, Carlo Andrea; Ossola, Maria; Colnaghi, Silvia; Arbasino, Carla

    2009-03-01

    Sleep paralysis (SP) is a common parasomnia. The diagnostic criteria for SP, as reported in the International Classification of Sleep Disorders, are essentially clinical, as electroencephalography (EEG)-polysomnography (PSG) is not mandatory. We describe a subject whose sleep-related events fulfilled the diagnostic criteria for SP, even though her visual hallucinations were elementary, repetitive and stereotyped, thus differing from those usually reported by patients with SP. Video/EEG-PSG documented the focal epileptic nature of the SP-like episodes.

  3. Vitamin-Responsive Epileptic Encephalopathies in Children

    PubMed Central

    Agadi, Satish; Quach, Michael M.

    2013-01-01

    Untreated epileptic encephalopathies in children may potentially have disastrous outcomes. Treatment with antiepileptic drugs (AEDs) often may not control the seizures, and even if they do, this measure is only symptomatic and not specific. It is especially valuable to identify potential underlying conditions that have specific treatments. Only a few conditions have definitive treatments that can potentially modify the natural course of disease. In this paper, we discuss the few such conditions that are responsive to vitamin or vitamin derivatives. PMID:23984056

  4. Elevated oxidative stress and decreased antioxidant function in the human hippocampus and frontal cortex with increasing age: implications for neurodegeneration in Alzheimer's disease.

    PubMed

    Venkateshappa, C; Harish, G; Mahadevan, Anita; Srinivas Bharath, M M; Shankar, S K

    2012-08-01

    Oxidative stress and mitochondrial damage are implicated in the evolution of neurodegenerative diseases. Increased oxidative damage in specific brain regions during aging might render the brain susceptible to degeneration. Previously, we demonstrated increased oxidative damage and lowered antioxidant function in substantia nigra during aging making it vulnerable to degeneration associated with Parkinson's disease. To understand whether aging contributes to the vulnerability of brain regions in Alzheimer's disease, we assessed the oxidant and antioxidant markers, glutathione (GSH) metabolic enzymes, glial fibrillary acidic protein (GFAP) expression and mitochondrial complex I (CI) activity in hippocampus (HC) and frontal cortex (FC) compared with cerebellum (CB) in human brains with increasing age (0.01-80 years). We observed significant increase in protein oxidation (HC: p = 0.01; FC: p = 0.0002) and protein nitration (HC: p = 0.001; FC: p = 0.02) and increased GFAP expression (HC: p = 0.03; FC: p = 0.001) with a decreasing trend in CI activity in HC and FC compared to CB with increasing age. These changes were associated with a decrease in antioxidant enzyme activities, such as superoxide dismutase (HC: p = 0.005), catalase (HC: p = 0.02), thioredoxin reductase (FC: p = 0.04), GSH reductase (GR) (HC: p = 0.005), glutathione-s-transferase (HC: p = 0.0001; FC: p = 0.03) and GSH (HC: p = 0.01) with age. However, these parameters were relatively unaltered in CB. We suggest that the regions HC and FC are subjected to widespread oxidative stress, loss of antioxidant function and enhanced GFAP expression during aging which might make them more susceptible to deranged physiology and selective neuronal degeneration.

  5. Activated iron-containing microglia in the human hippocampus identified by magnetic resonance imaging in Alzheimer disease

    PubMed Central

    Zeineh, Michael M.; Chen, Yuanxin; Kitzler, Hagen H.; Hammond, Robert; Vogel, Hannes; Rutt, Brian K.

    2016-01-01

    Although amyloid plaques and neurofibrillary pathology play important roles in Alzheimer disease (AD), our understanding of AD is incomplete, and the contribution of microglia and iron to neurodegeneration is unknown. High-field magnetic resonance imaging (MRI) is exquisitely sensitive to microscopic iron. To explore iron-associated neuroinflammatory AD pathology, we studied AD and control human brain specimens by (1) performing ultra-high resolution ex vivo 7 Tesla MRI, (2) coregistering the MRI with successive histologic staining for iron, microglia, amyloid beta, and tau, and (3) quantifying the relationship between magnetic resonance signal intensity and histological staining. In AD, we identified numerous small MR hypointensities primarily within the subiculum that were best explained by the combination of microscopic iron and activated microglia (p = 0.025), in contradistinction to the relatively lesser contribution of tau or amyloid. Neuropathologically, this suggests that microglial-mediated neurodegeneration may occur in the hippocampal formation in AD and is detectable by ultra-high resolution MRI. PMID:26190634

  6. Understanding Genotypes and Phenotypes in Epileptic Encephalopathies

    PubMed Central

    Helbig, Ingo; Tayoun, Abou Ahmad N.

    2016-01-01

    Epileptic encephalopathies are severe often intractable seizure disorders where epileptiform abnormalities contribute to a progressive disturbance in brain function. Often, epileptic encephalopathies start in childhood and are accompanied by developmental delay and various neurological and non-neurological comorbidities. In recent years, this concept has become virtually synonymous with a group of severe childhood epilepsies including West syndrome, Lennox-Gastaut syndrome, Dravet syndrome, and several other severe childhood epilepsies for which genetic factors are increasingly recognized. In the last 5 years, the field has seen a virtual explosion of gene discovery, raising the number of bona fide genes and possible candidate genes for epileptic encephalopathies to more than 70 genes, explaining 20-25% of all cases with severe early-onset epilepsies that had otherwise no identifiable causes. This review will focus on the phenotypic variability as a characteristic aspect of genetic epilepsies. For many genetic epilepsies, the phenotypic presentation can be broad, even in patients with identical genetic alterations. Furthermore, patients with different genetic etiologies can have seemingly similar clinical presentations, such as in Dravet syndrome. While most patients carry mutations in SCN1A, similar phenotypes can be seen in patients with mutations in PCDH19, CHD2, SCN8A, or in rare cases GABRA1 and STXBP1. In addition to the genotypic and phenotypic heterogeneity, both benign phenotypes and severe encephalopathies have been recognized in an increasing number of genetic epilepsies, raising the question whether these conditions represent a fluid continuum or distinct entities. PMID:27781027

  7. Diagnosis and Management of Epileptic Encephalopathies in Children

    PubMed Central

    Jain, Puneet; Tripathi, Manjari

    2013-01-01

    Epileptic encephalopathies refer to a group of disorders in which the unremitting epileptic activity contributes to severe cognitive and behavioral impairments above and beyond what might be expected from the underlying pathology alone, and these can worsen over time leading to progressive cerebral dysfunction. Several syndromes have been described based on their electroclinical features (age of onset, seizure type, and EEG pattern). This review briefly describes the clinical evaluation and management of commonly encountered epileptic encephalopathies in children. PMID:23970964

  8. Neural networks with periodogram and autoregressive spectral analysis methods in detection of epileptic seizure.

    PubMed

    Kiymik, M Kemal; Subasi, Abdulhamit; Ozcalik, H Riza

    2004-12-01

    Approximately 1% of the people in the world suffer from epilepsy. Careful analyses of the electroencephalograph (EEG) records can provide valuable insight and improved understanding of the mechanisms causing epileptic disorders. Predicting the onset of epileptic seizure is an important and difficult biomedical problem, which has attracted substantial attention of the intelligent computing community over the past two decades. The purpose of this work was to investigate the performance of the periodogram and autoregressive (AR) power spectrum methods to extract classifiable features from human electroencephalogram (EEG) by using artificial neural networks (ANN). The feedforward ANN system was trained and tested with the backpropagation algorithm using a large data set of exemplars. We present a method for the automatic comparison of epileptic seizures in EEG, allowing the grouping of seizures having similar overall patterns. Each channel of the EEG is first broken down into segments having relatively stationary characteristics. Features are then calculated for each segment, and all segments of all channels of the seizures of a patient are grouped into clusters of similar morphology. This clustering allows labeling of every EEG segment. Examples from 5 patients with scalp electrodes illustrate the ability of the method to group seizures of similar morphology. It was observed that ANN classification of EEG signals with AR preprocessing gives better results, and these results can also be used for the deduction of epileptic seizure.

  9. Luteinizing hormone acts at the hippocampus to dampen spatial memory.

    PubMed

    Burnham, Veronica; Sundby, Christopher; Laman-Maharg, Abigail; Thornton, Janice

    2017-03-01

    Luteinizing hormone (LH) rises dramatically during and after menopause, and has been correlated with an increased incidence of Alzheimer's disease and decreased memory performance in humans and animal models. To test whether LH acts directly on the dorsal hippocampus to affect memory, ovariectomized female rats were infused with either the LH-homologue human chorionic gonadotropin (hCG) or the LH receptor antagonist deglycosylated-hCG (dg-hCG). Infusion of hCG into either the lateral ventricle or the dorsal hippocampus caused significant memory impairments in ovariectomized estradiol-treated females. Consistent with this, infusion of the LH antagonist dg-hCG into the dorsal hippocampus caused an amelioration of memory deficits in ovariectomized females. Furthermore, the gonadotropin-releasing hormone antagonist Antide, failed to act in the hippocampus to affect memory. These findings demonstrate a significant role for LH action in the dorsal hippocampus in spatial memory dysfunction.

  10. "Anything is good that stimulates thought" in the hippocampus. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    NASA Astrophysics Data System (ADS)

    Hofmann, Markus J.; Kuchinke, Lars

    2015-06-01

    While the emotional trias of brainstem, diencephalon, and orbitofrontal cortex is generally accepted to hold an affective function at its core, fewer researchers would agree that the least common denominator function of the hippocampus is affective [1]. There is a greater consensus on complementary learning systems theory proposing that in contrast to the outer cerebral cortex hosting more stable memories, synaptic associations in the hippocampus create novel knowledge in the context of episodic memories [2]. We chose Oscar Wilde's quote [3, p. 108] as title because we think that the novel hippocampal conjunction of for the most part familiar (long-term) knowledge patterns elicits the positive affect of appreciation [4,5].

  11. Modulation of axonal sprouting along rostro-caudal axis of dorsal hippocampus and no neuronal survival in parahippocampal cortices by long-term post-lesion melatonin administration in lithium-pilocarpine model of temporal lobe epilepsy

    PubMed Central

    Ganjkhani, Mahin; Ali, Rostami; Iraj, Jafari Anarkooli

    2016-01-01

    Feature outcome of hippocampus and extra-hippocampal cortices was evaluated in melatonin treated lithium-pilocarpine epileptic rats during early and chronic phases of temporal lobe epilepsy (TLE). After status epilepticus (SE) induction, 5 and 20 mg/kg melatonin were administered for 14 days or 60 days. All animals were killed 60 days post SE induction and the histological features of the rosrto-caudal axis of the dorsal hippocampus, piriform and entorhinal cortices were evaluated utilizing Nissl, Timm, and synapsin I immunoflorescent staining. Melatonin (20 mg/kg) effect on CA1 and CA3 neurons showed a region-specific pattern along the rostro-caudal axis of the dorsal hippocampus. The number of counted granular cells by melatonin (20 mg/kg) treatment increased along the rostro-caudal axis of the dorsal hippocampus in comparison to the untreated epileptic group. The density of Timm granules in the inner molecular layer of the dentate gyrus decreased significantly in all melatonin treated groups in comparison to the untreated epileptic animals. The increased density of synapsin I immunoreactivity in the outer molecular layer of the dentate gyrus of untreated epileptic rats showed a profound decrease following melatonin treatment. There was no neuronal protection in the piriform and entorhinal cortices whatever the melatonin treatment. Long-term melatonin administration as a co-adjuvant probably could reduce the post-lesion histological consequences of TLE in a region-specific pattern along the rostro-caudal axis of the dorsal hippocampus. PMID:27051565

  12. Unsolved mysteries: the hippocampus.

    PubMed

    Isaacson, Robert L

    2002-06-01

    The continuing explosion of scientific interest in the hippocampus began in the 1950s, initiated in large part by the recognition of the importance of the observations of hippocampectomized monkeys made by Klüver and Bucy and the remarkable memory loss of patient H. M. following temporal lobe surgery. Subsequent to these studies, research and theories about the hippocampus grew exponentially in number and diversity. As yet, no theory of hippocampal function explains all of the phenomena discovered in the clinic or laboratory. In this article, experimental results that have been forgotten or ignored in most theories are presented. Adequate theories of hippocampal function must account for known, reliable postsurgical behavioral observations and consider the conditions under which anomalies are noted. Comprehensive theories will require new approaches in which the interactions of the hippocampus with the central nervous system are understood.

  13. Behavioral state classification in epileptic brain using intracranial electrophysiology

    NASA Astrophysics Data System (ADS)

    Kremen, Vaclav; Duque, Juliano J.; Brinkmann, Benjamin H.; Berry, Brent M.; Kucewicz, Michal T.; Khadjevand, Fatemeh; Van Gompel, Jamie; Stead, Matt; St. Louis, Erik K.; Worrell, Gregory A.

    2017-04-01

    Objective. Automated behavioral state classification can benefit next generation implantable epilepsy devices. In this study we explored the feasibility of automated awake (AW) and slow wave sleep (SWS) classification using wide bandwidth intracranial EEG (iEEG) in patients undergoing evaluation for epilepsy surgery. Approach. Data from seven patients (age 34+/- 12 , 4 women) who underwent intracranial depth electrode implantation for iEEG monitoring were included. Spectral power features (0.1–600 Hz) spanning several frequency bands from a single electrode were used to train and test a support vector machine classifier. Main results. Classification accuracy of 97.8  ±  0.3% (normal tissue) and 89.4  ±  0.8% (epileptic tissue) across seven subjects using multiple spectral power features from a single electrode was achieved. Spectral power features from electrodes placed in normal temporal neocortex were found to be more useful (accuracy 90.8  ±  0.8%) for sleep-wake state classification than electrodes located in normal hippocampus (87.1  ±  1.6%). Spectral power in high frequency band features (Ripple (80–250 Hz), Fast Ripple (250–600 Hz)) showed comparable performance for AW and SWS classification as the best performing Berger bands (Alpha, Beta, low Gamma) with accuracy  ⩾90% using a single electrode contact and single spectral feature. Significance. Automated classification of wake and SWS should prove useful for future implantable epilepsy devices with limited computational power, memory, and number of electrodes. Applications include quantifying patient sleep patterns and behavioral state dependent detection, prediction, and electrical stimulation therapies.

  14. Stress, memory, and the hippocampus.

    PubMed

    Wingenfeld, Katja; Wolf, Oliver T

    2014-01-01

    Stress hormones, i.e. cortisol in human and cortisone in rodents, influence a wide range of cognitive functions, including hippocampus-based declarative memory performance. Cortisol enhances memory consolidation, but impairs memory retrieval. In this context glucocorticoid receptor sensitivity and hippocampal integrity play an important role. This review integrates findings on the relationships between the hypothalamus-pituitary-adrenal (HPA) axis, one of the main coordinators of the stress response, hippocampus, and memory. Findings obtained in healthy participants will be compared with selected mental disorders, including major depressive disorder (MDD), posttraumatic stress disorder (PTSD), and borderline personality disorder (BPD). These disorders are characterized by alterations of the HPA axis and hippocampal dysfunctions. Interestingly, the acute effects of stress hormones on memory in psychiatric patients are different from those found in healthy humans. While cortisol administration has failed to affect memory retrieval in patients with MDD, patients with PTSD and BPD have been found to show enhanced rather than impaired memory retrieval after hydrocortisone. This indicates an altered sensitivity to stress hormones in these mental disorders.

  15. Serotonin Receptors in Hippocampus

    PubMed Central

    Berumen, Laura Cristina; Rodríguez, Angelina; Miledi, Ricardo; García-Alcocer, Guadalupe

    2012-01-01

    Serotonin is an ancient molecular signal and a recognized neurotransmitter brainwide distributed with particular presence in hippocampus. Almost all serotonin receptor subtypes are expressed in hippocampus, which implicates an intricate modulating system, considering that they can be localized as autosynaptic, presynaptic, and postsynaptic receptors, even colocalized within the same cell and being target of homo- and heterodimerization. Neurons and glia, including immune cells, integrate a functional network that uses several serotonin receptors to regulate their roles in this particular part of the limbic system. PMID:22629209

  16. Mice doubly-deficient in lysosomal hexosaminidase A and neuraminidase 4 show epileptic crises and rapid neuronal loss.

    PubMed

    Seyrantepe, Volkan; Lema, Pablo; Caqueret, Aurore; Dridi, Larbi; Bel Hadj, Samar; Carpentier, Stephane; Boucher, Francine; Levade, Thierry; Carmant, Lionel; Gravel, Roy A; Hamel, Edith; Vachon, Pascal; Di Cristo, Graziella; Michaud, Jacques L; Morales, Carlos R; Pshezhetsky, Alexey V

    2010-09-16

    Tay-Sachs disease is a severe lysosomal disorder caused by mutations in the HexA gene coding for the α-subunit of lysosomal β-hexosaminidase A, which converts G(M2) to G(M3) ganglioside. Hexa(-/-) mice, depleted of β-hexosaminidase A, remain asymptomatic to 1 year of age, because they catabolise G(M2) ganglioside via a lysosomal sialidase into glycolipid G(A2), which is further processed by β-hexosaminidase B to lactosyl-ceramide, thereby bypassing the β-hexosaminidase A defect. Since this bypass is not effective in humans, infantile Tay-Sachs disease is fatal in the first years of life. Previously, we identified a novel ganglioside metabolizing sialidase, Neu4, abundantly expressed in mouse brain neurons. Now we demonstrate that mice with targeted disruption of both Neu4 and Hexa genes (Neu4(-/-);Hexa(-/-)) show epileptic seizures with 40% penetrance correlating with polyspike discharges on the cortical electrodes of the electroencephalogram. Single knockout Hexa(-/-) or Neu4(-/-) siblings do not show such symptoms. Further, double-knockout but not single-knockout mice have multiple degenerating neurons in the cortex and hippocampus and multiple layers of cortical neurons accumulating G(M2) ganglioside. Together, our data suggest that the Neu4 block exacerbates the disease in Hexa(-/-) mice, indicating that Neu4 is a modifier gene in the mouse model of Tay-Sachs disease, reducing the disease severity through the metabolic bypass. However, while disease severity in the double mutant is increased, it is not profound suggesting that Neu4 is not the only sialidase contributing to the metabolic bypass in Hexa(-/-) mice.

  17. Glucocorticoids and the ageing hippocampus

    PubMed Central

    HIBBERD, CARINA; YAU, JOYCE L. W.; SECKL, JONATHAN R.

    2000-01-01

    Approximately 30% of human and mammalian populations develop cognitive impairments with ageing. Many of these impairments have been linked to dysfunction of the hippocampus, a well studied area of the medial-temporal lobe, which is involved in episodic memory and control of the hypothalamo-pituitary-adrenal stress axis and, thus, of glucocorticoid secretion. This paper reviews the growing body of studies which explore a possible relationship between lifetime exposure to glucocorticoids and hippocampal impairment. There is now strong evidence which associates hypercortisolemia in aged men with later cognitive dysfunction and this complements a wealth of rodent and other human data. We conclude with a discussion of possible pharmacological and behavioural interventions. PMID:11197528

  18. Whole transcriptome profiling of the human hippocampus suggests an involvement of the KIBRA rs17070145 polymorphism in differential activation of the MAPK signaling pathway.

    PubMed

    Piras, I S; Krate, J; Schrauwen, I; Corneveaux, J J; Serrano, G E; Sue, L; Beach, T G; Huentelman, M J

    2017-04-05

    The rs17070145-T variant of the WWC1 gene, coding for the KIBRA protein, has been associated with both increased episodic memory performance and lowered risk for late onset Alzheimer's disease, although the mechanism behind this protective effect has not been completely elucidated. To achieve a better understanding of the pathways modulated by rs17070145 and its associated functional variant(s), we used laser capture microdissection (LCM) and RNA-sequencing to investigate the effect of rs17070145 genotypes on whole transcriptome expression in the human hippocampus (HP) of 22 neuropathologically normal individuals, with a specific focus on the dentate gyrus (DG) and at the pyramidal cells (PC) of CA1 and CA3 sub-regions. Differential expression analysis of RNA-seq data within the HP based on the rs17070145 genotype revealed an overexpression of genes involved in the MAPK signaling pathway, potentially driven by the T/T genotype. The most important contribution comes from genes dysregulated within the DG region. Other genes significantly dysregulated, and not involved in the MAPK1 pathway (Adj P < 0.01 and Fold Change > |1.00|) were: RSPO4 (HP); ARC, DUSP5, DNAJB5, EGR4, PPP1R15A, WBP11P1, EGR1, GADD45B (DG); CH25H, HSPA1A, HSPA1B, TNFSF9 and NPAS4 (PC). Several evidences suggested that the MAPK signaling pathway is linked with memory and learning processes. In non-neuronal cells, the KIBRA protein is phosphorylated by ERK1/2 (involved in the MAPK signaling) in cells as well as in vitro. Several of the other dysregulated genes are involved in memory and learning processes, as well as in Alzheimer's Disease. In conclusion, our results suggest that the effect of the WWC1 rs17070145 polymorphism on memory performance and Alzheimer's disease might be due to a differential regulation of the MAPK signaling, a key pathway involved in memory and learning processes. This article is protected by copyright. All rights reserved.

  19. Impaired picture recognition in transient epileptic amnesia.

    PubMed

    Dewar, Michaela; Hoefeijzers, Serge; Zeman, Adam; Butler, Christopher; Della Sala, Sergio

    2015-01-01

    Transient epileptic amnesia (TEA) is an epileptic syndrome characterized by recurrent, brief episodes of amnesia. Transient epileptic amnesia is often associated with the rapid decline in recall of new information over hours to days (accelerated long-term forgetting - 'ALF'). It remains unknown how recognition memory is affected in TEA over time. Here, we report a systematic study of picture recognition in patients with TEA over the course of one week. Sixteen patients with TEA and 16 matched controls were presented with 300 photos of everyday life scenes. Yes/no picture recognition was tested 5min, 2.5h, 7.5h, 24h, and 1week after picture presentation using a subset of target pictures as well as similar and different foils. Picture recognition was impaired in the patient group at all test times, including the 5-minute test, but it declined normally over the course of 1week. This impairment was associated predominantly with an increased false alarm rate, especially for similar foils. High performance on a control test indicates that this impairment was not associated with perceptual or discrimination deficits. Our findings suggest that, at least in some TEA patients with ALF in verbal recall, picture recognition does not decline more rapidly than in controls over 1week. However, our findings of an early picture recognition deficit suggest that new visual memories are impoverished after minutes in TEA. This could be the result of deficient encoding or impaired early consolidation. The early picture recognition deficit observed could reflect either the early stages of the process that leads to ALF or a separable deficit of anterograde memory in TEA. Lastly, our study suggests that at least some patients with TEA are prone to falsely recognizing new everyday visual information that they have not in fact seen previously. This deficit, alongside their ALF in free recall, likely affects everyday memory performance.

  20. [Non-epileptic paroxysmal sleep disorders].

    PubMed

    Malagón-Valdez, Jorge

    2013-09-06

    Non-epileptic paroxysmal disorders during sleep are a great challenge for the clinician. It is important to know the various clinical manifestations for appropriate differential diagnosis, since alterations in sleep, mostly motor, are part of these disorders. Our paper describes the normal sleep stages and electroencephalographic characteristics and polysomnography basic data. The confusions especially with nocturnal frontal lobe epilepsy are frequent and cause unnecessary drugs administered, the emotional burden of the parents or caretakers, which is the diagnosis of epilepsy. We discuss the possible causes of diagnostic errors.

  1. The hippocampus is an integral part of the temporal limbic system during emotional processing. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    NASA Astrophysics Data System (ADS)

    Trost, Wiebke; Frühholz, Sascha

    2015-06-01

    The proposed quartet theory of human emotions by Koelsch and colleagues [1] identifies four different affect systems to be involved in the processing of particular types of emotions. Moreover, the theory integrates both basic emotions and more complex emotion concepts, which include also aesthetic emotions such as musical emotions. The authors identify a particular brain system for each kind of emotion type, also by contrasting them to brain structures that are generally involved in emotion processing irrespective of the type of emotion. A brain system that has been less regarded in emotion theories, but which represents one of the four systems of the quartet to induce attachment related emotions, is the hippocampus.

  2. Epileptic Seizure Detection and Warning Device

    SciTech Connect

    Elarton, J.K.; Koepsel, K.L.

    1999-06-21

    Flint Hills Scientific, L.L.C. (FHS) has invented what is believed to be the first real-time epileptic seizure detection and short-term prediction method in the world. They have demonstrated an IBM PC prototype with a multi-channel EEG monitoring configuration. This CRADA effort applied AlliedSignal FM and T hardware design, manufacturing miniaturization, and high quality manufacturing expertise in converting the prototype into a small, portable, self-contained, multi-channel EEG epileptic seizure detection and warning device. The purpose of this project was to design and build a proof-of-concept miniaturized prototype of the FHS-developed PC-based prototype. The resultant DSP prototype, measuring 4'' x 6'' x 2'', seizure detection performance compared favorably with the FHS PC prototype, thus validating the DSP design goals. The very successful completion of this project provided valuable engineering information for FHS for future prototype commercialization as well as providing AS/FM and T engineers DSP design experience.

  3. Factors associated with hopelessness in epileptic patients

    PubMed Central

    Pompili, Maurizio; Serafini, Gianluca; Innamorati, Marco; Montebovi, Franco; Lamis, Dorian A; Milelli, Mariantonietta; Giuliani, Manuela; Caporro, Matteo; Tisei, Paolo; Lester, David; Amore, Mario; Girardi, Paolo; Buttinelli, Carla

    2014-01-01

    AIM: To investigate factors related to hopelessness in a sample of epileptic patients, including measures of depression and quality of life (QOL). METHODS: Sixty-nine participants were administered the following psychometric instruments: Beck Depression Inventory-II, Beck Hopelessness Scale (BHS), and QOL in Epilepsy (QOLIE)-89. Patients were dichotomized into two categories: those affected by epilepsy with generalized tonic-clonic seizures vs those having epilepsy with partial seizures. RESULTS: The groups differed on the QOLIE Role Limitation/Emotional dimension. Patients with generalized seizures reported more limitations in common social/role activities related to emotional problems than patients with other types of epilepsy (89.57 ± 25.49 vs 72.86 ± 36.38; t63 = -2.16; P < 0.05). All of the respondents reported moderate to severe depression, and 21.7% of patients with generalized seizures and 28.6% of patients with other diagnoses had BHS total scores ≥ 9 indicating a higher suicidal risk. The study did not control for years of the illness. CONCLUSION: Patients with generalized seizures reported more limitations in common social/role activities related to emotional problems compared to patients with other types of seizures. Patients at increased suicide risk as evaluated by the BHS were older than those who had a lower suicidal risk. Future studies are required to further investigate the impact of hopelessness on the outcome of epileptic patients. PMID:25540729

  4. Long-Term Intake of Uncaria rhynchophylla Reduces S100B and RAGE Protein Levels in Kainic Acid-Induced Epileptic Seizures Rats

    PubMed Central

    Tang, Nou-Ying; Ho, Tin-Yun; Chen, Chao-Hsiang

    2017-01-01

    Epileptic seizures are crucial clinical manifestations of recurrent neuronal discharges in the brain. An imbalance between the excitatory and inhibitory neuronal discharges causes brain damage and cell loss. Herbal medicines offer alternative treatment options for epilepsy because of their low cost and few side effects. We established a rat epilepsy model by injecting kainic acid (KA, 12 mg/kg, i.p.) and subsequently investigated the effect of Uncaria rhynchophylla (UR) and its underlying mechanisms. Electroencephalogram and epileptic behaviors revealed that the KA injection induced epileptic seizures. Following KA injection, S100B levels increased in the hippocampus. This phenomenon was attenuated by the oral administration of UR and valproic acid (VA, 250 mg/kg). Both drugs significantly reversed receptor potentiation for advanced glycation end product proteins. Rats with KA-induced epilepsy exhibited no increase in the expression of metabotropic glutamate receptor 3, monocyte chemoattractant protein 1, and chemokine receptor type 2, which play a role in inflammation. Our results provide novel and detailed mechanisms, explaining the role of UR in KA-induced epileptic seizures in hippocampal CA1 neurons. PMID:28386293

  5. Transcriptional Response of Polycomb Group Genes to Status Epilepticus in Mice is Modified by Prior Exposure to Epileptic Preconditioning.

    PubMed

    Reynolds, James P; Miller-Delaney, Suzanne F C; Jimenez-Mateos, Eva M; Sano, Takanori; McKiernan, Ross C; Simon, Roger P; Henshall, David C

    2015-01-01

    Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group (PcG) proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here, we explored the transcriptional response of genes associated with polycomb repressive complex (PRC) 1 (Ring1A, Ring1B, and Bmi1) and PRC2 (Ezh1, Ezh2, and Suz12), as well as additional transcriptional regulators Sirt1, Yy1, and Yy2, in a mouse model of status epilepticus (SE). Findings were contrasted to changes after SE in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed SE prompted an early (1 h) increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4, 8, and 24 h). Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12, and Yy2 relative to the normal injury response to SE. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes PcG gene expression following SE and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.

  6. [ECG characteristics in epilepsy of homo- and heterospecific hereditary origin and schizophrenia with latent epileptic predisposition].

    PubMed

    Dvirskiĭ, A G; Shevtsov, A G; Glasner, A K; Dubrovin, Iu B; Krut'ko, Iu A; Svaĭdan, S

    1991-01-01

    The EEG data were compared among 260 epileptic patients, including 94 patients loaded with schizophrenia, 71 patients loaded with epilepsy, 95 patients without revealed hereditary loading with mental diseases, and among 32 schizophrenics in whom epileptic seizures could be seen during insulin therapy. Hereditary loading with epilepsy or schizophrenia in epileptic patients together with latent epileptic schizophrenia ++predisposition influence the characteristics of the electroencephalogram.

  7. Distribution entropy analysis of epileptic EEG signals.

    PubMed

    Li, Peng; Yan, Chang; Karmakar, Chandan; Liu, Changchun

    2015-01-01

    It is an open-ended challenge to accurately detect the epileptic seizures through electroencephalogram (EEG) signals. Recently published studies have made elaborate attempts to distinguish between the normal and epileptic EEG signals by advanced nonlinear entropy methods, such as the approximate entropy, sample entropy, fuzzy entropy, and permutation entropy, etc. Most recently, a novel distribution entropy (DistEn) has been reported to have superior performance compared with the conventional entropy methods for especially short length data. We thus aimed, in the present study, to show the potential of DistEn in the analysis of epileptic EEG signals. The publicly-accessible Bonn database which consisted of normal, interictal, and ictal EEG signals was used in this study. Three different measurement protocols were set for better understanding the performance of DistEn, which are: i) calculate the DistEn of a specific EEG signal using the full recording; ii) calculate the DistEn by averaging the results for all its possible non-overlapped 5 second segments; and iii) calculate it by averaging the DistEn values for all the possible non-overlapped segments of 1 second length, respectively. Results for all three protocols indicated a statistically significantly increased DistEn for the ictal class compared with both the normal and interictal classes. Besides, the results obtained under the third protocol, which only used very short segments (1 s) of EEG recordings showed a significantly (p <; 0.05) increased DistEn for the interictal class in compassion with the normal class, whereas both analyses using relatively long EEG signals failed in tracking this difference between them, which may be due to a nonstationarity effect on entropy algorithm. The capability of discriminating between the normal and interictal EEG signals is of great clinical relevance since it may provide helpful tools for the detection of a seizure onset. Therefore, our study suggests that the Dist

  8. Unconscious relational encoding depends on hippocampus

    PubMed Central

    Duss, Simone B.; Reber, Thomas P.; Hänggi, Jürgen; Schwab, Simon; Wiest, Roland; Müri, René M.; Brugger, Peter; Gutbrod, Klemens

    2014-01-01

    Textbooks divide between human memory systems based on consciousness. Hippocampus is thought to support only conscious encoding, while neocortex supports both conscious and unconscious encoding. We tested whether processing modes, not consciousness, divide between memory systems in three neuroimaging experiments with 11 amnesic patients (mean age = 45.55 years, standard deviation = 8.74, range = 23–60) and 11 matched healthy control subjects. Examined processing modes were single item versus relational encoding with only relational encoding hypothesized to depend on hippocampus. Participants encoded and later retrieved either single words or new relations between words. Consciousness of encoding was excluded by subliminal (invisible) word presentation. Amnesic patients and controls performed equally well on the single item task activating prefrontal cortex. But only the controls succeeded on the relational task activating the hippocampus, while amnesic patients failed as a group. Hence, unconscious relational encoding, but not unconscious single item encoding, depended on hippocampus. Yet, three patients performed normally on unconscious relational encoding in spite of amnesia capitalizing on spared hippocampal tissue and connections to language cortex. This pattern of results suggests that processing modes divide between memory systems, while consciousness divides between levels of function within a memory system. PMID:25273998

  9. Selective loss and axonal sprouting of GABAergic interneurons in the sclerotic hippocampus induced by LiCl-pilocarpine.

    PubMed

    Long, Lili; Xiao, Bo; Feng, Li; Yi, Fang; Li, Guoliang; Li, Shuyu; Mutasem, M Abuhamed; Chen, Si; Bi, Fangfang; Li, Yi

    2011-02-01

    In this study, we performed immunohistochemistry for somatostatin (SS), neuropeptide Y (NPY), and parvalbumin (PV) in LiCl-pilocarpine-treated rats to observe quantitative changes and axonal sprouting of GABAergic interneurons in the hippocampus, especially in the sclerotic hippocampus. Fluoro-Jade B (FJB) was performed to detect the specific degeneration of GABAergic interneurons. Compared with age-matched control rats, there were fewer SS/NPY/PV-immunoreactive (IR) interneurons in the hilus of the sclerotic hippocampus in pilocarpine-treated rats; hilar dentritic inhibitory interneurons were most vulnerable. FJB stain revealed degeneration was evident at 2 months after status epilepticus. Some SS-IR and NPY-IR interneurons were also stained for FJB, but there was no evidence of degeneration of PV-IR interneurons. Axonal sprouting of GABAergic interneurons was present in the hippocampus of epileptic rats, and a dramatic increase of SS-IR fibers was observed throughout all layers of CA1 region in the sclerotic hippocampus. These results confirm selective loss and degeneration of a specific subset of GABAergic interneurons in specific subfields of the hippocampus. Axonal sprouting of inhibitory GABAergic interneurons, especially numerous increase of SS-IR neutrophils within CA1 region of the sclerotic hippocampus, may constitute the aberrant inhibitory circum and play a significant role in the generation and compensation of temporal lobe epilepsy.

  10. Epileptic EEG: a comprehensive study of nonlinear behavior.

    PubMed

    Daneshyari, Moayed; Kamkar, L Lily; Daneshyari, Matin

    2010-01-01

    In this study, the nonlinear properties of the electroencephalograph (EEG) signals are investigated by comparing two sets of EEG, one set for epileptic and another set for healthy brain activities. Adopting measures of nonlinear theory such as Lyapunov exponent, correlation dimension, Hurst exponent, fractal dimension, and Kolmogorov entropy, the chaotic behavior of these two sets is quantitatively computed. The statistics for the two groups of all measures demonstrate the differences between the normal healthy group and epileptic one. The statistical results along with phase-space diagram verify that brain under epileptic seizures possess limited trajectory in the state space than in healthy normal state, consequently behaves less chaotically compared to normal condition.

  11. [Clinical presentation and diagnosis of epileptic auras].

    PubMed

    Barletova, E I; Kremenchugskaia, M R; Mukhin, K Iu; Glukhova, L Iu; Mironov, M B

    2012-01-01

    To define clinical presentations of visual auras and to reveal their clinical, encephalographic and neuroimaging correlates, we examined 23 patients, aged from 5 to 25 years (mean 14±6 years), with focal forms of epilepsy. Patients had visual auras regardless of the etiology of epilepsy which developed immediately before epileptic seizures or were isolated. Patients had simple or complex visual hallucinations, the former occurring more frequently, visual illusions and ictal amaurosis. Positive visual phenomena were noted more frequently than negative ones. In most of the patients, visual hallucinations were associated with the pathological activity in cortical occipital regions of the brain and, in some cases, in temporal and parietal regions. The different pathologies (developmental defects, post-ischemic, atrophic and other disturbances) identified by MRI were found in a half of patients.

  12. Epileptic Seizure Forewarning by Nonlinear Techniques

    SciTech Connect

    Hively, LM

    2001-02-05

    Nicolet Biomedical Inc. (NBI) is collaborating with Oak Ridge National Laboratory (ORNL) under a Cooperative Research and Development Agreement (CRADA) to convert ORNL.s patented technology for forewarning of epileptic seizures to a clinical prototype. This technical report describes the highlights of the first year.s effort. The software requirements for the clinical device were specified from which the hardware specifications were obtained. ORNL's research-class FORTRAN was converted to run under a graphical user interface (GUI) that was custom-built for this application by NBI. The resulting software package was cloned to desktop computers that are being tested in five different clinical sites. Two hundred electroencephalogram (EEG) datasets from those clinical sites were provided to ORNL for detailed analysis and improvement of the forewarning methodology. Effort under this CRADA is continuing into the second year as planned.

  13. Water intoxication in epileptic patients receiving carbamazepine.

    PubMed Central

    Perucca, E; Garratt, A; Hebdige, S; Richens, A

    1978-01-01

    Plasma sodium and osmolality were determined in 80 adult epileptic patients receiving chronic treatment with carbamazepine and in 50 control patients treated with other anticonvulsant drugs. Mean plasma osmolality was significantly lower in the carbamazepine-treated patients but mean plasma sodium did not differ in the two groups. Hyponatraemia was found in five of the carbamazine-treated patients and hypo-osmolality in six. None of the control patients had hyponatraemia and only one had a borderline low osmolality. Three of the 13 patients receiving carbamazepine alone were hyponatraemic. Plasma sodium concentration correlated negatively with both daily carbamazepine dose and serum carbamazepine level. Free water clearance after an oral water load was determined in six patients on carbamazepine alone and in six normal subjects not receiving drug therapy. The capacity of some of the patients to excrete the water load was found to be grossly impaired. PMID:681958

  14. Calcium/calmodulin kinase II activity of hippocampus in kainate-induced epilepsy.

    PubMed Central

    Lee, M. C.; Ban, S. S.; Woo, Y. J.; Kim, S. U.

    2001-01-01

    This study investigated calcium/calmodulin kinase II (CaMKII) activity related to long-standing neuronal injury of the hippocampus in kainate (KA)-induced experimental temporal lobe epilepsy. Epileptic seizure was induced by injection of KA (1 microg/microL) dissolved in phosphate buffer (0.1 M, pH 7.4) into the left amygdala. Clinical seizures, histopathologic changes and CaMKII activity of the hippocampus were evaluated. Characteristic early limbic and late seizures were developed. Hippocampal CaMKII activity increased significantly 4 and 8 weeks after intra-amygdaloid injection of KA, when late seizures developed. The histopathologic changes of the hippocampus included swelling of neuronal cytoplasm with nuclear pyknosis and loss of neurons in CA3 during this period. The increased activity of CaMKII may correlate with appearance of distant damage in the hippocampus. The above results indicate that intra-amygdaloid injection of KA produces excitatory signals for ipsilateral CA3 neurons in the hippocampus and that subsequently increased levels of CaMKII in postsynaptic neurons induce neuronal injury via phosphorylation of N-methyl-D-aspartate type glutamate receptor. PMID:11641537

  15. The multi-instrumentalist hippocampus. Comment on "The quartet theory of human emotions: An integrative and neurofunctional model" by S. Koelsch et al.

    NASA Astrophysics Data System (ADS)

    Strange, Bryan A.; Yebra, Mar

    2015-06-01

    Characterizing the neural circuitry of emotion is important not only from a basic science perspective, but also for understanding how these circuits may malfunction in psychiatric disease. A fundamental question for affective neuroscience is whether there are specialised neuroanatomical areas, or "modules", dedicated to the processing of emotional stimuli. In their review, Koelsch and colleagues [1] argue for the existence of a quartet of neuroanatomically distinct cerebral systems involved in the generation of a specific class of affects. Intriguingly, all four systems (brainstem-, diencephalon-, hippocampus-, and orbitofrontal-centred) comprise brain areas whose role in emotional processing is in addition to mediating other specific aspects of cognition. One member of the quartet in which this is particularly apparent is the hippocampus, a structure known to be critical for episodic memory and navigation. If areas involved in emotion also mediate other brain functions, this raises an issue of whether these multiple functions are executed by segregated circuits within each structure - i.e., a "module" for emotion residing in a sub-division of a brain structure - or whether these circuits are superimposed.

  16. The piriform cortex and human focal epilepsy.

    PubMed

    Vaughan, David N; Jackson, Graeme D

    2014-01-01

    It is surprising that the piriform cortex, when compared to the hippocampus, has been given relatively little significance in human epilepsy. Like the hippocampus, it has a phylogenetically preserved three-layered cortex that is vulnerable to excitotoxic injury, has broad connections to both limbic and cortical areas, and is highly epileptogenic - being critical to the kindling process. The well-known phenomenon of early olfactory auras in temporal lobe epilepsy highlights its clinical relevance in human beings. Perhaps because it is anatomically indistinct and difficult to approach surgically, as it clasps the middle cerebral artery, it has, until now, been understandably neglected. In this review, we emphasize how its unique anatomical and functional properties, as primary olfactory cortex, predispose it to involvement in focal epilepsy. From recent convergent findings in human neuroimaging, clinical epileptology, and experimental animal models, we make the case that the piriform cortex is likely to play a facilitating and amplifying role in human focal epileptogenesis, and may influence progression to epileptic intractability.

  17. The Piriform Cortex and Human Focal Epilepsy

    PubMed Central

    Vaughan, David N.; Jackson, Graeme D.

    2014-01-01

    It is surprising that the piriform cortex, when compared to the hippocampus, has been given relatively little significance in human epilepsy. Like the hippocampus, it has a phylogenetically preserved three-layered cortex that is vulnerable to excitotoxic injury, has broad connections to both limbic and cortical areas, and is highly epileptogenic – being critical to the kindling process. The well-known phenomenon of early olfactory auras in temporal lobe epilepsy highlights its clinical relevance in human beings. Perhaps because it is anatomically indistinct and difficult to approach surgically, as it clasps the middle cerebral artery, it has, until now, been understandably neglected. In this review, we emphasize how its unique anatomical and functional properties, as primary olfactory cortex, predispose it to involvement in focal epilepsy. From recent convergent findings in human neuroimaging, clinical epileptology, and experimental animal models, we make the case that the piriform cortex is likely to play a facilitating and amplifying role in human focal epileptogenesis, and may influence progression to epileptic intractability. PMID:25538678

  18. Neurogenesis in a young dog with epileptic seizures.

    PubMed

    Borschensky, C M; Woolley, J S; Kipar, A; Herden, C

    2012-09-01

    Epileptic seizures can lead to various reactions in the brain, ranging from neuronal necrosis and glial cell activation to focal structural disorganization. Furthermore, increased hippocampal neurogenesis has been documented in rodent models of acute convulsions. This is a report of hippocampal neurogenesis in a dog with spontaneous epileptic seizures. A 16-week-old epileptic German Shepherd Dog had marked neuronal cell proliferation (up to 5 mitotic figures per high-power field and increased immunohistochemical expression of proliferative cell nuclear antigen) in the dentate gyrus accompanied by microglial and astroglial activation. Some granule cells expressed doublecortin, a marker of immature neurons; mitotically active cells expressed neuronal nuclear antigen. No mitotic figures were found in the brain of age-matched control dogs. Whether increased neurogenesis represents a general reaction pattern of young epileptic dogs should be investigated.

  19. Causative factors for suicide attempts by overdose in epileptics.

    PubMed

    Mendez, M F; Lanska, D J; Manon-Espaillat, R; Burnstine, T H

    1989-10-01

    We investigated possible causative factors for the high epileptic suicide rate by reviewing the cases of 22 patients with idiopathic epilepsy found among 711 patients hospitalized for a suicide attempt by overdose. Suicide attempts occurred with increased seizure activity in one epileptic; otherwise, no relationships were found with seizure-related variables. When matched by age, sex, and race with 44 nonepileptic controls from the same population, the epileptics had more borderline personality disorders with multiple impulsive suicide attempts (45.5% vs 13.6%), more psychotic disturbances, including command hallucinations (31.8% vs 9.1%), fewer adjustment disorders (18.2% vs 45.5%), and a comparable frequency of depression (13.6% vs 25%). We conclude that suicide attempts in epileptics are primarily associated with interictal psychopathologic factors, such as borderline personality disorder and psychosis, rather than with specific psychosocial stressors, seizure variables, or anticonvulsant medications.

  20. De novo loss- or gain-of-function mutations in KCNA2 cause epileptic encephalopathy.

    PubMed

    Syrbe, Steffen; Hedrich, Ulrike B S; Riesch, Erik; Djémié, Tania; Müller, Stephan; Møller, Rikke S; Maher, Bridget; Hernandez-Hernandez, Laura; Synofzik, Matthis; Caglayan, Hande S; Arslan, Mutluay; Serratosa, José M; Nothnagel, Michael; May, Patrick; Krause, Roland; Löffler, Heidrun; Detert, Katja; Dorn, Thomas; Vogt, Heinrich; Krämer, Günter; Schöls, Ludger; Mullis, Primus E; Linnankivi, Tarja; Lehesjoki, Anna-Elina; Sterbova, Katalin; Craiu, Dana C; Hoffman-Zacharska, Dorota; Korff, Christian M; Weber, Yvonne G; Steinlin, Maja; Gallati, Sabina; Bertsche, Astrid; Bernhard, Matthias K; Merkenschlager, Andreas; Kiess, Wieland; Gonzalez, Michael; Züchner, Stephan; Palotie, Aarno; Suls, Arvid; De Jonghe, Peter; Helbig, Ingo; Biskup, Saskia; Wolff, Markus; Maljevic, Snezana; Schüle, Rebecca; Sisodiya, Sanjay M; Weckhuysen, Sarah; Lerche, Holger; Lemke, Johannes R

    2015-04-01

    Epileptic encephalopathies are a phenotypically and genetically heterogeneous group of severe epilepsies accompanied by intellectual disability and other neurodevelopmental features. Using next-generation sequencing, we identified four different de novo mutations in KCNA2, encoding the potassium channel KV1.2, in six isolated patients with epileptic encephalopathy (one mutation recurred three times independently). Four individuals presented with febrile and multiple afebrile, often focal seizure types, multifocal epileptiform discharges strongly activated by sleep, mild to moderate intellectual disability, delayed speech development and sometimes ataxia. Functional studies of the two mutations associated with this phenotype showed almost complete loss of function with a dominant-negative effect. Two further individuals presented with a different and more severe epileptic encephalopathy phenotype. They carried mutations inducing a drastic gain-of-function effect leading to permanently open channels. These results establish KCNA2 as a new gene involved in human neurodevelopmental disorders through two different mechanisms, predicting either hyperexcitability or electrical silencing of KV1.2-expressing neurons.

