Sample records for eubacterium rhodothermus marinus

  1. Expression and characterization of hyperthermostable exo-polygalacturonase RmGH28 from Rhodothermus marinus

    USDA-ARS?s Scientific Manuscript database

    The gene RmGH28 from the organism Rhodothermus marinus putatively encoding a glycosyl hydrolase family 28 polygalacturonase was expressed in E. coli, and the enzyme purified and biochemically characterized. The gene was found to encode an exo- polygalacturonase, with galacturonic acid monomer and th...

  2. Complete genome sequence of Rhodothermus marinus type strain (R-10T)

    SciTech Connect

    Nolan, Matt; Gronow, Sabine; Lapidus, Alla L.; Ivanova, N; Copeland, A; Lucas, Susan; Glavina Del Rio, Tijana; Chen, Feng; Tice, Hope; Pitluck, Sam; Cheng, Jan-Fang; Sims, David; Meincke, Linda; Bruce, David; Goodwin, Lynne A.; Han, Cliff; Detter, J. Chris; Ovchinnikova, Galina; Pati, Amrita; Mavromatis, K; Mikhailova, Natalia; Chen, Amy; Palaniappan, Krishna; Land, Miriam L; Hauser, Loren John; Chang, Yun-Juan; Jeffries, Cynthia; Rohde, Manfred; Sproer, Cathrin; Goker, Markus; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Chain, Patrick S. G.


    Rhodothermus marinus Alfredsson et al. 1995 is the type species of the genus and is of phylogenetic interest because the Rhodothermaceae represent the deepest lineage in the phylum Bacteroidetes. R. marinus R-10T is a Gram-negative, non-motile, non-spore-forming bacterium isolated from marine hot springs off the coast of Iceland. Strain R-10T is strictly aerobic and requires slightly halophilic conditions for growth. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the genus Rhodothermus, and only the second sequence from members of the family Rhodothermaceae. The 3,386,737 bp genome (including a 125 kb plasmid) with its 2914 protein-coding and 48 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  3. Proteome-wide identification of lysine propionylation in thermophilic and mesophilic bacteria: Geobacillus kaustophilus, Thermus thermophilus, Escherichia coli, Bacillus subtilis, and Rhodothermus marinus.


    Okanishi, Hiroki; Kim, Kwang; Masui, Ryoji; Kuramitsu, Seiki


    Recent studies have revealed the physiological significance of post-translational lysine acylations such as acetylation in the regulation of various cellular processes. Here, we characterized lysine propionylation, a recently discovered post-translational acylation, in five representative bacteria: Geobacillus kaustophilus, Thermus thermophilus, Escherichia coli, Bacillus subtilis, and Rhodothermus marinus. Using antibody-based propionyl peptide enrichment followed by identification with nano-liquid chromatography tandem mass spectrometry, we showed that proteins were subject to lysine propionylation in all five bacterial species analyzed. Notably, many propionylations were identified in the Bacillus-related, thermophilic eubacterium G. kaustophilus, but fewer in the mesophilic eubacterium B. subtilis, suggesting that propionylation event abundance is independent of phylogenetic relationship. We further found propionylation sites in the thermophilic eubacterium T. thermophilus, but the thermophilic eubacterium R. marinus showed the fewest number of sites, indicating that growth temperature is not a determinant of propionylation state. In silico analyses demonstrated that lysine propionylation is related to metabolic pathways, particularly those controlled by acyl-CoA synthetases, similar to lysine acetylation. We also detected dozens of propionylation sites at positions important for protein functions across bacteria, demonstrating the regulatory mechanisms affected by lysine propionylations. Our proteome-wide analyses across bacteria thus provide insights into the general functions of lysine propionylation.

  4. Crystallization and preliminary crystallographic analysis of laminarinase from Rhodothermus marinus: a case of pseudomerohedral twinning.


    Golubev, Alexander M; Rojas, Adriana L; Nascimento, Alessandro S; Bleicher, Lucas; Kulminskaya, Anna A; Eneyskaya, Elena V; Polikarpov, Igor


    Thermophilic endo-1,3(4)-beta glucanase (laminarinase) from Rhodothermus marinus was crystallized by the hanging-drop vapor diffusion method. The needle-like crystals belong to space group P2(1) and contain two protein molecules in the asymmetric unit with a solvent content of 51.75 %. Diffraction data were collected to a resolution of 1.95A and resulted in a dataset with an overall R(merge) of 10.4% and a completeness of 97.8%. Analysis of the structure factors revealed pseudomerohedral twinning of the crystals with a twin fraction of approximately 42%.

  5. Quinone reduction by Rhodothermus marinus succinate:menaquinone oxidoreductase is not stimulated by the membrane potential

    SciTech Connect

    Fernandes, Andreia S.; Konstantinov, Alexander A.; Teixeira, Miguel; Pereira, Manuela M. . E-mail:


    Succinate:quinone oxidoreductase (SQR), a di-haem enzyme purified from Rhodothermus marinus, reveals an HQNO-sensitive succinate:quinone oxidoreductase activity with several menaquinone analogues as electron acceptors that decreases with lowering the redox midpoint potential of the quinones. A turnover with the low-potential 2,3-dimethyl-1,4-naphthoquinone that is the closest analogue of menaquinone, although low, can be detected in liposome-reconstituted SQR. Reduction of the quinone is not stimulated by an imposed K{sup +}-diffusion membrane potential of a physiological sign (positive inside the vesicles). Nor does the imposed membrane potential increase the reduction level of the haems in R. marinus SQR poised with the succinate/fumarate redox couple. The data do not support a widely discussed hypothesis on the electrogenic transmembrane electron transfer from succinate to menaquinone catalysed by di-haem SQRs. The role of the membrane potential in regulation of the SQR activity is discussed.

  6. Electron transfer dynamics of Rhodothermus marinus caa3 cytochrome c domains on biomimetic films.


    Molinas, Maria F; De Candia, Ariel; Szajnman, Sergio H; Rodríguez, Juan B; Martí, Marcelo; Pereira, Manuela; Teixeira, Miguel; Todorovic, Smilja; Murgida, Daniel H


    The subunit II of the caa(3) oxygen reductase from Rhodothermus marinus contains, in addition to the Cu(A) center, a c-type heme group in the cytochrome c domain (Cyt-D) that is the putative primary electron acceptor of the enzyme. In this work we have combined surface-enhanced resonance Raman (SERR) spectroelectrochemistry, molecular dynamics (MD) simulations and electron pathway calculations to assess the most likely interaction domains and electron entry/exit points of the truncated Cyt-D of subunit II in the reactions with its electron donor, HiPIP and electron acceptor, Cu(A). The results indicate that the transient interaction between Cyt-D and HiPIP relies upon a delicate balance of hydrophobic and polar contacts for establishing an optimized electron transfer pathway that involves the exposed edge of the heme group and guaranties efficient inter-protein electron transfer on the nanosecond time scale. The reorganization energy of ca. 0.7 eV was determined by time-resolved SERR spectroelectrochemistry. The intramolecular electron transfer pathway in integral subunit II from Cyt-D to the Cu(A) redox center most likely involves the iron ligand histidine 20 as an electron exit point in Cyt-D.

  7. The caa(3) terminal oxidase of Rhodothermus marinus lacking the key glutamate of the D-channel is a proton pump.


    Pereira, M M; Verkhovskaya, M L; Teixeira, M; Verkhovsky, M I


    The thermohalophilic bacterium Rhodothermus marinus expresses a caa(3)-type dioxygen reductase as one of its terminal oxidases. The subunit I amino acid sequence shows the presence of all the essential residues of the D- and K-proton channels, defined in most heme-copper oxidases, with the exception of the key glutamate residue located in the middle of the membrane dielectric (E278 in Paracoccus denitrificans). On the basis of homology modeling studies, a tyrosine residue (Y256, R. marinus numbering) has been proposed to act as a functional substitute [Pereira, M. M., Santana, M., Soares, C. M., Mendes, J., Carita, J. N., Fernandes, A. S., Saraste, M., Carrondo, M. A., and Teixeira, M. (1999) Biochim. Biophys. Acta 1413, 1-13]. Here, R. marinus caa(3) oxidase was reconstituted in liposomes and shown to operate as a proton pump, translocating protons from the cytoplasmic side of the bacterial inner membrane to the periplasmatic space with a stoichiometry of 1H(+)/e(-), as in the case in heme-copper oxidases that contain the glutamate residue. Possible mechanisms of proton transfer in the D-channel with the participation of the tyrosine residue are discussed. The observation that the tyrosine residue is conserved in several other members of the heme-copper oxidase superfamily suggests a common alternative mode of action for the D-channel.

  8. The modular xylanase Xyn10A from Rhodothermus marinus is cell-attached, and its C-terminal domain has several putative homologues among cell-attached proteins within the phylum Bacteroidetes.


    Karlsson, Eva Nordberg; Hachem, Maher Abou; Ramchuran, Santosh; Costa, Hugo; Holst, Olle; Fex Svenningsen, Åsa; Hreggvidsson, Gudmundur O


    Until recently, the function of the fifth domain of the thermostable modular xylanase Xyn10A from Rhodothermus marinus was unresolved. A putative homologue to this domain was however identified in a mannanase (Man26A) from the same microorganism which raised questions regarding a common function. An extensive search of all accessible data-bases as well as the partially sequenced genomes of R. marinus and Cytophaga hutchinsonii showed that homologues of this domain were encoded by multiple genes in microorganisms in the phylum Bacteroidetes. Moreover, the domain occurred invariably at the C-termini of proteins that were predominantly extra-cellular/cell attached. A primary structure motif of three conserved regions including structurally important glycines and a proline was also identified suggesting a conserved 3D fold. This bioinformatic evidence suggested a possible role of this domain in mediating cell attachment. To confirm this theory, R. marinus was grown, and activity assays showed that the major part of the xylanase activity was connected to whole cells. Moreover, immunocytochemical detection using a Xyn10A-specific antibody proved presence of Xyn10A on the R. marinus cell surface. In the light of this, a revision of experimental data present on both Xyn10A and Man26A was performed, and the results all indicate a cell-anchoring role of the domain, suggesting that this domain represents a novel type of module that mediates cell attachment in proteins originating from members of the phylum Bacteroidetes.

  9. Generation of Targeted Deletions in the Genome of Rhodothermus marinus▿

    PubMed Central

    Bjornsdottir, Snaedis H.; Fridjonsson, Olafur H.; Hreggvidsson, Gudmundur O.; Eggertsson, Gudmundur


    The aim of this work was to develop an approach for chromosomal engineering of the thermophile Rhodothermus marinus. A selection strategy for R. marinus had previously been developed; this strategy was based on complementing a restriction-negative trpB strain with the R. marinus trpB gene. The current work identified an additional selective marker, purA, which encodes adenylosuccinate synthase and confers adenine prototrophy. In a two-step procedure, the available Trp+ selection was used during the deletion of purA from the R. marinus chromosome. The alternative Ade+ selection was in turn used while deleting the endogenous trpB gene. Since both deletions are unmarked, the purA and trpB markers may be reused. Through the double deletant SB-62 (ΔtrpB ΔpurA), the difficulties that are associated with spontaneous revertants and unintended chromosomal integration of marker-containing molecules are circumvented. The selection efficiency in R. marinus strain SB-62 (ΔtrpB ΔpurA) was demonstrated by targeting putative carotenoid biosynthesis genes, crtBI, using a linear molecule containing a marked deletion with 717 and 810 bp of 5′ and 3′ homologous sequences, respectively. The resulting Trp+ transformants were colorless rather than orange-red. The correct replacement of an internal crtBI fragment with the trpB marker was confirmed by Southern hybridization analysis of the transformants. Thus, it appears that target genes in the R. marinus chromosome can be readily replaced with linear molecules in a single step by double-crossover recombination. PMID:21705543

  10. Structure and stability of metagenome-derived glycoside hydrolase family 12 cellulase (LC-CelA) a homolog of Cel12A from Rhodothermus marinus☆

    PubMed Central

    Okano, Hiroyuki; Ozaki, Masashi; Kanaya, Eiko; Kim, Joong-Jae; Angkawidjaja, Clement; Koga, Yuichi; Kanaya, Shigenori


    Ten genes encoding novel cellulases with putative signal peptides at the N-terminus, termed pre-LC-CelA–J, were isolated from a fosmid library of a leaf–branch compost metagenome by functional screening using agar plates containing carboxymethyl cellulose and trypan blue. All the cellulases except pre-LC-CelG have a 14–29 residue long flexible linker (FL) between the signal peptide and the catalytic domain. LC-CelA without a signal peptide (residues 20–261), which shows 76% amino acid sequence identity to Cel12A from Rhodothermus marinus (RmCel12A), was overproduced in Escherichiacoli, purified and characterized. LC-CelA exhibited its highest activity across a broad pH range (pH 5–9) and at 90 °C, indicating that LC-CelA is a highly thermostable cellulase, like RmCel12A. The crystal structure of LC-CelA was determined at 1.85 Å resolution and is nearly identical to that of RmCel12A determined in a form without the FL. Both proteins contain two disulfide bonds. LC-CelA has a 16-residue FL (residues 20–35), most of which is not visible in the electron density map, probably due to structural disorder. However, Glu34 and Pro35 form hydrogen bonds with the central region of the protein. ΔFL-LC-CelA (residues 36–261) and E34A-LC-CelA with a single Glu34 → Ala mutation were therefore constructed and characterized. ΔFL-LC-CelA and E34A-LC-CelA had lower melting temperatures (Tm) than LC-CelA by 14.7 and 12.0 °C respectively. The Tm of LC-CelA was also decreased by 28.0 °C in the presence of dithiothreitol. These results suggest that Glu34-mediated hydrogen bonds and the two disulfide bonds contribute to the stabilization of LC-CelA. PMID:25426413

  11. Characterisation of Eubacterium-like strains isolated from oral infections.


    Downes, J; Munson, M A; Spratt, D A; Kononen, E; Tarkka, E; Jousimies-Somer, H; Wade, W G


    The genus Eubacterium currently includes a heterogeneous group of gram-positive, non-spore-forming anaerobic bacilli, many of which are slow growing, fastidious and generally unreactive in biochemical tests. As a consequence, cultivation and identification of isolates are difficult and the taxonomy of the group remains indifferent. In this study, 105 isolates from odontogenic infections, infections associated with dental implants or saliva from healthy subjects and provisionally assigned to the genus Eubacterium were subjected to phenotypic and genotypic analysis. Ninety-one of the isolates were identified as belonging to one of 14 previously described species: Atopobium parvulum (5 isolates), A. rimae (29), Bulleidia extructa (2), Cryptobacterium curtum (1), Dialister pneumosintes (1), Eubacterium saburreum (2), E. sulci (8), E. yurii subsp. yurii (1), Filifactor alocis (3), Lactobacillus uli (1), Mogibacterium timidum (13), M. vescum (6), Pseudoramibacter alactolyticus (6) and Slackia exigua (13). The remaining 14 isolates did not correspond to existing species. This study confirms the diversity of organisms provisionally assigned to the genus Eubacterium by conventional identification methods. This group of organisms is frequently isolated from oral infections but their role in the aetiology of these conditions has yet to be determined.

  12. Eubacterium callanderi bacteremia: report of the first case.


    Thiolas, Aurélie; Bollet, Claude; Gasmi, Mohammed; Drancourt, Michel; Raoult, Didier


    Eubacterium callanderi is an environmental anaerobic rod-shaped bacterium first isolated in 1998 from an industrial anaerobic digester. We report on the first clinical isolate of E. callanderi, which was recovered from the blood of a patient with a bladder carcinoma. Identification of the organism was made by cell fatty acid chromatographic analysis and 16S rRNA gene sequencing.

  13. Molecular characterization of the presence of Eubacterium spp and Streptococcus spp in endodontic infections.


    Fouad, A F; Kum, K-Y; Clawson, M L; Barry, J; Abenoja, C; Zhu, Q; Caimano, M; Radolf, J D


    Eubacterium spp. and Streptococcus spp. are virulent, commonly identified microorganisms in endodontic infections. The purpose of this study was to use molecular methods to identify these organisms in 22 infected root canals that include eight cases with preoperative clinical symptoms and five cases with a history of diabetes mellitus. The presence of Streptococcus spp. and Eubacterium spp. was examined using two sets of PCR primers specific with multiple species within the respective genera. Positive specimens had their PCR products sequenced and phylogenetically analyzed to identify the specific species. Sixteen specimens (73%) contained Eubacterium spp. and nine (41%) were positive for Streptococcus spp. Eubacterium infirmum was the most prevalent Eubacterium sp. This organism was significantly associated with a history of diabetes (OR = 9.6; P = 0.04). Streptococcus anginosus was the most common Streptococcus sp., but neither it nor any of the other streptococci were significantly associated with the clinical parameters evaluated.

  14. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.


    Kageyama, A; Benno, Y


    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  15. Arginine, a growth-limiting factor for Eubacterium lentum.

    PubMed Central

    Sperry, J F; Wilkins, T D


    Eubacterium lentum is a gram-positive, asaccharolytic, obligately anaerobic bacillus, which grows to a low turbidity (absorbancy at 650 nm = 0.05 to 0.1) in peptone-based medium. The addition of substrate amounts of arginine or citrulline dramatically increased growth (absorbancy at 650 nm =1.4). The presence of an arginine dihydrolase pathway was confirmed by measurement of the necessary enzymes and demonstration of the intermediate compounds. The production of adenosine 5'-triphosphate from the arginine dihydrolase pathway appeared to be the sole source of energy for growth of this organism. Each of 11 strains showed definite growth stimulation. Ten of the 11 strains had cytochromes. Growth stimulation with arginine and the presence of cytochromes offer two new positive criteria for the identification of E. lentum. PMID:182668

  16. Arginine, a growth-limiting factor for Eubacterium lentum.


    Sperry, J F; Wilkins, T D


    Eubacterium lentum is a gram-positive, asaccharolytic, obligately anaerobic bacillus, which grows to a low turbidity (absorbancy at 650 nm = 0.05 to 0.1) in peptone-based medium. The addition of substrate amounts of arginine or citrulline dramatically increased growth (absorbancy at 650 nm =1.4). The presence of an arginine dihydrolase pathway was confirmed by measurement of the necessary enzymes and demonstration of the intermediate compounds. The production of adenosine 5'-triphosphate from the arginine dihydrolase pathway appeared to be the sole source of energy for growth of this organism. Each of 11 strains showed definite growth stimulation. Ten of the 11 strains had cytochromes. Growth stimulation with arginine and the presence of cytochromes offer two new positive criteria for the identification of E. lentum.

  17. ppc, the gene for phosphoenolpyruvate carboxylase from an extremely thermophilic bacterium, Rhodothermus obamensis: cloning, sequencing and overexpression in Escherichia coli.


    Takai, K; Sako, Y; Uchida, A


    The ppc gene, which encodes phosphoenolpyruvate carboxylase (PEPC) of an extremely thermophilic bacterium, Rhodothermus obamensis, was directly sequenced by the thermal asymmetric interlaced (TAIL) PCR method. An ORF for a 937 amino acid polypeptide was found in the gene. The ppc gene had a high G+C content (66.2 mol%) and the third position of the codon exhibited strong preference for G or C usage (85.0 mol%). The calculated molecular mass was 107,848 Da, which was consistent with the molecular mass of the enzyme as determined by SDS-PAGE (100 kDa). The amino acid sequence of R. obamensis PEPC was closely related to that of PEPC from another thermophile, a Thermus sp., and from a mesophile, Corynebacterium glutamicum, exhibiting 45.3% or 37.7% identity and 61.5% or 56.5% similarity, respectively. By Southern analysis, the ppc gene was found to be present in a single copy in the genomic DNA of this organism. The cloned gene was expressed in Escherichia coli using a pET expression vector system and a thermostable recombinant PEPC was obtained. Comparison of the deduced amino acid sequences of the thermophilic and mesophilic PEPCs revealed distinct or common preferences for specific amino acid composition and substitutions in the two thermophilic enzymes.

  18. Antitumor mechanisms of Eubacterium lentum and its components.


    Hatta, M


    In the present study, some antitumor mechanisms of Eubacterium lentum (TYH-11) and bacterial components having antitumor effects were investigated. E.lentum induced maximum NK cell activity in C3H/He mice on day 1 after injection (90.6% against 33.9% of control at E:T ratio 50:1) and the activity was kept at a level of 48.6% on day 7. Tumoricidal peritoneal macrophages were induced 9 days after E.lentum injection into BALB/c mice (56.2% against 10.1% control at E:T ratio 10:1). Tumoricidal macrophage activity persisted at the same level for at least 11 days. Cytotoxic T lymphocyte (CTL) activity was induced only in tumor bearing mice treated with E.lentum, 4 weeks after tumor inoculation. Antitumor activity was observed in the cell wall (CW) and membrane fractions (CM) of E.lentum. CW induced NK cell activity; the activity was transient while the kinetics of NK activity by CM showed 2 peaks, on day 1 and day 7. Tumoricidal macrophages were induced by CW and the activity level was the same as that induced by whole body, while that induced by CM was at a lower level. Neither CW nor CM induced CTL in tumor bearing mice.

  19. Morphology and Round Body Formation in Vibrio marinus

    PubMed Central

    Felter, R. A.; Colwell, R. R.; Chapman, G. B.


    The morphology of Vibrio marinus MP-1 was studied by phase and electron microscopy. The ultrastructure of the vibrio form of V. marinus was found to be typically gram-negative with a trilaminar plasma membrane and cell wall. The coccoid or round bodies noted in otherwise pure cultures of V. marinus were frequently found in early and late stationary phase of growth. The round bodies in ultrathin section were found to contain at least one, and often three or four, cell units. Three types of round bodies were observed in ultrathin section, each differing in size and behavior: “spherules,” “spheres” or the “round body,” and “giant cells” or “macrospheres.” The round bodies appeared to be associated with, or to result from, the constrictive cell division of V. marinus. Images PMID:4895849

  20. Development of sea lamprey (Petromyzon marinus) larvicides

    USGS Publications Warehouse

    Howell, John H.; Lech, John J.; Allen, John L.


    Larvicides are used to control sea lamprey (Petromyzon marinus) in the Great Lakes. These larvicides are useful because they are more toxic to sea lamprey than fish species found in the same habitat. The lampricides come from two classes of chemical compounds: (1) halonitrophenols, and (2) halonitrosalicylanilides. Selectivity of the larvicides appears to be based on the differences in the ability of sea lamprey larvae and fishes to detoxify and/or excrete the chemicals. Glucuronide conjugation is an important mechanism for detoxification of these larvicides by fish, and selectivity of larvicides may be due to differences in glucuronyl transferase activity between lamprey and fishes. If more detailed information were available on uptake, metabolism, excretion, and the biochemistry and physiology of lamprey as compared to fishes, it might be possible to design chemicals that would be more selective than those now in use.

  1. Molecular and functional analysis of nicotinate catabolism in Eubacterium barkeri.


    Alhapel, Ashraf; Darley, Daniel J; Wagener, Nadine; Eckel, Elke; Elsner, Nora; Pierik, Antonio J


    The anaerobic soil bacterium Eubacterium barkeri catabolizes nicotinate to pyruvate and propionate via a unique fermentation. A full molecular characterization of nicotinate fermentation in this organism was accomplished by the following results: (i) A 23.2-kb DNA segment with a gene cluster encoding all nine enzymes was cloned and sequenced, (ii) two chiral intermediates were discovered, and (iii) three enzymes were found, completing the hitherto unknown part of the pathway. Nicotinate dehydrogenase, a (nonselenocysteine) selenium-containing four-subunit enzyme, is encoded by ndhF (FAD subunit), ndhS (2 x [2Fe-2S] subunit), and by the ndhL/ndhM genes. In contrast to all enzymes of the xanthine dehydrogenase family, the latter two encode a two-subunit molybdopterin protein. The 6-hydroxynicotinate reductase, catalyzing reduction of 6-hydroxynicotinate to 1,4,5,6-tetrahydro-6-oxonicotinate, was purified and shown to contain a covalently bound flavin cofactor, one [2Fe-2S](2+/1+) and two [4Fe-4S](2+/1+) clusters. Enamidase, a bifunctional Fe-Zn enzyme belonging to the amidohydrolase family, mediates hydrolysis of 1,4,5,6-tetrahydro-6-oxonicotinate to ammonia and (S)-2-formylglutarate. NADH-dependent reduction of the latter to (S)-2-(hydroxymethyl)glutarate is catalyzed by a member of the 3-hydroxyisobutyrate/phosphogluconate dehydrogenase family. A [4Fe-4S]-containing serine dehydratase-like enzyme is predicted to form 2-methyleneglutarate. After the action of the coenzyme B(12)-dependent 2-methyleneglutarate mutase and 3-methylitaconate isomerase, an aconitase and isocitrate lyase family pair of enzymes, (2R,3S)-dimethylmalate dehydratase and lyase, completes the pathway. Genes corresponding to the first three enzymes of the E. barkeri nicotinate catabolism were identified in nine Proteobacteria.

  2. Complete genome sequence of Staphylothermus marinus Stetter and Fiala 1986 type strain F1

    SciTech Connect

    Anderson, Iain; Sun, Hui; Lapidus, Alla L.; Copeland, A; Glavina Del Rio, Tijana; Tice, Hope; Dalin, Eileen; Lucas, Susan; Barry, Kerrie; Land, Miriam L; Richardson, P M; Huber, Harald; Kyrpides, Nikos C


    Staphylothermus marinus Fiala and Stetter 1986 belongs to the order Desulfurococcales within the archaeal phylum Crenarchaeota. S. marinus is a hyperthermophilic, sulfur-dependent, anaerobic heterotroph. Strain F1 was isolated from geothermally heated sediments at Vulcano, Italy, but S. marinus has also been isolated from a hydrothermal vent on the East Pacific Rise. We report the complete genome of S. marinus strain F1, the type strain of the species. This is the fifth reported complete genome sequence from the order Desulfurococcales.

  3. Proposal of a neotype strain (A1-86) for Eubacterium rectale. Request for an opinion.


    Duncan, Sylvia H; Flint, Harry J


    Eubacterium rectale is one of the most abundant bacterial species recovered from human faeces. E. rectale (Hauduroy et al. 1937) appears in the 'List of Bacterial Names with Standing in Nomenclature', but it is noted that the originally proposed type strain, VPI 0989(T), has been lost and its possible replacement by another strain (VPI 0990) from the same faecal sample has never been formally proposed. It is therefore proposed that strain A1-86 (=DSM 17629=NCIMB 14373), isolated from human adult faeces, be formally recognized as the neotype strain of Eubacterium rectale.

  4. Chemosterilization of the sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Hanson, Lee H.; Manion, Patrick J.


    The chemical, P,P-bis(1-aziridinyl)-N-methylphosphinothioic amide (bisazir), was found in laboratory studies to be an effective sterilant for both sexes of adult sea lampreys (Petromyzon marinus) when given intraperitoneally at a dosage of 100 mg per kilogram of body weight. A total of 300 normal spawning-run sea lampreys and 300 injected with bisazir were released into the Big Garlic River, Marquette County, Michigan, (a small stream divided into five sections by natural barriers), to determine the effect of bisazir on the nesting and spawning behavior of the adults and on the production of larvae. The lampreys constructed and spawned in 95 nests. Sterile adults showed no abnormal nest building or spawning behavior. Sterile males competed effectively with normal males for females. Egg samples taken from nests indicated that eggs in nests where sterile males spawned with sterile or normal females did not hatch, although some embryonic development occurred. Extensive surveys with electric shockers produced no larvae in stream sections where sterile males spawned, but yielded numerous larvae in sections where normal males spawned with normal females. These findings suggest that the release of sterile males may be an effective tool in an integrated approach to control of sea lampreys in the Great Lakes.

  5. Clinical and microbiological characteristics of bacteremia caused by Eggerthella, Paraeggerthella, and Eubacterium species at a university hospital in Taiwan from 2001 to 2010.


    Lee, Meng-Rui; Huang, Yu-Tsung; Liao, Chun-Hsing; Chuang, Tzu-Yi; Wang, Wei-Jie; Lee, Shih-Wei; Lee, Li-Na; Hsueh, Po-Ren


    We describe 16 patients with bacteremia caused by Eggerthella lenta (n = 7), Paraeggerthella hongkongensis (n = 3), Eubacterium limosum (n = 4), Eubacterium callanderi (n = 1), and concomitant Eubacterium limosum/Eggerthella lenta (n = 1). Nine (56%) patients had polymicrobial bacteremia. The overall 60-day mortality rate was 19%, and all deaths occurred in patients with E. lenta bacteremia.

  6. The behavioural response of adult Petromyzon marinus to damage-released alarm and predator cues.


    Imre, I; Di Rocco, R T; Belanger, C F; Brown, G E; Johnson, N S


    Using semi-natural enclosures, this study investigated (1) whether adult sea lamprey Petromyzon marinus show avoidance of damage-released conspecific cues, damage-released heterospecific cues and predator cues and (2) whether this is a general response to injured heterospecific fishes or a specific response to injured P. marinus. Ten replicate groups of 10 adult P. marinus, separated by sex, were exposed to one of the following nine stimuli: deionized water (control), extracts prepared from adult P. marinus, decayed adult P. marinus (conspecific stimuli), sympatric white sucker Catostomus commersonii, Amazon sailfin catfish Pterygoplichthys pardalis (heterospecific stimuli), 2-phenylethylamine (PEA HCl) solution, northern water snake Nerodia sipedon washing, human saliva (predator cues) and an adult P. marinus extract and human saliva combination (a damage-released conspecific cue and a predator cue). Adult P. marinus showed a significant avoidance response to the adult P. marinus extract as well as to C. commersonii, human saliva, PEA and the adult P. marinus extract and human saliva combination. For mobile P. marinus, the N. sipedon washing induced behaviour consistent with predator inspection. Exposure to the P. pardalis extract did not induce a significant avoidance response during the stimulus release period. Mobile adult female P. marinus showed a stronger avoidance behaviour than mobile adult male P. marinus in response to the adult P. marinus extract and the adult P. marinus extract and human saliva combination. The findings support the continued investigation of natural damage-released alarm cue and predator-based repellents for the behavioural manipulation of P. marinus populations in the Laurentian Great Lakes. © 2014 The Fisheries Society of the British Isles.

  7. The behavioural response of adult Petromyzon marinus to damage-released alarm and predator cues

    USGS Publications Warehouse

    Imre, István; Di Rocco, Richard; Belanger, Cowan; Brown, Grant; Johnson, Nicholas S.


    Using semi-natural enclosures, this study investigated (1) whether adult sea lamprey Petromyzon marinus show avoidance of damage-released conspecific cues, damage-released heterospecific cues and predator cues and (2) whether this is a general response to injured heterospecific fishes or a specific response to injured P. marinus. Ten replicate groups of 10 adult P. marinus, separated by sex, were exposed to one of the following nine stimuli: deionized water (control), extracts prepared from adult P. marinus, decayed adult P. marinus (conspecific stimuli), sympatric white sucker Catostomus commersonii, Amazon sailfin catfish Pterygoplichthys pardalis (heterospecific stimuli), 2-phenylethylamine (PEA HCl) solution, northern water snake Nerodia sipedon washing, human saliva (predator cues) and an adult P. marinus extract and human saliva combination (a damage-released conspecific cue and a predator cue). Adult P. marinus showed a significant avoidance response to the adult P. marinus extract as well as to C. commersonii, human saliva, PEA and the adult P. marinus extract and human saliva combination. For mobile P. marinus, the N. sipedon washing induced behaviour consistent with predator inspection. Exposure to the P. pardalis extract did not induce a significant avoidance response during the stimulus release period. Mobile adult female P. marinus showed a stronger avoidance behaviour than mobile adult male P. marinus in response to the adult P. marinus extract and the adult P. marinus extract and human saliva combination. The findings support the continued investigation of natural damage-released alarm cue and predator-based repellents for the behavioural manipulation of P. marinus populations in the Laurentian Great Lakes.

  8. Intestinal bacterium Eubacterium cellulosolvens deglycosylates flavonoid C- and O-glucosides.


    Braune, Annett; Blaut, Michael


    Eubacterium cellulosolvens cleaved the flavone C-glucosides homoorientin and isovitexin to their aglycones luteolin and apigenin, respectively. The corresponding isomers, orientin and vitexin, or other polyphenolic C-glucosides were not deglycosylated. E. cellulosolvens also cleaved several O-coupled glucosides of flavones and isoflavones to their corresponding aglycones.

  9. Complete genome sequence of a carbon monoxide-utilizing acetogen, Eubacterium limosum KIST612.


    Roh, Hanseong; Ko, Hyeok-Jin; Kim, Daehee; Choi, Dong Geon; Park, Shinyoung; Kim, Sujin; Chang, In Seop; Choi, In-Geol


    Eubacterium limosum KIST612 is an anaerobic acetogenic bacterium that uses CO as the sole carbon/energy source and produces acetate, butyrate, and ethanol. To evaluate its potential as a syngas microbial catalyst, we have sequenced the complete 4.3-Mb genome of E. limosum KIST612.

  10. Serum agglutinins to Eubacterium and Peptostreptococcus species in Crohn's and other diseases.

    PubMed Central

    Wensinck, F.; Van de Merwe, J. P.


    Sera from patients suffering from Crohn's and other diseases and from healthy subjects were tested for agglutinins to anaerobic, gram-positive coccoid rods belonging to species of Eubacterium and Peptostreptococcus. Four strains labelled Eubacterium contortum (two strains), Eubacterium rectale and Peptostreptococcus productus were agglutinated by a higher percentage of sera from patients with Crohn's disease than from healthy subjects and from patients with liver and intestinal diseases (including ulcerative colitis), ankylosing spondylitis, granulomatous diseases, diseases of immunity and malignancies. The agglutinins were of the IgG and IgM classes and strain-specific; the titres were low. The results obtained with sera from patients with Crohn's disease and healthy people were subjected to discriminant analysis to estimate the probability, based on the combined results with the four strains, that a patient suffers from Crohn's disease. When sera giving an a posteriori probability greater than or equal to 0.95 (a priori probability = 0.5) were considered positive, the test with four strains had a sensitivity of 54% and a specificity of nearly 100%. The results with sera submitted for diagnosis showed that positive reactions in patients with a diagnosis apparently incompatible with Crohn's disease were within acceptable limits. PMID:7019318

  11. Cloning, expression and purification of arylsulfate sulfotransferase from Eubacterium A-44.


    Kim, Bomi; Hyun, Yang-Jin; Lee, Keun-Sook; Kobashi, Kyoichi; Kim, Dong-Hyun


    A gene (astA) encoding arylsulfate sulfotransferase (ASST), which transfers a sulfate group from phenolic sulfate esters to phenolic acceptors, was cloned from a Eubacterium A-44 genomic library. The probe (1.5 kb fragment) for the astA gene was prepared from the PCR product of the primers produced using two internal amino acid sequences of ASST, which had been purified from Eubacterium A-44. The astA gene was cloned into the pKF3 vector. Its sequence revealed a 1863 bp open reading frame (ORF) encoding a protein containing 620 amino acids with a secretary signal peptide, and showed 91% homology (identity) to Eubacterium rectale IIIH previously reported. The cloned astA gene was expressed under the T7 promoter of the expression vectors, pET-39b(+) and pET-26b(+), in Escherichia coli BL21 (DE3), and the expressed ASSTs were purified using His Bind column chromatography. The specific activities of the purified ASSTs were 25.6 micromol/min/mg and 37.1 micromol/min/mg, respectively.

  12. Pseudokineococcus lusitanus gen. nov., sp. nov., and reclassification of Kineococcus marinus Lee 2006 as Pseudokineococcus marinus comb. nov.


    Jurado, Valme; Laiz, Leonila; Ortiz-Martinez, Alberto; Groth, Ingrid; Saiz-Jimenez, Cesareo


    A Gram-reaction-positive, motile, coccus-shaped actinobacterium, designated strain T2A-S27(T), was isolated from a roof tile in Oporto (Portugal) and studied using a polyphasic approach. The 16S rRNA gene sequence of the novel isolate showed high similarity to that of Kineococcus marinus KST3-3(T) (97.8 % sequence similarity). Strain T2A-S27(T) showed lower 16S rRNA gene sequence similarities with other members of the genus Kineococcus and members of the family Kineosporiaceae (<94 %). A phylogenetic tree, based on 16S rRNA gene sequences, showed that strain T2A-S27(T) formed a coherent clade with the type strain of K. marinus and Quadrisphaera granulorum. The isolate was characterized by the presence of meso-diaminopimelic acid in the cell-wall peptidoglycan, MK-9(H(2)) as the predominant menaquinone and a polar lipid profile consisting of diphosphatidylglycerol and phosphatidylglycerol. The fatty acid profile was dominated by anteiso-C(15 : 0). The DNA G+C content was 76.9 mol%. The low level of DNA-DNA relatedness to K. marinus (46-47 %) and the results of the chemotaxonomic and physiological studies clearly distinguished strain T2A-S27(T) from recognized species of the genus Kineococcus. On the basis of its phylogenetic position and phenotypic traits, strain T2A-S27(T) ( = LMG 24148(T)  = CECT 7306(T)  = DSM 23768(T)) represents a novel species of a new genus in the family Kineosporiaceae, for which the name Pseudokineococcus lusitanus gen. nov., sp. nov. is proposed. The misclassified species K. marinus is transferred to the new genus as Pseudokineococcus marinus comb. nov. The type strain of Pseudokineococcus marinus is KST3-3(T) ( = KCCM 42250(T)  = NRRL B-24439(T)).

  13. Artificial propagation of the sea lamprey Petromyzon marinus

    USGS Publications Warehouse

    Lennon, Robert E.


    Observations on the gland products, gonads, and general characteristics of sexually mature sea lampreys, Petromyzon marinus (Linnaeus), from Lake Huron, and a need to obtain some information on very young larval lampreys, prompted an experiment on the stripping and hatching of eggs. Seventeen specimens were selected from a group of spawning migrants which had been trapped in the Ocqueoc River, Michigan, during June and held in live-cars in the lake until early August.

  14. Phylogenetic and phenotypic evidence for the transfer of Eubacterium aerofaciens to the genus Collinsella as Collinsella aerofaciens gen. nov., comb. nov.


    Kageyama, A; Benno, Y; Nakase, T


    Three strains of Eubacterium aerofacien, JCM 10188T, JCM 7790 and JCM 7791, and 178 freshly isolated strains of the Eubacterium aerofaciens group from human faeces were characterized by biochemical tests, cell wall peptidoglycan type and 16S rRNA analysis. The Eubacterium aerofaciens group was divided into four groups by fermentation patterns of sucrose and cellobiose, and were further divided into 16 sub-groups by fermentation patterns of aesculin, salicin and amygdalin. All of the strains of the Eubacterium aerofaciens group were shown to be phylogenetically distantly related to Eubacterium limosum, which is the type species of genus Eubacterium. Eubacterium aerofaciens was shown to have a specific phylogenetic association with Coriobacterium glomerans. All the strains belonging to Eubacterium aerofaciens resembled Coriobacterium glomerans in possessing a high G + C content (60 mol%). Cell wall analysis, however, revealed the presence of different A4 beta (L-Ala)-D-Glu-L-Orn-L-Asp peptidoglycan types. Based on a 16S rRNA sequence divergence of greater than 9% with Coriobacterium glomerans and the presence of a unique peptidoglycan type, a new genus, Collinsella, is proposed for Eubacterium aerofaciens, with one species, Collinsella aerofaciens. The type strain of Collinsella aerofaciens is JCM 10188T.

  15. The Alveolate Perkinsus marinus: Biological Insights from EST Gene Discovery

    PubMed Central


    Background Perkinsus marinus, a protozoan parasite of the eastern oyster Crassostrea virginica, has devastated natural and farmed oyster populations along the Atlantic and Gulf coasts of the United States. It is classified as a member of the Perkinsozoa, a recently established phylum considered close to the ancestor of ciliates, dinoflagellates, and apicomplexans, and a key taxon for understanding unique adaptations (e.g. parasitism) within the Alveolata. Despite intense parasite pressure, no disease-resistant oysters have been identified and no effective therapies have been developed to date. Results To gain insight into the biological basis of the parasite's virulence and pathogenesis mechanisms, and to identify genes encoding potential targets for intervention, we generated >31,000 5' expressed sequence tags (ESTs) derived from four trophozoite libraries generated from two P. marinus strains. Trimming and clustering of the sequence tags yielded 7,863 unique sequences, some of which carry a spliced leader. Similarity searches revealed that 55% of these had hits in protein sequence databases, of which 1,729 had their best hit with proteins from the chromalveolates (E-value ≤ 1e-5). Some sequences are similar to those proven to be targets for effective intervention in other protozoan parasites, and include not only proteases, antioxidant enzymes, and heat shock proteins, but also those associated with relict plastids, such as acetyl-CoA carboxylase and methyl erythrithol phosphate pathway components, and those involved in glycan assembly, protein folding/secretion, and parasite-host interactions. Conclusions Our transcriptome analysis of P. marinus, the first for any member of the Perkinsozoa, contributes new insight into its biology and taxonomic position. It provides a very informative, albeit preliminary, glimpse into the expression of genes encoding functionally relevant proteins as potential targets for chemotherapy, and evidence for the presence of a relict


    EPA Science Inventory

    The oyster protozoan parasite, Perkinsus marinus, is one of the two important parasites causing severe mortality in the eastern oysters (Crassostrea virginica) on the US east coast. Our recent study suggests that P. marinus cells and its extracellular products (ECP) could scaveng...


    EPA Science Inventory

    The oyster protozoan parasite, Perkinsus marinus, is one of the two important parasites causing severe mortality in the eastern oysters (Crassostrea virginica) on the US east coast. Our recent study suggests that P. marinus cells and its extracellular products (ECP) could scaveng...