  1. De novo loss- or gain-of-function mutations in KCNA2 cause epileptic encephalopathy

    PubMed Central

    Müller, Stephan; Møller, Rikke S.; Maher, Bridget; Hernandez-Hernandez, Laura; Synofzik, Matthis; Caglayan, Hande S.; Arslan, Mutluay; Serratosa, José M.; Nothnagel, Michael; May, Patrick; Krause, Roland; Löffler, Heidrun; Detert, Katja; Dorn, Thomas; Vogt, Heinrich; Krämer, Günter; Schöls, Ludger; Mullis, Primus E.; Linnankivi, Tarja; Lehesjoki, Anna-Elina; Sterbova, Katalin; Craiu, Dana C.; Hoffman-Zacharska, Dorota; Korff, Christian M.; Weber, Yvonne G.; Steinlin, Maja; Gallati, Sabina; Bertsche, Astrid; Bernhard, Matthias K.; Merkenschlager, Andreas; Kiess, Wieland; Gonzalez, Michael; Züchner, Stephan; Palotie, Aarno; Suls, Arvid; De Jonghe, Peter; Helbig, Ingo; Biskup, Saskia; Wolff, Markus; Maljevic, Snezana; Schüle, Rebecca; Sisodiya, Sanjay M.; Weckhuysen, Sarah; Lerche, Holger; Lemke, Johannes R.

    2015-01-01

    Epileptic encephalopathies are a phenotypically and genetically heterogeneous group of severe epilepsies accompanied by intellectual disability and other neurodevelopmental features1-6. Using next generation sequencing, we identified four different de novo mutations in KCNA2, encoding the potassium channel KV1.2, in six patients with epileptic encephalopathy (one mutation recurred three times independently). Four individuals presented with febrile and multiple afebrile, often focal seizure types, multifocal epileptiform discharges strongly activated by sleep, mild-moderate intellectual disability, delayed speech development and sometimes ataxia. Functional studies of the two mutations associated with this phenotype revealed an almost complete loss-of-function with a dominant-negative effect. Two further individuals presented with a different and more severe epileptic encephalopathy phenotype. They carried mutations inducing a drastic gain-of-function effect leading to permanently open channels. These results establish KCNA2 as a novel gene involved in human neurodevelopmental disorders by two different mechanisms, predicting either hyperexcitability or electrical silencing of KV1.2-expressing neurons. PMID:25751627

  2. Toward Epileptic Brain Region Detection Based on Magnetic Nanoparticle Patterning

    PubMed Central

    Pedram, Maysam Z.; Shamloo, Amir; Alasty, Aria; Ghafar-Zadeh, Ebrahim

    2015-01-01

    Resection of the epilepsy foci is the best treatment for more than 15% of epileptic patients or 50% of patients who are refractory to all forms of medical treatment. Accurate mapping of the locations of epileptic neuronal networks can result in the complete resection of epileptic foci. Even though currently electroencephalography is the best technique for mapping the epileptic focus, it cannot define the boundary of epilepsy that accurately. Herein we put forward a new accurate brain mapping technique using superparamagnetic nanoparticles (SPMNs). The main hypothesis in this new approach is the creation of super-paramagnetic aggregates in the epileptic foci due to high electrical and magnetic activities. These aggregates may improve tissue contrast of magnetic resonance imaging (MRI) that results in improving the resection of epileptic foci. In this paper, we present the mathematical models before discussing the simulation results. Furthermore, we mimic the aggregation of SPMNs in a weak magnetic field using a low-cost microfabricated device. Based on these results, the SPMNs may play a crucial role in diagnostic epilepsy and the subsequent treatment of this disease. PMID:26402686

  3. Epileptic networks studied with EEG-fMRI.

    PubMed

    Gotman, Jean

    2008-01-01

    It is not easy to determine the location of the cerebral generators and the other brain regions that may be involved at the time of an epileptic spike seen in the scalp EEG. The possibility to combine EEG recording with functional MRI scanning (fMRI) opens the opportunity to uncover the regions of the brain showing changes in metabolism and blood flow in response to epileptic spikes seen in the EEG. These regions are presumably involved in the abnormal neuronal activity at the origin of epileptic discharges. This paper reviews the methodology involved in performing such studies, including the special techniques required for recording the EEG inside the scanner and the statistical issues in analyzing the fMRI signal. We then discuss the results obtained in patients with different types of focal epileptic disorders and in patients with primary generalized epilepsy. The results in general indicate that interictal epileptic discharges may affect brain areas well beyond the presumed region in which they are generated. The noninvasive nature of this method opens new horizons in the investigation of brain regions involved and affected by epileptic discharges.

  4. Enhancement of GABAA-current run-down in the hippocampus occurs at the first spontaneous seizure in a model of temporal lobe epilepsy

    PubMed Central

    Mazzuferi, Manuela; Palma, Eleonora; Martinello, Katiuscia; Maiolino, Francesca; Roseti, Cristina; Fucile, Sergio; Fabene, Paolo F.; Schio, Federica; Pellitteri, Michele; Sperk, Guenther; Miledi, Ricardo; Eusebi, Fabrizio; Simonato, Michele

    2010-01-01

    Refractory temporal lobe epilepsy (TLE) is associated with a dysfunction of inhibitory signaling mediated by GABAA receptors. In particular, the use-dependent decrease (run-down) of the currents (IGABA) evoked by the repetitive activation of GABAA receptors is markedly enhanced in hippocampal and cortical neurons of TLE patients. Understanding the role of IGABA run-down in the disease, and its mechanisms, may allow development of medical alternatives to surgical resection, but such mechanistic insights are difficult to pursue in surgical human tissue. Therefore, we have used an animal model (pilocarpine-treated rats) to identify when and where the increase in IGABA run-down occurs in the natural history of epilepsy. We found: (i) that the increased run-down occurs in the hippocampus at the time of the first spontaneous seizure (i.e., when the diagnosis of epilepsy is made), and then extends to the neocortex and remains constant in the course of the disease; (ii) that the phenomenon is strictly correlated with the occurrence of spontaneous seizures, because it is not observed in animals that do not become epileptic. Furthermore, initial exploration of the molecular mechanism disclosed a relative increase in α4-, relative to α1-containing GABAA receptors, occurring at the same time when the increased run-down appears, suggesting that alterations in the molecular composition of the GABA receptors may be responsible for the occurrence of the increased run-down. These observations disclose research opportunities in the field of epileptogenesis that may lead to a better understanding of the mechanism whereby a previously normal tissue becomes epileptic. PMID:20133704

  5. Morphine induces Beclin 1- and ATG5-dependent autophagy in human neuroblastoma SH-SY5Y cells and in the rat hippocampus.

    PubMed

    Zhao, Lixia; Zhu, Yushan; Wang, Dongmei; Chen, Ming; Gao, Ping; Xiao, Weiming; Rao, Guanhua; Wang, Xiaohui; Jin, Haijing; Xu, Lin; Sui, Nan; Chen, Quan

    2010-04-01

    Chronic exposure to morphine can induce drug addiction and neural injury, but the exact mechanism is not fully understood. Here we show that morphine induces autophagy in neuroblastoma SH-SY5Y cells and in the rat hippocampus. Pharmacological approach shows that this effect appears to be mediated by PTX-sensitive G protein-coupled receptors signaling cascade. Morphine increases Beclin 1 expression and reduces the interaction between Beclin 1 and Bcl-2, thus releasing Beclin 1 for its pro-autophagic activity. Bcl-2 overexpression inhibits morphine-induced autophagy, whereas knockdown of Beclin 1 or knockout of ATG5 prevents morphine-induced autophagy. In addition, chronic treatment with morphine induces cell death, which is increased by autophagy inhibition through Beclin 1 RNAi. Our data are the first to reveal that Beclin 1 and ATG5 play key roles in morphine-induced autophagy, which may contribute to morphine-induced neuronal injury.

  6. De novo mutations in the classic epileptic encephalopathies

    PubMed Central

    2013-01-01

    Epileptic encephalopathies (EE) are a devastating group of severe childhood epilepsy disorders for which the cause is often unknown. Here, we report a screen for de novo mutations in patients with two classical EE: infantile spasms (IS, n=149) and Lennox-Gastaut Syndrome (LGS, n=115). We sequenced the exomes of 264 probands, and their parents, and confirmed 329 de novo mutations. A likelihood analysis showed a significant excess of de novo mutations in the ~4,000 genes that are the most intolerant to functional genetic variation in the human population (p=2.9 × 10−3). Among these are GABRB3 with de novo mutations in four patients and ALG13 with the same de novo mutation in two patients; both genes show clear statistical evidence of association. Given the relevant site-specific mutation rates, the probabilities of these outcomes occurring by chance are p=4.1 × 10−10 and p=7.8 × 10−12, respectively. Other genes with de novo mutations in this cohort include: CACNA1A, CHD2, FLNA, GABRA1, GRIN1, GRIN2B, HDAC4, HNRNPU, IQSEC2, MTOR, and NEDD4L. Finally, we show that the de novo mutations observed are enriched in specific gene sets including genes regulated by the Fragile X protein (p<10−8), as was reported for autism spectrum disorders (ASD)1. PMID:23934111

  7. Mouse neuroblastoma cell-based model and the effect of epileptic events on calcium oscillations and neural spikes

    NASA Astrophysics Data System (ADS)

    Kim, Suhwan; Jung, Unsang; Baek, Juyoung; Lee, Sangwon; Jung, Woonggyu; Kim, Jeehyun; Kang, Shinwon

    2013-01-01

    Recently, mouse neuroblastoma cells have been considered as an attractive model for the study of human neurological and prion diseases, and they have been intensively used as a model system in different areas. For example, the differentiation of neuro2a (N2A) cells, receptor-mediated ion current, and glutamate-induced physiological responses have been actively investigated with these cells. These mouse neuroblastoma N2A cells are of interest because they grow faster than other cells of neural origin and have a number of other advantages. The calcium oscillations and neural spikes of mouse neuroblastoma N2A cells in epileptic conditions are evaluated. Based on our observations of neural spikes in these cells with our proposed imaging modality, we reported that they can be an important model in epileptic activity studies. We concluded that mouse neuroblastoma N2A cells produce epileptic spikes in vitro in the same way as those produced by neurons or astrocytes. This evidence suggests that increased levels of neurotransmitter release due to the enhancement of free calcium from 4-aminopyridine causes the mouse neuroblastoma N2A cells to produce epileptic spikes and calcium oscillations.

  8. Mouse neuroblastoma cell based model and the effect of epileptic events on calcium oscillations and neural spikes

    NASA Astrophysics Data System (ADS)

    Kim, Suhwan; Baek, Juyeong; Jung, Unsang; Lee, Sangwon; Jung, Woonggyu; Kim, Jeehyun; Kang, Shinwon

    2013-05-01

    Recently, Mouse neuroblastoma cells are considered as an attractive model for the study of human neurological and prion diseases, and intensively used as a model system in different areas. Among those areas, differentiation of neuro2a (N2A) cells, receptor mediated ion current, and glutamate induced physiological response are actively investigated. The reason for the interest to mouse neuroblastoma N2A cells is that they have a fast growing rate than other cells in neural origin with a few another advantages. This study evaluated the calcium oscillations and neural spikes recording of mouse neuroblastoma N2A cells in an epileptic condition. Based on our observation of neural spikes in mouse N2A cell with our proposed imaging modality, we report that mouse neuroblastoma N2A cells can be an important model related to epileptic activity studies. It is concluded that the mouse neuroblastoma N2A cells produce the epileptic spikes in vitro in the same way as produced by the neurons or the astrocytes. This evidence advocates the increased and strong level of neurotransmitters release by enhancement in free calcium using the 4-aminopyridine which causes the mouse neuroblastoma N2A cells to produce the epileptic spikes and calcium oscillation.

  9. Aging hippocampus and amygdala.

    PubMed

    Malykhin, Nikolai V; Bouchard, Thomas P; Camicioli, Richard; Coupland, Nicholas J

    2008-03-26

    Earlier studies suggest that the anterior hippocampus may show resilience to age-associated volume loss. This study compared high-resolution magnetic resonance images obtained from younger (n=28; age range: 22-50 years) and older (n=39; age range: 65-84 years) healthy right-handed individuals to determine whether age-related volume changes varied between the hippocampal head, body and tail. Volumetric reductions were progressively more severe from hippocampal head to tail. Amygdala volume differences were intermediate in size. Although limited by the cross-sectional design, these data suggest that hippocampal subregions show a gradient of volume reduction in healthy aging that contrasts with the preferential reduction of anterior hippocampal volumes in Alzheimer's and Parkinson's diseases.

  10. Asynchronous electrical activity in epileptic seizures

    NASA Astrophysics Data System (ADS)

    Holman, Katherine; Lim, Eugene; Gliske, Stephen; Stacey, William; Fink, Christian

    High-frequency oscillations (HFOs) have been postulated to be potential biomarkers for focal epileptic seizures, with fast ripples (>250 Hz) as the most interesting candidate. The mechanisms underlying the generation of fast ripples, however, are not well understood. In this study, we draw upon results from previous computational studies on HFOs to develop a new mathematical model from first principles describing the generation of HFOs through asynchronous neuronal firing. Asynchrony in the model is obtained with the introduction of two parameters of heterogeneity: variability in the inter-spike interval (ISI) and jitter. The model predicts the generation of harmonic narrow-band oscillations if the heterogeneity-governing parameters do not differ from the predefined ISI by more than 20%. Comparisons against results from a separately constructed computational model verify the accuracy of the model in study. These results provide us with a rigorous framework in which we may investigate the mechanisms driving the generation of abnormal HFOs, and may serve as groundwork for future research in epileptogenesis. Nsf Grant 1003992, Ohio Wesleyan University SSRP.

  11. Cerebrospinal fluid findings after epileptic seizures.

    PubMed

    Chatzikonstantinou, Anastasios; Ebert, Anne D; Hennerici, Michael G

    2015-12-01

    We aimed to evaluate ictally-induced CSF parameter changes after seizures in adult patients without acute inflammatory diseases or infectious diseases associated with the central nervous system. In total, 151 patients were included in the study. All patients were admitted to our department of neurology following acute seizures and received an extensive work-up including EEG, cerebral imaging, and CSF examinations. CSF protein elevation was found in most patients (92; 60.9%) and was significantly associated with older age, male sex, and generalized seizures. Abnormal CSF-to-serum glucose ratio was found in only nine patients (5.9%) and did not show any significant associations. CSF lactate was elevated in 34 patients (22.5%) and showed a significant association with focal seizures with impaired consciousness, status epilepticus, the presence of EEG abnormalities in general and epileptiform potentials in particular, as well as epileptogenic lesions on cerebral imaging. Our results indicate that non-inflammatory CSF elevation of protein and lactate after epileptic seizures is relatively common, in contrast to changes in CSF-to-serum glucose ratio, and further suggest that these changes are caused by ictal activity and are related to seizure type and intensity. We found no indication that these changes may have further-reaching pathological implications besides their postictal character.

  12. Nicotinic receptors, memory, and hippocampus.

    PubMed

    Kutlu, Munir Gunes; Gould, Thomas J

    2015-01-01

    Nicotinic acetylcholine receptors (nAChRs) modulate the neurobiological processes underlying hippocampal learning and memory. In addition, nicotine's ability to desensitize and upregulate certain nAChRs may alter hippocampus-dependent memory processes. Numerous studies have examined the effects of nicotine on hippocampus-dependent learning, as well as the roles of low- and high-affinity nAChRs in mediating nicotine's effects on hippocampus-dependent learning and memory. These studies suggested that while acute nicotine generally acts as a cognitive enhancer for hippocampus-dependent learning, withdrawal from chronic nicotine results in deficits in hippocampus-dependent memory. Furthermore, these studies demonstrated that low- and high-affinity nAChRs functionally differ in their involvement in nicotine's effects on hippocampus-dependent learning. In the present chapter, we reviewed studies using systemic or local injections of acute or chronic nicotine, nAChR subunit agonists or antagonists; genetically modified mice; and molecular biological techniques to characterize the effects of nicotine on hippocampus-dependent learning.

  13. Impaired expression and function of group II metabotropic glutamate receptors in pilocarpine-treated chronically epileptic rats

    PubMed Central

    Garrido-Sanabria, Emilio R.; Otalora, Luis F. Pacheco; Arshadmansab, Massoud F.; Herrera, Berenice; Francisco, Sebastian; Ermolinsky, Boris

    2008-01-01

    Group II metabotropic (mGlu II) receptor subtypes mGlu2 and mGlu3 are important modulators of synaptic plasticity and glutamate release in the brain. Accordingly, several pharmacological ligands have been designed to target these receptors for the treatment of neurological disorders characterized by anomalous glutamate regulation including epilepsy. In this study, we examine whether the expression level and function of mGlu2 and mGlu3 are altered in experimental epilepsy by using immunohistochemistry, Western blot analysis, RT-PCR and extracellular recordings. A down-regulation of mGlu2/3 protein expression at the mossy fiber pathway was associated with a significant reduction in mGlu2/3 protein expression in the hippocampus and cortex of chronically epileptic rats. Moreover, a reduction in mGlu2 and mGlu3 transcripts levels was noticed as early as 24h after pilocarpine-induced status epilepticus (SE) and persisted during subsequent “latent” and chronic periods. In addition, a significant impairment of mGlu II-mediated depression of field excitatory postsynaptic potentials at mossy fiber-CA3 synapses was detected in chronically epileptic rats. Application of mGlu II agonists (2S,2'R,3'R)-2-(2',3'-dicarboxycyclopropyl)glycine (DCG-IV) induced a significant reduction of the fEPSP amplitude in control rats, but not in chronic epileptic rats. These data indicate a long-lasting impairment of mGlu2/3 expression that may contribute to abnormal presynaptic plasticity, exaggerate glutamate release and hyperexcitability in temporal lobe epilepsy. PMID:18804094

  14. Impaired expression and function of group II metabotropic glutamate receptors in pilocarpine-treated chronically epileptic rats.

    PubMed

    Garrido-Sanabria, Emilio R; Otalora, Luis F Pacheco; Arshadmansab, Massoud F; Herrera, Berenice; Francisco, Sebastian; Ermolinsky, Boris S

    2008-11-13

    Group II metabotropic (mGlu II) receptor subtypes mGlu2 and mGlu3 are important modulators of synaptic plasticity and glutamate release in the brain. Accordingly, several pharmacological ligands have been designed to target these receptors for the treatment of neurological disorders characterized by anomalous glutamate regulation including epilepsy. In this study, we examine whether the expression level and function of mGlu2 and mGlu3 are altered in experimental epilepsy by using immunohistochemistry, Western blot analysis, RT-PCR and extracellular recordings. A down-regulation of mGlu2/3 protein expression at the mossy fiber pathway was associated with a significant reduction in mGlu2/3 protein expression in the hippocampus and cortex of chronically epileptic rats. Moreover, a reduction in mGlu2 and mGlu3 transcripts levels was noticed as early as 24 h after pilocarpine-induced status epilepticus (SE) and persisted during subsequent "latent" and chronic periods. In addition, a significant impairment of mGlu II-mediated depression of field excitatory postsynaptic potentials at mossy fiber-CA3 synapses was detected in chronically epileptic rats. Application of mGlu II agonists (2S,2'R,3'R)-2-(2',3'-dicarboxycyclopropyl)glycine (DCG-IV) induced a significant reduction of the fEPSP amplitude in control rats, but not in chronic epileptic rats. These data indicate a long-lasting impairment of mGlu2/3 expression that may contribute to abnormal presynaptic plasticity, exaggerate glutamate release and hyperexcitability in temporal lobe epilepsy.

  15. Occurrence and clinical features of epileptic and non-epileptic paroxysmal events in five children with Pallister-Killian syndrome.

    PubMed

    Filloux, Francis M; Carey, John C; Krantz, Ian D; Ekstrand, Jeffrey J; Candee, Meghan S

    2012-05-01

    Pallister-Killian syndrome (PKS) is a rare, sporadic genetic disorder caused by tetrasomy 12p mosaicism associated with a supernumerary isochromosome. Craniofacial dysmorphism, learning impairment and seizures are considered characteristic. However, little is known of the seizure and epilepsy patterns seen in PKS. To better define the occurrence and nature of epileptic and non-epileptic paroxysmal events in PKS, we describe our experience with 5 patients and compare their features with data from a larger cohort of PKS patients ascertained via a web-based parental questionnaire. Three of the 5 patients have had definite epileptic seizures, and one other has had paroxysmal events as yet not clarified. Four of the 5 have also had either non-epileptic paroxysmal events or episodes of uncertain nature. In those with epilepsy, all have had some period of relatively refractory seizures, all have required more than one antiepileptic drug, but none experienced status epilepticus. Only one of the patients with epilepsy (the oldest) has gone into remission. In two of the four with non-epileptic events, video-electroencephalographic monitoring has been valuable in clarifying the nature of the events. EEG characteristics include a slow dominant frequency as well as generalized and focal epileptiform features. Brain MRI findings can be normal but are variable. These specific findings correspond well to information reported by parents in a larger cohort of 51 individuals with PKS. Better understanding of the nature of epileptic and non-epileptic events in PKS will result from a more detailed analysis of objective data obtained from this larger cohort, and from deeper understanding of the molecular impact of 12p tetrasomy in selected cell lines.

  16. Occurrence and clinical features of epileptic and non-epileptic paroxysmal events in five children with Pallister–Killian syndrome

    PubMed Central

    Filloux, Francis M.; Carey, John C.; Krantz, Ian D.; Ekstrand, Jeffrey J.; Candee, Meghan S.

    2013-01-01

    Pallister–Killian syndrome (PKS) is a rare, sporadic genetic disorder caused by tetrasomy 12p mosaicism associated with a supernumerary isochromosome. Craniofacial dysmorphism, learning impairment and seizures are considered characteristic. However, little is known of the seizure and epilepsy patterns seen in PKS. To better define the occurrence and nature of epileptic and non-epileptic paroxysmal events in PKS, we describe our experience with 5 patients and compare their features with data from a larger cohort of PKS patients ascertained via a web-based parental questionnaire. Three of the 5 patients have had definite epileptic seizures, and one other has had paroxysmal events as yet not clarified. Four of the 5 have also had either non-epileptic paroxysmal events or episodes of uncertain nature. In those with epilepsy, all have had some period of relatively refractory seizures, all have required more than one antiepileptic drug, but none experienced status epilepticus. Only one of the patients with epilepsy (the oldest) has gone into remission. In two of the four with non-epileptic events, video-electroencephalographic monitoring has been valuable in clarifying the nature of the events. EEG characteristics include a slow dominant frequency as well as generalized and focal epileptiform features. Brain MRI findings can be normal but are variable. These specific findings correspond well to information reported by parents in a larger cohort of 51 individuals with PKS. Better understanding of the nature of epileptic and non-epileptic events in PKS will result from a more detailed analysis of objective data obtained from this larger cohort, and from deeper understanding of the molecular impact of 12p tetrasomy in selected cell lines. PMID:22349688

  17. A Novel Dynamic Update Framework for Epileptic Seizure Prediction

    PubMed Central

    Wang, Minghui; Hong, Xiaojun; Han, Jie

    2014-01-01

    Epileptic seizure prediction is a difficult problem in clinical applications, and it has the potential to significantly improve the patients' daily lives whose seizures cannot be controlled by either drugs or surgery. However, most current studies of epileptic seizure prediction focus on high sensitivity and low false-positive rate only and lack the flexibility for a variety of epileptic seizures and patients' physical conditions. Therefore, a novel dynamic update framework for epileptic seizure prediction is proposed in this paper. In this framework, two basic sample pools are constructed and updated dynamically. Furthermore, the prediction model can be updated to be the most appropriate one for the prediction of seizures' arrival. Mahalanobis distance is introduced in this part to solve the problem of side information, measuring the distance between two data sets. In addition, a multichannel feature extraction method based on Hilbert-Huang transform and extreme learning machine is utilized to extract the features of a patient's preseizure state against the normal state. At last, a dynamic update epileptic seizure prediction system is built up. Simulations on Freiburg database show that the proposed system has a better performance than the one without update. The research of this paper is significantly helpful for clinical applications, especially for the exploitation of online portable devices. PMID:25050381

  18. [Non-epileptic motor paroxysmal phenomena in wakefulness in childhood].

    PubMed

    Ruggieri, Víctor L; Arberas, Claudia L

    2013-09-06

    Paroxysmal events in childhood are a challenge for pediatric neurologists, given its highly heterogeneous clinical manifestations, often difficult to distinguish between phenomena of epileptic seizure or not. The non-epileptic paroxysmal episodes are neurological phenomena, with motor, sensory symptoms, and/or sensory impairments, with or without involvement of consciousness, epileptic phenomena unrelated, so no electroencephalographic correlative expression between or during episodes. From the clinical point of view can be classified into four groups: motor phenomena, syncope, migraine (and associated conditions) and acute psychiatric symptoms. In this paper we analyze paroxysmal motor phenomena in awake children, dividing them according to their clinical manifestations: extrapyramidal episodes (paroxysmal kinesiogenic, non kinesiogenic and not related to exercise dyskinesias, Dopa responsive dystonia) and similar symptoms of dystonia (Sandifer syndrome); manifestations of startle (hyperekplexia); episodic eye and head movements (benign paroxysmal tonic upward gaze nistagmus deviation); episodic ataxia (familial episodic ataxias, paroxysmal benign vertigo); stereotyped and phenomena of self-gratification; and myoclonic events (benign myoclonus of early infancy). The detection of these syndromes will, in many cases, allow an adequate genetic counseling, initiate a specific treatment and avoid unnecessary additional studies. Molecular studies have demonstrated a real relationship between epileptic and non-epileptic basis of many of these entities and surely the identification of the molecular basis and understanding of the pathophysiological mechanisms in many of them allow us, in the near future will benefit our patients.

  19. Plic-1, a new target in repressing epileptic seizure by regulation of GABAAR function in patients and a rat model of epilepsy.

    PubMed

    Zhang, Yujiao; Li, Zengyou; Gu, Juan; Zhang, Yanke; Wang, Wei; Shen, Hui; Chen, Guojun; Wang, Xuefeng

    2015-12-01

    Dysfunction of γ-aminobutyric acid A (GABAA) receptors (GABAARs) is a prominent factor affecting intractable epilepsy. Plic-1, an ubiquitin-like protein enriched in the inhibitory synapses connecting GABAARs and the ubiquitin protease system (UPS), plays a key role in the modification of GABAAR functions. However, the relationship between Plic-1 and epileptogenesis is not known. In the present study, we aimed to investigate Plic-1 levels in patients with temporal lobe epilepsy, as well as the role of Plic-1 in regulating onset and progression of epilepsy in animal models. We found that Plic-1 expression was significantly decreased in patients with epilepsy as well as pilocarpine- and pentylenetetrazol (PTZ)-induced rat epileptic models. Intrahippocampal injection of the PePα peptide, which disrupts Plic-1 binding to GABAARs, significantly shortened the latency of seizure onset, and increased the seizure severity and duration in these two epileptic models. Overexpressed Plic-1 through lentivirus transfection into a PTZ model resulted in a reduction in both seizure severity and generalized tonic-clonic seizure duration. Whole-cell clamp recordings revealed that the PePα peptide decreased miniature inhibitory postsynaptic currents (mIPSCs) whereas overexpressed Plic-1 increased mIPSCs in the pyramidal neurons of the hippocampus. These effects can be blocked by picrotoxin, a GABAAR inhibitor. Our results indicate that Plic-1 plays an important role in managing epileptic seizures by enhancing seizure inhibition through regulation of GABAARs at synaptic sites.

  20. Intravenous methylprednisolone pulse therapy for children with epileptic encephalopathy

    PubMed Central

    Pera, Maria Carmela; Randazzo, Giovanna; Masnada, Silvia; Dontin, Serena Donetti; De Giorgis, Valentina; Balottin, Umberto; Veggiotti, Pierangelo

    2015-01-01

    Summary The aim of this retrospective study of children affected by epileptic encephalopathy was to evaluate seizure frequency, electroencephalographic pattern and neuropsychological status, before and after intravenous methylprednisolone therapy. Eleven children with epileptic encephalopathy were administered one cycle of intravenous methylprednisolone (15–30 mg/kg/day for three consecutive days, once a month for four months) in addition to constant dosages of their regular antiepileptic drugs. The treatment resulted in statistically significant reductions of generalized slow spike-and-wave discharges (p<0.0028) and seizure frequency (p<0.013), which persisted even after methylprednisolone pulse therapy was stopped. A globally positive outcome was noted in 9/11 patients (81.8%). This methylprednisolone treatment regimen did not cause significant or persistent adverse effects. We suggest that children with epileptic encephalopathy without an underlying structural lesion could be the best candidates for intravenous methylprednisolone pulse therapy. PMID:26910177

  1. Hypnotic induction of an epileptic seizure: a brief communication.

    PubMed

    Bryant, R A; Somerville, E

    1995-07-01

    This case study investigated the utility of hypnosis to precipitate a seizure in a patient with refractory epilepsy. The patient was twice administered a hypnotic induction and a suggestion to age regress to a day when he was distressed and suffered repeated seizures. The patient did not respond to the first hypnotic suggestion; however, an epileptic seizure was observed in the second hypnotic session. Videorecording and subdural electroencephalograph recording confirmed that he suffered an epileptic seizure. Postexperimental inquiry revealed that the patient used deliberate cognitive strategies to avoid seizure onset in the first session but adopted a more constructive cognitive style in the second session. Findings are discussed in terms of emotions, hypnosis, and cognitive style as mediating factors in the experimental precipitation of epileptic seizures.

  2. Variations of ATP and its metabolites in the hippocampus of rats subjected to pilocarpine-induced temporal lobe epilepsy.

    PubMed

    Doná, Flávia; Conceição, Isaltino Marcelo; Ulrich, Henning; Ribeiro, Eliane Beraldi; Freitas, Thalma Ariani; Nencioni, Ana Leonor Abrahao; da Silva Fernandes, Maria José

    2016-06-01

    Although purinergic receptor activity has lately been associated with epilepsy, little is known about the exact role of purines in epileptogenesis. We have used a rat model of temporal lobe epilepsy induced by pilocarpine to study the dynamics of purine metabolism in the hippocampus during different times of status epilepticus (SE) and the chronic phase. Concentrations of adenosine 5'-triphosphate (ATP), adenosine diphosphate (ADP), adenosine monophosphate (AMP), and adenosine in normal and epileptic rat hippocampus were determined by microdialysis in combination with high-performance liquid chromatography (HPLC). Extracellular ATP concentrations did not vary along 4 h of SE onset. However, AMP concentration was elevated during the second hour, whereas ADP and adenosine concentrations augmented during the third and fourth hour following SE. During chronic phase, extracellular ATP, ADP, AMP, and adenosine concentrations decreased, although these levels again increased significantly during spontaneous seizures. These results suggest that the increased turnover of ATP during the acute period is a compensatory mechanism able to reduce the excitatory role of ATP. Increased adenosine levels following 4 h of SE may contribute to block seizures. On the other hand, the reduction of purine levels in the hippocampus of chronic epileptic rats may result from metabolic changes and be part of the mechanisms involved in the onset of spontaneous seizures. This work provides further insights into purinergic signaling during establishment and chronic phase of epilepsy.

  3. Quality of life in epileptic patients compared with healthy people

    PubMed Central

    Gholami, Ali; Salarilak, Shaker; Lotfabadi, Pegah; Kiani, Fereshte; Rajabi, Abdolhalim; Mansori, Kamyar; Moosavi Jahromi, Zahra

    2016-01-01

    Background: Epilepsy is a common chronic neurological disorder that has a great impact on people’s lives. Patients with epilepsy are at increased risk for poor Quality of Life (QoL). The objective of this study was to evaluate the QoL of epileptic patients in comparison to healthy persons. Methods: This cross-sectional study was conducted on 52 epileptic patients from Golbu region in Neyshabur (a city in northeast of Iran). Using Short Form Health Survey (SF-36) scale, the data were collected between April and Jun 2012. Every patient were compared with two healthy persons. Epileptic and healthy persons were similar for age, sex and local residence. Pearson’s correlation coefficient and t-independent test applied for data analysis through SPSS v. 16 software. Results: Of 52 epileptic patients, 24 were female (46.2%) and 28 were male (53.8%). The mean±SD age of epileptic patients was 40.92±20.33yr (Rang: 15-86yr). The total mean score of SF- 36 in patient group was 55.88 and in healthy group 68.52and this difference was statistically significant (p<0.001). Among the different subscales of SF-36 in epileptic patients, the highest and the lowest mean scores were found for social functioning and general health subscales, respectively. The mean scores in patient group in comparison to healthy group were lower in all subscales of SF-36 and these differences were statistically significant in all domains (except role limitations due to physical problems domain and role limitations due to emotional problems domain). Conclusion: The study showed that epilepsy disease has an important role in QoL of patients, thus some interventional programs are necessary to improve their QOL. PMID:27493932

  4. Detecting Epileptic Regions Based on Global Brain Connectivity Patterns

    PubMed Central

    Sweet, Andrew; Venkataraman, Archana; Stufflebeam, Steven M.; Liu, Hesheng; Tanaka, Naoro; Madsen, Joseph; Golland, Polina

    2014-01-01

    We present a method to detect epileptic regions based on functional connectivity differences between individual epilepsy patients and a healthy population. Our model assumes that the global functional characteristics of these differences are shared across patients, but it allows for the epileptic regions to vary between individuals. We evaluate the detection performance against intracranial EEG observations and compare our approach with two baseline methods that use standard statistics. The baseline techniques are sensitive to the choice of thresholds, whereas our algorithm automatically estimates the appropriate model parameters and compares favorably with the best baseline results. This suggests the promise of our approach for pre-surgical planning in epilepsy. PMID:24505654

  5. Detecting epileptic regions based on global brain connectivity patterns.

    PubMed

    Sweet, Andrew; Venkataraman, Archana; Stufflebeam, Steven M; Liu, Hesheng; Tanaka, Naoro; Madsen, Joseph; Golland, Polina

    2013-01-01

    We present a method to detect epileptic regions based on functional connectivity differences between individual epilepsy patients and a healthy population. Our model assumes that the global functional characteristics of these differences are shared across patients, but it allows for the epileptic regions to vary between individuals. We evaluate the detection performance against intracranial EEG observations and compare our approach with two baseline methods that use standard statistics. The baseline techniques are sensitive to the choice of thresholds, whereas our algorithm automatically estimates the appropriate model parameters and compares favorably with the best baseline results. This suggests the promise of our approach for pre-surgical planning in epilepsy.

  6. Transient epileptic amnesia--a clinical update and a reformulation.

    PubMed Central

    Kapur, N

    1993-01-01

    While absence attacks and complex partial seizures have been well documented in patients with epilepsy, the delineation of pure episodes of memory loss without additional clinical manifestations remains poorly characterised. The recently described condition of transient epileptic amnesia (TEA) is critically examined, and four new cases are described, in each of which there were episodes of pure memory loss which subsequently proved to be epileptic in origin. The anatomical and pathophysiological basis of TEA is presumed to be similar to transient global amnesia (TGA), that is, it is likely to be primarily hippocampal in origin, but with more variable involvement of limbic and adjacent temporal lobe neocortical structures. PMID:8229029

  7. Traumatic rupture of sternocleidomastoid muscle following an epileptic seizure.

    PubMed

    Wooles, Nicola Rachel; Bell, Philip Robert; Korda, Marian

    2014-11-19

    A 29-year-old man, a known epileptic, presented to an accident and emergency department following a tonic-clonic seizure, suffering a second seizure in the department. Subsequently, he reported neck pain, swelling and stiffness. An otorhinolaryngology neck examination revealed a tender left side with two palpable masses and a reduced range of movement. Ultrasound confirmed a ruptured middle third of the left sternocleidomastoid muscle, which was successfully treated non-surgically with analgaesia and intensive physiotherapy. Uncommonly, sternocleidomastoid muscle rupture has been reported following high-velocity trauma, but to the best of our knowledge this is the first case described in the literature following an epileptic seizure.

  8. [Clinical approach to the first epileptic crisis in adults].

    PubMed

    Espinosa-Jovel, Camilo Alfonso; Sobrino-Mejía, Fidel Ernesto

    2014-04-16

    Seizures are one of the main reasons for visits to emergency and neurology. Represent a traumatic event with potential medical and social consequences. A first epileptic seizure, can be the initial manifestation of malignancy, systemic disorder or infection, but can also be the first manifestation of epilepsy. The misdiagnosis of symptomatic seizures and unprovoked seizure, significantly affects prognosis and patient outcomes. The aim of this review is to examine the general concepts that enable successful diagnostic and therapeutic approach to the patient presenting with a first epileptic seizure.

  9. Transient epileptic amnesia: clinical report of a cohort of patients.

    PubMed

    Lapenta, Leonardo; Brunetti, Valerio; Losurdo, Anna; Testani, Elisa; Giannantoni, Nadia Mariagrazia; Quaranta, Davide; Di Lazzaro, Vincenzo; Della Marca, Giacomo

    2014-07-01

    Transient epileptic amnesia is a seizure disorder, usually with onset in the middle-elderly and good response to low dosages of antiepileptic drugs. We describe the clinical, electroencephalography (EEG), and neuroimaging features of 11 patients with a temporal lobe epilepsy characterized by amnesic seizures as the sole or the main symptom. We outline the relevance of a detailed clinical history to recognize amnesic seizures and to avoid the more frequent misdiagnoses. Moreover, the response to monotherapy was usually good, although the epileptic disorder was symptomatic of acquired lesions in the majority of patients.

  10. Electroencephalogram of Age-Dependent Epileptic Encephalopathies in Infancy and Early Childhood

    PubMed Central

    Wong-Kisiel, Lily C.; Nickels, Katherine

    2013-01-01

    Epileptic encephalopathy syndromes are disorders in which the epileptiform abnormalities are thought to contribute to a progressive cerebral dysfunction. Characteristic electroencephalogram findings have an important diagnostic value in classification of epileptic encephalopathy syndromes. In this paper, we focus on electroencephalogram findings of childhood epileptic encephalopathy syndromes and provide sample illustrations. PMID:24024028

  11. Capparis ovata modulates brain oxidative toxicity and epileptic seizures in pentylentetrazol-induced epileptic rats.

    PubMed

    Nazıroğlu, Mustafa; Akay, Mehmet Berk; Çelik, Ömer; Yıldırım, Muhammed İkbal; Balcı, Erdinç; Yürekli, Vedat Ali

    2013-04-01

    It has been widely suggested that oxidative stress products play an important role in the pathophysiology of epilepsy. Capparis ovata (C. ovata) may useful treatment of epilepsy because it contains antioxidant flavonoids. The current study was designed to determine the effects of C. ovata on lipid peroxidation, antioxidant levels and electroencephalography (EEG) records in pentylentetrazol (PTZ)-induced epileptic rats. Thirty-two rats were randomly divided into four groups. First group was used as control although second group was PTZ group. Oral 100 and 200 mg/kg C. ovata were given to rats constituting the third and fourth groups for 7 days before PTZ administration. Second, third and forth groups received 60 mg/kg PTZ for induction of epilepsy. Three hours after administration of PTZ, EEG records, brain cortex and blood samples were taken all groups. The lipid peroxidation levels of the brain cortex, number of spikes and epileptiform discharges of EEG were higher in PTZ group than in control and C. ovata group whereas they were decreased by C. ovata administration. Vitamin A, vitamin C, vitamin E and β-carotene concentrations of brain cortex and latency to first spike of EEG were decreased by the PTZ administration although the brain cortex and plasma vitamin concentrations, and brain cortex and erythrocyte glutathione and glutathione peroxidase values were increased in PTZ + 100 and PTZ + 200 mg C. ovata groups. In conclusion, C. ovata administration caused protection against the PTZ-induced brain oxidative toxicity by inhibiting free radical and epileptic seizures, and supporting antioxidant redox system.

  12. Overexpression of neuropeptide Y induced by brain-derived neurotrophic factor in the rat hippocampus is long lasting.

    PubMed

    Reibel, S; Vivien-Roels, B; Lê, B T; Larmet, Y; Carnahan, J; Marescaux, C; Depaulis, A

    2000-02-01

    Brain-derived neurotrophic factor (BDNF) plays an important role in hippocampal neuroplasticity. In particular, BDNF upregulation in the hippocampus by epileptic seizures suggests its involvement in the neuronal rearrangements accompanying epileptogenesis. We have shown previously that chronic infusion of BDNF in the hippocampus induces a long-term delay in hippocampal kindling progression. Although BDNF has been shown to enhance the excitability of this structure upon acute application, long-term transcriptional regulations leading to increased inhibition within the hippocampus may account for its suppressive effects on epileptogenesis. Therefore, the long-term consequences of a 7-day chronic intrahippocampal infusion of BDNF (12 microg/day) were investigated up to 2 weeks after the end of the infusion, on the expression of neurotransmitters contained in inhibitory hippocampal interneurons and which display anti-epileptic properties. Our results show that BDNF does not modify levels of immunostaining for glutamic acid decarboxylase, the rate-limiting enzyme for gamma-aminobutyric acid (GABA) synthesis, and somatostatin. Conversely, BDNF induces a long-lasting increase of neuropeptide Y (NPY) in the hippocampus, measured by immunohistochemistry and radioimmunoassay, outlasting the end of the infusion by at least 7 days. The distribution of BDNF-induced neuropeptide Y immunoreactivity is similar to the pattern observed in animals submitted to hippocampal kindling, with the exception of mossy fibres which only become immunoreactive following seizure activity. The enduring increase of neuropeptide Y expression induced by BDNF in the hippocampus suggests that this neurotrophin can trigger long-term genomic effects, which may contribute to the neuroplasticity of this structure, in particular during epileptogenesis.

  13. The rodent hippocampus is essential for nonspatial object memory.

    PubMed

    Cohen, Sarah J; Munchow, Alcira H; Rios, Lisa M; Zhang, Gongliang; Asgeirsdóttir, Herborg N; Stackman, Robert W

    2013-09-09

    Elucidating the role of the rodent hippocampus in object recognition memory is critical for establishing the appropriateness of rodents as models of human memory and for their use in the development of memory disorder treatments. In mammals, spatial memory and nonspatial memory depend upon the hippocampus and associated medial temporal lobe (MTL) structures. Although well established in humans, the role of the rodent hippocampus in object memory remains highly debated due to conflicting findings across temporary and permanent hippocampal lesion studies and evidence that the perirhinal cortex may support object memory. In the current studies, we used intrahippocampal muscimol microinfusions to transiently inactivate the male C57BL/6J mouse hippocampus at distinct stages during the novel object recognition (NOR) task: during object memory encoding and consolidation, just consolidation, and/or retrieval. We also assessed the effect of temporary hippocampal inactivation when objects were presented in different contexts, thus eliminating the spatial or contextual components of the task. Lastly, we assessed extracellular dorsal hippocampal glutamate efflux and firing properties of hippocampal neurons while mice performed the NOR task. Our results reveal a clear and compelling role of the rodent hippocampus in nonspatial object memory.

  14. A coupled ordinary differential equation lattice model for the simulation of epileptic seizures.

    PubMed

    Larter, Raima; Speelman, Brent; Worth, Robert M.

    1999-09-01

    A coupled ordinary differential equation lattice model for the CA3 region of the hippocampus (a common location of the epileptic focus) is developed. This model consists of a hexagonal lattice of nodes, each describing a subnetwork consisting of a group of prototypical excitatory pyramidal cells and a group of prototypical inhibitory interneurons connected via on/off excitatory and inhibitory synapses. The nodes communicate using simple rules to simulate the diffusion of extracellular potassium. Both the integration time over which a node's trajectory is integrated before the diffusional event is allowed to occur and the level of inhibition in each node were found to be important parameters. Shorter integration times lead to total synchronization of the lattice (similar to synchronous neural activity occurring during a seizure) whereas longer times cause more random spatiotemporal behavior. Moderately diminished levels of inhibition lead to simple nodal oscillatory behavior. It is postulated that both the lack of inhibition and an alteration in conduction time may be necessary for the development of a behaviorally manifest seizure. (c) 1999 American Institute of Physics.

  15. Role of mitochondrial fission in neuronal injury in pilocarpine-induced epileptic rats.

    PubMed

    Qiu, X; Cao, L; Yang, X; Zhao, X; Liu, X; Han, Y; Xue, Y; Jiang, H; Chi, Z

    2013-08-15

    Mitochondrial fission has been reported to be involved in oxidative stress, apoptosis and many neurological diseases. However, the role of mitochondrial fission in seizures, which could induce oxidative stress and neuronal loss, remains unknown. In this study, we used pilocarpine to elicit seizures in rats. Meanwhile, we used mitochondrial division inhibitor 1 (mdivi-1), a selective inhibitor of mitochondrial fission protein dynamin-related protein1 (Drp1), to suppress mitochondrial fission in epileptic model of rats in vivo. We found that mitochondrial fission was increased after seizures and the inhibition of mitochondrial fission by mdivi-1 significantly attenuated oxidative stress and reduced neuronal loss after seizures, shown by the decreased 8-hydroxy deoxyguanosine (8-oHdG) content, the increased superoxide dismutase (SOD) activity, the reduced expression of cytochrome c and caspase3 and the increased surviving neurons in the hippocampus. These results indicated that mitochondrial fission is up-regulated after seizures and the inhibition of mitochondrial fission is protective against neuronal injury in seizures, the underlying mechanism may be through the mitochondria/reactive oxygen species (ROS)/cytochrome c pathway.

  16. Analysis of intracerebral EEG recordings of epileptic spikes: insights from a neural network model

    PubMed Central

    Demont-Guignard, Sophie; Benquet, Pascal; Gerber, Urs; Wendling, Fabrice

    2009-01-01

    The pathophysiological interpretation of EEG signals recorded with depth electrodes (i.e. local field potentials, LFPs) during interictal (between seizures) or ictal (during seizures) periods is fundamental in the pre-surgical evaluation of patients with drug-resistant epilepsy. Our objective was to explain specific shape features of interictal spikes in the hippocampus (observed in LFPs) in terms of cell and network-related parameters of neuronal circuits that generate these events. We developed a neural network model based on “minimal” but biologically-relevant neuron models interconnected through GABAergic and glutamatergic synapses that reproduces the main physiological features of the CA1 subfield. Simulated LFPs were obtained by solving the forward problem (dipole theory) from networks including a large number (~3000) of cells. Insertion of appropriate parameters allowed the model to simulate events that closely resemble actual epileptic spikes. Moreover, the shape of the early fast component (‘spike’) and the late slow component (‘negative wave’) was linked to the relative contribution of glutamatergic and GABAergic synaptic currents in pyramidal cells. In addition, the model provides insights about the sensitivity of electrode localization with respect to recorded tissue volume and about the relationship between the LFP and the intracellular activity of principal cells and interneurons represented in the network. PMID:19651549

  17. A coupled ordinary differential equation lattice model for the simulation of epileptic seizures

    NASA Astrophysics Data System (ADS)

    Larter, Raima; Speelman, Brent; Worth, Robert M.

    1999-09-01

    A coupled ordinary differential equation lattice model for the CA3 region of the hippocampus (a common location of the epileptic focus) is developed. This model consists of a hexagonal lattice of nodes, each describing a subnetwork consisting of a group of prototypical excitatory pyramidal cells and a group of prototypical inhibitory interneurons connected via on/off excitatory and inhibitory synapses. The nodes communicate using simple rules to simulate the diffusion of extracellular potassium. Both the integration time over which a node's trajectory is integrated before the diffusional event is allowed to occur and the level of inhibition in each node were found to be important parameters. Shorter integration times lead to total synchronization of the lattice (similar to synchronous neural activity occurring during a seizure) whereas longer times cause more random spatiotemporal behavior. Moderately diminished levels of inhibition lead to simple nodal oscillatory behavior. It is postulated that both the lack of inhibition and an alteration in conduction time may be necessary for the development of a behaviorally manifest seizure.

  18. What is the impact of electromagnetic waves on epileptic seizures?

    PubMed Central

    Cinar, Nilgun; Sahin, Sevki; Erdinc, Oguz O.

    2013-01-01

    Background The effects of electromagnetic waves (EMWs) on humans and their relationship with various disorders have been investigated. We aimed to investigate the effects of exposure to different frequencies of EMWs in various durations in a mouse epilepsy model induced by pentylenetetrazole (PTZ). Material/Methods A total of 180 4-week-old male mice weighing 25–30 g were used in this study. Each experimental group consisted of 10 mice. They were exposed to 900, 700, 500, 300, and 100 MHz EMWs for 20 hours, 12 hours and 2 hours. Following electromagnetic radiation exposure, 60 mg/kg of PTZ was injected intraperitoneally to all mice. Each control was also injected with PTZ without any exposure to EMW. The latency of initial seizure and most severe seizure onset were compared with controls. Results The shortest initial seizure latency was noted in the 12-hour group, followed by the 700 MHz. The mean initial seizure latencies in the 2-hour EMW exposed group was significantly shorter compared to that in the 12- and 20-hour groups. There was no significant difference between 12- and 20-hour EMW exposed groups. There was a significant difference between control and 2- and 10-hour EMW exposed groups. No statistically significant differences were noted in mean latencies of the most severe seizure latency, following 20-, 12-, and 2- hour EMW exposed groups and control groups. Conclusions Our findings suggest that acute exposure to EMW may facilitate epileptic seizures, which may be independent of EMW exposure time. This information might be important for patients with epilepsy. Further studies are needed. PMID:23676765

  19. Proteomic profiling of the epileptic dentate gyrus

    PubMed Central

    Li, Aiqing; Choi, Yun-Sik; Dziema, Heather; Cao, Ruifeng; Cho, Hee-Yeon; Jung, Yeon Joo; Obrietan, Karl

    2010-01-01

    The development of epilepsy is often associated with marked changes in central nervous system cell structure and function. Along these lines, reactive gliosis and granule cell axonal sprouting within the dentate gyrus of the hippocampus are commonly observed in individuals with temporal lobe epilepsy. Here we used the pilocarpine model of temporal lobe epilepsy in mice to screen the proteome and phosphoproteome of the dentate gyrus to identify molecular events that are altered as part of the pathogenic process. Using a two-dimensional gel electrophoresis-based approach, followed by liquid chromatography-tandem mass spectrometry, 24 differentially expressed proteins, including 9 phosphoproteins, were identified. Functionally, these proteins were organized into several classes, including synaptic physiology, cell structure, cell stress, metabolism and energetics. The altered expression of three proteins involved in synaptic physiology, actin, profilin 1 and α-synuclein, was validated by secondary methods. Interestingly, marked changes in protein expression were detected in the supragranular cell region, an area where robust mossy fibers sprouting occurs. Together, these data provide new molecular insights into the altered protein profile of the epileptogenic dentate gyrus and point to potential pathophysiologic mechanisms underlying epileptogenesis. PMID:20608933

  20. Variations of dopamine, serotonin, and amino acid concentrations in Noda epileptic rat (NER) retina.

    PubMed

    Chanut, Evelyne; Labarthe, Benoît; Lacroix, Brigitte; Noda, Atsuhi; Gasdeblay, Sylvie; Bondier, Jean-Robert; Versaux-Botteri, Claudine

    2006-01-27

    Noda epileptic rats (NER) exhibit frequent spontaneous tonic-clonic convulsions which represent a valuable model of human epilepsy. If implication of brain neurotransmitters was largely reported, little is known about retina. However, it has been reported that human epilepsy syndrome varies not only with the location of seizure foci but also according to rhythmic patterns, for which retina has a major role in the transmission of external light-dark cycle information. The purpose of this work was to evaluate dopamine (DA), DA metabolites, serotonin (5-HT), and amino acid [glutamate, aspartate, glycine, gamma aminobutyric acid (GABA), and taurine] level variations in retina from NER, at two different nycthemeral periods (11 a.m. and 11 p.m.) and at different ages (2, 6, and 12 months). In NER, retinal dopaminergic function was decreased as soon as 2 months, whereas GABA levels were increased, even if no differences among the different ages could be distinguished. These variations were associated to a slight increase in 5-HT. Other amino acids tested were not affected by epilepsy, whereas taurine decreased with aging in NER as well as in control rats. Retinal 5-HT occurs principally as a precursor of melatonin (MEL). A triangular interaction may be hypothesized: MEL could decrease DA synthesis or release by enhancing GABA activity. Taken together, these results suggest that the retinal physiology is affected by the epileptic status and that information transmitted from retina to the brain should be affected by epilepsy in NER.

  1. Intrinsic neurophysiological properties of hilar ectopic and normotopic dentate granule cells in human temporal lobe epilepsy and a rat model

    PubMed Central

    Althaus, A. L.; Sagher, O.; Parent, J. M.

    2014-01-01

    Hilar ectopic dentate granule cells (DGCs) are a salient feature of aberrant plasticity in human temporal lobe epilepsy (TLE) and most rodent models of the disease. Recent evidence from rodent TLE models suggests that hilar ectopic DGCs contribute to hyperexcitability within the epileptic hippocampal network. Here we investigate the intrinsic excitability of DGCs from humans with TLE and the rat pilocarpine TLE model with the objective of comparing the neurophysiology of hilar ectopic DGCs to their normotopic counterparts in the granule cell layer (GCL). We recorded from 36 GCL and 7 hilar DGCs from human TLE tissue. Compared with GCL DGCs, hilar DGCs in patient tissue exhibited lower action potential (AP) firing rates, more depolarized AP threshold, and differed in single AP waveform, consistent with an overall decrease in excitability. To evaluate the intrinsic neurophysiology of hilar ectopic DGCs, we made recordings from retrovirus-birthdated, adult-born DGCs 2–4 mo after pilocarpine-induced status epilepticus or sham treatment in rats. Hilar DGCs from epileptic rats exhibited higher AP firing rates than normotopic DGCs from epileptic or control animals. They also displayed more depolarized resting membrane potential and wider AP waveforms, indicating an overall increase in excitability. The contrasting findings between disease and disease model may reflect differences between the late-stage disease tissue available from human surgical specimens and the earlier disease stage examined in the rat TLE model. These data represent the first neurophysiological characterization of ectopic DGCs from human hippocampus and prospectively birthdated ectopic DGCs in a rodent TLE model. PMID:25429123

  2. [Epileptic attacks in cerebral arterial pathology. Clinical findings].

    PubMed

    Rohmer, F; Collard, M; Kurtz, D; Warter, J M; Coquillat, G

    1975-09-01

    The authors analyse, with reference to 107 cases, the incidence of epileptic attacks in different types of non-traumatic arterial pathology of the brain. They describe their various clinical and evolutive aspects and attempt to isolate those peculiar to critical manifestations of this type occurring in the course of cerebral vascular accidents.

  3. Epileptic Hypergraphia: The Impact of Prolific Writing on Language Creativity

    ERIC Educational Resources Information Center

    Ammari, Elham H.

    2012-01-01

    Catalyzed academic concerns have been shown so far to tackle the issue of temporal lobe epileptic hypergraphia and the extent of its creativity. Temporal lobe epilepsy hence, (TLE) as a neurological brain disorder, has captured the attention of concerned scholars ever since. A constellation of TLE and its cohorts have baffled scientists,…

  4. Stress Effects on the Hippocampus: A Critical Review

    ERIC Educational Resources Information Center

    Kim, Eun Joo; Pellman, Blake; Kim, Jeansok J.

    2015-01-01

    Uncontrollable stress has been recognized to influence the hippocampus at various levels of analysis. Behaviorally, human and animal studies have found that stress generally impairs various hippocampal-dependent memory tasks. Neurally, animal studies have revealed that stress alters ensuing synaptic plasticity and firing properties of hippocampal…

  5. Persistent neurological damage associated with spontaneous recurrent seizures and atypical aggressive behavior of domoic acid epileptic disease.

    PubMed

    Tiedeken, Jessica A; Ramsdell, John S

    2013-05-01

    The harmful alga Pseudo-nitzschia sp. is the cause of human amnesic shellfish poisoning and the stranding of thousands of sea lions with seizures as a hallmark symptom. A human case study and epidemiological report of hundreds of stranded sea lions found individuals presenting months after recovery with a neurological disease similar to temporal lobe epilepsy. A rat model developed to establish and better predict how epileptic disease results from domoic acid poisoning demonstrated that a single episode of status epilepticus (SE), after a latent period, leads to a progressive state of spontaneous recurrent seizure (SRS) and expression of atypical aggressive behaviors. Structural damage associated with domoic acid-induced SE is prominent in olfactory pathways. Here, we examine structural damage in seven rats that progressed to epileptic disease. Diseased animals show progressive neuronal loss in the piriform cortex and degeneration of terminal fields in these layers and the posteromedial cortical amygdaloid nucleus. Animals that display aggressive behavior had additional neuronal damage to the anterior olfactory cortex. This study provides insight into the structural basis for the progression of domoic acid epileptic disease and relates to the California sea lion, where poisoned animals progress to a disease characterized by SRS and aggressive behaviors.

  6. The role of the hippocampus in generalizing configural relationships.

    PubMed

    Berens, Sam C; Bird, Chris M

    2017-03-01

    The hippocampus has been implicated in integrating information across separate events in support of mnemonic generalizations. These generalizations may be underpinned by processes at both encoding (linking similar information across events) and retrieval ("on-the-fly" generalization). However, the relative contribution of the hippocampus to encoding- and retrieval-based generalizations is poorly understood. Using fMRI in humans, we investigated the hippocampal role in gradually learning a set of spatial discriminations and subsequently generalizing them in an acquired equivalence task. We found a highly significant correlation between individuals' performance on a generalization test and hippocampal activity during the test, providing evidence that hippocampal processes support on-the-fly generalizations at retrieval. Within the same hippocampal region there was also a correlation between activity during the final stage of learning (when all associations had been learnt but no generalization was required) and subsequent generalization performance. We suggest that the hippocampus spontaneously retrieves prior events that share overlapping features with the current event. This process may also support the creation of generalized representations during encoding. These findings are supportive of the view that the hippocampus contributes to both encoding- and retrieval-based generalization via the same basic mechanism; retrieval of similar events sharing common features. © 2016 The Authors Hippocampus Published by Wiley Periodicals, Inc.

  7. The role of the hippocampus in generalizing configural relationships

    PubMed Central

    2017-01-01

    ABSTRACT The hippocampus has been implicated in integrating information across separate events in support of mnemonic generalizations. These generalizations may be underpinned by processes at both encoding (linking similar information across events) and retrieval (“on‐the‐fly” generalization). However, the relative contribution of the hippocampus to encoding‐ and retrieval‐based generalizations is poorly understood. Using fMRI in humans, we investigated the hippocampal role in gradually learning a set of spatial discriminations and subsequently generalizing them in an acquired equivalence task. We found a highly significant correlation between individuals’ performance on a generalization test and hippocampal activity during the test, providing evidence that hippocampal processes support on‐the‐fly generalizations at retrieval. Within the same hippocampal region there was also a correlation between activity during the final stage of learning (when all associations had been learnt but no generalization was required) and subsequent generalization performance. We suggest that the hippocampus spontaneously retrieves prior events that share overlapping features with the current event. This process may also support the creation of generalized representations during encoding. These findings are supportive of the view that the hippocampus contributes to both encoding‐ and retrieval‐based generalization via the same basic mechanism; retrieval of similar events sharing common features. © 2016 The Authors Hippocampus Published by Wiley Periodicals, Inc. PMID:27933668

  8. Neural Representations of Location Outside the Hippocampus

    ERIC Educational Resources Information Center

    Knierim, James J.

    2006-01-01

    Place cells of the rat hippocampus are a dominant model system for understanding the role of the hippocampus in learning and memory at the level of single-unit and neural ensemble responses. A complete understanding of the information processing and computations performed by the hippocampus requires detailed knowledge about the properties of the…

  9. Nonrandom connectivity of the epileptic dentate gyrus predicts a major role for neuronal hubs in seizures

    PubMed Central

    Morgan, Robert J.; Soltesz, Ivan

    2008-01-01

    Many complex neuronal circuits have been shown to display nonrandom features in their connectivity. However, the functional impact of nonrandom network topologies in neurological diseases is not well understood. The dentate gyrus is an excellent circuit in which to study such functional implications because proepileptic insults cause its structure to undergo a number of specific changes in both humans and animals, including the formation of previously nonexistent granule cell-to-granule cell recurrent excitatory connections. Here, we use a large-scale, biophysically realistic model of the epileptic rat dentate gyrus to reconnect the aberrant recurrent granule cell network in four biologically plausible ways to determine how nonrandom connectivity promotes hyperexcitability after injury. We find that network activity of the dentate gyrus is quite robust in the face of many major alterations in granule cell-to-granule cell connectivity. However, the incorporation of a small number of highly interconnected granule cell hubs greatly increases network activity, resulting in a hyperexcitable, potentially seizure-prone circuit. Our findings demonstrate the functional relevance of nonrandom microcircuits in epileptic brain networks, and they provide a mechanism that could explain the role of granule cells with hilar basal dendrites in contributing to hyperexcitability in the pathological dentate gyrus. PMID:18375756

  10. The dynamics of the epileptic brain reveal long-memory processes.

    PubMed

    Cook, Mark J; Varsavsky, Andrea; Himes, David; Leyde, Kent; Berkovic, Samuel Frank; O'Brien, Terence; Mareels, Iven

    2014-01-01

    The pattern of epileptic seizures is often considered unpredictable and the interval between events without correlation. A number of studies have examined the possibility that seizure activity respects a power-law relationship, both in terms of event magnitude and inter-event intervals. Such relationships are found in a variety of natural and man-made systems, such as earthquakes or Internet traffic, and describe the relationship between the magnitude of an event and the number of events. We postulated that human inter-seizure intervals would follow a power-law relationship, and furthermore that evidence for the existence of a long-memory process could be established in this relationship. We performed a post hoc analysis, studying eight patients who had long-term (up to 2 years) ambulatory intracranial EEG data recorded as part of the assessment of a novel seizure prediction device. We demonstrated that a power-law relationship could be established in these patients (β = - 1.5). In five out of the six subjects whose data were sufficiently stationary for analysis, we found evidence of long memory between epileptic events. This memory spans time scales from 30 min to 40 days. The estimated Hurst exponents range from 0.51 to 0.77 ± 0.01. This finding may provide evidence of phase-transitions underlying the dynamics of epilepsy.

  11. Reduced expression of human endogenous retrovirus (HERV)-W GAG protein in the cingulate gyrus and hippocampus in schizophrenia, bipolar disorder, and depression.

    PubMed

    Weis, S; Llenos, I C; Sabunciyan, S; Dulay, J R; Isler, L; Yolken, R; Perron, H

    2007-01-01

    The human endogenous retrovirus (HERV)-W multicopy family was identified in human DNA from the previously characterized multiple sclerosis associated retroviral element (MSRV). Upregulation of the HERV-W POL has been reported in cerebrospinal fluid of patients with schizophrenia. The expression of capsid (GAG) protein of HERV-W was studied by immunohistochemistry and western blotting in postmortem brain tissue of the anterior cingulate cortex and hippocampal formation of normal controls and of patients with schizophrenia, bipolar disorder and major depression. A physiological expression of GAG protein was detected in neurons as well as astroglial cells in normal brain both in the anterior cingulate cortex and in the hippocampal formation. There was a statistically significant reduction of this expression in neurons and astroglial cells in brains from individuals with schizophrenia, major depression, and bipolar disorder. The results from the present study confirm that GAG protein encoded by the HERV-W multicopy gene family is expressed in cells of the central nervous system under normal conditions. Our findings of a cell type-, brain region- and disease-specific reduced expression in schizophrenia, major depression, and bipolar disorder are compatible with a pathophysiological role of HERVs in human brain disorders. The causes and biological consequences of this differential regulation will be the subject of further investigations.

  12. Anomalous expression of chloride transporters in the sclerosed hippocampus of mesial temporal lobe epilepsy patients☆

    PubMed Central

    Cai, Xiaodong; Yang, Libai; Zhou, Jueqian; Zhu, Dan; Guo, Qiang; Chen, Ziyi; Chen, Shuda; Zhou, Liemin

    2013-01-01

    The Na+-K+-Cl- cotransporter 1 and K+-Cl- cotransporter 2 regulate the levels of intracellular chloride in hippocampal cells. Impaired chloride transport by these proteins is thought to be involved in the pathophysiological mechanisms of mesial temporal lobe epilepsy. Imbalance in the relative expression of these two proteins can lead to a collapse of Cl- homeostasis, resulting in a loss of gamma-aminobutyric acid-ergic inhibition and even epileptiform discharges. In this study, we investigated the expression of Na+-K+-Cl- cotransporter 1 and K+-Cl- cotransporter 2 in the sclerosed hippocampus of patients with mesial temporal lobe epilepsy, using western blot analysis and immunohistochemistry. Compared with the histologically normal hippocampus, the sclerosed hippocampus showed increased Na+-K+-Cl- cotransporter 1 expression and decreased K+-Cl- cotransporter 2 expression, especially in CA2 and the dentate gyrus. The change was more prominent for the Na+-K+-Cl- cotransporter 1 than for the K+-Cl- cotransporter 2. These experimental findings indicate that the balance between intracellular and extracellular chloride may be disturbed in hippocampal sclerosis, contributing to the hyperexcitability underlying epileptic seizures. Changes in Na+-K+-Cl- cotransporter 1 expression seems to be the main contributor. Our study may shed new light on possible therapies for patients with mesial temporal lobe epilepsy with hippocampal sclerosis. PMID:25206700

  13. Repeated citalopram administration counteracts kainic acid-induced spreading of PSA-NCAM-immunoreactive cells and loss of reelin in the adult mouse hippocampus.

    PubMed

    Jaako, Külli; Aonurm-Helm, Anu; Kalda, Anti; Anier, Kaili; Zharkovsky, Tamara; Shastin, Dmitri; Zharkovsky, Alexander

    2011-09-01

    Systemic or intracerebral administration of kainic acid in rodents induces neuronal death followed by a cascade of neuroplastic changes in the hippocampus. Kainic acid-induced neuroplasticity is evidenced by alterations in hippocampal neurogenesis, dispersion of the granule cell layer and re-organisation of mossy fibres. Similar abnormalities are observed in patients with temporal lobe epilepsy and, therefore, kainic acid-induced hippocampal neuroplasticity might mimic pathological mechanisms leading to the formation of 'epileptic brain' in patients with temporal lobe epilepsy. Previous studies have demonstrated that selective serotonin re-uptake inhibitor antidepressants might reduce the severity of seizures in epileptic patients and reduce neuronal death in laboratory animal models of kainic acid-induced neurotoxicity. In the present study, we investigated whether kainic acid-induced neuroplasticity in mice is modulated by the repeated administration of citalopram, a selective serotonin reuptake inhibitor. We found that at the histopathological level, repeated citalopram treatment counteracted the kainic acid-induced neuronal loss and dispersion of young granule neurons expressing the polysialylated neural cell adhesion molecule within the granule cell layer of the hippocampus. Citalopram also counteracted the downregulation of reelin on both mRNA and protein levels induced by kainic acid administration. Our findings indicate that repeated administration of citalopram is able to prevent kainic acid-induced abnormal brain plasticity and thereby prevent the formation of an epileptic phenotype.

  14. [Video electroencephalographic diagnosis of epileptic and non-epileptic paroxysmal episodes in infants and children at the pre-school age].

    PubMed

    Pérez-Jiménez, Angeles; García-Fernández, Marta; Santiago, M del Mar; Fournier-Del Castillo, M Concepción

    2012-05-21

    The main usefulness of video electroencephalographic (video-EEG) monitoring lies in the fact that it allows proper classification of the type of epileptic seizure and epileptic syndrome, identification of minor seizures, location of the epileptogenic zone and differentiation between epileptic seizures and non-epileptic paroxysmal manifestations (NEPM). In infants and pre-school age children, the clinical signs with which epileptic seizures are expressed differ to those of older children, seizures with bilateral motor signs such as epileptic spasms, tonic and myoclonic seizures predominate, and seizures with interruption of activity or hypomotor seizures, and no prominent automatisms are observed. In children with focal epilepsies, focal and generalised signs are often superposed, both clinically and in the EEG. NEPM may be benign transitory disorders or they can be episodic symptoms of different neurological or psychopathological disorders. NEPM are often observed in children with mental retardation, neurological compromise or autism spectrum disorders, who present epileptic seizures and epileptiform abnormalities in the baseline EEG. It then becomes necessary to determine which episodes correspond to epileptic seizures and which do not. The NEPM that are most frequently registered in the video-EEG in infants and pre-school age children are unexpected sudden motor contractions ('spasms'), introspective tendencies, motor stereotypic movements and paroxysmal sleep disorders.

  15. Sparse generalized volterra model of human hippocampal spike train transformation for memory prostheses.

    PubMed

    Song, Dong; Robinson, Brian S; Hampson, Robert E; Marmarelis, Vasilis Z; Deadwyler, Sam A; Berger, Theodore W

    2015-01-01

    In order to build hippocampal prostheses for restoring memory functions, we build multi-input, multi-output (MIMO) nonlinear dynamical models of the human hippocampus. Spike trains are recorded from the hippocampal CA3 and CA1 regions of epileptic patients performing a memory-dependent delayed match-to-sample task. Using CA3 and CA1 spike trains as inputs and outputs respectively, second-order sparse generalized Laguerre-Volterra models are estimated with group lasso and local coordinate descent methods to capture the nonlinear dynamics underlying the spike train transformations. These models can accurately predict the CA1 spike trains based on the ongoing CA3 spike trains and thus will serve as the computational basis of the hippocampal memory prosthesis.

  16. Nonlinear Dynamic Analysis of Scalp EEG Epileptic Signals

    NASA Astrophysics Data System (ADS)

    Blanco, Susana A.; Creso, Judith; Figliola, Alejandra; Quiroga, Rodrigo Quian; Rosso, Osvaldo A.

    Noisy signals obtained during a tonic-clonic epileptic seizure, are usually neglected for visual inspection by the physicians due to the presence of muscle artifacts. Although noise obscures completely the recording, information about the underlying brain activity can be obtained by filtering, through the Orthogonal Wavelet Transforms, those frequencies bands associated with muscle activity. After generating a "noise free" signal by removing the muscle artifacts with wavelets, a dynamical analysis of the brain behavior will be performed by using nonlinear dynamics methods. The values for nonlinear metric invariants, like the correlation dimension and the maximum Lyapunov exponent, confirm that the brain dynamical behavior is more ordered during the epileptic seizure than pre-seizure stage.

  17. Assortative mixing in functional brain networks during epileptic seizures

    NASA Astrophysics Data System (ADS)

    Bialonski, Stephan; Lehnertz, Klaus

    2013-09-01

    We investigate assortativity of functional brain networks before, during, and after one-hundred epileptic seizures with different anatomical onset locations. We construct binary functional networks from multi-channel electroencephalographic data recorded from 60 epilepsy patients; and from time-resolved estimates of the assortativity coefficient, we conclude that positive degree-degree correlations are inherent to seizure dynamics. While seizures evolve, an increasing assortativity indicates a segregation of the underlying functional network into groups of brain regions that are only sparsely interconnected, if at all. Interestingly, assortativity decreases already prior to seizure end. Together with previous observations of characteristic temporal evolutions of global statistical properties and synchronizability of epileptic brain networks, our findings may help to gain deeper insights into the complicated dynamics underlying generation, propagation, and termination of seizures.

  18. Epileptic Seizures Induced by a Spontaneous Carotid Cavernous Fistula

    PubMed Central

    Yildirim, Erkan

    2016-01-01

    A 79-year-old woman was admitted to our emergency department with complaints of fainting and loss of consciousness three times during the past month. She was diagnosed with epilepsy and started to be treated with antiepileptic drug. Physical examination showed, in the left eye, chemosis, limited eye movements in all directions, and minimal exophthalmos as unexisting symptoms on admission developed on the sixth day. Orbital magnetic resonance imaging (MRI) and digital subtraction angiography (DSA) imaging revealed a carotid cavernous fistula (CCF). Epileptic attacks and ophthalmic findings previously present but diagnosed during our examinations were determined to ameliorate completely after performing the coil embolization. Based on literature, we present the first case with nontraumatic CCF manifesting with epileptic seizures and intermittent eye symptoms in the present report. PMID:28077946

  19. Optical imaging of acute epileptic networks in mice.

    PubMed

    Guevara, Edgar; Pouliot, Philippe; Nguyen, Dang Khoa; Lesage, Frédéric

    2013-07-01

    The potential of intrinsic optical imaging and resting-state analysis under anesthetized conditions as a tool to study brain networks associated with epileptic seizures is investigated. Using an acute model of epileptiform activity, the 4-aminopyridine model in live mice, we observe the changes in resting-state networks with the onset of seizure activity and in conditions of spiking activity. Resting-state networks identified before and after the onset of epileptiform activity show both decreased and increased homologous correlations, with a small dependence on seizure intensity. The observed changes are not uniform across the different hemodynamic measures, suggesting a potential decoupling between blood flow and metabolism in the low-frequency networks. This study supports the need for a more extensive investigation of epileptic networks including more than one independent hemodynamic measurement.

  20. Epileptic seizure prediction by non-linear methods

    DOEpatents

    Hively, L.M.; Clapp, N.E.; Day, C.S.; Lawkins, W.F.

    1999-01-12

    This research discloses methods and apparatus for automatically predicting epileptic seizures monitor and analyze brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis tools; obtaining time serial trends in the nonlinear measures; comparison of the trend to known seizure predictors; and providing notification that a seizure is forthcoming. 76 figs.

  1. Epileptic seizure prediction by non-linear methods

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1999-01-01

    Methods and apparatus for automatically predicting epileptic seizures monitor and analyze brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis tools; obtaining time serial trends in the nonlinear measures; comparison of the trend to known seizure predictors; and providing notification that a seizure is forthcoming.

  2. Anticipating epileptic seizures: from mathematics to clinical applications.

    PubMed

    Le Van Quyen, Michel

    2005-02-01

    The study of dynamical changes in the neural activity preceding an epileptic seizure allows the characterization of a preictal state several minutes prior to seizure onset. This opens new perspectives for studying the mechanisms of ictogenesis as well as for possible therapeutic interventions that represent a major breakthrough. In this review we present and discuss the results from our group in this domain using nonlinear analysis of brain signals, as well as its limitation and open questions.

  3. Quadriplegia Following Epileptic Seizure : Things to Keep in Mind

    PubMed Central

    Yeşilbudak, Zülal; Şişman, Lokman; Uca, Ali Ulvi

    2016-01-01

    People with epilepsy are believed to be at a higher risk of incurring accidental injury than people who do not have seizures. The incidence of injury, either due to seizure or accident as a consequent of seizure is also high and varies from 0.03% to 3%. The most common injuries are head contusions, lacerations, burns and fractures. In this article, we present a case of quadriplegia after a generalized epileptic seizure. PMID:27226869

  4. Estimation of degree of synchronization in epileptic brain

    NASA Astrophysics Data System (ADS)

    Moskalenko, Olga I.; Koronovskii, Alexey A.; Pavlov, Alexey N.; Hramov, Alexander E.; Zhuravlev, Maksim O.

    2016-03-01

    The method for calculation of zero conditional Lyapunov exponent from time series has been proposed. Such method is shown to define the degree of synchronization of the regime realized in the system. It has been applied to real experimental neurophysiological time series represented by electroencephalograms of WAG/Rij rats having genetic predisposition to absence-epilepsy. The degree of synchronization in epileptic brain has been found.

  5. Unstable periodic orbits in human epileptic hippocampal slices.

    PubMed

    Pen-Ning Yu; Min-Chi Hsiao; Dong Song; Liu, Charles Y; Heck, Christi N; Millett, David; Berger, Theodore W

    2014-01-01

    Inter-ictal activity is studied in hippocampal slices resected from patients with epilepsy using local field potential recording. Inter-ictal activity in the dentate gyrus (DG) is induced by high-potassium (8 mM), low-magnesium (0.25 mM) aCSF with additional 100 μM 4-aminopyridine(4-AP). The dynamics of the inter-ictal activity is investigated by developing the first return map with inter-pulse intervals. Unstable periodic orbits (UPOs) are detected in the hippocampal slice at the DG area according to both the topological recurrence method and the periodic orbit transform method. Surrogate analysis suggests the presence of UPOs in hippocampal slices from patients with epilepsy. This finding also suggests that inter-ictal activity is a chaotic system and will allow us to apply chaos control techniques to manipulate inter-ictal activity.

  6. Human circulating dopamine-beta-hydroxylase and epilepsy.

    PubMed

    Warter, J M; Coquillat, G; Kurtz, D

    1975-01-01

    The activity of circulatory dopamine-beta-hydroxylase (DBH) in humans is shown to be lower in some epileptic subjects than in normal subjects. The activity of the enzymes was found to be dramatically low in subjects who experienced an epileptic seizure 24 hrs before DBH activity was determined. The activity varied through the course of epileptic seizures induced by a convulsant drugs and these variations might be due to the "en masse" changes of the sympathetic nervous system.

  7. Epileptic syndrome in systemic lupus erythematosus and neuronal autoantibody associations.

    PubMed

    Kampylafka, E I; Alexopoulos, H; Fouka, P; Moutsopoulos, H M; Dalakas, M C; Tzioufas, A G

    2016-10-01

    We investigated systemic lupus erythematosus (SLE) patients with epilepsy, a major and organic neurological symptom. Our aim was to test patients for the autoimmune epilepsy-associated antibodies anti-GAD, anti-NMDAR, anti-AMPAR1/2, anti-GABABR and anti-VGKC. We tested sera from ten SLE patients with current or previous episodes of epileptic seizures. In addition, sera were tested for staining on primary hippocampal neurons. The patients' clinical and neuroimaging profile, disease activity and accumulated damage scores and therapeutic regimens administered were recorded, and correlations were evaluated. Patients were negative for all anti-neuronal autoantibodies tested, and showed no staining on primary hippocampal cells, which suggests the absence of autoantibodies against neuronal cell surface antigens. Epileptic seizures were all tonic-clonic, and all patients had high disease activity (mean SLE Damage Acticity Index score 19.3 ± 7.3). Six patients had minor or no brain magnetic resonance imaging findings, and three had major findings. 9/10 patients received immunosuppression for 5 ± 4 months, while anti-convulsive treatment was administered to all patients (4.2 ± 3 years). Our results suggest that the majority of SLE-related epileptic seizures cannot be attributed to the action of a single antibody against neuronal antigens. Studies with larger neuropsychiatric SLE populations and stricter inclusion criteria are necessary to verify these findings.

  8. [Portable Epileptic Seizure Monitoring Intelligent System Based on Android System].

    PubMed

    Liang, Zhenhu; Wu, Shufeng; Yang, Chunlin; Jiang, Zhenzhou; Yu, Tao; Lu, Chengbiao; Li, Xiaoli

    2016-02-01

    The clinical electroencephalogram (EEG) monitoring systems based on personal computer system can not meet the requirements of portability and home usage. The epilepsy patients have to be monitored in hospital for an extended period of time, which imposes a heavy burden on hospitals. In the present study, we designed a portable 16-lead networked monitoring system based on the Android smart phone. The system uses some technologies including the active electrode, the WiFi wireless transmission, the multi-scale permutation entropy (MPE) algorithm, the back-propagation (BP) neural network algorithm, etc. Moreover, the software of Android mobile application can realize the processing and analysis of EEG data, the display of EEG waveform and the alarm of epileptic seizure. The system has been tested on the mobile phones with Android 2. 3 operating system or higher version and the results showed that this software ran accurately and steadily in the detection of epileptic seizure. In conclusion, this paper provides a portable and reliable solution for epileptic seizure monitoring in clinical and home applications.

  9. [Diagnosis and treatment of non-triggered single epileptic seizures].

    PubMed

    Martinez-Juarez, I E; Moreno, J; Ladino, L D; Castro, N; Hernandez-Vanegas, L; Burneo, J G; Hernandez-Ronquillo, L; Tellez-Zenteno, J F

    2016-08-16

    Epileptic seizures are one of the main reasons for neurological visits in an emergency department. Convulsions represent a traumatic event for the patient and the family, with significant medical and social consequences. Due to their prevalence and impact, the initial management is of vital importance. Although following the first epileptic seizure, early recurrence diminishes after establishing treatment with antiepileptic drugs, the forecast for developing epilepsy and long-term outcomes are not altered by any early intervention. Detailed questioning based on the symptoms of the convulsions, the patient's medical history and a full electroencephalogram and neuroimaging study make it possible to define the risk of recurrence of the seizure and the possible diagnosis of epilepsy. Epileptic abnormalities, the presence of old or new potentially epileptogenic brain lesions, as well as nocturnal seizures, increase the risk of recurrence. Physicians must assess each patient on an individual basis to determine the most suitable treatment, and explain the risk of not being treated versus the risk that exists if treatment with antiepileptic drugs is established.

  10. Early myoclonic epileptic encephalopathy (E.M.E.E.).

    PubMed

    Dalla Bernardina, B; Dulac, O; Fejerman, N; Dravet, C; Capovilla, G; Bondavalli, S; Colamaria, V; Roger, J

    1983-01-01

    The authors describe the electroclinical aspects and evolution of nine cases of myoclonic epileptic encephalopathy which began between two days and ten weeks of life. At onset it is associated with: myoclonic jerks, partial fits and periodic paroxysmal EEG abnormalities. Repeated spasms coexisting with partial fits and 'suppression-bursts' (both appearing later) complete the electroclinical picture. The neurological status (initially normal) progressively deteriorates leading within a few months to a decerebrate posture with opisthotonos. In spite of thorough neuroradiological, biochemical, cytological, metabolic, and ultrastructural investigations, the etiology remained unknown. However, the electroclinical and evolutive patterns are similar to those of some metabolic diseases (Polyodystrophy, Non-Ketotic Hyperglycinemia, etc.). All these observations display a homogeneous electroclinical pattern for which the authors propose the name of Early Myoclonic Epileptic Encephalopathy. This type deserves to be classified as a particular electroclinical entity among the epileptic encephalopathies of the first year of life; since its course is regularly downhill in all cases there may be a familial recurrence due to the possibility of a metabolic etiology.

  11. Connectivity of epileptic brain regions in wake and sleep.

    PubMed

    Klimes, Petr; Duque, Juliano J; Jurak, Pavel; Halamek, Josef; Worrell, Gregory A

    2015-08-01

    Focal epileptic brain is characterized by a region of pathological tissue seizure onset zone (SOZ) - the pathologic tissue generating seizures. During the interictal period (nonseizure) the SOZ is characterized by epileptiform activity - interictal spikes & high-frequency oscillations (HFO). The SOZ also exhibits hyper-synchrony and functional disconnection from the surrounding areas. Recent studies have described the synchrony inside the SOZ and surrounding tissue for just small sets of patients (2-4) and without any distinction in behavioral states. Wake and sleep cycles can, however, have a significant influence on SOZ activity. Here we show the results of connectivity analysis in three fundamental areas of the epileptic brain - inside SOZ, outside SOZ and bridging areas in 7 patients during wake and sleep. We observed increased synchrony inside SOZ and decreased synchrony on its edges (bridging areas) in specific frequency bands. We also detected significant differences of synchrony levels between wake and sleep periods in HFO frequencies. Our results provide additional insight into the properties of SOZ connectivity. Knowledge of these principles may prove useful for SOZ localization and understanding epileptic brain function in general.

  12. Epileptic drivers--a study of 1,089 patients.

    PubMed

    Beaussart, M; Beaussart-Defaye, J; Lamiaux, J M; Grubar, J C

    1997-01-01

    A longitudinal study of 1,089 epileptic patients followed up by the same specialist between 1965-1991, allowed close observation of the seizures occurring to the patient at the wheel and their consequences and to relate them to detailed epileptological criteria. The results show road accidents caused by epileptic seizures are few and most of them are minor. The repatriation of risks between patients is very uneven. The quality of the neuro-psychic inter-critical state as well as the patients' degree of compliance seem to be more reliable risk indicators than some more traditional criteria like the length of remission between seizures. Although seizures occur more frequently in patients suffering from Complex Partial seizures as opposed to other forms of epileptic seizures, the differences between patients with epilepsy lies mostly in their behaviour and in their own representation of the risks. There is a need for a body of rules and regulations serving as an official framework regulating the driving test. This widely circulated document should take into account the multiplicity of cases, including the small number of patients thought to be dangerous. Its mode of application should allow doctors as well as patients to opt for a realistic attitude based on decision-making criteria involving a thorough knowledge of epilepsy as well as a thorough knowledge of the psychological characteristics of the patient concerned.

  13. Dystrophin Distribution and Expression in Human and Experimental Temporal Lobe Epilepsy

    PubMed Central

    Hendriksen, Ruben G. F.; Schipper, Sandra; Hoogland, Govert; Schijns, Olaf E. M. G.; Dings, Jim T. A.; Aalbers, Marlien W.; Vles, Johan S. H.

    2016-01-01

    Objective: Dystrophin is part of a protein complex that connects the cytoskeleton to the extracellular matrix. In addition to its role in muscle tissue, it functions as an anchoring protein within the central nervous system such as in hippocampus and cerebellum. Its presence in the latter regions is illustrated by the cognitive problems seen in Duchenne Muscular Dystrophy (DMD). Since epilepsy is also supposed to constitute a comorbidity of DMD, it is hypothesized that dystrophin plays a role in neuronal excitability. Here, we aimed to study brain dystrophin distribution and expression in both, human and experimental temporal lobe epilepsy (TLE). Method: Regional and cellular dystrophin distribution was evaluated in both human and rat hippocampi and in rat cerebellar tissue by immunofluorescent colocalization with neuronal (NeuN and calbindin) and glial (GFAP) markers. In addition, hippocampal dystrophin levels were estimated by Western blot analysis in biopsies from TLE patients, post-mortem controls, amygdala kindled (AK)-, and control rats. Results: Dystrophin was expressed in all hippocampal pyramidal subfields and in the molecular-, Purkinje-, and granular cell layer of the cerebellum. In these regions it colocalized with GFAP, suggesting expression in astrocytes such as Bergmann glia (BG) and velate protoplasmic astrocytes. In rat hippocampus and cerebellum there were neither differences in dystrophin positive cell types, nor in the regional dystrophin distribution between AK and control animals. Quantitatively, hippocampal full-length dystrophin (Dp427) levels were about 60% higher in human TLE patients than in post-mortem controls (p < 0.05), whereas the level of the shorter Dp71 isoform did not differ. In contrast, AK animals showed similar dystrophin levels as controls. Conclusion: Dystrophin is ubiquitously expressed by astrocytes in the human and rat hippocampus and in the rat cerebellum. Hippocampal full-length dystrophin (Dp427) levels are upregulated

  14. The hippocampus in neurodegenerative disease.

    PubMed

    Moodley, K K; Chan, D

    2014-01-01

    AD is the commonest neurodegenerative disorder resulting ultimately in dementia, a stage during which there is a loss of previously acquired intellectual skill and independent occupational and social function. Neurodegenerative changes within the hippocampus and an extended neuronal network involving the medial temporal and medial parietal lobe result in the archetypal memory impairment seen in Alzheimer's disease (AD). As attention focuses increasingly on early diagnosis and treatment of dementia, this understanding of the hippocampal involvement in AD has helped to develop diagnostic tools for use in early disease. However, hippocampal damage is also a common feature among non-AD neurodegenerative dementias. Neuroimaging techniques, in conjunction with behavioral and pathological techniques, can be used to determine the involvement of the hippocampus in AD and other neurodegenerative diseases.

  15. Stress and the Developing Hippocampus

    PubMed Central

    Brunson, Kristen L.; Chen, Yuncai; Avishai-Eliner, Sarit; Baram, Tallie Z.

    2011-01-01

    The mechanisms that regulate neuronal function are a sum of genetically determined programs and experience. The effect of experience on neuronal function is particularly important during development, because early-life positive and adverse experience (stress) may influence the still “plastic” nervous system long-term. Specifically, for hippocampal-mediated learning and memory processes, acute stress may enhance synaptic efficacy and overall learning ability, and conversely, chronic or severe stress has been shown to be detrimental. The mechanisms that enable stress to act as this “double-edged sword” are unclear. Here, we discuss the molecular mediators of the stress response in the hippocampus with an emphasis on novel findings regarding the role of the neuropeptide known as corticotropin-releasing hormone (CRH). We highlight the physiological and pathological roles of this peptide in the developing hippocampus, and their relevance to the long-term effects of early-life experience on cognitive function during adulthood. PMID:12777683

  16. Convulsive Syncope Induced by Ventricular Arrhythmia Masquerading as Epileptic Seizures: Case Report and Literature Review

    PubMed Central

    Sabu, John; Regeti, Kalyani; Mallappallil, Mary; Kassotis, John; Islam, Hamidul; Zafar, Shoaib; Khan, Rafay; Ibrahim, Hiyam; Kanta, Romana; Sen, Shuvendu; Yousif, Abdalla; Nai, Qiang

    2016-01-01

    It is important but difficult to distinguish convulsive syncope from epileptic seizure in many patients. We report a case of a man who presented to emergency department after several witnessed seizure-like episodes. He had a previous medical history of systolic heart failure and automated implantable converter defibrillator (AICD) in situ. The differential diagnoses raised were epileptic seizures and convulsive syncope secondary to cardiac arrhythmia. Subsequent AICD interrogation revealed ventricular tachycardia and fibrillation (v-tach/fib). Since convulsive syncope and epileptic seizure share many similar clinical features, early diagnosis is critical for choosing the appropriate management and preventing sudden cardiac death in patients with presumed epileptic seizure. PMID:27429683

  17. Increased excitability and metabolism in pilocarpine induced epileptic rats: effect of Bacopa monnieri.

    PubMed

    Mathew, Jobin; Paul, Jes; Nandhu, M S; Paulose, C S

    2010-09-01

    We have evaluated the acetylcholine esterase and malate dehydrogenase activity in the muscle, epinephrine, norepinephrine, insulin and T3 content in the serum of epileptic rats. Acetylcholine esterase and malate dehydrogenase activity increased in the muscle and decreased in the heart of the epileptic rats compared to control. Insulin and T3 content were increased significantly in the serum of the epileptic rats. Our results suggest that repetitive seizures resulted in increased metabolism and excitability in epileptic rats. Bacopa monnieri and Bacoside-A treatment prevents the occurrence of seizures there by reducing the impairment on peripheral nervous system.

  18. Novel STXBP1 mutations in 2 patients with early infantile epileptic encephalopathy.

    PubMed

    Sampaio, Mafalda; Rocha, Ruben; Biskup, Saskia; Leão, Miguel

    2015-04-01

    The authors describe 2 patients with early infantile epileptic encephalopathy caused by 2 novel mutations involving the STXBP1 gene. The authors suggest that in spite of the rarity of STXBP1 mutations, molecular analysis of STXBP1 gene should be performed in patients with early infantile epileptic encephalopathy, after exclusion of ARX mutations in male patients and CDKL5 mutations in female patients. The potential mechanisms explaining the variable clinical phenotypes caused by STXBP1 mutations are discussed and the designation of early-onset epileptic encephalopathies, including an updated genetic classification, is proposed to encompass the epileptic encephalopathies beginning in the first 6 months of life.

  19. High-resolution synchrotron radiation-based phase tomography of the healthy and epileptic brain

    NASA Astrophysics Data System (ADS)

    Bikis, Christos; Janz, Philipp; Schulz, Georg; Schweighauser, Gabriel; Hench, Jürgen; Thalmann, Peter; Deyhle, Hans; Chicherova, Natalia; Rack, Alexander; Khimchenko, Anna; Hieber, Simone E.; Mariani, Luigi; Haas, Carola A.; Müller, Bert

    2016-10-01

    Phase-contrast micro-tomography using synchrotron radiation has yielded superior soft tissue visualization down to the sub-cellular level. The isotropic spatial resolution down to about one micron is comparable to the one of histology. The methods, however, provide different physical quantities and are thus complementary, also allowing for the extension of histology into the third dimension. To prepare for cross-sectional animal studies on epilepsy, we have standardized the specimen's preparation and scanning procedure for mouse brains, so that subsequent histology remains entirely unaffected and scanning of all samples (n = 28) is possible in a realistic time frame. For that, we have scanned five healthy and epileptic mouse brains at the ID19 beamline, ESRF, Grenoble, France, using grating- and propagation-based phase contrast micro-tomography. The resulting datasets clearly show the cortex, ventricular system, thalamus, hypothalamus, and hippocampus. Our focus is on the latter, having planned kainate-induced epilepsy experiments. The cell density and organization in the dentate gyrus and Ammon's horn region were clearly visualized in control animals. This proof of principle was required to initiate experiment. The resulting three-dimensional data have been correlated to histology. The goal is a brain-wide quantification of cell death or structural reorganization associated with epilepsy as opposed to histology alone that represents small volumes of the total brain only. Thus, the proposed technique bears the potential to correlate the gold standard in analysis with independently obtained data sets. Such an achievement also fuels interest for other groups in neuroscience research to closely collaborate with experts in phase micro-tomography.