  18. Liver granulomas due to Eubacterium tortuosum in a seven-week-old Bobwhite quail.


    Williams, Susan M; Hafner, Scott; Sundram, Yoga


    Three 7-wk-old Bobwhite quail were submitted for necropsy to the Douglas branch of the Georgia Poultry Laboratory Network. Grossly, one bird had multiple white foci in the liver and a mild airsacculitis. In this quail there were multiple hepatic granulomas that contained mats of filamentous bacteria easily seen in hematoxylin- and eosin-stained histologic sections. These bacteria were negative with period acid-Schiff and were not acid fast. Bacteria were gram-positive but were most evident on Warthin-Starry silver-stained sections. The appearance and histochemical characteristics of these bacteria are most consistent with Eubacterium tortuosum.

  19. Anaerobic biodegradation of methyl esters by Acetobacterium woodii and Eubacterium limosum

    USGS Publications Warehouse

    Liu, Shi; Suflita, Joseph M.


    The ability ofAcetobacterium woodii andEubacterium limosum to degrade methyl esters of acetate, propionate, butyrate, and isobutyrate was examined under growing and resting-cell conditions. Both bacteria hydrolyzed the esters to the corresponding carboxylates and methanol under either condition. Methanol was further oxidized to formate under growing but not resting conditions. Unlike the metabolism of phenylmethylethers, no H2 requirement was evident for ester biotransformation. The hydrolysis of methyl carboxylates is thermodynamically favorable under standard conditions and the mixotrophic metabolism of ester/CO2 allowed for bacterial growth. These results suggest that the degradation of methyl carboxylates may be a heretofore unrecognized nutritional option for acetogenic bacteria.

  20. The family Coriobacteriaceae: reclassification of Eubacterium exiguum (Poco et al. 1996) and Peptostreptococcus heliotrinreducens (Lanigan 1976) as Slackia exigua gen. nov., comb. nov. and Slackia heliotrinireducens gen. nov., comb. nov., and Eubacterium lentum (Prevot 1938) as Eggerthella lenta gen. nov., comb. nov.


    Wade, W G; Downes, J; Dymock, D; Hiom, S J; Weightman, A J; Dewhirst, F E; Paster, B J; Tzellas, N; Coleman, B


    16S rRNA gene sequences were determined for Eubacterium exiguum and Peptostreptococcus heliotrinreducens. These species were found to be closely related and, together with Eubacterium lentum, to constitute a branch of the Coriobacteriaceae. Two new genera are proposed on the basis of phenotypic characteristics and 16S rRNA gene sequence comparisons: Slackia to include the bile-sensitive species Eubacterium exiguum and P. heliotrinreducens, and Eggerthella to include the bile-resistant Eubacterium lentum. It is proposed that Eubacterium exiguum and Peptostreptococcus heliotrinreducens are transferred to the genus Slackia gen. nov. as Slackia exigua gen. nov., comb. nov. (type strain ATCC 700122T) and Slackia heliotrinireducens gen. nov., comb. nov. (type strain NTCC 11029T), respectively, and Eubacterium lentum is transferred to the genus Eggerthella gen. nov. as Eggerthella lenta gen. nov., comb. nov. with Eggerthella lenta as the type species.

  1. Cutaneous abscess due to Eubacterium lentum in injection drug user: a case report and review of the literature.


    Lattuada, Emanuela; Zorzi, Antonella; Lanzafame, Massimiliano; Antolini, Dario; Fontana, Roberta; Vento, Sandro; Concia, Ercole


    We described the first case, to the best of our knowledge, of cutaneous abscess due to Eubacterium lentum in a parenteral drug user, after complete fracture of the right femor. The case underlines the importance of carefully performed microbiological tests, due to the peculiar cultural needs of the micro-organism.


    EPA Science Inventory

    A colorimetric microbicidal assay was adapted, optimized and applied in experiments to characterize the in vitro capacity of eastern oyster (Crassostrea virginica) hemocytes to kill cultured isolates of Perkinsus marinus, a protozoan parasite causing a highly destructive disease...


    EPA Science Inventory

    A colorimetric microbicidal assay was adapted, optimized and applied in experiments to characterize the in vitro capacity of eastern oyster (Crassostrea virginica) hemocytes to kill cultured isolates of Perkinsus marinus, a protozoan parasite causing a highly destructive disease...

  4. Evaluating potential artefacts of photo-reversal on behavioral studies with nocturnal invasive sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Barnett, Matthew; Imre, Istvan; Wagner, Michael C.; Di Rocco, Richard T.; Johnson, Nicholas; Brown, Grant E.


    Sea lampreys (Petromyzon marinus L., 1758) are nocturnal, so experiments evaluating their behaviour to chemosensory cues have typically been conducted at night. However, given the brief timeframe each year that adult P. marinus are available for experimentation, we investigated whether P. marinus exposed to a 12 h shifted diurnal cycle (reversed photoperiod) could be tested in a darkened arena during the day and show the same response to chemosensory cues as natural photoperiod P. marinus that were tested during the night. Ten replicates of 10 P. marinus, from each photoperiod, were exposed to deionized water (negative control), 2-phenylethylamine hydrochloride (PEA HCl, putative predator cue), or P. marinus whole-body extract (conspecific alarm cue). All P. marinus demonstrated a significant avoidance response to both cues. No significant differences were found in avoidance to PEA HCl between photoperiods. Avoidance of P. marinus whole-body extract was significantly stronger in natural compared with reversed photoperiod P. marinus. The use of reversed photoperiod subjects is suitable for examining the presence or absence of avoidance in response to novel chemosensory alarm cues, or the change in the magnitude of antipredator response. Studies investigating the natural magnitude of antipredator response should use natural photoperiod experimental subjects.

  5. Reclassification of Eubacterium formicigenerans Holdeman and Moore 1974 as Dorea formicigenerans gen. nov., comb. nov., and description of Dorea longicatena sp. nov., isolated from human faeces.


    Taras, David; Simmering, Rainer; Collins, Matthew D; Lawson, Paul A; Blaut, Michael


    Two strains of a gram-positively staining, obligately anaerobic, non-spore-forming, rod-shaped bacterium, designated strains 111-13A and 111-35T, were isolated from human faeces. Analysis of the 16S rRNA gene sequences indicated that these strains were members of the Clostridium coccoides rRNA group of organisms. The nearest relatives of the unknown bacterium were Eubacterium formicigenerans (having a sequence similarity of 94%) and an uncultured bacterium (similarity > 99%). Characterization studies indicated that the unidentified faecal bacterium was biochemically distinct from Eubacterium formicigenerans, members of the Clostridium coccoides group and all other described Eubacterium species. On the basis of the data from these studies, it is proposed that the hitherto unknown rod-shaped bacterium be designated a species of a novel genus, namely Dorea longicatena gen. nov., sp. nov., and that Eubacterium formicigenerans be transferred to this genus as Dorea formicigenerans gen. nov., comb. nov.

  6. Biochemical characterization of cellulose-binding proteins (CBPA and CBPB) from the rumen cellulolytic bacterium Eubacterium cellulosolvens 5.


    Yoshimatsu, Miho; Toyoda, Atsushi; Onizawa, Naoki; Nakamura, Yutaka; Minato, Hajime


    The cellulose-binding proteins, CBPA and CBPB, of rumen cellulolytic bacterium Eubacterium cellulosolvens 5 were biochemically characterized, and their properties were compared. Recombinant CBPA and CBPB were a typical 1,4-beta-endoglucanase. Both proteins bound to insoluble polysaccharides such as Avicel cellulose, acid swollen cellulose, lichenan, chitin, and oat spelt xylan. On the other hand, only recombinant CBPB bound to agarose and starch.

  7. Systemic Antibody Response of Clinically Characterized Patients with Antigens of Eubacterium brachy Initially and Following Periodontal Therapy,

    DTIC Science & Technology


    Iderity b, block numb.;_ Eubacterium brach a Gram (+) positive anaerobic rod, has been Implicated by cultura ~stu- es to be associated with the microflora...than V.’ did HS when reactivity with E. brachy artigeus was determined (P < .001). Juvenile perlodontitis (JP) and adult periodontlt is (AP) patients...there was uo specific pattern of bone loss. Forty-nlue patients were classified as juvenile periodontitis (JP) patients, a condition previously

  8. Consumption and feeding preference of Echinogammarus marinus on two different algae: Fucus vesiculosus and Ulva intestinalis

    NASA Astrophysics Data System (ADS)

    Martins, Irene; Leite, Nuno; Constantino, Emanuel


    Echinogammarus marinus constitutes the most abundant amphipod species in Fucus spp. assemblages from many North Atlantic estuaries. However, there are some doubts about the real use of fucoids by the amphipod. Whilst some studies report the ingestion of Fucus vesiculosus by E. marinus, others suggest that the amphipod preference for fucoids is mostly related to sheltering rather than feeding, due to the high phlorotannin content of brown algae. The purpose of the present work was to disentangle this issue by checking the consumption rate and feeding preference of E. marinus on F. vesiculosus, its preferential habitat, and on Ulva intestinalis, a green algae abundant in the Mondego estuary (Western Coast of Portugal) and usually considered as highly palatable for herbivores. In a 2-stage laboratorial setup, fresh disks of the two types of algae were offered to E. marinus for three days. Consumption rates were estimated from differences between algal and animal initial and final fresh weights using a control correction factor, while preference was tested by differences in algal consumption rates when no choice was offered (stage 1) and when the two algae were offered simultaneously (stage 2). Results showed that E. marinus effectively consumed fresh F. vesiculosus in much higher amounts than U. intestinalis and significantly preferred to consume F. vesiculosus over U. intestinalis. Therefore, feeding habits must be one of the factors related to the close association of the amphipod with F. vesiculosus, although other factors may also be involved (e.g. sheltering).

  9. Eubacterium plautii infection in a kidney transplant recipient: a noteworthy case of pleural effusion and fever.


    Orlando, Giuseppe; Pisani, Francesco; Mastrantonio, Paola; Bonanni, Luigi; Di Cocco, Pierpaolo; D'Angelo, Maurizio; Tabilio, Antonio; Famulari, Antonio


    We report a noteworthy case of Eubacterium plautii infection after kidney transplantation. Our 33-yr-old transplant recipient received standard care; his post-transplant course was uneventful. However, on day 44 he underwent an emergency laparotomy for perforation of the ileum. He was initially treated with ceftazidime, fluconazole and metronidazole, but his fever persisted, so he was switched to meropenem and vancocin. We could not find any cause for his infection. On day 70, his temperature normalized. On day 75, he developed severe leukopenia (280 cell/mL). His cytomegalovirus-DNA test result was negative, so all immunosuppressants, except for prednisone, were stopped; instead, antibiotic prophylaxis was started, using caspofungin, trimethoprim-sulfamethoxazole and ciprofloxacin. On day 83, he underwent percutaneous drainage of massive left pleural effusion. We repeatedly cultured the pleural liquid, but it was not till three wk later that we were finally able to identify the causative organism. We hypothesize that the microorganism - which normally resides on the surface of the intestinal lumen - entered the bloodstream via bacterial translocation, eventually colonizing the pleurae. This translocation was favored by our patient poor clinical condition, his immunosuppressive treatment and his heavy antibiotherapy. Our experience highlights the need for wiser use of antibiotics in transplant recipients.

  10. Molecular details of a starch utilization pathway in the human gut symbiont Eubacterium rectale.


    Cockburn, Darrell W; Orlovsky, Nicole I; Foley, Matthew H; Kwiatkowski, Kurt J; Bahr, Constance M; Maynard, Mallory; Demeler, Borries; Koropatkin, Nicole M


    Eubacterium rectale is a prominent human gut symbiont yet little is known about the molecular strategies this bacterium has developed to acquire nutrients within the competitive gut ecosystem. Starch is one of the most abundant glycans in the human diet, and E. rectale increases in vivo when the host consumes a diet rich in resistant starch, although it is not a primary degrader of this glycan. Here we present the results of a quantitative proteomics study in which we identify two glycoside hydrolase 13 family enzymes, and three ABC transporter solute-binding proteins that are abundant during growth on starch and, we hypothesize, work together at the cell surface to degrade starch and capture the released maltooligosaccharides. EUR_21100 is a multidomain cell wall anchored amylase that preferentially targets starch polysaccharides, liberating maltotetraose, whereas the membrane-associated maltogenic amylase EUR_01860 breaks down maltooligosaccharides longer than maltotriose. The three solute-binding proteins display a range of glycan-binding specificities that ensure the capture of glucose through maltoheptaose and some α1,6-branched glycans. Taken together, we describe a pathway for starch utilization by E. rectale DSM 17629 that may be conserved among other starch-degrading Clostridium cluster XIVa organisms in the human gut.

  11. Structure of the pilus assembly protein TadZ from Eubacterium rectale: implications for polar localization.


    Xu, Qingping; Christen, Beat; Chiu, Hsiu-Ju; Jaroszewski, Lukasz; Klock, Heath E; Knuth, Mark W; Miller, Mitchell D; Elsliger, Marc-André; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Figurski, David H; Shapiro, Lucy; Wilson, Ian A


    The tad (tight adherence) locus encodes a protein translocation system that produces a novel variant of type IV pili. The pilus assembly protein TadZ (called CpaE in Caulobacter crescentus) is ubiquitous in tad loci, but is absent in other type IV pilus biogenesis systems. The crystal structure of TadZ from Eubacterium rectale (ErTadZ), in complex with ATP and Mg(2+) , was determined to 2.1 Å resolution. ErTadZ contains an atypical ATPase domain with a variant of a deviant Walker-A motif that retains ATP binding capacity while displaying only low intrinsic ATPase activity. The bound ATP plays an important role in dimerization of ErTadZ. The N-terminal atypical receiver domain resembles the canonical receiver domain of response regulators, but has a degenerate, stripped-down 'active site'. Homology modelling of the N-terminal atypical receiver domain of CpaE indicates that it has a conserved protein-protein binding surface similar to that of the polar localization module of the social mobility protein FrzS, suggesting a similar function. Our structural results also suggest that TadZ localizes to the pole through the atypical receiver domain during an early stage of pili biogenesis, and functions as a hub for recruiting other pili components, thus providing insights into the Tad pilus assembly process.

  12. Glutathionylation of the iron superoxide dismutase from the psychrophilic eubacterium Pseudoalteromonas haloplanktis.


    Castellano, Immacolata; Ruocco, Maria Rosaria; Cecere, Francesca; Di Maro, Antimo; Chambery, Angela; Michniewicz, Andzelika; Parlato, Giuseppe; Masullo, Mariorosario; De Vendittis, Emmanuele


    Our previous work showed that the adduct between beta-mercaptoethanol and the single cysteine residue (Cys57) in superoxide dismutase from the psychrophilic eubacterium Pseudoalteromonas haloplanktis (PhSOD) reduces the enzyme inactivation by peroxynitrite. In this work, immunoblotting experiments prove that peroxynitrite inactivation of PhSOD involves formation of nitrotyrosine residue(s). In order to study the role of Cys57 as a redox-sensor residue modifiable by cellular thiols, a recombinant PhSOD and two Cys57 mutants were produced and characterized. Recombinant and mutant enzymes share similar activity and peroxynitrite inactivation, but different reactivity towards three glutathione forms. Indeed, oxidized glutathione and S-nitrosoglutathione, but reduced glutathione, lead to S-glutathionylation of recombinant PhSOD. This new covalent modification for a Fe-SOD does not occur in both Cys57 mutants, thus indicating that its target is Cys57. Moreover, mass spectrometry analysis confirmed that S-glutathionylation of Cys57 takes place also with endogenous PhSOD. Formation of this mixed disulfide in PhSOD protects the enzyme from tyrosine nitration and peroxynitrite inactivation. PhSOD undergoes S-glutathionylation during its overproduction in E. coli cells and in a growing culture of P. haloplanktis. In both cases the extent of glutathionylated PhSOD is enhanced upon cell exposure to oxidative agents. We suggest that S-glutathionylation of PhSOD could represent a further cold-adaptation strategy to improve the antioxidant cellular defence mechanism.

  13. Reductive dechlorination of methoxychlor and DDT by human intestinal bacterium Eubacterium limosum under anaerobic conditions.


    Yim, You-Jin; Seo, Jiyoung; Kang, Su-Il; Ahn, Joong-Hoon; Hur, Hor-Gil


    Methoxychlor [1,1,1-trichloro-2,2-bis(p-methoxyphenyl)ethane], a substitute for 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane (DDT), is a compound of environmental concern because of potential long-term health risks related to its endocrine-disrupting and carcinogenic potency. In order to determine the metabolic fate of methoxychlor and DDT in the human intestinal gut, Eubacterium limosum (ATCC 8486), a strict anaerobe isolated from the human intestine that is capable of O-demethylation toward O-methylated isoflavones, was used as a model intestinal microbial organism. Under anaerobic incubation conditions, E. limosum completely transformed methoxychlor and DDT in 16 days. Based on gas chromatography-mass chromatography analyses, the metabolites produced from methoxychlor and DDT by E. limosum were confirmed to be 1,1-dichloro-2,2-bis(p-methoxyphenyl)ethane (methoxydichlor) and 1,1-dichloro-2,2-bis(p-chlorophenyl)ethane (DDD), respectively. This study suggests that E. limosum in the human intestinal gut might be a participant in the reductive dechlorination of methoxychlor to the more antiandrogenic active methoxydichlor.

  14. Molecular details of a starch utilization pathway in the human gut symbiont Eubacterium rectale

    PubMed Central

    Cockburn, Darrell W.; Orlovsky, Nicole I.; Foley, Matthew H.; Kwiatkowski, Kurt J.; Bahr, Constance M.; Maynard, Mallory; Demeler, Borries; Koropatkin, Nicole M.


    Summary Eubacterium rectale is a prominent human gut symbiont yet little is known about the molecular strategies this bacterium has developed to acquire nutrients within the competitive gut ecosystem. Starch is one of the most abundant glycans in the human diet, and E. rectale increases in vivo when the host consumes a diet rich in resistant starch, although it is not a primary degrader of this glycan. Here we present the results of a quantitative proteomics study in which we identify two glycoside hydrolase 13 family enzymes, and three ABC transporter solute-binding proteins that are abundant during growth on starch and, we hypothesize, work together at the cell surface to degrade starch and capture the released maltooligosaccharides. EUR_21100 is a multidomain cell wall anchored amylase that preferentially targets starch polysaccharides, liberating maltotetraose, while the membrane associated maltogenic amylase EUR_01860 breaks down maltooligosaccharides longer than maltotriose. The three solute-binding proteins display a range of glycan-binding specificities that ensure the capture of glucose through maltoheptaose and some α1,6-branched glycans. Taken together, we describe a pathway for starch utilization by E. rectale DSM 17629 that may be conserved among other starch-degrading Clostridium cluster XIVa organisms in the human gut. PMID:25388295

  15. Reduction of digoxin to 20R-dihydrodigoxin by cultures of Eubacterium lentum.

    PubMed Central

    Robertson, L W; Chandrasekaran, A; Reuning, R H; Hui, J; Rawal, B D


    The anaerobic bacterium Eubacterium lentum, a common constituent of the intestinal microflora, inactivates digoxin by reducing the unsaturated lactone ring. Reduction of the cardiac glycoside by growing cultures of E. lentum ATCC 25559 proceeded in a stereospecific manner, with the 20R-dihydrodigoxin constituting more than 99% of the product formed. This is in contrast to the 3:1 ratio of 20R and 20S epimers formed in the chemical catalytic hydrogenation. Formation of the reduced glycosides proceeded quantitatively when an overall concentration of 10 micrograms/ml was added to the cultures. E. lentum did not hydrolyze the digitoxose sugars from C-3 of the parent glycoside. However, the synthetically prepared sugar-hydrolyzed metabolites (digoxigenin, digoxigenin monodigitoxoside, and digoxigenin bisdigitoxoside) were reduced to the corresponding dihydro metabolites. Repetition of the experiments with a feces sample from a volunteer who was known to be a converter of digoxin to dihydrodigoxin gave results identical to those obtained with pure E. lentum cultures. PMID:3729400

  16. Oral treatment with Eubacterium hallii improves insulin sensitivity in db/db mice.


    Udayappan, Shanthadevi; Manneras-Holm, Louise; Chaplin-Scott, Alice; Belzer, Clara; Herrema, Hilde; Dallinga-Thie, Geesje M; Duncan, Silvia H; Stroes, Erik S G; Groen, Albert K; Flint, Harry J; Backhed, Fredrik; de Vos, Willem M; Nieuwdorp, Max


    An altered intestinal microbiota composition is associated with insulin resistance and type 2 diabetes mellitus. We previously identified increased intestinal levels of Eubacterium hallii, an anaerobic bacterium belonging to the butyrate-producing Lachnospiraceae family, in metabolic syndrome subjects who received a faecal transplant from a lean donor. To further assess the effects of E. hallii on insulin sensitivity, we orally treated obese and diabetic db/db mice with alive E. hallii and glycerol or heat-inactive E. hallii as control. Insulin tolerance tests and hyperinsulinemic-euglycemic clamp experiments revealed that alive E. hallii treatment improved insulin sensitivity compared control treatment. In addition, E. hallii treatment increased energy expenditure in db/db mice. Active E. hallii treatment was found to increase faecal butyrate concentrations and to modify bile acid metabolism compared with heat-inactivated controls. Our data suggest that E. hallii administration potentially alters the function of the intestinal microbiome and that microbial metabolites may contribute to the improved metabolic phenotype.


    EPA Science Inventory

    Perkinsus marinus, a pathogen of the eastern oyster Crassostrea virginica, is transmitted directly among oysters. Previous studies found viable P. marinus parasites in the feces and
    pseudofeces of oysters within hours of injection with parasites, suggesting that the parasite ...

  18. Natural and cultured populations of the mangrove oyster Saccostrea palmula from Sinaloa, Mexico, infected by Perkinsus marinus.


    Cáceres-Martínez, Jorge; Ortega, Mauricio García; Vásquez-Yeomans, Rebeca; García, Teresa de Jesús Pineda; Stokes, Nancy A; Carnegie, Ryan B


    The mangrove oyster Saccostrea palmula coexists with the pleasure oyster Crassostrea corteziensis in coastal lagoons of northwest Mexico. Recent discovery of Perkinsus marinus infecting the pleasure oyster in the region prompted evaluation of S. palmula as an alternative P. marinus host. An analysis to determine the possible presence of P. marinus in natural and cultured populations of S. palmula at four coastal lagoons in Sinaloa, Mexico was carried out during October-November 2010. Tissues from apparently healthy S. palmula were evaluated using Ray's fluid thioglycollate method (RFTM), which revealed a Perkinsus sp. to be present in all four locations at 6.7-20.0% prevalence. Histopathological analysis of these specimens showed tissue alterations and parasite forms consistent with moderate P. marinus infection, which was confirmed by ribosomal non-transcribed spacer (NTS)-based PCR assays on DNA samples from oysters positive by RFTM and histology. DNA sequencing of amplified NTS fragments (307 bp) produced a sequence 98-100% similar to GenBank-deposited sequences of the NTS from P. marinus. Fluorescent in situ hybridization for Perkinsus spp. and P. marinus corroborated the PCR results, showing clear hybridization of P. marinus in host tissues. This is the first record of P. marinus infecting a species from genus Saccostrea and the first record of the parasite from coastal lagoons in Sinaloa, Mexico.


    EPA Science Inventory

    Perkinsus marinus, a pathogen of the eastern oyster Crassostrea virginica, is transmitted directly among oysters. Previous studies found viable P. marinus parasites in the feces and
    pseudofeces of oysters within hours of injection with parasites, suggesting that the parasite ...

  20. Feeding of sea lampreys Petromyzon marinus on minke whales Balaenoptera acutorostrata in the St Lawrence Estuary, Canada.


    Nichols, O C; Tscherter, U T


    Sea lampreys Petromyzon marinus were observed on 109 occasions on 47 individual minke whales Balaenoptera acutorostrata. Bloody lesions could be identified as previous attachment sites, indicating P. marinus feeding on B. acutorostrata blood. © 2010 The Authors. Journal of Fish Biology © 2010 The Fisheries Society of the British Isles.

  1. Microsatellite genotypes reveal some long distance gene flow in Perkinsus marinus, a major pathogen of eastern oysters

    USDA-ARS?s Scientific Manuscript database

    As the agent of Dermo disease, Perkinsus marinus causes significant mortality and reduced fecundity in host populations. Passive dispersal of P. marinus between hosts subjects parasite movements to control by water currents in estuarine systems, potentially limiting connectivity among parasite popul...

  2. Distribution of ferric iron in larval lampreys, Petromyzon marinus L.


    Hall, S J; Youson, J H


    The distribution and abundance of ferric iron in larval lampreys (Petromyzon marinus L.) were investigated using light microscopy and the Prussian blue stain. Animals from various watersheds contained different concentrations of iron, although the sites of deposition were the same for all animals. A major portion of iron is within adipose tissue, while the liver, and cartilage contain predominantly low to trace amounts of iron, respectively. Iron is associated with fibrous connective tissue in several places in the body, and this association may have particular significance in the inner ear. Iron is also located in cells of the meninges. The presence of iron in the epithelial cells of the posterior intestine may reflect elimination of the metal through the extrusion of iron-loaded cells into the intestinal lumen. Iron within mucous cells of the epidermis, suggest elimination of iron during mucous secretion. Iron-loaded cells of bipolar shape are also present in the epidermis, but are particularly prominent around the branchiopore. Low concentrations of iron are observed within in melanin-containing macrophages (melano-macrophages) in regions of iron absorption, erythrophagocytosis, and haemopoiesis. High levels of iron in the epithelia and lumina of pronephric tubules are concomitant with degeneration of this organ. These data are evidence of the wide spread distribution of iron in lamprey tissues and additional evidence for the potential value of lampreys for the study of iron metabolism in vertebrates.

  3. Chemical cues and pheromones in the sea lamprey (Petromyzon marinus).


    Buchinger, Tyler J; Siefkes, Michael J; Zielinski, Barbara S; Brant, Cory O; Li, Weiming


    Chemical cues and pheromones guide decisions in organisms throughout the animal kingdom. The neurobiology, function, and evolution of olfaction are particularly well described in insects, and resulting concepts have driven novel approaches to pest control. However, aside from several exceptions, the olfactory biology of vertebrates remains poorly understood. One exception is the sea lamprey (Petromyzon marinus), which relies heavily upon olfaction during reproduction. Here, we provide a broad review of the chemical cues and pheromones used by the sea lamprey during reproduction, including overviews of the sea lamprey olfactory system, chemical cues and pheromones, and potential applications to population management. The critical role of olfaction in mediating the sea lamprey life cycle is evident by a well-developed olfactory system. Sea lamprey use chemical cues and pheromones to identify productive spawning habitat, coordinate spawning behaviors, and avoid risk. Manipulation of olfactory biology offers opportunities for management of populations in the Laurentian Great Lakes, where the sea lamprey is a destructive invader. We suggest that the sea lamprey is a broadly useful organism with which to study vertebrate olfaction because of its simple but well-developed olfactory organ, the dominant role of olfaction in guiding behaviors during reproduction, and the direct implications for vertebrate pest management.

  4. The sea lamprey (Petromyzon marinus) has a receptor for androstenedione.


    Bryan, Mara B; Scott, Alexander P; Li, Weiming


    The use of nuclear steroid receptors as ligand-activated transcription factors is a critical event in vertebrate evolution. It is believed that nuclear steroid receptors arose at or before the vertebrate radiation, except for an androgen receptor (Ar) that evolved only in the gnathostome line. We report an androgen-Ar complex in the male sea lamprey (Petromyzon marinus), an extant jawless vertebrate. The androgen with the highest affinity is not testosterone, but its direct precursor, androstenedione (Ad). To establish that the binding moiety in lamprey testis is a receptor-and not an "androgen-binding protein"-we have shown that it can be extracted from the nucleus as well as the cytosol, that the Ad-receptor complex binds to DNA, and that the receptor is approximately twice the size of an androgen-binding protein extracted from the Atlantic salmon testis. The capacity (and high affinity) of binding of the lamprey Ar is such that much of the Ad present in male lampreys becomes sequestered within the testis (as opposed to circulating in the plasma). Concentrations of Ad (but not of testosterone) in plasma and testis tissue are upregulated by injection of lamprey GnRH. Implantation of male lampreys with exogenous Ad significantly accelerates the development of the testis and growth of at least one secondary male characteristic. It appears that all classes of steroid hormones have contributed to the evolution of the regulatory complexity of steroid receptors found in modern vertebrates.

  5. Mercury accumulation in sea lamprey (Petromyzon marinus) from Lake Huron.


    Madenjian, Charles P; Johnson, Nicholas S; Siefkes, Michael J; Dettmers, John M; Blum, Joel D; Johnson, Marcus W


    We determined whole-fish total mercury (Hg) concentrations of 40 male and 40 female adult sea lampreys (Petromyzon marinus) captured in the Cheboygan River, a tributary to Lake Huron, during May 2011. In addition, bioenergetics modeling was used to explore the effects of sex-related differences in activity and resting (standard) metabolic rate (SMR) on mercury accumulation. The grand mean for Hg concentrations was 519 ng/g (standard error of the mean=46 ng/g). On average, males were 16% higher in Hg concentration than females. Bioenergetics modeling results indicated that 14% higher activity and SMR in males would account for this observed sex difference in Hg concentrations. We concluded that the higher Hg concentration in males was most likely due to higher rate of energy expenditure in males, stemming from greater activity and SMR. Our findings have implications for estimating the effects of sea lamprey populations on mercury cycling within ecosystems, as well as for the proposed opening of sea lamprey fisheries. Eventually, our results may prove useful in improving control of sea lamprey, a pest responsible for substantial damage to fisheries in lakes where it is not native.

  6. Mercury accumulation in sea lamprey (Petromyzon marinus) from Lake Huron

    USGS Publications Warehouse

    Madenjian, Charles P.; Johnson, Nicholas S.; Siefkes, Michael J.; Dettmers, John M.; Blum, Joel D.; Johnson, Marcus W.


    We determined whole-fish total mercury (Hg) concentrations of 40 male and 40 female adult sea lampreys (Petromyzon marinus) captured in the Cheboygan River, a tributary to Lake Huron, during May 2011. In addition, bioenergetics modeling was used to explore the effects of sex-related differences in activity and resting (standard) metabolic rate (SMR) on mercury accumulation. The grand mean for Hg concentrations was 519 ng/g (standard error of the mean = 46 ng/g). On average, males were 16% higher in Hg concentration than females. Bioenergetics modeling results indicated that 14% higher activity and SMR in males would account for this observed sex difference in Hg concentrations. We concluded that the higher Hg concentration in males was most likely due to higher rate of energy expenditure in males, stemming from greater activity and SMR. Our findings have implications for estimating the effects of sea lamprey populations on mercury cycling within ecosystems, as well as for the proposed opening of sea lamprey fisheries. Eventually, our results may prove useful in improving control of sea lamprey, a pest responsible for substantial damage to fisheries in lakes where it is not native.

  7. Saccharicrinis marinus sp. nov., isolated from marine sediment.


    Liu, Qian-Qian; Li, Juan; Xiao, Di; Lu, Jin-Xing; Chen, Guan-Jun; Du, Zong-Jun


    A novel bacterial strain, designated Y11T, was isolated from marine sediment at Weihai in China. Comparative analysis of 16S rRNA gene sequences demonstrated that the novel isolate showed highest similarity to Saccharicrinis fermentans DSM 9555T (94.0 %) and Saccharicrinis carchari SS12T (92.7 %). Strain Y11T was a Gram-stain-negative, rod-shaped, non-endospore-forming, yellow-pigmented bacterium and was able to hydrolyse agar weakly. It was catalase-negative, oxidase-positive, facultatively anaerobic and motile by gliding. Optimal growth occurred at 28-30 °C, at pH 7.0-7.5 and in the presence of 2-3 % (w/v) NaCl. The DNA G+C content was 34.4 mol%. The strain contained MK-7 as the prevalent menaquinone. The major cellular fatty acids were iso-C15 : 0, anteiso-C15 : 0 and C15 : 1ω6c. The predominant polar lipids were phosphatidylethanolamine and two unknown lipids. Data from the present polyphasic taxonomic study clearly place the strain as representing a novel species within the genus Saccharicrinis, for which the name Saccharicrinis marinus sp. nov. is proposed. The type strain is Y11T ( = CICC10837T = KCTC42400T).

  8. Description of Mogibacterium pumilum gen. nov., sp. nov. and Mogibacterium vescum gen. nov., sp. nov., and reclassification of Eubacterium timidum (Holdeman et al. 1980) as Mogibacterium timidum gen. nov., comb. nov.


    Nakazawa, F; Sato, M; Poco, S E; Hashimura, T; Ikeda, T; Kalfas, S; Sundqvist, G; Hoshino, E


    A new genus, Mogibacterium, is proposed for anaerobic, non-spore-forming, Gram-positive, rod-shaped bacteria which have been isolated from the periodontal pockets of adult human patients with periodontal disease and infected root canals. The novel isolates, strains D2-18T, BA11a-f and D5-2T, were inert in most of the conventional biochemical tests and phenotypically resemble asaccharolytic Eubacterium species. The protein profiles of whole cells on SDS-PAGE gels and Western immunoblotting reaction analysis distinguished these organisms from type strains belonging to the previously described Eubacterium species. The G + C content of the DNA is 45-46 mol% for Mogibacterium pumilum and 46 mol% for Mogibacterium vescum. The levels of DNA-DNA relatedness of these new species to other Eubacterium species, including Eubacterium limosum, Eubacterium brachy, Eubacterium lentum, Eubacterium nodatum, Eubacterium saphenum, and the more recently proposed Eubacterium minutum and Eubacterium exiguum (reclassified as Slackia exigua), are less than 2%. The DNA-DNA hybridization value between M. pumilum and M. vescum was 30%. Eubacterium timidum exhibited DNA homologies with Mogibacterium species which were low (17 and 18%) but clearly higher than with all the other Eubacterium species. Phylogenetic analysis based on 16S rRNA gene sequences revealed that the closest phylogenetic neighbour of Mogibacterium species was E. timidum, and that these three species represent a novel lineage distinct from the previously described genera of Gram-positive, rod-shaped bacteria. On the basis of phenotypic characteristics and 16S rRNA gene sequence comparisons, it is also proposed that E. timidum is transferred to the genus Mogibacterium gen. nov. as Mogibacterium timidum gen. nov., comb. nov. (type strain ATCC 33093T).

  9. The complete genome sequence of Staphylothermus marinus reveals differences in sulfur metabolism among heterotrophic Crenarchaeota

    SciTech Connect

    Anderson, Iain; Lakshmi, Lakshmi Dharmarajan; Rodriquez, Jason; Hooper, Sean; Porat, I.; Ulrich, Luke; Mavromatis, K; Sun, Hui; Land, Miriam L; Lapidus, Alla L.; Lucas, Susan; Barry, Kerrie; Huber, Harald; Zhulin, Igor B; Whitman, W. B.; Mukhopadhyay, Biswarup; Woese, Carl; Bristow, James; Kyrpides, Nikos C


    Background Staphylothermus marinus is an anaerobic, sulfur-reducing peptide fermenter of the archaeal phylum Crenarchaeota. It is the third heterotrophic, obligate sulfur reducing crenarchaeote to be sequenced and provides an opportunity for comparative analysis of the three genomes. Results The 1.57 Mbp genome of the hyperthermophilic crenarchaeote Staphylothermus marinus has been completely sequenced. The main energy generating pathways likely involve 2-oxoacid:ferredoxin oxidoreductases and ADP-forming acetyl-CoA synthases. S. marinus possesses several enzymes not present in other crenarchaeotes including a sodium ion-translocating decarboxylase likely to be involved in amino acid degradation. S. marinus lacks sulfur-reducing enzymes present in the other two sulfur-reducing crenarchaeotes that have been sequenced Thermofilum pendens and Hyperthermus butylicus. Instead it has three operons similar to the mbh and mbx operons of Pyrococcus furiosus, which may play a role in sulfur reduction and/or hydrogen production. The two marine organisms, S. marinus and H. butylicus, possess more sodium-dependent transporters than T. pendens and use symporters for potassium uptake while T. pendens uses an ATP-dependent potassium transporter. T. pendens has adapted to a nutrient-rich environment while H. butylicus is adapted to a nutrient-poor environment, and S. marinus lies between these two extremes. Conclusion The three heterotrophic sulfur-reducing crenarchaeotes have adapted to their habitats, terrestrial vs. marine, via their transporter content, and they have also adapted to environments with differing levels of nutrients. Despite the fact that they all use sulfur as an electron acceptor, they are likely to have different pathways for sulfur reduction.

  10. Heterologous Expression of Gene of Interest Using the Marine Protozoan Perkinsus marinus

    NASA Astrophysics Data System (ADS)

    Cold, E. R.


    Perkinsus marinus is a marine protozoan parasite that causes "Dermo" disease in eastern oysters (Crassostrea virginica). P. marinus is closely related to Plasmodium falciparum which causes malaria. A recent study has showed that P. marinus causes no pathology damage but an immune response in humanized mouse, providing the bases for a genetically modified P. marinus expressing Plasmodium genes to be used as a vaccination delivery system for malaria and other pathogenic diseases. A modified plasmid vector (pMOE-GFP) based on highly expressed gene tagged with green fluorescence protein and targeted to P. marinus cell wall was used to clone MSP8 and HAP2. MSP8 encodes for merozoite surface in P. falciparum and HAP2 is essential for fusion of male and female gametes; genetic disruption of the HAP2 locus revealed that parasite fertilization is prevented. Using electroporation, MSP8 and HAP2 plasmid were introduced into the P. marinus trophozoites. As controls pMOE-GFP was transfected into P. mediterraneus, P. atlanticus and P. chesapeaki. Transfection conditions included 5x107 Perkinsus trophozoites and 10 µg of plasmid using Nucleofector® technology (D-023 program). The cells were recovered in 3 mL of Perkinsus culture media and transfected trophozoites were examined for green fluorescence. To facilitate subcloning of cells expressing GFP, we optimized a DME: HAM's F12 -5% FBS -containing agar solid medium for plating Perkinsus. Examination of all transfected cells indicates expression of both MSP8 and HAP2. This is the first time that genes of a protozoan parasite have been expressed in a marine protozoan. It was also concluded that P. mediterraneus, P. atlanticus and P. chesapeaki were stable mutation and can be isolated for further research.

  11. The complete genome sequence of Staphylothermus marinus reveals differences in sulfur metabolism among heterotrophic Crenarchaeota.


    Anderson, Iain J; Dharmarajan, Lakshmi; Rodriguez, Jason; Hooper, Sean; Porat, Iris; Ulrich, Luke E; Elkins, James G; Mavromatis, Kostas; Sun, Hui; Land, Miriam; Lapidus, Alla; Lucas, Susan; Barry, Kerrie; Huber, Harald; Zhulin, Igor B; Whitman, William B; Mukhopadhyay, Biswarup; Woese, Carl; Bristow, James; Kyrpides, Nikos


    Staphylothermus marinus is an anaerobic, sulfur-reducing peptide fermenter of the archaeal phylum Crenarchaeota. It is the third heterotrophic, obligate sulfur reducing crenarchaeote to be sequenced and provides an opportunity for comparative analysis of the three genomes. The 1.57 Mbp genome of the hyperthermophilic crenarchaeote Staphylothermus marinus has been completely sequenced. The main energy generating pathways likely involve 2-oxoacid:ferredoxin oxidoreductases and ADP-forming acetyl-CoA synthases. S. marinus possesses several enzymes not present in other crenarchaeotes including a sodium ion-translocating decarboxylase likely to be involved in amino acid degradation. S. marinus lacks sulfur-reducing enzymes present in the other two sulfur-reducing crenarchaeotes that have been sequenced -- Thermofilum pendens and Hyperthermus butylicus. Instead it has three operons similar to the mbh and mbx operons of Pyrococcus furiosus, which may play a role in sulfur reduction and/or hydrogen production. The two marine organisms, S. marinus and H. butylicus, possess more sodium-dependent transporters than T. pendens and use symporters for potassium uptake while T. pendens uses an ATP-dependent potassium transporter. T. pendens has adapted to a nutrient-rich environment while H. butylicus is adapted to a nutrient-poor environment, and S. marinus lies between these two extremes. The three heterotrophic sulfur-reducing crenarchaeotes have adapted to their habitats, terrestrial vs. marine, via their transporter content, and they have also adapted to environments with differing levels of nutrients. Despite the fact that they all use sulfur as an electron acceptor, they are likely to have different pathways for sulfur reduction.

  12. The complete genome sequence of Staphylothermus marinus reveals differences in sulfur metabolism among heterotrophic Crenarchaeota

    SciTech Connect

    Anderson, iain J.; Dharmarajan, Lakshmi; Rodriguez, Jason; Hooper, Sean; Porat, Iris; Ulrich, Luke E.; Elkins, James G.; Mavromatis, Kostas; Sun, Hui; Land, Miriam; Lapidus, Alla; Lucas, Susan; Barry, Kerrie; Huber, Harald; Zhulin, Igor B.; Whitman, William B.; Mukhopadhyay, Biswarup; Woese, Carl; Bristow, James; Kyrpides, Nikos


    Staphylothermus marinus is an anaerobic, sulfur-reducing peptide fermenter of the archaeal phylum Crenarchaeota. It is the third heterotrophic, obligate sulfur reducing crenarchaeote to be sequenced and provides an opportunity for comparative analysis of the three genomes. The 1.57 Mbp genome of the hyperthermophilic crenarchaeote Staphylothermus marinus has been completely sequenced. The main energy generating pathways likely involve 2-oxoacid:ferredoxin oxidoreductases and ADP-forming acetyl-CoA synthases. S. marinus possesses several enzymes not present in other crenarchaeotes including a sodium ion-translocating decarboxylase likely to be involved in amino acid degradation. S. marinus lacks sulfur-reducing enzymes present in the other two sulfur-reducing crenarchaeotes that have been sequenced - Thermofilum pendens and Hyperthermus butylicus. Instead it has three operons similar to the mbh and mbx operons of Pyrococcus furiosus, which may play a role in sulfur reduction and/or hydrogen production. The two marine organisms, S. marinus and H. butylicus, possess more sodium-dependent transporters than T. pendens and use symporters for potassium uptake while T. pendens uses an ATP-dependent potassium transporter. T. pendens has adapted to a nutrient-rich environment while H. butylicus is adapted to a nutrient-poor environment, and S. marinus lies between these two extremes. The three heterotrophic sulfur-reducing crenarchaeotes have adapted to their habitats, terrestrial vs. marine, via their transporter content, and they have also adapted to environments with differing levels of nutrients. Despite the fact that they all use sulfur as an electron acceptor, they are likely to have different pathways for sulfur reduction.