  20. Altered expression and function of small-conductance (SK) Ca2+-activated K+ channels in pilocarpine-treated epileptic rats

    PubMed Central

    Oliveira, Mauro S.; Skinner, Frank; Arshadmansab, Massoud F.; Garcia, Ileana; Mello, Carlos F.; Knaus, Hans-Günther; Ermolinsky, Boris S.; Pacheco Otalora, Luis F.; Garrido-Sanabria, Emilio R.

    2010-01-01

    Small conductance calcium (Ca2+) activated SK channels are critical regulators of neuronal excitability in hippocampus. Accordingly, these channels are thought to play a key role in controlling neuronal activity in acute models of epilepsy. In this study, we investigate the expression and function of SK channels in the pilocarpine model of mesial temporal lobe epilepsy. For this purpose, protein expression was assessed using western blotting assays and gene expression was analyzed using TaqMan-based probes and the quantitative real-time polymerase chain reaction (qPCR) comparative method delta-delta cycle threshold (ΔΔCT) in samples extracted from control and epileptic rats. In addition, the effect of SK channel antagonist UCL1684 and agonist NS309 on CA1 evoked population spikes was studied in hippocampal slices. Western blotting analysis showed a significant reduction in the expression of SK1 and SK2 channels at 10 days following status epilepticus (SE), but levels recovered at 1 month and at more than 2 months after SE. In contrast, a significant down-regulation of SK3 channels was detected after 10 days of SE. Analysis of gene expression by qPCR revealed a significant reduction of transcripts for SK2 (Kcnn1) and SK3 (Kcnn3) channels as early as 10 days following pilocarpine-induced SE and during the chronic phase of the pilocarpine model. Moreover, bath application of UCL1684 (100 nM for 15 min) induced a significant increase of the population spike amplitude and number of spikes in the hippocampal CA1 area of slices obtained control and chronic epileptic rats. This effect was obliterated by co-administration of UCL1684 with SK channel agonist NS309 (1 μM). Application of NS309 failed to modify population spikes in the CA1 area of slices taken from control and epileptic rats. These data indicate an abnormal expression of SK channels and a possible dysfunction of these channels in experimental MTLE. PMID:20553876

  1. Comparison of automated and manual segmentation of hippocampus MR images

    NASA Astrophysics Data System (ADS)

    Haller, John W.; Christensen, Gary E.; Miller, Michael I.; Joshi, Sarang C.; Gado, Mokhtar; Csernansky, John G.; Vannier, Michael W.

    1995-05-01

    The precision and accuracy of area estimates from magnetic resonance (MR) brain images and using manual and automated segmentation methods are determined. Areas of the human hippocampus were measured to compare a new automatic method of segmentation with regions of interest drawn by an expert. MR images of nine normal subjects and nine schizophrenic patients were acquired with a 1.5-T unit (Siemens Medical Systems, Inc., Iselin, New Jersey). From each individual MPRAGE 3D volume image a single comparable 2-D slice (matrix equals 256 X 256) was chosen which corresponds to the same coronal slice of the hippocampus. The hippocampus was first manually segmented, then segmented using high dimensional transformations of a digital brain atlas to individual brain MR images. The repeatability of a trained rater was assessed by comparing two measurements from each individual subject. Variability was also compared within and between subject groups of schizophrenics and normal subjects. Finally, the precision and accuracy of automated segmentation of hippocampal areas were determined by comparing automated measurements to manual segmentation measurements made by the trained rater on MR and brain slice images. The results demonstrate the high repeatability of area measurement from MR images of the human hippocampus. Automated segmentation using high dimensional transformations from a digital brain atlas provides repeatability superior to that of manual segmentation. Furthermore, the validity of automated measurements was demonstrated by a high correlation with manual segmentation measurements made by a trained rater. Quantitative morphometry of brain substructures (e.g. hippocampus) is feasible by use of a high dimensional transformation of a digital brain atlas to an individual MR image. This method automates the search for neuromorphological correlates of schizophrenia by a new mathematically robust method with unprecedented sensitivity to small local and regional differences.

  2. Manipulating epileptiform bursting in the rat hippocampus using chaos control and adaptive techniques.

    PubMed

    Slutzky, Marc W; Cvitanovic, Predrag; Mogul, David J

    2003-05-01

    Epilepsy is a relatively common disease, afflicting 1%-2% of the population, yet many epileptic patients are not sufficiently helped by current pharmacological therapies. Recent reports have suggested that chaos control techniques may be useful for electrically manipulating epileptiform bursting behavior in vitro and could possibly lead to an alternative method for preventing seizures. We implemented chaos control of spontaneous bursting in the rat hippocampal slice using robust control techniques: stable manifold placement (SMP) and an adaptive tracking (AT) algorithm designed to overcome nonstationarity. We examined the effect of several factors, including control radius size and synaptic plasticity, on control efficacy. AT improved control efficacy over basic SMP control, but relatively frequent stimulation was still necessary and very tight control was only achieved for brief stretches. A novel technique was developed for validating period-1 orbit detection in noisy systems by forcing the system directly onto the period-1 orbit. This forcing analysis suggested that period-1 orbits were indeed present but that control would be difficult because of high noise levels and nonstationarity. Noise might actually be lower in vivo, where regulatory inputs to the hippocampus are still intact. Thus, it may still be feasible to use chaos control algorithms for preventing epileptic seizures.

  3. An event map of memory space in the hippocampus

    PubMed Central

    Deuker, Lorena; Bellmund, Jacob LS; Navarro Schröder, Tobias; Doeller, Christian F

    2016-01-01

    The hippocampus has long been implicated in both episodic and spatial memory, however these mnemonic functions have been traditionally investigated in separate research strands. Theoretical accounts and rodent data suggest a common mechanism for spatial and episodic memory in the hippocampus by providing an abstract and flexible representation of the external world. Here, we monitor the de novo formation of such a representation of space and time in humans using fMRI. After learning spatio-temporal trajectories in a large-scale virtual city, subject-specific neural similarity in the hippocampus scaled with the remembered proximity of events in space and time. Crucially, the structure of the entire spatio-temporal network was reflected in neural patterns. Our results provide evidence for a common coding mechanism underlying spatial and temporal aspects of episodic memory in the hippocampus and shed new light on its role in interleaving multiple episodes in a neural event map of memory space. DOI: http://dx.doi.org/10.7554/eLife.16534.001 PMID:27710766

  4. A comparison of the efficacy of carbamazepine and the novel anti-epileptic drug levetiracetam in the tetanus toxin model of focal complex partial epilepsy

    PubMed Central

    Doheny, H C; Whittington, M A; Jefferys, J G R; Patsalos, P N

    2002-01-01

    The tetanus toxin seizure model, which is associated with spontaneous and intermittent generalized and non-generalized seizures, is considered to reflect human complex partial epilepsy. The purpose of the present study was to investigate and compare the anticonvulsant effects of carbamazepine with that of levetiracetam, a new anti-epileptic drug in this model. One μl of tetanus toxin solution (containing 12 mLD50 μl−1 of tetanus toxin) was placed stereotactically into the rat left hippocampus resulting in generalized and non-generalized seizures. Carbamazepine (4 mg kg−1 h−1) and levetiracetam (8 and 16 mg kg−1 h−1) were administered during a 7 day period via an osmotic minipump which was placed in the peritoneal cavity. Carbamazepine (4 mg kg−1 h−1) exhibited no significant anticonvulsant effect, compared to control, when the entire 7 day study period was evaluated but the reduction in generalized seizures was greater (35.5%) than that for non-generalized seizures (12.6%). However, during the first 2 days of carbamazepine administration a significant reduction in both generalized seizure frequency (90%) and duration (25%) was observed. Non-generalized seizures were unaffected. This time-dependent anticonvulsant effect exactly paralleled the central (CSF) and peripheral (serum) kinetics of carbamazepine in that steady-state concentrations declined over time, with the highest concentrations achieved during the first 2 days. Also there was a significant 27.3% reduction in duration of generalized seizures during the 7 day study period (P=0.0001). Levetiracetam administration (8 and 16 mg kg−1 h−1) was associated with a dose-dependent reduction in the frequency of both generalized (39 v 57%) and non-generalized (36 v 41%) seizures. However, seizure suppression was more substantial for generalized seizures. Also a significant dose-dependent reduction in overall generalized seizure duration was observed. These data provide

  5. Preictal Dynamics of EEG Complexity in Intracranially Recorded Epileptic Seizure

    PubMed Central

    Bob, Petr; Roman, Robert; Svetlak, Miroslav; Kukleta, Miloslav; Chladek, Jan; Brazdil, Milan

    2014-01-01

    Abstract Recent findings suggest that neural complexity reflecting a number of independent processes in the brain may characterize typical changes during epileptic seizures and may enable to describe preictal dynamics. With respect to previously reported findings suggesting specific changes in neural complexity during preictal period, we have used measure of pointwise correlation dimension (PD2) as a sensitive indicator of nonstationary changes in complexity of the electroencephalogram (EEG) signal. Although this measure of complexity in epileptic patients was previously reported by Feucht et al (Applications of correlation dimension and pointwise dimension for non-linear topographical analysis of focal onset seizures. Med Biol Comput. 1999;37:208–217), it was not used to study changes in preictal dynamics. With this aim to study preictal changes of EEG complexity, we have examined signals from 11 multicontact depth (intracerebral) EEG electrodes located in 108 cortical and subcortical brain sites, and from 3 scalp EEG electrodes in a patient with intractable epilepsy, who underwent preoperative evaluation before epilepsy surgery. From those 108 EEG contacts, records related to 44 electrode contacts implanted into lesional structures and white matter were not included into the experimental analysis. The results show that in comparison to interictal period (at about 8–6 minutes before seizure onset), there was a statistically significant decrease in PD2 complexity in the preictal period at about 2 minutes before seizure onset in all 64 intracranial channels localized in various brain sites that were included into the analysis and in 3 scalp EEG channels as well. Presented results suggest that using PD2 in EEG analysis may have significant implications for research of preictal dynamics and prediction of epileptic seizures. PMID:25415671

  6. The Contribution of Raised Intraneuronal Chloride to Epileptic Network Activity

    PubMed Central

    Alfonsa, Hannah; Merricks, Edward M.; Codadu, Neela K.; Cunningham, Mark O.; Deisseroth, Karl; Racca, Claudia

    2015-01-01

    Altered inhibitory function is an important facet of epileptic pathology. A key concept is that GABAergic activity can become excitatory if intraneuronal chloride rises. However, it has proved difficult to separate the role of raised chloride from other contributory factors in complex network phenomena, such as epileptic pathology. Therefore, we asked what patterns of activity are associated with chloride dysregulation by making novel use of Halorhodopsin to load clusters of mouse pyramidal cells artificially with Cl−. Brief (1–10 s) activation of Halorhodopsin caused substantial positive shifts in the GABAergic reversal potential that were proportional to the charge transfer during the illumination and in adult neocortical pyramidal neurons decayed with a time constant of τ = 8.0 ± 2.8s. At the network level, these positive shifts in EGABA produced a transient rise in network excitability, with many distinctive features of epileptic foci, including high-frequency oscillations with evidence of out-of-phase firing (Ibarz et al., 2010). We show how such firing patterns can arise from quite small shifts in the mean intracellular Cl− level, within heterogeneous neuronal populations. Notably, however, chloride loading by itself did not trigger full ictal events, even with additional electrical stimulation to the underlying white matter. In contrast, when performed in combination with low, subepileptic levels of 4-aminopyridine, Halorhodopsin activation rapidly induced full ictal activity. These results suggest that chloride loading has at most an adjunctive role in ictogenesis. Our simulations also show how chloride loading can affect the jitter of action potential timing associated with imminent recruitment to an ictal event (Netoff and Schiff, 2002). PMID:25995461

  7. Perirhinal Cortex Hyperexcitability in Pilocarpine-Treated Epileptic Rats

    PubMed Central

    Benini, Ruba; Longo, Daniela; Biagini, Giuseppe; Avoli, Massimo

    2016-01-01

    The perirhinal cortex (PC), which is heavily connected with several epileptogenic regions of the limbic system such as the entorhinal cortex and amygdala, is involved in the generation and spread of seizures. However, the functional alterations occurring within an epileptic PC network are unknown. Here, we analyzed this issue by using in vitro electrophysiology and immunohistochemistry in brain tissue obtained from pilocarpine-treated epileptic rats and age-matched, nonepileptic controls (NECs). Neurons recorded intracellularly from the PC deep layers in the two experimental groups had similar intrinsic and firing properties and generated spontaneous depolarizing and hyperpolarizing postsynaptic potentials with comparable duration and amplitude. However, spontaneous and stimulus-induced epileptiform discharges were seen with field potential recordings in over one-fifth of pilocarpine-treated slices but never in NEC tissue. These network events were reduced in duration by antagonizing NMDA receptors and abolished by NMDA + non-NMDA glutamatergic receptor antagonists. Pharmacologically isolated isolated inhibitory postsynaptic potentials had reversal potentials for the early GABAA receptor-mediated component that were significantly more depolarized in pilocarpine-treated cells. Experiments with a potassium-chloride cotransporter 2 antibody identified, in pilocarpine-treated PC, a significant immunostaining decrease that could not be explained by neuronal loss. However, interneurons expressing parvalbumin and neuropeptide Y were found to be decreased throughout the PC, whereas cholecystokinin-positive cells were diminished in superficial layers. These findings demonstrate synaptic hyper-excitability that is contributed by attenuated inhibition in the PC of pilocarpine-treated epileptic rats and underscore the role of PC networks in temporal lobe epilepsy. PMID:20865722

  8. Analysis of resting noise characteristics of three EIT systems in order to compare suitability for time difference imaging with scalp electrodes during epileptic seizures.

    PubMed

    Fabrizi, L; McEwan, A; Woo, E; Holder, D S

    2007-07-01

    Electrical impedance tomography measurements in clinical applications are limited by an undesired noise component. We have investigated the noise in three systems suitable for imaging epileptic seizures, the UCH Mark1b, UCH Mark2.5 and KHU Mark1 16 channel, at applied frequencies in three steps from 1 to 100 kHz, by varying load impedance, single terminal or multiplexed measurements, and in test objects of increasing complexity from a resistor to a saline filled tank and human volunteer. The noise was white, and increased from about 0.03% rms on the resistor to 0.08% on the human; it increased with load but was independent of use of the multiplexer. The KHU Mark1 delivered the best performance with noise spectra of about 0.02%, which could be further reduced by averaging to a level where reliable imaging of changes of about 0.1% estimated during epileptic seizures appears plausible.

  9. Hippocampus Is Place of Interaction between Unconscious and Conscious Memories

    PubMed Central

    Züst, Marc Alain; Colella, Patrizio; Reber, Thomas Peter; Vuilleumier, Patrik; Hauf, Martinus; Ruch, Simon; Henke, Katharina

    2015-01-01

    Recent evidence suggests that humans can form and later retrieve new semantic relations unconsciously by way of hippocampus—the key structure also recruited for conscious relational (episodic) memory. If the hippocampus subserves both conscious and unconscious relational encoding/retrieval, one would expect the hippocampus to be place of unconscious-conscious interactions during memory retrieval. We tested this hypothesis in an fMRI experiment probing the interaction between the unconscious and conscious retrieval of face-associated information. For the establishment of unconscious relational memories, we presented subliminal (masked) combinations of unfamiliar faces and written occupations (“actor” or “politician”). At test, we presented the former subliminal faces, but now supraliminally, as cues for the reactivation of the unconsciously associated occupations. We hypothesized that unconscious reactivation of the associated occupation—actor or politician—would facilitate or inhibit the subsequent conscious retrieval of a celebrity’s occupation, which was also actor or politician. Depending on whether the reactivated unconscious occupation was congruent or incongruent to the celebrity’s occupation, we expected either quicker or delayed conscious retrieval process. Conscious retrieval was quicker in the congruent relative to a neutral baseline condition but not delayed in the incongruent condition. fMRI data collected during subliminal face-occupation encoding confirmed previous evidence that the hippocampus was interacting with neocortical storage sites of semantic knowledge to support relational encoding. fMRI data collected at test revealed that the facilitated conscious retrieval was paralleled by deactivations in the hippocampus and neocortical storage sites of semantic knowledge. We assume that the unconscious reactivation has pre-activated overlapping relational representations in the hippocampus reducing the neural effort for conscious

  10. Mitochondrial dysfunction in neurological disorders with epileptic phenotypes.

    PubMed

    Zsurka, Gábor; Kunz, Wolfram S

    2010-12-01

    A broad variety of mutations of the mitochondrial DNA or nuclear genes that lead to the impairment of mitochondrial respiratory chain or mitochondrial ATP synthesis have been associated with epileptic phenotypes. Additionally, evidence for an impaired mitochondrial function in seizure focus of patients with temporal lobe epilepsy and Ammon's horn sclerosis, as well as, animal models of temporal lobe epilepsy has been accumulated. This implies a direct pathogenic role of mitochondrial dysfunction in the process of epileptogenesis and seizure generation in certain forms of epilepsy.

  11. Metabotropic glutamate receptor 5 in Down's syndrome hippocampus during development: increased expression in astrocytes.

    PubMed

    Iyer, A M; van Scheppingen, J; Milenkovic, I; Anink, J J; Lim, D; Genazzani, A A; Adle-Biassette, H; Kovacs, G G; Aronica, E

    2014-01-01

    Metabotropic glutamate receptor 5 (mGluR5) is highly expressed throughout the forebrain and hippocampus. Several lines of evidence support the role of this receptor in brain development and developmental disorders, as well as in neurodegenerative disorders like Alzheimer's disease (AD). In the present study, the expression pattern of mGluR5 was investigated by immunocytochemistry in the developing hippocampus from patients with Down's syndrome (DS) and in adults with DS and AD. mGluR5 was expressed in developing human hippocampus from the earliest stages tested (9 gestational weeks), with strong expression in the ventricular/subventricular zones. We observed a consistent similar temporal and spatial neuronal pattern of expression in DS hippocampus. However, in DS we detected increased prenatal mGluR5 expression in white matter astrocytes, which persisted postnatally. In addition, in adult DS patients with widespread ADassociated neurodegeneration (DS-AD) increased mGluR5 expression was detected in astrocytes around amyloid plaque. In vitro data confirm the existence of a modulatory crosstalk between amyloid-β and mGluR5 in human astrocytes. These findings demonstrate a developmental regulation of mGluR5 in human hippocampus and suggest a role for this receptor in astrocytes during early development in DS hippocampus, as well as a potential contribution to the pathogenesis of ADassociated pathology.

  12. [Multicystic encephalopathy with frontal lobe-originated gelastic seizure, ipsilateral oculogyric crisis, and horizontal epileptic nystagmus: an autopsy case].

    PubMed

    Ohara, K; Morita, Y; Takauchi, S; Takeda, T; Hayashi, S

    1996-08-01

    Attacks of gelastic (laughing) seizure are usually reported as complex partial seizures of temporal lobe epilepsy and seizures associated with hypothalamic hamartomas, but are rarely reported as complex partial seizures of frontal lobe origin. We recently encountered a 29-year-old woman who had gelastic seizure attacks from age 17. She had shown severe mental retardation with cerebral palsy at 7 months, and entered precocious puberty at age 7. Attacks of gelastic seizure with ipsilateral adversive seizures, ipsilateral oculogyric crisis, and horizontal epileptic nystagmus were observed until her death at age 29. Each gelastic seizure lasted 1 to 10 minutes. Her laughing was very strong and loud. Interictal spikes were observed over the right fronto-parietal lobe, but no ictal spike was detected. The neuropathological examinations of her brain revealed no hypothalamic lesions such as hamartomas, gliosis, and distinct neuronal loss. Her brain was severely affected with multicystic encephalopathy, and the bilateral temporal lobe tissues were almost replaced by the cystic changes. The right frontal lobe and occipital lobe were not cystic. From the clinicopathological examinations, the focus of her gelastic seizure was considered to be of the right frontal origin. The hippocampus and parahippocampal gyrus are major components of the limbic system, which is involved in affective emotions. Although the right hippocampus and parahippocampal gyrus were completely lost, and those of the left hemisphere were almost completely lost, by the multicystic replacements in this case, the gelastic seizure attacks were evoked from right frontal origin. The frontal lobe may play an important role in motor expressions of laughing. The motor expressions of the loud and strong laughing may be one of the characteristic features of frontal lobe-originated gelastic seizure of this case.

  13. Hippocampal cell loss and propagation of abnormal discharges accompanied with the expression of tonic convulsion in the spontaneously epileptic rat.

    PubMed

    Hanaya, Ryosuke; Sasa, Masashi; Sugata, Sei; Tokudome, Mai; Serikawa, Tadao; Kurisu, Kaoru; Arita, Kazunori

    2010-04-30

    Spontaneously epileptic rats (SER) are double mutants with both tonic convulsion and absence-like seizures from the age of 8 weeks. Hippocampal CA3 neurons in SER display a long-lasting depolarizing shift accompanied by repetitive firing (attributed to abnormalities of the Ca(2+) channels) with a single stimulation of the mossy fibers. In the present investigation, we examined if the seizure discharges of SER were correlated with the hippocampal abnormality of SER using electrophysiological and histological methods. In CA1 neurons of seizure-susceptible mature SER, higher-voltage (<8-11 V) stimulations induced a long depolarization shift (in 25% of neurons) with repetitive firing (in 12.5% of neurons). However, the tremor rat, one of the parent strains of SER, did not exhibit such abnormal firing in the CA3 region of the hippocampus. The number of CA3 neurons in SER was significantly (p<0.01) lower than that in tremor rats and Wistar rats, although no significant difference was established in the hilus. Sprouting of mossy fiber was observed in the dentate of mature SER; however, negligible staining was spotted in the dentate of both mature tremor and Wistar rats. Interestingly, expression of the brain-derived neurotrophic factor was higher in the hilus, CA3, and granular cell layer of dentate gyrus in SER than normal Wistar rats. The expression levels of TUNEL, bax, and Caspase-3 did not show significant changes between the SER and Wistar rats. SER exhibited hippocampal sclerosis-like changes which did not have enough potential for epileptogenesis. Repetitive tonic seizures and vulnerable CA3 neurons of SER could be involved in the induction of sclerosis-like changes in the hippocampus.

  14. [The influence of epileptic predisposition on clinical features of schizophrenia in patients after delirium tremens].

    PubMed

    Dvirskiĭ, A A

    2001-01-01

    153 patients with schizophrenia in combination with alcoholic delirium were examined. Latent epilepsy has been found in 36 patients (23.5%). The basis of the epileptic seizures during alcoholic delirium was hereditary epileptic predisposition. Frequency of the progredient course was high while that of the favourable--recurrent course of schizophrenia was low in these cases.

  15. Selective changes in inhibition as determinants for limited hyperexcitability in the insular cortex of epileptic rats

    PubMed Central

    Bortel, Aleksandra; Longo, Daniela; de Guzman, Philip; Dubeau, François; Biagini, Giuseppe; Avoli, Massimo

    2016-01-01

    The insular cortex (IC) is involved in the generalization of epileptic discharges in temporal lobe epilepsy (TLE), whereas seizures originating in the IC can mimic the epileptic phenotype seen in some patients with TLE. However, few studies have addressed the changes occurring in the IC in TLE animal models. Here, we analyzed the immunohistochemical and electrophysiological properties of IC networks in non-epileptic control and pilocarpine-treated epileptic rats. Neurons identified with a neuron-specific nuclear protein antibody showed similar counts in the two types of tissue but parvalbumin- and neuropeptide Y-positive interneurons were significantly decreased (parvalbumin, approximately −35%; neuropeptide Y, approximately −38%; P < 0.01) in the epileptic IC. Nonadapting neurons were seen more frequently in the epileptic IC during intracellular injection of depolarizing current pulses. In addition, single-shock electrical stimuli elicited network-driven epileptiform responses in 87% of epileptic and 22% of non-epileptic control neurons (P < 0.01) but spontaneous postsynaptic potentials had similar amplitude, duration and intervals of occurrence in the two groups. Finally, pharmacologically isolated, GABAA receptor-mediated inhibitory postsynaptic potentials had more negative reversal potential (P < 0.01) and higher peak conductance (P < 0.05) in epileptic tissue. These data reveal moderate increased network excitability in the IC of pilocarpine-treated epileptic rats. We propose that this limited degree of hyperexcitability originates from the loss of parvalbumin- and neuropeptide Y-positive interneurons that is compensated by an increased drive for GABAA receptor-mediated inhibition. PMID:20497472

  16. Epileptic Neuronal Networks: Methods of Identification and Clinical Relevance

    PubMed Central

    Stefan, Hermann; Lopes da Silva, Fernando H.

    2012-01-01

    The main objective of this paper is to examine evidence for the concept that epileptic activity should be envisaged in terms of functional connectivity and dynamics of neuronal networks. Basic concepts regarding structure and dynamics of neuronal networks are briefly described. Particular attention is given to approaches that are derived, or related, to the concept of causality, as formulated by Granger. Linear and non-linear methodologies aiming at characterizing the dynamics of neuronal networks applied to EEG/MEG and combined EEG/fMRI signals in epilepsy are critically reviewed. The relevance of functional dynamical analysis of neuronal networks with respect to clinical queries in focal cortical dysplasias, temporal lobe epilepsies, and “generalized” epilepsies is emphasized. In the light of the concepts of epileptic neuronal networks, and recent experimental findings, the dichotomic classification in focal and generalized epilepsy is re-evaluated. It is proposed that so-called “generalized epilepsies,” such as absence seizures, are actually fast spreading epilepsies, the onset of which can be tracked down to particular neuronal networks using appropriate network analysis. Finally new approaches to delineate epileptogenic networks are discussed. PMID:23532203

  17. The quantitative measurement of consciousness during epileptic seizures.

    PubMed

    Nani, Andrea; Cavanna, Andrea E

    2014-01-01

    The assessment of consciousness is a fundamental element in the classification of epileptic seizures. It is, therefore, of great importance for clinical practice to develop instruments that enable an accurate and reliable measurement of the alteration of consciousness during seizures. Over the last few years, three psychometric scales have been specifically proposed to measure ictal consciousness: the Ictal Consciousness Inventory (ICI), the Consciousness Seizure Scale (CSS), and the Responsiveness in Epilepsy Scale--versions I and II (RES-I and RES-II). The ICI is a self-report psychometric instrument which retrospectively assesses ictal consciousness along the dimensions of the level/arousal and contents/awareness. The CSS has been used by clinicians to quantify the impairment of consciousness in order to establish correlations with the brain mechanisms underlying alterations of consciousness during temporal lobe seizures. The most recently developed observer-rated instrument is the RES-I, which has been used to assess responsiveness during epileptic seizures in patients undergoing video-EEG. The implementation of standardized psychometric tools for the assessment of ictal consciousness can complement clinical observations and contribute to improve accuracy in seizure classification.

  18. Neuroimaging and spectroscopy in children with epileptic encephalopathies

    PubMed Central

    Parker, A.; Ferrie, C.; Keevil, S.; Newbold, M.; Cox, T.; Maisey, M.; Robinson, R.

    1998-01-01

    AIMS—To investigate the nature of the unifocal cortical abnormalities on FDG positron emission tomography (PET) in children with an epileptic encephalopathy but no focal abnormality on electroencephalogram or standard magnetic resonance imaging (MRI).
METHODS—Repeat FDG PET, surface rendered high resolution MRI, and single voxel magnetic resonance proton spectroscopy of the areas of abnormal metabolism compared to the contralateral side in 11children aged 2 to 12 years. Imaging was repeated after a median of 13months.
RESULTS—Visual analysis of repeat FDG PET revealed similar abnormalities in 10 of 11 children. Semiquantitative analysis revealed similar sited abnormalities in eight children. One child with ictal hypermetabolism initially had an inconsistent second scan. Magnetic resonance spectra in three children showed the N-acetylaspartate/choline ratio was lower in the hypometabolic focus than in the reciprocal area on the opposite side, in two children it was higher, and in one child it was equal. Surface rendered MRI was normal in seven of eight children, and showed temporal lobe asymmetry in one.
CONCLUSION—In children with established epileptic encephalopathies most hypometabolic areas on FDG PET are stable over time. While focal neuronal loss is likely in these areas in some children, microdysplasias or other focal cortical dysplasias are probable in others.

 PMID:9771250

  19. Stimulus-induced reflex epileptic spasms in 5p- syndrome.

    PubMed

    Shirai, Kentaro; Saito, Yoshiaki; Yokoyama, Atushi; Nishimura, Yoko; Tamasaki, Akiko; Maegaki, Yoshihiro

    2016-02-01

    Here we describe two patients with 5p- syndrome who suffered from epilepsy characterised by stimulus-induced epileptic spasms manifesting as head nodding. In patient 1, a series of spasms were exclusively triggered by eating, and were associated with diffuse high-voltage slow waves on ictal EEG, particularly presenting as a positive slow potential at the left mid-temporal area. Clusters of sharp waves with negative polarity emerged in the same area during the inter-spasm periods during eating. In patient 2, spasms were provoked by either eating or micturition. Ictal EEG of clustered spasms after micturition showed positive slow or triphasic waves, which correlated with each spasm, over the bifrontal and vertex areas. These findings suggest that the focal cortical areas act as trigger regions in reflex epilepsies, and that a spasm-generator responsible for the execution of reflex spasms exists either in other cortical areas or in the subcortical structures. Although epilepsy is an unusual complication of 5p- syndrome, this syndrome may have a propensity to develop reflex epilepsy, particularly epileptic spasms. However, identification of responsible genes and their roles in this phenotype requires further investigations.

  20. Characterization of ictal slow waves in epileptic spasms.

    PubMed

    Honda, Ryoko; Saito, Yoshiaki; Okumura, Akihisa; Abe, Shinpei; Saito, Takashi; Nakagawa, Eiji; Sugai, Kenji; Sasaki, Masayuki

    2015-12-01

    We characterized the clinico-neurophysiological features of epileptic spasms, particularly focusing on high-voltage slow waves during ictal EEG. We studied 22 patients with epileptic spasms recorded during digital video-scalp EEG, including five individuals who still had persistent spasms after callosotomy. We analysed the duration, amplitude, latency to onset of electromyographic bursts, and distribution of the highest positive and negative peaks of slow waves in 352 spasms. High-voltage positive slow waves preceded the identifiable muscle contractions of spasms. The mean duration of these positive waves was 569±228 m, and the mean latency to electromyographic onset was 182±127 m. These parameters varied markedly even within a patient. The highest peak of the positive component was distributed in variable regions, which was not consistent with the location of lesions on MRI. The peak of the negative component following the positivity was distributed in the neighbouring or opposite areas of the positive peak distribution. No changes were evident in the pre- or post-surgical distributions of the positive peak, or in the interhemispheric delay between both hemispheres, in individuals with callosotomy. Our data imply that ictal positive slow waves are the most common EEG changes during spasms associated with a massive motor component. Plausible explanations for these widespread positive slow waves include the notion that EEG changes possibly reflect involvement of both cortical and subcortical structures.

  1. Unexplained early onset epileptic encephalopathy: Exome screening and phenotype expansion.

    PubMed

    Allen, Nicholas M; Conroy, Judith; Shahwan, Amre; Lynch, Bryan; Correa, Raony G; Pena, Sergio D J; McCreary, Dara; Magalhães, Tiago R; Ennis, Sean; Lynch, Sally A; King, Mary D

    2016-01-01

    Early onset epileptic encephalopathies (EOEEs) represent a significant diagnostic challenge. Newer genomic approaches have begun to elucidate an increasing number of responsible single genes as well as emerging diagnostic strategies. In this single-center study, we aimed to investigate a cohort of children with unexplained EOEE. We performed whole-exome sequencing (WES), targeting a list of 137 epilepsy-associated genes on 50 children with unexplained EOEE. We characterized all phenotypes in detail and classified children according to known electroclinical syndromes where possible. Infants with previous genetic diagnoses, causative brain malformations, or inborn errors of metabolism were excluded. We identified disease-causing variants in 11 children (22%) in the following genes: STXBP1 (n = 3), KCNB1 (n = 2), KCNT1, SCN1A, SCN2A, GRIN2A, DNM1, and KCNA2. We also identified two further variants (in GRIA3 and CPA6) in two children requiring further investigation. Eleven variants were de novo, and in one paternal testing was not possible. Phenotypes were broadened for some variants identified. This study demonstrates that WES is a clinically useful screening tool for previously investigated unexplained EOEE and allows for reanalysis of data as new genes are being discovered. Detailed phenotyping allows for expansion of specific gene disorders leading to epileptic encephalopathy and emerging sub-phenotypes.

  2. Epileptic activity in Alzheimer's disease: causes and clinical relevance.

    PubMed

    Vossel, Keith A; Tartaglia, Maria C; Nygaard, Haakon B; Zeman, Adam Z; Miller, Bruce L

    2017-04-01

    Epileptic activity is frequently associated with Alzheimer's disease; this association has therapeutic implications, because epileptic activity can occur at early disease stages and might contribute to pathogenesis. In clinical practice, seizures in patients with Alzheimer's disease can easily go unrecognised because they usually present as non-motor seizures, and can overlap with other symptoms of the disease. In patients with Alzheimer's disease, seizures can hasten cognitive decline, highlighting the clinical relevance of early recognition and treatment. Some evidence indicates that subclinical epileptiform activity in patients with Alzheimer's disease, detected by extended neurophysiological monitoring, can also lead to accelerated cognitive decline. Treatment of clinical seizures in patients with Alzheimer's disease with select antiepileptic drugs (AEDs), in low doses, is usually well tolerated and efficacious. Moreover, studies in mouse models of Alzheimer's disease suggest that certain classes of AEDs that reduce network hyperexcitability have disease-modifying properties. These AEDs target mechanisms of epileptogenesis involving amyloid β and tau. Clinical trials targeting network hyperexcitability in patients with Alzheimer's disease will identify whether AEDs or related strategies could improve their cognitive symptoms or slow decline.

  3. Epileptic and nonepileptic paroxysmal events out of sleep in children.

    PubMed

    Vendrame, Martina; Kothare, Sanjeev V

    2011-04-01

    The distinction between epileptic and nonepileptic events out of sleep may represent a significant challenge to the pediatrician. It is known that sleep can facilitate epileptic activity and that seizures in sleep tend to occur during specific sleep stages. Certain epilepsy syndromes have a well-documented and strong association with sleep and these can present with a variety of bizarre behaviors and motor activity. Disorders that may present with nocturnal nonepileptic paroxysmal events may include not only sleep-related disorders per se but also psychiatric/behavioral conditions"benign" paroxysmal phenomena with unrelated etiology, and nonneurologic disorders. These phenomena, especially when involving complex motor activity, such as that observed in parasomnias, nocturnal panic attacks, and rapid eye movement behavior disorders may be difficult to differentiate from seizures. Moreover, there is increasing awareness that certain sleep disorders, such as sleep-disordered breathing, may coexist with epilepsy. There are several clinical and electrographical features that allow an accurate diagnosis, and diagnostic tools such as video-EEG polysomnography may be essential.

  4. Coexistence of Epileptic Nocturnal Wanderings and an Arachnoid Cyst

    PubMed Central

    Jiménez-Genchi, Alejandro; Díaz-Galviz, John L.; García-Reyna, Juan Carlos; Ávila-Ordoñez, Mario U.

    2007-01-01

    Episodic nocturnal wanderings (ENWs) have rarely been associated with gross abnormalities of brain structures. We describe the case of a patient with ENWs in coexistence with an arachnoid cyst (AC). The patient was a 15-year-old boy who presented with nocturnal attacks characterized by complex motor behaviors. An MRI revealed a left temporal cyst and a SPECT Tc99 scan showed left temporal hypoperfusion and bilateral frontal hyperperfusion, more evident on the right side. During an all-night polysomnographic recording with audiovisual monitoring, dystonic posture followed by sleepwalking-like behavior was documented. The sleepwalking-like behavior was preceded by a spike discharge over the left frontocentral region with contralateral projection and secondary generalization during stage 2 sleep. Treatment with levetiracetam produced a striking remission of seizures. This supports a conservative management of an AC, considering that it may be an incidental finding. In epileptic patients, an AC may not necessarily be related to the location of the seizure focus. Citation: Jiménez-Genchi A; Díaz-Galviz JL; García-Reyna JC et al. Coexistence of epileptic nocturnal wanderings and an arachnoid cyst. J Clin Sleep Med 2007;3(4):399-401. PMID:17694730

  5. Epileptic neuronal networks: methods of identification and clinical relevance.

    PubMed

    Stefan, Hermann; Lopes da Silva, Fernando H

    2013-01-01

    The main objective of this paper is to examine evidence for the concept that epileptic activity should be envisaged in terms of functional connectivity and dynamics of neuronal networks. Basic concepts regarding structure and dynamics of neuronal networks are briefly described. Particular attention is given to approaches that are derived, or related, to the concept of causality, as formulated by Granger. Linear and non-linear methodologies aiming at characterizing the dynamics of neuronal networks applied to EEG/MEG and combined EEG/fMRI signals in epilepsy are critically reviewed. The relevance of functional dynamical analysis of neuronal networks with respect to clinical queries in focal cortical dysplasias, temporal lobe epilepsies, and "generalized" epilepsies is emphasized. In the light of the concepts of epileptic neuronal networks, and recent experimental findings, the dichotomic classification in focal and generalized epilepsy is re-evaluated. It is proposed that so-called "generalized epilepsies," such as absence seizures, are actually fast spreading epilepsies, the onset of which can be tracked down to particular neuronal networks using appropriate network analysis. Finally new approaches to delineate epileptogenic networks are discussed.

  6. Ethanol neurobehavioural teratogenesis and the role of L-glutamate in the fetal hippocampus.

    PubMed

    Reynolds, J D; Brien, J F

    1995-09-01

    The purpose of this article is to review the current state of knowledge of ethanol neurobehavioural teratogenesis and its postulated mechanisms. The review comprises an examination of ethanol teratogenesis in the human, including the fetal alcohol syndrome, and in experimental animals. Several current proposed mechanisms of ethanol neurobehavioural teratogenesis are critically assessed, including the role of acetaldehyde as the proximate metabolite of ethanol; fetal hypoxia; placental dysfunction; fetal prostaglandin metabolism; and action of ethanol on developing neurons in the fetal brain, including the hippocampus, one of ethanol's main target sites. The effect of ethanol on the release of L-glutamate, an excitatory amino acid neurotransmitter, in the fetal hippocampus is described, and the role of L-glutamate in ethanol teratogenesis involving the hippocampus is discussed. A novel mechanism for abnormal neuronal development in the fetal hippocampus produced by prenatal ethanol exposure is presented, and future experiments to test this hypothesis are proposed.

  7. Hippocampus shape analysis for temporal lobe epilepsy detection in magnetic resonance imaging

    NASA Astrophysics Data System (ADS)

    Kohan, Zohreh; Azmi, Reza

    2016-03-01

    There are evidences in the literature that Temporal Lobe Epilepsy (TLE) causes some lateralized atrophy and deformation on hippocampus and other substructures of the brain. Magnetic Resonance Imaging (MRI), due to high-contrast soft tissue imaging, is one of the most popular imaging modalities being used in TLE diagnosis and treatment procedures. Using an algorithm to help clinicians for better and more effective shape deformations analysis could improve the diagnosis and treatment of the disease. In this project our purpose is to design, implement and test a classification algorithm for MRIs based on hippocampal asymmetry detection using shape and size-based features. Our method consisted of two main parts; (1) shape feature extraction, and (2) image classification. We tested 11 different shape and size features and selected four of them that detect the asymmetry in hippocampus significantly in a randomly selected subset of the dataset. Then, we employed a support vector machine (SVM) classifier to classify the remaining images of the dataset to normal and epileptic images using our selected features. The dataset contains 25 patient images in which 12 cases were used as a training set and the rest 13 cases for testing the performance of classifier. We measured accuracy, specificity and sensitivity of, respectively, 76%, 100%, and 70% for our algorithm. The preliminary results show that using shape and size features for detecting hippocampal asymmetry could be helpful in TLE diagnosis in MRI.

  8. Prediction, sequences and the hippocampus

    PubMed Central

    Lisman, John; Redish, A.D.

    2009-01-01

    Recordings of rat hippocampal place cells have provided information about how the hippocampus retrieves memory sequences. One line of evidence has to do with phase precession, a process organized by theta and gamma oscillations. This precession can be interpreted as the cued prediction of the sequence of upcoming positions. In support of this interpretation, experiments in two-dimensional environments and on a cue-rich linear track demonstrate that many cells represent a position ahead of the animal and that this position is the same irrespective of which direction the rat is coming from. Other lines of investigation have demonstrated that such predictive processes also occur in the non-spatial domain and that retrieval can be internally or externally cued. The mechanism of sequence retrieval and the usefulness of this retrieval to guide behaviour are discussed. PMID:19528000

  9. The ketogenic diet can be used successfully in combination with corticosteroids for epileptic encephalopathies.

    PubMed

    Ville, Dorothée; Chiron, Catherine; Laschet, Jacques; Dulac, Olivier

    2015-07-01

    Hormonal therapy or ketogenic diet often permits overcoming the challenging periods of many epileptic encephalopathies (West and Lennox-Gastaut syndromes and encephalopathy with continuous spike-waves in slow sleep), but relapse affects over 20% of patients. We report here a monocenter pilot series of 42 consecutive patients in whom we combined oral steroids with the ketogenic diet for corticosteroid-resistant or -dependent epileptic encephalopathy. We retrospectively evaluated the effect on seizure frequency, interictal spike activity, neuropsychological course, and steroid treatment course. Twenty-three patients had West syndrome (WS), 13 had encephalopathy with continuous spike-waves in slow sleep (CSWS), and six others had miscellaneous epileptic encephalopathies. All patients succeeded to reach 0.8 to 1.6g/l ketone bodies in the urine following the usual KD regimen. For at least 6 months, 14/42 responded to the addition of the ketogenic diet: 4/23 with WS, 8/13 with CSWS, and 2/6 with miscellaneous epileptic encephalopathies. The addition of the KD allowed withdrawing steroids in all responders. Among them, 10/15 had been patients with steroid-dependent epileptic encephalopathy and 4/27 patients with steroid-resistant epileptic encephalopathy. Therefore, the ketogenic diet can be used successfully in combination with corticosteroids for epileptic encephalopathies. Patients presenting with steroid-dependent CSWS seem to be the best candidates.

  10. Positive associations among dichotic listening errors, complex partial epileptic-like signs, and paranormal beliefs.

    PubMed

    Skirda, R J; Persinger, M A

    1993-11-01

    The numbers of complex partial epileptic-like signs were moderately (rs = .50) associated with strength of paranormal beliefs but not conservative (religious) beliefs in a population of young males and females (13 to 20 years). Dichotic listening errors were also significantly correlated with both complex partial epileptic-like signs and paranormal, but not conservative, beliefs; the females demonstrated the strongest intercorrelations (rs between .54 and .63). These results support the hypotheses that dichotic listening errors reflect a continuum of complex partial epileptic phenomenology in the normal population and this process encourages the acquisition of paranormal but not traditional beliefs.

  11. New clinical findings on the longevity gene in disease, health, & longevity: Sirtuin 1 often decreases with advanced age & serious diseases in most parts of the human body, while relatively high & constant Sirtuin 1 regardless of age was first found in the hippocampus of supercentenarians.

    PubMed

    Omura, Yoshiaki; Lu, Dominic P; Jones, Marilyn; O'Young, Brian; Duvvi, Harsha; Paluch, Kamila; Shimotsuura, Yasuhiro; Ohki, Motomu

    2011-01-01

    The expression of the longevity gene, Sirtuin 1, was non-invasively measured using Electro-Magnetic Field (EMF) resonance phenomenon between a known amount of polyclonal antibody of the C-terminal of Sirtuin 1 & Sirtuin 1 molecule inside of the body. Our measurement of over 100 human adult males and females, ranging between 20-122 years old, indicated that the majority of subjects had Sirtuin 1 levels of 5-10 pg BDORT units in most parts of the body. When Sirtuin 1 was less than 1 pg, the majority of the people had various degrees of tumors or other serious diseases. When Sirtuin 1 levels were less than 0.25 pg BDORT units, a high incidence of AIDS was also detected. Very few people had Sirtuin 1 levels of over 25 pg BDORT units in most parts of the body. We selected 7 internationally recognized supercentenarians who lived between 110-122 years old. To our surprise, most of their body Sirtuin 1 levels were between 2.5-10 pg BDORT units. However, by evaluating different parts of the brain, we found that both sides of the Hippocampus had a much higher amount of Sirtuin 1, between 25-100 pg BDORT units. With most subjects, Sirtuin 1 was found to be higher in the Hippocampus than in the rest of the body and remains relatively constant regardless of age. We found that Aspartame, plastic eye contact lenses, and asbestos in dental apparatuses, which reduce normal cell telomeres, also significantly reduce Sirtuin 1. In addition, we found that increasing normal cell telomere by electrical or mechanical stimulation of True ST-36 increases the expression of the Sirtuin 1 gene in people in which expression is low. This measurement of Sirtuin 1 in the Hippocampus has become a reliable indicator for detecting potential longevity of an individual.

  12. Change of seizure frequency in pregnant epileptic women.

    PubMed Central

    Schmidt, D; Canger, R; Avanzini, G; Battino, D; Cusi, C; Beck-Mannagetta, G; Koch, S; Rating, D; Janz, D

    1983-01-01

    The effect of pregnancy on seizure frequency was monitored prospectively in 136 pregnancies of 122 epileptic women. Pregnancy did not influence the seizure frequency in 68 pregnancies (50%). In 50 pregnancies (37%) the number of seizures increased during pregnancy or puerperium. The seizure frequency decreased in 18 pregnancies (13%). In 34 out of 50 pregnancies (68%) the increase was associated with non-compliance with the drug regimen or sleep deprivation. In seven out of 18 pregnancies (39%) improvement was related to correction of non-compliance or sleep deprivation during the pregestational nine months. Insufficiently low plasma concentrations of antiepileptic drugs were found in 47% of the women with uncontrolled epilepsy during pregnancy. The course of epilepsy during pregnancy is primarily influenced by non-compliance, sleep deprivation during pregnancy, and inadequate therapy before and during pregnancy. With good medical attention pregnancy itself seems to have only a minimal influence on the course of epilepsy. PMID:6411866

  13. [Preditive clinical factors for epileptic seizures after ischemic stroke].