  13. Acute toxicity, uptake and accumulation kinetics of nickel in an invasive copepod species: Pseudodiaptomus marinus.


    Tlili, Sofiène; Ovaert, Julien; Souissi, Anissa; Ouddane, Baghdad; Souissi, Sami


    Pseudodiaptomus marinus is a marine calanoid copepod originating of the Indo-Pacific region, who has successfully colonized new areas and it was recently observed in the European side of the Mediterranean Sea as well as in the North Sea. Actually, many questions were posed about the invasive capacity of this copepod in several non-native ecosystems. In this context, the main aim of this study was to investigate the tolerance and the bioaccumulation of metallic stress in the invasive copepod P. marinus successfully maintained in mass culture at laboratory conditions since 2 years. In order to study the metallic tolerance levels of P. marinus, an emergent trace metal, the nickel, was chosen. First, lethal concentrations determination experiments were done for 24, 48, 72 and 96 h in order to calculated LC50% but also to select a relevant ecological value for the suite of experiments. Then, three types of experiments, using a single concentration of nickel (correspond the 1/3 of 96 h-LC50%) was carried in order to study the toxico-kinetics of nickel in P. marinus. Concerning lethal concentrations, we observed that P. marinus was in the same range of sensitivity compared to other calanoid copepods exposed to nickel in the same standardized experimental conditions. Results showed that the uptake of nickel in P. marinus depends from the pathways of entrance (water of food), but also that Isochrysis galbana, used as a food source, has an important bioaccumulation capacity and a rapid uptake of nickel. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Chalcone Isomerase from Eubacterium ramulus Catalyzes the Ring Contraction of Flavanonols.


    Braune, Annett; Engst, Wolfram; Elsinghorst, Paul W; Furtmann, Norbert; Bajorath, Jürgen; Gütschow, Michael; Blaut, Michael


    The enzyme catalyzing the ring-contracting conversion of the flavanonol taxifolin to the auronol alphitonin in the course of flavonoid degradation by the human intestinal anaerobe Eubacterium ramulus was purified and characterized. It stereospecifically catalyzed the isomerization of (+)-taxifolin but not that of (-)-taxifolin. The Km for (+)-taxifolin was 6.4 ± 0.8 μM, and the Vmax was 108 ± 4 μmol min(-1) (mg protein)(-1) The enzyme also isomerized (+)-dihydrokaempferol, another flavanonol, to maesopsin. Inspection of the encoding gene revealed its complete identity to that of the gene encoding chalcone isomerase (CHI) from E. ramulus Based on the reported X-ray crystal structure of CHI (M. Gall et al., Angew Chem Int Ed 53:1439-1442, 2014,, docking experiments suggest the substrate binding mode of flavanonols and their stereospecific conversion. Mutation of the active-site histidine (His33) to alanine led to a complete loss of flavanonol isomerization by CHI, which indicates that His33 is also essential for this activity. His33 is proposed to mediate the stereospecific abstraction of a proton from the hydroxymethylene carbon of the flavanonol C-ring followed by ring opening and recyclization. A flavanonol-isomerizing enzyme was also identified in the flavonoid-converting bacterium Flavonifractor plautii based on its 50% sequence identity to the CHI from E. ramulus IMPORTANCE: Chalcone isomerase was known to be involved in flavone/flavanone conversion by the human intestinal bacterium E. ramulus Here we demonstrate that this enzyme moreover catalyzes a key step in the breakdown of flavonols/flavanonols. Thus, a single isomerase plays a dual role in the bacterial conversion of dietary bioactive flavonoids. The identification of a corresponding enzyme in the human intestinal bacterium F. plautii suggests a more widespread occurrence of this isomerase in flavonoid-degrading bacteria.

  15. Eubacterium rangiferina, a novel usnic acid-resistant bacterium from the reindeer rumen.


    Sundset, Monica A; Kohn, Alexandra; Mathiesen, Svein D; Praesteng, Kirsti E


    Reindeer are able to eat and utilize lichens as an important source of energy and nutrients. In the current study, the activities of antibiotic secondary metabolites including usnic, antranoric, fumarprotocetraric, and lobaric acid commonly found in lichens were tested against a collection of 26 anaerobic rumen bacterial isolates from reindeer (Rangifer tarandus tarandus) using the agar diffusion method. The isolates were identified based on their 16S ribosomal ribonucleic acid (rRNA) gene sequences. Usnic acid had a potent antimicrobial effect against 25 of the isolates, belonging to Clostridiales, Enterococci, and Streptococci. Isolates of Clostridia and Streptococci were also susceptible to atranoric and lobaric acid. However, one isolate (R3_91_1) was found to be resistant to usnic, antranoric, fumarprotocetraric, and lobaric acid. R3_91_1 was also seen invading and adhering to lichen particles when grown in a liquid anaerobic culture as demonstrated by transmission electron microscopy. This was a Gram-negative, nonmotile rod (0.2-0.7 x 2.0-3.5 microm) with a deoxyribonucleic acid G + C content of 47.0 mol% and main cellular fatty acids including 15:0 anteiso-dimethyl acetal (DMA), 16:0 iso-fatty acid methyl ester (FAME), 13:0 iso-3OH FAME, and 17:0 anteiso-FAME, not matching any of the presently known profiles in the MIDI database. Combined, the phenotypic and genotypic traits including the 16S rRNA gene sequence show that R3_91_1 is a novel species inside the order Clostridiales within the family Lachnospiraceae, for which we propose the name Eubacterium rangiferina. This is the first record of a rumen bacterium able to tolerate and grow in the presence of usnic acid, indicating that the rumen microorganisms in these animals have adapted mechanisms to deal with lichen secondary metabolites, well known for their antimicrobial and toxic effects.

  16. The complete genome sequence of Eubacterium limosum SA11, a metabolically versatile rumen acetogen.


    Kelly, William J; Henderson, Gemma; Pacheco, Diana M; Li, Dong; Reilly, Kerri; Naylor, Graham E; Janssen, Peter H; Attwood, Graeme T; Altermann, Eric; Leahy, Sinead C


    Acetogens are a specialized group of anaerobic bacteria able to produce acetate from CO2 and H2 via the Wood-Ljungdahl pathway. In some gut environments acetogens can compete with methanogens for H2, and as a result rumen acetogens are of interest in the development of microbial approaches for methane mitigation. The acetogen Eubacterium limosum SA11 was isolated from the rumen of a New Zealand sheep and its genome has been sequenced to examine its potential application in methane mitigation strategies, particularly in situations where hydrogenotrophic methanogens are inhibited resulting in increased H2 levels in the rumen. The 4.15 Mb chromosome of SA11 has an average G + C content of 47 %, and encodes 3805 protein-coding genes. There is a single prophage inserted in the chromosome, and several other gene clusters appear to have been acquired by horizontal transfer. These include genes for cell wall glycopolymers, a type VII secretion system, cell surface proteins and chemotaxis. SA11 is able to use a variety of organic substrates in addition to H2/CO2, with acetate and butyrate as the principal fermentation end-products, and genes involved in these metabolic pathways have been identified. An unusual feature is the presence of 39 genes encoding trimethylamine methyltransferase family proteins, more than any other bacterial genome. Overall, SA11 is a metabolically versatile organism, but its ability to grow on such a wide range of substrates suggests it may not be a suitable candidate to take the place of hydrogen-utilizing methanogens in the rumen.

  17. Eubacterium rangiferina, a novel usnic acid-resistant bacterium from the reindeer rumen

    NASA Astrophysics Data System (ADS)

    Sundset, Monica A.; Kohn, Alexandra; Mathiesen, Svein D.; Præsteng, Kirsti E.


    Reindeer are able to eat and utilize lichens as an important source of energy and nutrients. In the current study, the activities of antibiotic secondary metabolites including usnic, antranoric, fumarprotocetraric, and lobaric acid commonly found in lichens were tested against a collection of 26 anaerobic rumen bacterial isolates from reindeer ( Rangifer tarandus tarandus) using the agar diffusion method. The isolates were identified based on their 16S ribosomal ribonucleic acid (rRNA) gene sequences. Usnic acid had a potent antimicrobial effect against 25 of the isolates, belonging to Clostridiales, Enterococci, and Streptococci. Isolates of Clostridia and Streptococci were also susceptible to atranoric and lobaric acid. However, one isolate (R3_91_1) was found to be resistant to usnic, antranoric, fumarprotocetraric, and lobaric acid. R3_91_1 was also seen invading and adhering to lichen particles when grown in a liquid anaerobic culture as demonstrated by transmission electron microscopy. This was a Gram-negative, nonmotile rod (0.2-0.7 × 2.0-3.5 μm) with a deoxyribonucleic acid G + C content of 47.0 mol% and main cellular fatty acids including 15:0 anteiso-dimethyl acetal (DMA), 16:0 iso-fatty acid methyl ester (FAME), 13:0 iso-3OH FAME, and 17:0 anteiso-FAME, not matching any of the presently known profiles in the MIDI database. Combined, the phenotypic and genotypic traits including the 16S rRNA gene sequence show that R3_91_1 is a novel species inside the order Clostridiales within the family Lachnospiraceae, for which we propose the name Eubacterium rangiferina. This is the first record of a rumen bacterium able to tolerate and grow in the presence of usnic acid, indicating that the rumen microorganisms in these animals have adapted mechanisms to deal with lichen secondary metabolites, well known for their antimicrobial and toxic effects.

  18. Tungstate Uptake by a highly specific ABC transporter in Eubacterium acidaminophilum.


    Makdessi, K; Andreesen, J R; Pich, A


    The Gram-positive anaerobe Eubacterium acidaminophilum contains at least two tungsten-dependent enzymes: viologen-dependent formate dehydrogenase and aldehyde dehydrogenase. (185)W-Labeled tungstate was taken up by this organism with a maximum rate of 0.53 pmol min(-)1 mg(-)1 of protein at 36 degrees C. The uptake was not affected by equimolar amounts of molybdate. The genes tupABC coding for an ABC transporter specific for tungstate were cloned in the downstream region of genes encoding a tungsten-containing formate dehydrogenase. The substrate-binding protein, TupA, of this putative transporter was overexpressed in Escherichia coli, and its binding properties toward oxyanions were determined by a native polyacrylamide gel retardation assay. Only tungstate induced a shift of TupA mobility, suggesting that only this anion was specifically bound by TupA. If molybdate and sulfate were added in high molar excess (>1000-fold), they were also slightly bound by TupA. The K(d) value for tungstate was determined to be 0.5 microm. The genes encoding the tungstate-specific ABC transporter exhibited highest similarities to putative transporters from Methanobacterium thermoautotrophicum, Haloferax volcanii, Vibrio cholerae, and Campylobacter jejuni. These five transporters represent a separate phylogenetic group of oxyanion ABC transporters as evident from analysis of the deduced amino acid sequences of the binding proteins. Downstream of the tupABC genes, the genes moeA, moeA-1, moaA, and a truncated moaC have been identified by sequence comparison of the deduced amino acid sequences. They should participate in the biosynthesis of the pterin cofactor that is present in molybdenum- and tungsten-containing enzymes except nitrogenase.

  19. Electrical responses of rods in the retina of Bufo marinus

    PubMed Central

    Cervetto, L.; Pasino, E.; Torre, V.


    1. Intracellular responses to flashes and steps of light have been recorded from the outer segment and the cell body of rods in the retina of the Bufo marinus. The identification of the origin of recorded responses has been confirmed by intracellular marking. 2. Responses to flashes delivered in darkness or superimposed on a background were analysed. Responses recorded from outer segments conform to the principle of `spectral univariance'. The shape of the response is not affected by enlarging the spot diameter from 150 to 1000 μm. 3. The membrane potential measured in darkness at the outer segments varied from -15 to -25 mV. Injection of steady hyperpolarizing currents increases the size of the response to light; depolarizing currents reduce the response. The mean value of the input resistance is 97 ± 30 MΩ in darkness and increases by 20-30% during illumination. 4. The responses obtained from the cell body of rods have the same shape, time course and spectral sensitivity of those recorded at the outer segment. Injection of steady current at the cell body produces different effects than at the outer segment: hyperpolarizing currents reduce the amplitude of the response to light; depolarizing currents increase the response. 5. The experimental data are fitted according to a model similar to that used to describe the responses of turtle cones (Baylor & Hodgkin, 1974; Baylor, Hodgkin & Lamb, 1974a, b). 6. The model reproduces the electrical responses of the rod outer segment to a variety of stimuli: (a) brief flashes and steps of light in dark adapted conditions; (b) bright flashes superimposed on background illuminations; (c) pairs of flashes delivered at different time intervals. Responses to hyperpolarizing steps of current are also reproduced by the model. ImagesABCD PMID:406383

  20. Perkinsus marinus superoxide dismutase 2 (PmSOD2) localizes to single-membrane subcellular compartments

    SciTech Connect

    Fernandez-Robledo, Jose A.; Schott, Eric J.; Vasta, Gerardo R.


    Perkinsus marinus (Phylum Perkinsozoa), a protozoan parasite of oysters, is considered one of the earliest diverging groups of the lineage leading to dinoflagellates. Perkinsus trophozoites are phagocytosed by oyster hemocytes, where they are likely exposed to reactive oxygen species. As part of its reactive oxygen detoxifying pathway, P. marinus possesses two iron-cofactored SOD (PmSOD1 and PmSOD2). Immunoflourescence analysis of P. marinus trophozoites and gene complementation in yeast revealed that PmSOD1 is targeted to the mitochondria. Surprisingly, although PmSOD2 is characterized by a bipartite N-terminus extension typical of plastid targeting, in preliminary immunofluorescence studies it was visualized as punctuate regions in the cytoplasm that could not be assigned to any organelle. Here, we used immunogold electron microscopy to examine the subcellular localization PmSOD2 in P. marinus trophozoites. Gold grains were mostly associated with single-membrane vesicle-like structures, and eventually, localized to electron-dense, apparently amorphous material present in the lumen of a larger, unique compartment. The images suggested that PmSOD2 is targeted to small vesicles that fuse and/or discharge their content into a larger compartment, possibly the large vacuole typical of the mature trophozoites. In light of the in silico targeting prediction, the association of PmSOD2 with single-membrane compartments raises interesting questions regarding its organellar targeting, and the nature of a putative relic plastid in Perkinsus species.

  1. Minimal sulfur requirement for growth and sulfur-dependent metabolism of the hyperthermophilic archaeon Staphylothermus marinus.


    Hao, Xiaolei; Ma, Kesen


    Staphylothermus marinus is an anaerobic hyperthermophilic archaeon that uses peptides as carbon and energy sources. Elemental sulfur (S(o)) is obligately required for its growth and is reduced to H2S. The metabolic functions and mechanisms of S(o) reduction were explored by examining S(o)-dependent growth and activities of key enzymes present in this organism. All three forms of S(o) tested--sublimed S(o), colloidal S(o) and polysulfide--were used by S. marinus, and no other sulfur-containing compounds could replace S(o). Elemental sulfur did not serve as physical support but appeared to function as an electron acceptor. The minimal S(o) concentration required for optimal growth was 0.05% (w/v). At this concentration, there appeared to be a metabolic transition from H2 production to S reduction. Some enzymatic activities related to S(o)-dependent metabolism, including sulfur reductase, hydrogenase, glutamate dehydrogenase and electron transfer activities, were detected in cell-free extracts of S. marinus. These results indicate that S(o) plays an essential role in the heterotrophic metabolism of S. marinus. Reducing equivalents generated by the oxidation of amino acids from peptidolysis may be transferred to sulfur reductase and hydrogenase, which then catalyze the production of H2S and H2, respectively.

  2. Clonal population structures are derived from various population processes in the protistan oyster parasite Perkinsus marinus

    USDA-ARS?s Scientific Manuscript database

    Population genetic analysis of genotypes comprised of seven microsatellite loci revealed clonal genetic patterns in each of four populations of the protistan estuarine parasite Perkinsus marinus. Each locus was amplified directly from DNA extracted from infected oysters collected from four geographi...

  3. Weight Length Relationships in Gaftopsail Catfish (Bagre marinus) and Hardhead Catfish (Ariopsis felis) in Louisiana Waters

    DTIC Science & Technology


    In spite of the abundance and commercial importance of these two species, there is little published weight-length data for the gafftopsail catfish ...Bagre marinus) and hardhead catfish (Ariopsis felis). For this study 84 catfish were caught (hook and line) from the Calcasieu Estuary in Southwest

  4. Effects of cyanobacteria Synechocystis spp. in the host-parasite model Crassostrea gasar-Perkinsus marinus.


    Queiroga, Fernando Ramos; Marques-Santos, Luis Fernando; Hégaret, Hélène; Sassi, Roberto; Farias, Natanael Dantas; Santana, Lucas Nunes; da Silva, Patricia Mirella


    Perkinsosis is a disease caused by protozoan parasites from the Perkinsus genus. In Brazil, two species, P. beihaiensis and P. marinus, are frequently found infecting native oysters (Crassostrea gasar and C. rhizophorae) from cultured and wild populations in several states of the Northeast region. The impacts of this disease in bivalves from Brazil, as well as the interactions with environmental factors, are poorly studied. In the present work, we evaluated the in vitro effects of the cyanobacteria Synechocystis spp. on trophozoites of P. marinus and haemocytes of C. gasar. Four cyanobacteria strains isolated from the Northeast Brazilian coast were used as whole cultures (WCs) and extracellular products (ECPs). Trophozoites of P. marinus were exposed for short (4h) and long (48h and 7days, the latter only for ECPs) periods, while haemocytes were exposed for a short period (4h). Cellular and immune parameters, i.e. cell viability, cell count, reactive oxygen species production (ROS) and phagocytosis of inert (latex beads) and biological particles (zymosan and trophozoites of P. marinus) were measured by flow cytometry. The viability of P. marinus trophozoites was improved in response to WCs of Synechocystis spp., which could be a beneficial effect of the cyanobacteria providing nutrients and reducing reactive oxygen species. Long-term exposure of trophozoites to ECPs of cyanobacteria did not modify in vitro cell proliferation nor viability. In contrast, C. gasar haemocytes showed a reduction in cell viability when exposed to WCs, but not to ECPs. However, ROS production was not altered. Haemocyte ability to engulf latex particles was reduced when exposed mainly to ECPs of cyanobacteria; while neither the WCs nor the ECPs modified phagocytosis of the biological particles, zymosan and P. marinus. Our results suggest a negative effect of cyanobacteria from the Synechocystis genus on host immune cells, in contrast to a more beneficial effect on the parasite cell, which

  5. High efficiency of meiotic gynogenesis in sea lamprey Petromyzon marinus

    USGS Publications Warehouse

    Rinchard, J.; Dabrowski, K.; Garcia-Abiado, M. -A.


    Induction of androgenesis and gynogenesis by applying a pressure (PS) or heat shock (HS) to double the haploid chromosomal set results in progenies possessing only chromosomes from a single parent. This has never been accomplished in representatives of Agnatha. The objective of this study was to induce gynogenesis and androgenesis in sea lamprey Petromyzon marinus. For gynogenesis experiments, ultraviolet (UV)-irradiated sperm was used to activate sea lamprey eggs and HS or PS were applied to inhibit the second meiotic division and consequently induce diploidy in the embryos. The UV irradiation of immobilized sperm was performed for 1 min at 1,719 J m-2. HS of 35 ?? 1??C for 2 min and PS of 9,000 psi for 4 min were applied at different times after egg activation (8, 12, 20, and 24 min or 8, 16, and 24 min for HS or PS, respectively). Regardless of the induction time of the HS, survivals at pre-hatching stage were similar. In contrast, PS applied 8 min after activation appears to increase survival rate of pre-hatched embryos in comparison to 16 and 24 min after activation. In control groups, without shock treatment (no diploidization), there were no survivors. All deformed, gynogenetic embryos were confirmed to be haploids and died prior to burying themselves in the sand. We confirmed by flow cytometry that progenies produced using both shock methods surviving to the next stage, burying in the substrate, were diploid gynogenetic. For the androgenesis experiments, UV-irradiated eggs (1,719 J m-2 for 1 min) were fertilized with non-treated sperm and HS was applied to restore diploidy of the eggs. Several attempts have been made to optimize the parameters used. HS of 35 ?? 1??C was applied 110, 140, 170, 200, and 230 min after activation for 2 min. Low yields of androgens were obtained and all animals died within a week after hatching. These techniques will allow to establish meiotic gynogenetic lines of sea lamprey for determining sex differentiation in this species

  6. High efficiency of meiotic gynogenesis in sea lamprey Petromyzon marinus.


    Rinchard, Jacques; Dabrowski, Konrad; Garcia-Abiado, Mary-Ann


    Induction of androgenesis and gynogenesis by applying a pressure (PS) or heat shock (HS) to double the haploid chromosomal set results in progenies possessing only chromosomes from a single parent. This has never been accomplished in representatives of Agnatha. The objective of this study was to induce gynogenesis and androgenesis in sea lamprey Petromyzon marinus. For gynogenesis experiments, ultraviolet (UV)-irradiated sperm was used to activate sea lamprey eggs and HS or PS were applied to inhibit the second meiotic division and consequently induce diploidy in the embryos. The UV irradiation of immobilized sperm was performed for 1 min at 1,719 J m(-2). HS of 35+/-1 degrees C for 2 min and PS of 9,000 psi for 4 min were applied at different times after egg activation (8, 12, 20, and 24 min or 8, 16, and 24 min for HS or PS, respectively). Regardless of the induction time of the HS, survivals at pre-hatching stage were similar. In contrast, PS applied 8 min after activation appears to increase survival rate of pre-hatched embryos in comparison to 16 and 24 min after activation. In control groups, without shock treatment (no diploidization), there were no survivors. All deformed, gynogenetic embryos were confirmed to be haploids and died prior to burying themselves in the sand. We confirmed by flow cytometry that progenies produced using both shock methods surviving to the next stage, burying in the substrate, were diploid gynogenetic. For the androgenesis experiments, UV-irradiated eggs (1,719 J m(-2) for 1 min) were fertilized with non-treated sperm and HS was applied to restore diploidy of the eggs. Several attempts have been made to optimize the parameters used. HS of 35+/-1 degrees C was applied 110, 140, 170, 200, and 230 min after activation for 2 min. Low yields of androgens were obtained and all animals died within a week after hatching. These techniques will allow to establish meiotic gynogenetic lines of sea lamprey for determining sex differentiation

  7. Trophic Interactions of Infant Bifidobacteria and Eubacterium hallii during L-Fucose and Fucosyllactose Degradation.


    Schwab, Clarissa; Ruscheweyh, Hans-Joachim; Bunesova, Vera; Pham, Van Thanh; Beerenwinkel, Niko; Lacroix, Christophe


    Fucosyllactoses (2'- or 3'-FL) account for up to 20% of human milk oligosaccharides (HMOs). Infant bifidobacteria, such as Bifidobacterium longum subsp. infantis, utilize the lactose moiety to form lactate and acetate, and metabolize L-fucose to 1,2-propanediol (1,2-PD). Eubacterium hallii is a common member of the adult gut microbiota that can produce butyrate from lactate and acetate, and convert 1,2-PD to propionate. Recently, a Swiss cohort study identified E. hallii as one of the first butyrate producers in the infant gut. However, the global prevalence of E. hallii and its role in utilization of HMO degradation intermediates remains unexplored. Fecal 16S rRNA gene libraries (n = 857) of humans of all age groups from Venezuela, Malawi, Switzerland, and the USA were screened for the occurrence of E. hallii. Single and co-culture experiments of B. longum subsp. infantis and E. hallii were conducted in modified YCFA containing acetate and glucose, L-fucose, or FL. Bifidobacterium spp. (n = 56) of different origin were screened for the ability to metabolize L-fucose. Relative abundance of E. hallii was low (10(-5)-10(-3)%) during the first months but increased and reached adult levels (0.01-10%) at 5-10 years of age in all four populations. In single culture, B. longum subsp. infantis grew in the presence of all three carbohydrates while E. hallii was metabolically active only with glucose. In co-culture E. hallii also grew with L-fucose or FL. In co-cultures grown with glucose, acetate, and glucose were consumed and nearly equimolar proportions of formate and butyrate were formed. B. longum subsp. infantis used L-fucose and produced 1,2-PD, acetate and formate in a ratio of 1:1:1, while 1,2-PD was used by E. hallii to form propionate. E. hallii consumed acetate, lactate and 1,2-PD released by B. longum subsp. infantis from FL, and produced butyrate, propionate, and formate. Beside B. longum subsp. infantis, Bifidobacterium breve, and a strain of B. longum subsp

  8. Crystal structure and putative mechanism of 3-methylitaconate-delta-isomerase from Eubacterium barkeri.


    Velarde, Milko; Macieira, Sofia; Hilberg, Markus; Bröker, Gerd; Tu, Shang-Min; Golding, Bernard T; Pierik, Antonio J; Buckel, Wolfgang; Messerschmidt, Albrecht


    3-Methylitaconate-Delta-isomerase (Mii) participates in the nicotinate fermentation pathway of the anaerobic soil bacterium Eubacterium barkeri (order Clostridiales) by catalyzing the reversible conversion of (R)-3-methylitaconate (2-methylene-3-methylsuccinate) to 2,3-dimethylmaleate. The enzyme is also able to catalyze the isomerization of itaconate (methylenesuccinate) to citraconate (methylmaleate) with ca 10-fold higher K(m) but > 1000-fold lower k(cat). The gene mii from E. barkeri was cloned and expressed in Escherichia coli. The protein produced with a C-terminal Strep-tag exhibited the same specific activity as the wild-type enzyme. The crystal structure of Mii from E. barkeri has been solved at a resolution of 2.70 A. The asymmetric unit of the P2(1)2(1)2(1) unit cell with parameters a = 53.1 A, b = 142.3 A, and c = 228.4 A contains four molecules of Mii. The enzyme belongs to a group of isomerases with a common structural feature, the so-called diaminopimelate epimerase fold. The monomer of 380 amino acid residues has two topologically similar domains exhibiting an alpha/beta-fold. The active site is situated in a cleft between these domains. The four Mii molecules are arranged as a tetramer with 222 symmetry for the N-terminal domains. The C-terminal domains have different relative positions with respect to the N-terminal domains resulting in a closed conformation for molecule A and two distinct open conformations for molecules B and D. The C-terminal domain of molecule C is disordered. The Mii active site contains the putative catalytic residues Lys62 and Cys96, for which mechanistic roles are proposed based on a docking experiment of the Mii substrate complex. The active sites of Mii and the closely related PrpF, most likely a methylaconitate Delta-isomerase, have been compared. The overall architecture including the active-site Lys62, Cys96, His300, and Ser17 (Mii numbering) is similar. This positioning of (R)-3-methylitaconate allows Cys96 (as

  9. Trophic Interactions of Infant Bifidobacteria and Eubacterium hallii during L-Fucose and Fucosyllactose Degradation

    PubMed Central

    Schwab, Clarissa; Ruscheweyh, Hans-Joachim; Bunesova, Vera; Pham, Van Thanh; Beerenwinkel, Niko; Lacroix, Christophe


    Fucosyllactoses (2′- or 3′-FL) account for up to 20% of human milk oligosaccharides (HMOs). Infant bifidobacteria, such as Bifidobacterium longum subsp. infantis, utilize the lactose moiety to form lactate and acetate, and metabolize L-fucose to 1,2-propanediol (1,2-PD). Eubacterium hallii is a common member of the adult gut microbiota that can produce butyrate from lactate and acetate, and convert 1,2-PD to propionate. Recently, a Swiss cohort study identified E. hallii as one of the first butyrate producers in the infant gut. However, the global prevalence of E. hallii and its role in utilization of HMO degradation intermediates remains unexplored. Fecal 16S rRNA gene libraries (n = 857) of humans of all age groups from Venezuela, Malawi, Switzerland, and the USA were screened for the occurrence of E. hallii. Single and co-culture experiments of B. longum subsp. infantis and E. hallii were conducted in modified YCFA containing acetate and glucose, L-fucose, or FL. Bifidobacterium spp. (n = 56) of different origin were screened for the ability to metabolize L-fucose. Relative abundance of E. hallii was low (10−5–10−3%) during the first months but increased and reached adult levels (0.01–10%) at 5–10 years of age in all four populations. In single culture, B. longum subsp. infantis grew in the presence of all three carbohydrates while E. hallii was metabolically active only with glucose. In co-culture E. hallii also grew with L-fucose or FL. In co-cultures grown with glucose, acetate, and glucose were consumed and nearly equimolar proportions of formate and butyrate were formed. B. longum subsp. infantis used L-fucose and produced 1,2-PD, acetate and formate in a ratio of 1:1:1, while 1,2-PD was used by E. hallii to form propionate. E. hallii consumed acetate, lactate and 1,2-PD released by B. longum subsp. infantis from FL, and produced butyrate, propionate, and formate. Beside B. longum subsp. infantis, Bifidobacterium breve, and a strain of B

  10. The Common Gut Microbe Eubacterium hallii also Contributes to Intestinal Propionate Formation.


    Engels, Christina; Ruscheweyh, Hans-Joachim; Beerenwinkel, Niko; Lacroix, Christophe; Schwab, Clarissa


    Eubacterium hallii is considered an important microbe in regard to intestinal metabolic balance due to its ability to utilize glucose and the fermentation intermediates acetate and lactate, to form butyrate and hydrogen. Recently, we observed that E. hallii is capable of metabolizing glycerol to 3-hydroxypropionaldehyde (3-HPA, reuterin) with reported antimicrobial properties. The key enzyme for glycerol to 3-HPA conversion is the cobalamin-dependent glycerol/diol dehydratase PduCDE which also utilizes 1,2-propanediol (1,2-PD) to form propionate. Therefore our primary goal was to investigate glycerol to 3-HPA metabolism and 1,2-PD utilization by E. hallii along with its ability to produce cobalamin. We also investigated the relative abundance of E. hallii in stool of adults using 16S rRNA and pduCDE based gene screening to determine the contribution of E. hallii to intestinal propionate formation. We found that E. hallii utilizes glycerol to produce up to 9 mM 3-HPA but did not further metabolize 3-HPA to 1,3-propanediol. Utilization of 1,2-PD in the presence and absence of glucose led to the formation of propanal, propanol and propionate. E. hallii formed cobalamin and was detected in stool of 74% of adults using 16S rRNA gene as marker gene (n = 325). Relative abundance of the E. hallii 16S rRNA gene ranged from 0 to 0.59% with a mean relative abundance of 0.044%. E. hallii PduCDE was detected in 63 to 81% of the metagenomes depending on which subunit was investigated beside other taxons such as Ruminococcus obeum, R. gnavus, Flavonifractor plautii, Intestinimonas butyriciproducens, and Veillonella spp. In conclusion, we identified E. hallii as a common gut microbe with the ability to convert glycerol to 3-HPA, a step that requires the production of cobalamin, and to utilize 1,2-PD to form propionate. Our results along with its ability to use a broad range of substrates point at E. hallii as a key species within the intestinal trophic chain with the potential to

  11. The Common Gut Microbe Eubacterium hallii also Contributes to Intestinal Propionate Formation

    PubMed Central

    Engels, Christina; Ruscheweyh, Hans-Joachim; Beerenwinkel, Niko; Lacroix, Christophe; Schwab, Clarissa


    Eubacterium hallii is considered an important microbe in regard to intestinal metabolic balance due to its ability to utilize glucose and the fermentation intermediates acetate and lactate, to form butyrate and hydrogen. Recently, we observed that E. hallii is capable of metabolizing glycerol to 3-hydroxypropionaldehyde (3-HPA, reuterin) with reported antimicrobial properties. The key enzyme for glycerol to 3-HPA conversion is the cobalamin-dependent glycerol/diol dehydratase PduCDE which also utilizes 1,2-propanediol (1,2-PD) to form propionate. Therefore our primary goal was to investigate glycerol to 3-HPA metabolism and 1,2-PD utilization by E. hallii along with its ability to produce cobalamin. We also investigated the relative abundance of E. hallii in stool of adults using 16S rRNA and pduCDE based gene screening to determine the contribution of E. hallii to intestinal propionate formation. We found that E. hallii utilizes glycerol to produce up to 9 mM 3-HPA but did not further metabolize 3-HPA to 1,3-propanediol. Utilization of 1,2-PD in the presence and absence of glucose led to the formation of propanal, propanol and propionate. E. hallii formed cobalamin and was detected in stool of 74% of adults using 16S rRNA gene as marker gene (n = 325). Relative abundance of the E. hallii 16S rRNA gene ranged from 0 to 0.59% with a mean relative abundance of 0.044%. E. hallii PduCDE was detected in 63 to 81% of the metagenomes depending on which subunit was investigated beside other taxons such as Ruminococcus obeum, R. gnavus, Flavonifractor plautii, Intestinimonas butyriciproducens, and Veillonella spp. In conclusion, we identified E. hallii as a common gut microbe with the ability to convert glycerol to 3-HPA, a step that requires the production of cobalamin, and to utilize 1,2-PD to form propionate. Our results along with its ability to use a broad range of substrates point at E. hallii as a key species within the intestinal trophic chain with the potential to

  12. An evolutionary legacy of sex and clonal reproduction in the protistan oyster parasite Perkinsus marinus.


    Thompson, Peter C; Rosenthal, Benjamin M; Hare, Matthew P


    Perkinsus marinus, a protozoan parasite of the eastern oyster Crassostrea virginica, causes Dermo disease which limits fecundity and causes high mortality in host populations. The long-term efficacy of management strategies for suppressing this disease in both aquaculture and restoration settings depends on the potential rate of evolutionary response by P. marinus. Sexual reproduction has never been demonstrated in vitro or in previous population genetic studies. We developed high resolution microsatellite markers and amplified alleles directly from infected oyster genomic DNA. Of 336 infected oysters from four populations between Massachusetts and Florida, 129 (48%) appeared to be infected with a single parasite genotype and were subjected to population genetic analyses assuming diploidy. The great diversity of multilocus genotypes observed is incompatible with strictly clonal reproduction. Substantial heterozygote deficits in three populations suggest that sexual reproduction often involves inbreeding. At the same time, significant multilocus linkage disequilibrium occurred in most sampled populations, and several genotypes were sampled repeatedly in each of two populations, indicating that asexual reproduction also occurs in P. marinus populations. Interestingly, where this parasite has recently expanded its range, lower strain diversity, significant heterozygote excess, and highly heterozygous multilocus genotypes suggests clonal propagation of recent recombinants. Taken together, these data suggest that P. marinus employs multiple reproductive modes, and that over the short term, selection acts upon independent parasite lineages rather than upon individual loci in a cohesive, interbreeding population. Nevertheless, high genotypic diversity is the evolutionary legacy of sex in P. marinus. Anthropogenic movement of infected oysters may increase outcrossing opportunities, potentially facilitating rapid evolution of this parasite. Copyright © 2011 Elsevier B

  13. Cloning and sequencing of the gene for cellobiose 2-epimerase from a ruminal strain of Eubacterium cellulosolvens.


    Taguchi, Hidenori; Senoura, Takeshi; Hamada, Shigeki; Matsui, Hirokazu; Kobayashi, Yasuo; Watanabe, Jun; Wasaki, Jun; Ito, Susumu


    Cellobiose 2-epimerase (CE; EC is known to catalyze the reversible epimerization of cellobiose to 4-O-beta-D-glucopyranosyl-D-mannose in Ruminococcus albus cells. Here, we report a CE in a ruminal strain of Eubacterium cellulosolvens for the first time. The nucleotide sequence of the CE had an ORF of 1218 bp (405 amino acids; 46 963.3 Da). The CE from E. cellulosolvens showed 44-54% identity to N-acyl-D-glucosamine 2-epimerase-like hypothetical proteins in the genomes of Coprococcus eutactus, Faecalibacterium prausnitzii, Clostridium phytofermentans, Caldicellulosiruptor saccharolyticus, and Eubacterium siraeum. Surprisingly, it exhibited only 46% identity to a CE from R. albus. The recombinant enzyme expressed in Escherichia coli was purified by two-step chromatography. The purified enzyme had a molecular mass of 46.7 kDa and exhibited optimal activity at around 35 degrees C and pH 7.0-8.5. In addition to cello-oligosaccharides, it converted lactose to epilactose (4-O-beta-D-galactopyranosyl-D-mannose).

  14. Numerical Quantification of Perkinsus Marinus in the American Oyster Crassostrea virginicata (Gmelin 1791) (Mollusca: Bivalvia) by Modern Stereology

    EPA Science Inventory

    Species of Perkinsus are responsible for high mortalities of bivalve molluscs world-wide. Techniques to accurately estimate parasites in tissues are required to improve understanding of perkinsosis. This study quantifies the number and tissue distribution of Perkinsus marinus in ...


    EPA Science Inventory

    The progression of diseases caused by the oyster parasites, Perkinsus marinus and Haplosporidium nelsoni, were evaluated by periodic sampling (May 1994 - December 1995) of oysters, Crassostrea virginica, on an artificial reef located in the Piankatank River, Virginia. The infecti...

  16. Numerical Quantification of Perkinsus Marinus in the American Oyster Crassostrea virginicata (Gmelin 1791) (Mollusca: Bivalvia) by Modern Stereology

    EPA Science Inventory

    Species of Perkinsus are responsible for high mortalities of bivalve molluscs world-wide. Techniques to accurately estimate parasites in tissues are required to improve understanding of perkinsosis. This study quantifies the number and tissue distribution of Perkinsus marinus in ...

  17. Exposure to a putative alarm cue reduces downstream drift in larval sea lamprey Petromyzon marinus in the laboratory.


    Wagner, C M; Kierczynski, K E; Hume, J B; Luhring, T M


    An experimental mesocosm study suggested larval sea lamprey Petromyzon marinus detect and respond to an alarm cue released by dead adult conspecifics. Larvae exhibited a reduced tendency to move downstream when exposed to the cue and were less likely to move under continuous v. pulsed exposure. These findings support the hypothesis that short-term exposure to the alarm cue would probably result in retraction into the burrow, consistent with the blind, cryptic lifestyle of the larval P. marinus.

  18. Quantification of different Eubacterium spp. in human fecal samples with species-specific 16S rRNA-targeted oligonucleotide probes.


    Schwiertz, A; Le Blay, G; Blaut, M


    Species-specific 16S rRNA-targeted, Cy3 (indocarbocyanine)-labeled oligonucleotide probes were designed and validated to quantify different Eubacterium species in human fecal samples. Probes were directed at Eubacterium barkeri, E. biforme, E. contortum, E. cylindroides (two probes), E. dolichum, E. hadrum, E. lentum, E. limosum, E. moniliforme, and E. ventriosum. The specificity of the probes was tested with the type strains and a range of common intestinal bacteria. With one exception, none of the probes showed cross-hybridization under stringent conditions. The species-specific probes were applied to fecal samples obtained from 12 healthy volunteers. E. biforme, E. cylindroides, E. hadrum, E. lentum, and E. ventriosum could be determined. All other Eubacterium species for which probes had been designed were under the detection limit of 10(7) cells g (dry weight) of feces(-1). The cell counts obtained are essentially in accordance with the literature data, which are based on colony counts. This shows that whole-cell in situ hybridization with species-specific probes is a valuable tool for the enumeration of Eubacterium species in feces.

  19. Faecalimonas umbilicata gen. nov., sp. nov., isolated from human faeces, and reclassification of Eubacterium contortum, Eubacterium fissicatena and Clostridium oroticum as Faecalicatena contorta gen. nov., comb. nov., Faecalicatena fissicatena comb. nov. and Faecalicatena orotica comb. nov.


    Sakamoto, Mitsuo; Iino, Takao; Ohkuma, Moriya


    Two bacterial strains, designated EGH7T and TSAH33, were isolated from human faeces and characterized by using a polyphasic taxonomic approach that included analysis of morphology, phenotypic and biochemical features, cellular fatty acid profiles and phylogenetic position based on 16S rRNA and hsp60 gene sequence analyses. The results of 16S rRNA gene sequence analysis indicated that these strains represented members of the family Lachnospiraceae and formed a monophyletic cluster near Eubacterium contortum JCM 6483T (95 % sequence similarity), Ruminococcus gnavus JCM 6515T (95 %), Clostridium oroticum JCM 1429T (95 %), Eubacterium fissicatena JCM 31501T (95 %) and Clostridium nexile JCM 31500T (94 %). The results of a hsp60 gene sequence analysis supported the phylogenetic tree based on the 16S rRNA gene sequence, with a sequence similarity value of between 77.9 and 84.8 % to the five strains listed above. The novel strains were obligately anaerobic, non-pigmented, non-spore-forming, non-motile, Gram-stain-positive cocco-bacilli. The strains formed characteristic umbilicated colonies on EG agar plates. The major cellular fatty acids were C18 : 1ω9c, C16 : 0 and C18 : 1ω9c dimethyl acetal (DMA). EGH7T and TSAH33 have DNA G+C contents of 46.9 and 45.5 mol%, respectively. On the basis of these data, strains EGH7T and TSAH33 represent a novel species of a novel genus, for which the name Faecalimonas umbilicata gen. nov., sp. nov. is proposed. The type strain of F. umbilicata is EGH7T (=JCM 30896T=DSM 103426T).

  20. Unique transducins expressed in long and short photoreceptors of lamprey Petromyzon marinus

    PubMed Central

    Muradov, Hakim; Kerov, Vasily; Boyd, Kimberly K.; Artemyev, Nikolai O.


    Lampreys represent the most primitive vertebrate class of jawless fish and serve as an evolutionary model of the vertebrate visual system. Transducin-α (Gαt) subunits were investigated in lamprey Petromyzon marinus in order to understand the molecular origins of rod and cone photoreceptor G proteins. Two Gαt subunits, GαtL and GαtS, were identified in the P. marinus retina. GαtL is equally distant from cone and rod G proteins and is expressed in the lamprey’s long photoreceptors. The short photoreceptor GαtS is a rod-like transducin-α that retains several unique features of cone transducins. Thus, the duplication of the ancestral transducin gene giving rise to rod transducins has already occurred in the last common ancestor of the jawed and jawless vertebrates. PMID:18687354

  1. Diet composition of the invasive cane toad (Chaunus marinus) on Rota, Northern Mariana Islands

    USGS Publications Warehouse

    Reed, R.N.; Bakkegard, K.A.; Desy, G.E.; Plentovich, S.M.


    The cane or marine toad (Chaunus marinus, formerly Bufo marinus) was introduced to the Northern Mariana Islands starting in the 1930s. The effects of this exotic predator on native vertebrates (especially lizards) are largely unknown. We analysed the stomach contents of 336 cane toads collected from the island of Rota, with the goal of estimating the level of toad predation on native vertebrates. Beetles, ants, millipedes, and grasshoppers/crickets comprised the majority of prey classes consumed by toads. The introduced Brahminy blindsnake (Ramphotyphlops braminus; N = 6) and conspecific cane toads (N = 4) were the vertebrates most commonly found in toad stomachs. Skinks (Emoia; N = 2) were the only native vertebrates represented in our sample. The small numbers of nocturnal terrestrial vertebrates native to Rota likely translates to relatively low rates of predation by cane toads on native vertebrates.

  2. The frequency of eubacterium-to-eukaryote lateral gene transfers shows significant cross-taxa variation within amoebozoa.


    Watkins, Russell F; Gray, Michael W


    Single-celled bacterivorous eukaryotes offer excellent test cases for evaluation of the frequency of prey-to-predator lateral gene transfer (LGT). Here we use analysis of expressed sequence tag (EST) data sets to quantify the extent of LGT from eubacteria to two amoebae, Acanthamoeba castellanii and Hartmannella vermiformis. Stringent screening for LGT proceeded in several steps intended to enrich for authentic events while at the same time minimizing the incidence of false positives due to factors such as limitations in database coverage and ancient paralogy. The results were compared with data obtained when the same methodology was applied to EST libraries from a number of other eukaryotic taxa. Significant differences in the extent of apparent eubacterium-to-eukaryote LGT were found between taxa. Our results indicate that there may be substantial inter-taxon variation in the number of LGT events that become fixed even between amoebozoan species that have similar feeding modalities.

  3. Perkinsus marinus in pleasure oyster Crassostrea corteziensis from Nayarit, Pacific coast of México.


    Cáceres-Martínez, J; Vásquez-Yeomans, R; Padilla-Lardizábal, G; del Río Portilla, M A


    Culture of the pleasure oyster Crassostrea corteziensis is emerging as an alternative to the Pacific oyster (Crassostrea gigas) for oyster producers, who face severe mortalities since 1997 in Northwest México. For determining the health status of this species, we conducted a histopathological analysis of cultured populations from two estuaries in the Pacific coast of México. Macroscopical analysis revealed animals with transparent and retracted mantle. Histopathological analysis of these specimens showed tissue alterations and parasitic forms consistent with Perkinsus sp. infection. Stages of the parasite identified included tomont and trophozoites with an eccentric vacuole characteristic of Perkinsus spp. Pieces of tissues of infected oysters were incubated in Fluid Thioglycollate Medium (FTM) resulting in blue-black hypnospores after incubation. The identity of the parasite was confirmed by species specific PCR-based assay in DNA samples from oysters, tissue fractions from FTM cultures, and deparaffined samples with Perkinsus-like parasite detected by histology. Sequencing of positive amplified fragments (307bp) showed a sequence similar to Perkinsus marinus strain TXsc NTS ribosomal RNA gene (100% coverage and 98% identity, GenBank Accession No. AF497479.1) and to P. marinus, Genomic DNA, (100% coverage and 97% identity, GenBank Accession No. S78416.1). The prevalence of P. marinus varied from 1 to 5% in Boca del Camichín and from 1 to 6% in Pozo Chino. In general, the intensity of infection was moderate. The infection was observed in oysters from 31 to 110mm of shell length. This is the first record of P. marinus in oysters from the North America Pacific coast and the first record in C. corteziensis. The origin of this parasite in the area is unknown, but it may be associated to introductions of Crassostrea virginica from the East coast of United States of America or Gulf of México.

  4. Acute toxicity of methyl mercury to the larval lamprey, Petromyzon marinus

    SciTech Connect

    Mallatt, J.; Barron, M.G.; McDonough, C.


    Mercury compounds pollute many aquatic habitats and are extremely toxic to aquatic organisms. Acute toxicity of waterborne methyl mercury has been studied in several teleost species. Lampreys are taxonomically distant from teleosts and are used for comparative toxicological purposes. Landlocked sea lampreys, Petromyzon marinus, inhabit the Great Lakes region, and their larvae (ammocoetes) burrow in stream sediments. In this study, the authors present toxicity curves for ammocoetes exposed acutely to methyl mercuric chloride solutions. Susceptibility was related to temperature and animal size.

  5. Copper exposure affects hemocyte apoptosis and Perkinsus marinus infection in eastern oysters Crassostrea virginica (Gmelin).


    Foster, Brent; Grewal, Snimar; Graves, Ondrea; Hughes, Francis M; Sokolova, Inna M


    Dermo disease in the eastern oyster (Crassostrea virginica) is caused by an intracellular protistan parasite Perkinsus marinus. The progression and outcome of this disease is determined by a complex interplay between the host's immunity and parasite's escape mechanisms, both of which can be influenced by environmental pollutants including heavy metals such as copper (Cu). The goal of the present study was to determine the effects of Cu on the levels of apoptosis (which can serve as an important host defense mechanism) in oyster immune cells (hemocytes) in vitro and in vivo as well as on the establishment of P. marinus infections in vivo. Surprisingly, Cu exerted opposing effects on apoptosis levels of hemocytes in vitro and in vivo, stimulating apoptosis in isolated hemocytes but suppressing it during Cu exposure of whole oysters. The mechanisms of this effect are presently unknown and may be related to the different bioavailability of the metal in vitro and in vivo. As expected, Cu accumulated in oyster soft tissues during in vitro exposure. Unexpectedly, this metal also strongly accumulated in hemolymph plasma which is classically considered isoionic with the surrounding seawater, likely reflecting the presence of soluble Cu-binding proteins in oyster plasma. Cu reduced growth of P. marinus in vitro and greatly reduced infection levels of hemocytes in vivo, presumably by direct toxic effects on the parasite. As a possible parasitic counterbalance, Cu accumulation in the hemocytes was reduced by P. marinus infection, although this reduction was not sufficient to prevent the parasiticidal effects of the heavy metal in vivo. This effect of Cu may be useful as a potential therapeutic against Dermo disease in aquaculture conditions. Overall, this study provides important new insights into the potential role of environmental metals in host-parasite relationships and disease dynamics in C. virginica.

  6. Diversity of Aplochiton fishes (Galaxiidea) and the taxonomic resurrection of A. marinus.


    Alò, Dominique; Correa, Cristián; Arias, Carlos; Cárdenas, Leyla


    Aplochiton is a small genus of galaxiid fishes endemic to Patagonia and the Falkland Islands whose taxonomy is insufficiently resolved. Recent genetic analyses confirmed the existence of only two closely related species, Aplochiton taeniatus and Aplochiton zebra, while a third controversial species, Aplochiton marinus, remained lost to synonymy with A. taeniatus. Using an integrative taxonomy framework, we studied original samples and published sequences from a broad range in western Patagonia and the Falkland Islands, and generated robust species hypotheses based on single-locus (Cytochrome Oxidase subunit I; COI) species-delineation methods and known diagnostic morphological characters analyzed in a multivariate context. Results revealed three distinct evolutionary lineages that morphologically resemble, in important respects, existing nominal species descriptions. Interestingly, the lineage associated with A. marinus was unambiguously identifiable (100% accuracy) both from the genetic and morphological viewpoints. In contrast, the morphology of A. taeniatus and A. zebra overlapped substantially, mainly due to the high variability of A. taeniatus. Discriminant function analysis aided the identification of these species with 83.9% accuracy. Hence, for their unambiguous identification, genetic screening is needed. A. marinus has seldom been documented, and when recorded, it has always been found in sites with clear marine influence. It is possible that only A. marinus preserves a life cycle related to the sea akin to the hypothesized ancestral galaxiid. We did not find evidence of claimed diadromy in A. taeniatus or A. zebra, and, therefore, these should be regarded as freshwater species. Finally, a lack of phylogeographic patterns and overrepresentation of uncommon haplotypes suggested demographic expansions in recent evolutionary time, especially of A. zebra, in line with the hypothesis of large-scale range expansion and lineage spread in western Patagonia.

  7. Diversity of Aplochiton Fishes (Galaxiidea) and the Taxonomic Resurrection of A. marinus

    PubMed Central

    Arias, Carlos; Cárdenas, Leyla


    Aplochiton is a small genus of galaxiid fishes endemic to Patagonia and the Falkland Islands whose taxonomy is insufficiently resolved. Recent genetic analyses confirmed the existence of only two closely related species, Aplochiton taeniatus and Aplochiton zebra, while a third controversial species, Aplochiton marinus, remained lost to synonymy with A. taeniatus. Using an integrative taxonomy framework, we studied original samples and published sequences from a broad range in western Patagonia and the Falkland Islands, and generated robust species hypotheses based on single-locus (Cytochrome Oxidase subunit I; COI) species-delineation methods and known diagnostic morphological characters analyzed in a multivariate context. Results revealed three distinct evolutionary lineages that morphologically resemble, in important respects, existing nominal species descriptions. Interestingly, the lineage associated with A. marinus was unambiguously identifiable (100% accuracy) both from the genetic and morphological viewpoints. In contrast, the morphology of A. taeniatus and A. zebra overlapped substantially, mainly due to the high variability of A. taeniatus. Discriminant function analysis aided the identification of these species with 83.9% accuracy. Hence, for their unambiguous identification, genetic screening is needed. A. marinus has seldom been documented, and when recorded, it has always been found in sites with clear marine influence. It is possible that only A. marinus preserves a life cycle related to the sea akin to the hypothesized ancestral galaxiid. We did not find evidence of claimed diadromy in A. taeniatus or A. zebra, and, therefore, these should be regarded as freshwater species. Finally, a lack of phylogeographic patterns and overrepresentation of uncommon haplotypes suggested demographic expansions in recent evolutionary time, especially of A. zebra, in line with the hypothesis of large-scale range expansion and lineage spread in western Patagonia. PMID

  8. Cardiovascular and behavioural changes during water absorption in toads, Bufo alvarius and Bufo marinus.


    Viborg, Arne L; Wang, Tobias; Hillyard, Stanley D


    Blood cell flux (BCF) in the pelvic skin of Bufo marinus was lower than Bufo alvarius when toads rehydrated from deionised water (DI) or 50 mmol l-1 NaCl (NaCl). Despite the lower BCF in B. marinus, water absorption was not different between the species when toads rehydrated from DI or NaCl. When fluid contact was limited to the pelvic skin, water uptake from NaCl was lower than from DI, but became greater than uptake from DI as the immersion level increased. Hydrophobic beeswax coating the lateral sides reduced absorption from NaCl but not from DI. Toads settled into water absorption response posture well after maximal BCF was attained in both DI and NaCl, indicating that the behavioural response requires neural integration beyond the increase in BCF. Water exposure increased BCF in hydrated B. alvarius with empty bladders but not in those with stored bladder water. Hydrated B. marinus with an empty bladder did not increase BCF when given water. Handling stress depressed BCF but increased central arterial flow (CAF), measured using a flow probe around the dorsal aorta. In undisturbed toads, CAF increased with the same time course as BCF while heart rate remained relatively constant, suggesting redistribution of blood flow.

  9. Whole genome phylogeny of Prochlorococcus marinus group of cyanobacteria: genome alignment and overlapping gene approach.


    Prabha, Ratna; Singh, Dhananjaya P; Gupta, Shailendra K; Rai, Anil


    Prochlorococcus is the smallest known oxygenic phototrophic marine cyanobacterium dominating the mid-latitude oceans. Physiologically and genetically distinct P. marinus isolates from many oceans in the world were assigned two different groups, a tightly clustered high-light (HL)-adapted and a divergent low-light (LL-) adapted clade. Phylogenetic analysis of this cyanobacterium on the basis of 16S rRNA and other conserved genes did not show consistency with its phenotypic behavior. We analyzed phylogeny of this genus on the basis of complete genome sequences through genome alignment, overlapping-gene content and gene-order approach. Phylogenetic tree of P. marinus obtained by comparing whole genome sequences in contrast to that based on 16S rRNA gene, corresponded well with the HL/LL ecotypic distinction of twelve strains and showed consistency with phenotypic classification of P. marinus. Evidence for the horizontal descent and acquisition of genes within and across the genus was observed. Many genes involved in metabolic functions were found to be conserved across these genomes and many were continuously gained by different strains as per their needs during the course of their evolution. Consistency in the physiological and genetic phylogeny based on whole genome sequence is established. These observations improve our understanding about the adaptation and diversification of these organisms under evolutionary pressure.

  10. Pallial mucus of the oyster Crassostrea virginica regulates the expression of putative virulence genes of its pathogen Perkinsus marinus.


    Pales Espinosa, Emmanuelle; Corre, Erwan; Allam, Bassem


    Perkinsus marinus is a pathogen responsible for severe mortalities of the eastern oyster Crassostrea virginica along the East and Gulf coasts of the United States. When cultivated, the pathogenicity of this microorganism decreases significantly, hampering the study of its virulence factors. Recent investigations have shown a significant increase of the in vivo virulence of P. marinus exposed to oyster pallial mucus. In the current study, we investigated the effect of pallial mucus on P. marinus gene expression compared with cultures supplemented with oyster digestive extracts or with un-supplemented cultures. In parallel, parasite cells cultured under these three conditions were used to challenge oysters and to assess virulence in vivo. Perkinsus marinus mRNA sequencing was performed on an Illumina GAIIX sequencer and data were analysed using the Tuxedo RNAseq suite for mapping against the draft P. marinus genome and for differential expression analysis. Results showed that exposure of P. marinus to mucus induces significant regulation of nearly 3,600 transcripts, many of which are considered as putative virulence factors. Pallial mucus is suspected to mimic internal host conditions, thereby preparing the pathogen to overcome defense factors before invasion. This hypothesis is supported by significant regulation in several antioxidant proteins, heat shock proteins, protease inhibitors and proteasome subunits. In addition, mucus exposure induced the modulation of several genes known to affect immunity and apoptosis in vertebrates and invertebrates. Several proteases (proteolysis) and merozoite surface proteins (cell recognition) were also modulated. Overall, these results provide a baseline for targeted, in depth analysis of candidate virulence factors in P. marinus.

  11. Thyroid hormone and retinoid X receptor function and expression during sea lamprey (Petromyzon marinus) metamorphosis.


    Manzon, Lori A; Youson, John H; Holzer, Guillaume; Staiano, Leopoldo; Laudet, Vincent; Manzon, Richard G


    Sea lampreys (Petromyzon marinus) are members of the ancient class Agnatha and undergo a metamorphosis that transforms blind, sedentary, filter-feeding larvae into free-swimming, parasitic juveniles. Thyroid hormones (THs) appear to be important for lamprey metamorphosis, however, serum TH concentrations are elevated in the larval phase, decline rapidly during early metamorphosis and remain low until metamorphosis is complete; these TH fluctuations are contrary to those of other metamorphosing vertebrates. Moreover, thyroid hormone synthesis inhibitors (goitrogens) induce precocious metamorphosis and exogenous TH treatments disrupt natural metamorphosis in P. marinus. Given that THs exert their effects by binding to TH nuclear receptors (TRs) that often act as heterodimers with retinoid X receptors (RXRs), we cloned and characterized these receptors from P. marinus and examined their expression during metamorphosis. Two TRs (PmTR1 and PmTR2) and three RXRs (PmRXRs) were isolated from P. marinus cDNA. Phylogenetic analyses group the PmTRs together on a branch prior to the gnathostome TRα/β split. The three RXRs also group together, but our data indicated that these transcripts are most likely either allelic variants of the same gene locus, or the products of a lamprey-specific duplication event. Importantly, these P. marinus receptors more closely resemble vertebrate as opposed to invertebrate chordate receptors. Functional analysis revealed that PmTR1 and PmTR2 can activate transcription of TH-responsive genes when treated with nanomolar concentrations of TH and they have distinct pharmacological profiles reminiscent of vertebrate TRβ and TRα, respectively. Also similar to other metamorphosing vertebrates, expression patterns of the PmTRs during lamprey metamorphosis suggest that PmTR1 has a dynamic, tissue-specific expression pattern that correlates with tissue morphogenesis and biochemical changes and PmTR2 has a more uniform expression pattern. This TR

  12. Isolation and characterization of a human intestinal bacterium, Eubacterium sp. ARC-2, capable of demethylating arctigenin, in the essential metabolic process to enterolactone.


    Jin, Jong-Sik; Zhao, Yu-Feng; Nakamura, Norio; Akao, Teruaki; Kakiuchi, Nobuko; Hattori, Masao


    Plant lignans, such as pinoresinol diglucoside, secoisolariciresinol diglucoside and arctiin, are metabolized to mammalian lignans, enterolactone or enterodiol, by human intestinal bacteria. Their metabolic processes include deglucosylation, ring cleavage, demethylation, dehydroxylation and oxidation. Here we isolated an intestinal bacterium capable of demethylating arctigenin, an aglycone of arctiin, to 2,3-bis(3,4-dihydroxybenzyl)butyrolactone (1) from human feces, and identified as an Eubacterium species (E. sp. ARC-2), which is similar to Eubacterium limosum on the basis of morphological and biochemical properties and 16S rRNA gene sequencing. By incubating with E. sp. ARC-2, arctigenin was converted to 1 through stepwise demethylation. Demethylation of arctigenin by E. sp. ARC-2 was tetrahydrofolate- and ATP-dependent, indicating that the reaction was catalyzed by methyltransferase. Moreover, E. sp. ARC-2 transformed secoisolariciresinol to 2,3-bis(3,4-dihydroxybenzyl)-1,4-butanediol by demethylation.

  13. Competition in the metabolism of glycyrrhizin with glycyrrhetic acid mono-glucuronide by mixed Eubacterium sp. GLH and Ruminococcus sp. PO1-3.


    Akao, T


    Eubacterium sp. GLH possessing glycyrrhizin (GL) and glycyrrhetic acid mono-glucuronide (GAMG) beta-D-glucuronidases, Ruminococcus sp. PO1-3 possessing GL and GAMG beta-D-glucuronidases and 3beta-hydroxysteroid dehydrogenase and these mixed bacteria were cultured in GAM medium with and without GL, GAMG or both. GL added to Eubacterium sp. GLH accelerated the peaks of enhanced GL beta-D-glucuronidase activity and suppressed GAMG beta-D-glucuronidase activity, and GAMG delayed the peaks of the enhanced growth with GL and GAMG beta-D-glucuronidase activities. GL added to Ruminococcus sp. PO1-3 enhanced gradually the growth with GL and GAMG beta-D-glucuronidase activities, and GAMG enhanced slowly GL beta-D-glucuronidase activity and rapidly the growth with GAMG beta-D-glucuronidase activity. The metabolite glycyrrhetic acid (GA) was produced by Eubacterium sp. GLH and Ruminococcus sp. PO1-3 in larger amounts and faster from GAMG than from GL. GL (1.0 mM) and 1.0 mM GAMG added to these mixed bacteria enhanced the growth with GL and GAMG beta-D-glucuronidase activities and were metabolized almost completely to GA in culture of 2 d and 1 d, respectively. It was found that the metabolism of GAMG was faster than that of GL. GL with GAMG added to mixed Eubacterium sp. GLH and Ruminococcus sp. PO1-3 cultured for 0 and 1 d led to a lower level of these enzyme activities and the consumption of GAMG more quickly, not GL. Low GAMG beta-D-glucuronidase had the ability to hydrolyze GAMG well.

  14. Reclassification of Eubacterium desmolans as Butyricicoccus desmolans comb. nov., and description of Butyricicoccus faecihominis sp. nov., a butyrate-producing bacterium from human faeces.


    Takada, Toshihiko; Watanabe, Koichi; Makino, Hiroshi; Kushiro, Akira


    A Gram-positive-staining, coccoid-shaped, non-motile, asporogenous, obligately anaerobic and butyrate-producing bacterium was recovered from a healthy human's faeces. The organism was isolated by the enrichment culture technique using yeast extract-casein hydrolysate-fatty acids broth supplemented with 0.5 % mucin. Phylogenetic analysis of 16S rRNA gene sequences demonstrated that the novel strain should be classified as a member of the Eubacterium desmolans-related cluster in the family Ruminococcaceae. Furthermore, this analysis demonstrated that the type strains of Butyricicoccus pullicaecorum (95.6 %) and Eubacterium desmolans (94.7 %) were the closest phylogenetic neighbours to strain YIT 12789T. However, DNA‒DNA reassociation values with these closest strains were less than 20 %. On the basis of the phenotypic, genotypic and chemotaxonomic features, the novel coccoid-shaped bacterium should be designated as a representative of a novel species of the genus Butyricicoccus, for which the name Butyricicoccus faecihominis sp. nov. is proposed. The type strain is YIT 12789T (=JCM 31056T=DSM 100989T). It is also proposed that Eubacterium desmolans be reclassified in the genus Butyricicoccus as Butyricicoccus desmolans comb. nov.



    Demir-Hilton, Elif; Hutchins, David A; Czymmek, Kirk J; Coyne, Kathryn J


    Delaware's Inland Bays (DIB), USA, are subject to blooms of potentially harmful raphidophytes, including Heterosigma akashiwo. In 2004, a dense bloom was observed in a low salinity tributary of the DIB. Light microscopy initially suggested that the species was H. akashiwo; however, the cells were smaller than anticipated. 18S rDNA sequences of isolated cultures differed substantially from all raphidophyte sequences in GenBank. Phylogenetic analysis placed it approximately equidistant from Chattonella and Heterosigma with only ~96% sequence homology with either group. Here, we describe this marine raphidophyte as a novel genus and species, Viridilobus marinus (gen. et sp. nov.). We also compared this species with H. akashiwo, because both species are superficially similar with respect to morphology and their ecological niches overlap. V. marinus cells are ovoid to spherical (11.4 × 9.4 μm), and the average number of chloroplasts (4 per cell) is lower than in H. akashiwo (15 per cell). Pigment analysis of V. marinus revealed the presence of fucoxanthin, violaxanthin, and zeaxanthin, which are characteristic of marine raphidophytes within the family Chattonellaceae of the Raphidophyceae. TEM and confocal microscopy, however, revealed diagnostic microscopic and ultrastructural characteristics that distinguish it from other raphidophytes. Chloroplasts were in close association with the nucleus and thylakoids were arranged either parallel or perpendicular to the cell surface. Putative mucocysts were identified, but trichocysts were not observed. These features, along with DNA sequence data, distinguish this species from all other raphidophyte genera within the family Chattonellaceae of the Raphidophyceae.

  16. Fast detection of a protozoan pathogen, Perkinsus marinus, using AlGaN/GaN high electron mobility transistors

    NASA Astrophysics Data System (ADS)

    Wang, Yu-Lin; Chu, B. H.; Chen, K. H.; Chang, C. Y.; Lele, T. P.; Papadi, G.; Coleman, J. K.; Sheppard, B. J.; Dungen, C. F.; Pearton, S. J.; Johnson, J. W.; Rajagopal, P.; Roberts, J. C.; Piner, E. L.; Linthicum, K. J.; Ren, F.


    Antibody-functionalized, Au-gated AlGaN/GaN high electron mobility transistors (HEMTs) were used to detect Perkinsus marinus. The antibody was anchored to the gate area through immobilized thioglycolic acid. The AlGaN/GaN HEMT drain-source current showed a rapid response of less than 5 s when the infected solution was added to the antibody-immobilized surface. The sensor can be recycled with a phosphate buffered saline wash. These results clearly demonstrate the promise of field-deployable electronic biological sensors based on AlGaN/GaN HEMTs for Perkinsus marinus detection.

  17. Endocrine events associated with spawning behavior in the sea lamprey (Petromyzon marinus).


    Linville, J E; Hanson, L H; Sower, S A


    Levels of estradiol, progesterone, and testosterone were determined in plasma of sea lamprey (Petromyzon marinus) undergoing certain behaviors associated with spawning in natural and artificial stream environments. Significantly higher levels of estradiol, progesterone, and testosterone were found in males than in females. In the artificial spawning channel, levels of estradiol were significantly higher in females exhibiting resting and swimming behaviors than in fanning, nest building, and spawning behaviors. No significant correlation was found with either progesterone or testosterone levels and the various reproductive behaviors. The data presented are the first experimental evidence that suggest gonadal steroids may be correlated with certain reproductive behaviors in the sea lamprey.

  18. Endocrine events associated with spawning behavior in the sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Linville, Jane E.; Hanson, Lee H.; Sower, Stacia A.


    Levels of estradiol, progesterone, and testosterone were determined in plasma of sea lamprey (Petromyzon marinus) undergoing certain behaviors associated with spawning in natural and artifical stream environments. Significantly higher levels of estradiol, progesterone, and testosterone were found in males than in females. In the artifical spawning channel, levels of estradiol were significantly higher in females exhibiting resting and swimming behaviors than in fanning, nest building, and spawning behaviors. No significant correlation was found with either progesterone or testosterone levels and the various reproductive behaviors. The data presented are the first experimental evidence that suggest gonadal steroids may be correlated with certain reproductive behaviors in the sea lamprey.

  19. The Effects of the Toxic Cyanobacterium Limnothrix (Strain AC0243) on Bufo marinus Larvae

    PubMed Central

    Daniels, Olivia; Fabbro, Larelle; Makiela, Sandrine


    Limnothrix (strain AC0243) is a cyanobacterium, which has only recently been identified as toxin producing. Under laboratory conditions, Bufo marinus larvae were exposed to 100,000 cells mL−1 of Limnothrix (strain AC0243) live cultures for seven days. Histological examinations were conducted post mortem and revealed damage to the notochord, eyes, brain, liver, kidney, pancreas, gastrointestinal tract, and heart. The histopathological results highlight the toxicological impact of this strain, particularly during developmental stages. Toxicological similarities to β-N-Methylamino-l-alanine are discussed. PMID:24662524

  20. Role of physical barriers in the control of sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Hunn, J.B.; Youngs, W.D.


    Mechanical and electromechanical barriers played a significant role in the initial attempts to control sea lamprey (Petromyzon marinus) populations in the upper Great Lakes. More recently electromechanical weirs have been used to assess the relative abundance of spawning-run sea lampreys in Lake Superior. Development of an integrated control approach to sea lamprey control has stimulated an ongoing research program to define structural and/or velocity criteria that can be used to design barrier dams that block spawning runs of sea lamprey

  1. A possible role of cellulose-binding protein A (CBPA) in the adhesion of Eubacterium cellulosolvens 5 to cellulose.


    Toyoda, Atsushi; Takano, Kazunori; Minato, Hajime


    The cellulose-binding protein A (CBPA) of Eubacterium cellulosolvens 5 is a modular enzyme comprised of a catalytic domain, a cellulose-binding domain and a cell wall-binding domain. Cellobiose-grown cells changed their adhesion ability to cellulose depending on the growth phase. On the other hand, carboxymethyl cellulose (CMC)-grown cells bound to cellulose regardless of their growth phase. The distribution of CBPA in the culture supernatant and cell fractions changed depending on the carbon source contained in the medium and growth phase. The cellobiose-grown cells harvested from the culture of the late stationary growth phase did not bind to cellulose, but their adhesion ability was recovered by treatment with recombinant CBPA. Moreover, cellobiose-grown cells harvested from the culture of an early exponential growth phase bound to cellulose, but their adhesion ability was inhibited by treatment with anti-CBPA antiserum. CBPA rapidly decreased the viscosity of CMC, indicating that CBPA was endoglucanase. The results obtained in this study indicate that CBPA plays an important role in the adhesion of E. cellulosolvens 5 cells to cellulose.

  2. Biotransformation on the flavonolignan constituents of Silybi Fructus by an intestinal bacterial strain Eubacterium limosum ZL-II.


    Zhang, Ying; Yang, Dong-Hui; Zhang, Ying-Tao; Chen, Xiu-Min; Li, Li-Li; Cai, Shao-Qing


    Eubacterium limosum ZL-II is an anaerobic bacterium with demethylated activity, which was isolated from human intestinal bacteria in our previous work. In this study, the flavonolignan constituents of Silybi Fructus were biotransformed by E. limosum(1) ZL-II, producing four new transformation products - demethylisosilybin B (T1), demethylisosilybin A (T2), demethylsilybin B (T3) and demethylsilybin A (T4), among which T1 and T2 were new compounds. Their chemical structures were identified by ESI-TOF/MS, (1)H NMR, (13)C NMR, HMBC and CD spectroscopic data. The bioassay results showed that the transformation products T1-T4 exhibited significant inhibitory activities on Alzheimer's amyloid-β 42 (Aβ42(2)) aggregation with IC50 values at 7.49 μM-10.46 μM, which were comparable with that of the positive control (epigallocatechin gallate, EGCG(3), at 9.01 μM) and much lower than those of their parent compounds (at not less than 145.10 μM). The method of biotransformation by E. limosum ZL-II explored a way to develop the new and active lead compounds in Alzheimer's disease from Silybi Fructus. However, the transformation products T1-T4 exhibited decreased inhibitory activities against human tumor cell lines comparing with their parent compounds.

  3. A phylogenetically distinctive and extremely heat stable light-driven proton pump from the eubacterium Rubrobacter xylanophilus DSM 9941T

    PubMed Central

    Kanehara, Kanae; Yoshizawa, Susumu; Tsukamoto, Takashi; Sudo, Yuki


    Rhodopsins are proteins that contain seven transmembrane domains with a chromophore retinal and that function as photoreceptors for light-energy conversion and light-signal transduction in a wide variety of organisms. Here we characterized a phylogenetically distinctive new rhodopsin from the thermophilic eubacterium Rubrobacter xylanophilus DSM 9941T that was isolated from thermally polluted water. Although R. xylanophilus rhodopsin (RxR) is from Actinobacteria, it is located between eukaryotic and archaeal rhodopsins in the phylogenetic tree. Escherichia coli cells expressing RxR showed a light-induced decrease in environmental pH and inhibition by a protonophore, indicating that it works as a light-driven outward proton pump. We characterized purified RxR spectroscopically, and showed that it has an absorption maximum at 541 nm and binds nearly 100% all-trans retinal. The pKa values for the protonated retinal Schiff base and its counterion were estimated to be 10.7 and 1.3, respectively. Time-resolved flash-photolysis experiments revealed the formation of a red-shifted intermediate. Of note, RxR showed an extremely high thermal stability in comparison with other proton pumping rhodopsins such as thermophilic rhodopsin TR (by 16-times) and bacteriorhodopsin from Halobacterium salinarum (HsBR, by 4-times). PMID:28290523

  4. Presence of several cellulose-binding proteins in culture supernatant and cell lysate of Eubacterium cellulosolvens 5.


    Toyoda, Atsushi; Yoda, Kazutoyo; Nakamura, Yutaka; Minato, Hajime


    Attempts were made to separate and characterize cellulose-binding proteins (CBPs) from both the culture supernatant and cell lysate of Eubacterium cellulosolvens 5. Once the CBPs were bound to Avicel cellulose, they were then effectively eluted with the solution containing 3.2 or 5% sodium dodecyl sulfate (SDS), but not eluted with the solution containing various kinds of carbohydrates and reagents. Namely, CBPs in both the culture supernatant and cell lysate of the bacterium bound tightly and strongly to cellulose. The SDS-polyacrylamide gel electrophoresis (SDS-PAGE) of the eluted CBPs indicated that the CBPs contained the two major proteins having the molecular weights of approximately 160 and 84 kilodaltons (kDa) and one sub-major protein having a molecular weight of approximately 140 kDa. Zymogram analysis after the SDS-PAGE of the eluted CBPs showed that two proteins exhibited the highest levels of carboxymethyl cellulase (CMCase) activity corresponding to the molecular weights of approximately 160 and 90 kDa. A major protein having the molecular weight of approximately 160 kDa exhibited a distinct CMCase activity and was designated as CBPE1. Western immunoblot analysis indicated that the proteins prepared from 16 representative strains of rumen bacteria did not cross-react with rabbit antiserum raised against CBPE1. Thus, CBPE1 may be a unique CBP that plays an important role in the adhesion of the bacterium to cellulose.

  5. A phylogenetically distinctive and extremely heat stable light-driven proton pump from the eubacterium Rubrobacter xylanophilus DSM 9941(T).


    Kanehara, Kanae; Yoshizawa, Susumu; Tsukamoto, Takashi; Sudo, Yuki


    Rhodopsins are proteins that contain seven transmembrane domains with a chromophore retinal and that function as photoreceptors for light-energy conversion and light-signal transduction in a wide variety of organisms. Here we characterized a phylogenetically distinctive new rhodopsin from the thermophilic eubacterium Rubrobacter xylanophilus DSM 9941(T) that was isolated from thermally polluted water. Although R. xylanophilus rhodopsin (RxR) is from Actinobacteria, it is located between eukaryotic and archaeal rhodopsins in the phylogenetic tree. Escherichia coli cells expressing RxR showed a light-induced decrease in environmental pH and inhibition by a protonophore, indicating that it works as a light-driven outward proton pump. We characterized purified RxR spectroscopically, and showed that it has an absorption maximum at 541 nm and binds nearly 100% all-trans retinal. The pKa values for the protonated retinal Schiff base and its counterion were estimated to be 10.7 and 1.3, respectively. Time-resolved flash-photolysis experiments revealed the formation of a red-shifted intermediate. Of note, RxR showed an extremely high thermal stability in comparison with other proton pumping rhodopsins such as thermophilic rhodopsin TR (by 16-times) and bacteriorhodopsin from Halobacterium salinarum (HsBR, by 4-times).

  6. Does DNA methylation regulate metamorphosis? The case of the sea lamprey (Petromyzon marinus) as an example.


    Covelo-Soto, Lara; Saura, María; Morán, Paloma


    Lampreys represent one of the most ancient vertebrate lineages enclosing a special interest for genetic and epigenetic studies. The sea lamprey (Petromyzon marinus) is an anadromous species that experiences metamorphosis all the way up to the adult stage. Although representing a gradual process, metamorphosis in this species involves dramatic conversions with regard to physiological together with structural body changes preparing individuals for a marine and parasitic life; in consequence, multiple gene expression modifications are expected. The implications of thyroid hormones and HOX gene expression changes have previously been reported in this species and also in other vertebrate species. Nonetheless, information lacks on how these genes are regulated in lampreys. We here report about the existence of methylation pattern differences between the adult and the larvae sea lamprey life cycle stages making use of the Methylation-Sensitive Amplified Polymorphism (MSAP) technique. Differentially methylated fragment sequencing allowed to establish homologous identities with HOX genes involved in morphogenesis, along with genes related to the water balance and to the osmotic homoeostasis, all associated to a marine environment adaptation. These results provide evidences revealing that DNA methylation plays a role in the epigenetic regulation of the P. marinus post-natal development representing a starting point for future studies. To the best of our knowledge, this is the first study which detects DNA methylation changes associated with metamorphosis in lampreys. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Heterokont Predator Develorapax marinus gen. et sp. nov. – A Model of the Ochrophyte Ancestor

    PubMed Central

    Aleoshin, Vladimir V.; Mylnikov, Alexander P.; Mirzaeva, Gulnara S.; Mikhailov, Kirill V.; Karpov, Sergey A.


    Heterotrophic lineages of Heterokonta (or stramenopiles), in contrast to a single monophyletic group of autotrophs, Ochrophyta, form several clades that independently branch off the heterokont stem lineage. The nearest neighbors of Ochrophyta in the phylogenetic tree appear to be almost exclusively bacterivorous, whereas the hypothesis of plastid acquisition by the ancestors of the ochrophyte lineage suggests an ability to engulf eukaryotic alga. In line with this hypothesis, the heterotrophic predator at the base of the ochrophyte lineage may be regarded as a model for the ochrophyte ancestor. Here, we present a new genus and species of marine free-living heterotrophic heterokont Develorapax marinus, which falls into an isolated heterokont cluster, along with the marine flagellate Developayella elegans, and is able to engulf eukaryotic cells. Together with environmental sequences D. marinus and D. elegans form a class-level clade Developea nom. nov. represented by species adapted to different environmental conditions and with a wide geographical distribution. The position of Developea among Heterokonta in large-scale phylogenetic tree is discussed. We propose that members of the Developea clade represent a model for transition from bacterivory to a predatory feeding mode by selection for larger prey. Presumably, such transition in the grazing strategy is possible in the presence of bacterial biofilms or aggregates expected in eutrophic environment, and has likely occurred in the ochrophyte ancestor. PMID:27536283

  8. Effects of salinity and temperature on in vitro cell cycle and proliferation of Perkinsus marinus from Brazil.


    Queiroga, Fernando Ramos; Marques-Santos, Luis Fernando; De Medeiros, Isac Almeida; Da Silva, Patrícia Mirella


    Field and in vitro studies have shown that high salinities and temperatures promote the proliferation and dissemination of Perkinsus marinus in several environments. In Brazil, the parasite infects native oysters Crassostrea gasar and Crassostrea rhizophorae in the Northeast (NE), where the temperature is high throughout the year. Despite the high prevalence of Perkinsus spp. infection in oysters from the NE of Brazil, no mortality events were reported by oyster farmers to date. The present study evaluated the effects of salinity (5, 20 and 35 psu) and temperature (15, 25 and 35 °C) on in vitro proliferation of P. marinus isolated from a host (C. rhizophorae) in Brazil, for a period of up to 15 days and after the return to the control conditions (22 days; recovery). Different cellular parameters (changes of cell phase's composition, cell density, viability and production of reactive oxygen species) were analysed using flow cytometry. The results indicate that the P. marinus isolate was sensitive to the extreme salinities and temperatures analysed. Only the highest temperature caused lasting cell damage under prolonged exposure, impairing P. marinus recovery, which is likely to be associated with oxidative stress. These findings will contribute to the understanding of the dynamics of perkinsiosis in tropical regions.


    EPA Science Inventory

    The progression of diseases caused by the oyster parasites, Perkinsus marinus and Haplosporidium nelsoni, were evaluated by periodic sampling (May 1994-Dec. 1995) of oysters, Crassostrea virginica, that set on an artificial reef located in the Piankatank River, Virginia, in Augus...


    EPA Science Inventory

    The progression of diseases caused by the oyster parasites, Perkinsus marinus and Haplosporidium nelsoni, were evaluated by periodic sampling (May 1994-Dec. 1995) of oysters, Crassostrea virginica, that set on an artificial reef located in the Piankatank River, Virginia, in Augus...

  11. Transient Expression of Plasmodium berghei MSP8 and HAP2 in the Marine Protozoan Parasite Perkinsus marinus.


    Cold, Emma R; Vasta, Gerardo R; Robledo, José A Fernández


    Perkinsus marinus is a protozoan parasite of molluscs that can be propagated in vitro in a defined culture medium, in the absence of host cells. We previously reported that P. marinus trophozoites can be transfected with high efficiency by electroporation using a plasmid based on MOE, a highly expressed gene, and proposed its potential use as a "pseudoparasite." This is a novel gene expression platform for parasites of medical relevance for which the choice of the surrogate organism is based on phylogenetic affinity to the parasite of interest, while taking advantage of the whole engineered surrogate organism as a vaccination adjuvant. Here we improved the original transfection plasmid by incorporating a multicloning site, an enterokinase recognition sequence upstream of GFP, and a His-tag and demonstrate its potential suitability for the heterologous expression of Plasmodium sp. genes relevant to the development of anti-malarial vaccines. Plasmodium berghei HAP2 and MSP8, currently considered candidate genes for a malaria vaccine, were cloned into p[MOE]:GFP, and the constructs were used to transfect P. marinus trophozoites. Within 48 hr of transfection we observed fluorescent cells indicating that the P. berghei genes fused to GFP were expressed. The expression appeared to be transient for both P. berghei genes, as florescence of the transfectants diminished gradually over time. Although this heterologous expression system will require optimization for integration and constitutive expression of Plasmodium genes, our results represent attainment of proof for the "pseudoparasite" concept we previously proposed, as we show that the engineered P. marinus system has the potential to become a surrogate system suitable for expression of Plasmodium spp. genes of interest, which could eventually be used as a malaria vaccine delivery platform. The aim of the present study was to test the ability of marine protozoan parasite P. marinus to express genes of P. berghei .