    PubMed

    Fukujima, M M; Cardeal, J O; Lima, J G

    1996-06-01

    Preditive clinical factors for epileptic seizures after ischemic stroke. Clinical features of 35 patients with ischemic stroke who developed epilepsy (Group 1) were compared with those of 35 patients with ischemic stroke without epilepsy (Group 2). The age of the patients did not differ between the groups. There were more men than women and more white than other races in both groups. Diabetes melitus, hypertension, transient ischemic attack, previous stroke, migraine, Chagas disease, cerebral embolism of cardiac origin and use of oral contraceptive did not differ between the groups. Smokers and alcohol users were more frequent in Group 1 (p < 0.05). Most patients of Group 1 presented with hemiparesis; none presented cerebellar or brainstem involvement. Perhaps strokes in smokers have some different aspects, that let them more epileptogenic than in non smokers.

  14. Amplitude suppression and chaos control in epileptic EEG signals.

    PubMed

    Majumdar, Kaushik; Myers, Mark H

    2006-03-01

    In this paper we have proposed a novel amplitude suppression algorithm for EEG signals collected during epileptic seizure. Then we have proposed a measure of chaoticity for a chaotic signal, which is somewhat similar to measuring sensitive dependence on initial conditions by measuring Lyapunov exponent in a chaotic dynamical system. We have shown that with respect to this measure the amplitude suppression algorithm reduces chaoticity in a chaotic signal (EEG signal is chaotic). We have compared our measure with the estimated largest Lyapunov exponent measure by the largelyap function, which is similar to Wolf's algorithm. They fit closely for all but one of the cases. How the algorithm can help to improve patient specific dosage titration during vagus nerve stimulation therapy has been outlined.

  15. Pallister-Killian syndrome: an unusual cause of epileptic spasms.

    PubMed

    Sánchez-Carpintero, Rocio; McLellan, Ailsa; Parmeggiani, Lucio; Cockwell, Annette E; Ellis, Richard J; Cross, J Helen; Eckhardt, Susan; Guerrini, Renzo

    2005-11-01

    Pallister-Killian syndrome (PKS) is a rare, sporadic, genetic disorder characterized by dysmorphic features, learning disability, and epilepsy. It is caused by a mosaic supernumerary isochromosome 12p (i[12p]). The i(12p) is rarely found in peripheral blood but it is present in skin fibroblasts. Recognition is essential for cytogenetic diagnosis. We describe a male aged 2 years 6 months and a female aged 11 years with PKS and epileptic spasms (ES). This type of seizure is not unusual in patients with brain malformations and with severe developmental delay, but it is sometimes difficult to recognize without video-electroencephalogram studies and could be mistaken for other types of seizure or behavioural manifestations. In these two patients with PKS, spasms had late onset, persisted beyond infancy, and were drug resistant. Clinicians should be aware of this possibility in PKS, which appears to be a rare cause of ES.

  16. Resolution of epileptic encephalopathy following treatment with transdermal nicotine.

    PubMed

    Zerem, Ayelet; Nishri, Daniella; Yosef, Yael; Blumkin, Lubuv; Lev, Dorit; Leshinsky-Silver, Esther; Kivity, Sara; Lerman-Sagie, Tally

    2013-01-01

    We report resolution of an epileptic encephalopathy by administration of transdermal nicotine patches in an adolescent with severe nonlesional refractory frontal lobe epilepsy. The 18.5-year-old female patient had refractory epilepsy from the age of 11. Recurrent electroencephalography (EEG) recordings showed mostly generalized activity, albeit with right frontal predominance. Almost all antiepileptic medications failed to provide benefit. She developed an encephalopathic state with cognitive decline. The nonlesional frontal lobe epilepsy and a family history of a cousin with nocturnal epilepsy with frontal origin suggested genetic etiology. Transdermal nicotine patches brought complete resolution of the seizures, normalization of the EEG, and a significant improvement in her thinking process and speech organization. Sequencing of the CHRNB2 and CHRNA4 genes did not detect a mutation. Transdermal nicotine patches should be considered in severe pharmacoresistant frontal lobe epilepsy.

  17. Compulsive versifying after treatment of transient epileptic amnesia

    PubMed Central

    Woollacott, Ione O. C.; Fletcher, Phillip D.; Massey, Luke A.; Pasupathy, Amirtha; Rossor, Martin N.; Caine, Diana; Rohrer, Jonathan D.; Warren, Jason D.

    2015-01-01

    Compulsive production of verse is an unusual form of hypergraphia that has been reported mainly in patients with right temporal lobe seizures. We present a patient with transient epileptic amnesia and a left temporal seizure focus, who developed isolated compulsive versifying, producing multiple rhyming poems, following seizure cessation induced by lamotrigine. Functional neuroimaging studies in the healthy brain implicate left frontotemporal areas in generating novel verbal output and rhyme, while dysregulation of neocortical and limbic regions occurs in temporal lobe epilepsy. This case complements previous observations of emergence of altered behavior with reduced seizure frequency in patients with temporal lobe epilepsy. Such cases suggest that reduced seizure frequency has the potential not only to stabilize or improve memory function, but also to trigger complex, specific behavioral alterations. PMID:25157425

  18. Compulsive versifying after treatment of transient epileptic amnesia.

    PubMed

    Woollacott, Ione O C; Fletcher, Phillip D; Massey, Luke A; Pasupathy, Amirtha; Rossor, Martin N; Caine, Diana; Rohrer, Jonathan D; Warren, Jason D

    2015-01-01

    Compulsive production of verse is an unusual form of hypergraphia that has been reported mainly in patients with right temporal lobe seizures. We present a patient with transient epileptic amnesia and a left temporal seizure focus, who developed isolated compulsive versifying, producing multiple rhyming poems, following seizure cessation induced by lamotrigine. Functional neuroimaging studies in the healthy brain implicate left frontotemporal areas in generating novel verbal output and rhyme, while dysregulation of neocortical and limbic regions occurs in temporal lobe epilepsy. This case complements previous observations of emergence of altered behavior with reduced seizure frequency in patients with temporal lobe epilepsy. Such cases suggest that reduced seizure frequency has the potential not only to stabilize or improve memory function, but also to trigger complex, specific behavioral alterations.

  19. Cognitive Aging and the Hippocampus in Older Adults

    PubMed Central

    O’Shea, Andrew; Cohen, Ronald A.; Porges, Eric C.; Nissim, Nicole R.; Woods, Adam J.

    2016-01-01

    The hippocampus is one of the most well studied structures in the human brain. While age-related decline in hippocampal volume is well documented, most of our knowledge about hippocampal structure-function relationships was discovered in the context of neurological and neurodegenerative diseases. The relationship between cognitive aging and hippocampal structure in the absence of disease remains relatively understudied. Furthermore, the few studies that have investigated the role of the hippocampus in cognitive aging have produced contradictory results. To address these issues, we assessed 93 older adults from the general community (mean age = 71.9 ± 9.3 years) on the Montreal Cognitive Assessment (MoCA), a brief cognitive screening measure for dementia, and the NIH Toolbox-Cognitive Battery (NIHTB-CB), a computerized neurocognitive battery. High-resolution structural magnetic resonance imaging (MRI) was used to estimate hippocampal volume. Lower MoCA Total (p = 0.01) and NIHTB-CB Fluid Cognition (p < 0.001) scores were associated with decreased hippocampal volume, even while controlling for sex and years of education. Decreased hippocampal volume was significantly associated with decline in multiple NIHTB-CB subdomains, including episodic memory, working memory, processing speed and executive function. This study provides important insight into the multifaceted role of the hippocampus in cognitive aging. PMID:28008314

  20. Neurogenic Effects of Ghrelin on the Hippocampus

    PubMed Central

    Kim, Chanyang; Kim, Sehee; Park, Seungjoon

    2017-01-01

    Mammalian neurogenesis continues throughout adulthood in the subventricular zone of the lateral ventricle and in the subgranular zone of the dentate gyrus in the hippocampus. It is well known that hippocampal neurogenesis is essential in mediating hippocampus-dependent learning and memory. Ghrelin, a peptide hormone mainly synthesized in the stomach, has been shown to play a major role in the regulation of energy metabolism. A plethora of evidence indicates that ghrelin can also exert important effects on neurogenesis in the hippocampus of the adult brain. The aim of this review is to discuss the current role of ghrelin on the in vivo and in vitro regulation of neurogenesis in the adult hippocampus. We will also discuss the possible role of ghrelin in dietary restriction-induced hippocampal neurogenesis and the link between ghrelin-induced hippocampal neurogenesis and cognitive functions. PMID:28282857

  1. Neurogenic Effects of Ghrelin on the Hippocampus.

    PubMed

    Kim, Chanyang; Kim, Sehee; Park, Seungjoon

    2017-03-08

    Mammalian neurogenesis continues throughout adulthood in the subventricular zone of the lateral ventricle and in the subgranular zone of the dentate gyrus in the hippocampus. It is well known that hippocampal neurogenesis is essential in mediating hippocampus-dependent learning and memory. Ghrelin, a peptide hormone mainly synthesized in the stomach, has been shown to play a major role in the regulation of energy metabolism. A plethora of evidence indicates that ghrelin can also exert important effects on neurogenesis in the hippocampus of the adult brain. The aim of this review is to discuss the current role of ghrelin on the in vivo and in vitro regulation of neurogenesis in the adult hippocampus. We will also discuss the possible role of ghrelin in dietary restriction-induced hippocampal neurogenesis and the link between ghrelin-induced hippocampal neurogenesis and cognitive functions.

  2. Selective activation of parvalbumin- or somatostatin-expressing interneurons triggers epileptic seizurelike activity in mouse medial entorhinal cortex.

    PubMed

    Yekhlef, Latefa; Breschi, Gian Luca; Lagostena, Laura; Russo, Giovanni; Taverna, Stefano

    2015-03-01

    GABAergic interneurons are thought to play a critical role in eliciting interictal spikes (IICs) and triggering ictal discharges in temporal lobe epilepsy, yet the contribution of different interneuronal subtypes to seizure initiation is still largely unknown. Here we took advantage of optogenetic techniques combined with patch-clamp and field recordings to selectively stimulate parvalbumin (PV)- or somatostatin (SOM)-positive interneurons expressing channelrhodopsin-2 (CHR-2) in layers II-III of adult mouse medial entorhinal cortical slices during extracellular perfusion with the proconvulsive compound 4-aminopyridine (4-AP, 100-200 μM). In control conditions, blue laser photostimulation selectively activated action potential firing in either PV or SOM interneurons and, in both cases, caused a robust GABAA-receptor-mediated inhibition in pyramidal cells (PCs). During perfusion with 4-AP, brief photostimuli (300 ms) activating either PV or SOM interneurons induced patterns of epileptiform activity that closely replicated spontaneously occurring IICs and tonic-clonic ictal discharges. Laser-induced synchronous firing in both interneuronal types elicited large compound GABAergic inhibitory postsynaptic currents (IPSCs) correlating with IICs and preictal spikes. In addition, spontaneous and laser-induced epileptic events were similarly initiated in concurrence with a large increase in extracellular potassium concentration. Finally, interneuron activation was unable to stop or significantly shorten the progression of seizurelike episodes. These results suggest that entorhinal PV and SOM interneurons are nearly equally effective in triggering interictal and ictal discharges that closely resemble human temporal lobe epileptic activity.

  3. Investigation of Anti-Toxocara Antibodies in Epileptic Patients and Comparison of Two Methods: ELISA and Western Blotting

    PubMed Central

    Zibaei, Mohammad; Firoozeh, Farzaneh; Bahrami, Parviz; Sadjjadi, Seyed Mahmoud

    2013-01-01

    The relationship between Toxocara infection and epilepsy was previously demonstrated by several case-control studies and case reports. These previous studies were often based on the enzyme-linked immunosorbent assay (ELISA) using Toxocara excretory-secretory antigens, which are not specific due to cross-reactivity with other parasitic infections such as ascariasis, trichuriasis, and anisakiasis. An immunoblot analysis is highly specific and can detect low levels of Toxocara antibodies. Therefore, this assay may be useful in the identification of toxocariasis in epileptic patients. We examined patients who had epilepsy and healthy subjects for seropositivity for Toxocara infection by ELISA and Western blotting. Out of 85 epileptic patients, 10 (11.8%) and 3 (3.5%) persons exhibited Toxocara immunoglobulin G (IgG) antibodies responses by ELISA and by both techniques, respectively. Moreover, in the healthy group (n = 85), 3 (3.5%) persons were positive by ELISA, but none was detected by Western blotting. This study indicates that Toxocara infection is a risk factor for epilepsy in Iran. These findings strongly suggest the need to perform Western blotting immunodiagnosis, as well as the ELISA using Toxocara excretory-secretory antigens, to improve diagnosis of human toxocariasis in patients with epilepsy. PMID:23710354

  4. Encoding and reactivation patterns predictive of successful memory performance are topographically organized along the longitudinal axis of the hippocampus.

    PubMed

    Nakamura, Nozomu H; Sauvage, Magdalena M

    2016-01-01

    An ongoing debate in human memory research is whether the encoding and the retrieval of memory engage the same part of the hippocampus and the same cells, or whether encoding preferentially involves the anterior part of the hippocampus and retrieval its posterior part. Here, we used a human to rat translational behavioral approach combined to high-resolution molecular imaging to address this issue. We showed that successful memory performance is predicted by encoding and reactivation patterns only in the dorsal part of the rat hippocampus (posterior part in humans), but not in the ventral part (anterior part in humans). Our findings support the view that the encoding and the retrieval processes per se are not segregated along the longitudinal axis of the hippocampus, but that activity predictive of successful memory is and concerns specifically the dorsal part of the hippocampus. In addition, we found evidence that these processes are likely to be mediated by the activation/reactivation of the same cells at this level. Given the translational character of the task, our results suggest that both the encoding and the retrieval processes take place in the same cells of the posterior part of the human hippocampus.

  5. Concordance of Epileptic Networks Associated with Epileptic Spikes Measured by High-Density EEG and Fast fMRI

    PubMed Central

    Jäger, Vera; Dümpelmann, Matthias; LeVan, Pierre; Ramantani, Georgia; Mader, Irina; Schulze-Bonhage, Andreas; Jacobs, Julia

    2015-01-01

    Objective The present study aims to investigate whether a newly developed fast fMRI called MREG (magnetic resonance encephalography) measures metabolic changes related to interictal epileptic discharges (IED). For this purpose BOLD changes are correlated with the IED distribution and variability. Methods Patients with focal epilepsy underwent EEG-MREG using a 64 channel cap. IED voltage maps were generated using 32 and 64 channels and compared regarding their correspondence to the BOLD response. The extents of IEDs (defined as number of channels with >50% of maximum IED negativity) were correlated with the extents of positive and negative BOLD responses. Differences in inter-spike variability were investigated between interictal epileptic discharges (IED) sets with and without concordant positive or negative BOLD responses. Results 17 patients showed 32 separate IED types. In 50% of IED types the BOLD changes could be confirmed by another independent imaging method. The IED extent significantly correlated with the positive BOLD extent (p = 0.04). In 6 patients the 64-channel EEG voltage maps better reflected the positive or negative BOLD response than the 32-channel EEG; in all others no difference was seen. Inter-spike variability was significantly lower in IED sets with than without concordant positive or negative BOLD responses (with p = 0.04). Significance Higher density EEG and fast fMRI seem to improve the value of EEG-fMRI in epilepsy. The correlation of positive BOLD and IED extent could suggest that widespread BOLD responses reflect the IED network. Inter-spike variability influences the likelihood to find IED concordant positive or negative BOLD responses, which is why single IED analysis may be promising. PMID:26496480

  6. Cannabidiol Post-Treatment Alleviates Rat Epileptic-Related Behaviors and Activates Hippocampal Cell Autophagy Pathway Along with Antioxidant Defense in Chronic Phase of Pilocarpine-Induced Seizure.

    PubMed

    Hosseinzadeh, Mahshid; Nikseresht, Sara; Khodagholi, Fariba; Naderi, Nima; Maghsoudi, Nader

    2016-04-01

    Abnormal and sometimes severe behavioral and molecular symptoms are usually observed in epileptic humans and animals. To address this issue, we examined the behavioral and molecular aspects of seizure evoked by pilocarpine. Autophagy can promote both cell survival and death, but there are controversial reports about the neuroprotective or neurodegenerative effects of autophagy in seizure. Cannabidiol has anticonvulsant properties in some animal models when used as a pretreatment. In this study, we investigated alteration of seizure scores, autophagy pathway proteins, and antioxidant status in hippocampal cells during the chronic phase of pilocarpine-induced epilepsy after treatment with cannabidiol. Cannabidiol (100 ng, intracerebroventricular injection) delayed the chronic phase of epilepsy. Single administration of cannabidiol during the chronic phase of seizure significantly diminished seizure scores such as mouth clonus, head nodding, monolateral and bilateral forelimb clonus and increased the activity of catalase enzyme and reduced glutathione content. Such a protective effect in the behavioral scores of epileptic rats was also observed after repeated administrations of cannabidiol at the onset of the silent phase. Moreover, the amount of Atg7, conjugation of Atg5/12, Atg12, and LC3II/LC3I ratio increased significantly in epileptic rats treated with repeated injections of cannabidiol. In short, our results suggest that post-treatment of Cannabidiol could enhance the induction of autophagy pathway and antioxidant defense in the chronic phase of epilepsy, which could be considered as the protective mechanisms of cannabidiol in a temporal lobe epilepsy model.

  7. Ketogenic diet - A novel treatment for early epileptic encephalopathy due to PIGA deficiency.

    PubMed

    Joshi, Charuta; Kolbe, Diana L; Mansilla, M Adela; Mason, Sara; Smith, Richard J H; Campbell, Colleen A

    2016-10-01

    We describe the presentation and workup of two brothers with early-onset epileptic encephalopathy who became seizure-free on a ketogenic diet. Extensive testing culminated in whole exome sequencing, which led to the diagnosis of phosphatidyl inositol glycan biosynthesis class A protein (PIGA) deficiency. This familial case highlights the importance of genetic testing for early-onset epileptic encephalopathies and underscores the potential value of a ketogenic diet in the treatment of this condition.

  8. A note on a phrase in Shakespeare's play King Lear: 'a plague upon your epileptic visage'.

    PubMed

    Betts, T; Betts, H

    1998-10-01

    In Shakespeare's play King Lear the word 'epileptic' appears (used in a derogatory manner). This is held to be the first appearance of the word in the English language (although we have found earlier English references to the word which Shakespeare may have read). Textual analysis of the lines following the use of 'epileptic' suggests that it is actually a reference to the pock-marks of syphilis, endemic in Elizabethan England, and is not actually a reference to epilepsy itself.

  9. Recurrent occurrences of CDKL5 mutations in patients with epileptic encephalopathy

    PubMed Central

    Yamamoto, Toshiyuki; Shimojima, Keiko; Kimura, Nobusuke; Mogami, Yukiko; Usui, Daisuke; Takayama, Rumiko; Ikeda, Hiroko; Imai, Katsumi

    2015-01-01

    The cyclin-dependent kinase-like 5 gene (CDKL5) is recognized as one of the genes responsible for epileptic encephalopathy. We identified CDKL5 mutations in five Japanese patients (one male and four female) with epileptic encephalopathy. Although all mutations were of de novo origin, they were located in the same positions as previously reported pathogenic mutations. These recurrent occurrences of de novo mutations in the same loci may indicate hot spots of nucleotide alteration. PMID:27081548

  10. Patient-specific connectivity pattern of epileptic network in frontal lobe epilepsy.

    PubMed

    Luo, Cheng; An, Dongmei; Yao, Dezhong; Gotman, Jean

    2014-01-01

    There is evidence that focal epilepsy may involve the dysfunction of a brain network in addition to the focal region. To delineate the characteristics of this epileptic network, we collected EEG/fMRI data from 23 patients with frontal lobe epilepsy. For each patient, EEG/fMRI analysis was first performed to determine the BOLD response to epileptic spikes. The maximum activation cluster in the frontal lobe was then chosen as the seed to identify the epileptic network in fMRI data. Functional connectivity analysis seeded at the same region was also performed in 63 healthy control subjects. Nine features were used to evaluate the differences of epileptic network patterns in three connection levels between patients and controls. Compared with control subjects, patients showed overall more functional connections between the epileptogenic region and the rest of the brain and higher laterality. However, the significantly increased connections were located in the neighborhood of the seed, but the connections between the seed and remote regions actually decreased. Comparing fMRI runs with interictal epileptic discharges (IEDs) and without IEDs, the patient-specific connectivity pattern was not changed significantly. These findings regarding patient-specific connectivity patterns of epileptic networks in FLE reflect local high connectivity and connections with distant regions differing from those of healthy controls. Moreover, the difference between the two groups in most features was observed in the strictest of the three connection levels. The abnormally high connectivity might reflect a predominant attribute of the epileptic network, which may facilitate propagation of epileptic activity among regions in the network.

  11. Apneas observed in trisomy 18 neonates should be differentiated from epileptic apneas.

    PubMed

    Fukasawa, Tatsuya; Kubota, Tetsuo; Tanaka, Masaharu; Asada, Hideyuki; Matsusawa, Kaname; Hattori, Tetsuo; Kato, Yuichi; Negoro, Tamiko

    2015-03-01

    Many children with trisomy 18 have apneas from the neonatal period. It has been reported that some children with trisomy 18 have epilepsy, including epileptic apneas. However, no previous report has described epileptic apneas in trisomy 18 neonates. We retrospectively reviewed the clinical records of neonates with trisomy 18 who were born at Anjo Kosei Hospital between July 2004 and October 2013 and investigated whether they had epileptic apneas during the neonatal period and whether antiepileptic drugs (AEDs) were effective for treating them. We identified 16 patients with trisomy 18. Nine patients who died within 3 days of birth were excluded. Five of the remaining seven patients had apneas. All five patients underwent electroencephalograms (EEGs) to assess whether they suffered epileptic apneas. Three of the five patients had EEG-confirmed seizures. In two patients, the apneas corresponded to ictal discharges. In one patient, ictal discharges were recorded when she was under mechanical ventilation, but no ictal discharges that corresponded to apneas were recorded after she was extubated. AEDs were effective for treating the apneas and stabilizing the SpO2 in all three patients. Among neonates with trisomy 18 who lived longer than 3 days, three of seven patients had EEG-confirmed seizures. AEDs were useful for treating their epileptic apneas and stabilizing their SpO2. Physicians should keep epileptic apneas in mind when treating apneas in neonates with trisomy 18.

  12. All together now: Analogies between chimera state collapses and epileptic seizures

    NASA Astrophysics Data System (ADS)

    Andrzejak, Ralph G.; Rummel, Christian; Mormann, Florian; Schindler, Kaspar

    2016-03-01

    Conceptually and structurally simple mathematical models of coupled oscillator networks can show a rich variety of complex dynamics, providing fundamental insights into many real-world phenomena. A recent and not yet fully understood example is the collapse of coexisting synchronous and asynchronous oscillations into a globally synchronous motion found in networks of identical oscillators. Here we show that this sudden collapse is promoted by a further decrease of synchronization, rather than by critically high synchronization. This strikingly counterintuitive mechanism can be found also in nature, as we demonstrate on epileptic seizures in humans. Analyzing spatiotemporal correlation profiles derived from intracranial electroencephalographic recordings (EEG) of seizures in epilepsy patients, we found a pronounced decrease of correlation at the seizure onsets. Applying our findings in a closed-loop control scheme to models of coupled oscillators in chimera states, we succeed in both provoking and preventing outbreaks of global synchronization. Our findings not only advance the understanding of networks of coupled dynamics but can open new ways to control them, thus offering a vast range of potential new applications.

  13. All together now: Analogies between chimera state collapses and epileptic seizures

    PubMed Central

    Andrzejak, Ralph G.; Rummel, Christian; Mormann, Florian; Schindler, Kaspar

    2016-01-01

    Conceptually and structurally simple mathematical models of coupled oscillator networks can show a rich variety of complex dynamics, providing fundamental insights into many real-world phenomena. A recent and not yet fully understood example is the collapse of coexisting synchronous and asynchronous oscillations into a globally synchronous motion found in networks of identical oscillators. Here we show that this sudden collapse is promoted by a further decrease of synchronization, rather than by critically high synchronization. This strikingly counterintuitive mechanism can be found also in nature, as we demonstrate on epileptic seizures in humans. Analyzing spatiotemporal correlation profiles derived from intracranial electroencephalographic recordings (EEG) of seizures in epilepsy patients, we found a pronounced decrease of correlation at the seizure onsets. Applying our findings in a closed-loop control scheme to models of coupled oscillators in chimera states, we succeed in both provoking and preventing outbreaks of global synchronization. Our findings not only advance the understanding of networks of coupled dynamics but can open new ways to control them, thus offering a vast range of potential new applications. PMID:26957324

  14. Unsupervised EEG analysis for automated epileptic seizure detection

    NASA Astrophysics Data System (ADS)

    Birjandtalab, Javad; Pouyan, Maziyar Baran; Nourani, Mehrdad

    2016-07-01

    Epilepsy is a neurological disorder which can, if not controlled, potentially cause unexpected death. It is extremely crucial to have accurate automatic pattern recognition and data mining techniques to detect the onset of seizures and inform care-givers to help the patients. EEG signals are the preferred biosignals for diagnosis of epileptic patients. Most of the existing pattern recognition techniques used in EEG analysis leverage the notion of supervised machine learning algorithms. Since seizure data are heavily under-represented, such techniques are not always practical particularly when the labeled data is not sufficiently available or when disease progression is rapid and the corresponding EEG footprint pattern will not be robust. Furthermore, EEG pattern change is highly individual dependent and requires experienced specialists to annotate the seizure and non-seizure events. In this work, we present an unsupervised technique to discriminate seizures and non-seizures events. We employ power spectral density of EEG signals in different frequency bands that are informative features to accurately cluster seizure and non-seizure events. The experimental results tried so far indicate achieving more than 90% accuracy in clustering seizure and non-seizure events without having any prior knowledge on patient's history.

  15. Effect of anti-epileptic drugs in pregnancy and teratogenesis.

    PubMed

    Lakshmi, Sowbhagya; Sunanda, Kulkarni

    2008-07-01

    Epilepsy raises special concern in women during pregnancy. Antiepileptic drugs are known to induce major and minor malformations in the foetus. Aim of the study was to find an association between maternal serum alpha fetoprotein levels, foetal abnormalities and antiepileptic drugs mediated teratogenicity. Maternal serum alpha feto protein levels, kidney and liver function tests in age matched normal pregnant women and seizure free epileptic pregnant women during 12-14 weeks of gestation were estimated. Cases were subjected to ultrasonography at 11(th)-14(th) week of pregnancy and again at 20(th) week of pregnancy. maternal serum alfa feto protein was assayed by a specific Electro Chemiluminescence Immuno Assay test. There was no significant difference in kidney and liver function tests in cases as compared to controls. There were elevated levels of alpha feto protein in cases as compared to controls but this was not statistically significant. No anomalies were detected in ultrasound reports. Most women had normal full term delivery with healthy children but of low birth weight. No correlation was seen between maternal serum alfa feto protein levels and antiepileptic drug leading to teratogenesis.

  16. Do energy drinks cause epileptic seizure and ischemic stroke?

    PubMed

    Dikici, Suber; Saritas, Ayhan; Besir, Fahri Halit; Tasci, Ahmet Hakan; Kandis, Hayati

    2013-01-01

    Energy drinks are popular among young individuals and marketed to college students, athletes, and active individuals between the ages of 21 and 35 years. We report a case that had ischemic stroke and epileptic seizure after intake of energy drink with alcohol. To the best of our knowledge, the following case is the first report of ischemic stroke after intake of energy drink. A previously healthy 37-year-old man was brought to the emergency department after a witnessed tonic-clonic seizure. According to his wife's testimony, just before loss of consciousness, the patient had been drinking 3 boxes of energy drinks (Redbull, Istanbul, Turkey, 250 mL) with vodka on an empty stomach. He did not have a history of seizures, head trauma, or family history of seizures or another disease. In cranial diffusion magnetic resonance imaging, there were hyperintense signal changes in bilateral occipital area (more pronounced in the left occipital lobe), right temporal lobe, frontal lobe, and posterior parietal lobe. All tests associated with possible etiologic causes of ischemic stroke in young patients were negative. Herein, we want to attract attention to adverse effect of energy drink usage.

  17. Resetting of brain dynamics: epileptic versus psychogenic nonepileptic seizures.

    PubMed

    Krishnan, Balu; Faith, Aaron; Vlachos, Ioannis; Roth, Austin; Williams, Korwyn; Noe, Katie; Drazkowski, Joe; Tapsell, Lisa; Sirven, Joseph; Iasemidis, Leon

    2011-12-01

    We investigated the possibility of differential diagnosis of patients with epileptic seizures (ES) and patients with psychogenic nonepileptic seizures (PNES) through an advanced analysis of the dynamics of the patients' scalp EEGs. The underlying principle was the presence of resetting of brain's preictal spatiotemporal entrainment following onset of ES and the absence of resetting following PNES. Long-term (days) scalp EEGs recorded from five patients with ES and six patients with PNES were analyzed. It was found that: (1) Preictal entrainment of brain sites was reset at ES (P<0.05) in four of the five patients with ES, and not reset (P=0.28) in the fifth patient. (2) Resetting did not occur (p>0.1) in any of the six patients with PNES. These preliminary results in patients with ES are in agreement with our previous findings from intracranial EEG recordings on resetting of brain dynamics by ES and are expected to constitute the basis for the development of a reliable and supporting tool in the differential diagnosis between ES and PNES. Finally, we believe that these results shed light on the electrophysiology of PNES by showing that occurrence of PNES does not assist patients in overcoming a pathological entrainment of brain dynamics. This article is part of a Supplemental Special Issue entitled The Future of Automated Seizure Detection and Prediction.

  18. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    PubMed Central

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.; Talvik, Inga; Talvik, Tiina; Vaher, Ulvi; Miranda, Maria J.; Farooq, Muhammad; Nielsen, Jens E.K.; Svendsen, Lene Lavard; Kjelgaard, Ditte B.; Linnet, Karen M.; Hao, Qin; Uldall, Peter; Frangu, Mimoza; Tommerup, Niels; Baig, Shahid M.; Abdullah, Uzma; Born, Alfred P.; Gellert, Pia; Nikanorova, Marina; Olofsson, Kern; Jepsen, Birgit; Marjanovic, Dragan; Al-Zehhawi, Lana I.K.; Peñalva, Sofia J.; Krag-Olsen, Bente; Brusgaard, Klaus; Hjalgrim, Helle; Rubboli, Guido; Pal, Deb K.; Dahl, Hans A.

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures to epileptic encephalopathies (EEs). Potentially causative variants were evaluated by literature and database searches, submitted to bioinformatic prediction algorithms, and validated by Sanger sequencing. If possible, parents were included for segregation analysis. We identified a presumed disease-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared to 17% among patients with generalized epilepsies and 16% in patients with focal or multifocal epilepsies. By the use of a gene panel consisting of 46 epilepsy genes, we were able to find a disease-causing genetic variation in 23% of the analyzed patients. The highest yield was found among patients with neonatal-onset epilepsies and EEs. PMID:27781031

  19. CAD mutations and uridine-responsive epileptic encephalopathy.

    PubMed

    Koch, Johannes; Mayr, Johannes A; Alhaddad, Bader; Rauscher, Christian; Bierau, Jörgen; Kovacs-Nagy, Reka; Coene, Karlien L M; Bader, Ingrid; Holzhacker, Monika; Prokisch, Holger; Venselaar, Hanka; Wevers, Ron A; Distelmaier, Felix; Polster, Tilman; Leiz, Steffen; Betzler, Cornelia; Strom, Tim M; Sperl, Wolfgang; Meitinger, Thomas; Wortmann, Saskia B; Haack, Tobias B

    2017-02-01

    Unexplained global developmental delay and epilepsy in childhood pose a major socioeconomic burden. Progress in defining the molecular bases does not often translate into effective treatment. Notable exceptions include certain inborn errors of metabolism amenable to dietary intervention. CAD encodes a multifunctional enzyme involved in de novo pyrimidine biosynthesis. Alternatively, pyrimidines can be recycled from uridine. Exome sequencing in three families identified biallelic CAD mutations in four children with global developmental delay, epileptic encephalopathy, and anaemia with anisopoikilocytosis. Two died aged 4 and 5 years after a neurodegenerative disease course. Supplementation of the two surviving children with oral uridine led to immediate cessation of seizures in both. A 4-year-old female, previously in a minimally conscious state, began to communicate and walk with assistance after 9 weeks of treatment. A 3-year-old female likewise showed developmental progress. Blood smears normalized and anaemia resolved. We establish CAD as a gene confidently implicated in this neurometabolic disorder, characterized by co-occurrence of global developmental delay, dyserythropoietic anaemia and seizures. While the natural disease course can be lethal in early childhood, our findings support the efficacy of uridine supplementation, rendering CAD deficiency a treatable neurometabolic disorder and therefore a potential condition for future (genetic) newborn screening.

  20. Neuronal avalanches, epileptic quakes and other transient forms of neurodynamics.

    PubMed

    Milton, John G

    2012-07-01

    Power-law behaviors in brain activity in healthy animals, in the form of neuronal avalanches, potentially benefit the computational activities of the brain, including information storage, transmission and processing. In contrast, power-law behaviors associated with seizures, in the form of epileptic quakes, potentially interfere with the brain's computational activities. This review draws attention to the potential roles played by homeostatic mechanisms and multistable time-delayed recurrent inhibitory loops in the generation of power-law phenomena. Moreover, it is suggested that distinctions between health and disease are scale-dependent. In other words, what is abnormal and defines disease it is not the propagation of neural activity but the propagation of activity in a neural population that is large enough to interfere with the normal activities of the brain. From this point of view, epilepsy is a disease that results from a failure of mechanisms, possibly located in part in the cortex itself or in the deep brain nuclei and brainstem, which truncate or otherwise confine the spatiotemporal scales of these power-law phenomena.

  1. Epileptic Seizures From Abnormal Networks: Why Some Seizures Defy Predictability

    PubMed Central

    Azhar, Feraz; Kudela, Pawel; Bergey, Gregory K.; Franaszczuk, Piotr J.

    2011-01-01

    Summary Seizure prediction has proven to be difficult in clinically realistic environments. Is it possible that fluctuations in cortical firing could influence the onset of seizures in an ictal zone? To test this, we have now used neural network simulations in a computational model of cortex having a total of 65,536 neurons with intercellular wiring patterned after histological data. A spatially distributed Poisson driven background input representing the activity of neighboring cortex affected 1% of the neurons. Gamma distributions were fit to the interbursting phase intervals, a non-parametric test for randomness was applied, and a dynamical systems analysis was performed to search for period-1 orbits in the intervals. The non-parametric analysis suggests that intervals are being drawn at random from their underlying joint distribution and the dynamical systems analysis is consistent with a nondeterministic dynamical interpretation of the generation of bursting phases. These results imply that in a region of cortex with abnormal connectivity analogous to a seizure focus, it is possible to initiate seizure activity with fluctuations of input from the surrounding cortical regions. These findings suggest one possibility for ictal generation from abnormal focal epileptic networks. This mechanism additionally could help explain the difficulty in predicting partial seizures in some patients. PMID:22169211

  2. Focal autobiographical amnesia in association with transient epileptic amnesia.

    PubMed

    Manes, F; Hodges, J R; Graham, K S; Zeman, A

    2001-03-01

    Although problems with remembering significant events from the past (e.g. holidays, weddings, etc.) have been reported previously in patients with transient epileptic amnesia (TEA), to date there have been no detailed studies of autobiographical memory in patients with this disorder. To investigate this issue, a 68-year-old right-handed man (R.G.) who suffered from TEA and reported significant autobiographical memory problems was tested on a battery of neuropsychological tests of anterograde and remote memory. Tests of autobiographical memory revealed that R.G. was unable to evoke detailed autobiographical recollections from a substantial part of his life. By contrast, he performed well on tests of new learning and general knowledge and possessed good personal semantic information about his past. In summary, a distinct form of autobiographical amnesia, which is characterized by loss of experiential remembering of significant events, may be associated with TEA. It is proposed that the autobiographical memory deficit seen in the disorder may result from the progressive erasure of cortically based memory representations. This case adds to growing evidence for a dissociation between mechanisms subserving anterograde memory and those required to evoke remote episodic memories.

  3. Chronic alcohol use and first symptomatic epileptic seizures

    PubMed Central

    Leone, M; Tonini, C; Bogliun, G; Monaco, F; Mutani, R; Bottacchi, E; Gambaro, P; Rocci, E; Tassinari, T; Cavestro, C; Beghi, E

    2002-01-01

    Objective: To establish whether chronic alcoholism and alcohol consumption are risk factors for developing a first symptomatic epileptic seizure. Methods: Multicentre case-control study of 293 patients (160 men, 133 women) with a first seizure symptomatic (either acute or remote) of head trauma, stroke, or brain tumour, matched to 444 hospital controls for centre, sex, age (±5 years), and underlying pathology. Results: The risk of first seizure in alcoholics was no higher than in non-alcoholics for men (odds ratio 1.2, 95% confidence interval 0.4 to 3.2) or women (1.5, 0.1 to 54.4). The odds ratio (both sexes) was 1.2 (0.8 to 1.7) for an average intake of absolute alcohol of 1–25 g/day, 0.9 (0.5 to 1.5) for 26–50 g/day, 1.6 (0.8 to 3.0) for 51–100 g/day, and 1.4 (0.5 to 3.5) for >100 g/day. Conclusions: We found no evidence of an association between alcohol use or alcoholism and a first symptomatic seizure. PMID:12397140

  4. Drug therapy of epileptic seizures among adult epileptic outpatients of University of Gondar Referral and Teaching Hospital, Gondar, North West Ethiopia

    PubMed Central

    Birru, Eshetie Melese; Shafi, Miftah; Geta, Mestayet

    2016-01-01

    Objective The aim of this study was to assess the practice of pharmacotherapy of epilepsy and its treatment outcomes in adult epileptic outpatients at the University of Gondar Referral and Teaching Hospital, Gondar, North West Ethiopia. Methods An institution based, retrospective cross-sectional study was conducted from the medical charts of 336 adult epileptic patients at the outpatient epileptic clinic of Neurology Department of University of Gondar Teaching Hospital from May 2014 to April 2015. Reviewing follow-up information from the medical charts was used to evaluate antiepileptic drug (AED) prescribing patterns and treatment outcome. Data were collected by using data collection format and analyzed using SPSS software version 16. Results The most common type of seizure diagnosed was generalized tonic–clonic seizure (n=245, 72.91%). Monotherapy with an AED accounted for 80.35% of the cases, whereas dual therapy and polytherapy with three AED combinations accounted for 16.37% and 3.28%, respectively. The most frequently prescribed AED was phenobarbitone (62.47%) followed by carbamazepine (17.91%). From the total epileptic cases, 277 (82.4%) had well-controlled seizure status in the last three consecutive months. Conclusion Most of the patients were maintained by monotherapy, and largely this was by the older antiepileptic drug, phenobarbitone. Considering the development of pharmacotherapy of epilepsy and other patient related factors, the standard treatment guideline for Ethiopia needs to be revised periodically. PMID:28053533

  5. A local adjustment strategy for the initialization of dynamic causal modelling to infer effective connectivity in brain epileptic structures.

    PubMed

    Xiang, Wentao; Karfoul, Ahmad; Shu, Huazhong; Le Bouquin Jeannès, Régine

    2017-03-07

    This paper addresses the question of effective connectivity in the human cerebral cortex in the context of epilepsy. Among model based approaches to infer brain connectivity, spectral Dynamic Causal Modelling is a conventional technique for which we propose an alternative to estimate cross spectral density. The proposed strategy we investigated tackles the sub-estimation of the free energy using the well-known variational Expectation-Maximization algorithm highly sensitive to the initialization of the parameters vector by a permanent local adjustment of the initialization process. The performance of the proposed strategy in terms of effective connectivity identification is assessed using simulated data generated by a neuronal mass model (simulating unidirectional and bidirectional flows) and real epileptic intracerebral Electroencephalographic signals. Results show the efficiency of proposed approach compared to the conventional Dynamic Causal Modelling and the one wherein a deterministic annealing scheme is employed.

  6. The role of the hippocampus in transitive inference

    PubMed Central

    Zalesak, Martin; Heckers, Stephan

    2009-01-01

    Transitive inference (TI) is the ability to infer the relationship between items (e.g., A>C) after having learned a set of premise pairs (e.g., A>B and B>C). Previous studies in humans have identified a distributed neural network, including cortex, hippocampus, and thalamus, during TI judgments. We studied two aspects of TI using fMRI of subjects who had acquired the 6-item sequence (A>B>C>D>E>F) of visual stimuli. First, the identification of novel pairs not containing end items (i.e., B>D, C>E, B>E) was associated with greater left hippocampal activation when compared to the identification of novel pairs containing end items A and F. This demonstrates that the identification of stimulus pairs requiring the flexible representation of a sequence is associated with hippocampal activation. Second, for the three novel pairs devoid of end items we found greater right hippocampal activation for pairs B>D and C>E compared with pair B>E. This indicates that TI decisions on pairs derived from more adjacent items in the sequence are associated with greater hippocampal activation. Hippocampal activation thus scales with the degree of relational processing necessary for TI judgments. Both findings confirm a role of the hippocampus in transitive inference in humans. PMID:19216061

  7. Stress effects on the hippocampus: a critical review

    PubMed Central

    Kim, Eun Joo; Pellman, Blake

    2015-01-01

    Uncontrollable stress has been recognized to influence the hippocampus at various levels of analysis. Behaviorally, human and animal studies have found that stress generally impairs various hippocampal-dependent memory tasks. Neurally, animal studies have revealed that stress alters ensuing synaptic plasticity and firing properties of hippocampal neurons. Structurally, human and animal studies have shown that stress changes neuronal morphology, suppresses neuronal proliferation, and reduces hippocampal volume. Since the inception of stress research nearly 80 years ago, much focus has been on the varying levels of hypothalamic-pituitary-adrenal (HPA) axis neuroendocrine hormones, namely glucocorticoids, as mediators of the myriad stress effects on the hippocampus and as contributing factors to stress-associated psychopathologies such as post-traumatic stress disorder (PTSD). However, reports of glucocorticoid-produced alterations in hippocampal functioning vary widely across studies. This review provides a brief history of stress research, examines how the glucocorticoid hypothesis emerged and guides contemporary stress research, and considers alternative approaches to understanding the mechanisms underlying stress effects on hippocampal functioning. PMID:26286651

  8. Carbamazepine pharmacokinetics are not affected by zonisamide: in vitro mechanistic study and in vivo clinical study in epileptic patients.

    PubMed

    Ragueneau-Majlessi, Isabelle; Levy, Rene H; Bergen, Donna; Garnett, William; Rosenfeld, William; Mather, Gary; Shah, Jaymin; Grundy, John S

    2004-11-01

    Carbamazepine is metabolized by CYP3A4 and several other cytochrome P450 enzymes. The potential effects of zonisamide on carbamazepine pharmacokinetics (PK) have not been well characterized, with contradictory literature reports. Hence, an in vitro study was designed to evaluate the cytochrome P450 inhibition spectrum of zonisamide using human liver microsomes. Further, an in vivo steady-state study was performed to measure the effect of zonisamide on carbamazepine PK in epileptic patients, and monitor zonisamide PK. In vitro human liver microsomes were incubated with zonisamide (200, 600 or 1000 microM) in the presence of appropriate probe substrates to assess selected cytochrome P450 activities. In vivo, the effect of zonisamide, up to 400 mg/day, on the steady-state PK of carbamazepine and carbamazepine-epoxide (CBZ-E) was studied in 18 epileptic patients. In vitro, zonisamide did not inhibit CYP1A2 and 2D6, and only weakly inhibited CYP2A6, 2C9, 2C19, and 2E1. The estimated Ki for zonisamide inhibition of CYP3A4 was 1076 microM, 12 times higher than typical unbound therapeutic serum zonisamide concentrations. In vivo, no statistically significant differences were observed for mean Cmax, Tmax, and AUC0-12 of total and free carbamazepine and CBZ-E measured before and after zonisamide administration (300-400 mg/day for 14 days). However, CBZ-E renal clearance was significantly (p < 0.05) reduced by zonisamide. The observed mean zonisamide t1/2 (36.3h), relative to approximately 65 h reported in subjects on zonisamide monotherapy, reflects known CYP3A4 induction by carbamazepine. Based on the lack of clinically relevant in vitro and in vivo effects, adjustment of carbamazepine dosing should not be required with concomitant zonisamide administration.

  9. Mozart's music in children with drug-refractory epileptic encephalopathies.

    PubMed

    Coppola, Giangennaro; Toro, Annacarmela; Operto, Francesca Felicia; Ferrarioli, Giuseppe; Pisano, Simone; Viggiano, Andrea; Verrotti, Alberto

    2015-09-01

    Mozart's sonata for two pianos in D major, K448, has been shown to decrease interictal EEG discharges and recurrence of clinical seizures in both adults and young patients. In this prospective, open-label study, we evaluated the effect of listening to a set of Mozart's compositions, according to the Tomatis method, on sleep quality and behavioral disorders, including auto-/hetero-aggression, irritability, and hyperactivity, in a group of children and adolescents with drug-resistant epilepsy. The study group was composed of 11 outpatients (7 males and 4 females), between 1.5years and 21years of age (mean age: 11.9years), all suffering from drug-resistant epileptic encephalopathy (n=11). All of them had a severe/profound intellectual disability associated with cerebral palsy. During the study period, each patient had to listen to a set of Mozart's compositions 2h per day for fifteen days for a total of 30h, which could be distributed over the day depending on the habits and compliance of each patient. The music was filtered by a device preferably delivering higher sound frequencies (>3000Hz) according to the Tomatis principles. The antiepileptic drug therapy remained unchanged throughout the study period. During the 15-day music therapy, 2 out of 11 patients had a reduction of 50-75% in seizure recurrence, and 3 out of 12 patients had a reduction of 75-89%. Overall, 5 (45.4%) out of 11 patients had a ≥50% reduction in the total number of seizures, while the percentage decrease of the total seizure number (11/11) compared with baseline was -51.5% during the 15-day music therapy and -20.7% in the two weeks after the end of treatment. All responders also had an improvement in nighttime sleep and daytime behavior.

  10. Medical management of epileptic seizures: challenges and solutions

    PubMed Central

    Sarma, Anand K; Khandker, Nabil; Kurczewski, Lisa; Brophy, Gretchen M

    2016-01-01

    Epilepsy is one of the most common neurologic illnesses. This condition afflicts 2.9 million adults and children in the US, leading to an economic impact amounting to $15.5 billion. Despite the significant burden epilepsy places on the population, it is not very well understood. As this understanding continues to evolve, it is important for clinicians to stay up to date with the latest advances to provide the best care for patients. In the last 20 years, the US Food and Drug Administration has approved 15 new antiepileptic drugs (AEDs), with many more currently in development. Other advances have been achieved in terms of diagnostic modalities like electroencephalography technology, treatment devices like vagal nerve and deep-brain stimulators, novel alternate routes of drug administration, and improvement in surgical techniques. Specific patient populations, such as the pregnant, elderly, those with HIV/AIDS, and those with psychiatric illness, present their own unique challenges, with AED side effects, drug interactions, and medical–psychiatric comorbidities adding to the conundrum. The purpose of this article is to review the latest literature guiding the management of acute epileptic seizures, focusing on the current challenges across different practice settings, and it discusses studies in various patient populations, including the pregnant, geriatric, those with HIV/AIDS, comatose, psychiatric, and “pseudoseizure” patients, and offers possible evidence-based solutions or the expert opinion of the authors. Also included is information on newer AEDs, routes of administration, and significant AED-related drug-interaction tables. This review has tried to address only some of these issues that any practitioner who deals with the acute management of seizures may encounter. The document also highlights the numerous avenues for new research that would help practitioners optimize epilepsy management. PMID:26966367

  11. Surgical Treatment for Refractory Epileptic Spasms: The Detroit Series

    PubMed Central

    Chugani, Harry T; Ilyas, Mohammed; Kumar, Ajay; Juhász, Csaba; Kupsky, William J; Sood, Sandeep; Asano, Eishi

    2015-01-01

    Objective We reviewed our experience of surgery for epileptic spasms (ES) with or without history of infantile spasms. Methods Data were reviewed from 65 (33 males) ES patients who underwent surgery between 1993–2014; palliative cases were excluded. Results Mean age at surgery was 5.1 (range: 0.2–19) years, with mean post-surgical follow-up of 45.3 (6–120) months. Mean number of anticonvulsants used pre-operatively was 4.2 (2–8) which decreased to 1.2 (0–4) post-operatively (p<0.0001). Total hemispherectomy was the most commonly performed surgery (n=20), followed by subtotal hemispherectomy (n=17), multilobar resection (n=13), lobectomy (n=7), tuberectomy (n=6) and lobectomy+tuberectomy (n=2), with ILAE class-I outcome in 20, 10, 7, 6, 3 and 0 patients, respectively (total=46/65 (71%); 22 off medication). Shorter duration of epilepsy (p=0.022) and presence of MRI lesion (p=0.026) were independently associated with class-I outcome. Of 34 patients operated <3 years after seizure onset, 30 (88%) achieved class-I outcome. 37/47 patients with lesional MRI (79%) had class-I outcome, whereas 9/18 with normal MRI (50%) had class-I outcome. PET scan was abnormal in almost all patients [61/63 (97%) with lateralizing/localizing findings in 56/61 (92%) patients, thus helping in surgical decision-making and guiding subdural grid placements, particularly in patients with non-lesional MRI. Fifteen had post-operative complications, mostly minor. Significance Curative epilepsy surgery in ES patients, with or without history of infantile spasms, is best accomplished at an early age and in those with lesional abnormalities on MRI with EEG concordance. Good outcomes can be achieved even when there is no MRI lesion but positive PET localization. PMID:26522016

  12. Guanosine may increase absence epileptic activity by means of A2A adenosine receptors in Wistar Albino Glaxo Rijswijk rats.

    PubMed

    Lakatos, Renáta Krisztina; Dobolyi, Árpád; Todorov, Mihail Ivilinov; Kékesi, Katalin A; Juhász, Gábor; Aleksza, Magdolna; Kovács, Zsolt

    2016-06-01

    The non-adenosine nucleoside guanosine (Guo) was demonstrated to decrease quinolinic acid(QA)-induced seizures, spontaneously emerged absence epileptic seizures and lipopolysaccharide(LPS)-evoked induction of absence epileptic seizures suggesting its antiepileptic potential. It was also described previously that intraperitoneal (i.p.) injection of 20 and 50mg/kg Guo decreased the number of spike-wave discharges (SWDs) in a well investigated model of human absence epilepsy, the Wistar Albino Glaxo Rijswijk (WAG/Rij) rats during 4th (20mg/kg Guo) and 3rd as well as 4th (50mg/kg Guo) measuring hours. Guanosine can potentially decrease SWD number by means of its putative receptors but absence epileptic activity changing effects of Guo by means of increased extracellular adenosine (Ado) cannot be excluded. An increase in the dose of i.p. injected Guo is limited by its low solubility in saline, therefore, we addressed in the present study whether higher doses of Guo, diluted in sodium hydroxide (NaOH) solution, have more potent antiepileptic effect in WAG/Rij rats. We confirmed that i.p. 50mg/kg Guo decreased but, surprisingly, i.p. 100mg/kg Guo enhanced the number of SWDs in WAG/Rij rats. Combined i.p. injection of a non-selective Ado receptor antagonist theophylline (5mg/kg) or a selective Ado A2A receptor (A2AR) antagonist SCH 58261 (7-(2-phenylethyl)-5-amino-2-(2-furyl)-pyrazolo-[4,3-e]-1,2,4-triazolo[1,5-c]pyrimidine) (1mg/kg) and a cyclooxygenase 1 and 2/COX-1 and COX-2 inhibitor indomethacin (10mg/kg) with 100mg/kg Guo decreased the SWD number compared to i.p. 100mg/kg Guo alone. The results suggest that i.p. 100mg/kg Guo can increase SWD number by means of the adenosinergic system.

  13. Andrographolide Stimulates Neurogenesis in the Adult Hippocampus

    PubMed Central

    Varela-Nallar, Lorena; Arredondo, Sebastian B.; Tapia-Rojas, Cheril; Hancke, Juan; Inestrosa, Nibaldo C.

    2015-01-01

    Andrographolide (ANDRO) is a labdane diterpenoid component of Andrographis paniculata widely used for its anti-inflammatory properties. We have recently determined that ANDRO is a competitive inhibitor of glycogen synthase kinase-3β (GSK-3β), a key enzyme of the Wnt/β-catenin signaling cascade. Since this signaling pathway regulates neurogenesis in the adult hippocampus, we evaluated whether ANDRO stimulates this process. Treatment with ANDRO increased neural progenitor cell proliferation and the number of immature neurons in the hippocampus of 2- and 10-month-old mice compared to age-matched control mice. Moreover, ANDRO stimulated neurogenesis increasing the number of newborn dentate granule neurons. Also, the effect of ANDRO was evaluated in the APPswe/PS1ΔE9 transgenic mouse model of Alzheimer's disease. In these mice, ANDRO increased cell proliferation and the density of immature neurons in the dentate gyrus. Concomitantly with the increase in neurogenesis, ANDRO induced the activation of the Wnt signaling pathway in the hippocampus of wild-type and APPswe/PS1ΔE9 mice determined by increased levels of β-catenin, the inactive form of GSK-3β, and NeuroD1, a Wnt target gene involved in neurogenesis. Our findings indicate that ANDRO stimulates neurogenesis in the adult hippocampus suggesting that this drug could be used as a therapy in diseases in which neurogenesis is affected. PMID:26798521

  14. Andrographolide Stimulates Neurogenesis in the Adult Hippocampus.

    PubMed

    Varela-Nallar, Lorena; Arredondo, Sebastian B; Tapia-Rojas, Cheril; Hancke, Juan; Inestrosa, Nibaldo C

    2015-01-01

    Andrographolide (ANDRO) is a labdane diterpenoid component of Andrographis paniculata widely used for its anti-inflammatory properties. We have recently determined that ANDRO is a competitive inhibitor of glycogen synthase kinase-3β (GSK-3β), a key enzyme of the Wnt/β-catenin signaling cascade. Since this signaling pathway regulates neurogenesis in the adult hippocampus, we evaluated whether ANDRO stimulates this process. Treatment with ANDRO increased neural progenitor cell proliferation and the number of immature neurons in the hippocampus of 2- and 10-month-old mice compared to age-matched control mice. Moreover, ANDRO stimulated neurogenesis increasing the number of newborn dentate granule neurons. Also, the effect of ANDRO was evaluated in the APPswe/PS1ΔE9 transgenic mouse model of Alzheimer's disease. In these mice, ANDRO increased cell proliferation and the density of immature neurons in the dentate gyrus. Concomitantly with the increase in neurogenesis, ANDRO induced the activation of the Wnt signaling pathway in the hippocampus of wild-type and APPswe/PS1ΔE9 mice determined by increased levels of β-catenin, the inactive form of GSK-3β, and NeuroD1, a Wnt target gene involved in neurogenesis. Our findings indicate that ANDRO stimulates neurogenesis in the adult hippocampus suggesting that this drug could be used as a therapy in diseases in which neurogenesis is affected.

  15. The role of the hippocampus in navigation is memory.

    PubMed

    Eichenbaum, Howard

    2017-04-01

    There is considerable research on the neurobiological mechanisms within the hippocampal system that support spatial navigation. In this article I review the literature on navigational strategies in humans and animals, observations on hippocampal function in navigation, and studies of hippocampal neural activity in animals and humans performing different navigational tasks and tests of memory. Whereas the hippocampus is essential to spatial navigation via a cognitive map, its role derives from the relational organization and flexibility of cognitive maps and not from a selective role in the spatial domain. Correspondingly, hippocampal networks map multiple navigational strategies, as well as other spatial and nonspatial memories and knowledge domains that share an emphasis on relational organization. These observations suggest that the hippocampal system is not dedicated to spatial cognition and navigation, but organizes experiences in memory, for which spatial mapping and navigation are both a metaphor for and a prominent application of relational memory organization.

  16. Phase synchronization analysis of voltage-sensitive dye imaging during drug-induced epileptic seizures.

    NASA Astrophysics Data System (ADS)

    Takeshita, Daisuke; Tsytsarev, Vassiliy; Bahar, Sonya

    2008-03-01

    Epileptic seizures are generally held to result from excess and synchronized neural activity. However, recent studies have suggested that this is not necessarily the case. We investigate how the spatiotemporal pattern of synchronization changes during drug-induced in vivo neocortical seizures in rats. Epileptic seizures are caused by the potassium channel blocker 4-aminopyridine, which is often used in experiments to induce epileptic seizures. In our experiments, the neocortex is stained with the voltage-sensitive dye RH-1691. The intensity changes in dye fluorescence are measured by a CCD camera and are consistent with the signal from local field potential recording. We apply phase synchronization analysis to the voltage-sensitive dye signals from pairs of pixels in order to investigate the degree to which synchronization occurs, and how spatial patterns of synchrony may change, during the course of the seizure. Our preliminary results show that two distant pixels are well synchronized during a seizure event.

  17. Epileptic seizure classification of EEG time-series using rational discrete short-time fourier transform.

    PubMed

    Samiee, Kaveh; Kovács, Petér; Gabbouj, Moncef

    2015-02-01

    A system for epileptic seizure detection in electroencephalography (EEG) is described in this paper. One of the challenges is to distinguish rhythmic discharges from nonstationary patterns occurring during seizures. The proposed approach is based on an adaptive and localized time-frequency representation of EEG signals by means of rational functions. The corresponding rational discrete short-time Fourier transform (DSTFT) is a novel feature extraction technique for epileptic EEG data. A multilayer perceptron classifier is fed by the coefficients of the rational DSTFT in order to separate seizure epochs from seizure-free epochs. The effectiveness of the proposed method is compared with several state-of-art feature extraction algorithms used in offline epileptic seizure detection. The results of the comparative evaluations show that the proposed method outperforms competing techniques in terms of classification accuracy. In addition, it provides a compact representation of EEG time-series.

  18. The Lombrosian prejudice in medicine. The case of epilepsy. Epileptic psychosis. Epilepsy and aggressiveness.

    PubMed

    Granieri, Enrico; Fazio, Patrik

    2012-02-01

    In the nineteenth century, epilepsy became subject of experimental research. Lombroso established a relationship between epilepsy and criminality believing in the existence of epileptoid traits and atavism. He tried to demonstrate the common origin of epilepsy, criminality, and genius; factors deteriorating the CNS would act upon centers, which control behavior and ethics. This impairment would cause a lack of control on the lower nervous centers, reducing restraints of instincts and criminal behavior. He described developmental frontal cortex lesions in epileptic patients (today Taylor's dysplasia) and these observations supported the erroneous conviction of a relationship between criminality and epilepsy. Neurological, behavioral, and criminological sciences analyzed Lombroso's doctrine, whereas it was controversial that epileptic patients should be prone to violent actions and aggressive behavior. Today, there is an international panel of experts on epilepsy, which suggests five relevant criteria to determine if a crime committed with aggressiveness could result from epileptic seizures.

  19. Long-term variability of global statistical properties of epileptic brain networks

    NASA Astrophysics Data System (ADS)

    Kuhnert, Marie-Therese; Elger, Christian E.; Lehnertz, Klaus

    2010-12-01

    We investigate the influence of various pathophysiologic and physiologic processes on global statistical properties of epileptic brain networks. We construct binary functional networks from long-term, multichannel electroencephalographic data recorded from 13 epilepsy patients, and the average shortest path length and the clustering coefficient serve as global statistical network characteristics. For time-resolved estimates of these characteristics we observe large fluctuations over time, however, with some periodic temporal structure. These fluctuations can—to a large extent—be attributed to daily rhythms while relevant aspects of the epileptic process contribute only marginally. Particularly, we could not observe clear cut changes in network states that can be regarded as predictive of an impending seizure. Our findings are of particular relevance for studies aiming at an improved understanding of the epileptic process with graph-theoretical approaches.

  20. Wavelet-based texture analysis of EEG signal for prediction of epileptic seizure

    NASA Astrophysics Data System (ADS)

    Petrosian, Arthur A.; Homan, Richard; Pemmaraju, Suryalakshmi; Mitra, Sunanda

    1995-09-01

    Electroencephalographic (EEG) signal texture content analysis has been proposed for early warning of an epileptic seizure. This approach was evaluated by investigating the interrelationship between texture features and basic signal informational characteristics, such as Kolmogorov complexity and fractal dimension. The comparison of several traditional techniques, including higher-order FIR digital filtering, chaos, autoregressive and FFT time- frequency analysis was also carried out on the same epileptic EEG recording. The purpose of this study is to investigate whether wavelet transform can be used to further enhance the developed methods for prediction of epileptic seizures. The combined consideration of texture and entropy characteristics extracted from subsignals decomposed by wavelet transform are explored for that purpose. Yet, the novel neuro-fuzzy clustering algorithm is performed on wavelet coefficients to segment given EEG recording into different stages prior to an actual seizure onset.

  1. Management of a high risk epileptic patient under conscious sedation: A multidisciplinary approach

    PubMed Central

    Chellathurai, Burnice Nalina Kumari; Thiagarajan, Ramakrishnan; Jayakumaran, SelvaKumar; Devadoss, Pradeep; Elavazhagan

    2016-01-01

    Epilepsy, characterized by the risk of recurrent seizures, is a chronic disease that afflicts about 5% of the world's population. The main dental problems associated with epileptic patients include gingival hyperplasia, minor oral injuries, tooth trauma, and prosthodontic problems, which require the dental treatment. Stress and fear are the most common triggering factors for the epilepsy in dental chair. Therefore, a more appropriate method of treating such epileptic patients may be warranted. Conscious sedation is a technique of providing good anesthesia and analgesia to patients, the main advantage of which is the patient's rapid return to presentation levels. Midazolam used as a sedative agent has anticonvulsant properties. This case report highlights a case requiring multiple dental procedures carried out in a high risk epileptic patient under conscious sedation. PMID:27041847

  2. Management of a high risk epileptic patient under conscious sedation: A multidisciplinary approach.

    PubMed

    Chellathurai, Burnice Nalina Kumari; Thiagarajan, Ramakrishnan; Jayakumaran, SelvaKumar; Devadoss, Pradeep; Elavazhagan

    2016-01-01

    Epilepsy, characterized by the risk of recurrent seizures, is a chronic disease that afflicts about 5% of the world's population. The main dental problems associated with epileptic patients include gingival hyperplasia, minor oral injuries, tooth trauma, and prosthodontic problems, which require the dental treatment. Stress and fear are the most common triggering factors for the epilepsy in dental chair. Therefore, a more appropriate method of treating such epileptic patients may be warranted. Conscious sedation is a technique of providing good anesthesia and analgesia to patients, the main advantage of which is the patient's rapid return to presentation levels. Midazolam used as a sedative agent has anticonvulsant properties. This case report highlights a case requiring multiple dental procedures carried out in a high risk epileptic patient under conscious sedation.

  3. A case report of stellate ganglion block in the treatment of epileptic pain

    PubMed Central

    Wang, Shengtao; Zhu, Yangzi

    2017-01-01

    Abstract Rationale: Stellate ganglion blocks have been shown to provide effective pain relief in a number of different conditions, but no one had reported stellate ganglion blocks for the treatment of epileptic pain. We describe a case report of the successful use of stellate ganglion block in the treatment of epileptic pain in the patient. Patient concerns: A 8-year-old girl who had experienced severe paroxysmal pain in her right upper limb. Diagnoses: She was diagnosed as drug-resistant partial epilepsy. Interventions: The patient received stellate ganglion blocks with lidocaine for 2 courses with 2 weeks in a course of treatment and oral carbamazepine once a day. Outcomes: Carbamazepine dosage gradually tapered until stop and epileptic pain attacks become less and less, eventually disappear. Lessons: Stellate ganglion block may be an effective treatment of intractable partial epilepsy. However, more research is now needed to verify the validity. PMID:28178147

  4. De Novo Mutations in Synaptic Transmission Genes Including DNM1 Cause Epileptic Encephalopathies

    PubMed Central

    Appenzeller, Silke; Balling, Rudi; Barisic, Nina; Baulac, Stéphanie; Caglayan, Hande; Craiu, Dana; De Jonghe, Peter; Depienne, Christel; Dimova, Petia; Djémié, Tania; Gormley, Padhraig; Guerrini, Renzo; Helbig, Ingo; Hjalgrim, Helle; Hoffman-Zacharska, Dorota; Jähn, Johanna; Klein, Karl Martin; Koeleman, Bobby; Komarek, Vladimir; Krause, Roland; Kuhlenbäumer, Gregor; Leguern, Eric; Lehesjoki, Anna-Elina; Lemke, Johannes R.; Lerche, Holger; Linnankivi, Tarja; Marini, Carla; May, Patrick; Møller, Rikke S.; Muhle, Hiltrud; Pal, Deb; Palotie, Aarno; Pendziwiat, Manuela; Robbiano, Angela; Roelens, Filip; Rosenow, Felix; Selmer, Kaja; Serratosa, Jose M.; Sisodiya, Sanjay; Stephani, Ulrich; Sterbova, Katalin; Striano, Pasquale; Suls, Arvid; Talvik, Tiina; von Spiczak, Sarah; Weber, Yvonne; Weckhuysen, Sarah; Zara, Federico; Abou-Khalil, Bassel; Alldredge, Brian K.; Andermann, Eva; Andermann, Frederick; Amron, Dina; Bautista, Jocelyn F.; Berkovic, Samuel F.; Bluvstein, Judith; Boro, Alex; Cascino, Gregory; Consalvo, Damian; Crumrine, Patricia; Devinsky, Orrin; Dlugos, Dennis; Epstein, Michael P.; Fiol, Miguel; Fountain, Nathan B.; French, Jacqueline; Friedman, Daniel; Geller, Eric B.; Glauser, Tracy; Glynn, Simon; Haas, Kevin; Haut, Sheryl R.; Hayward, Jean; Helmers, Sandra L.; Joshi, Sucheta; Kanner, Andres; Kirsch, Heidi E.; Knowlton, Robert C.; Kossoff, Eric H.; Kuperman, Rachel; Kuzniecky, Ruben; Lowenstein, Daniel H.; McGuire, Shannon M.; Motika, Paul V.; Novotny, Edward J.; Ottman, Ruth; Paolicchi, Juliann M.; Parent, Jack; Park, Kristen; Poduri, Annapurna; Sadleir, Lynette; Scheffer, Ingrid E.; Shellhaas, Renée A.; Sherr, Elliott; Shih, Jerry J.; Singh, Rani; Sirven, Joseph; Smith, Michael C.; Sullivan, Joe; Thio, Liu Lin; Venkat, Anu; Vining, Eileen P.G.; Von Allmen, Gretchen K.; Weisenberg, Judith L.; Widdess-Walsh, Peter; Winawer, Melodie R.; Allen, Andrew S.; Berkovic, Samuel F.; Cossette, Patrick; Delanty, Norman; Dlugos, Dennis; Eichler, Evan E.; Epstein, Michael P.; Glauser, Tracy; Goldstein, David B.; Han, Yujun; Heinzen, Erin L.; Johnson, Michael R.; Kuzniecky, Ruben; Lowenstein, Daniel H.; Marson, Anthony G.; Mefford, Heather C.; Nieh, Sahar Esmaeeli; O’Brien, Terence J.; Ottman, Ruth; Petrou, Stephen; Petrovski, Slavé; Poduri, Annapurna; Ruzzo, Elizabeth K.; Scheffer, Ingrid E.; Sherr, Elliott

    2014-01-01

    Emerging evidence indicates that epileptic encephalopathies are genetically highly heterogeneous, underscoring the need for large cohorts of well-characterized individuals to further define the genetic landscape. Through a collaboration between two consortia (EuroEPINOMICS and Epi4K/EPGP), we analyzed exome-sequencing data of 356 trios with the “classical” epileptic encephalopathies, infantile spasms and Lennox Gastaut syndrome, including 264 trios previously analyzed by the Epi4K/EPGP consortium. In this expanded cohort, we find 429 de novo mutations, including de novo mutations in DNM1 in five individuals and de novo mutations in GABBR2, FASN, and RYR3 in two individuals each. Unlike previous studies, this cohort is sufficiently large to show a significant excess of de novo mutations in epileptic encephalopathy probands compared to the general population using a likelihood analysis (p = 8.2 × 10−4), supporting a prominent role for de novo mutations in epileptic encephalopathies. We bring statistical evidence that mutations in DNM1 cause epileptic encephalopathy, find suggestive evidence for a role of three additional genes, and show that at least 12% of analyzed individuals have an identifiable causal de novo mutation. Strikingly, 75% of mutations in these probands are predicted to disrupt a protein involved in regulating synaptic transmission, and there is a significant enrichment of de novo mutations in genes in this pathway in the entire cohort as well. These findings emphasize an important role for synaptic dysregulation in epileptic encephalopathies, above and beyond that caused by ion channel dysfunction. PMID:25262651

  5. The NMDAR subunit NR2B expression is modified in hippocampus after repetitive seizures.

    PubMed

    Auzmendi, J; González, N; Girardi, Elena

    2009-05-01

    NMDA receptor is involved in synaptic plasticity, learning, memory and neurological diseases like epilepsia and it is the major mediator of excitotoxicity. NR2B-containing NMDA receptors may be playing a crucial role in epileptic disorders. In the present study the effect of the convulsant drug 3-mercaptopropionic acid (MP) repetitive administration (4-7 days) on the hippocampal NR2B subunit was studied. A significant decrease in NR2B in the whole hippocampus was observed after MP4 with a tendency to recover to normal values in MP7 by western blot assay. Immunohistochemical studies showed a decrease in several CA1 and CA2/3 strata (21-73%). MP7 showed a reversion of the drop observed at 4 days in stratum oriens, pyramidal cell layer in CA1, CA2/3 and CA1 stratum radiatum. A significant fall in the lacunosum molecular layer of both areas and stratum radiatum of CA2/3 was observed. The immunostaining in MP4 showed a decrease in the granulare layer from dentate gyrus (20%), in hillus (71%) and subicullum (63%) as compared with control and these decreases were similar at MP7 values. Results showed decreases in NR2B subunit expression in different areas following repeated MP-induce seizures, suggesting that NR2B expression is altered depending on the diverse hippocampal input and output signals of each region that could be differently involved in modulating MP-induced hyperactivity.

  6. Multi-feature characterization of epileptic activity for construction of an automated internet-based annotated classification.

    PubMed

    Arvind, R; Karthik, B; Sriraam, Natarajan

    2012-06-01

    Continuous monitoring of EEG is essential for the neurologist to detect the epileptic seizures that occur at various intervals. Since large volume of data need to be analyzed, visual analysis has been proven to be time consuming and subsequently automated detection techniques have gained importance in the recent years. For the biomedical research community, the major challenge lies in providing a solution to neurologists in terms of diagnosis and EEG database management. This paper discusses the automated detection of epileptic seizure using frequency domain and entropy parameters which helps in the construction of epileptic database for handling EEG data. Experimental study indicates that the suggested mode of operation can be used for internet based framework which contains pure epileptic patterns in the server. This can be retrieved and analyzed for detection and annotation of epileptic spikes in extensive EEG recordings.

  7. The hippocampus facilitates integration within a symbolic field.

    PubMed

    Cornelius, John Thor

    2017-01-13

    This paper attempts to elaborate a fundamental brain mechanism involved in the creation and maintenance of symbolic fields of thought. It will integrate theories of psychic spaces as explored by Donald Winnicott and Wilfred Bion with the neuroscientific examinations of those with bilateral hippocampal injury to show how evidence from both disciplines sheds important light on this aspect of mind. Possibly originating as a way of maintaining an oriented, first person psychic map, this capacity allows individuals a dynamic narrative access to a realm of layered elements and their connections. If the proposed hypothesis is correct, the hippocampus facilitates the integration of this symbolic field of mind, where narrative forms of thinking, creativity, memory, and dreaming are intertwined. Without the hippocampus, there is an inability to engage many typical forms of thought itself. Also, noting the ways these individuals are not impaired supports theories about other faculties of mind, providing insight into their possible roles within human thought. The evidence of different systems working in conjunction with the symbolic field provides tantalizing clues about these fundamental mechanisms of brain and mind that are normally seamlessly integrated, and hints at future areas of clinical and laboratory research, both within neuroscience and psychoanalysis.

  8. Stress Effects on Neuronal Structure: Hippocampus, Amygdala, and Prefrontal Cortex

    PubMed Central

    McEwen, Bruce S; Nasca, Carla; Gray, Jason D

    2016-01-01

    The hippocampus provided the gateway into much of what we have learned about stress and brain structural and functional plasticity, and this initial focus has expanded to other interconnected brain regions, such as the amygdala and prefrontal cortex. Starting with the discovery of adrenal steroid, and later, estrogen receptors in the hippocampal formation, and subsequent discovery of dendritic and spine synapse remodeling and neurogenesis in the dentate gyrus, mechanistic studies have revealed both genomic and rapid non-genomic actions of circulating steroid hormones in the brain. Many of these actions occur epigenetically and result in ever-changing patterns of gene expression, in which there are important sex differences that need further exploration. Moreover, glucocorticoid and estrogen actions occur synergistically with an increasing number of cellular mediators that help determine the qualitative nature of the response. The hippocampus has also been a gateway to understanding lasting epigenetic effects of early-life experiences. These findings in animal models have resulted in translation to the human brain and have helped change thinking about the nature of brain malfunction in psychiatric disorders and during aging, as well as the mechanisms of the effects of early-life adversity on the brain and the body. PMID:26076834

  9. Anterior hippocampus and goal-directed spatial decision making.

    PubMed

    Viard, Armelle; Doeller, Christian F; Hartley, Tom; Bird, Chris M; Burgess, Neil

    2011-03-23

    Planning spatial paths through our environment is an important part of everyday life and is supported by a neural system including the hippocampus and prefrontal cortex. Here we investigated the precise functional roles of the components of this system in humans by using fMRI as participants performed a simple goal-directed route-planning task. Participants had to choose the shorter of two routes to a goal in a visual scene that might contain a barrier blocking the most direct route, requiring a detour, or might be obscured by a curtain, requiring memory for the scene. The participant's start position was varied to parametrically manipulate their proximity to the goal and the difference in length of the two routes. Activity in medial prefrontal cortex, precuneus, and left posterior parietal cortex was associated with detour planning, regardless of difficulty, whereas activity in parahippocampal gyrus was associated with remembering the spatial layout of the visual scene. Activity in bilateral anterior hippocampal formation showed a strong increase the closer the start position was to the goal, together with medial prefrontal, medial and posterior parietal cortices. Our results are consistent with computational models in which goal proximity is used to guide subsequent navigation and with the association of anterior hippocampal areas with nonspatial functions such as arousal and reward expectancy. They illustrate how spatial and nonspatial functions combine within the anterior hippocampus, and how these functions interact with parahippocampal, parietal, and prefrontal areas in decision making and mnemonic function.

  10. The hippocampus and the flexible use and processing of language

    PubMed Central

    Duff, Melissa C.; Brown-Schmidt, Sarah

    2012-01-01

    Fundamental to all human languages is an unlimited expressive capacity and creative flexibility that allow speakers to rapidly generate novel and complex utterances. In turn, listeners interpret language “on-line,” incrementally integrating multiple sources of information as words unfold over time. A challenge for theories of language processing has been to understand how speakers and listeners generate, gather, integrate, and maintain representations in service of language processing. We propose that many of the processes by which we use language place high demands on and receive contributions from the hippocampal declarative memory system. The hippocampal declarative memory system is long known to support relational binding and representational flexibility. Recent findings demonstrate that these same functions are engaged during the real-time processes that support behavior in-the-moment. Such findings point to the hippocampus as a potentially key contributor to cognitive functions that require on-line integration of multiple sources of information, such as on-line language processing. Evidence supporting this view comes from findings that individuals with hippocampal amnesia show deficits in the use of language flexibly and on-line. We conclude that the relational binding and representational flexibility afforded by the hippocampal declarative memory system positions the hippocampus as a key contributor to language use and processing. PMID:22493573

  11. Emperor Napoleon Bonaparte: did he have seizures? Psychogenic or epileptic or both?

    PubMed

    Hughes, John R

    2003-12-01

    Napoleon Bonaparte was a general in the French army at 24 years of age, later conquering most of Europe. He was one of the greatest military geniuses the world has ever known, but also an extremely intelligent individual. Did he have seizures? The evidence shows that he had both psychogenic and epileptic attacks. The psychogenic attacks were likely related to the tremendous stress in his life, and the epileptic seizures were the result of chronic uremia from a severe urethral stricture caused by gonorrhea that was transmitted from his wife, Empress Josephine.

  12. [Semiological comparison of spontaneous and bemegride-induced epileptic seizures (author's transl)].

    PubMed

    Micheletti, M; Laroye, M; Coquillat, G; Micheletti, G; Kurtz, D

    1979-01-01

    The authors view an epileptic seizure as a series of symptoms which they can localize on the bases of data taken from stereoelectroencephalography literature. They reconstruct and compare the presumed organization (origin and propagation) of the discharge in 100 epileptic subjects. Both spontaneous and megimide-induced seizures are considered. The results involve 34 subjects with quite similar spontaneous and induced seizures. Comparison of the two critical modalities show that : 1) There is no variation in the chronological relationship of the symptoms. 3) There are differences in the symptomatology. These differences may be interpreted as non-uniform response of involved structures to the source of activation, or as involvement of new structures.

  13. The Ohio Hospital for Epileptics-the first "epilepsy colony" in America.

    PubMed

    Kissiov, Djem; Dewall, Taylor; Hermann, Bruce

    2013-09-01

    This review examines the planning, development, and course of the first established colony for epilepsy in the United States-The Ohio Hospital for Epileptics. The events leading to the development of the colony, its early course, and the people who were instrumental in its establishment and maintenance are reviewed. At approximately the same time as the development of the Ohio Hospital for Epileptics, eugenics was gaining momentum in America, which affected epilepsy deeply. How this movement influenced thinking and practice at the Ohio Hospital is also reviewed.

  14. Complex phase synchronization in epileptic seizures: Evidence for a devil's staircase

    NASA Astrophysics Data System (ADS)

    Perez Velazquez, J. L.; Garcia Dominguez, L.; Wennberg, R.

    2007-01-01

    We describe multifrequency phase synchronization in epileptic seizures. Using magnetoencephalographic recordings from three patients suffering generalized seizures, the evidence is presented that, in addition to the commonly studied 1:1 frequency locking, there exists complex multifrequency coordination that, in some cases, follows a classical “devil’s staircase.” Within the limitations of observing this phenomenon in a clinical experimental setting, these observations reveal that in pathological brain activity, complex frequency locking can be found similar to that identified in certain pathological cardiac re-entrant arrhythmias. This may suggest the existence of similar re-entrant mechanisms active in cerebral neocortex during epileptic seizures.

  15. Facilitation of epileptic activity during sleep is mediated by high amplitude slow waves.

    PubMed

    Frauscher, Birgit; von Ellenrieder, Nicolás; Ferrari-Marinho, Taissa; Avoli, Massimo; Dubeau, François; Gotman, Jean

    2015-06-01

    Epileptic discharges in focal epilepsy are frequently activated during non-rapid eye movement sleep. Sleep slow waves are present during this stage and have been shown to include a deactivated ('down', hyperpolarized) and an activated state ('up', depolarized). The 'up' state enhances physiological rhythms, and we hypothesize that sleep slow waves and particularly the 'up' state are the specific components of non-rapid eye movement sleep that mediate the activation of epileptic activity. We investigated eight patients with pharmaco-resistant focal epilepsies who underwent combined scalp-intracerebral electroencephalography for diagnostic evaluation. We analysed 259 frontal electroencephalographic channels, and manually marked 442 epileptic spikes and 8487 high frequency oscillations during high amplitude widespread slow waves, and during matched control segments with low amplitude widespread slow waves, non-widespread slow waves or no slow waves selected during the same sleep stages (total duration of slow wave and control segments: 49 min each). During the slow waves, spikes and high frequency oscillations were more frequent than during control segments (79% of spikes during slow waves and 65% of high frequency oscillations, both P ∼ 0). The spike and high frequency oscillation density also increased for higher amplitude slow waves. We compared the density of spikes and high frequency oscillations between the 'up' and 'down' states. Spike and high frequency oscillation density was highest during the transition from the 'up' to the 'down' state. Interestingly, high frequency oscillations in channels with normal activity expressed a different peak at the transition from the 'down' to the 'up' state. These results show that the apparent activation of epileptic discharges by non-rapid eye movement sleep is not a state-dependent phenomenon but is predominantly associated with specific events, the high amplitude widespread slow waves that are frequent, but not

  16. The epileptic syndromes with continuous spikes and waves during slow sleep: definition and management guidelines.

    PubMed

    Van Bogaert, P; Aeby, A; De Borchgrave, V; De Cocq, C; Deprez, M; De Tiège, X; de Tourtchaninoff, M; Dubru, J M; Foulon, M; Ghariani, S; Grisar, T; Legros, B; Ossemann, M; Tugendhaft, P; van Rijckevorsel, K; Verheulpen, D

    2006-06-01

    The authors propose to define the epileptic syndromes with continuous spikes and waves during slow sleep (CSWS) as a cognitive or behavioral impairment acquired during childhood, associated with a strong activation of the interictal epileptiform discharges during NREM sleep--whatever focal or generalized--and not related to another factor than the presence of CSWS. The type of syndrome will be defined according to the neurological and neuropsychological deficit. These syndromes have to be classified among the localization-related epileptic syndromes. Some cases are idiopathic and others are symptomatic. Guidelines for work-up and treatment are proposed.

  17. Canine and feline epileptic seizures and the lunar cycle: 2,507 seizures (2000-2008).

    PubMed

    Browand-Stainback, Laura; Levesque, Donald; McBee, Matthew

    2011-01-01

    Epileptic seizures in 211 canine and feline patients diagnosed with idiopathic epilepsy were evaluated for temporal significance in relation to the lunar cycle. Seizure counts were compared among each of the eight individual lunar phases, among each of eight exact lunar phase dates, and by percent of lunar illumination using generalized estimating equations. No statistical significance was found in any of these comparisons excluding a relationship between the onset of epileptic seizures and the phases of the moon. Alteration in anticonvulsant treatment or monitoring of canine and feline patients with idiopathic epilepsy at large was not warranted based on the lunar cycle.

  18. First records of Hippocampus algiricus in the Canary Islands (north-east Atlantic Ocean) with an observation of hybridization with Hippocampus hippocampus.

    PubMed

    Otero-Ferrer, F; Herrera, R; López, A; Socorro, J; Molina, L; Bouza, C

    2015-10-01

    Morphometric and genetic analyses confirmed the first records of the West African seahorse Hippocampus algiricus at Gran Canaria Island (north-east Atlantic Ocean), and also the first evidence of interspecific hybridization in seahorses. These results provide additional data on the distribution of H. algiricus that may help to establish future conservation strategies, and uncover a new potential sympatric scenario between H. algiricus and Hippocampus hippocampus.

  19. The function of BMP4 during neurogenesis in the adult hippocampus in Alzheimer's disease.

    PubMed

    Xu, Haiwei; Huang, Wei; Wang, Yanjiang; Sun, Weizhong; Tang, Jun; Li, Dabing; Xu, Pei; Guo, Liang; Yin, Zheng Qin; Fan, Xiaotang

    2013-01-01

    Alzheimer's disease (AD) is an age-related, progressive and irreversible neurodegenerative disease that results in the loss of selected neurons throughout the basal forebrain, amygdala, hippocampus, and cortical area as well as progressive deficits of cognition and memory. The subgranular zone (SGZ) of the hippocampal dentate gyrus (DG) is one of the regions where adult neurogenesis occurs in mammals, including humans and non-human primates. The new granule cells, which are the primary excitatory neurons in the DG, contribute to the processes of learning and memory. The changes in neurogenesis observed during the initial stages and progression of AD suggest that the modulation of the new production of neurons at neurogenic sites may exert profound effects on hippocampal function. Bone morphogenetic protein-4 (BMP4) and its antagonist Noggin contribute to the modulation of neurogenesis in the adult hippocampus, thereby affecting hippocampal function. This review focuses on the role of BMP4 and Noggin in the control of the stem and precursor cells in the adult hippocampus during AD and their potential as a possible therapeutic strategy for AD sufferers. It is helpful to extend the understanding of the control of stem cells in the normal and diseased hippocampus.

  20. Network dynamics of the brain and influence of the epileptic seizure onset zone.

    PubMed

    Burns, Samuel P; Santaniello, Sabato; Yaffe, Robert B; Jouny, Christophe C; Crone, Nathan E; Bergey, Gregory K; Anderson, William S; Sarma, Sridevi V

    2014-12-09

    The human brain is a dynamic networked system. Patients with partial epileptic seizures have focal regions that periodically diverge from normal brain network dynamics during seizures. We studied the evolution of brain connectivity before, during, and after seizures with graph-theoretic techniques on continuous electrocorticographic (ECoG) recordings (5.4 ± 1.7 d per patient, mean ± SD) from 12 patients with temporal, occipital, or frontal lobe partial onset seizures. Each electrode was considered a node in a graph, and edges between pairs of nodes were weighted by their coherence within a frequency band. The leading eigenvector of the connectivity matrix, which captures network structure, was tracked over time and clustered to uncover a finite set of brain network states. Across patients, we found that (i) the network connectivity is structured and defines a finite set of brain states, (ii) seizures are characterized by a consistent sequence of states, (iii) a subset of nodes is isolated from the network at seizure onset and becomes more connected with the network toward seizure termination, and (iv) the isolated nodes may identify the seizure onset zone with high specificity and sensitivity. To localize a seizure, clinicians visually inspect seizures recorded from multiple intracranial electrode contacts, a time-consuming process that may not always result in definitive localization. We show that network metrics computed from all ECoG channels capture the dynamics of the seizure onset zone as it diverges from normal overall network structure. This suggests that a state space model can be used to help localize the seizure onset zone in ECoG recordings.

  1. Cortical sulcal areas in baboons (Papio hamadryas spp.) with generalized interictal epileptic discharges on scalp EEG.

    PubMed

    Szabó, C A; Kochunov, P; Knape, K D; McCoy, K J M; Leland, M M; Lancaster, J L; Fox, P T; Williams, J T; Rogers, J

    2011-02-01

    Brain MRI studies in people with idiopathic generalized epilepsies demonstrate regional morphometric differences, though variable in magnitude and location. As the baboon provides an excellent electroclinical and neuroimaging model for photosensitive generalized epilepsy in humans, this study evaluated MRI volumetric and morphometric differences between baboons with interictal epileptic discharges (IEDs) on scalp EEG and baboons with normal EEG studies. Seventy-seven baboons underwent high-resolution brain MRI and scalp EEG studies. The scans were acquired using an 8-channel primate head coil (Siemens TRIO 3T scanner, Erlangen, Germany). After spatial normalization, sulcal measurements were obtained by object-based-morphology methods. One-hour scalp EEG studies were performed in animals sedated with ketamine. Thirty-eight (22F/16M) baboons had normal EEGs (IED-), while 39 (22F/17M) had generalized IEDs (IED+). The two groups were compared for age, total brain volume, and sulcal areas (Hotelling's Trace) as well as between-subjects comparison of 11 individual sulcal areas (averaged between left and right hemispheres). There were no differences between IED- and IED+ groups with respect to age or total brain (gray or white matter) volume, and multivariate tests demonstrated a marginally significant decrease of sulcal areas in IED+ baboons (p=0.075). Tests of between-subjects effects showed statistically significant decreases in the intraparietal (p=0.002), central (p=0.03) and cingulate sulci (p=0.02), and marginal decreases involving the lunate (p=0.07) and superior temporal sulci (p=0.08). Differences in sulcal areas in IED+ baboons may reflect global developmental abnormalities, while decreases of areas of specific sulci reflect anatomical markers for potential generators or cortical nodes of the networks underlying spontaneous seizures and photosensitivity in the baboon.

  2. Distribution of glutamate transporters in the hippocampus of patients with pharmaco-resistant temporal lobe epilepsy.

    PubMed

    Proper, E A; Hoogland, G; Kappen, S M; Jansen, G H; Rensen, M G A; Schrama, L H; van Veelen, C W M; van Rijen, P C; van Nieuwenhuizen, O; Gispen, W H; de Graan, P N E

    2002-01-01

    In patients suffering from temporal lobe epilepsy (TLE), increased extracellular glutamate levels in the epileptogenic hippocampus both during and after clinical seizures have been reported. These increased glutamate levels could be the result of malfunctioning and/or downregulation of glutamate transporters (also known as EAATs; excitatory amino acid transporters). In this study, the distribution of protein and mRNA of EAAT subtypes was examined in the hippocampus of TLE patients with hippocampal sclerosis (HS group) and without hippocampal sclerosis (non-HS group), and in autopsy controls without neurological disorders. EAAT protein localization was studied by immunohistochemistry on paraffin sections using specific poly- and monoclonal antibodies against the glial glutamate transporters EAAT1 and EAAT2 and the neuronal glutamate transporter EAAT3. Antibody specificity was shown by immunoblotting. In the HS group, a small decrease in EAAT1-immunoreactivity (IR) was observed in CA4 and in the polymorphic and supragranular layer of the dentate gyrus, compared with the control group. The strongest changes were found for EAAT2 levels. In the non-HS group, increased EAAT2-IR was detected in the CA1 and CA2 field, compared with non-epileptic controls. EAAT2-IR was decreased in the HS compared with the non-HS group. Fewer EAAT3-positive cells were found in the HS group than in the non-HS and control group. In both TLE groups, increased EAAT3 levels were observed in individual neurones. In the HS group, the percentage of EAAT3-IR neurones was increased in CA2 and in the granule cell layer of the dentate gyrus. Radioactive in situ hybridization for EAAT1-3 confirmed our immunohistochemical results. Non-radioactive in situ hybridization showed that not only astrocytes, but also neurones express EAAT2 mRNA. Taken together, differences in both mRNA and protein levels of glutamate transporter subtypes were found in specific regions in the TLE hippocampus, with most severe

  3. Does the hippocampus keep track of time?

    PubMed

    Palombo, D J; Keane, M M; Verfaellie, M

    2016-03-01

    In the present study, we examined the role of the medial temporal lobe (MTL) in prospective time estimation at short and long timescales using a novel behavioral paradigm adapted from rodent work. Amnesic patients with MTL damage and healthy control participants estimated the duration of nature-based video clips that were either short (≤ 90 s) or long (more than 4 min). Consistent with previous work in rodents, we found that amnesic patients were impaired at making estimations for long, but not for short durations. Critically, these effects were observed in patients who had lesions circumscribed to the hippocampus, suggesting that the pattern observed was not attributable to the involvement of extra-hippocampal structures. That the MTL, and more specifically the hippocampus, is critical for prospective temporal estimation only at long intervals suggests that multiple neurobiological mechanisms support prospective time estimation.

  4. Functional neurogenesis in the adult hippocampus

    NASA Astrophysics Data System (ADS)

    van Praag, Henriette; Schinder, Alejandro F.; Christie, Brian R.; Toni, Nicolas; Palmer, Theo D.; Gage, Fred H.

    2002-02-01

    There is extensive evidence indicating that new neurons are generated in the dentate gyrus of the adult mammalian hippocampus, a region of the brain that is important for learning and memory. However, it is not known whether these new neurons become functional, as the methods used to study adult neurogenesis are limited to fixed tissue. We use here a retroviral vector expressing green fluorescent protein that only labels dividing cells, and that can be visualized in live hippocampal slices. We report that newly generated cells in the adult mouse hippocampus have neuronal morphology and can display passive membrane properties, action potentials and functional synaptic inputs similar to those found in mature dentate granule cells. Our findings demonstrate that newly generated cells mature into functional neurons in the adult mammalian brain.

  5. Development of short-snouted seahorse (Hippocampus hippocampus, L. 1758): osteological and morphological aspects.

    PubMed

    Novelli, B; Otero-Ferrer, F; Socorro, J A; Caballero, M J; Segade-Botella, A; Molina Domínguez, L

    2017-01-25

    Information about early development after male release lags behind studies of juveniles and adult seahorses, and newborn seahorses, similar in shape to adults, are considered juveniles or fry. During early life, Hippocampus hippocampus present behavioural (shift in habitat, from planktonic to benthic) and morphological changes; for this reasons, the aims of this study are to define the stage of development of H. hippocampus after they are expelled from the male brood pouch and to establish direct or indirect development through an osteological analysis. The ossification process was studied in 120 individuals, from their release to 30 days after birth. To analyse the osteological development, Alcian Blue-Alizarin Red double staining technique for bone and cartilage was adapted to this species. At birth, H. hippocampus presents a mainly cartilaginous structure that ossifies in approximately 1 month. The bony armour composed of bony rings and plates develops in 10 days. The caudal fin, a structure absent in juveniles and adult seahorses, is present at birth and progressively disappears with age. The absence of adult osteological structure in newborns, like coronet, bony rings and plates, head spines and components allowing tail prehensile abilities, suggests a metamorphosis before the juvenile stage. During the indirect development, the metamorphic stage started inside brood pouch and followed outside and leads up to reconsider the status of H. hippocampus newborns.