  12. Viability, infectivity and fatty acid synthetic activity of Perkinsus marinus meront cells incubated in estuarine and artificial seawater.


    Chu, Fu-Lin E; Lund, Eric D


    We investigated the viability and fatty acid synthetic activity of in vitro cultured Perkinsus marinus (Dermo) in lipid-free medium and estuarine water, and the infectivity of P. marinus maintained in artificial seawater (ASW). Viability and fatty acid synthetic activity in 7 d old P. marinus meronts maintained in lipid-free medium and estuarine water were tested. The infectivity of meronts incubated in ASW was examined by first incubating P. marinus meronts in ASW for 2, 3 or 7 d, and then inoculating viable ASW-incubated meronts into the shell cavity of individual oysters Crassostrea virginica. P. marinus infection prevalence and intensity in oysters were determined 9 wk post-inoculation. Heavy mortality occurred in meronts maintained in estuarine water, a drop from an initial value of 100% viable to 7.8 and 6.1% after 3 and 14 d incubation, respectively. Viability was 85 and 67% in meronts maintained in lipid-free medium for 3 and 24 d, respectively. Meronts kept in lipid-free medium for 14 d retained their ability to synthesize fatty acids. Viable meronts incubated in ASW remained infective for up to 7 d. The infection prevalences were 85, 48 and 100%, in the treatments inoculated with viable meronts that were incubated in ASW for 2, 3 and 7 d, respectively. Infection prevalence in the group inoculated with viable meronts immediately after they were transferred to ASW ranged from 61 to 85%. Our results suggest that in nature meronts can survive for at least 14 d outside the host. Viable meronts are not only infective, but are also able to replicate and retain their fatty acid synthetic ability for 7 d.

  13. Cloning and expression of a phloretin hydrolase gene from Eubacterium ramulus and characterization of the recombinant enzyme.


    Schoefer, Lilian; Braune, Annett; Blaut, Michael


    Phloretin hydrolase catalyzes the hydrolytic C-C cleavage of phloretin to phloroglucinol and 3-(4-hydroxyphenyl)propionic acid during flavonoid degradation in Eubacterium ramulus. The gene encoding the enzyme was cloned by screening a gene library for hydrolase activity. The insert of a clone conferring phloretin hydrolase activity was sequenced. Sequence analysis revealed an open reading frame of 822 bp (phy), a putative promoter region, and a terminating stem-loop structure. The deduced amino acid sequence of phy showed similarities to a putative protein of the 2,4-diacetylphloroglucinol biosynthetic operon from Pseudomonas fluorescens. The phloretin hydrolase was heterologously expressed in Escherichia coli and purified. The molecular mass of the native enzyme was approximately 55 kDa as determined by gel filtration. The results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the deduced amino acid sequence of phy indicated molecular masses of 30 and 30.8 kDa, respectively, suggesting that the enzyme is a homodimer. The recombinant phloretin hydrolase catalyzed the hydrolysis of phloretin to equimolar amounts of phloroglucinol and 3-(4-hydroxyphenyl)propionic acid. The optimal temperature and pH of the catalyzed reaction mixture were 37 degrees C and 7.0, respectively. The K(m) for phloretin was 13 +/- 3 microM and the k(cat) was 10 +/- 2 s(-1). The enzyme did not transform phloretin-2'-glucoside (phloridzin), neohesperidin dihydrochalcone, 1,3-diphenyl-1,3-propandione, or trans-1,3-diphenyl-2,3-epoxy-propan-1-one. The catalytic activity of the phloretin hydrolase was reduced by N-bromosuccinimide, o-phenanthroline, N-ethylmaleimide, and CuCl(2) to 3, 20, 35, and 85%, respectively. Phloroglucinol and 3-(4-hydroxyphenyl)propionic acid reduced the activity to 54 and 70%, respectively.

  14. Fermentation RS3 derived from sago and rice starch with Clostridium butyricum BCC B2571 or Eubacterium rectale DSM 17629.


    Purwani, Endang Yuli; Purwadaria, Tresnawati; Suhartono, Maggy Thenawidjaja


    Resistant starch type 3 (RS3) is retrograded starch which is not digested by human starch degrading enzyme, and will thus undergo bacterial degradation in the colon. The main fermentation products are the Short Chain Fatty Acid (SCFA): acetate, propionate and butyrate. SCFA has significant benefit impact on the metabolism of the host. The objectives of this research were to study the SCFA profile produced by colonic butyrate producing bacteria grown in medium containing RS3. RS3 was made from sago or rice starch treated with amylase, pullulanase and the combination of amylase and pullulanase. Fermentation study was performed by using Clostridium butyricum BCC B2571 or Eubacterium rectale DSM 17629, which has been identified as capable of degradation of starch residue and also regarded as beneficial bacteria. Experimental result revealed that enzyme hydrolysis of retrograded sago or rice starch was beneficial to RS formation. RS3 derived from sago contained higher RS (31-38%) than those derived from rice starch (21-26%). This study indicated that C. butyricum BCC B2571 produced acetate, propionate and butyrate at molar ratio of 1.8 : 1 : 1, when the medium was supplemented with RSSA at concentration 1%. In the medium containing similar substrate, E. rectale DSM 17629 produced acetate, propionate and butyrate at molar ratio of 1.7 : 1 : 1.2. High levels of acetate, propionate and butyrate at molar ratio of 1.8 : 1 : 1.1 was also produced by E. rectale DSM 17629 in medium supplemented with RSSP at concentration 1%. The results showed that both bacteria responded differently to the RS3 supplementation. Such result provided insight into the possibility of designing RS3 as prebiotic with featured regarding SCFA released in the human colon with potential health implication.

  15. Use of an industrial grade medium and medium enhancing effects on high cell density CO fermentation by Eubacterium limosum KIST612.


    Chang, In Seop; Kim, Daehee; Kim, Byung Hong; Lovitt, Robert W


    Studies were made on the composition of the growth medium to increase the cell concentration in a cell-recycled continuous culture (Eubacterium limosum KIST612) with carbon monoxide as a sole energy source using phosphate-buffered basal medium (PBBM) and modified PBBM. One of major limiting factors in PBBM might be nitrogen during the high cell density culture. This limitation could be overcome by increasing of inorganic nitrogen or yeast extract concentration in the medium. Anaerobic digester fluid, which could replace the organic nitrogen in PBBM, was used to develop an industrial grade medium for conversion of CO to multi-carbon compound.

  16. Molecular diversity, cultivation, and improved detection by fluorescent in situ hybridization of a dominant group of human gut bacteria related to Roseburia spp. or Eubacterium rectale.


    Aminov, Rustam I; Walker, Alan W; Duncan, Sylvia H; Harmsen, Hermie J M; Welling, Gjalt W; Flint, Harry J


    Phylogenetic analysis was used to compare 16S rRNA sequences from 19 cultured human gut strains of Roseburia and Eubacterium rectale with 356 related sequences derived from clone libraries. The cultured strains were found to represent five of the six phylotypes identified. A new oligonucleotide probe, Rrec584, and the previous group probe Rint623, when used in conjunction with a new helper oligonucleotide, each recognized an average of 7% of bacteria detected by the eubacterial probe Eub338 in feces from 10 healthy volunteers. Most of the diversity within this important group of butyrate-producing gut bacteria can apparently be retrieved through cultivation.

  17. Genetic signature analysis of Perkinsus marinus in Mexico suggests possible translocation from the Atlantic Ocean to the Pacific coast of Mexico.


    Ek-Huchim, Juan Pablo; Aguirre-Macedo, Ma Leopoldina; Améndola-Pimenta, Monica; Vidal-Martínez, Victor Manuel; Pérez-Vega, Juan Antonio; Simá-Alvarez, Raúl; Jiménez-García, Isabel; Zamora-Bustillos, Roberto; Rodríguez-Canul, Rossanna


    The protozoan Perkinsus marinus (Mackin, Owen & Collier) Levine, 1978 causes perkinsosis in the American oyster Crassostrea virginica Gmelin, 1791. This pathogen is present in cultured C. virginica from the Gulf of Mexico and has been reported recently in Saccostrea palmula (Carpenter, 1857), Crassostrea corteziensis (Hertlein, 1951) and Crassostrea gigas (Thunberg, 1793) from the Mexican Pacific coast. Transportation of fresh oysters for human consumption and repopulation could be implicated in the transmission and dissemination of this parasite across the Mexican Pacific coast. The aim of this study was two-fold. First, we evaluated the P. marinus infection parameters by PCR and RFTM (Ray's fluid thioglycollate medium) in C. virginica from four major lagoons (Términos Lagoon, Campeche; Carmen-Pajonal-Machona Lagoon complex, Tabasco; Mandinga Lagoon, Veracruz; and La Pesca Lagoon, Tamaulipas) from the Gulf of Mexico. Secondly, we used DNA sequence analyses of the ribosomal non-transcribed spacer (rNTS) region of P. marinus to determine the possible translocation of this species from the Gulf of Mexico to the Mexican Pacific coast. Perkinsus marinus prevalence by PCR was 57.7% (338 out of 586 oysters) and 38.2% (224 out of 586 oysters) by RFTM. The highest prevalence was observed in the Carmen-Pajonal-Machona Lagoon complex in the state of Tabasco (73% by PCR and 58% by RFTM) and the estimated weighted prevalence (WP) was less than 1.0 in the four lagoons. Ten unique rDNA-NTS sequences of P. marinus [termed herein the "P. marinus (Pm) haplotype"] were identified in the Gulf of Mexico sample. They shared 96-100% similarity with 18 rDNA-NTS sequences from the GenBank database which were derived from 16 Mexican Pacific coast infections and two sequences from the USA. The phylogenetic tree and the haplotype network showed that the P. marinus rDNA-NTS sequences from Mexico were distant from the rDNA-NTS sequences of P. marinus reported from the USA. The ten r

  18. Classification of lentic habitat for sea lamprey (Petromyzon marinus) larvae using a remote seabed classification device

    USGS Publications Warehouse

    Fodale, Michael F.; Bronte, Charles R.; Bergstedt, Roger A.; Cuddy, Douglas W.; Adams, Jean V.


    Lentic populations of larval sea lampreys (Petromyzon marinus) are suspected of being a major source of recruitment to parasitic stocks in some areas of the Great Lakes, and methods are needed to estimate habitat and population sizes. A deepwater electroshocker has been used to quantitatively assess larval sea lamprey populations in deepwater areas, however a method has not been developed to efficiently identify the most promising locations to sample in this environment. A remote seabed classification device (RoxAnn™) was used to identify soft substrates in a lentic area where sea lamprey larvae have been found in Batchawana Bay (Ontario) in eastern Lake Superior, and related those substrate types to larval distribution and occurrence. Presence of larvae was significantly related to substrate type, distance from the stream mouth, and slope of the lake bottom. Remote seabed classification would be a useful tool in the Sea Lamprey Control Program to identify the most promising locations to conduct larval surveys in lentic areas.

  19. Blood cell lineage in the sea lamprey, Petromyzon marinus (Pisces: Petromyzontidae)

    USGS Publications Warehouse

    Piavis, George W.; Hiatt, James L.


    Blood cell types of the sea lamprey, Petromyzon marinus, are described and identified and the lineage of mature circulating cells in peripheral blood is traced to blast cells in the hematopoietic fat body. The fat body appears to be the phylogenetic precursor of bone marrow in higher forms, since blood cells originate and begin maturation in this tissue. Experimental animals were injected first with a hematopoietic stimulant and then (at an experimentally determined time) with pertussis vaccine to release proliferated blood cells into peripheral blood. Peripheral blood for smears was collected by cardiac exsanguination; hematopoietic tissue was extirpated for imprints; and leucocyte preparations were made by a special technique. Blood cells of the sea lamprey are apparently products of at least four distinct blast cells, each of which has a 'one end' maturation process. Results of this investigation support the polyphyletic theory of blood cell formation.

  20. Development of the viscerocranial skeleton during embryogenesis of the sea lamprey, Petromyzon Marinus.


    Martin, Wendy M; Bumm, Lloyd A; McCauley, David W


    Evolution of the skeleton was a key transition in early vertebrates. Lampreys lack a mineralized skeleton but possess cartilaginous neurocranial and viscerocranial elements. In lampreys, the visceral skeleton develops as a fused branchial basket supporting the pharynx. Here, we have adapted Alcian blue staining of lamprey cartilage and show this method results in cartilage fluorescence that we used to describe development of the branchial skeleton in Petromyzon marinus between 17 and 63 days of development. We show that skeletal rods develop from condensations of flattened discoidal chondrocytes and may involve cellular intercalation. Lamprey trabecular, parachordal, and subchordal cartilages consist of aggregations of polygonal chondrocytes positioned on the ventral and lateral surfaces of the notochord. We speculate that morphological differences relate to functional differences in the cartilage. We show that differentiated skeletal rods are derived from neural crest. Finally, we show how branchial muscles intercalate with skeletal rods of the branchial basket. (c) 2009 Wiley-Liss, Inc.

  1. Genetic compatibility and hatching success in the sea lamprey (Petromyzon marinus)

    PubMed Central

    Rodríguez-Muñoz, Rolando; Tregenza, Tom


    Recent discussion of genetic benefits of polyandry and female mate choice has distinguished between two potential factors influencing offspring quality: (i) some males carry higher quality genes and (ii) males and females differ in their degree of genetic compatibility. We examined evidence for effects of good genes and genetic compatibility on embryonic survival of sea lamprey (Petromyzon marinus), a fish species with external fertilization that spawns in North Atlantic rivers. Using in vitro fertilization, we made all possible crosses among 10 males and 5 females collected in the spawning grounds. Male identity did not have any significant effect on hatching success. However, female identity and male×female interactions had a highly significant effect on hatching success. Our results suggest that genetic compatibility between male and female genomes plays an important role in embryo survival during the early stages of development in the sea lamprey. PMID:19049954

  2. Efficacy of animal anti-fertility compounds against sea lamprey (Petromyzon marinus) spermatozoa.


    Ciereszko, Andrzej; Babiak, Igor; Dabrowski, Konrad


    Sterile-male-release technique is currently used to control the sea lamprey (Petromyzon marinus) population in the Great Lakes. The chemosterilant (bisazir) used in this program is extremely hazardous; special safety measures are necessary when handling this chemical. Therefore, replacement of bisazir with safer agents is desirable. In this study, we examined the effects of low-toxicity compounds with previously described spermicidal activity (mainly against mammalian sperm) on motility and fertilizing ability of sea lamprey spermatozoa. Nonoxynol-9, benzalkonium chloride, zinc acetate, cupric chloride, cysteamine, tannic acid and propranolol were able to inhibit both sperm motility and fertilizing ability. Effective concentrations of these spermicides ranged from 0.15 to 1%. Therefore, they can be potentially used in further study directed at in vivo sterilization of male sea lampreys.

  3. Genetic compatibility and hatching success in the sea lamprey (Petromyzon marinus).


    Rodríguez-Muñoz, Rolando; Tregenza, Tom


    Recent discussion of genetic benefits of polyandry and female mate choice has distinguished between two potential factors influencing offspring quality: (i) some males carry higher quality genes and (ii) males and females differ in their degree of genetic compatibility. We examined evidence for effects of good genes and genetic compatibility on embryonic survival of sea lamprey (Petromyzon marinus), a fish species with external fertilization that spawns in North Atlantic rivers. Using in vitro fertilization, we made all possible crosses among 10 males and 5 females collected in the spawning grounds. Male identity did not have any significant effect on hatching success. However, female identity and male x female interactions had a highly significant effect on hatching success. Our results suggest that genetic compatibility between male and female genomes plays an important role in embryo survival during the early stages of development in the sea lamprey.

  4. Sequencing of the sea lamprey (Petromyzon marinus) genome provides insights into vertebrate evolution

    PubMed Central

    Smith, Jeramiah J; Kuraku, Shigehiro; Holt, Carson; Sauka-Spengler, Tatjana; Jiang, Ning; Campbell, Michael S; Yandell, Mark D; Manousaki, Tereza; Meyer, Axel; Bloom, Ona E; Morgan, Jennifer R; Buxbaum, Joseph D; Sachidanandam, Ravi; Sims, Carrie; Garruss, Alexander S; Cook, Malcolm; Krumlauf, Robb; Wiedemann, Leanne M; Sower, Stacia A; Decatur, Wayne A; Hall, Jeffrey A; Amemiya, Chris T; Saha, Nil R; Buckley, Katherine M; Rast, Jonathan P; Das, Sabyasachi; Hirano, Masayuki; McCurley, Nathanael; Guo, Peng; Rohner, Nicolas; Tabin, Clifford J; Piccinelli, Paul; Elgar, Greg; Ruffier, Magali; Aken, Bronwen L; Searle, Stephen MJ; Muffato, Matthieu; Pignatelli, Miguel; Herrero, Javier; Jones, Matthew; Brown, C Titus; Chung-Davidson, Yu-Wen; Nanlohy, Kaben G; Libants, Scot V; Yeh, Chu-Yin; McCauley, David W; Langeland, James A; Pancer, Zeev; Fritzsch, Bernd; de Jong, Pieter J; Zhu, Baoli; Fulton, Lucinda L; Theising, Brenda; Flicek, Paul; Bronner, Marianne E; Warren, Wesley C; Clifton, Sandra W; Wilson, Richard K; Li, Weiming


    Lampreys are representatives of an ancient vertebrate lineage that diverged from our own ~500 million years ago. By virtue of this deeply shared ancestry, the sea lamprey (P. marinus) genome is uniquely poised to provide insight into the ancestry of vertebrate genomes and the underlying principles of vertebrate biology. Here, we present the first lamprey whole-genome sequence and assembly. We note challenges faced owing to its high content of repetitive elements and GC bases, as well as the absence of broad-scale sequence information from closely related species. Analyses of the assembly indicate that two whole-genome duplications likely occurred before the divergence of ancestral lamprey and gnathostome lineages. Moreover, the results help define key evolutionary events within vertebrate lineages, including the origin of myelin-associated proteins and the development of appendages. The lamprey genome provides an important resource for reconstructing vertebrate origins and the evolutionary events that have shaped the genomes of extant organisms. PMID:23435085

  5. Neuropeptide Y family receptors Y1 and Y2 from sea lamprey, Petromyzon marinus.


    Xu, Bo; Lagman, David; Sundström, Görel; Larhammar, Dan


    The vertebrate gene family for neuropeptide Y (NPY) receptors expanded by duplication of the chromosome carrying the ancestral Y1-Y2-Y5 gene triplet. After loss of some duplicates, the ancestral jawed vertebrate had seven receptor subtypes forming the Y1 (including Y1, Y4, Y6, Y8), Y2 (including Y2, Y7) and Y5 (only Y5) subfamilies. Lampreys are considered to have experienced the same chromosome duplications as gnathostomes and should also be expected to have multiple receptor genes. However, previously only a Y4-like and a Y5 receptor have been cloned and characterized. Here we report the cloning and characterization of two additional receptors from the sea lamprey Petromyzon marinus. Sequence phylogeny alone could not with certainty assign their identity, but based on synteny comparisons of P. marinus and the Arctic lamprey, Lethenteron camtschaticum, with jawed vertebrates, the two receptors most likely are Y1 and Y2. Both receptors were expressed in human HEK293 cells and inositol phosphate assays were performed to determine the response to the three native lamprey peptides NPY, PYY and PMY. The three peptides have similar potencies in the nanomolar range for Y1. No obvious response to the three peptides was detected for Y2. Synteny analysis supports identification of the previously cloned receptor as Y4. No additional NPY receptor genes could be identified in the presently available lamprey genome assemblies. Thus, four NPY-family receptors have been identified in lampreys, orthologs of the same subtypes as in humans (Y1, Y2, Y4 and Y5), whereas many other vertebrate lineages have retained additional ancestral subtypes.

  6. Flow cytometric analysis of lectin binding to in vitro-cultured Perkinsus marinus surface carbohydrates

    USGS Publications Warehouse

    Gauthier, J.D.; Jenkins, J.A.; La Peyre, Jerome F.


    Parasite surface glycoconjugates are frequently involved in cellular recognition and colonization of the host. This study reports on the identification of Perkinsus marinus surface carbohydrates by flow cytometric analyses of fluorescein isothiocyanate-conjugated lectin binding. Lectin-binding specificity was confirmed by sugar inhibition and Kolmogorov-Smirnov statistics. Clear, measurable fluorescence peaks were discriminated, and no parasite autofluorescence was observed. Parasites (GTLA-5 and Perkinsus-1 strains) harvested during log and stationary phases of growth in a protein-free medium reacted strongly with concanavalin A and wheat germ agglutinin, which bind to glucose-mannose and N-acetyl-D-glucosamine (GlcNAc) moieties, respectively. Both P. marinus strains bound with lower intensity to Maclura pomifera agglutinin, Bauhinia purpurea agglutinin, soybean agglutinin (N-acetyl-D-galactosamine-specific lectins), peanut agglutinin (PNA) (terminal galactose specific), and Griffonia simplicifolia II (GlcNAc specific). Only background fluorescence levels were detected with Ulex europaeus agglutinin I (L-fucose specific) and Limulus polyphemus agglutinin (sialic acid specific). The lectin-binding profiles were similar for the 2 strains except for a greater relative binding intensity of PNA for Perkinsus-1 and an overall greater lectin-binding capacity of Perkinsus-1 compared with GTLA-5. Growth stage comparisons revealed increased lectin-binding intensities during stationary phase compared with log phase of growth. This is the first report of the identification of surface glycoconjugates on a Perkinsus spp. by flow cytometry and the first to demonstrate that differential surface sugar expression is growth phase and strain dependent. ?? American Society of Parasitologists 2004.

  7. Migratory-stage sea lamprey Petromyzon marinus stop responding to conspecific damage-released alarm cues after 4 h of continuous exposure in laboratory conditions

    USGS Publications Warehouse

    Imre, Istvan; Di Rocco, Richard T.; McClure, Haley; Johnson, Nicholas; Brown, Grant E.


    This study investigated the length of avoidance response of migratory-stage sea lamprey Petromyzon marinus exposed continuously to conspecific damage-released alarm cues for varying lengths of time in laboratory stream channels. Ten replicate groups of P. marinus, separated by sex, were exposed to either deionized water control or to P. marinus extract for 0, 2 or 4 h continuously. Petromyzon marinus maintained their avoidance response to the conspecific damage-released alarm cue after continuous exposure to the alarm cue for 0 and 2 h but not 4 h. Beyond being one of the first studies in regards to sensory–olfactory adaptation–acclimation of fishes to alarm cues of any kind, these results have important implications for use of conspecific alarm cues in P. marinus control. For example, continuous application of conspecific alarm cue during the day, when P. marinus are inactive and hiding, may result in sensory adaptation to the odour by nightfall when they migrate upstream.

  8. Differential cold-adaptation among protein components of the thioredoxin system in the psychrophilic eubacterium Pseudoalteromonas haloplanktis TAC 125.


    Cotugno, Roberta; Rosaria Ruocco, Maria; Marco, Salvatore; Falasca, Patrizia; Evangelista, Giovanna; Raimo, Gennaro; Chambery, Angela; Di Maro, Antimo; Masullo, Mariorosario; De Vendittis, Emmanuele


    Thioredoxin and thioredoxin reductase from the psychrophilic eubacterium Pseudoalteromonas haloplanktis were obtained as recombinant His-tagged proteins (rPhTrx and rPhTrxR, respectively). rPhTrxR is organised as a homodimeric flavoenzyme, whereas rPhTrx is a small monomeric protein, both containing a functional disulfide bridge. However, three additional cysteines are present as free thiols in purified rPhTrxR. When individually tested in specific assays, rPhTrxR and rPhTrx display a full activity at low temperatures, an indispensable requirement for cold-adapted proteins. In particular, rPhTrxR catalyses the NADPH dependent reduction of DTNB and rPhTrx provokes the insulin precipitation in the presence of DTT. The analysis of the effect of temperature on these reactions indicates that rPhTrxR is more cold-adapted than rPhTrx, having a higher psychrophilicity. The combined activity of rPhTrxR and rPhTrx, tested in a reconstituted assay containing NADPH as electrons donor and human insulin as the thioredoxin substrate, demonstrates a direct functional interaction between the purified recombinant components of the thioredoxin system of P. haloplanktis. Furthermore, the NADPH-dependent reduction of rPhTrx catalysed by rPhTrxR is fully reversible and allows the determination of its redox potential, whose value is in the range of other bacterial and archaeal thioredoxins. The analysis of the thermostability of rPhTrxR points to its discrete heat resistance. However, rPhTrx is much more heat resistant, with a half inactivation time of about 4 h at 95 degrees C. This exceptional heat resistance for a psychrophilic protein is significantly decreased by the reduction of the disulfide bridge of rPhTrx. Functionality, thermodependence and thermostability of the P. haloplanktis thioredoxin system point to the relevance of this key mechanism for the preservation of the reduced state of cytoplasmic proteins even in a cold-adapted source.

  9. Eubacterium pyruvativorans sp. nov., a novel non-saccharolytic anaerobe from the rumen that ferments pyruvate and amino acids, forms caproate and utilizes acetate and propionate.


    Wallace, R J; McKain, N; McEwan, N R; Miyagawa, E; Chaudhary, L C; King, T P; Walker, N D; Apajalahti, J H A; Newbold, C J


    Two similar gram-positive rods were isolated from 10(-6) dilutions of ruminal fluid from a sheep receiving a mixed grass hay/concentrate diet, using a medium containing pancreatic casein hydrolysate as sole source of carbon and energy. The isolates did not ferment sugars, but grew on pyruvate or trypticase, forming caproate as the main fermentation product and valerate to a lesser extent. Acetate and propionate were utilized. One of these strains, I-6T, was selected for further study. Strain I-6T was a non-motile coccal rod, 1.2 x 0.4 microm, with a gram-positive cell wall ultrastructure and a G + C content of 56.8 mol%. No spores were visible, and strain I-6T did not survive heating at 80 degrees C for 10 min. Its rate of NH3 production was 375 nmol (mg protein)(-1) min(-1), placing it in the 'ammonia-hyperproducing' (or HAP) group of ruminal bacteria. 16S rDNA sequence analysis (1296 bases) indicated that it represents a novel species within the 'low-G + C' gram-positive group, for which the name Eubacterium pyruvativorans sp. nov. is proposed. Among cultivated bacteria, strain I-6T was most closely related (89% identity) to other asaccharolytic Eubacterium isolates from the mouth and the rumen. It was 98% identical to uncultured bacterial sequences amplified by others from ruminal digesta.

  10. A review of current state of knowledge concerning Perkinsus marinus effects on Crassostrea virginica (Gmelin) (the eastern oyster).


    Smolowitz, R


    The eastern oyster, Crassostrea virginica (Gmelin), is both an important component of our estuaries and an important farmed food animal along the east and south coasts of the United States. Its populations have been significantly diminished in the wild due to decades of overfishing beginning in the 1890 s. Unfortunately, in 1950, a new disease in eastern oysters caused by the protistan agent, Perkinsus marinus, was identified. The disease, resulting from infection with this protozoan, leads to high mortality of both wild and cultured eastern oysters. Current restoration efforts are hampered by the disease, as is the aquaculture of this economically important food. The parasite infects hemocytes and causes hemolytic anemia and general degeneration of the tissues, leading to death. Ongoing research efforts are attempting to develop oysters resistant to the disease. Transport regulations exist in may states. Infection with P. marinus is listed as a reportable disease by the World Health Organization.

  11. Mortality and toxin bioaccumulation in Bufo marinus following exposure to Cylindrospermopsis raciborskii cell extracts and live cultures.


    White, S H; Duivenvoorden, L J; Fabbro, L D; Eaglesham, G K


    Cylindrospermopsis raciborskii is a cyanobacterium responsible for the production of the toxin, cylindrospermopsin (CYN). Tadpoles of the cane toad Bufo marinus were exposed to freeze-thawed whole cell extracts or live cultures of C. raciborskii containing maximum CYN concentrations of 400 microg L-1 or 232 microg L-1, respectively. Exposure to live culture treatment solutions resulted in up to 66% mortality of B. marinus, whereas tadpoles exposed to whole cell extracts containing similar toxin concentrations survived. Decreases in relative growth rates and time spent for swimming were recorded from tadpoles during both types of exposure regimes. Bioconcentration of CYN was not evident following exposure to whole cell extracts containing extracellular toxin. In contrast exposure to live cultures, which contained cell-bound toxin, resulted in maximum average tissue concentrations of 895 microg free-CYN kg-1 fresh weight. This is the first investigation of C. raciborskii exposure effects and toxin bioaccumulation in the developmental stages of an amphibian.

  12. Epizootiology of Perkinsus marinus, parasite of the pleasure oyster Crassostrea corteziensis, in the Pacific coast of Mexico.


    Cáceres-Martínez, Jorge; Madero-López, Luis Humberto; Padilla-Lardizábal, Gloria; Vásquez-Yeomans, Rebeca


    The protozoan parasite Perkinsus marinus is the etiological agent of "dermo disease". This pathogen is considered by the World Organization for Animal Health (OIE) as reportable due to the high mortalities that it produces in the eastern oyster Crassostrea virginica in the US. In 2006, this parasite was detected in the pleasure oyster Crassostrea corteziensis in Nayarit on the Pacific coast of Mexico, indicating a new host and an extension of its known distribution. Epizootiological data of P. marinus in the pleasure oyster are unknown. With the objective of determining the prevalence and intensity in relation with temperature and salinity throughout time, as well as for studying interactions of host size and sex with the parasite, a monthly sampling was carried out in two aquaculture sites of Nayarit from 2007 to 2014. A total of 7700 oysters were analyzed. In both localities, prevalence was low in winter (<6%) when temperature and salinity fluctuated around 24°C and 33, respectively; and the highest prevalence values occurred during summer (37%) when temperature and salinity were around 30°C and 20, respectively. Infection intensity increased in summer, but severe cases remained on average <10%. Larger oysters showed the highest prevalence and intensity, and higher prevalence were generally observed in females. No unusual mortalities directly related with P. marinus were observed. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Humanized HLA-DR4 Mice Fed with the Protozoan Pathogen of Oysters Perkinsus Marinus (Dermo) Do Not Develop Noticeable Pathology but Elicit Systemic Immunity

    PubMed Central

    Kleschenko, Yuliya; Pow-Sang, Luis; Brumeanu, Teodor D.; Villasante, Eileen Franke; Vasta, Gerardo R.; Fernández-Robledo, José-Antonio; Casares, Sofia


    Perkinsus marinus (Phylum Perkinsozoa) is a marine protozoan parasite responsible for “Dermo” disease in oysters, which has caused extensive damage to the shellfish industry and estuarine environment. The infection prevalence has been estimated in some areas to be as high as 100%, often causing death of infected oysters within 1–2 years post-infection. Human consumption of the parasites via infected oysters is thus likely to occur, but to our knowledge the effect of oral consumption of P. marinus has not been investigated in humans or other mammals. To address the question we used humanized mice expressing HLA-DR4 molecules and lacking expression of mouse MHC-class II molecules (DR4.EA0) in such a way that CD4 T cell responses are solely restricted by the human HLA-DR4 molecule. The DR4.EA0 mice did not develop diarrhea or any detectable pathology in the gastrointestinal tract or lungs following single or repeated feedings with live P. marinus parasites. Furthermore, lymphocyte populations in the gut associated lymphoid tissue and spleen were unaltered in the parasite-fed mice ruling out local or systemic inflammation. Notably, naïve DR4.EA0 mice had antibodies (IgM and IgG) reacting against P. marinus parasites whereas parasite specific T cell responses were undetectable. Feeding with P. marinus boosted the antibody responses and stimulated specific cellular (IFNγ) immunity to the oyster parasite. Our data indicate the ability of P. marinus parasites to induce systemic immunity in DR4.EA0 mice without causing noticeable pathology, and support rationale grounds for using genetically engineered P. marinus as a new oral vaccine platform to induce systemic immunity against infectious agents. PMID:24498105

  14. Humanized HLA-DR4 mice fed with the protozoan pathogen of oysters Perkinsus marinus (Dermo) do not develop noticeable pathology but elicit systemic immunity.


    Wijayalath, Wathsala; Majji, Sai; Kleschenko, Yuliya; Pow-Sang, Luis; Brumeanu, Teodor D; Villasante, Eileen Franke; Vasta, Gerardo R; Fernández-Robledo, José-Antonio; Casares, Sofia


    Perkinsus marinus (Phylum Perkinsozoa) is a marine protozoan parasite responsible for "Dermo" disease in oysters, which has caused extensive damage to the shellfish industry and estuarine environment. The infection prevalence has been estimated in some areas to be as high as 100%, often causing death of infected oysters within 1-2 years post-infection. Human consumption of the parasites via infected oysters is thus likely to occur, but to our knowledge the effect of oral consumption of P. marinus has not been investigated in humans or other mammals. To address the question we used humanized mice expressing HLA-DR4 molecules and lacking expression of mouse MHC-class II molecules (DR4.EA(0)) in such a way that CD4 T cell responses are solely restricted by the human HLA-DR4 molecule. The DR4.EA(0) mice did not develop diarrhea or any detectable pathology in the gastrointestinal tract or lungs following single or repeated feedings with live P. marinus parasites. Furthermore, lymphocyte populations in the gut associated lymphoid tissue and spleen were unaltered in the parasite-fed mice ruling out local or systemic inflammation. Notably, naïve DR4.EA(0) mice had antibodies (IgM and IgG) reacting against P. marinus parasites whereas parasite specific T cell responses were undetectable. Feeding with P. marinus boosted the antibody responses and stimulated specific cellular (IFNγ) immunity to the oyster parasite. Our data indicate the ability of P. marinus parasites to induce systemic immunity in DR4.EA(0) mice without causing noticeable pathology, and support rationale grounds for using genetically engineered P. marinus as a new oral vaccine platform to induce systemic immunity against infectious agents.

  15. Behavioural and transcriptional changes in the amphipod Echinogammarus marinus exposed to two antidepressants, fluoxetine and sertraline.


    Bossus, Maryline C; Guler, Yasmin Z; Short, Stephen J; Morrison, Edward R; Ford, Alex T


    In the past decade, there have been increasing concerns over the effects of pharmaceutical compounds in the aquatic environment, however very little is known about the effects of antidepressants such as the selective serotonin re-uptake inhibitors (SSRIs). Many biological functions within invertebrates are under the control of serotonin, such as reproduction, metabolism, moulting and behaviour. The effects of serotonin and fluoxetine have recently been shown to alter the behaviour of the marine amphipod, Echinogammarus marinus (Leach, 1815). The purpose of this study was to observe behavioural and transcriptional modifications in this crustacean exposed to the two most prescribed SSRIs (fluoxetine and sertraline) and to develop biomarkers of neurological endocrine disruption. The animals were exposed to both drugs at environmentally relevant concentrations from 0.001 to 1μg/L during short-term (1h and 1day) and medium-term (8 days) experiments. The movement of the amphipods was tracked using the behavioural analysis software during 12min alternating dark/light conditions. The behavioural analysis revealed a significant effect on velocity which was observed after 1h exposure to sertraline at 0.01μg/L and after 1 day exposure to fluoxetine as low as 0.001μg/L. The most predominant effect of drugs on velocity was recorded after 1 day exposure for the 0.1 and 0.01μg/L concentrations of fluoxetine and sertraline, respectively. Subsequently, the expression (in this article gene expression is taken to represent only transcription, although it is acknowledged that gene expression can also be regulated at translation, mRNA and protein stability levels) of several E. marinus neurological genes, potentially involved in the serotonin metabolic pathway or behaviour regulation, were analysed in animals exposed to various SSRIs concentrations using RT-qPCR. The expression of a tryptophan hydroxylase (Ph), a neurocan core protein (Neuc), a Rhodopsin (Rhod1) and an Arrestin

  16. Myofibril Changes in the Copepod Pseudodiaptomus marinus Exposed to Haline and Thermal Stresses.


    Ibrahim, Ali; Souissi, Anissa; Leray, Aymeric; Héliot, Laurent; Vandenbunder, Bernard; Souissi, Sami


    Copepods are small crustaceans capable to survive in various aquatic environments. Their responses to changes in different external factors such as salinity and temperature can be observed at different integration levels from copepod genes to copepod communities. Until now, no thorough observation of the temperature or salinity effect stresses on copepods has been done by optical microscopy. In this study, we used autofluorescence to visualize these effects on the morphology of the calanoid copepod Pseudodiaptomus marinus maintained during several generations in the laboratory at favorable and stable conditions of salinity (30 psu) and temperature (18°C). Four different stress experiments were conducted: at a sharp decrease in temperature (18 to 4°C), a moderate decrease in salinity (from 30 to 15 psu), a major decrease in salinity (from 30 to 0 psu), and finally a combined stress with a decrease in both temperature and salinity (from 18°C and 30 psu to 4°C and 0 psu). After these stresses, images acquired by confocal laser scanning microscopy (CLSM) revealed changes in copepod cuticle and muscle structure. Low salinity and/or temperature stresses affected both the detection of fluorescence emitted by muscle sarcomeres and the distance between them. In the remaining paper we will use the term sarcomeres to describe the elements located within sarcomeres and emitted autofluorescence signals. Quantitative study showed an increase in the average distance between two consecutive sarcomeres from 2.06 +/- 0.11 μm to 2.44 +/- 0.42 μm and 2.88 +/- 0.45μm after the exposure to major haline stress (18°C, 0 psu) and the combined stress (4°C, 0 psu), respectively. These stresses also caused cuticle cracks which often occurred at the same location, suggesting the cuticle as a sensitive area for osmoregulation. Our results suggest the use of cuticular and muscle autofluorescence as new biomarkers of stress detectable in formalin-preserved P. marinus individuals. Our

  17. Myofibril Changes in the Copepod Pseudodiaptomus marinus Exposed to Haline and Thermal Stresses

    PubMed Central

    Ibrahim, Ali; Souissi, Anissa; Leray, Aymeric; Héliot, Laurent; Vandenbunder, Bernard; Souissi, Sami


    Copepods are small crustaceans capable to survive in various aquatic environments. Their responses to changes in different external factors such as salinity and temperature can be observed at different integration levels from copepod genes to copepod communities. Until now, no thorough observation of the temperature or salinity effect stresses on copepods has been done by optical microscopy. In this study, we used autofluorescence to visualize these effects on the morphology of the calanoid copepod Pseudodiaptomus marinus maintained during several generations in the laboratory at favorable and stable conditions of salinity (30 psu) and temperature (18°C). Four different stress experiments were conducted: at a sharp decrease in temperature (18 to 4°C), a moderate decrease in salinity (from 30 to 15 psu), a major decrease in salinity (from 30 to 0 psu), and finally a combined stress with a decrease in both temperature and salinity (from 18°C and 30 psu to 4°C and 0 psu). After these stresses, images acquired by confocal laser scanning microscopy (CLSM) revealed changes in copepod cuticle and muscle structure. Low salinity and/or temperature stresses affected both the detection of fluorescence emitted by muscle sarcomeres and the distance between them. In the remaining paper we will use the term sarcomeres to describe the elements located within sarcomeres and emitted autofluorescence signals. Quantitative study showed an increase in the average distance between two consecutive sarcomeres from 2.06 +/- 0.11 μm to 2.44 +/- 0.42 μm and 2.88 +/- 0.45μm after the exposure to major haline stress (18°C, 0 psu) and the combined stress (4°C, 0 psu), respectively. These stresses also caused cuticle cracks which often occurred at the same location, suggesting the cuticle as a sensitive area for osmoregulation. Our results suggest the use of cuticular and muscle autofluorescence as new biomarkers of stress detectable in formalin-preserved P. marinus individuals. Our

  18. Prevalence of Perkinsus marinus (dermo), Haplosporidium nelsoni (MSX), and QPX in bivalves of Delaware's inland bays and quantitative, high-throughput diagnosis of dermo by QPCR.


    Ulrich, Paul N; Ewart, John W; Marsh, Adam G


    Restoration of oyster reef habitat in the Inland Bays of Delaware was accompanied by an effort to detect and determine relative abundance of the bivalve pathogens Perkinsus marinus, Haplosporidium nelsoni, and QPX. Both the oyster Crassostrea virginica and the clam Mercenaria mercenaria were sampled from the bays. In addition, oysters were deployed at eight sites around the bays as sentinels for the three parasites. Perkinsus marinus prevalence was measured with a real-time, quantitative polymerase chain reaction (PCR) methodology that enabled high-throughput detection of as few as 31 copies of the ribosomal non-transcribed spacer region in 500 ng oyster DNA. The other pathogens were assayed using PCR with species-specific primers. Perkinsus marinus was identified in Indian River Bay at moderate prevalence ( approximately 40%) in both an artificial reef and a wild oyster population whereas sentinel oysters were PCR-negative after 3-months exposure during summer and early fall. Haplosporidium nelsoni was restricted to one oyster deployed in Little Assawoman Bay. QPX and P. marinus were not detected among wild clams. While oysters in these bays have historically been under the greatest threat by MSX, it is apparent that P. marinus currently poses a greater threat to recovery of oyster aquaculture in Delaware's Inland Bays.

  19. First report of the protozoan parasite Perkinsus marinus in South America, infecting mangrove oysters Crassostrea rhizophorae from the Paraíba River (NE, Brazil).


    da Silva, Patricia Mirella; Vianna, Rogério Tubino; Guertler, Cristhiane; Ferreira, Liana Pinho; Santana, Lucas Nunes; Fernández-Boo, Sergio; Ramilo, Andrea; Cao, Asunción; Villalba, Antonio


    The present work aimed to study the infection by Perkinsus sp. in the mangrove oysters Crassostrea rhizophorae from the estuary of the Paraíba River (Paraíba State, Brazil). Perkinsosis was detected by incubation of oyster gill pieces in Ray's fluid thioglycollate medium. The monthly prevalence values were all above 70%, thus infection was not likely to be a transient event. Perkinsus sp. parasites isolated from eight oysters were propagated in vitro. PCR-RFLP analysis of in vitro cultured cells as well as the sequences of the rDNA ITS region allowed the identification of the in vitro propagated parasites as Perkinsus marinus. Phylogenetic analyses using rDNA ITS region sequences strongly supported the Perkinsus sp. from Paraíba in a monophyletic group with P. marinus. Thus, the results confirmed the species affiliation of Paraíba Perkinsus sp. as P. marinus. This is the first report of P. marinus in Brazil and South America and the first report of P. marinus naturally infecting C. rhizophorae. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Overproduction, purification, crystallization and preliminary X-ray characterization of a novel carbohydrate-binding module of endoglucanase Cel5A from Eubacterium cellulosolvens.


    Luís, Ana S; Alves, Victor D; Romão, Maria J; Prates, José A M; Fontes, Carlos M G A; Najmudin, Shabir


    The anaerobic cellulolytic rumen bacterium Eubacterium cellulosolvens produces a large array of cellulases and hemicellulases that are responsible for the hydrolysis of plant cell-wall polysaccharides. One of these enzymes, endoglucanase Cel5A, comprises two tandemly repeated novel carbohydrate-binding modules (CBMs) and two catalytic domains belonging to glycoside hydrolase family 5 joined by flexible linker sequences. The novel CBM located at the N-terminus of the endoglucanase has been crystallized. The crystals belonged to the hexagonal space group P6(1)22 and contained a single molecule in the asymmetric unit. The structure of the L-selenomethionine derivative has been solved by a MAD experiment on crystals that diffracted to 1.75 Å resolution.

  1. Classification of sea lamprey (Petromyzon marinus) attack marks on Great Lakes lake trout (Salvelinus namaycush)

    USGS Publications Warehouse

    King, Everett Louis


    Criteria for the classification of marks inflicted by sea lamprey (Petromyzon marinus) into nine categories were developed from laboratory studies in an attempt to refine the classification system used in field assessment work. These criteria were based on characteristics of the attachment site that could be identified under field conditions by unaided visual means and by touching the attachment site. Healing of these marks was somewhat variable and was influenced by the size of lamprey, duration of attachment, severity of the wound at lamprey detachment, season and water temperature, and by other less obvious factors. Even under laboratory conditions staging of some wounds was difficult, especially at low water temperatures. If these criteria are to be used effectively and with precision in the field, close examination of individual fish may be required. If the feeding and density of specific year-classes of sea lampreys are to be accurately assessed on an annual basis, close attention to the wound size (as it reflects the size of the lamprey's oral disc) and character of wounds on fish will be required as well as consideration of the season of the year in which they are observed.Key words: sea lamprey, attack marks, lake trout, Great Lakes

  2. Olfactory-mediated stream-finding behavior of migratory adult sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Vrieze, L.A.; Bergstedt, R.A.; Sorensen, P.W.


    Stream-finding behavior of adult sea lamprey (Petromyzon marinus), an anadromous fish that relies on pheromones to locate spawning streams, was documented in the vicinity of an important spawning river in the Great Lakes. Untreated and anosmic migrating sea lampreys were implanted with acoustic transmitters and then released outside the Ocqueoc River. Lampreys swam only at night and then actively. When outside of the river plume, lampreys pursued relatively straight bearings parallel to the shoreline while making frequent vertical excursions. In contrast, when within the plume, lampreys made large turns and exhibited a weak bias towards the river mouth, which one-third of them entered. The behavior of anosmic lampreys resembled that of untreated lampreys outside of the plume, except they pursued a more northerly compass bearing. To locate streams, sea lampreys appear to employ a three-phase odor-mediated strategy that involves an initial search along shorelines while casting vertically, followed by river-water-induced turning that brings them close to the river's mouth, which they then enter using rheotaxis. This novel strategy differs from that of salmonids and appears to offer this poor swimmer adaptive flexibility and suggests ways that pheromonal odors might be used to manage this invasive species.

  3. A synthesized mating pheromone component increases adult sea lamprey (Petromyzon marinus) trap capture in management scenarios

    USGS Publications Warehouse

    Johnson, Nicholas S.; Siefkes, Michael J.; Wagner, C. Michael; Dawson, Heather; Wang, Huiyong; Steeves, Todd; Twohey, Michael; Li, Weiming


    Application of chemical cues to manipulate adult sea lamprey (Petromyzon marinus) behavior is among the options considered for new sea lamprey control techniques in the Laurentian Great Lakes. A male mating pheromone component, 7a,12a,24-trihydroxy-3-one-5a-cholan-24-sulfate (3kPZS), lures ovulated female sea lamprey upstream into baited traps in experimental contexts with no odorant competition. A critical knowledge gap is whether this single pheromone component influences adult sea lamprey behavior in management contexts containing free-ranging sea lampreys. A solution of 3kPZS to reach a final in-stream concentration of 10-12 mol·L-1 was applied to eight Michigan streams at existing sea lamprey traps over 3 years, and catch rates were compared between paired 3kPZS-baited and unbaited traps. 3kPZS-baited traps captured significantly more sexually immature and mature sea lampreys, and overall yearly trapping efficiency within a stream averaged 10% higher during years when 3kPZS was applied. Video analysis of a trap funnel showed that the likelihood of sea lamprey trap entry after trap encounter was higher when the trap was 3kPZS baited. Our approach serves as a model for the development of similar control tools for sea lamprey and other aquatic invaders.

  4. A new clarification method to visualize biliary degeneration during liver metamorphosis in Sea Lamprey (Petromyzon marinus).


    Chung-Davidson, Yu-Wen; Davidson, Peter J; Scott, Anne M; Walaszczyk, Erin J; Brant, Cory O; Buchinger, Tyler; Johnson, Nicholas S; Li, Weiming


    Biliary atresia is a rare disease of infancy, with an estimated 1 in 15,000 frequency in the southeast United States, but more common in East Asian countries, with a reported frequency of 1 in 5,000 in Taiwan. Although much is known about the management of biliary atresia, its pathogenesis is still elusive. The sea lamprey (Petromyzon marinus) provides a unique opportunity to examine the mechanism and progression of biliary degeneration. Sea lamprey develop through three distinct life stages: larval, parasitic, and adult. During the transition from larvae to parasitic juvenile, sea lamprey undergo metamorphosis with dramatic reorganization and remodeling in external morphology and internal organs. In the liver, the entire biliary system is lost, including the gall bladder and the biliary tree. A newly-developed method called "CLARITY" was modified to clarify the entire liver and the junction with the intestine in metamorphic sea lamprey. The process of biliary degeneration was visualized and discerned during sea lamprey metamorphosis by using laser scanning confocal microscopy. This method provides a powerful tool to study biliary atresia in a unique animal model.

  5. Response of larval sea lampreys (Petromyzon marinus) to pulsed DC electrical stimuli in laboratory experiments

    USGS Publications Warehouse

    Bowen, Anjanette K.; Weisser, John W.; Bergstedt, Roger A.; Famoye, Felix


    Four electrical factors that are used in pulsed DC electrofishing for larval sea lampreys (Petromyzon marinus) were evaluated in two laboratory studies to determine the optimal values to induce larval emergence over a range of water temperatures and conductivities. Burrowed larvae were exposed to combinations of pulsed DC electrical factors including five pulse frequencies, three pulse patterns, and two levels of duty cycle over a range of seven voltage gradients in two separate studies conducted at water temperatures of 10, 15, and 20°C and water conductivities of 25, 200, and 900 μS/cm. A four-way analysis of variance was used to determine significant (α = 0.05) influences of each electrical factor on larval emergence. Multiple comparison tests with Bonferroni adjustments were used to determine which values of each factor resulted in significantly higher emergence at each temperature and conductivity. Voltage gradient and pulse frequency significantly affected emergence according to the ANOVA model at each temperature and conductivity tested. Duty cycle and pulse pattern generally did not significantly influence the model. Findings suggest that a setting of 2.0 V/cm, 3 pulses/sec, 10% duty, and 2:2 pulse pattern seems the most promising in waters of medium conductivity and across a variety of temperatures. This information provides a basis for understanding larval response to pulsed DC electrofishing gear factors and identifies electrofisher settings that show promise to increase the efficiency of the gear during assessments for burrowed sea lamprey larvae.

  6. Interseasonal variation in blood concentrations of organochlorines in great black-backed gulls (Larus marinus).


    Bustnes, Jan Ove; Skaare, Janneche Utne; Berg, Vidar; Tveraa, Torkild


    In two subsequent breeding seasons (2001 and 2002), we measured 12 organochlorines (OCs), including hexachlorobenzene (HCB), beta-hexachlorocyclohexane (beta-HCH), p,p'-dichlorodiphenyldichloroethylene (DDE), oxychlordane, and eight polychlorinated biphenyl congeners (PCBs), in the blood of the same 25 great black-backed gulls (Larus marinus). The wet-weight concentrations of different OCs in the blood decreased between 45 and 60% from 2001 to 2002. The main reasons for this were lower blood-lipid concentrations and higher body condition in 2002 compared to 2001. The differences in blood lipids and body condition probably resulted from changes in the availability of different prey types between the years. Despite the variation in the blood concentrations of OCs, there was a high predictability of the relative relationship among individuals between the years, especially for the most-persistent compounds (persistent PCBs, oxychlordane, and DDE); that is, individuals with high levels in 2001 still had relatively high levels compared to other individuals in 2002. This suggests that a concentration obtained from a single blood sample is a relatively reliable measurement of OC burdens for individual great black-backed gulls compared to other individuals, independent of changes in mean OC levels within the population. However, by including information about the nutritional status of individuals, more precise interference from samples in different years and locations may be made. Moreover, the great seasonal variation in OC levels within individuals may have implications for how OC monitoring should be conducted in gull populations.

  7. Mark-recapture population estimates of parasitic sea lampreys (Petromyzon marinus) in Lake Huron

    USGS Publications Warehouse

    Bergstedt, Roger A.; McDonald, Rodney B.; Mullett, Katherine M.; Wright, Gregory M.; Swink, William D.; Burnham, Kenneth P.


    Metamorphosed sea lampreys (Petromyzon marinus) were collected and marked at two points in their life cycle. Recently metamorphosed juveniles were collected from streams, marked with coded wire tags, and returned to migrate to the Great Lakes. Juveniles already in the lakes and feeding on teleost hosts were obtained from incidental catches by sport or commercial fisheries. Sea lampreys in the Great Lakes spend only 1 feeding year as parasites, and marked animals were recaptured during the spawning runs. For one marked group in each of four parasitic cohorts (feeding years 1991 to 1994) and two marked groups in each of three cohorts (feeding years 1998 to 2000) we recovered from 1.1 to 10.2 percent of marked animals. The number of metamorphosed animals present in autumn before migration to Lake Huron was estimated for five cohorts, with estimates ranging from 639 to 803 thousand. The number of feeding, parasitic animals present in Lake Huron in mid summer was estimated for five cohorts, with estimates ranging from 515,000 to 2,342,000. The larger estimates later in the parasitic year suggested that animals collected and marked from sport or commercial fisheries did not survive at the same rate as unmarked animals. It is recommended that only estimates from recaptures of animals marked in the streams before migration be used until it can be established why survival of juveniles obtained from sport or commercial fisheries might be affected.

  8. Chemosterilization of male sea lampreys (Petromyzon marinus) does not affect sex pheromone release

    USGS Publications Warehouse

    Siefkes, Michael J.; Bergstedt, Roger A.; Twohey, Michael B.; Li, Weiming


    Release of males sterilized by injection with bisazir is an important experimental technique in management of sea lamprey (Petromyzon marinus), an invasive, nuisance species in the Laurentian Great Lakes. Sea lampreys are semelparous and sterilization can theoretically eliminate a male's reproductive capacity and, if the ability to obtain mates is not affected, waste the sex products of females spawning with him. It has been demonstrated that spermiating males release a sex pheromone that attracts ovulating females. We demonstrated that sterilized, spermiating males also released the pheromone and attracted ovulating females. In a two-choice maze, ovulating females increased searching behavior and spent more time in the side of the maze containing chemical stimuli from sterilized, spermiating males. This attraction response was also observed in spawning stream experiments. Also, electro-olfactograms showed that female olfactory organs were equally sensitive to chemical stimuli from sterilized and nonsterilized, spermiating males. Finally, fast atom bombardment mass spectrometry showed that extracts from water conditioned with sterilized and nonsterilized, spermiating males contained the same pheromonal molecule at similar levels. We concluded that injection of bisazir did not affect the efficacy of sex pheromone in sterilized males.

  9. Effects of sex pheromones and sexual maturation on locomotor activity in female sea lamprey (Petromyzon marinus).


    Walaszczyk, Erin J; Johnson, Nicholas S; Steibel, Juan Pedro; Li, Weiming


    Synchronization of male and female locomotor rhythmicity can play a vital role in ensuring reproductive success. Several physiological and environmental factors alter these locomotor rhythms. As sea lamprey, Petromyzon marinus, progress through their life cycle, their locomotor activity rhythm changes multiple times. The goal of this study was to elucidate the activity patterns of adult female sea lamprey during the sexual maturation process and discern the interactions of these patterns with exposure to male pheromones. During these stages, preovulated and ovulated adult females are exposed to sex pheromone compounds, which are released by spermiated males and attract ovulated females to the nest for spawning. The locomotor behavior of adult females was monitored in a natural stream with a passive integrated tag responder system as they matured, and they were exposed to a sex pheromone treatment (spermiated male washings) or a control (prespermiated male washings). Results showed that, dependent on the hour of day, male sex pheromone compounds reduce total activity (p < 0.05) and cause increases in activity during several daytime hours in preovulated and ovulated females. These results are one of the first examples of how sex pheromones modulate a locomotor rhythm in a vertebrate, and they suggest that the interaction between maturity stage and sex pheromone exposure contributes to the differential locomotor rhythms found in adult female sea lamprey. This phenomenon may contribute to the reproductive synchrony of mature adults, thus increasing reproductive success in this species.

  10. Male sea lampreys, Petromyzon marinus L., excrete a sex pheromone from gill epithelia.


    Siefkes, Michael J; Scott, Alexander P; Zielinski, Barbara; Yun, Sang-Seon; Li, Weiming


    During the period when they are producing sperm, male sea lampreys (Petromyzon marinus L.) release a sex pheromone 7alpha, 12alpha, 24-trihydroxy-5alpha-cholan-3-one-24-sulfate (3 keto-petromyzonol sulfate, 3ketoPZS) that induces search and preference behaviors in ovulating females. In this study, we conducted a series of experiments to demonstrate that release of this pheromone into water takes place exclusively through the gills. In a behavioral maze, water conditioned with the anterior region of spermiating males induced an increase of search and preference behaviors in ovulating females. Similar behavior was not elicited by water conditioned by the posterior region. The anterior region washings and whole-body washings from spermiating males also elicited large and virtually identical electro-olfactogram responses from female sea lampreys, while the posterior washings produced negligible responses. Further, mass spectrometry and immunoassay confirmed that virtually all the 3ketoPZS released into water was through the gills. Immunocytochemistry revealed some gill epithelial cells and hepatocytes from spermiating males contained dense immunoreactive 3ketoPZS, but not those from prespermiating males. These results demonstrate that 3ketoPZS is released through the gill epithelia and suggest that this pheromone or its precursor may be produced in the liver.

  11. Developmental transformations in a normal series of embryos of the sea lamprey Petromyzon marinus (Linnaeus).


    Richardson, Michael K; Wright, Glenda M


    Lamprey development is of interest to evolutionary biologists because it can inform our understanding of primitive vertebrate developmental patterns. In this study, we describe and illustrate some of the principle landmarks of organogenesis in the embryonic sea lamprey Petromyzon marinus L. at different chronological ages. We examined 63 fixed embryos spanning Piavis developmental stages 11-18+ (5-70 days postfertilization) by gross observation and histology. This period begins at late neurulation stages and ends with the formation of the larva (ammocoete). A significant difference with some previous accounts is that the anus develops not from a persistent blastopore, but by secondary canalization and proctodeum formation at the former site of the blastopore. Further, we show that the ciliated bands of the pharyngeal roof originate in the esophagus, distinguishing it from the intestine. We clarify the epithelialization of the gut, showing that the secondary gut cavity is progressively epithelialized from each end. We identify possible germ cells in the coelomic and cloacal walls. Balfour's "subnotochordal rod" is lacking in our specimens; we suggest that he may have misinterpreted the corpus adiposum. Our study is of potential value to the growing number of biologists interested in lamprey development and provides a character set that will be used : 1) in a phylogenetic study of vertebrate development, and 2) to prepare a staging series for the lamprey based on parsimony analysis. Copyright 2003 Wiley-Liss, Inc.

  12. Effects of proteinase inhibitors on fertilization in sea lamprey (Petromyzon marinus).


    Dabrowski, Konrad; Glogowski, Jan; Ciereszko, Andrzej


    A search for alternative sterilants in parasitic fish encouraged us to explore the usefulness of proteinase inhibitors for this purpose. Fertilization in sea lamprey species (Petromyzon marinus L.) was inhibited by chymotrypsin and trypsin inhibitors 4'-acetamidophenyl 4-guanidinobenzoate (AGB), chymostatin, tosyl-L-lysine chloromethyl ketone (TLCK), and N-tosyl-L-phenylalanine chloromethyl ketone (TPCK) when these substances were added into a fertilization medium at the time of fertilization. Preincubation of eggs before fertilization with 100 microM TPCK, but not TLCK, resulted in inhibition of fertilization. Conversely, preincubation of spermatozoa with TLCK, but not TPCK, produced inhibition of fertilization. These data suggest the involvement of the chymotrypsin-like activity of eggs and trypsin-like activity of spermatozoa in fertilization. However, enzymes present in sperm suspensions were able to hydrolyze a chymotrypsin substrate N-glutaryl-L-phenylalanine-p-nitroanilide (GPNA) but not trypsin substrate N-alpha-benzoyl-DL-arginine-p-nitroanilide (BAPNA). The nature of this activity can be characterized as serine protease and our results indicate the involvement of serine proteinases in the fertilization of sea lamprey.

  13. Neuroendocrine and behavioral responses to weak electric fields in adult sea lampreys (Petromyzon marinus).


    Chung-Davidson, Yu-Wen; Bryan, Mara B; Teeter, John; Bedore, Christine N; Li, Weiming


    We characterized the behavioral and neuroendocrine responses of adult sea lampreys (Petromyzon marinus) to weak electric fields. Adult sea lampreys, captured during upstream spawning migration, exhibited limited active behaviors during exposure to weak electric fields and spent the most time attached to the wall of the testing arena near the cathode (-). For adult male sea lampreys, exposure to weak electric fields resulted in increased lamprey (l) GnRH-I mRNA expression but decreased lGnRH-I immunoreactivities in the forebrain, and decreased Jun (a neuronal activation marker) mRNA levels in the brain stem. Similar effects were not observed in the brains of female sea lampreys after weak electric field stimulation. The influence of electroreception on forebrain lGnRH suggests that electroreception may modulate the reproductive systems in adult male sea lampreys. The changes in Jun expression may be associated with swimming inhibition during weak electric field stimulation. The results for adult sea lampreys are the opposite of those obtained using parasitic-stage sea lampreys, which displayed increased activity during and after cathodal stimulation. Our results demonstrate that adult sea lampreys are sensitive to weak electric fields, which may play a role in reproduction. They also suggest that electrical stimuli mediate different behaviors in feeding-stage and spawning-stage sea lampreys.

  14. Seasonal growth and duration of the parasitic life stage of the landlocked sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Bergstedt, Roger A.; Swink, William D.


    We used lengths and weights of 2367 live parasitic-phase sea lampreys (Petromyzon marinus) collected from Lake Huron, 1984–1990, to calculate their mean size at half-month intervals. Growth in weight was linear during June through September; increments averaged 11.1 g per half month. Growth increased sharply in October to several times the summer rate. We speculate that the increase in growth in October is explained partly by water temperature and partly by an increase in appetite related to the onset of gonadal development. The greater compression of biomass accumulation in autumn than has been previously demonstrated better explains the autumn pulse of sea lamprey induced host mortality. Based on the seasonal pattern of growth and on recaptures of marked sea lampreys, we conclude that landlocked individuals grow to adult size and mature in one parasitic growth year. Regressions of weight (grams) on total length (millimetres) differed significantly among months, and the season of collection must be considered in predicting weight from length.

  15. Stone-dwelling actinobacteria Blastococcus saxobsidens, Modestobacter marinus and Geodermatophilus obscurus proteogenomes.


    Sghaier, Haïtham; Hezbri, Karima; Ghodhbane-Gtari, Faten; Pujic, Petar; Sen, Arnab; Daffonchio, Daniele; Boudabous, Abdellatif; Tisa, Louis S; Klenk, Hans-Peter; Armengaud, Jean; Normand, Philippe; Gtari, Maher


    The Geodermatophilaceae are unique model systems to study the ability to thrive on or within stones and their proteogenomes (referring to the whole protein arsenal encoded by the genome) could provide important insight into their adaptation mechanisms. Here we report the detailed comparative genome analysis of Blastococcus saxobsidens (Bs), Modestobacter marinus (Mm) and Geodermatophilus obscurus (Go) isolated respectively from the interior and the surface of calcarenite stones and from desert sandy soils. The genome-scale analysis of Bs, Mm and Go illustrates how adaptation to these niches can be achieved through various strategies including 'molecular tinkering/opportunism' as shown by the high proportion of lost, duplicated or horizontally transferred genes and ORFans. Using high-throughput discovery proteomics, the three proteomes under unstressed conditions were analyzed, highlighting the most abundant biomarkers and the main protein factors. Proteomic data corroborated previously demonstrated stone-related ecological distribution. For instance, these data showed starvation-inducible, biofilm-related and DNA-protection proteins as signatures of the microbes associated with the interior, surface and outside of stones, respectively.

  16. Stone-dwelling actinobacteria Blastococcus saxobsidens, Modestobacter marinus and Geodermatophilus obscurus proteogenomes

    PubMed Central

    Sghaier, Haïtham; Hezbri, Karima; Ghodhbane-Gtari, Faten; Pujic, Petar; Sen, Arnab; Daffonchio, Daniele; Boudabous, Abdellatif; Tisa, Louis S; Klenk, Hans-Peter; Armengaud, Jean; Normand, Philippe; Gtari, Maher


    The Geodermatophilaceae are unique model systems to study the ability to thrive on or within stones and their proteogenomes (referring to the whole protein arsenal encoded by the genome) could provide important insight into their adaptation mechanisms. Here we report the detailed comparative genome analysis of Blastococcus saxobsidens (Bs), Modestobacter marinus (Mm) and Geodermatophilus obscurus (Go) isolated respectively from the interior and the surface of calcarenite stones and from desert sandy soils. The genome-scale analysis of Bs, Mm and Go illustrates how adaptation to these niches can be achieved through various strategies including ‘molecular tinkering/opportunism' as shown by the high proportion of lost, duplicated or horizontally transferred genes and ORFans. Using high-throughput discovery proteomics, the three proteomes under unstressed conditions were analyzed, highlighting the most abundant biomarkers and the main protein factors. Proteomic data corroborated previously demonstrated stone-related ecological distribution. For instance, these data showed starvation-inducible, biofilm-related and DNA-protection proteins as signatures of the microbes associated with the interior, surface and outside of stones, respectively. PMID:26125681

  17. Lake trout (Salvelinus namaycush) and sea lamprey (Petromyzon marinus) populations in Lake Michigan, 1971-78

    USGS Publications Warehouse

    Wells, LaRue


    Lake trout (Salvelinus namaycush) was exterminated in Lake Michigan by the mid-1950s as a result of the combined effects of an intensive fishery and predation by the sea lamprey (Petromyzon marinus). The widespread application of lampricide in tributary streams had greatly reduced the abundance of lampreys by the early 1960s, and a program to restore self-sustaining populations of lake trout through stocking of yearlings and fingerlings was initiated in 1965. Although the hatchery-reared fish spawned widely in Lake Michigan each year after 1970, no progeny were observed except in an isolated area in Grand Traverse Bay. During 1971–78, sea lamprey abundance was generally greater in Wisconsin than in other parts of the lake. However, the rate of occurrence of sea lamprey wounds on lake trout dropped dramatically there in 1978 after the Peshtigo River, a tributary to Green Bay, was treated with lampricide. Application of Lake Michigan wounding rates to a regression model relating mortality to lamprey wounding developed from Lake Superior data, yielded lamprey-induced mortality estimates in 1977 of 5% in Michigan plus Indiana (combined) and 31% in Wisconsin; corresponding estimates for 1978 were 5 and 15%.Key words: lake trout, sea lamprey predation, abundance, Lake Michigan

  18. A spatial age-structured model for describing sea lamprey (Petromyzon marinus) population dynamics

    USGS Publications Warehouse

    Robinson, Jason M.; Wilberg, Michael J.; Adams, Jean V.; Jones, Michael L.


    The control of invasive sea lampreys (Petromyzon marinus) presents large scale management challenges in the Laurentian Great Lakes. No modeling approach has been developed that describes spatial dynamics of lamprey populations. We developed and validated a spatial and age-structured model and applied it to a sea lamprey population in a large river in the Great Lakes basin. We considered 75 discrete spatial areas, included a stock-recruitment function, spatial recruitment patterns, natural mortality, chemical treatment mortality, and larval metamorphosis. Recruitment was variable, and an upstream shift in recruitment location was observed over time. From 1993–2011 recruitment, larval abundance, and the abundance of metamorphosing individuals decreased by 80, 84, and 86%, respectively. The model successfully identified areas of high larval abundance and showed that areas of low larval density contribute significantly to the population. Estimated treatment mortality was less than expected but had a large population-level impact. The results and general approach of this work have applications for sea lamprey control throughout the Great Lakes and for the restoration and conservation of native lamprey species globally.

  19. Ontogenetic dynamics of mercury accumulation in Northwest Atlantic sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Drevnick, P.E.; Horgan, M.J.; Oris, J.T.; Kynard, B.E.


    We examined the ontogenetic dynamics of mercury accumulation in sea lamprey (Petromyzon marinus) from the Connecticut River, USA. Mercury concentrations in eggs (mean 84 ng??g-1 wet weight) were lowest of all life stages and correlated to concentrations in females. There was a higher rate of maternal transfer of mercury to eggs compared with teleosts. Ammocoetes had high mercury concentrations for their trophic level (e.g., mean of age-4 ammocoetes 492 ng??g-1 wet weight). A further investigation of four streams showed that ammocoetes reflected the level of contamination in their nursery streams. Concentrations of mercury decreased during metamorphosis from ammocoete to adult. Mercury concentrations in adults ranged from 83 to 942 ng??g-1 wet weight and, unlike teleosts, showed no relation to sex, length, or weight. We provide evidence from stable isotope analyses that this high variability is due to feeding ecology. There are fundamental differences in mercury accumulation between sea lamprey and teleosts. ?? 2006 NRC Canada.

  20. Effects of sex pheromones and sexual maturation on locomotor activity in female sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Walaszczyk, Erin J.; Johnson, Nicholas S.; Steibel, Juan Pedro; Li, Weiming


    Synchronization of male and female locomotor rhythmicity can play a vital role in ensuring reproductive success. Several physiological and environmental factors alter these locomotor rhythms. As sea lamprey, Petromyzon marinus, progress through their life cycle, their locomotor activity rhythm changes multiple times. The goal of this study was to elucidate the activity patterns of adult female sea lamprey during the sexual maturation process and discern the interactions of these patterns with exposure to male pheromones. During these stages, preovulated and ovulated adult females are exposed to sex pheromone compounds, which are released by spermiated males and attract ovulated females to the nest for spawning. The locomotor behavior of adult females was monitored in a natural stream with a passive integrated tag responder system as they matured, and they were exposed to a sex pheromone treatment (spermiated male washings) or a control (prespermiated male washings). Results showed that, dependent on the hour of day, male sex pheromone compounds reduce total activity (p < 0.05) and cause increases in activity during several daytime hours in preovulated and ovulated females. These results are one of the first examples of how sex pheromones modulate a locomotor rhythm in a vertebrate, and they suggest that the interaction between maturity stage and sex pheromone exposure contributes to the differential locomotor rhythms found in adult female sea lamprey. This phenomenon may contribute to the reproductive synchrony of mature adults, thus increasing reproductive success in this species.

  1. Glutamine Synthetase Sensitivity to Oxidative Modification during Nutrient Starvation in Prochlorococcus marinus PCC 9511

    PubMed Central

    Gómez-Baena, Guadalupe; Domínguez-Martín, María Agustina; Donaldson, Robert P.; García-Fernández, José Manuel; Diez, Jesús


    Glutamine synthetase plays a key role in nitrogen metabolism, thus the fine regulation of this enzyme in Prochlorococcus, which is especially important in the oligotrophic oceans where this marine cyanobacterium thrives. In this work, we studied the metal-catalyzed oxidation of glutamine synthetase in cultures of Prochlorococcus marinus strain PCC 9511 subjected to nutrient limitation. Nitrogen deprivation caused glutamine synthetase to be more sensitive to metal-catalyzed oxidation (a 36% increase compared to control, non starved samples). Nutrient starvation induced also a clear increase (three-fold in the case of nitrogen) in the concentration of carbonyl derivatives in cell extracts, which was also higher (22%) upon addition of the inhibitor of electron transport, DCMU, to cultures. Our results indicate that nutrient limitations, representative of the natural conditions in the Prochlorococcus habitat, affect the response of glutamine synthetase to oxidative inactivating systems. Implications of these results on the regulation of glutamine synthetase by oxidative alteration prior to degradation of the enzyme in Prochlorococcus are discussed. PMID:26270653

  2. Gene expression analysis of a critical enzyme in intermediary metabolism in oyster pathogen Perkinsus marinus .

    NASA Astrophysics Data System (ADS)

    Noell, K.


    A key regulatory component in the Krebs cycle pathway is the mitochondrial aconitase enzyme which has been posited to balance energy needs and oxidative growth total storage via citrate utilization. The presence of a cytosolic aconitase (cAcon) activity which serves as a competitor for citrate substrate has been recognized for years. cAcon is a dual function protein with mutually exclusive roles as a post transcriptional regulator of animal cell iron metabolism or as the cytosolic isoform of the iron sulfur enzyme aconitase. We are interested in establishing the role of this orthologue in Perkinsus marnius metabolism through demonstrating its function as aconitase, by looking at gene expression under certain environmental conditions. P. marinus is a close evolutionary relative of the dinoflagellates and is the causative agent of Dermo disease, which has significantly impacted oyster populations along the eastern seaboard. An understanding of intermediary metabolism will yield important insights into how c-aconitase may be involved in stress response systems such as oxidative tension and metabolite deficiency, which could be used to help aquaculturists alleviate the severe impact of "dermo" on the on the oyster population. This study will present data regarding our preliminary analysis of the gene aconitase and its role in intermediary metabolism.

  3. Measuring Energetics and Behaviour Using Accelerometry in Cane Toads Bufo marinus

    PubMed Central

    Halsey, Lewis G.; White, Craig R.


    Cane toads Bufo marinus were introduced to Australia as a control agent but now have a rapidly progressing invasion front and damage new habitats they enter. Predictive models that can give expansion rates as functions of energy supply and feeding ground distribution could help to maximise control efficiency but to date no study has measured rates of field energy expenditure in an amphibian. In the present study we used the accelerometry technique to generate behavioural time budgets and, through the derivation of ODBA (overall dynamic body acceleration), to obtain estimates of energetics in free ranging cane toads. This represents the first time that accelerometers have been used to not only quantify the behaviour of animals but also assign to those behaviours rates of energy expenditure. Firstly, laboratory calibrations between ODBA and metabolic rate were obtained and used to generate a common prediction equation for the subject toads (R2 = 0.74). Furthermore, acceleration data recorded during different behaviours was studied to ascertain threshold values for objectively defining behaviour categories. Importantly, while subsequent accelerometer field deployments were relatively short they agreed with previous studies on the proportion of time that cane toads locomote yet suggest that the metabolic rate of cane toads in the wild may sometimes be considerably higher than might be assumed based on data for other species. PMID:20422048

  4. Association of Novel Domain in Active Site of Archaic Hyperthermophilic Maltogenic Amylase from Staphylothermus marinus*

    PubMed Central

    Jung, Tae-Yang; Li, Dan; Park, Jong-Tae; Yoon, Se-Mi; Tran, Phuong Lan; Oh, Byung-Ha; Janeček, Štefan; Park, Sung Goo; Woo, Eui-Jeon; Park, Kwan-Hwa


    Staphylothermus marinus maltogenic amylase (SMMA) is a novel extreme thermophile maltogenic amylase with an optimal temperature of 100 °C, which hydrolyzes α-(1–4)-glycosyl linkages in cyclodextrins and in linear malto-oligosaccharides. This enzyme has a long N-terminal extension that is conserved among archaic hyperthermophilic amylases but is not found in other hydrolyzing enzymes from the glycoside hydrolase 13 family. The SMMA crystal structure revealed that the N-terminal extension forms an N′ domain that is similar to carbohydrate-binding module 48, with the strand-loop-strand region forming a part of the substrate binding pocket with several aromatic residues, including Phe-95, Phe-96, and Tyr-99. A structural comparison with conventional cyclodextrin-hydrolyzing enzymes revealed a striking resemblance between the SMMA N′ domain position and the dimeric N domain position in bacterial enzymes. This result suggests that extremophilic archaea that live at high temperatures may have adopted a novel domain arrangement that combines all of the substrate binding components within a monomeric subunit. The SMMA structure provides a molecular basis for the functional properties that are unique to hyperthermophile maltogenic amylases from archaea and that distinguish SMMA from moderate thermophilic or mesophilic bacterial enzymes. PMID:22223643

  5. Sea lamprey Petromyzon marinus: an exception to the rule of homing in anadromous fishes.


    Waldman, John; Grunwald, Cheryl; Wirgin, Isaac


    Anadromous fishes are believed to make regular circuits of migration in the sea before homing to their natal rivers. Sea lamprey Petromyzon marinus is an anadromous fish that is an exception to this life-history pattern. It also differs from other anadromous fishes in that its adult phase is parasitic, a feeding strategy that should make homing problematic for lamprey cohorts that become widely dispersed through transport by the diverse hosts they parasitize. We sequenced a portion of the mitochondrial DNA control region from sea lampreys collected from 11 North American east coast rivers to test for genetic evidence of homing. There were no significant differences (chi2=235.1, p=0.401) in haplotype frequencies among them, with almost 99 per cent of haplotypic diversity occurring within populations. These findings, together with concordant genetic results from other geographical regions and ancillary information on pheromonal communication, suggest that sea lamprey does not home but rather exhibits regional panmixia while using a novel 'suitable river' strategy to complete its life cycle.

  6. Glutamine Synthetase Sensitivity to Oxidative Modification during Nutrient Starvation in Prochlorococcus marinus PCC 9511.


    Gómez-Baena, Guadalupe; Domínguez-Martín, María Agustina; Donaldson, Robert P; García-Fernández, José Manuel; Diez, Jesús


    Glutamine synthetase plays a key role in nitrogen metabolism, thus the fine regulation of this enzyme in Prochlorococcus, which is especially important in the oligotrophic oceans where this marine cyanobacterium thrives. In this work, we studied the metal-catalyzed oxidation of glutamine synthetase in cultures of Prochlorococcus marinus strain PCC 9511 subjected to nutrient limitation. Nitrogen deprivation caused glutamine synthetase to be more sensitive to metal-catalyzed oxidation (a 36% increase compared to control, non starved samples). Nutrient starvation induced also a clear increase (three-fold in the case of nitrogen) in the concentration of carbonyl derivatives in cell extracts, which was also higher (22%) upon addition of the inhibitor of electron transport, DCMU, to cultures. Our results indicate that nutrient limitations, representative of the natural conditions in the Prochlorococcus habitat, affect the response of glutamine synthetase to oxidative inactivating systems. Implications of these results on the regulation of glutamine synthetase by oxidative alteration prior to degradation of the enzyme in Prochlorococcus are discussed.

  7. Measuring energetics and behaviour using accelerometry in cane toads Bufo marinus.


    Halsey, Lewis G; White, Craig R


    Cane toads Bufo marinus were introduced to Australia as a control agent but now have a rapidly progressing invasion front and damage new habitats they enter. Predictive models that can give expansion rates as functions of energy supply and feeding ground distribution could help to maximise control efficiency but to date no study has measured rates of field energy expenditure in an amphibian. In the present study we used the accelerometry technique to generate behavioural time budgets and, through the derivation of ODBA (overall dynamic body acceleration), to obtain estimates of energetics in free ranging cane toads. This represents the first time that accelerometers have been used to not only quantify the behaviour of animals but also assign to those behaviours rates of energy expenditure. Firstly, laboratory calibrations between ODBA and metabolic rate were obtained and used to generate a common prediction equation for the subject toads (R(2) = 0.74). Furthermore, acceleration data recorded during different behaviours was studied to ascertain threshold values for objectively defining behaviour categories. Importantly, while subsequent accelerometer field deployments were relatively short they agreed with previous studies on the proportion of time that cane toads locomote yet suggest that the metabolic rate of cane toads in the wild may sometimes be considerably higher than might be assumed based on data for other species.

  8. Guiding out-migrating juvenile sea lamprey (Petromyzon marinus) with pulsed direct current

    USGS Publications Warehouse

    Johnson, Nicholas S.; Miehls, Scott M.


    Non-physical stimuli can deter or guide fish without affecting water flow or navigation and therefore have been investigated to improve fish passage at anthropogenic barriers and to control movement of invasive fish. Upstream fish migration can be blocked or guided without physical structure by electrifying the water, but directional downstream fish guidance with electricity has received little attention. We tested two non-uniform pulsed direct current electric systems, each having different electrode orientations (vertical versus horizontal), to determine their ability to guide out-migrating juvenile sea lamprey (Petromyzon marinus) and rainbow trout (Oncorhynchus mykiss). Both systems guided significantly more juvenile sea lamprey to a specific location in our experimental raceway when activated than when deactivated, but guidance efficiency decreased at the highest water velocities tested. At the electric field setting that effectively guided sea lamprey, rainbow trout were guided by the vertical electrode system, but most were blocked by the horizontal electrode system. Additional research should characterize the response of other species to non-uniform fields of pulsed DC and develop electrode configurations that guide fish over a range of water velocity.

  9. Daytime avoidance of chemosensory alarm cues by adult sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Di Rocco, Richard; Belanger, Cowan; Imre, István; Brown, Grant; Johnson, Nicholas S.


    Sea lamprey (Petromyzon marinus) avoid damage-released and predator chemosensory cues at night, but their response to these cues during the day is unknown. Here, we explored (i) whether sea lamprey avoid these cues during the day and (ii) the effect of water temperature on the avoidance of chemosensory alarm cues in two diurnal laboratory experiments. We hypothesized that daytime activity would be temperature-dependent and that only sea lamprey vulnerable to predation (i.e., not hiding) would behaviourally respond to chemosensory alarm cues. Ten groups of ten sea lamprey were exposed to one of a variety of potential chemosensory cues. The experiments were conducted over a range of temperatures to quantify the effect of temperature on avoidance behaviour. Consistent with our hypothesis, a higher proportion of animals were active during daytime as water temperature increased. Moving sea lamprey showed an avoidance response to 2-phenylethylamine (a compound found in mammalian urine) and human saliva once water temperatures had risen to mean (±SD) = 13.7 (±1.4) °C. Resting and hiding sea lamprey did not show an avoidance response to any of the experimental stimuli.

  10. A new clarification method to visualize biliary degeneration during liver metamorphosis in sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Chung-Davidson, Yu-Wen; Davidson, Peter J.; Scott, Anne M.; Walaszczyk, Erin J.; Brant, Cory O.; Buchinger, Tyler; Johnson, Nicholas S.; Li, Weiming


    Biliary atresia is a rare disease of infancy, with an estimated 1 in 15,000 frequency in the southeast United States, but more common in East Asian countries, with a reported frequency of 1 in 5,000 in Taiwan. Although much is known about the management of biliary atresia, its pathogenesis is still elusive. The sea lamprey (Petromyzon marinus) provides a unique opportunity to examine the mechanism and progression of biliary degeneration. Sea lamprey develop through three distinct life stages: larval, parasitic, and adult. During the transition from larvae to parasitic juvenile, sea lamprey undergo metamorphosis with dramatic reorganization and remodeling in external morphology and internal organs. In the liver, the entire biliary system is lost, including the gall bladder and the biliary tree. A newly-developed method called “CLARITY” was modified to clarify the entire liver and the junction with the intestine in metamorphic sea lamprey. The process of biliary degeneration was visualized and discerned during sea lamprey metamorphosis by using laser scanning confocal microscopy. This method provides a powerful tool to study biliary atresia in a unique animal model.

  11. PCB concentrations and activity of sea lamprey Petromyzon marinus vary by sex

    USGS Publications Warehouse

    Madenjian, Charles P.; Johnson, Nicholas S.; Binder, Thomas R.; Rediske, Richard R.; O'Keefe, James P.


    We determined the polychlorinated biphenyl (PCB) concentrations of 40 male and 40 female adult sea lampreys Petromyzon marinus captured in the Cheboygan River, a tributary to Lake Huron, during May 2011. In addition, we performed a laboratory experiment using passive integrated transponder tags to determine whether male adult sea lampreys were more active than female adult sea lampreys. Sex had a significant effect on PCB concentration, and PCB concentration at a given level of sea lamprey condition was approximately 25 % greater in males than in females. Adjusting for the difference in condition between the sexes, males averaged a 17 % greater PCB concentration compared with females. Results from the laboratory experiment indicated that males were significantly more active than females. The observed sex difference in PCB concentrations was not due to female sea lampreys releasing eggs at spawning because the sea lamprey is semelparous, and we caught the sea lampreys before spawning. Rather, we attributed the sex difference in PCB concentrations to a greater rate of energy expenditure in males compared with females. We proposed that this greater rate of energy expenditure was likely due to greater activity. Our laboratory experiment results supported this hypothesis. A greater resting metabolic rate may also have contributed to a greater rate of energy expenditure. Our findings should eventually be applicable toward improving control of sea lamprey, a pest responsible for considerable damage to fisheries in lakes where it is not native.