  6. Ictal epileptic headache: a review of current literature and differentiation from migralepsy and other epilepsies.

    PubMed

    Saitowitz, Zacharry; Flamini, Robert; Berenson, Frank

    2014-10-01

    Ictal headaches are increasingly becoming the focus of research as more data demonstrate headaches existing as a sole manifestation of an epileptic event. Due to the difficulty in diagnosing the event as an epileptic phenomenon as opposed to a migraine, the condition is often misdiagnosed. This paper seeks to review the current published literature on ictal epileptic headaches as well as provide differentiation between ictal headaches and similarly presenting conditions. In doing so, we hope to improve the diagnosis of ictal headaches and thus improve patient care. We review two case studies that exemplify the potential of multiple conditions with comparable symptoms to ictal headaches, and discuss how to differentiate the variable diagnoses. As of the writing of this paper, there is no universally agreed upon set of features of ictal headaches; however, reviewing the current literature, there do seem to be several features that should be noted when treating patients. More research on the pathophysiology of ictal epileptic headaches needs to be done before the condition can be fully understood.

  7. The role of antiepileptic drugs in free radicals generation and antioxidant levels in epileptic patients.

    PubMed

    Eldin, Essam Eldin Mohamed Nour; Elshebiny, Hosam Abdel-Fattah; Mohamed, Tarek Mostafa; Abdel-Aziz, Mohamed Abdel-Azim; El-Readi, Mahmoud Zaki

    2016-01-01

    Many risk factors are encountered during the pathogenesis of epilepsy. In this study, the effect of seizure frequency on free radical generation and antioxidants levels in epileptic patients was evaluated. This study was carried out on 15 healthy controls (GI) and 60 epileptic patients treated with mono- or poly-therapy of carbamazepine, valproic acid, or phenytoin. The treated epileptic patients were divided into 2 main groups according to the seizure frequency: controlled seizure patients GII (n = 30) and uncontrolled seizure patients GIII (n = 30). GII included the GIIA subgroup (n = 15) which had been seizure free for more than 12 months and the GIIB subgroup (n = 15) which had been seizure free for a period from 6 to12 months. GIII included GIIIA (n = 15) and GIIIB (n = 15) for patients which had a seizure frequency of less than and more than four times/month, respectively. In comparison to the control group (GI), the levels of nitric oxide (NO) and malondialdehyde/creatinine ratio were significantly increased in GIIB, GIIIA, and GIIIB, while vitamins A and E levels were significantly decreased in GIIIB. Serum NO levels had significant negative correlations with serum vitamin E in the GIIA and GIIB groups, and with vitamin A in the GIIIA and GIIIB groups. However, serum NO had positive correlation with urinary MDA/Cr ratio. The imbalance between free radical generation and antioxidant system in epileptic patients may be a factor in seizure frequency.

  8. Mozart k.545 mimics mozart k.448 in reducing epileptiform discharges in epileptic children.

    PubMed

    Lin, Lung-Chang; Lee, Mei-Wen; Wei, Ruey-Chang; Mok, Hin-Kiu; Wu, Hui-Chuan; Tsai, Chin-Lin; Yang, Rei-Cheng

    2012-01-01

    Mozart K.448 has been shown to improve cognitive function, leading to what is known as the Mozart Effect. Our previous work reveals positive effects of Mozart K.448 in reducing epileptiform discharges in epileptic children. In this study, we evaluated the effect of Mozart K.545 and compared the effects with those of Mozart K.448 on epileptiform discharges in children with epilepsy. Thirty-nine epileptic children with epileptiform discharges were included in the study. They received electroencephalogram examinations before, during, and after listening to Mozart K.448 and K.545, one week apart, respectively. The frequencies of epileptiform discharges were compared. There was a significant decrease in the frequency of epileptiform discharges during and right after listening to Mozart K.448 and K.545 (reduced by 35.7 ± 32.7% during Mozart K.448 and 30.3 ± 44.4% after Mozart K.448; and 34.0 ± 39.5% during Mozart K.545 and 31.8 ± 39.2% after Mozart K.545). Spectrogrammatic analysis of the two pieces of music demonstrated that both share similar spectrogrammatic characteristics. Listening to Mozart K.448 and K.545 decreased the epileptiform discharges in epileptic children. This suggests that Mozart K.448 is not the only piece of music to have beneficial effects on children with epilepsy. Other music with lower harmonics may also decrease epileptiform discharges in epileptic children.

  9. Verbal Memory Compensation: Application to Left and Right Temporal Lobe Epileptic Patients

    ERIC Educational Resources Information Center

    Bresson, Christel; Lespinet-Najib, Veronique; Rougier, Alain; Claverie, Bernard; N'Kaoua, Bernard

    2007-01-01

    This study investigates the compensatory impact of cognitive aids on left and right temporal lobe epileptic patients suffering from verbal memory disorders, who were candidates for surgery. Cognitive aids are defined in the levels-of-processing framework and deal with the depth of encoding, the elaboration of information, and the use of retrieval…

  10. [The role of the nurse in the patient education of young epileptic patients].

    PubMed

    Danse, Marion; Goujon, Estelle

    2015-01-01

    An epileptic seizure in a child is a major source of anxiety and turns the family's everyday life upside down. Through therapeutic education, the nurse guides the families towards the autonomous management of the seizures, antiepileptic treatments, adaptations to daily life and potential comorbidities.

  11. Epileptic Seizure Detection in Eeg Signals Using Multifractal Analysis and Wavelet Transform

    NASA Astrophysics Data System (ADS)

    Uthayakumar, R.; Easwaramoorthy, D.

    2013-06-01

    This paper explores the three different methods to explicitly recognize the healthy and epileptic EEG signals: Modified, Improved, and Advanced forms of Generalized Fractal Dimensions (GFD). The newly proposed scheme is based on GFD and the discrete wavelet transform (DWT) for analyzing the EEG signals. First EEG signals are decomposed into approximation and detail coefficients using DWT and then GFD values of the original EEGs, approximation and detail coefficients are computed. Significant differences are observed among the GFD values of the healthy and epileptic EEGs allowing us to classify seizures with high accuracy. It is shown that the classification rate is very less accurate without DWT as a preprocessing step. The proposed idea is illustrated through the graphical and statistical tools. The EEG data is further tested for linearity by using normal probability plot and we proved that epileptic EEG had significant nonlinearity whereas healthy EEG distributed normally and similar to Gaussian linear process. Therefore, we conclude that the GFD and the wavelet decomposition through DWT are the strong indicators of the state of illness of epileptic patients.

  12. The Persistence of Erroneous Familiarity in an Epileptic Male: Challenging Perceptual Theories of Deja Vu Activation

    ERIC Educational Resources Information Center

    O'Connor, Akira R.; Moulin, Christopher J. A.

    2008-01-01

    We report the case of a 39-year-old, temporal lobe epileptic male, MH. Prior to complex partial seizure, experienced up to three times a day, MH often experiences an aura experienced as a persistent sensation of deja vu. Data-driven theories of deja vu formation suggest that partial familiarity for the perceived stimulus is responsible for the…

  13. Modeling epileptic brain states using EEG spectral analysis and topographic mapping.

    PubMed

    Direito, Bruno; Teixeira, César; Ribeiro, Bernardete; Castelo-Branco, Miguel; Sales, Francisco; Dourado, António

    2012-09-30

    Changes in the spatio-temporal behavior of the brain electrical activity are believed to be associated to epileptic brain states. We propose a novel methodology to identify the different states of the epileptic brain, based on the topographic mapping of the time varying relative power of delta, theta, alpha, beta and gamma frequency sub-bands, estimated from EEG. Using normalized-cuts segmentation algorithm, points of interest are identified in the topographic mappings and their trajectories over time are used for finding out relations with epileptogenic propagations in the brain. These trajectories are used to train a Hidden Markov Model (HMM), which models the different epileptic brain states and the transition among them. Applied to 10 patients suffering from focal seizures, with a total of 30 seizures over 497.3h of data, the methodology shows good results (an average point-by-point accuracy of 89.31%) for the identification of the four brain states--interictal, preictal, ictal and postictal. The results suggest that the spatio-temporal dynamics captured by the proposed methodology are related to the epileptic brain states and transitions involved in focal seizures.

  14. [Relational models and psychopathology of epileptics in a group-psychotherapy perspective (author's transl)].

    PubMed

    Bergonzi, P; Ferro, F M; Mazza, S; Zolo, P

    1976-01-01

    Epileptic patients show a large range of psychopathologic manifestations, both from a qualitative point of view (even with an exact reference to the nature and the site of lesion) and from a quantitative point of view (from the so-called characterial attitude to the psychotic developments). Perhaps all these alterations of psychiatric interest have a common denominator because, after all, they arise from the sum of two essential moments: the experience of the critical event on the one hand, and the interactive network between the patient and those who are present to his critical manifestations on the other. In particular this complex relational psychopathology needs several therapeutic interventions which are to be complementary and concordant so that they may give satisfactory results of psychosocial reinsertion. We think that the model of intervention to be preferred for its effectiveness is that drawn from group-psychotherapy tecniques: the model in which "psychoanalysis meets sociology (Foulkes) seems to be particularly specific to this problem because it concerns the microsocial and investigates (and, by means of the conduction, it resolves) distorted ways of communication and conflictual dynamic interactions. We followed some epileptics in the group-community of the neurological department of a general hospital (of course with other mental, not epileptic, patients). These preliminary studies lead us to point out the theoretical reasons and the practical justifications of such possible management of the psychological manifestations of epileptic patients.

  15. Epileptic Seizure Prediction Using a New Similarity Index for Chaotic Signals

    NASA Astrophysics Data System (ADS)

    Niknazar, Hamid; Nasrabadi, Ali Motie

    Epileptic seizures are generated by abnormal activity of neurons. The prediction of epileptic seizures is an important issue in the field of neurology, since it may improve the quality of life of patients suffering from drug resistant epilepsy. In this study a new similarity index based on symbolic dynamic techniques which can be used for extracting behavior of chaotic time series is presented. Using Freiburg EEG dataset, it is found that the method is able to detect the behavioral changes of the neural activity prior to epileptic seizures, so it can be used for prediction of epileptic seizure. A sensitivity of 63.75% with 0.33 false positive rate (FPR) in all 21 patients and sensitivity of 96.66% with 0.33 FPR in eight patients were achieved using the proposed method. Moreover, the method was evaluated by applying on Logistic and Tent map with different parameters to demonstrate its robustness and ability in determining similarity between two time series with the same chaotic characterization.

  16. Epileptic Encephalopathies and Their Relationship to Developmental Disorders: Do Spikes Cause Autism?

    ERIC Educational Resources Information Center

    Tharp, Barry R.

    2004-01-01

    Epileptic encephalopathies are progressive clinical and electroencephalographic syndromes where deterioration is thought to be caused by frequent seizures and abundant EEG epileptiform activity. Seizures occur in approximately 10-15% of children with pervasive developmental disorders (PDD) and 8-10% have epileptiform EEG abnormalities without…

  17. Fractal spectral analysis of pre-epileptic seizures in terms of criticality

    NASA Astrophysics Data System (ADS)

    Li, Xiaoli; Polygiannakis, J.; Kapiris, P.; Peratzakis, A.; Eftaxias, K.; Yao, X.

    2005-06-01

    The analysis of pre-epileptic seizure through EEG (electroencephalography) is an important issue for epilepsy diagnosis. Currently, there exist some methods derived from the dynamics to analyse the pre-epileptic EEG data. It is still necessary to create a novel method to better fit and explain the EEG data for making sense of the seizures' predictability. In this paper, a fractal wavelet-based spectral method is proposed and applied to analyse EEG recordings from rat experiments. Three types of patterns are found from the 12 experiments; moreover three typical cases corresponding to the three types of seizures are sorted out and analysed in detail by using the new method. The results indicate that this method can reveal the characteristic signs of an approaching seizure, which includes the emergence of long-range correlation, the decrease of anti-persistence behaviour with time and the decrease of the fractal dimension. The pre-seizure features and their implications are further discussed in the framework of the theory of criticality. We suggest that an epileptic seizure could be considered as a generalized kind of 'critical phenomenon', culminating in a large event that is analogous to a kind of 'critical point'. We also emphasize that epileptic event emergence is a non-repetitive process, so the critical interpretation meets a certain number of cases.

  18. Hippocampus responds to auditory change in rabbits.

    PubMed

    Ruusuvirta, T; Astikainen, P; Wikgren, J; Nokia, M

    2010-09-29

    Any change or novelty in the auditory environment is potentially important for survival. The cortex has been implicated in the detection of auditory change whereas the hippocampus has been associated with the detection of auditory novelty. Local field potentials (LFPs) were recorded from the CA1 area of the hippocampus in waking rabbits. In the oddball condition, a rare tone of one frequency (deviant) randomly replaced a repeated tone of another frequency (standard). In the equal-probability condition, the standard was replaced by a set of tones of nine different frequencies in order to remove the repetitive auditory background of the deviant (now labelled as control-deviant) while preserving its temporal probability. In the oddball condition, evoked potentials at 36-80 ms post-stimulus were found to have greater amplitude towards negative polarity for the deviant relative to the standard. No significant differences in response amplitudes were observed between the control-deviant and the standard. These findings suggest that the hippocampus plays a role in auditory change detection.

  19. Oxidative Stress Measurement and Prediction of Epileptic Seizure in Children and Adults With Severe Motor and Intellectual Disabilities

    PubMed Central

    Morimoto, Masahito; Satomura, Shigeko; Hashimoto, Toshiaki; Ito, Etsuro; Kyotani, Shojiro

    2016-01-01

    Background The medical care of severe motor and intellectual disabilities (SMID) depends on the empirical medical care. Epileptic seizure specific to SMID is difficult to suppress using anti-epileptic drugs, and its tendency to persist for long periods poses an issue. The present study was undertaken to evaluate the relationship between epileptic seizure in cases with SMID and oxidative stress in the living body by examining endogenous antioxidants, the degree of oxidation (reactive oxygen metabolites (d-ROMs)), and the biological antioxidant potential (BAP) as indicators. Methods Target patients were 43 SMID epilepsy patients. Blood was sampled before breakfast and medication. As for the specimen, d-ROMs and BAP were measured using the free radical analyzer. Results The present study did not reveal any correlation between endogenous antioxidants (albumin) and the frequency of epileptic seizures. On the other hand, d-ROMs were correlated with the frequency of epileptic seizure. In particular, strong correlations between the frequency of epileptic seizures and the d-ROMs/BAP ratio as well as the BAP/d-ROMs ratio were noted. Conclusions These results indicate that the use of d-ROMs and BAP as biomarkers can provide a tool for predicting the prognosis of epileptic seizures in patients with SMID. PMID:27222671

  20. Gaussian mixture model for the identification of psychogenic non-epileptic seizures using a wearable accelerometer sensor.

    PubMed

    Kusmakar, Shitanshu; Muthuganapathy, Ramanathan; Yan, Bernard; O'Brien, Terence J; Palaniswami, Marimuthu

    2016-08-01

    Any abnormal hypersynchronus activity of neurons can be characterized as an epileptic seizure (ES). A broad class of non-epileptic seizures is comprised of Psychogenic non-epileptic seizures (PNES). PNES are paroxysmal events, which mimics epileptic seizures and pose a diagnostic challenge with epileptic seizures due to their clinical similarities. The diagnosis of PNES is done using video-electroencephalography (VEM) monitoring. VEM being a resource intensive process calls for alternative methods for detection of PNES. There is now an emerging interest in the use of accelerometer based devices for the detection of seizures. In this work, we present an algorithm based on Gaussian mixture model (GMM's) for the identification of PNES, ES and normal movements using a wrist-worn accelerometer device. Features in time, frequency and wavelet domain are extracted from the norm of accelerometry signal. All events are then classified into three classes i.e normal, PNES and ES using a parametric estimate of the multivariate normal probability density function. An algorithm based on GMM's allows us to accurately model the non-epileptic and epileptic movements, thus enhancing the overall predictive accuracy of the system. The new algorithm was tested on data collected from 16 patients and showed an overall detection accuracy of 91% with 25 false alarms.

  1. Alzheimer's disease pathology in the neocortex and hippocampus of the western lowland gorilla (Gorilla gorilla gorilla).

    PubMed

    Perez, Sylvia E; Raghanti, Mary Ann; Hof, Patrick R; Kramer, Lynn; Ikonomovic, Milos D; Lacor, Pascale N; Erwin, Joseph M; Sherwood, Chet C; Mufson, Elliott J

    2013-12-15

    The two major histopathologic hallmarks of Alzheimer's disease (AD) are amyloid beta protein (Aβ) plaques and neurofibrillary tangles (NFT). Aβ pathology is a common feature in the aged nonhuman primate brain, whereas NFT are found almost exclusively in humans. Few studies have examined AD-related pathology in great apes, which are the closest phylogenetic relatives of humans. In the present study, we examined Aβ and tau-like lesions in the neocortex and hippocampus of aged male and female western lowland gorillas using immunohistochemistry and histochemistry. Analysis revealed an age-related increase in Aβ-immunoreactive plaques and vasculature in the gorilla brain. Aβ plaques were more abundant in the neocortex and hippocampus of females, whereas Aβ-positive blood vessels were more widespread in male gorillas. Plaques were also Aβ40-, Aβ42-, and Aβ oligomer-immunoreactive, but only weakly thioflavine S- or 6-CN-PiB-positive in both sexes, indicative of the less fibrillar (diffuse) nature of Aβ plaques in gorillas. Although phosphorylated neurofilament immunostaining revealed a few dystrophic neurites and neurons, choline acetyltransferase-immunoreactive fibers were not dystrophic. Neurons stained for the tau marker Alz50 were found in the neocortex and hippocampus of gorillas at all ages. Occasional Alz50-, MC1-, and AT8-immunoreactive astrocyte and oligodendrocyte coiled bodies and neuritic clusters were seen in the neocortex and hippocampus of the oldest gorillas. This study demonstrates the spontaneous presence of both Aβ plaques and tau-like lesions in the neocortex and hippocampus in old male and female western lowland gorillas, placing this species at relevance in the context of AD research.

  2. Hippocampal body changes in pure partial onset sleep and pure partial onset waking epileptic patients.

    PubMed

    Motamedi, Mahmood; Zandieh, Ali; Hajimirzabeigi, Alireza; Tahsini, Majid; Vakhshiteh, Fatemeh; Rahimian, Elham

    2013-09-01

    The aim of the current study was to evaluate for the first time the hippocampal changes in patients with pure sleep and pure waking epilepsy. A total of 35 patients with pure partial onset sleep epilepsy and 35 patients with pure partial onset waking epilepsy matched for age and sex ratio were enrolled. MR images were analyzed to determine hippocampal body changes. Rounding ratio of hippocampal body was defined as short axis divided by long axis and hippocampal bodies with ratios ≥ 0.70 were considered rounded. Hippocampal sclerosis and atrophy were found in nine (25.7 %) and seven (20.0 %) patients with pure sleep epilepsy, and in 12 (34.3 %) and 11 (31.4 %) patients with pure waking epilepsy, respectively (P > 0.05 for the comparison between sleep and waking epilepsy). However, proportion of subjects with rounded hippocampal bodies (15, 42.9 % vs. 3, 8.6 % for patients with sleep and waking epilepsy, respectively) and rounding ratios of both left and right hippocampal bodies (0.66 ± 0.13 and 0.61 ± 0.12, respectively for left and right hippocampal bodies in sleep epileptic patients vs. 0.57 ± 0.11 and 0.55 ± 0.11, respectively for left and right hippocampal bodies in waking epileptic patients) were increased in patients with sleep epilepsy (P < 0.05). Further, in sleep epileptic patients with left sided hippocampal body rounding, epileptiform discharges were more readily lateralized to the left temporal lobe (P < 0.05). In conclusion, hippocampal sclerosis and atrophy are not different between pure partial onset sleep and waking epileptic patients. However, rounding ratio and frequency of hippocampal body rounding are increased in sleep epileptic patients.

  3. Neurophysiological activity underlying altered brain metabolism in epileptic encephalopathies with CSWS.

    PubMed

    De Tiège, Xavier; Trotta, Nicola; Op de Beeck, Marc; Bourguignon, Mathieu; Marty, Brice; Wens, Vincent; Nonclercq, Antoine; Goldman, Serge; Van Bogaert, Patrick

    2013-08-01

    We investigated the neurophysiological correlate of altered regional cerebral glucose metabolism observed in children with epileptic encephalopathy with continuous spike-waves during sleep (CSWS) by using a multimodal approach combining time-sensitive magnetic source imaging (MSI) and positron emission tomography with [(18)F]-fluorodeoxyglucose (FDG-PET). Six patients (4 boys and 2 girls, age range: 4-8 years, 3 patients with Landau-Kleffner syndrome (LKS), 3 patients with atypical rolandic epilepsy (ARE)) were investigated by FDG-PET and MSI at the acute phase of CSWS. In all patients, the onset(s) of spike-waves discharges were associated with significant focal hypermetabolism. The propagation of epileptic discharges to other brain areas was associated with focal hypermetabolism (five patients), hypometabolism (one patient) or the absence of any significant metabolic change (one patient). Interestingly, most of the hypometabolic areas were not involved in the epileptic network per se. This study shows that focal hypermetabolism observed at the acute phase of CSWS are related to the onset or propagation sites of spike-wave discharges. Spike-wave discharges propagation can be associated to other types of metabolic changes, suggesting the occurrence of various neurophysiological mechanisms at the cellular level. Most of the hypometabolic areas are not involved in the epileptic network as such and are probably related to a mechanism of remote inhibition. These findings highlight the critical value of combining FDG-PET with time-sensitive functional neuroimaging approaches such as MSI to assess CSWS epileptic network when surgery is considered as a therapeutic approach.

  4. Alleviation of Oxidative Damage and Involvement of Nrf2-ARE Pathway in Mesodopaminergic System and Hippocampus of Status Epilepticus Rats Pretreated by Intranasal Pentoxifylline.

    PubMed

    Kang, Yunxiao; Yan, Wensheng; Fang, Hui; Zhang, Guoliang; Du, Yakun; Wang, Lei; Cui, Huixian; Shi, Geming

    2017-01-01

    The current studies were aimed at evaluating the efficacy of intranasal pentoxifylline (Ptx) pretreatment in protecting mesodopaminergic system and hippocampus from oxidative damage of lithium-pilocarpine induced status epilepticus (SE) and the involvement of nuclear factor erythroid 2-related factor 2- (Nrf2-) antioxidant response elements pathway. Pentoxifylline was administered to rats intranasally or intraperitoneally 30 minutes before inducing SE. Our results showed the impaired visuospatial memory, the defected mesodopaminergic system, and the oxidative damage and the transient activation of Nrf2 in SE rats. The transient activation of Nrf2 in SE rats was enhanced by Ptx pretreatment, which was followed by the upregulation of heme oxygenase-1 and NAD(P)H:quinone oxidoreductase-1. Ptx pretreatment to SE rats significantly suppressed the epileptic seizures, decreased the levels of lipid peroxide and malondialdehyde, and elevated the ratio of reduced glutathione/oxidized glutathione. Compared with intraperitoneal injection, intranasal Ptx delivery completely restored the visuospatial memory and the activity of mesodopaminergic system in SE rats. Intranasal administration of Ptx may hopefully become a noninvasive, painless, and easily administered option for epileptic patients.

  5. Alleviation of Oxidative Damage and Involvement of Nrf2-ARE Pathway in Mesodopaminergic System and Hippocampus of Status Epilepticus Rats Pretreated by Intranasal Pentoxifylline

    PubMed Central

    Yan, Wensheng; Fang, Hui; Zhang, Guoliang; Du, Yakun; Wang, Lei; Cui, Huixian

    2017-01-01

    The current studies were aimed at evaluating the efficacy of intranasal pentoxifylline (Ptx) pretreatment in protecting mesodopaminergic system and hippocampus from oxidative damage of lithium-pilocarpine induced status epilepticus (SE) and the involvement of nuclear factor erythroid 2-related factor 2- (Nrf2-) antioxidant response elements pathway. Pentoxifylline was administered to rats intranasally or intraperitoneally 30 minutes before inducing SE. Our results showed the impaired visuospatial memory, the defected mesodopaminergic system, and the oxidative damage and the transient activation of Nrf2 in SE rats. The transient activation of Nrf2 in SE rats was enhanced by Ptx pretreatment, which was followed by the upregulation of heme oxygenase-1 and NAD(P)H:quinone oxidoreductase-1. Ptx pretreatment to SE rats significantly suppressed the epileptic seizures, decreased the levels of lipid peroxide and malondialdehyde, and elevated the ratio of reduced glutathione/oxidized glutathione. Compared with intraperitoneal injection, intranasal Ptx delivery completely restored the visuospatial memory and the activity of mesodopaminergic system in SE rats. Intranasal administration of Ptx may hopefully become a noninvasive, painless, and easily administered option for epileptic patients. PMID:28386312

  6. The Effect of Diabetes Mellitus on Apoptosis in Hippocampus: Cellular and Molecular Aspects

    PubMed Central

    Sadeghi, Akram; Hami, Javad; Razavi, Shahnaz; Esfandiary, Ebrahim; Hejazi, Zahra

    2016-01-01

    Background: Diabetes mellitus is associated with cognitive deficits in humans and animals. These deficits are paralleled by neurophysiological and structural changes in brain. In diabetic animals, impairments of spatial learning, memory, and cognition occur in association with distinct changes in hippocampus, a key brain area for many forms of learning and memory and are particularly sensitive to changes in glucose homeostasis. However, the multifactorial pathogenesis of diabetic encephalopathy is not yet completely understood. Apoptosis plays a crucial role in diabetes-induce neuronal loss in hippocampus. Methods: The effects of diabetes on hippocampus and cognitive/behavioral dysfunctions in experimental models of diabetes are reviewed, with a focus on the negative impact on increased neuronal apoptosis and related cellular and molecular mechanisms. Results: Of all articles that were assessed, most of the experimental studies clearly showed that diabetes causes neuronal apoptosis in hippocampus through multiple mechanisms, including oxidative stress, inhibition of caspases, disturbance in expression of apoptosis regulator genes, as well as deficits in mitochondrial function. The balance between pro-apoptotic and anti-apoptotic signaling may determine the neuronal apoptotic outcome in vitro and in vivo models of experimental diabetes. Conclusions: Dissecting out the mechanisms responsible for diabetes-related changes in the hippocampal cell apoptosis helps improve treatment of impaired cognitive and memory functions in diabetic individuals. PMID:27076895

  7. The effects of 30 mT electromagnetic fields on hippocampus cells of rats

    PubMed Central

    Teimori, Farzaneh; Khaki, Amir A.; Rajabzadeh, Asghar; Roshangar, Leila

    2016-01-01

    Background: Despite the use of electromagnetic waves in the treatment of some acute and chronic diseases, application of these waves in everyday life has created several problems for humans, especially the nerve system. In this study, the effects of 30mT electromagnetic fields (EMFs) on the hippocampus is investigated. Methods: Twenty-four 5-month Wistar rats weighing 150–200 g were divided into two groups. The experimental group rats were under the influence of an EMF at an intensity of 3 mT for approximately 4 hours a day (from 8 AM to 12 PM) during 10 weeks. After the hippocampus was removed, thin slides were prepared for transmission electron microscope (TEM) to study the ultrastructural tissue. Cell death detection POD kits were used to determine the apoptosis rate. Results: The results of the TEM showed that, in the hippocampus of the experimental group, in comparison to the control group, there was a substantial shift; even intracellular organelles such as the mitochondria were morphologically abnormal and uncertain. The number of apoptotic cells in the exposed group compared to the control group showed significant changes. Conclusions: Similar to numerous studies that have reported the effects of EMFs on nerves system, it was also confirmed in this lecture. Hence, the hippocampus which is important in regulating emotions, behavior, motivation, and memory functions, may be impaired by the negative impacts of EMFs. PMID:27453795

  8. Appearance and incomplete label matching for diffeomorphic template based hippocampus segmentation.

    PubMed

    Pluta, John; Avants, Brian B; Glynn, Simon; Awate, Suyash; Gee, James C; Detre, John A

    2009-06-01

    We present a robust, high-throughput, semiautomated template-based protocol for segmenting the hippocampus in temporal lobe epilepsy. The semiautomated component of this approach, which minimizes user effort while maximizing the benefit of human input to the algorithm, relies on "incomplete labeling." Incomplete labeling requires the user to quickly and approximately segment a few key regions of the hippocampus through a user-interface. Subsequently, this partial labeling of the hippocampus is combined with image similarity terms to guide volumetric diffeomorphic normalization between an individual brain and an unbiased disease-specific template, with fully labeled hippocampi. We solve this many-to-few and few-to-many matching problem, and gain robustness to inter and intrarater variability and small errors in user labeling, by embedding the template-based normalization within a probabilistic framework that examines both label geometry and appearance data at each label. We evaluate the reliability of this framework with respect to manual labeling and show that it increases minimum performance levels relative to fully automated approaches and provides high inter-rater reliability. Thus, this approach does not require expert neuroanatomical training and is viable for high-throughput studies of both the normal and the highly atrophic hippocampus.

  9. Segmentation of Infant Hippocampus Using Common Feature Representations Learned for Multimodal Longitudinal Data

    PubMed Central

    Guo, Yanrong; Wu, Guorong; Yap, Pew-Thian; Jewells, Valerie; Lin, Weili

    2016-01-01

    Aberrant development of the human brain during the first year after birth is known to cause critical implications in later stages of life. In particular, neuropsychiatric disorders, such as attention deficit hyperactivity disorder (ADHD), have been linked with abnormal early development of the hippocampus. Despite its known importance, studying the hippocampus in infant subjects is very challenging due to the significantly smaller brain size, dynamically varying image contrast, and large across-subject variation. In this paper, we present a novel method for effective hippocampus segmentation by using a multi-atlas approach that integrates the complementary multimodal information from longitudinal T1 and T2 MR images. In particular, considering the highly heterogeneous nature of the longitudinal data, we propose to learn their common feature representations by using hierarchical multi-set kernel canonical correlation analysis (CCA). Specifically, we will learn (1) within-time-point common features by projecting different modality features of each time point to its own modality-free common space, and (2) across-time-point common features by mapping all time-point-specific common features to a global common space for all time points. These final features are then employed in patch matching across different modalities and time points for hippocampus segmentation, via label propagation and fusion. Experimental results demonstrate the improved performance of our method over the state-of-the-art methods. PMID:27019875

  10. Equivalent activation of the hippocampus by face-face and face-laugh paired associate learning and recognition.

    PubMed

    Holdstock, J S; Crane, J; Bachorowski, J-A; Milner, B

    2010-11-01

    The human hippocampus is known to play an important role in relational memory. Both patient lesion studies and functional-imaging studies have shown that it is involved in the encoding and retrieval from memory of arbitrary associations. Two recent patient lesion studies, however, have found dissociations between spared and impaired memory within the domain of relational memory. Recognition of associations between information of the same kind (e.g., two faces) was spared, whereas recognition of associations between information of different kinds (e.g., face-name or face-voice associations) was impaired by hippocampal lesions. Thus, recognition of associations between information of the same kind may not be mediated by the hippocampus. Few imaging studies have directly compared activation at encoding and recognition of associations between same and different types of information. Those that have have shown mixed findings and been open to alternative interpretation. We used fMRI to compare hippocampal activation while participants studied and later recognized face-face and face-laugh paired associates. We found no differences in hippocampal activation between our two types of stimulus materials during either study or recognition. Study of both types of paired associate activated the hippocampus bilaterally, but the hippocampus was not activated by either condition during recognition. Our findings suggest that the human hippocampus is normally engaged to a similar extent by study and recognition of associations between information of the same kind and associations between information of different kinds.

  11. Independent Neuronal Origin of Seizures and Behavioral Comorbidities in an Animal Model of a Severe Childhood Genetic Epileptic Encephalopathy

    PubMed Central

    Asinof, Samuel K.; Sukoff Rizzo, Stacey J.; Buckley, Alexandra R.; Beyer, Barbara J.; Letts, Verity A.; Frankel, Wayne N.; Boumil, Rebecca M.

    2015-01-01

    The childhood epileptic encephalopathies (EE’s) are seizure disorders that broadly impact development including cognitive, sensory and motor progress with severe consequences and comorbidities. Recently, mutations in DNM1 (dynamin 1) have been implicated in two EE syndromes, Lennox-Gastaut Syndrome and Infantile Spasms. Dnm1 encodes dynamin 1, a large multimeric GTPase necessary for activity-dependent membrane recycling in neurons, including synaptic vesicle endocytosis. Dnm1Ftfl or “fitful” mice carry a spontaneous mutation in the mouse ortholog of DNM1 and recapitulate many of the disease features associated with human DNM1 patients, providing a relevant disease model of human EE’s. In order to examine the cellular etiology of seizures and behavioral and neurological comorbidities, we engineered a conditional Dnm1Ftfl mouse model of DNM1 EE. Observations of Dnm1 Ftfl/flox mice in combination with various neuronal subpopulation specific cre strains demonstrate unique seizure phenotypes and clear separation of major neurobehavioral comorbidities from severe seizures associated with the germline model. This demonstration of pleiotropy suggests that treating seizures per se may not prevent severe comorbidity observed in EE associated with dynamin-1 mutations, and is likely to have implications for other genetic forms of EE. PMID:26125563

  12. Pregnane X Receptor Not Nuclear Factor-kappa B Up-regulates P-glycoprotein Expression in the Brain of Chronic Epileptic Rats Induced by Kainic Acid.

    PubMed

    Yu, Nian; Zhang, Yan-Fang; Zhang, Kang; Cheng, Yong-Fei; Ma, Hai-Yan; Di, Qing

    2017-03-16

    Drug-resistance epilepsy (DRE) is attributed to the brain P-glycoprotein (P-gp) overexpression. We previously reported that nuclear factor-kappa B (NF-κB) played a critical role in regulating P-gp expression at the brain of the acute seizure rats. This study was extended further to investigate the interaction effect of NF-κB and pregnane X receptor (PXR) on P-gp expression at the brain of chronic epileptic rats treated with carbamazepine (CBZ). The chronic epileptic models were induced by the micro-injection of kainic acid (KA) into rats' hippocampus. Subsequently, the successful models were treated with different intervention agents of CBZ; PMA(a non-specific PXR activity inhibitor) or PDTC(a specific NF-κB activity inhibitor) respectively. The expression levels of P-gp and its encoded gene mdr1a/b were significantly up-regulated on the brain of KA-induced chronic epilepsy rats or the epilepsy rats treated with CBZ for 1 week, meanwhile with a high expression of PXR. The treatment of PMA dramatically reduced both PXR and P-gp expressions at the protein and mRNA levels in the chronic epilepsy brain. By compared to the epilepsy model group, the P-gp expression was not markedly attenuated by the inhibition of NF-κB activity with PDTC treatment, nevertheless with a decrease of NF-κB expression in this intervention group. Higher levels of proinflammatory cytokines(IL-1β, IL-6, TNF-α) were found both in the brain tissue and the serum in the epilepsy rats of each group. There was a declined trend of the pro-inflammatory cytokines expression of the PDTC treatment group but with no statistical significance. This study demonstrates for the first time that P-gp up-regulation is due to increase PXR expression in the chronic phase of epilepsy, differently from that NF-κB signaling may induce the P-gp expression in the acute seizure phase. Our results offer insights into the mechanism underlying the development of DRE using or not using CBZ treatment.

  13. LTP enhances synaptogenesis in the developing hippocampus

    PubMed Central

    Watson, Deborah J.; Ostroff, Linnaea; Cao, Guan; Parker, Patrick H.; Smith, Heather

    2015-01-01

    ABSTRACT In adult hippocampus, long‐term potentiation (LTP) produces synapse enlargement while preventing the formation of new small dendritic spines. Here, we tested how LTP affects structural synaptic plasticity in hippocampal area CA1 of Long‐Evans rats at postnatal day 15 (P15). P15 is an age of robust synaptogenesis when less than 35% of dendritic spines have formed. We hypothesized that LTP might therefore have a different effect on synapse structure than in adults. Theta‐burst stimulation (TBS) was used to induce LTP at one site and control stimulation was delivered at an independent site, both within s. radiatum of the same hippocampal slice. Slices were rapidly fixed at 5, 30, and 120 min after TBS, and processed for analysis by three‐dimensional reconstruction from serial section electron microscopy (3DEM). All findings were compared to hippocampus that was perfusion‐fixed (PF) in vivo at P15. Excitatory and inhibitory synapses on dendritic spines and shafts were distinguished from synaptic precursors, including filopodia and surface specializations. The potentiated response plateaued between 5 and 30 min and remained potentiated prior to fixation. TBS resulted in more small spines relative to PF by 30 min. This TBS‐related spine increase lasted 120 min, hence, there were substantially more small spines with LTP than in the control or PF conditions. In contrast, control test pulses resulted in spine loss relative to PF by 120 min, but not earlier. The findings provide accurate new measurements of spine and synapse densities and sizes. The added or lost spines had small synapses, took time to form or disappear, and did not result in elevated potentiation or depression at 120 min. Thus, at P15 the spines formed following TBS, or lost with control stimulation, appear to be functionally silent. With TBS, existing synapses were awakened and then new spines formed as potential substrates for subsequent plasticity. © 2015 The Authors Hippocampus

  14. Anti-Epileptic Effect of Ganoderma Lucidum Polysaccharides by Inhibition of Intracellular Calcium Accumulation and Stimulation of Expression of CaMKII α in Epileptic Hippocampal Neurons

    PubMed Central

    Wang, Shu-Qiu; Li, Xiao-Jie; Qiu, Hong-Bin; Jiang, Zhi-Mei; Simon, Maria; Ma, Xiao-Ru; Liu, Lei; Liu, Jun-Xing; Wang, Fang-Fang; Liang, Yan-Feng; Wu, Jia-Mei; Di, Wei-Hua; Zhou, Shaobo

    2014-01-01

    Purpose To investigate the mechanism of the anti-epileptic effect of Ganoderma lucidum polysaccharides (GLP), the changes of intracellular calcium and CaMK II α expression in a model of epileptic neurons were investigated. Method Primary hippocampal neurons were divided into: 1) Control group, neurons were cultured with Neurobasal medium, for 3 hours; 2) Model group I: neurons were incubated with Mg2+ free medium for 3 hours; 3) Model group II: neurons were incubated with Mg2+ free medium for 3 hours then cultured with the normal medium for a further 3 hours; 4) GLP group I: neurons were incubated with Mg2+ free medium containing GLP (0.375 mg/ml) for 3 hours; 5) GLP group II: neurons were incubated with Mg2+ free medium for 3 hours then cultured with a normal culture medium containing GLP for a further 3 hours. The CaMK II α protein expression was assessed by Western-blot. Ca2+ turnover in neurons was assessed using Fluo-3/AM which was added into the replacement medium and Ca2+ turnover was observed under a laser scanning confocal microscope. Results The CaMK II α expression in the model groups was less than in the control groups, however, in the GLP groups, it was higher than that observed in the model group. Ca2+ fluorescence intensity in GLP group I was significantly lower than that in model group I after 30 seconds, while in GLP group II, it was reduced significantly compared to model group II after 5 minutes. Conclusion GLP may inhibit calcium overload and promote CaMK II α expression to protect epileptic neurons. PMID:25010576

  15. GABAergic cell types in the lizard hippocampus.

    PubMed

    Guirado, S; Dávila, J C

    1999-04-01

    The neurochemical classification of GABAergic cells in the lizard hippocampus resulted in a further division into four major, non-overlapping subtypes. Each GABAergic cell subtype displays specific targets on the principal hippocampal neurons. The synaptic targets of the GABA/neuropeptide subtype are the distal apical dendrites of principal neurons. Calretinin- and parvalbumin-containing GABAergic cells synapse on the cell body and proximal dendrites of principal cells. Calbindin is expressed in a distinct group of interneurons, the synapses of which are directed to the dendrites of principal neurons. Finally, another subtype displays NADPH-diaphorase activity, but its synaptic target has not been established.

  16. Hippocampus and neocortex: recognition and spatial memory.

    PubMed

    Vann, Seralynne D; Albasser, Mathieu M

    2011-06-01

    Recognition and spatial memory are typically associated with the perirhinal cortex and hippocampal formation, respectively. Solely focusing on these structures for these specific mnemonic functions may, however, be limiting progress in the field. The distinction between these subdivisions of memory is becoming less defined as, for example, hippocampal cells traditionally considered to encode locations also encode place-object associations. There is increasing evidence for the involvement of overlapping networks of brain structures for aspects of both spatial and recognition memory. Future models of spatial and recognition memory will have to extend beyond the hippocampus and perirhinal cortex to incorporate a wider network of cortical and subcortical structures.

  17. [Epilepsy from a metaphysical perspective: an interpretation of the biblical story of the epileptic boy and Raphael's Transfiguration].

    PubMed

    Janz, D

    1994-01-01

    Raphael's last painting reveals, in the upper half of the picture, Christ's transfiguration on Mount Tabor and, in the lower half, the young boy's epileptic seizure at the foot of the mountain in the presence of the other disciples. Raphael depicts both events, which are told in succession in the Gospels, as if they took place at the same time. By synchronizing both scenes, Raphael demonstrated a significant correspondence between Christ and the epileptic boy which reveals the epileptic seizure as a symbolic representation of a transcendental event. This metaphysical aspect of epilepsy depicted by Raphael can also be found in the corresponding biblical passages. In the Gospels, the metamorphosis caused by the epileptic seizure is used as a simile for Christ's transfiguration through suffering, death and resurrection.

  18. Epilepsy, viewed metaphysically: an interpretation of the biblical story of the epileptic boy and of Raphael's transfiguration.

    PubMed

    Janz, D

    1986-01-01

    Raphael's last painting reveals, in the upper half of the picture, Christ's transfiguration on Mount Tabor and, in the lower half, the young boy's epileptic seizure at the foot of the mountain in the presence of the other disciples. Raphael depicts both events, which are told in succession in the Gospels, as if they took place at the same time. By synchronizing both scenes Raphael demonstrated a significant correspondence between Christ and the epileptic boy, which reveals the epileptic seizure as a symbolic representation of a transcendent event. This metaphysical aspect of epilepsy depicted by Raphael can also be found in the corresponding biblical passages. In the Gospels, the metamorphosis caused by the epileptic seizure is used as a simile for Christ's transfiguration through suffering, death, and resurrection.

  19. Focal seizures and epileptic spasms in a child with Down syndrome from a family with a PRRT2 mutation.

    PubMed

    Igarashi, Ayuko; Okumura, Akihisa; Shimojima, Keiko; Abe, Shinpei; Ikeno, Mitsuru; Shimizu, Toshiaki; Yamamoto, Toshiyuki

    2016-06-01

    We describe a girl with Down syndrome who experienced focal seizures and epileptic spasms during infancy. The patient was diagnosed as having trisomy 21 during the neonatal period. She had focal seizures at five months of age, which were controlled with phenobarbital. However, epileptic spasms appeared at seven months of age in association with hypsarrhythmia. Upon treatment with adrenocorticotropic hormone, her epileptic spasms disappeared. Her younger brother also had focal seizures at five months of age. His development and interictal electroencephalogram were normal. The patient's father had had infantile epilepsy and paroxysmal kinesigenic dyskinesia. We performed a mutation analysis of the PRRT2 gene and found a c.841T>C mutation in the present patient, her father, and in her younger brother. We hypothesized that the focal seizures in our patient were caused by the PRRT2 mutation, whereas the epileptic spasms were attributable to trisomy 21.

  20. Characterization of a population of neural progenitor cells in the infant hippocampus

    PubMed Central

    Paine, S M L; Willsher, A R; Nicholson, S L; Sebire, N J; Jacques, T S

    2014-01-01

    Aims Abnormalities of the hippocampus are associated with a range of diseases in children, including epilepsy and sudden death. A population of rod cells in part of the hippocampus, the polymorphic layer of the dentate gyrus, has long been recognized in infants. Previous work suggested that these cells were microglia and that their presence was associated with chronic illness and sudden infant death syndrome. Prompted by the observations that a sensitive immunohistochemical marker of microglia used in diagnostic practice does not typically stain these cells and that the hippocampus is a site of postnatal neurogenesis, we hypothesized that this transient population of cells were not microglia but neural progenitors. Methods Using archived post mortem tissue, we applied a broad panel of antibodies to establish the immunophenotype of these cells in 40 infants dying suddenly of causes that were either explained or remained unexplained, following post mortem investigation. Results The rod cells were consistently negative for the microglial markers CD45, CD68 and HLA-DR. The cells were positive, in varying proportions, for the neural progenitor marker, doublecortin, the neural stem cell marker, nestin and the neural marker, TUJ1. Conclusions These data support our hypothesis that the rod cells of the polymorphic layer of the dentate gyrus in the infant hippocampus are not microglia but a population of neural progenitors. These findings advance our understanding of postnatal neurogenesis in the human hippocampus in health and disease and are of diagnostic importance, allowing reactive microglia to be distinguished from the normal population of neural progenitors. PMID:23742713

  1. Chronic 835-MHz radiofrequency exposure to mice hippocampus alters the distribution of calbindin and GFAP immunoreactivity.

    PubMed

    Maskey, Dhiraj; Pradhan, Jonu; Aryal, Bijay; Lee, Chang-Min; Choi, In-Young; Park, Ki-Sup; Kim, Seok Bae; Kim, Hyung Gun; Kim, Myeung Ju

    2010-07-30

    Exponential interindividual handling in wireless communication system has raised possible doubts in the biological aspects of radiofrequency (RF) exposure on human brain owing to its close proximity to the mobile phone. In the nervous system, calcium (Ca(2+)) plays a critical role in releasing neurotransmitters, generating action potential and membrane integrity. Alterations in intracellular Ca(2+) concentration trigger aberrant synaptic action or cause neuronal apoptosis, which may exert an influence on the cellular pathology for learning and memory in the hippocampus. Calcium binding proteins like calbindin D28-K (CB) is responsible for the maintaining and controlling Ca(2+) homeostasis. Therefore, in the present study, we investigated the effect of RF exposure on rat hippocampus at 835 MHz with low energy (specific absorption rate: SAR=1.6 W/kg) for 3 months by using both CB and glial fibrillary acidic protein (GFAP) specific antibodies by immunohistochemical method. Decrease in CB immunoreactivity (IR) was noted in exposed (E1.6) group with loss of interneurons and pyramidal cells in CA1 area and loss of granule cells. Also, an overall increase in GFAP IR was observed in the hippocampus of E1.6. By TUNEL assay, apoptotic cells were detected in the CA1, CA3 areas and dentate gyrus of hippocampus, which reflects that chronic RF exposure may affect the cell viability. In addition, the increase of GFAP IR due to RF exposure could be well suited with the feature of reactive astrocytosis, which is an abnormal increase in the number of astrocytes due to the loss of nearby neurons. Chronic RF exposure to the rat brain suggested that the decrease of CB IR accompanying apoptosis and increase of GFAP IR might be morphological parameters in the hippocampus damages.

  2. Sudden death in epileptic rats exposed to nocturnal magnetic fields that simulate the shape and the intensity of sudden changes in geomagnetic activity: an experiment in response to Schnabel, Beblo and May

    NASA Astrophysics Data System (ADS)

    Persinger, M. A.; McKay, B. E.; O'Donovan, C. A.; Koren, S. A.

    2005-03-01

    To test the hypothesis that sudden unexplained death (SUD) in some epileptic patients is related to geomagnetic activity we exposed rats in which limbic epilepsy had been induced to experimentally produced magnetic fields designed to simulate sudden storm commencements (SSCs). Prior studies with rats had shown that sudden death in groups of rats in which epilepsy had been induced months earlier was associated with the occurrence of SSCs and increased geomagnetic activity during the previous night. Schnabel et al. [(2000) Neurology 54:903 908) found no relationship between SUD in human patients and geomagnetic activity. A total of 96 rats were exposed to either 500, 50, 10 40 nT or sham (less than 10 nT) magnetic fields for 6 min every hour between midnight and 0800 hours (local time) for three successive nights. The shape of the complex, amplitude-modulated magnetic fields simulated the shape and structure of an average SSC. The rats were then seized with lithium and pilocarpine and the mortality was monitored. Whereas 10% of the rats that had been exposed to the sham field died within 24 h, 60% of the rats that had been exposed to the experimental magnetic fields simulating natural geomagnetic activity died (P<.001) during this period. These results suggest that correlational analyses between SUD in epileptic patients and increased geomagnetic activity can be simulated experimentally in epileptic rats and that potential mechanisms might be testable directly.

  3. Abnormal changes in voltage-gated sodium channels Na(V)1.1, Na(V)1.2, Na(V)1.3, Na(V)1.6 and in calmodulin/calmodulin-dependent protein kinase II, within the brains of spontaneously epileptic rats and tremor rats.

    PubMed

    Xu, Xiaoxue; Guo, Feng; Lv, Xintong; Feng, Rui; Min, Dongyu; Ma, Lihua; Liu, Yajing; Zhao, Jinsheng; Wang, Lei; Chen, Tianbao; Shaw, Chris; Hao, Liying; Cai, Jiqun

    2013-07-01

    Voltage-gated sodium channels (VGSCs) play a crucial role in epilepsy. The expressions of different VGSCs subtypes are varied in diverse animal models of epilepsy that may reflect their multiple phenotypes or the complexity of the mechanisms of epilepsy. In a previous study, we reported that NaV1.1 and NaV1.3 were up-regulated in the hippocampus of the spontaneously epileptic rat (SER). In this study, we further analyzed both the expression and distribution of the typical VGSC subtypes NaV1.1, NaV1.2, NaV1.3 and NaV1.6 in the hippocampus and in the cortex of the temporal lobe of two genetic epileptic animal models: the SER and the tremor rat (TRM). The expressions of calmodulin (CaM) and calmodulin-dependent protein kinase II (CaMKII) were also analyzed with the purpose of assessing the effect of the CaM/CaMKII pathway in these two models of epilepsy. Increased expression of the four VGSC subtypes and CaM, accompanied by a decrease in CaMKII was observed in the hippocampus of both the SERs and the TRM rats. However, the changes observed in the expression of VGSC subtypes and CaM were decreased with an elevated CaMKII in the cortex of their temporal lobes. Double-labeled immunofluorescence data suggested that in SERs and TRM rats, the four subtypes of the VGSC proteins were present throughout the CA1, CA3 and dentate gyrus regions of the hippocampus and temporal lobe cortex and these were co-localized in neurons with CaM. These data represent the first evidence of abnormal changes in expression of four VGSC subtypes (NaV1.1, NaV1.2, NaV1.3 and NaV1.6) and CaM/CaMKII in the hippocampus and temporal lobe cortex of SERs and TRM rats. These changes may be involved in the generation of epileptiform activity and underlie the observed seizure phenotype in these rat models of genetic epilepsy.

  4. Orthomolecular enhancement of human development

    NASA Technical Reports Server (NTRS)

    Pauling, L.

    1978-01-01

    The importance of molecules introduced into the human body by the way of foods is emphasized. Examples of orthomolecular therapy are given that range from the control of epileptic seizures, the therapy of mental illness, to the prevention of the common cold.

  5. Hippocampus and Retrograde Amnesia in the Rat Model: A Modest Proposal for the Situation of Systems Consolidation

    ERIC Educational Resources Information Center

    Sutherland, Robert J.; Sparks, Fraser T.; Lehmann, Hugo

    2010-01-01

    The properties of retrograde amnesia after damage to the hippocampus have been explicated with some success using a rat model of human medial temporal lobe amnesia. We review the results of this experimental work with rats focusing on several areas of consensus in this growing literature. We evaluate the theoretically significant hypothesis that…

  6. Decreased GABA receptor in the cerebral cortex of epileptic rats: effect of Bacopa monnieri and Bacoside-A

    PubMed Central

    2012-01-01

    Abstact Background Gamma amino butyric acid (GABA), the principal inhibitory neurotransmitter in the cerebral cortex, maintains the inhibitory tones that counter balances neuronal excitation. When this balance is perturbed, seizures may ensue. Methods In the present study, alterations of the general GABA, GABAA and GABAB receptors in the cerebral cortex of the epileptic rat and the therapeutic application of Bacopa monnieri were investigated. Results Scatchard analysis of [3H]GABA, [3H]bicuculline and [3H]baclofen in the cerebral cortex of the epileptic rat showed significant decrease in Bmax (P < 0.001) compared to control. Real Time PCR amplification of GABA receptor subunits such as GABAAά1, GABAAγ, GABAAδ, GABAB and GAD where down regulated (P < 0.001) in epileptic rats. GABAAά5 subunit and Cyclic AMP responsible element binding protein were up regulated. Confocal imaging study confirmed the decreased GABA receptors in epileptic rats. Epileptic rats have deficit in radial arm and Y maze performance. Conclusions Bacopa monnieri and Bacoside-A treatment reverses epilepsy associated changes to near control suggesting that decreased GABA receptors in the cerebral cortex have an important role in epileptic occurrence; Bacopa monnieri and Bacoside-A have therapeutic application in epilepsy management. PMID:22364254

  7. Upregulation of adenosine kinase in astrocytes in experimental and human temporal lobe epilepsy

    PubMed Central

    Aronica, Eleonora; Zurolo, Emanuele; Iyer, Anand; de Groot, Marjolein; Anink, Jasper; Carbonell, Caterina; van Vliet, Erwin A.; Baayen, Johannes C.; Boison, Detlev; Gorter, Jan A.

    2011-01-01

    Purpose Adenosine kinase (ADK) represents the key metabolic enzyme for the regulation of extracellular adenosine levels in the brain. In adult brain, ADK is primarily present in astrocytes. Several lines of experimental evidence support a critical role of ADK in different types of brain injury associated with astrogliosis, which is also a prominent morphological feature of temporal lobe epilepsy (TLE). We hypothesized that dysregulation of ADK is an ubiquitous pathological hallmark of TLE. Methods Using immunocytochemistry and western blot analysis, we investigated ADK protein expression in a rat model of TLE during epileptogenesis and the chronic epileptic phase and compared those findings with tissue resected from TLE patients with mesial temporal sclerosis (MTS). Key findings In rat control hippocampus and cortex, a low baseline expression of ADK was found with mainly nuclear localization. One week after the electrical induction of status epilepticus (SE), prominent up-regulation of ADK became evident in astrocytes with a characteristic cytoplasmic localization. This increase in ADK persisted at least for 3-4 months after SE in rats developing a progressive form of epilepsy. In line with the findings from the rat model, expression of astrocytic ADK was also found to be increased in the hippocampus and temporal cortex of TLE patients. In addition, in vitro experiments in human astrocyte cultures showed that ADK expression was increased by several pro-inflammatory molecules (interleukin-1β and LPS). Significance These results suggest that dysregulation of ADK in astrocytes is a common pathological hallmark of TLE. Moreover, in vitro data suggest the existence of an additional layer of modulatory crosstalk between the astrocyte-based adenosine cycle and inflammation. Whether this interaction also can play role in vivo needs to be further investigated. PMID:21635241

  8. Hippocampus Segmentation Based on Local Linear Mapping

    PubMed Central

    Pang, Shumao; Jiang, Jun; Lu, Zhentai; Li, Xueli; Yang, Wei; Huang, Meiyan; Zhang, Yu; Feng, Yanqiu; Huang, Wenhua; Feng, Qianjin

    2017-01-01

    We propose local linear mapping (LLM), a novel fusion framework for distance field (DF) to perform automatic hippocampus segmentation. A k-means cluster method is propose for constructing magnetic resonance (MR) and DF dictionaries. In LLM, we assume that the MR and DF samples are located on two nonlinear manifolds and the mapping from the MR manifold to the DF manifold is differentiable and locally linear. We combine the MR dictionary using local linear representation to present the test sample, and combine the DF dictionary using the corresponding coefficients derived from local linear representation procedure to predict the DF of the test sample. We then merge the overlapped predicted DF patch to obtain the DF value of each point in the test image via a confidence-based weighted average method. This approach enabled us to estimate the label of the test image according to the predicted DF. The proposed method was evaluated on brain images of 35 subjects obtained from SATA dataset. Results indicate the effectiveness of the proposed method, which yields mean Dice similarity coefficients of 0.8697, 0.8770 and 0.8734 for the left, right and bi-lateral hippocampus, respectively. PMID:28368016

  9. The Hippocampus and Disambiguation of Overlapping Sequences

    PubMed Central

    Agster, Kara L.; Fortin, Norbert J.; Eichenbaum, Howard

    2010-01-01

    Recent models of hippocampal function emphasize its potential role in disambiguating sequences of events that compose distinct episodic memories. In this study, rats were trained to distinguish two overlapping sequences of odor choices. The capacity to disambiguate the sequences was measured by the critical odor choice after the overlapping elements of the sequences. When the sequences were presented in rapid alternation, damage to the hippocampus, produced either by infusions of the neurotoxin ibotenic acid or by radiofrequency current, produced a severe deficit, although animals with radiofrequency lesions relearned the task. When the sequences were presented spaced apart and in random order, animals with radiofrequency hippocampal lesions could perform the task. However, they failed when a memory delay was imposed before the critical choice. These findings support the hypothesis that the hippocampus is involved in representing sequences of nonspatial events, particularly when interference between the sequences is high or when animals must remember across a substantial delay preceding items in a current sequence. PMID:12097529

  10. Hippocampus Segmentation Based on Local Linear Mapping.

    PubMed

    Pang, Shumao; Jiang, Jun; Lu, Zhentai; Li, Xueli; Yang, Wei; Huang, Meiyan; Zhang, Yu; Feng, Yanqiu; Huang, Wenhua; Feng, Qianjin

    2017-04-03

    We propose local linear mapping (LLM), a novel fusion framework for distance field (DF) to perform automatic hippocampus segmentation. A k-means cluster method is propose for constructing magnetic resonance (MR) and DF dictionaries. In LLM, we assume that the MR and DF samples are located on two nonlinear manifolds and the mapping from the MR manifold to the DF manifold is differentiable and locally linear. We combine the MR dictionary using local linear representation to present the test sample, and combine the DF dictionary using the corresponding coefficients derived from local linear representation procedure to predict the DF of the test sample. We then merge the overlapped predicted DF patch to obtain the DF value of each point in the test image via a confidence-based weighted average method. This approach enabled us to estimate the label of the test image according to the predicted DF. The proposed method was evaluated on brain images of 35 subjects obtained from SATA dataset. Results indicate the effectiveness of the proposed method, which yields mean Dice similarity coefficients of 0.8697, 0.8770 and 0.8734 for the left, right and bi-lateral hippocampus, respectively.

  11. Localization of focal epileptic discharges using functional connectivity magnetic resonance imaging

    PubMed Central

    Stufflebeam, Steven M.; Liu, Hesheng; Sepulcre, Jorge; Tanaka, Naoaki; Buckner, Randy L.; Madsen, Joseph R.

    2011-01-01

    Object In patients with medically refractory epilepsy the accurate localization of the seizure onset zone is critical for successful surgical treatment. The object of this study was to investigate whether the degree of coupling of spontaneous brain activity as measured with functional connectivity MR imaging (fcMR imaging) can accurately identify and localize epileptic discharges. Methods The authors studied 6 patients who underwent fcMR imaging presurgical mapping and subsequently underwent invasive electroencephalography. Results Focal regions of statistically significant increases in connectivity were identified in 5 patients when compared with an ad hoc normative sample of 300 controls. The foci identified by fcMR imaging overlapped the epileptogenic areas identified by invasive encephalography in all 5 patients. Conclusions These results suggest that fcMR imaging may provide an effective high–spatial resolution and noninvasive method of localizing epileptic discharges in patients with refractory epilepsy. PMID:21351832

  12. Plasticity of Hippocampal Excitatory-Inhibitory Balance: Missing the Synaptic Control in the Epileptic Brain

    PubMed Central

    Bonansco, Christian; Fuenzalida, Marco

    2016-01-01

    Synaptic plasticity is the capacity generated by experience to modify the neural function and, thereby, adapt our behaviour. Long-term plasticity of glutamatergic and GABAergic transmission occurs in a concerted manner, finely adjusting the excitatory-inhibitory (E/I) balance. Imbalances of E/I function are related to several neurological diseases including epilepsy. Several evidences have demonstrated that astrocytes are able to control the synaptic plasticity, with astrocytes being active partners in synaptic physiology and E/I balance. Here, we revise molecular evidences showing the epileptic stage as an abnormal form of long-term brain plasticity and propose the possible participation of astrocytes to the abnormal increase of glutamatergic and decrease of GABAergic neurotransmission in epileptic networks. PMID:27006834

  13. Epileptic seizure in a patient with an implantable cardioverter-defibrillator: Quo vadis right ventricular lead?

    PubMed

    Wedekind, Horst; Rozhnev, Andrey; Kleine-Katthöfer, Peter; Kranig, Wolfgang

    2016-03-01

    The case of a 77-year-old man admitted for suspected epileptic seizure is reported. Patient history showed implantation of a single-chamber implantable cardioverter-defibrillator (ICD) after cardiac arrest in 2007 with replacement in 2012 due to battery depletion; the patient reported no previous syncope, unconsciousness or seizures. Interrogation records of the ICD showed five ventricular tachyarrhythmia episodes that corresponded to the "seizure". Further examination revealed incorrect position of the RV-lead. Diagnosis was a provoked epileptic seizure due to undersensing of ventricular tachycardia because of improper ICD lead implantation in the coronary sinus. Treatment consisted of implantation of a new device with an additional ICD lead into the right ventricle.

  14. Trichotillomania and Non-Epileptic Seizures as Sleep-Related Dissociative Phenomena

    PubMed Central

    Angulo-Franco, Melina; Bush-Martínez, Alejandra; Nenclares-Portocarrero, Alejandro; Jiménez-Genchi, Alejandro

    2015-01-01

    The occurrence of non-epileptic seizures (NES) and trichotillomania during sleep is rare. We describe the case of an adult woman with a personal history of childhood maltreatment and psychiatric morbidity (major depression, trichotillomania, and conversion disorder), who was referred to the sleep unit because of nocturnal hair-pulling and psychomotor agitation during sleep. An all-night PSG recording with audiovisual monitoring documented seven episodes of trichotillomania and one NES, all of which arose from unequivocal wakefulness. Improvement of nocturnal behaviors was observed after long-term psychotherapy. This case illustrates that nocturnal trichotillomania and NES may be symptoms of a sleep-related dissociative disorder. Citation: Angulo-Franco M, Bush-Martínez A, Nenclares-Portocarrero A, Jiménez-Genchi A. Trichotillomania and non-epileptic seizures as sleep-related dissociative phenomena. J Clin Sleep Med 2015;11(3):271–273. PMID:25515284

  15. Comparison of five directed graph measures for identification of leading interictal epileptic regions

    PubMed Central

    Amini, Ladan; Jutten, Christian; Achard, Sophie; David, Olivier; Kahane, Philippe; Vercueil, Laurent; Minotti, Lorella; Hossein-Zadeh, Gh. Ali; Soltanian-Zadeh, Hamid

    2010-01-01

    Directed graphs (digraphs) derived from interictal periods of intracerebral EEG (iEEG) recordings can be used to estimate the leading interictal epileptic regions for presurgery evaluations. For this purpose, quantification of the emittance contribution of each node to the rest of digraph is important. However, the usual digraph measures are not very well suited for this quantification. Here we compare the efficiency of recently introduced local information measure LI and a new measure called total global efficiency with classical measures like global efficiency, local efficiency and node degree. For evaluation, the estimated leading interictal epileptic regions based on five measures are compared with seizure onset zones obtained by visual inspection of epileptologists for five patients. The comparison revealed the superior performance of LI measure. We showed efficiency of different digraph measures for the purpose of source and sink node identification. PMID:20952817

  16. The spectrum of psychogenic non-epileptic seizures and comorbidities seen in an epilepsy monitoring unit.

    PubMed

    Seneviratne, Udaya; Briggs, Belinda; Lowenstern, David; D'Souza, Wendyl

    2011-03-01

    We sought to study characteristics of patients presenting with psychogenic non-epileptic seizures (PNES), with and without major psychiatric comorbidity. A total of 39 patients who were diagnosed with PNES in a tertiary care setting were studied, and those patients with and without axis I psychiatric disorders in the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) were compared. The mean time in confirming the diagnosis was 9 years. More than half the patients were taking anti-epileptic medications when they presented for video-electroencephalographic monitoring. The mean monitoring time required to capture a PNES was 0.6 days. Comorbid chronic medical conditions were found in 38.5% and axis I-psychiatric diagnoses in 48.7%. There were no significant differences in characteristics between those with and without major psychiatric comorbidities.

  17. Pattern of trauma determines the threshold for epileptic activity in a model of cortical deafferentation

    PubMed Central

    Volman, Vladislav; Bazhenov, Maxim; Sejnowski, Terrence J.

    2011-01-01

    Epileptic activity often occurs in the cortex after a latent period after head trauma; this delay has been attributed to the destabilizing influence of homeostatic synaptic scaling and changes in intrinsic properties. However, the impact of the spatial organization of cortical trauma on epileptogenesis is poorly understood. We addressed this question by analyzing the dynamics of a large-scale biophysically realistic cortical network model subjected to different patterns of trauma. Our results suggest that the spatial pattern of trauma can greatly affect the propensity for developing posttraumatic epileptic activity. For the same fraction of lesioned neurons, spatially compact trauma resulted in stronger posttraumatic elevation of paroxysmal activity than spatially diffuse trauma. In the case of very severe trauma, diffuse distribution of a small number of surviving intact neurons alleviated posttraumatic epileptogenesis. We suggest that clinical evaluation of the severity of brain trauma should take into account the spatial pattern of the injured cortex. PMID:21896754

  18. A comprehensive oral and dental management of an epileptic and intellectually deteriorated adolescent

    PubMed Central

    Joshi, Sourabh Ramesh; Pendyala, Gowri Swaminatham; Saraf, Veena; Choudhari, Shantanu; Mopagar, Viddyasagar

    2013-01-01

    Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. PMID:24130597

  19. The epileptic spectrum in the congenital bilateral perisylvian syndrome. CBPS Multicenter Collaborative Study.

    PubMed

    Kuzniecky, R; Andermann, F; Guerrini, R

    1994-03-01

    We studied the frequency, clinical and EEG characteristics, and outcome of the epileptic syndrome in 31 patients with a congenital neurologic syndrome characterized by pseudobulbar palsy, cognitive deficits, and bilateral perisylvian polymicrogyria. Seizures were present in 27 of 31 patients (87%) and usually began between the ages of 4 and 12 years; they commonly consisted of atypical absence, atonic/tonic, and generalized tonic-clonic seizures. Partial attacks were present in 26%. EEG demonstrated generalized spike and wave abnormalities and, less frequently, multifocal discharges, predominantly in centro-parietal regions. Seizures were poorly controlled in 65%, with the remaining patients well controlled. Seven patients underwent callosotomy, which resulted in seizure improvement. This study indicates that the epileptic spectrum in this syndrome is broad but follows predictable patterns. Callosotomy is a valuable treatment strategy in those with intractable drop attacks.

  20. A comprehensive oral and dental management of an epileptic and intellectually deteriorated adolescent.

    PubMed

    Joshi, Sourabh Ramesh; Pendyala, Gowri Swaminatham; Saraf, Veena; Choudhari, Shantanu; Mopagar, Viddyasagar

    2013-07-01

    Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office. Epilepsy along with intellectual deterioration and other neurological disorders can have social, physical, and psychological consequences, especially, when they begin in childhood. Moreover, the seizure episode along with mental deterioration may compromise the oral and dental care resulting in numerous decayed teeth. This report presents the case history of an adolescent with poor oral hygiene and numerous decayed teeth. This report also presents the comprehensive endodontic, surgical, and prosthodontic management of epileptic mentally challenged patient in the dental office.

  1. Topiramate-induced paresthesia is more frequently reported by migraine than epileptic patients.

    PubMed

    Sedighi, Behnaz; Shafiei, Kaveh; Azizpour, Iman

    2016-04-01

    Topiramate is an approved and effective drug in migraine prophylaxis. Paresthesia is the most commonly reported side effect. The primary objective of this study was to compare the frequency of topiramate-induced paresthesia in migraine headache to epileptic patients. Patients with migraine without aura and epilepsy were enrolled in this observational study. All cases were interviewed by telephone about their history of paresthesia. Confounding factors were controlled through logistic regression. The odds ratio of developing topiramate-induced paresthesia in migraine compared to epilepsy patients was 3.4. Three factors were independent contributors to developing topiramate-induced paresthesia: female sex (odds ratio 2.1), topiramate dosage (odds ratio 0.3) and duration of therapy. Our findings indicate an independent association between migraine and development of paresthesia. Migraineurs were more likely than epileptic patients to report paresthesia as topiramate adverse effects. Female sex, treatment duration and topiramate dosage contribute significantly to subsequent development of paresthesia.

  2. Influence of Chronic Amphetamine Treatment and Acute Withdrawal on Serotonin Synthesis and Clearance Mechanisms in the Rat Ventral Hippocampus

    PubMed Central

    Barr, Jeffrey L.; Scholl, Jamie L.; Solanki, Rajeshwari R.; Watt, Michael J.; Lowry, Christopher A.; Renner, Kenneth J.; Forster, Gina L.

    2012-01-01

    Amphetamine withdrawal in both humans and rats is associated with increased anxiety states, which are thought to contribute to drug relapse. Serotonin in the ventral hippocampus mediates affective behaviors, and reduced serotonin levels in this region are observed in rat models of high anxiety, including during withdrawal from chronic amphetamine. This goal of this study was to understand the mechanisms by which reduced ventral hippocampus serotonergic neurotransmission occurs during amphetamine withdrawal. Serotonin synthesis (assessed by accumulation of serotonin precursor as a measure of the capacity of in vivo tryptophan hydroxylase activity), expression of serotonergic transporters, and in vivo serotonergic clearance using in vivo microdialysis, were assessed in the ventral hippocampus in adult male Sprague Dawley rats at 24 hours withdrawal from chronic amphetamine. Overall, results showed that diminished extracellular serotonin at 24 hours withdrawal from chronic amphetamine was not accompanied by a change in capacity for serotonin synthesis (in vivo tryptophan hydroxylase activity), nor serotonin transporter expression or function in the ventral hippocampus, but instead was associated with increased expression and function of organic cation transporters (low affinity, high capacity serotonin transporters). These findings suggest that 24 hours withdrawal from chronic amphetamine reduces the availability of extracellular serotonin in the ventral hippocampus by increasing organic cation transporter-mediated serotonin clearance, which may represent at future pharmacological target for reversing anxiety states during drug withdrawal. PMID:23157166

  3. Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

    PubMed

    Xi, Zhiqin; Deng, Wanni; Wang, Liang; Xiao, Fei; Li, Jie; Wang, Zhihua; Wang, Xin; Mi, Xiujuan; Wang, Na; Wang, Xuefeng

    2015-11-01

    Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

  4. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.

    1998-04-28

    Methods and apparatus are disclosed for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence. 76 figs.

  5. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOEpatents

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1998-01-01

    Methods and apparatus for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence.

  6. Alterations of endocannabinoids in cerebrospinal fluid of dogs with epileptic seizure disorder

    PubMed Central

    2013-01-01

    Background Epilepsy is one of the most common chronic neurological disorders in dogs characterized by recurrent seizures. The endocannabinoid (EC) system plays a central role in suppressing pathologic neuronal excitability and in controlling the spread of activity in an epileptic network. Endocannabinoids are released on demand and their dysregulation has been described in several pathological conditions. Recurrent seizures may lead to an adverse reorganization of the EC system and impairment of its protective effect. In the current study, we tested the hypothesis that cerebrospinal fluid (CSF) concentrations of the endocannabinoids anandamide (AEA) and 2-arachidonoyl glycerol (2AG) are altered in epileptic dogs. Concentrations of AEA and total AG (sum of 2AG and 1AG) were measured in 40 dogs with idiopathic epilepsy and in 16 unaffected, healthy control dogs using liquid chromatography combined with tandem mass spectrometry. Results AEA and total AG were measured at 4.94 (3.18 – 9.17) pM and 1.43 (0.90 – 1.92) nM in epileptic dogs and at 3.19 (2.04 – 4.28) pM and 1.76 (1.08 – 2.69) nM in the control group, respectively (median, 25 – 75% percentiles in brackets). The AEA difference between epileptic and healthy dogs was statistically significant (p < 0.05). Values correlated with seizure severity and duration of seizure activity. Dogs with cluster seizures and/or status epilepticus and with seizure activity for more than six months displayed the highest EC concentrations. Conclusion In conclusion, we present the first endocannabinoid measurements in canine CSF and confirm the hypothesis that the EC system is altered in canine idiopathic epilepsy. PMID:24370333

  7. Wavelet-based analysis of electroencephalogram (EEG) signals for detection and localization of epileptic seizures

    NASA Astrophysics Data System (ADS)

    Benke, George; Bozek-Kuzmicki, Maribeth; Colella, David; Jacyna, Garry M.; Benedetto, John J.

    1995-04-01

    A wavelet-based technique WISP is used to discriminate normal brain activity from brain activity during epileptic seizures. The WISP technique is used to exploit the noted difference in frequency content during the normal brain state and the seizure brain state so that detection and localization decisions can be made. An AR-Pole statistic technique is used as a comparative measure to base-line the WISP performance.

  8. How Do Parents Think about the Effect of Food and Alternative Medicine on their Epileptic Children?

    PubMed Central

    Mohammadi, Mahmoud; Meysamie, Alipasha; Jahanian, Alireza

    2010-01-01

    Objective Parents of epileptic children are willing to know if specific foods precipitate or aggravate their kids' seizures. Nonetheless conclusive data are limited. Alternative medicine has become a popular approach to many diseases in the world and there are limited data about this approach to epilepsy in Iran. We tried to evaluate attitude of parents of epileptic children to food-epilepsy relationship and alternative therapeutic approach to epilepsy. Methods We carried out a cross-sectional study with analytic aspect at Children's Medical Center, Tehran, Iran in 2008, by asking the parents of epileptic children to fill out a valid and excellently reliable questionnaire. We collected parents‘ attitude and analyzed it using SPSS software. Findings One-hundred and fifty one families participated in the study. Fifty-nine of participants (39.1%) believed that foods had no effect on epilepsy. Fifty one cases (33.8%) said that foods might have negative or positive effect on epilepsy and 27.1% (41 cases) had no idea. Higher percent of parents believed in food-epilepsy relation in cases that fathers had educational levels above high school graduation. Sixteen cases (10.6%) said that alternative medicine might improve epilepsy and 55% had no idea about efficacy of this approach to epilepsy. Conclusion Compared with previous published study from Iran, parents of epileptic children believed less in food-epilepsy relation. Majority of parents either believed that foods had no effect on epilepsy or had no idea. More than half of parents had no idea about efficacy of alternative medicine to epilepsy. Only a few of them believed in ameliorating effects of alternative medicine on epilepsy. PMID:23056703

  9. Mobile phone emission increases inter-hemispheric functional coupling of electroencephalographic α rhythms in epileptic patients.

    PubMed

    Vecchio, Fabrizio; Tombini, Mario; Buffo, Paola; Assenza, Giovanni; Pellegrino, Giovanni; Benvenga, Antonella; Babiloni, Claudio; Rossini, Paolo Maria

    2012-05-01

    It has been reported that GSM electromagnetic fields (GSM-EMFs) of mobile phones modulate - after a prolonged exposure - inter-hemispheric synchronization of temporal and frontal resting electroencephalographic (EEG) rhythms in normal young and elderly subjects (Vecchio et al., 2007, 2010). Here we tested the hypothesis that this can be even more evident in epileptic patients, who typically suffer from abnormal mechanisms governing synchronization of rhythmic firing of cortical neurons. Eyes-closed resting EEG data were recorded in ten patients affected by focal epilepsy in real and sham exposure conditions. These data were compared with those obtained from 15 age-matched normal subjects of the previous reference studies. The GSM device was turned on (45 min) in the "GSM" condition and was turned off (45 min) in the other condition ("sham"). The mobile phone was always positioned on the left side in both patients and control subjects. Spectral coherence evaluated the inter-hemispheric synchronization of EEG rhythms at the following frequency bands: delta (about 2-4 Hz), theta (about 4-6 Hz), alpha1 (about 6-8 Hz), alpha2 (about 8-10 Hz), and alpha3 (about 10-12 Hz). The effects on the patients were investigated comparing the inter-hemispheric EEG coherence in the epileptic patients with the control group of subjects evaluated in the previous reference studies. Compared with the control subjects, epileptic patients showed a statistically significant higher inter-hemispheric coherence of temporal and frontal alpha rhythms (about 8-12 Hz) in the GSM than "Sham" condition. These results suggest that GSM-EMFs of mobile phone may affect inter-hemispheric synchronization of the dominant (alpha) EEG rhythms in epileptic patients. If confirmed by future studies on a larger group of epilepsy patients, the modulation of the inter-hemispheric alpha coherence due to the GSM-EMFs could have clinical implications and be related to changes in cognitive-motor function.

  10. Epileptic spasms in paediatric post-traumatic epilepsy at a tertiary referral centre.

    PubMed

    Park, Jun T; Chugani, Harry T

    2017-03-17

    To recognize epileptic spasms (ES) as a seizure type after traumatic brain injury (TBI), accidental or non-accidental, in infants and children. In the process, we aim to gain some insight into the mechanisms of epileptogenesis in ES. A retrospective electronic chart review was performed at the Children's Hospital of Michigan from 2002 to 2012. Electronic charts of 321 patients were reviewed for evidence of post-traumatic epilepsy. Various clinical variables were collected including age at TBI, mechanism of trauma, severity of brain injury, electroencephalography/neuroimaging data, and seizure semiology. Six (12.8%) of the 47 patients diagnosed with post-traumatic epilepsy (PTE) had ES. Epileptic spasms occurred between two months to two years after TBI. All patients with ES had multiple irritative zones, manifesting as multifocal epileptiform discharges, unilateral or bilateral. Cognitive delay and epileptic encephalopathy were seen in all six patients, five of whom were free of spasms after treatment with vigabatrin or adrenocorticotropic hormone. The risk of PTE is 47/321(14.6%) and the specific risk of ES after TBI is 6/321 (1.8%). The risk of ES appears to be high if the age at which severe TBI occurred was during infancy. Non-accidental head trauma is a risk factor of epileptic spasms. While posttraumatic epilepsy (not ES) may start 10 years after the head injury, ES starts within two years, according to our small cohort. The pathophysiology of ES is unknown, however, our data support a combination of previously proposed models in which the primary dysfunction is a focal or diffuse cortical abnormality, coupled with its abnormal interaction with the subcortical structures and brainstem at a critical maturation stage.

  11. Cognitive functions of epileptic patients on monotherapy with phenobarbitone and healthy controls.

    PubMed

    Bigarella, M M; Mäder, M J; Doro, M P; Gorz, A M; Marcourakis, T; Tsanaclis, L; Bittencourt, P R

    1991-06-01

    Quantitative measurements have indicated that heredity, cerebral damage, psycho-social aspects, ictal and inter-ictal phenomena and antiepileptic drugs may interfere in the cognitive dysfunction of epileptic patients. In the present study objective methods included immediate and late recall and recognition of pictures, Stroop test and auditory selection. Twenty patients with symptomatic localized epilepsy aged 17-52 years (27 +/- 10, mean +/- sd) were compared to age and socially matched healthy controls. Patients were on therapeutic serum concentrations (25 +/- 12 mu/ml) of phenobarbitone and had active epilepsy with 1.94 generalized tonic-clonic, 0.85 simple partial and 6.28 complex partial seizures monthly (means). Patients performed worse than controls in all 6 tests (p less than 0.05 to p less than 0.001), indicating a generalized cognitive deficit related to seizures and/or barbiturate therapy. We suggest further studies should be carried out in populations with uniform monotherapeutic regimens and epileptic syndromes in order to isolate factors related to the cognitive dysfunction of epileptic patients.

  12. A study of synchronization of nonlinear oscillators: Application to epileptic seizures

    NASA Astrophysics Data System (ADS)

    Takeshita, Daisuke

    This dissertation focuses on several problems in neuroscience from the perspective of nonlinear dynamics and stochastic processes. The first part concerns a method to visualize the idea of the power spectrum of spike trains, which has an educational value to introductory students in biophysics. The next part consists of experimental and computational work on drug-induced epileptic seizures in the rat neocortex. In the experimental part, spatiotemporal patterns of electrical activities in the rat neocortex are measured using voltage-sensitive dye imaging. Epileptic regions show well-synchronized, in-phase activity during epileptic seizures. In the computational part, a network of a Hodgkin-Huxley type neocortical neural model is constructed. Phase reduction, which is a dimension reduction technique for a stable limit cycle, is applied to the system. The results propose a possible mechanism for the initiation of the drug-induced seizure as a result of a bifurcation. In the last part, a theoretical framework is developed to obtain the statistics for the period of oscillations of a stable limit cycle under stochastic perturbation. A stochastic version of phase reduction and first passage time analysis are utilized for this purpose. The method presented here shows a good agreement with numerical results for the weak noise regime.

  13. [Sodium valproate: a hyperammonemic drug. Study in the epileptic and healthy volunteer].

    PubMed

    Marescaux, C; Warter, J M; Laroye, M; Rumbach, L; Micheletti, G; Koehl, C; Imler, M; Kurtz, D

    1983-02-01

    Sodium valproate (VPA) consistently induces an arterial hyperammonemia in epileptics tolerant of this drug and in normal subjects. The hyperammonemia appears with the first oral or intravenous dose of the drug, 15-25 mg/kg, and is established within minutes following drug absorption. In 20 epileptics treated with VPA alone for 4 days, the mean arterial ammonemia measured 2-3 h after breakfast and the day's first VPA dose was 72 +/- 9 mumols/l in non-alcoholics, and 77 +/- 7 mumols/l in alcoholics. Hyperammonemia persisted during chronic treatment; in 10 epileptics who had had received only VPA for over a month, the mean hyperammonemia was 87 +/- 6 mumols/l (normal value means +/- 2 SD = 28 +/- 12 mumols/l). The ammonemia varied in the course of the day; sharp peaks 7 or more times the base value were observed. These variations, differing among subjects, depended on the VPA plasma concentration, and above all on the meal composition and the relative timing of the meal and the drug administration. No secondary effects were seen; in particular, hepatic and pancreatic tests were normal. The hyperammonemia would seem to be due to physiopathological mechanisms other than those giving rise to the hepatic complications occasionally observed with VPA. The permanence and the extent of the hyperammonemia raise questions as to its origin, its relation to the stuporous states induced by VPA, and its eventual repercussions on the functioning of neurons.

  14. Antioxidants as a Preventive Treatment for Epileptic Process: A Review of the Current Status

    PubMed Central

    Martinc, Boštjan; Grabnar, Iztok; Vovk, Tomaž

    2014-01-01

    Epilepsy is known as one of the most frequent neurological diseases, characterized by an enduring predisposition to generate epileptic seizures. Oxidative stress is believed to directly participate in pathways leading to neurodegeneration, which serves as the most important propagating factor, leading to the epileptic condition and cognitive decline. Moreover, there is also a growing body of evidence showing the disturbance of antioxidant system balance and consequently increased production of reactive species in patients with epilepsy. A meta-analysis, conducted in the present review confirms an association between epilepsy and increased lipid peroxidation. Furthermore, it was also shown that some of the antiepileptic drugs could potentially be responsible for additionally increased lipid peroxidation. Therefore, it is reasonable to propose that during the epileptic process neuroprotective treatment with antioxidants could lead to less sever structural damages, reduced epileptogenesis and milder cognitive deterioration. To evaluate this hypothesis studies investigating the neuroprotective therapeutic potential of various antioxidants in cells, animal seizure models and patients with epilepsy have been reviewed. Numerous beneficial effects of antioxidants on oxidative stress markers and in some cases also neuroprotective effects were observed in animal seizure models. However, despite these encouraging results, till now only a few antioxidants have been further applied to patients with epilepsy as an add-on therapy. Based on the several positive findings in animal models, a strong need for more carefully planned, randomized, double-blind, cross-over, placebo-controlled clinical trials for the evaluation of antioxidants efficacy in patients with epilepsy is warranted. PMID:25977679

  15. Brain Graph Topology Changes Associated with Anti-Epileptic Drug Use.

    PubMed

    Haneef, Zulfi; Levin, Harvey S; Chiang, Sharon

    2015-06-01

    Neuroimaging studies of functional connectivity using graph theory have furthered our understanding of the network structure in temporal lobe epilepsy (TLE). Brain network effects of anti-epileptic drugs could influence such studies, but have not been systematically studied. Resting-state functional MRI was analyzed in 25 patients with TLE using graph theory analysis. Patients were divided into two groups based on anti-epileptic medication use: those taking carbamazepine/oxcarbazepine (CBZ/OXC) (n=9) and those not taking CBZ/OXC (n=16) as a part of their medication regimen. The following graph topology metrics were analyzed: global efficiency, betweenness centrality (BC), clustering coefficient, and small-world index. Multiple linear regression was used to examine the association of CBZ/OXC with graph topology. The two groups did not differ from each other based on epilepsy characteristics. Use of CBZ/OXC was associated with a lower BC. Longer epilepsy duration was also associated with a lower BC. These findings can inform graph theory-based studies in patients with TLE. The changes observed are discussed in relation to the anti-epileptic mechanism of action and adverse effects of CBZ/OXC.

  16. Stimulus-induced Epileptic Spike-Wave Discharges in Thalamocortical Model with Disinhibition

    PubMed Central

    Fan, Denggui; Liu, Suyu; Wang, Qingyun

    2016-01-01

    Epileptic absence seizure characterized by the typical 2–4 Hz spike-wave discharges (SWD) are known to arise due to the physiologically abnormal interactions within the thalamocortical network. By introducing a second inhibitory neuronal population in the cortical system, here we propose a modified thalamocortical field model to mathematically describe the occurrences and transitions of SWD under the mutual functions between cortex and thalamus, as well as the disinhibitory modulations of SWD mediated by the two different inhibitory interneuronal populations. We first show that stimulation can induce the recurrent seizures of SWD in the modified model. Also, we demonstrate the existence of various types of firing states including the SWD. Moreover, we can identify the bistable parametric regions where the SWD can be both induced and terminated by stimulation perturbations applied in the background resting state. Interestingly, in the absence of stimulation disinhibitory functions between the two different interneuronal populations can also both initiate and abate the SWD, which suggests that the mechanism of disinhibition is comparable to the effect of stimulation in initiating and terminating the epileptic SWD. Hopefully, the obtained results can provide theoretical evidences in exploring dynamical mechanism of epileptic seizures. PMID:27876879

  17. Knowledge, attitude and practices of school teachers towards epileptic school children in Karachi, Pakistan

    PubMed Central

    Homi Bhesania, Nasha; Rehman, Anaya; Saleh Savul, Ilma; Zehra, Nosheen

    2014-01-01

    Objective: To assess the knowledge and attitude of school teachers towards an epileptic child. Methods: This cross-sectional study was conducted among teachers of primary, middle and high schools from different communities in Karachi, Pakistan. A total of 120 self-administered KAP questionnaires were distributed in schools selected through convenience sampling. Data was analyzed using SPSS version 19. Results: Out of the total sample size, 90.9% (n=100) had heard about epilepsy. Sixteen (14.5%) teachers considered epilepsy to be contagious while 72.7% (n=80) teachers were of the view that epileptics can succeed as other normal children and sixty nine (62.7%) teachers were willing to help a child experiencing a fit, though only 15.5% (n=17) received knowledge about epilepsy during their training years. Conclusion: The research was conclusive for assessing the knowledge and attitude of teachers towards epileptic children. It highlighted the lack of awareness and negative attitude still existing among teachers. However, many were in the favor of mass education through awareness programs. PMID:24639865

  18. Automatic epileptic seizure detection in EEGs based on line length feature and artificial neural networks.

    PubMed

    Guo, Ling; Rivero, Daniel; Dorado, Julián; Rabuñal, Juan R; Pazos, Alejandro

    2010-08-15

    About 1% of the people in the world suffer from epilepsy. The main characteristic of epilepsy is the recurrent seizures. Careful analysis of the electroencephalogram (EEG) recordings can provide valuable information for understanding the mechanisms behind epileptic disorders. Since epileptic seizures occur irregularly and unpredictably, automatic seizure detection in EEG recordings is highly required. Wavelet transform (WT) is an effective analysis tool for non-stationary signals, such as EEGs. The line length feature reflects the waveform dimensionality changes and is a measure sensitive to variation of the signal amplitude and frequency. This paper presents a novel method for automatic epileptic seizure detection, which uses line length features based on wavelet transform multiresolution decomposition and combines with an artificial neural network (ANN) to classify the EEG signals regarding the existence of seizure or not. To the knowledge of the authors, there exists no similar work in the literature. A famous public dataset was used to evaluate the proposed method. The high accuracy obtained for three different classification problems testified the great success of the method.

  19. Time-frequency texture descriptors of EEG signals for efficient detection of epileptic seizure.

    PubMed

    Şengür, Abdulkadir; Guo, Yanhui; Akbulut, Yaman

    2016-06-01

    Detection of epileptic seizure in electroencephalogram (EEG) signals is a challenging task and requires highly skilled neurophysiologists. Therefore, computer-aided detection helps neurophysiologist in interpreting the EEG. In this paper, texture representation of the time-frequency (t-f) image-based epileptic seizure detection is proposed. More specifically, we propose texture descriptor-based features to discriminate normal and epileptic seizure in t-f domain. To this end, three popular texture descriptors are employed, namely gray-level co-occurrence matrix (GLCM), texture feature coding method (TFCM), and local binary pattern (LBP). The features that are obtained on the GLCM are contrast, correlation, energy, and homogeneity. Moreover, in the TFCM method, several statistical features are calculated. In addition, for the LBP, the histogram is used as a feature. In the classification stage, a support vector machine classifier is employed. We evaluate our proposal with extensive experiments. According to the evaluated terms, our method produces successful results. 100 % accuracy is obtained with LIBLINEAR. We also compare our method with other published methods and the results show the superiority of our proposed method.

  20. Usefulness of MEG magnetometer for spike detection in patients with mesial temporal epileptic focus.

    PubMed

    Enatsu, R; Mikuni, N; Usui, K; Matsubayashi, J; Taki, J; Begum, T; Matsumoto, R; Ikeda, A; Nagamine, T; Fukuyama, H; Hashimoto, N

    2008-07-15

    The present study investigated the sensitivity of magnetoencephalography (MEG) for spikes depending on sensor type in patients with mesial temporal epileptic focus. We recorded MEG in 6 patients with mesial temporal epileptic focus using two sensor types (magnetometer and gradiometer) simultaneously. The number of spikes detected and the corresponding equivalent current dipole (ECD) parameters (distance from the coordinated head center (radius), and dipole moment) were evaluated with respect to sensor type. Among 426 MEG 'consensus spikes' determined by 3 reviewers, 378 spikes satisfied the predetermined criteria for source localization. Comparing ECD parameters, spikes detected by magnetometer alone displayed a smaller radius and larger dipole moment than those detected by gradiometer alone. Spikes estimated in the mesial temporal area were more frequently detected by magnetometer alone (38.5%) than by gradiometer alone (11.5%), whereas spikes in the lateral temporal area were detected less by magnetometer alone (3.7%) than by gradiometer alone (53.9%). The present results suggest that a magnetometer is advantageous for spike detection in patients with mesial temporal epileptic focus. This also implies the higher sensitivity of magnetometer for deep sources.

  1. Exploring the Epileptic Brain Network using Time-Variant Effective Connectivity and Graph Theory.

    PubMed

    Storti, Silvia; Boscolo Galazzo, Ilaria; Khan, Sehresh; Manganotti, Paolo; Menegaz, Gloria

    2016-09-09

    The application of time-varying measures of causality between source time series can be very informative to elucidate the direction of communication among the regions of an epileptic brain. The aim of the study was to identify the dynamic patterns of epileptic networks in focal epilepsy by applying multivariate adaptive directed transfer function (ADTF) analysis and graph-theory to high-density electroencephalographic (hdEEG) recordings. The cortical network was modeled after source reconstruction and topology modulations were detected during interictal spikes. First a distributed linear inverse solution, constrained to the individual grey matter, was applied to the averaged spikes and the mean source activity over 112 regions, as identified by the Harvard-Oxford Atlas, was calculated. Then, ADTF, a dynamic measure of causality, was used to quantify the connectivity strength between pairs of regions acting as nodes in the graph, and the measure of node centrality was derived. The proposed analysis was effective in detecting the focal regions as well as in characterizing the dynamics of the spike propagation, providing evidence of the fact that node centrality is a reliable feature for the identification of the epileptogenic zones. Validation was performed by multi-modal analysis as well as from surgical outcomes. In conclusion, the time-variant connectivity analysis applied to the epileptic patients can distinguish the generator of the abnormal activity from the propagation spread and identify the connectivity pattern over time.

  2. PRRT2 Mutations Are Related to Febrile Seizures in Epileptic Patients

    PubMed Central

    He, Zheng-Wen; Qu, Jian; Zhang, Ying; Mao, Chen-Xue; Wang, Zhi-Bin; Mao, Xiao-Yuan; Deng, Zhi-Yong; Zhou, Bo-Ting; Yin, Ji-Ye; Long, Hong-Yu