    PubMed Central

    Choi, Jae Kwon


    The urinary bladder of the toad (Bufo marinus) was studied with both the light and the electron microscope. The bladder wall consists of epithelium, submucosa, and serosa. In the epithelium, four different cell types were recognized on the basis of their fine structure and staining properties with several different dyes. These four were designated as granular cells, mitochondria-rich cells, mucous cells, and basal cells. In addition, migratory cells of a different type were found in the basal region of the epithelium. The luminal surface of the epithelial cells presents irregular microvilli and is coated by PAS-positive material which has been further investigated by histochemical procedures and radioautography. Included is a description of the fine structural details of cell membranes, cell junctions, and intracellular components. The submucosa consists of a delicate stroma of fibroblasts and collagen fibers and also contains blood and lymph vessels, unmyelinated nerves, migratory cells, and smooth muscle cells. The serosa consists of a single layer of serosal (mesothelial) cells which form an uninterrupted covering of the viscus. Possible pathways of sodium and water transport across the bladder wall are discussed. PMID:14020969

  13. Multiple functions of a multi-component mating pheromone in sea lamprey Petromyzon marinus

    USGS Publications Warehouse

    Johnson, N.S.; Yun, S.-S.; Buchinger, T.J.; Li, W.


    The role of the C24 sulphate in the mating pheromone component, 7α,12α,24-trihydroxy-5α-cholan-3-one 24-sulphate (3kPZS), to specifically induce upstream movement in ovulated female sea lampreys Petromyzon marinus was investigated. 7α,12α-dihydroxy-5α-cholan-3-one 24-oic acid (3kACA), a structurally similar bile acid released by spermiated males, but lacking the C24 sulphate ester, was tested in bioassays at concentrations between 10−11 and 10−14 molar (M). 3kACA did not induce upstream movement in females or additional reproductive behaviours. In contrast, spermiated male washings induced upstream movement, prolonged retention on a nest and induced an array of nesting behaviours. Differential extraction and elution by solid-phase extraction resins showed that components other than 3kPZS + 3kACA are necessary to retain females on nests and induce nest cleaning behaviours. All pheromone components, including components in addition to 3kPZS + 3kACA that retain females and induce nest cleaning behaviours were released from the anterior region of the males, as had been reported for 3kPZS. It is concluded that the sea lamprey male mating pheromone has multiple functions and is composed of multiple components.

  14. Sea lamprey (Petromyzon marinus) parasite-host interactions in the Great Lakes

    USGS Publications Warehouse

    Bence, James R.; Bergstedt, Roger A.; Christie, Gavin C.; Cochran, Phillip A.; Ebener, Mark P.; Koonce, Joseph F.; Rutter, Michael A.; Swink, William D.


    Prediction of how host mortality responds to efforts to control sea lampreys (Petromyzon marinus) is central to the integrated management strategy for sea lamprey (IMSL) in the Great Lakes. A parasite-host submodel is used as part of this strategy, and this includes a type-2 multi-species functional response, a developmental response, but no numerical response. General patterns of host species and size selection are consistent with the model assumptions, but some observations appear to diverge. For example, some patterns in sea lamprey marking on hosts suggest increases in selectivity for less preferred hosts and lower host survival when preferred hosts are scarce. Nevertheless, many of the IMSL assumptions may be adequate under conditions targeted by fish community objectives. Of great concern is the possibility that the survival of young parasites (parasitic-phase sea lampreys) varies substantially among lakes or over time. Joint analysis of abundance estimates for parasites being produced in streams and returning spawners could address this. Data on sea lamprey marks is a critical source of information on sea lamprey activity and potential effects. Theory connecting observed marks to sea lamprey feeding activity and host mortality is reviewed. Uncertainties regarding healing and attachment times, the probability of hosts surviving attacks, and problems in consistent classification of marks have led to widely divergent estimates of damages caused by sea lamprey. Laboratory and field studies are recommended to provide a firmer linkage between host blood loss, host mortality, and observed marks on surviving hosts, so as to improve estimates of damage.

  15. Mutual Cross-Feeding Interactions between Bifidobacterium longum subsp. longum NCC2705 and Eubacterium rectale ATCC 33656 Explain the Bifidogenic and Butyrogenic Effects of Arabinoxylan Oligosaccharides.


    Rivière, Audrey; Gagnon, Mérilie; Weckx, Stefan; Roy, Denis; De Vuyst, Luc


    Arabinoxylan oligosaccharides (AXOS) are a promising class of prebiotics that have the potential to stimulate the growth of bifidobacteria and the production of butyrate in the human colon, known as the bifidogenic and butyrogenic effects, respectively. Although these dual effects of AXOS are considered beneficial for human health, their underlying mechanisms are still far from being understood. Therefore, this study investigated the metabolic interactions between Bifidobacterium longum subsp. longum NCC2705 (B. longum NCC2705), an acetate producer and arabinose substituent degrader of AXOS, and Eubacterium rectale ATCC 33656, an acetate-converting butyrate producer. Both strains belong to prevalent species of the human colon microbiota. The strains were grown on AXOS during mono- and coculture fermentations, and their growth, AXOS consumption, metabolite production, and expression of key genes were monitored. The results showed that the growth of both strains and gene expression in both strains were affected by cocultivation and that these effects could be linked to changes in carbohydrate consumption and concomitant metabolite production. The consumption of the arabinose substituents of AXOS by B. longum NCC2705 with the concomitant production of acetate allowed E. rectale ATCC 33656 to produce butyrate (by means of a butyryl coenzyme A [CoA]:acetate CoA-transferase), explaining the butyrogenic effect of AXOS. Eubacterium rectale ATCC 33656 released xylose from the AXOS substrate, which favored the B. longum NCC2705 production of acetate, explaining the bifidogenic effect of AXOS. Hence, those interactions represent mutual cross-feeding mechanisms that favor the coexistence of bifidobacterial strains and butyrate producers in the same ecological niche. In conclusion, this study provides new insights into the bifidogenic and butyrogenic effects of AXOS.

  16. Eubacterial components similar to small nuclear ribonucleoproteins: identification of immunoprecipitable proteins and capped RNAs in a cyanobacterium and a gram-positive eubacterium.

    PubMed Central

    Kovacs, S A; O'Neil, J; Watcharapijarn, J; Moe-Kirvan, C; Vijay, S; Silva, V


    Small nuclear ribonucleoprotein (snRNP) particles play an important role in the processing of pre-mRNA. snRNPs have been identified immunologically in a variety of cells, but none have ever been observed in prokaryotic systems. This report provides the first evidence for the presence of snRNP-like components in two types of prokaryotic cells: those of the cyanobacterium Synechococcus leopoliensis and those of the gram-positive eubacterium Bacillus subtilis. These components consist of snRNP-immunoreactive proteins and RNAs, including some with the snRNP-unique 5' m2,2,7G (m3G) cap. Immunoreactivity was determined by immunoprecipitation procedures, with either antinuclear-antibody-positive (RNP- and Sm-monospecific) patient sera or a m3G monoclonal antibody, with radiolabelled cell extracts that were preadsorbed with antinuclear-antibody-negative sera. S. leopoliensis immunoprecipitates showed the presence of high-molecular-mass proteins (14 to 70 kDa) and RNAs (138 to 243 nucleotides) that are analogous in size to proteins and RNAs found in human (HEp-2) cell immunoprecipitates but absent in Escherichia coli immunoprecipitates. Thin-layer chromatography of S. leopoliensis immunoprecipitates confirmed the presence of a capped nucleotide similar to a capped nucleotide in HEp-2 immunoprecipitates; no such nucleotide was observed in E. coli immunoprecipitates. Immunoreactive RNAs (117-170 nucleotides) were identified in a second eubacterium, B. subtilis, as well. This work suggests that snRNPs or their evolutionary predecessors predate the emergence of eukaryotic cells. Images PMID:8458830

  17. Mutual Cross-Feeding Interactions between Bifidobacterium longum subsp. longum NCC2705 and Eubacterium rectale ATCC 33656 Explain the Bifidogenic and Butyrogenic Effects of Arabinoxylan Oligosaccharides

    PubMed Central

    Rivière, Audrey; Gagnon, Mérilie; Weckx, Stefan; Roy, Denis


    Arabinoxylan oligosaccharides (AXOS) are a promising class of prebiotics that have the potential to stimulate the growth of bifidobacteria and the production of butyrate in the human colon, known as the bifidogenic and butyrogenic effects, respectively. Although these dual effects of AXOS are considered beneficial for human health, their underlying mechanisms are still far from being understood. Therefore, this study investigated the metabolic interactions between Bifidobacterium longum subsp. longum NCC2705 (B. longum NCC2705), an acetate producer and arabinose substituent degrader of AXOS, and Eubacterium rectale ATCC 33656, an acetate-converting butyrate producer. Both strains belong to prevalent species of the human colon microbiota. The strains were grown on AXOS during mono- and coculture fermentations, and their growth, AXOS consumption, metabolite production, and expression of key genes were monitored. The results showed that the growth of both strains and gene expression in both strains were affected by cocultivation and that these effects could be linked to changes in carbohydrate consumption and concomitant metabolite production. The consumption of the arabinose substituents of AXOS by B. longum NCC2705 with the concomitant production of acetate allowed E. rectale ATCC 33656 to produce butyrate (by means of a butyryl coenzyme A [CoA]:acetate CoA-transferase), explaining the butyrogenic effect of AXOS. Eubacterium rectale ATCC 33656 released xylose from the AXOS substrate, which favored the B. longum NCC2705 production of acetate, explaining the bifidogenic effect of AXOS. Hence, those interactions represent mutual cross-feeding mechanisms that favor the coexistence of bifidobacterial strains and butyrate producers in the same ecological niche. In conclusion, this study provides new insights into the bifidogenic and butyrogenic effects of AXOS. PMID:26319874

  18. Predicting the variation in Echinogammarus marinus at its southernmost limits under global warming scenarios: can the sex-ratio make a difference?


    Guerra, Alexandra; Leite, Nuno; Marques, João Carlos; Ford, Alex T; Martins, Irene


    Understanding the environmental parameters that constrain the distribution of a species at its latitudinal extremes is critical for predicting how ecosystems react to climate change. Our first aim was to predict the variation in the amphipod populations of Echinogammarus marinus from the southernmost limit of its distribution under global warming scenarios. Our second aim was to test whether sex-ratio fluctuations - a mechanism frequently displayed by amphipods - respond to the variations in populations under altered climate conditions. To achieve these aims, scenarios were run with a validated model of E. marinus populations. Simulations were divided into: phase I - simulation of the effect of climate change on amphipod populations, and phase II - simulation of the effect of climate change on populations with male and female proportions. In both phases, temperature (T), salinity (S) and temperature and salinity (T-S) were tested. Results showed that E. marinus populations are highly sensitive to increases in temperature (>2 °C), which has adverse effects on amphipod recruitment and growth. Results from the climate change scenarios coupled with the sex-ratio fluctuations depended largely on the degree of female bias within population. Temperature increase of 2 °C had less impact on female-biased populations, particularly when conjugated with increases in salinity. Male-biased populations were highly sensitive to any variation in temperature and/or salinity; these populations exhibited a long-term decline in density. Simulations in which temperature increased more than 4 °C led to a continuous decline in the E. marinus population. According to this work, E. marinus populations at their southernmost limit are vulnerable to global warming. We anticipate that in Europe, temperature increases of 2 °C will incite a withdrawal of the population of 5°N from the amphipod species located at southernmost geographical borders. This effect is discussed in relation to the

  19. Impact of the invasive cane toad (Bufo marinus) on an Australian frog (Opisthodon ornatus) depends on minor variation in reproductive timing.


    Crossland, Michael R; Alford, Ross A; Shine, Richard


    Invasive species are widely viewed as unmitigated ecological catastrophes, but the reality is more complex. Theoretically, invasive species could have negligible or even positive effects if they sufficiently reduce the intensity of processes regulating native populations. Understanding such mechanisms is crucial to predicting ultimate ecological impacts. We used a mesocosm experiment to quantify the impact of eggs and larvae of the introduced cane toad (Bufo marinus) on fitness-related traits (number, size and time of emergence of metamorphs) of a native Australian frog species (Opisthodon ornatus). The results depended upon the timing of oviposition of the two taxa, and hence the life-history stages that came into contact. Growth and survival of O. ornatus tadpoles were enhanced when they preceded B. marinus tadpoles into ponds, and reduced when they followed B. marinus tadpoles into ponds, relative to when tadpoles of both species were added to ponds simultaneously. The dominant tadpole-tadpole interaction is competition, and the results are consistent with competitive priority effects. However, these priority effects were reduced or reversed when O. ornatus tadpoles encountered B. marinus eggs. Predation on toxic toad eggs reduced the survival of O. ornatus and B. marinus. The consequent reduction in tadpole densities allowed the remaining O. ornatus tadpoles to grow more rapidly and to metamorphose at larger body sizes (>60% disparity in mean mass). Thus, exposure to B. marinus eggs reduced the number of O. ornatus metamorphs, but increased their body sizes. If the increased size at metamorphosis more than compensates for the reduced survival, the effective reproductive output of native anurans may be increased rather than decreased by the invasive toad. Minor interspecific differences in the seasonal timing of oviposition thus have the potential to massively alter the impact of invasive cane toads on native anurans.

  20. Marinicauda algicola sp. nov., isolated from a marine red alga Rhodosorus marinus.


    Jeong, Sang Eun; Jeon, Seung Heon; Chun, Byung Hee; Kim, Dong-Woon; Jeon, Che Ok


    An aerobic Gram-stain-negative prosthecate bacterium, designated RMAR8-3T, was isolated from a marine red alga Rhodosorus marinus in the Republic of Korea. Cells were dimorphic rods with a single polar prostheca (non-motile) or flagellum (motile) showing catalase- and oxidase-positive reactions. Growth of strain RMAR8-3T was observed at 15-45 °C (optimum, 40 °C), at pH 6.0-9.0 (optimum, pH 7.0) and in the presence of 0-10 % (w/v) NaCl (optimum, 2 %). Ubiquinone-10 was detected as the sole isoprenoid quinone and C18 : 0, summed feature 8 (comprising C18 : 1 ω7c and/or C18 : 1ω6c), C17 : 0, C12 : 0 3-OH and C16 : 0 were identified as the major cellular fatty acids. The major polar lipids were sulfo-quinovosyldiacylglycerol, glucuronopyranosyldiglyceride and monoglycosyldiglyceride. The G+C content of the genomic DNA was 66.3 mol%. Strain RMAR8-3T was most closely related to Marinicauda pacifica P-1 km-3T with a 97.6 % 16S rRNA gene sequence similarity. Phylogenetic analyses based on 16S rRNA gene sequences showed that strain RMAR8-3T formed a tight phylogenic lineage with M. pacifica P-1 km-3T within the family Hyphomonadaceae. On the basis of phenotypic, chemotaxonomic and molecular features, strain RMAR8-3T clearly represents a novel species of the genus Marinicauda, for which the name Marinicauda algicola sp. nov. is proposed. The type strain is RMAR8-3T (=KACC 18990T=JCM 31718T).

  1. The natural resistance-associated macrophage protein from the protozoan parasite Perkinsus marinus mediates iron uptake.


    Lin, Zhuoer; Fernández-Robledo, José-Antonio; Cellier, Mathieu F M; Vasta, Gerardo R


    Microbial pathogens succeed in acquiring essential metals such as iron and manganese despite their limited availability because of the host's immune response. The eukaryotic natural resistance-associated macrophage proteins mediate uptake of divalent metals and, during infection, may compete directly for metal acquisition with the pathogens' transporters. In this study, we characterize the Nramp gene family of Perkinsus marinus, an intracellular parasite of the eastern oyster, and through yeast complementation, we demonstrate for the first time for a protozoan parasite that Nramp imports environmental Fe. Three PmNramp isogenes differ in their exon-intron structures and encode transcripts that display a trans splicing leader at the 5' end. The protein sequences share conserved properties predicted for the Nramp/Solute carrier 11 (Slc11) family, such as 12-transmembrane segment (TMS) topology (N- and C-termini cytoplasmic) and preferential conservation of four TMS predicted to form a pseudosymmetric proton/metal symport pathway. Yeast fet3fet4 mutant complementation assays showed iron transport activity for PmNramp1 and a fusion chimera of the PmNramp3 hydrophobic core and PmNramp1 N- and C-termini. PmNramp1 site-directed mutagenesis demonstrated that Slc11 invariant and predicted pseudosymmetric motifs (TMS1 Asp-Pro-Gly and TMS6 Met-Pro-His) are key for transport function. PmNramp1 TMS1 mutants D76E, G78A, and D76E/G78A prevented membrane protein expression, while TMS6 M250A, H252Y, and M250A/H252Y specifically abrogated Fe uptake; the TMS6 H252Y mutation also correlates with divergence from Nramp specificity for divalent metals. © 2011 American Chemical Society

  2. Serum and hepatic vitamin A levels in captive and wild marine toads (Bufo marinus).


    Berkvens, Charlene N; Lentini, Andrew; Dutton, Christopher J; Pearl, David L; Barker, Ian K; Crawshaw, Graham J


    The captive breeding program for the endangered Puerto Rican crested toad (Peltophryne [Bufo] lemur) has been hampered by an undiagnosed condition called "Brown Skin Disease" (BSD). Toads develop widespread skin darkening, skin thickening and abnormal shedding and eventually succumb to a chronic loss of viability. This project evaluated the marine toad (Bufo marinus) as a model for the PRCT, examining vitamin A deficiency as a potential cause of BSD. Wild caught marine toads had significantly higher liver vitamin A concentrations (61.89 ± 63.49 µg/g) than captive born marine toads (0.58 ± 0.59 µg/g); P<0.001). A significant difference in serum vitamin A concentration was found between the captive and wild caught toads (P=0.013) and between the low vitamin A-fed and wild caught toads (P=0.004), when controlling for liver vitamin A concentrations. After captive toads were treated with topical and/or oral vitamin A, their hepatic vitamin A concentrations were similar to those of the wild toads, averaging 48.41 ± 37.03 µg/g. However, plasma vitamin A concentrations pre- and post-vitamin A supplementation did not differ statistically. We concluded that plasma vitamin A concentrations do not provide a linear indication of liver/body vitamin A status, and that both topical and oral supplementation with an oil-based vitamin A formulation can increase liver stores in amphibians. No evidence of BSD or other signs of deficiency were noted in the marine toads, although this feeding trial was relatively short (127 days). To date, clinical, pathological and research findings do not support vitamin A deficiency as a primary factor underlying BSD.

  3. Lamins of the sea lamprey (Petromyzon marinus) and the evolution of the vertebrate lamin protein family.


    Schilf, Paul; Peter, Annette; Hurek, Thomas; Stick, Reimer


    Lamin proteins are found in all metazoans. Most non-vertebrate genomes including those of the closest relatives of vertebrates, the cephalochordates and tunicates, encode only a single lamin. In teleosts and tetrapods the number of lamin genes has quadrupled. They can be divided into four sub-types, lmnb1, lmnb2, LIII, and lmna, each characterized by particular features and functional differentiations. Little is known when during vertebrate evolution these features have emerged. Lampreys belong to the Agnatha, the sister group of the Gnathostomata. They split off first within the vertebrate lineage. Analysis of the sea lamprey (Petromyzon marinus) lamin complement presented here, identified three functional lamin genes, one encoding a lamin LIII, indicating that the characteristic gene structure of this subtype had been established prior to the agnathan/gnathostome split. Two other genes encode lamins for which orthology to gnathostome lamins cannot be designated. Search for lamin gene sequences in all vertebrate taxa for which sufficient sequence data are available reveals the evolutionary time frame in which specific features of the vertebrate lamins were established. Structural features characteristic for A-type lamins are not found in the lamprey genome. In contrast, lmna genes are present in all gnathostome lineages suggesting that this gene evolved with the emergence of the gnathostomes. The analysis of lamin gene neighborhoods reveals noticeable similarities between the different vertebrate lamin genes supporting the hypothesis that they emerged due to two rounds of whole genome duplication and makes clear that an orthologous relationship between a particular vertebrate paralog and lamins outside the vertebrate lineage cannot be established. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. A lunar clock changes shielding pigment transparency in larval ocelli of Clunio marinus.


    Fleissner, Gerta; Schuchardt, Kirsten; Neumann, Dietrich; Bali, Geetha; Falkenberg, Gerald; Fleissner, Guenther


    Living in the tidal zones of the sea requires synchronization with the dominant environmental influences of tidal, solar, and lunar periodicity. Endogenous clocks anticipate those geoclimatic changes and control the respective rhythms of vital functions. But the underlying mechanisms are only partly understood. While the circadian clocks in animals are investigated employing neurobiological, molecular, and genetic approaches, clocks with a lunar periodicity have been studied with reference to development and behavior only. Sites of their pacemakers, zeitgeber receptors, and coupled endocrine components are unknown. Here, a lunar-rhythmic change of shielding pigment transparency in the larval ocelli of the intertidal midge Clunio marinus is demonstrated for the first time as a possible access to the neurobiology of lunar timing mechanisms. We studied third instar larvae (Vigo strain) throughout the lunar cycle by light- and electron-microscopy as well as by x-ray fluorescence analysis for the identification of the pigment. Moonlight detection is a prerequisite for photic synchronization of the lunar clock. The larval ocelli of Clunio putatively may function as moonlight receptors and are also controlled by the circalunar clock itself, hence being primary candidates for tracing input and output pathways of the lunar pacemaker. Additionally, the demonstration of a reversible optical change of shielding pigment transparency in Clunio is a novel finding, not reported so far in any other animal species, and reveals a mechanism to enhance photosensitivity under the condition of very dim light. It represents a remarkable change of a sense organ from an imaging device to a radiometer. Its restriction to the developmental stage susceptible to lunar timing elucidates a unique sensory strategy evolved at the level of sensory input. It also raises basic questions about the biochemistry of optically active pigments, like melanin, and their intracellular control.

  5. Characterization of Somatically-Eliminated Genes During Development of the Sea Lamprey (Petromyzon marinus).


    Bryant, Stephanie A; Herdy, Joseph R; Amemiya, Chris T; Smith, Jeramiah J


    The sea lamprey (Petromyzon marinus) is a basal vertebrate that undergoes developmentally programmed genome rearrangements (PGRs) during early development. These events facilitate the elimination of ∼20% of the genome from the somatic cell lineage, resulting in distinct somatic and germline genomes. Thus far only a handful of germline-specific genes have been definitively identified within the estimated 500 Mb of DNA that is deleted during PGR, although a few thousand germline-specific genes are thought to exist. To improve our understanding of the evolutionary/developmental logic of PGR, we generated computational predictions to identify candidate germline-specific genes within a new transcriptomic dataset derived from adult germline and the early embryonic stages during which PGR occurs. Follow-up validation studies identified 44 germline-specific genes and further characterized patterns of transcription and DNA loss during early embryogenesis. Expression analyses reveal that many of these genes are differentially expressed during early embryogenesis and presumably function in the early development of the germline. Ontology analyses indicate that many of these germline-specific genes play known roles in germline development, pluripotency, and oncogenesis (when misexpressed). These studies provide support for the theory that PGR serves to segregate molecular functions related to germline development/pluripotency in order to prevent their potential misexpression in somatic cells. This larger set of eliminated genes also allows us to extend the evolutionary/developmental breadth of this theory, as some deleted genes (or their gnathostome homologs) appear to be associated with the early development of somatic lineages, perhaps through the evolution of novel functions within gnathostome lineages. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e

  6. Characterization of a Novel Bile Alcohol Sulfate Released by Sexually Mature Male Sea Lamprey (Petromyzon marinus)

    PubMed Central

    Li, Ke; Brant, Cory O.; Siefkes, Michael J.; Kruckman, Hanna G.; Li, Weiming


    A sulphate-conjugated bile alcohol, 3,12-diketo-4,6-petromyzonene-24-sulfate (DKPES), was identified using bioassay-guided fractionation from water conditioned with sexually mature male sea lamprey (Petromyzon marinus). The structure and relative stereochemistry of DKPES was established using spectroscopic data. The electro-olfactogram (EOG) response threshold of DKPES was 10−7 Molar (M) and that of 3-keto petromyzonol sulfate (3 KPZS; a known component of the male sea lamprey sex pheromone) was 10−10 M. Behavioural studies indicated that DKPES can be detected at low concentrations by attracting sexually mature females to nests when combined with 3 KPZS. Nests baited with a mixture of DKPES and 3 KPZS (ratio 1∶29.8) attracted equal numbers of sexually mature females compared to an adjacent nest baited with 3 KPZS alone. When DKPES and 3 KPZS mixtures were applied at ratios of 2∶29.8 and 10∶29.8, the proportion of sexually mature females that entered baited nests increased to 73% and 70%, respectively. None of the sexually mature females released were attracted to nests baited with DKPES alone. These results indicated that DKPES is a component of the sex pheromone released by sexually mature male sea lamprey, and is the second biologically active compound identified from this pheromone. DKPES represents the first example that a minor component of a vertebrate pheromone can be combined with a major component to elicit critical sexual behaviors. DKPES holds considerable promise for increasing the effectiveness of pheromone-baited trapping as a means of sea lamprey control in the Laurentian Great Lakes. PMID:23874530

  7. Cellular and Molecular Features of Developmentally Programmed Genome Rearrangement in a Vertebrate (Sea Lamprey: Petromyzon marinus).


    Timoshevskiy, Vladimir A; Herdy, Joseph R; Keinath, Melissa C; Smith, Jeramiah J


    The sea lamprey (Petromyzon marinus) represents one of the few vertebrate species known to undergo large-scale programmatic elimination of genomic DNA over the course of its normal development. Programmed genome rearrangements (PGRs) result in the reproducible loss of ~20% of the genome from somatic cell lineages during early embryogenesis. Studies of PGR hold the potential to provide novel insights related to the maintenance of genome stability during the cell cycle and coordination between mechanisms responsible for the accurate distribution of chromosomes into daughter cells, yet little is known regarding the mechanistic basis or cellular context of PGR in this or any other vertebrate lineage. Here we identify epigenetic silencing events that are associated with the programmed elimination of DNA and describe the spatiotemporal dynamics of PGR during lamprey embryogenesis. In situ analyses reveal that the earliest DNA methylation (and to some extent H3K9 trimethylation) events are limited to specific extranuclear structures (micronuclei) containing eliminated DNA. During early embryogenesis a majority of micronuclei (~60%) show strong enrichment for repressive chromatin modifications (H3K9me3 and 5meC). These analyses also led to the discovery that eliminated DNA is packaged into chromatin that does not migrate with somatically retained chromosomes during anaphase, a condition that is superficially similar to lagging chromosomes observed in some cancer subtypes. Closer examination of "lagging" chromatin revealed distributions of repetitive elements, cytoskeletal contacts and chromatin contacts that provide new insights into the cellular mechanisms underlying the programmed loss of these segments. Our analyses provide additional perspective on the cellular and molecular context of PGR, identify new structures associated with elimination of DNA and reveal that PGR is completed over the course of several successive cell divisions.

  8. 15Alpha-hydroxyprogesterone in male sea lampreys, Petromyzon marinus L.


    Bryan, Mara B; Scott, Alexander P; Cerný, Ivan; Young, Bradley A; Li, Weiming


    There is growing evidence that sea lampreys, Petromyzon marinus L., produce gonadal steroids differing from those of other vertebrates by possessing an additional hydroxyl group at the C15 position. Here we demonstrate that sea lamprey testes produce 15alpha-hydroxyprogesterone (15alpha-P) in vitro when incubated with tritiated progesterone, that 15alpha-P is present in the plasma of sea lampreys, and that plasma concentrations of immunoreactive (ir) 15alpha-P rise dramatically in response to injections of gonadotropin-releasing hormone (GnRH). The identity of the tritiated 15alpha-P produced in vitro was confirmed by co-elution with standard 15alpha-P on high performance liquid chromatography, co-elution with standard and acetylated 15alpha-P on thin layer chromatography, and specific binding to antibodies raised against standard 15alpha-P. The in vitro conversion was used to produce tritiated 15alpha-P label for a radioimmunoassay (RIA), which is able to detect 15alpha-P in amounts as low as 2 pg per tube. The RIA has been used to measure the plasma concentrations of 15alpha-P in males given two serial injections, 24 h apart, of either lamprey GnRH I or GnRH III (50, 100, or 200 microg/kg) or saline control, with plasma being sampled 8 and 24 h after the second injection. Plasma concentrations of ir-15alpha-P rose from < 1 to 36 ng/ml (mean of all treatments) 8 h after injection and declined within 24 h. This is the first time that an RIA has detected such high steroid concentrations in lampreys. This finding is suggestive of a role for 15alpha-P in control of reproduction in the sea lamprey.

  9. Electrophysiological properties of the tongue epithelium of the toad Bufo marinus.


    Baker, Timothy K; Rios, Karina; Hillyard, Stanley D


    The dorsal lingual epithelium from the tongue of the toad Bufo marinus was mounted in an Ussing-type chamber, and the short-circuit current (I(sc)) was measured using a low-noise voltage clamp. With NaCl Ringer bathing the mucosal and serosal surfaces of the isolated tissue, an outwardly directed (mucosa-positive) I(sc) was measured that averaged -10.71+/-0.82 microA cm(-2) (mean +/- S.E.M., N=24) with a resistance of 615+/-152 Omega cm(2) (mean +/- S.E.M., N=10). Substitution of chloride with sulfate as the anion produced no significant change in I(sc). Fluctuation analysis with either NaCl or Na(2)SO(4) Ringer bathing both sides of the tissue revealed a spontaneous Lorentzian component, suggesting that the I(sc) was the result of K(+) secretion through spontaneously fluctuating channels in the apical membrane of the epithelium. This hypothesis was supported by the reversible inhibition of I(sc) by Ba(2+) added to the mucosal Ringer. Analysis of the kinetics of Ba(2+) inhibition of I(sc) indicates that there might be more than one type of K(+) channel carrying the I(sc). This hypothesis was supported by power spectra obtained with a serosa-to-mucosa K(+) gradient, which could be fitted to two Lorentzian components. At present, the K(+) secretory current cannot be localized to taste cells or other cells that might be associated with the secretion of saliva or mucus. Nonetheless, the resulting increase in [K(+)] in fluid bathing the mucosal surface of the tongue could presumably affect the sensitivity of the taste cells. These results contrast with those from the mammalian tongue, in which a mucosa-negative I(sc) results from amiloride-sensitive Na(+) transport.

  10. Moonlight receptor of the "1-h-midge" Clunio marinus studied by micro-XRF

    NASA Astrophysics Data System (ADS)

    Falkenberg, G.; Fleissner, Ge; Neumann, D.; Wellenreuther, G.; Alraun, P.; Fleissner, Gue


    Melanin is a pigment widely occurring in animals, plants, fungi and algae. It does not only colour skin, hair and eyes but serves mainly as photoprotectant and prevents overload with minerals induced by inflammations, infections and degenerative diseases. Therefore, the mechanisms underlying melanisation gained increasing interest in the field of biomedical research and clinic. So far, the processes of melanogenesis are only partly analysed, nearly nothing is known on a putative switch between melanins of different types. Here we offer a model organism to study these mechanisms as part of a naturally cycling change of transparency of the retinal shielding pigment. A marine midge, Clunio marinus, living in coastal regions, underlies a complex timing of its development by solar and lunar climatic periodicities, which synchronise biological clocks. The question was how the animals can discriminate changing sunlight from moonlight intensities. For the first time, we could show a "moonlight window" in the larval ocelli of this midge, and propose a hypothesis on the underlying mechanisms. Driven by a lunar clock the image forming ocelli become transparent and convert during moonlit nights to a sensitive photometer, which can record the dynamics of environmental light. High resolution X-ray fluorescence (XRF) measurements of the distribution of trace minerals in single melanosomes combined with their fine structural details in various states of the lunar cycle provide a first insight into the enzymatic pathways for the generation of a dark melanin (like eumelanin) and a light coloured melanin (like phaeomelanin). Essential advantage of this approach is the spatial and temporal resolution of the metals associated with melanisation processes, which could never before be demonstrated in these details. The data may stimulate further research projects in biomedicine.

  11. Host selection and lethality of attacks by sea lampreys (Petromyzon marinus) in laboratory studies

    USGS Publications Warehouse

    Swink, William D.


    Parasitic-phase sea lampreys (Petromyzon marinus) are difficult to study in the wild. A series of laboratory studies (1984-1995) of single attacks on lake trout (Salvelinus namaycush), rainbow trout (Oncorhynchus mykiss), and burbot (Lota lota) examined host size selection; determined the effects of host size, host species, host strain, and temperature on host mortality; and estimated the weight of hosts killed per lamprey. Rainbow trout were more able and burbot less able to survive attacks than lake trout. Small sea lampreys actively selected the larger of two small hosts; larger sea lampreys attacked larger hosts in proportion to the hosts' body sizes, but actively avoided shorter hosts (a?? 600 mm) when larger were available. Host mortality was significantly less for larger (43-44%) than for smaller hosts (64%). However, the yearly loss of hosts per sea lamprey was less for small hosts (range, 6.8-14.2 kg per sea lamprey) than larger hosts (range, 11.4-19.3 kg per sea lamprey). Attacks at the lower of two temperature ranges (6.1-11.8A?C and 11.1-15.0A?C) did not significantly reduce the percentage of hosts killed (54% vs. 69%, p > 0.21), but longer attachment times at lower temperatures reduced the number of hosts attacked (33 vs. 45), and produced the lowest loss of hosts (6.6 kg per sea lamprey). Low temperature appeared to offset other factors that increase host mortality. Reanalysis of 789 attacks pooled from these studies, using forward stepwise logistic regression, also identified mean daily temperature as the dominant factor affecting host mortality. Observations in Lakes Superior, Huron, and Ontario support most laboratory results.

  12. Ionoregulatory changes during metamorphosis and salinity exposure of juvenile sea lamprey (Petromyzon marinus L.)

    USGS Publications Warehouse

    Reis-Santos, P.; McCormick, S.D.; Wilson, J.M.


    Ammocoetes of the anadromous sea lamprey Petromyzon marinus L. spend many years in freshwater before metamorphosing and migrating to sea. Metamorphosis involves the radical transformation from a substrate-dwelling, filter feeder into a free-swimming, parasitic feeder. In the present work we examined osmoregulatory differences between ammocoetes and transformers (metamorphic juveniles), and the effects of salinity acclimation. We measured the expression of key ion-transporting proteins [Na+/K+-ATPase, vacuolar (V)-type H+-ATPase and carbonic anhydrase (CA)] as well as a number of relevant blood parameters (hematocrit, [Na+] and [Cl -]). In addition, immunofluorescence microscopy was used to identify and characterize the distributions of Na+/K+-ATPase, V-type H+-ATPase and CA immunoreactive cells in the gill. Ammocoetes did not survive in the experiments with salinities greater than 10???, whereas survival in high salinity (???25-35???) increased with increased degree of metamorphosis in transformers. Plasma [Na+] and [Cl -] of ammocoetes in freshwater was lower than transformers and increased markedly at 10???. In transformers, plasma ions increased only at high salinity (>25???). Branchial Na+/K+-ATPase levels were ??? tenfold higher in transformers compared to ammocoetes and salinity did not affect expression in either group. However, branchial H +-ATPase expression showed a negative correlation with salinity in both groups. Na+/K+-ATPase immunoreactivity was strongest in transformers and associated with clusters of cells in the interlamellar spaces. H+-ATPase (B subunit) immunoreactivity was localized to epithelial cells not expressing high Na+/K+-ATPase immunoreactivity and having a similar tissue distribution as carbonic anhydrase. The results indicate that branchial Na+/K+-ATPase and salinity tolerance increase in metamorphosing lampreys, and that branchial H+-ATPase is downregulated by salinity.

  13. Anadromous sea lampreys (Petromyzon marinus) are ecosystem engineers in a spawning tributary

    USGS Publications Warehouse

    Hogg, Robert S.; Coghlan, Stephen M.; Zydlewski, Joseph; Simon, Kevin S.


    Sea lampreys (Petromyzon marinus) disturb the substratum during nest construction and alter the physical habitat, potentially affecting other stream organisms. We quantified differences in depth, velocity, fine-sediment coverage, embeddedness, intragravel permeability and benthic invertebrate assemblages (density and diversity) among nest mounds, nest pits and undisturbed reference locations over a 4-month period after June spawning. In 2010 and 2011, immediate and persistent effects of nest construction were assessed in summer (July) and in autumn (late September to early October), respectively. Randomly selected nests were sampled annually (25 each in summer and autumn). Nest construction increased stream-bed complexity by creating and juxtaposing shallow, swift, rocky habitat patches with deep, slow, sandy habitat patches. Mounds had a 50–143% less cover of fine sediment, and a 30–62% reduction in embeddedness, compared to pits and reference locations. These physical changes persisted into the autumn (almost 4 months). Five insect families contributed 74% of the benthic invertebrate abundance: Chironomidae (27%), Hydropsychidae (26%), Heptageniidae (8%), Philopotamidae (7%) and Ephemerellidae (6%). Densities of Hydropsychidae, Philopotamidae and Heptageniidae were up to 10 times greater in mounds than in pits and adjacent reference habitat. In summer, mounds had twice the density of Chironomidae than did pits, and 1.5 times more than reference habitats, but densities were similar among the habitats in autumn. These results suggest that spawning sea lampreys are ecosystem engineers. The physical disturbance caused by nest-building activity was significant and persistent, increasing habitat heterogeneity and favouring pollution-sensitive benthic invertebrates and, possibly, drift-feeding fish.

  14. Warmer temperatures reduce the costs of inducible defences in the marine toad, Rhinella marinus.


    van Uitregt, Vincent O; Alton, Lesley A; Heiniger, Jaime; Wilson, R S


    Many of the far-reaching impacts of climate change on ecosystem function will be due to alterations in species interactions. However, our understanding of the effects of temperature on the dynamics of interactions between species is largely inadequate. Inducible defences persist in prey populations because defensive traits increase survival in the presence of predators but are costly when they are absent. Large-scale changes in the thermal climate are likely to alter the costs or benefits of these defences for ectotherms, whose physiological processes are driven by environmental temperature. A shift in costs of defensive traits would affect not only predator-prey interactions, but also the strength of selection for inducible defences in natural populations. We investigate the effect of temperature on the costs of behavioural defences in larvae of the marine toad, Rhinella marinus. Larvae were reared in the presence or absence of predator cues at both 25 and 30 °C. When exposed to predation cues, larvae reduced activity and spent less time feeding. Exposure to predation cues also reduced metabolic rate, presumably as a by-product of reducing activity levels. Larvae exposed to predation cues also grew more slowly, were smaller at metamorphosis and were poorer jumpers after metamorphosis--three traits associated with fitness in post-metamorphic anurans. We found that the costs of behavioural defences, in terms of larval growth, post-metamorphic size and jumping performance, were exacerbated at cooler temperatures. The thermal sensitivity of costs associated with defensive traits may explain geographic variation in plasticity of defensive traits in other species and suggests that changes in environmental temperature associated with climate change may affect predator-prey interactions in subtle ways not previously considered.

  15. A role for tight junction-associated MARVEL proteins in larval sea lamprey (Petromyzon marinus) osmoregulation.


    Kolosov, Dennis; Bui, Phuong; Donini, Andrew; Wilkie, Mike P; Kelly, Scott P


    This study reports on tight junction-associated MARVEL proteins of larval sea lamprey (Petromyzon marinus) and their potential role in ammocoete osmoregulation. Two Occludin isoforms (designated Ocln and Ocln-a) and a tricellulin (Tric) were identified. Transcripts encoding ocln, ocln-a, and tric were broadly expressed in larval lamprey, with greatest abundance of ocln in gut, liver and kidney, ocln-a in the gill and skin, and tric in the kidney. Ocln and Ocln-a resolved as ∼63 kDa and ∼35 kDa MW proteins respectively while Tric resolved as a ∼50 kDa protein. Ocln immunolocalized to the gill vasculature and in gill mucous cells while Ocln-a localized to the gill pouch and gill epithelium. Both Ocln and Ocln-a localized in the nephron, the epidermis and the luminal side of the gut. In branchial tissue, Tric exhibited punctate localization, consistent with its presence at regions of tricellular contact. Following ion-poor water (IPW) acclimation of ammocoetes, serum [Na(+)] and [Cl(-)] reduced, but not [Ca(++)], and carcass moisture content increased. In association, Ocln abundance increased in skin and kidney, but reduced in gill of IPW-acclimated ammocoetes while Ocln-a abundance reduced in the kidney only. Tric abundance increased in the gill. Region-specific alterations in ocln, ocln-a and tric mRNA abundance was also observed in the gut. Data support a role for Ocln, Ocln-a and Tric in the osmoregulatory strategies of a basal vertebrate. © 2017. Published by The Company of Biologists Ltd.

  16. Agriculture Alters Gonadal Form and Function in the Toad Bufo marinus

    PubMed Central

    McCoy, Krista A.; Bortnick, Lauriel J.; Campbell, Chelsey M.; Hamlin, Heather J.; Guillette, Louis J.; St. Mary, Colette M.


    Background Many agricultural contaminants disrupt endocrine systems of wildlife. However, evidence of endocrine disruption in wild amphibians living in agricultural areas has been controversial. Typically, studies on the effects of pollutants on wildlife attempt to compare polluted with unpolluted sites. Objectives We took a novel approach to address this question by explicitly quantifying the relationship between gonadal abnormalities and habitats characterized by differing degrees of agricultural activity. Methods We quantified the occurrence of gonadal abnormalities and measures of gonadal function in at least 20 giant toads (Bufo marinus) from each of five sites that occur along a gradient of increasing agricultural land use from 0 to 97%. Results The number of abnormalities and frequency of intersex gonads increased with agriculture in a dose-dependent fashion. These gonadal abnormalities were associated with altered gonadal function. Testosterone, but not 17β-estradiol, concentrations were altered and secondary sexual traits were either feminized (increased skin mottling) or demasculinized (reduced forearm width and nuptial pad number) in intersex toads. Based on the end points we examined, female morphology and physiology did not differ across sites. However, males from agricultural areas had hormone concentrations and secondary sexual traits that were intermediate between intersex toads and non-agricultural male toads. Skin coloration at the most agricultural site was not sexually dimorphic; males had female coloration. Conclusions Steroid hormone concentrations and secondary sexual traits correlate with reproductive activity and success, so affected toads likely have reduced reproductive success. These reproductive abnormalities could certainly contribute to amphibian population declines occurring in areas exposed to agricultural contaminants. PMID:19057706

  17. Nitropelagi marinus gen. nov., sp. nov., Isolated From Seawater, Je-bu island, South Korea.


    Jeong, Sun Hwan; Lee, Sang Seob


    A Gram-stain-negative, non-spore forming, non-motile and aerobic strain, designated JB22(T), was isolated from seawater, Je-bu Island, South Korea. Strain JB22(T) was catalase and oxidase positive. Optimal growth of JB22(T) was observed at 30 °C and pH 7.0. NaCl tolerance range was 1-9 % (w/v) with an optimum of 2.0 % concentration. The phylogenetic analysis based on 16S rRNA gene sequence of strain JB22(T) showed the highest sequence similarity to those of Pelagicola litorisediminis D1-W8(T) (95.8 %), Roseovarius litoreus GSW-M15(T) (95.2 %), Roseovarius aestuarii SMK-122(T) (95.0 %), Donghicola eburmeus SW-277(T) (95.0 %), and Roseovarius halotolerans HJ50(T) (94.9 %). It contained ubiquine-10 as the major respiratory quinone and C18:1 ω7c (69.3 %), :0 (9.9 %), C18:1 ω7c 11-methyl (9.6 %) as the major fatty acid. The polar lipid profile included phosphatidylcholine, phosphatidylglycerol, and unidentified aminolipid. The DNA G+C content of the strain JB22(T) was 47 mol  %. Based on physiological and chemotaxonomic characteristics, strain JB22(T) should be regarded as a new genus of the family Rhodobacteraceae, for which the Nitropelagi marinus gen. nov., sp. nov. is proposed. The type strain is JB22(T) (= KEMB 3001-101(T) = JCM 30822(T)).

  18. Superoxide dismutases from the oyster parasite Perkinsus marinus: purification, biochemical characterization, and development of a plate microassay for activity.


    Ahmed, Hafiz; Schott, Eric J; Gauthier, Julie D; Vasta, Gerardo R


    We have isolated and biochemically characterized superoxide dismutase (SOD) activity in cell extracts of clonally cultured Perkinsus marinus, a facultative intracellular parasite of the Eastern oyster, Crassostrea virginica. In order to assess the SOD activity throughout the purification, we developed and optimized a 96-well-plate microassay based on the inhibition of pyrogallol oxidation. The assay was also adapted to identify SOD activity type (Cu/Zn-, Mn-, or FeSOD), even in mixtures of more than one type of SOD. All SOD activity detected in the cell extracts was of the FeSOD type. Most of the SOD activity in P. marinus trophozoites resides in a major component of subunit molecular weight 24 kDa. The protein was purified by affinity chromatography on an anti-SOD antibody-Sepharose column. Amino-terminal peptide sequence of the affinity-purified protein corresponds to the predicted product of the PmSOD1 gene and indicates that amino-terminal processing has taken place. The results are discussed in the context of processing of mitochondrially targeted SODs.

  19. Associations between land use and Perkinsus marinus infection of eastern oysters in a high salinity, partially urbanized estuary

    USGS Publications Warehouse

    Gray, Brian R.; Bushek, David; Drane, J. Wanzer; Porter, Dwayne


    Infection levels of eastern oysters by the unicellular pathogen Perkinsus marinus have been associated with anthropogenic influences in laboratory studies. However, these relationships have been difficult to investigate in the field because anthropogenic inputs are often associated with natural influences such as freshwater inflow, which can also affect infection levels. We addressed P. marinus-land use associations using field-collected data from Murrells Inlet, South Carolina, USA, a developed, coastal estuary with relatively minor freshwater inputs. Ten oysters from each of 30 reefs were sampled quarterly in each of 2 years. Distances to nearest urbanized land class and to nearest stormwater outfall were measured via both tidal creeks and an elaboration of Euclidean distance. As the forms of any associations between oyster infection and distance to urbanization were unknown a priori, we used data from the first and second years of the study as exploratory and confirmatory datasets, respectively. With one exception, quarterly land use associations identified using the exploratory dataset were not confirmed using the confirmatory dataset. The exception was an association between the prevalence of moderate to high infection levels in winter and decreasing distance to nearest urban land use. Given that the study design appeared adequate to detect effects inferred from the exploratory dataset, these results suggest that effects of land use gradients were largely insubstantial or were ephemeral with duration less than 3 months.

  20. Faecalicoccus acidiformans gen. nov., sp. nov., isolated from the chicken caecum, and reclassification of Streptococcus pleomorphus (Barnes et al. 1977), Eubacterium biforme (Eggerth 1935) and Eubacterium cylindroides (Cato et al. 1974) as Faecalicoccus pleomorphus comb. nov., Holdemanella biformis gen. nov., comb. nov. and Faecalitalea cylindroides gen. nov., comb. nov., respectively, within the family Erysipelotrichaceae.


    De Maesschalck, Celine; Van Immerseel, Filip; Eeckhaut, Venessa; De Baere, Siegrid; Cnockaert, Margo; Croubels, Siska; Haesebrouck, Freddy; Ducatelle, Richard; Vandamme, Peter


    Strains LMG 27428(T) and LMG 27427 were isolated from the caecal content of a chicken and produced butyric, lactic and formic acids as major metabolic end products. The genomic DNA G+C contents of strains LMG 27428(T) and LMG 27427 were 40.4 and 38.8 mol%. On the basis of 16S rRNA gene sequence similarity, both strains were most closely related to the generically misclassified Streptococcus pleomorphus ATCC 29734(T). Strain LMG 27428(T) could be distinguished from S. pleomorphus ATCC 29734(T) based on production of more lactic acid and less formic acid in M2GSC medium, a higher DNA G+C content and the absence of activities of acid phosphatase and leucine, arginine, leucyl glycine, pyroglutamic acid, glycine and histidine arylamidases, while strain LMG 27428 was biochemically indistinguishable from S. pleomorphus ATCC 29734(T). The novel genus Faecalicoccus gen. nov. within the family Erysipelotrichaceae is proposed to accommodate strains LMG 27428(T) and LMG 27427. Strain LMG 27428(T) ( =DSM 26963(T)) is the type strain of Faecalicoccus acidiformans sp. nov., and strain LMG 27427 ( =DSM 26962) is a strain of Faecalicoccus pleomorphus comb. nov. (type strain LMG 17756(T) =ATCC 29734(T) =DSM 20574(T)). Furthermore, the nearest phylogenetic neighbours of the genus Faecalicoccus are the generically misclassified Eubacterium cylindroides DSM 3983(T) (94.4% 16S rRNA gene sequence similarity to strain LMG 27428(T)) and Eubacterium biforme DSM 3989(T) (92.7% 16S rRNA gene sequence similarity to strain LMG 27428(T)). We present genotypic and phenotypic data that allow the differentiation of each of these taxa and propose to reclassify these generically misnamed species of the genus Eubacterium formally as Faecalitalea cylindroides gen. nov., comb. nov. and Holdemanella biformis gen. nov., comb. nov., respectively. The type strain of Faecalitalea cylindroides is DSM 3983(T) =ATCC 27803(T) =JCM 10261(T) and that of Holdemanella biformis is DSM 3989(T

  1. The combined influence of sub-optimal temperature and salinity on the in vitro viability of Perkinsus marinus, a protistan parasite of the eastern oyster Crassostrea virginica

    USGS Publications Warehouse

    La Peyre, M.K.; Casas, S.M.; Gayle, W.; La Peyre, Jerome F.


    Perkinsus marinus is a major cause of mortality in eastern oysters along the Gulf of Mexico and Atlantic coasts. It is also well documented that temperature and salinity are the primary environmental factors affecting P. marinus viability and proliferation. However, little is known about the effects of combined sub-optimal temperatures and salinities on P. marinus viability. This in vitro study examined those effects by acclimating P. marinus at three salinities (7, 15, 25. ppt) to 10 ??C to represent the lowest temperatures generally reached in the Gulf of Mexico, and to 2 ??C to represent the lowest temperatures reached along the mid-Atlantic coasts and by measuring changes in cell viability and density on days 1, 30, 60 and 90 following acclimation. Cell viability and density were also measured in 7. ppt cultures acclimated to each temperature and then transferred to 3.5. ppt. The largest decreases in cell viability occurred only with combined low temperature and salinity, indicating that there is clearly a synergistic effect. The largest decreases in cell viability occurred only with both low temperature and salinity after 30. days (3.5. ppt, 2 ??C: 0% viability), 60. days (3.5. ppt, 10 ??C: 0% viability) and 90. days (7. ppt, 2 ??C: 0.6 ?? 0.7%; 7. ppt, 10 ??C: 0.2 ?? 0.2%). ?? 2010 .

  2. Effects of salinity on upstream-migrating, spawning sea lamprey, Petromyzon marinus

    PubMed Central

    Ferreira-Martins, D.; Coimbra, J.; Antunes, C.; Wilson, J. M.


    The sea lamprey, Petromyzon marinus, is an anadromous, semelparous species that is vulnerable to endangered in parts of its native range due in part to loss of spawning habitat because of man-made barriers. The ability of lampreys to return to the ocean or estuary and search out alternative spawning river systems would be limited by their osmoregulatory ability in seawater. A reduction in tolerance to salinity has been documented in migrants, although the underlying mechanisms have not been characterized. We examined the capacity for marine osmoregulation in upstream spawning migrants by characterizing the physiological effects of salinity challenge from a molecular perspective. Estuarine-captured migrants held in freshwater (FW) for ∼1 week (short-term acclimation) or 2 months (long-term acclimation) underwent an incremental salinity challenge until loss of equilibrium occurred and upper thresholds of 25 and 17.5, respectively, occurred. Regardless of salinity tolerance, all lamprey downregulated FW ion-uptake mechanisms [gill transcripts of Na+:Cl− cotransporter (NCC/slc12a3) and epithelial Na+ channel (ENaC/scnn1) and kidney Na+/K+-ATPase (NKA) protein and activity but not transcript]. At their respective salinity limits, lamprey displayed a clear osmoregulatory failure and were unable to regulate [Na+] and [Cl−] in plasma and intestinal fluid within physiological limits, becoming osmocompromised. A >90% drop in haematocrit indicated haemolysis, and higher plasma concentrations of the cytosolic enzymes alanine aminotransferase, aspartate aminotransferase and lactate dehydrogenase indicated damage to other tissues, including liver. However, >80% of short-term FW-acclimated fish were able to osmoregulate efficiently, with less haemolysis and tissue damage. This osmoregulatory ability was correlated with significant upregulation of the secretory form of Na+:K+:2Cl− cotransporter (NKCC1/slc12a2) transcript levels and the re-emergence of seawater

  3. Quantitative Proteomics Shows Extensive Remodeling Induced by Nitrogen Limitation in Prochlorococcus marinus SS120

    PubMed Central

    Domínguez-Martín, Maria Agustina; Gómez-Baena, Guadalupe; Díez, Jesús; López-Grueso, Maria José; Beynon, Robert J.


    ABSTRACT Prochlorococcus requires the capability to accommodate to environmental changes in order to proliferate in oligotrophic oceans, in particular regarding nitrogen availability. A precise knowledge of the composition and changes in the proteome can yield fundamental insights into such a response. Here we report a detailed proteome analysis of the important model cyanobacterium Prochlorococcus marinus SS120 after treatment with azaserine, an inhibitor of ferredoxin-dependent glutamate synthase (GOGAT), to simulate extreme nitrogen starvation. In total, 1,072 proteins, corresponding to 57% of the theoretical proteome, were identified—the maximum proteome coverage obtained for any Prochlorococcus strain thus far. Spectral intensity, calibrated quantification by the Hi3 method, was obtained for 1,007 proteins. Statistically significant changes (P value of <0.05) were observed for 408 proteins, with the majority of proteins (92.4%) downregulated after 8 h of treatment. There was a strong decrease in ribosomal proteins upon azaserine addition, while many transporters were increased. The regulatory proteins PII and PipX were decreased, and the global nitrogen regulator NtcA was upregulated. Furthermore, our data for Prochlorococcus indicate that NtcA also participates in the regulation of photosynthesis. Prochlorococcus responds to the lack of nitrogen by slowing down translation, while inducing photosynthetic cyclic electron flow and biosynthesis of proteins involved in nitrogen uptake and assimilation. IMPORTANCE Prochlorococcus is the most abundant photosynthetic organism on Earth, contributing significantly to global primary production and playing a prominent role in biogeochemical cycles. Here we study the effects of extreme nitrogen limitation, a feature of the oligotrophic oceans inhabited by this organism. Quantitative proteomics allowed an accurate quantification of the Prochlorococcus proteome, finding three main responses to nitrogen limitation

  4. Prostaglandins as mediators of acidification in the urinary bladder of Bufo marinus

    SciTech Connect

    Frazier, L.W.; Yorio, T. )


    Experiments were performed to determine whether prostaglandins (PG) play a role in H+ and NH4+ excretion in the urinary bladder of Bufo marinus. Ten paired hemibladders from normal toads were mounted in chambers. One was control and the other hemibladder received PGE2 in the serosal medium (10(-5) M). H+ excretion was measured by change in pH in the mucosal fluid and reported in units of nmol (100 mg tissue)-1 (min)-1. NH4+ excretion was measured colorimetrically and reported in the same units. The control group H+ excretion was 8.4 +/- 1.67, while the experimental group was 16.3 +/- 2.64 (P less than 0.01). The NH4+ excretion in the experimental and control group was not significantly different. Bladders from toads in a 48-hr NH4+Cl acidosis (metabolic) did not demonstrate this response to PGE2 (P greater than 0.30). Toads were put in metabolic acidosis by gavaging with 10 ml of 120 mM NH4+Cl 3 x day for 2 days. In another experiment, we measured levels of PG in bladders from control (N) and animals placed in metabolic acidosis (MA). Bladders were removed from the respective toad, homogenized, extracted, and PG separated using high-pressure liquid chromatography and quantified against PG standards. The results are reported in ng (mg tissue)-1. PGE2 fraction in N was 1.09 +/- 0.14 and in MA was 3.21 +/- 0.63 (P less than 0.01). PGF1 alpha, F2 alpha and I2 were not significantly different in N and MA toads. Bladders were also removed from N and MA toads, and incubated in Ringer's solution containing (3H)arachidonic acid (0.2 microCi/ml) at 25 degrees C for 2 hr. Bladders were then extracted for PG and the extracts separated by thin layer chromatography. PG were identified using standards and autoradiography, scraped from plates, and counted in a scintillation detector. The results are reported in cpm/mg tissue x hr +/- SEM.

  5. The influence of temperature and salinity on the duration of embryonic development, fecundity and growth of the amphipod Echinogammarus marinus Leach (Gammaridae)

    NASA Astrophysics Data System (ADS)

    Maranhão, Paulo; Marques, João Carlos


    The effects of salinity and temperature on the duration of embryonic development, fecundity and growth of the amphipod Echinogammarus marinus Leach from the Mondego estuary (Portugal) were studied in laboratory experiments. Combinations of three temperatures (10, 15 and 20 °C) and four salinities (10, 15, 20 and 25 ‰) were used. The duration of embryonic development was 33 ± 0.7 d (mean ± S.E.) at 10 °C, 32 ± 0.5 d at 15 °C, and 17 ± 0.3 d at 20 °C. Analysis of variance demonstrated that the duration of E. marinus embryonic development, reared under different combinations of salinity and temperature, was significantly affected only by temperature ( P < 0.001). A positive correlation between the number of newborn juveniles and the size of E. marinus females (as head length) was observed. The number of juveniles released per female was higher at 10 °C and lower at 20 °C. Analysis of variance showed that only temperature significantly affected the number of juveniles released per female ( P < 0.001). Experimental data were used to calibrate the von Bertalanffy growth model. Results showed that growth was continuous throughout life under all laboratory conditions. Intrinsic growth rates were higher at 20 °C and lower at 10 °C. Analysis of covariance applied over the initial 90 d after hatching showed significant differences between growth rates of E. marinus under different salinity and temperature conditions. Extrapolation of laboratory data to the field scenario suggests that E. marinus in the Mondego estuary have a multivoltine life cycle.

  6. Components of glycine reductase from Eubacterium acidaminophilum. Cloning, sequencing and identification of the genes for thioredoxin reductase, thioredoxin and selenoprotein PA.


    Lübbers, M; Andreesen, J R


    The genes encoding thioredoxin reductase (trxB), thioredoxin (trxA), protein PA of glycine reductase (grdA) and the first 23 amino acids of the large subunit of protein PC of glycine reductase (grdC) belonging to the reductive deamination systems present in Eubacterium acidaminophilum were cloned and sequenced. The proteins were products of closely linked genes with 314 codons (thioredoxin reductase), 110 codons (thioredoxin), and 158 codons (protein PA). The protein previously called 'atypically small lipoamide dehydrogenase' or 'electron transferring flavoprotein' could now conclusively be identified as a thioredoxin reductase (subunit mass of 34781 Da) by the alignment with the enzyme of Escherichia coli showing the same typical order of the corresponding domains. The thioredoxin (molecular mass of 11742 Da) deviated considerably from the known consensus sequence, even in the most strongly conserved redox-active segment WCGPC that was now GCVPC. The selenocysteine of protein PA (molecular mass of 16609 Da) was encoded by TGA. The protein was highly similar to those of Clostridium purinolyticum and Clostridium sticklandii involved in glycine reductase. Thioredoxin reductase and thioredoxin of E. acidaminophilum could be successfully expressed in E. coli.

  7. Anaerostipes hadrus comb. nov., a dominant species within the human colonic microbiota; reclassification of Eubacterium hadrum Moore et al. 1976.


    Allen-Vercoe, Emma; Daigneault, Michelle; White, Aaron; Panaccione, Remo; Duncan, Sylvia H; Flint, Harry J; O'Neal, Lindsey; Lawson, Paul A


    Recent molecular analyses suggest that bacteria related to strains SS2/1 and SSC/2, previously reported to be distantly related to Anaerostipes caccae NCIMB 13811(T), represent one of the ten most abundant phylotypes detected in adult human faecal samples. These two strains were isolated as d-lactate-utilizing bacteria from faecal samples of a healthy individual. We show here that they share >99.9% similarity in 16S rRNA gene sequence with a new butyrate-producing isolate recovered from a colonic biopsy of a Crohn's disease patient, and also with the sequence reported recently for Eubacterium hadrum ATCC 29173(T). Biochemical profiling using API Rapid ID 32A and API ZYM test systems confirmed a close phenotypic similarity to E. hadrum ATCC 29173(T), but also indicated that the description of this species should be expanded to include the ability to produce butyrate from d-lactate and acetate. Phylogenetic analysis confirmed an affinity between E. hadrum and members of the genus Anaerostipes (92.3-94.2% sequence similarity) belonging to the family Lachnospiraceae (formerly Clostridium cluster XIVa). Based on phylogenetic, phenotypic and chemotaxonomic evidence it is proposed that E. hadrum be transferred to the genus Anaerostipes with the name Anaerostipes hadrus comb. nov. The type strain of A. hadrus comb. nov. is =ATCC 29173(T) (=DSM 3319(T) = VP 82-52(T)).

  8. Cloning, nucleotide sequence and module structure of the gene encoding the cellulose-binding protein B (CBPB) of Eubacterium cellulosolvens 5.


    Toyoda, Atsushi; Yoshimatsu, Miho; Takano, Kazunori; Minato, Hajime


    The nucleotide sequence of the gene encoding the cellulose-binding protein B (CBPB) of Eubacterium cellulosolvens 5 was determined. The gene consists of an open reading frame of 3,429 nucleotides. The deduced amino acid sequence of CBPB contained one module highly similar to a catalytic module of glycosyl hydrolase family 9 (GHF9), one module partially similar to a family 3 carbohydrate-binding module (CBM3), two linkers, one module similar to a CBM of cellulose-binding protein A (CBPA) from E. cellulosolvens 5, and one module almost identical to a cell wall-binding module (CWBM) of CBPA. The module similar to GHF9 showed CMCase activity, and the modules similar to CBM3 and CBM of CBPA bound to cellulose. Moreover, the module highly similar to CWBM of CBPA bound to the cell walls prepared from E. cellulosolvens 5. The amino acid sequence of CBPB had a significant homology (64.15% sequence identity) with that of CBPA. These results suggest that cbpA and cbpB genes descended from the same ancestral cellulase gene.

  9. PCR DGGE and RT-PCR DGGE show diversity and short-term temporal stability in the Clostridium coccoides-Eubacterium rectale group in the human intestinal microbiota.


    Maukonen, Johanna; Mättö, Jaana; Satokari, Reetta; Söderlund, Hans; Mattila-Sandholm, Tiina; Saarela, Maria


    As the Clostridium coccoides-Eubacterium rectale (Erec; clostridial phylogenetic cluster XIVa) group is one of the major groups of the human intestinal microbiota, DNA- and RNA-based population analysis techniques (denaturing gradient gel electrophoresis; DGGE) were developed and applied to assess the diversity and temporal stability (6 months-2 years) of this faecal clostridial microbiota in 12 healthy adults. The stability of the Erec group was compared with the stability of the predominant bacterial microbiota, which was also assessed with PCR-DGGE. In addition, the Erec group was quantified with a hybridization-based method. According to our results, the Erec group was diverse in each subject, but interindividual uniqueness was not as clear as that of the predominant bacteria. The Erec group was found to be temporally as stable as the predominant bacteria. Over 200 clones obtained from two samples proved the developed method to be specific. However, the amount of bacteria belonging to the Erec group was not related to the diversity of that same bacterial group. In conclusion, the newly developed DGGE method proved to be a valuable and specific tool for the direct assessment of the stability of the Erec group, demonstrating diversity in addition to short-term stability in most of the subjects studied.

  10. The strict anaerobic gut microbe Eubacterium hallii transforms the carcinogenic dietary heterocyclic amine 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP).


    Fekry, Mostafa I; Engels, Christina; Zhang, Jianbo; Schwab, Clarissa; Lacroix, Christophe; Sturla, Shana J; Chassard, Christophe


    2-Amino-1-methyl-6-phenylimidazo(4,5-b)pyridine (PhIP) is the most abundant food-derived heterocyclic aromatic amine in well-cooked meats and may contribute to the recognized carcinogenicity of processed meats. In this study, a panel of human gut microbes was tested for their ability to convert PhIP to a conjugate PhIP-M1. Eubacterium hallii was newly identified to catalyse the conversion of PhIP to PhIP-M1 with high efficiency. The reaction was shown to involve the metabolism of glycerol to 3-hydroxypropionaldehyde as a key pathway. The proficiency of E. hallii in transforming PhIP in the presence of a complex intestinal microbiota was confirmed using batch fermentations inoculated with effluents from a continuous intestinal fermentation model mimicking human proximal and distal colon microbiota. In batch fermentations inoculated with proximal colon microbiota, PhIP-M1 transformation corresponded to an up to 300-fold increase of E. hallii. In contrast, PhIP transformation of distal colon microbiota was low but increased by 120-fold after supplementation with E. hallii. These findings indicate for the first time the relevance of the abundant commensal strict anaerobe E. hallii in the transformation of a dietary carcinogen that could contribute to its detoxification in the human colon.

  11. Decreased colonization of fecal Clostridium coccoides/Eubacterium rectale species from ulcerative colitis patients in an in vitro dynamic gut model with mucin environment.


    Vermeiren, Joan; Van den Abbeele, Pieter; Laukens, Debby; Vigsnaes, Louise Kristine; De Vos, Martine; Boon, Nico; Van de Wiele, Tom


    The mucus layer in the colon, acting as a barrier to prevent invasion of pathogens, is thinner and discontinuous in patients with ulcerative colitis (UC). A recent developed in vitro dynamic gut model, the M-SHIME, was used to compare long-term colonization of the mucin layer by the microbiota from six healthy volunteers (HV) and six UC patients and thus distinguish the mucin adhered from the luminal microbiota. Although under the same nutritional conditions, short-chain fatty acid production by the luminal communities from UC patients showed a tendency toward a lower butyrate production. A more in-depth community analysis of those microbial groups known to produce butyrate revealed that the diversity of the Clostridium coccoides/Eubacterium rectale and Clostridium leptum group, and counts of Faecalibacterium prausnitzii were lower in the luminal fractions of the UC samples. Counts of Roseburia spp. were lower in the mucosal fractions of the UC samples. qPCR analysis for butyryl-CoA:acetate CoA transferase, responsible for butyrate production, displayed a lower abundance in both the luminal and mucosal fractions of the UC samples. The M-SHIME model revealed depletion in butyrate producing microbial communities not restricted to the luminal but also in the mucosal samples from UC patients compared to HV.

  12. Effect of Aloe vera whole leaf extract on short chain fatty acids production by Bacteroides fragilis, Bifidobacterium infantis and Eubacterium limosum.


    Pogribna, M; Freeman, J P; Paine, D; Boudreau, M D


    To investigate the effect of Aloe vera whole leaf extract on pure and mixed human gut bacterial cultures by assessing the bacterial growth and changes in the production of short chain fatty acids. Bacteroides fragilis, Bifidobacterium infantis, and Eubacterium limosum were incubated with Aloe vera extracts [0%, 0.5%, 1%, 1.5% and 2%; (w/v)] for 24 and 48 h. Short chain fatty acids production was measured by gas chromatography/mass spectrometry analyses. A significant linear increase in growth response to Aloe vera supplementation was observed at 24 h for each of the bacterial cultures; however, only B. infantis and a mixed bacterial culture showed a significant positive linear dose response in growth at 48 h. In pure bacteria cultures, a significantly enhanced dose response to Aloe vera supplementation was observed in the production of acetic acid by B. infantis at 24 h and of butyric acid by E. limosum at 24 and 48 h. In the mixed bacterial culture, the production of propionic acid was reduced significantly at 24 and 48 h in a dose-dependent fashion, whereas butyric acid production showed a significant linear increase. The results indicated that Aloe vera possessed bacteriogenic activity in vitro and altered the production of acetic, butyric and propionic acids by micro-organisms selected for the study. The results of the study suggest that consumption of a dietary supplement, Aloe vera, may alter the production of short chain fatty acids by human intestinal microflora.

  13. Effects of sea lamprey (Petromyzon marinus) control in the Great Lakes on aquatic plants, invertebrates and amphibians

    USGS Publications Warehouse

    Gilderhus, P.A.; Johnson, B.G.H.


    The chemicals 3-trifluoromethyl-4-nitrophenol (TFM) or a combination of TFM and 2a??,5-dichloro-4a??-nitrosalicylanilide (Bayer 73) have been used to control the sea lamprey (Petromyzon marinus) in the Great Lakes for about 20 yr. These chemicals cause some mortalities of Oligochaeta and Hirudinea, immature forms of Ephemeroptera (Hexagenia sp.), and certain Trichoptera, Simuliidae, and Amphibia (Necturus sp.). The combination of TFM and Bayer 73 may affect some Pelecypoda and Gastropoda, but its overall effects on invertebrates are probably less than those of TFM alone. Granular Bayer 73 is likely to induce mortalities among oligochaetes, microcrustaceans, chironomids, and pelecypods. No evidence exists that the lampricides have caused the catastrophic decline or disappearance of any species. The overall impact of chemical control of sea lampreys on aquatic communities has been minor compared with the benefits derived.

  14. Ultrastructure of the renal juxtaglomerular complex and peripolar cells in the axolotl (Ambystoma mexicanum) and toad (Bufo marinus).

    PubMed Central

    Hanner, R H; Ryan, G B


    Renal juxtaglomerular regions were examined in the axolotl (Ambystoma mexicanum and toad (Bufo marinus). Prominent granulated peripolar epithelial cells were found surrounding the origin of the glomerular tuft in the axolotl. These cells resembled the peripolar cells recently discovered in mammalian species. They contained multiple electron-dense cytoplasmic granules, some of which showed a paracrystalline substructure and signs of exocytoxic activity. Such cells were difficult to find and smaller in the toad. In contrast, granulated juxtaglomerular arteriolar myoephithelial cells were much more readily found and larger in the toad than in the axolotl. No consistent differences were noted in juxtaglomerular cells or their granules in response to changes in environmental chloride concentration. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 PMID:7410189

  15. Early development and organization of the retinopetal system in the larval sea lamprey, Petromyzon marinus L. An HRP study.


    Rodicio, M C; Pombal, M A; Anadón, R


    Development of the retinopetal system of the larval sea lamprey, Petromyzon marinus, was investigated following labelling of this system by injection of horseradish peroxidase into the orbit. This study extends our previous report on larval stages and provides a detailed description of the development of this system. We present quantitative and qualitative evidence suggesting that the retinopetal nuclei of Schober's M2-M5 nucleus, the mesencephalic reticular area and the tectum arise sequentially in that order, that the three retinopetal nuclei originate from a common anlage in the ventricular zone of the mesencephalic tegmentum and that the retinopetal cell population increases throughout the larval period. No neuronal death was observed. We also describe and discuss the significance of a transitory phase of retinopetal cell differentiation characterized by the presence of ventricular dendrites. Finally, we compare the development of retinopetal and retinofungal systems.

  16. The effects of bis(tributyltin) oxide on the development, reproduction and sex ratio of calanoid copepod Pseudodiaptomus marinus

    NASA Astrophysics Data System (ADS)

    Huang, Ying; Zhu, Liyan; Liu, Guangxing


    In order to study the biological effects by bis(tributyltin) oxide (TBTO) exposure, chronic toxicity tests were conducted on the calanoid copepod Pseudodiaptomus marinus over two generations. The results indicated that nauplii were more sensitive than copepodites. F1 copepods were more vulnerable than F0 copepods and a drastic increase in mortality was observed as the TBTO concentration became higher. Exposure of copepods to 60 ng l -1 TBTO concentration reduced the fecundity and resulted in some females being infecund (in the F0 generation). The time to the first egg sac for females in the F1 generation exposed to 6 ng l -1 TBTO concentration was significantly reduced, and the fecundity of this generation was increased. The female-to-male ratio in the F1 generation exposed to 20 ng l -1 TBTO concentration was significantly reduced. These results show that the current ambient TBT concentration may influence populations of copepods in the coastal environment.

  17. Predation by sea lamprey (Petromyzon marinus) on lake trout (Salvelinus namaycush) in southern Lake Ontario, 1982-1992

    USGS Publications Warehouse

    Schneider, C.P.; Owens, R.W.; Bergstedt, R.A.; O'Gorman, R.


    Dead lake trout (Salvelinus namaycush) killed by sea lamprey (Petromyzon marinus) were collected from the bottom of Lake Ontario using bottom trawls. The number of dead lake trout per hectare could be predicted from the number of type A-1 sea lamprey marks observed on live fish in September gillnet surveys (r2 = 0.60, P P > 0.05) from those of live fish with A-1 marks in 5 of 6 years where comparisons could be made. Compared with Lake Superior strain lake trout, Seneca Lake strain fish were only 0.41 times as likely to be attacked by sea lamprey and were less likely to die from an attack (both differences P < 0.05). Conservative estimates of the numbers of lake trout killed by sea lamprey in southern Lake Ontario from October to mid-November ranged from 17 000 in 1988 to 121 000 in 1984.

  18. The effect of pinealectomy, continuous light, and continuous darkness on metamorphosis of anadromous sea lampreys, Petromyzon marinus L

    SciTech Connect

    Cole, W.C.; Youson, J.H.


    The role of the pineal complex in lamprey metamorphosis was investigated by examining the influence of pinealectomy and continuous light and darkness on the initiation of this event in anadromous sea lampreys, Petromyzon marinus L. Larval lampreys, which on the basis of a condition factor were considered likely to enter metamorphosis in July, were separated in May of 1979 and 1980 into the following groups: (1) intact controls, (2) sham-operated controls, (3) pinealectomized individuals, (4) those exposed to continuous light, and (5) those exposed to continuous light or dark. The importance of the pineal complex to metamorphosis was supported by morphological evidence that, in all presumably pinealectomized individuals that entered metamorphosis, the complex had apparently not been removed during the surgical procedure. The ways in which the pineal complex may be involved in lamprey metamorphosis are discussed.

  19. Recombinant expression of the antimicrobial peptide polyphemusin and its activity against the protozoan oyster pathogen Perkinsus marinus.


    Pierce, J C; Maloy, W L; Salvador, L; Dungan, C F


    Polyphemusin is a broad-spectrum antimicrobial peptide isolated from hemocytes of the North American horseshoe crab Limulus polyphemus. To date the polyphemusin used for scientific analyses has been purified from the natural materials or obtained by chemical synthesis. We report here the recombinant expression in Escherichia coli, and subsequent purification, of a polyphemusin analogue (rLim1). To prevent toxicity of the antimicrobial peptide in the highly susceptible E. coli host, we used a carboxy-terminal fusion protein cloning strategy provided by a maltose-binding protein (MBP) gene fusion system (New England Biolabs). Antimicrobial activity of recombinant polyphemusin was similar to that seen with amidated native polyphemusin peptide. When rLim1 was tested for antibiotic activity against the apicomplexan protozoan oyster pathogen Perkinsus marinus, complete inhibition was observed at 12 micrograms/ml, and partial inhibition at 8 micrograms/ml.

  20. Timing the tides: genetic control of diurnal and lunar emergence times is correlated in the marine midge Clunio marinus.


    Kaiser, Tobias S; Neumann, Dietrich; Heckel, David G


    The intertidal zone of seacoasts, being affected by the superimposed tidal, diurnal and lunar cycles, is temporally the most complex environment on earth. Many marine organisms exhibit lunar rhythms in reproductive behaviour and some show experimental evidence of endogenous control by a circalunar clock, the molecular and genetic basis of which is unexplored. We examined the genetic control of lunar and diurnal rhythmicity in the marine midge Clunio marinus (Chironomidae, Diptera), a species for which the correct timing of adult emergence is critical in natural populations. We crossed two strains of Clunio marinus that differ in the timing of the diurnal and lunar rhythms of emergence. The phenotype distribution of the segregating backcross progeny indicates polygenic control of the lunar emergence rhythm. Diurnal timing of emergence is also under genetic control, and is influenced by two unlinked genes with major effects. Furthermore, the lunar and diurnal timing of emergence is correlated in the backcross generation. We show that both the lunar emergence time and its correlation to the diurnal emergence time are adaptive for the species in its natural environment. The correlation implies that the unlinked genes affecting lunar timing and the two unlinked genes affecting diurnal timing could be the same, providing an unexpectedly close interaction of the two clocks. Alternatively, the genes could be genetically linked in a two-by-two fashion, suggesting that evolution has shaped the genetic architecture to stabilize adaptive combinations of lunar and diurnal emergence times by tightening linkage. Our results, the first on genetic control of lunar rhythms, offer a new perspective to explore their molecular clockwork.

  1. Energy Conservation Model Based on Genomic and Experimental Analyses of a Carbon Monoxide-Utilizing, Butyrate-Forming Acetogen, Eubacterium limosum KIST612

    PubMed Central

    Jeong, Jiyeong; Bertsch, Johannes; Hess, Verena; Choi, Sunju; Choi, In-Geol


    Eubacterium limosum KIST612 is one of the few acetogens that can produce butyrate from carbon monoxide. We have used a genome-guided analysis to delineate the path of butyrate formation, the enzymes involved, and the potential coupling to ATP synthesis. Oxidation of CO is catalyzed by the acetyl-coenzyme A (CoA) synthase/CO dehydrogenase and coupled to the reduction of ferredoxin. Oxidation of reduced ferredoxin is catalyzed by the Rnf complex and Na+ dependent. Consistent with the finding of a Na+-dependent Rnf complex is the presence of a conserved Na+-binding motif in the c subunit of the ATP synthase. Butyrate formation is from acetyl-CoA via acetoacetyl-CoA, hydroxybutyryl-CoA, crotonyl-CoA, and butyryl-CoA and is consistent with the finding of a gene cluster that encodes the enzymes for this pathway. The activity of the butyryl-CoA dehydrogenase was demonstrated. Reduction of crotonyl-CoA to butyryl-CoA with NADH as the reductant was coupled to reduction of ferredoxin. We postulate that the butyryl-CoA dehydrogenase uses flavin-based electron bifurcation to reduce ferredoxin, which is consistent with the finding of etfA and etfB genes next to it. The overall ATP yield was calculated and is significantly higher than the one obtained with H2 + CO2. The energetic benefit may be one reason that butyrate is formed only from CO but not from H2 + CO2. PMID:25956767

  2. Energy Conservation Model Based on Genomic and Experimental Analyses of a Carbon Monoxide-Utilizing, Butyrate-Forming Acetogen, Eubacterium limosum KIST612.


    Jeong, Jiyeong; Bertsch, Johannes; Hess, Verena; Choi, Sunju; Choi, In-Geol; Chang, In Seop; Müller, Volker


    Eubacterium limosum KIST612 is one of the few acetogens that can produce butyrate from carbon monoxide. We have used a genome-guided analysis to delineate the path of butyrate formation, the enzymes involved, and the potential coupling to ATP synthesis. Oxidation of CO is catalyzed by the acetyl-coenzyme A (CoA) synthase/CO dehydrogenase and coupled to the reduction of ferredoxin. Oxidation of reduced ferredoxin is catalyzed by the Rnf complex and Na(+) dependent. Consistent with the finding of a Na(+)-dependent Rnf complex is the presence of a conserved Na(+)-binding motif in the c subunit of the ATP synthase. Butyrate formation is from acetyl-CoA via acetoacetyl-CoA, hydroxybutyryl-CoA, crotonyl-CoA, and butyryl-CoA and is consistent with the finding of a gene cluster that encodes the enzymes for this pathway. The activity of the butyryl-CoA dehydrogenase was demonstrated. Reduction of crotonyl-CoA to butyryl-CoA with NADH as the reductant was coupled to reduction of ferredoxin. We postulate that the butyryl-CoA dehydrogenase uses flavin-based electron bifurcation to reduce ferredoxin, which is consistent with the finding of etfA and etfB genes next to it. The overall ATP yield was calculated and is significantly higher than the one obtained with H2 + CO2. The energetic benefit may be one reason that butyrate is formed only from CO but not from H2 + CO2.

  3. Eubacterium limosum activates isoxanthohumol from hops (Humulus lupulus L.) into the potent phytoestrogen 8-prenylnaringenin in vitro and in rat intestine.


    Possemiers, Sam; Rabot, Sylvie; Espín, Juan Carlos; Bruneau, Aurélia; Philippe, Catherine; González-Sarrías, Antonio; Heyerick, Arne; Tomás-Barberán, Francisco A; De Keukeleire, Denis; Verstraete, Willy


    Recently, it was shown that the exposure to the potent hop phytoestrogen 8-prenylnaringenin (8-PN) depends on intestinal bacterial activation of isoxanthohumol (IX), but this occurs in only one-third of tested individuals. As the butyrate-producing Eubacterium limosum can produce 8-PN from IX, a probiotic strategy was applied to investigate whether 8-PN production could be increased in low 8-PN producers, thus balancing phytoestrogen exposure. Using fecal samples from high (Hop +) and low (Hop -) 8-PN-producing individuals, a Hop + and Hop - dynamic intestinal model was developed. In parallel, Hop + and Hop - human microbiota-associated rats were developed, germ-free (GF) rats acting as negative controls. IX and then IX + E. limosum were administered in the intestinal model and to the rats, and changes in 8-PN production and exposure were assessed. After dosing IX, 80% was converted into 8-PN in the Hop + model and highest 8-PN production, plasma concentrations, and urinary and fecal excretion occurred in the Hop + rats. Administration of the bacterium triggered 8-PN production in the GF rats and increased 8-PN production in the Hop - model and Hop - rats. 8-PN excretion was similar in the feces (294.1 +/- 132.2 nmol/d) and urine (8.5 +/- 1.1 nmol/d ) of all rats (n = 18). In addition, butyrate production increased in all rats. In conclusion, intestinal microbiota determined 8-PN production and exposure after IX intake. Moreover, E. limosum administration increased 8-PN production in low producers, resulting in similar 8-PN production in all rats.

  4. Cloning, sequencing, and expression of a Eubacterium cellulosolvens 5 gene encoding an endoglucanase (Cel5A) with novel carbohydrate-binding modules, and properties of Cel5A.


    Yoda, Kazutoyo; Toyoda, Atsushi; Mukoyama, Yoshihiro; Nakamura, Yutaka; Minato, Hajime


    A novel Eubacterium cellulosolvens 5 gene encoding an endoglucanase (Cel5A) was cloned and expressed in Escherichia coli, and its enzymatic properties were characterized. The cel5A gene consists of a 3,444-bp open reading frame and encodes a 1,148-amino-acid protein with a molecular mass of 127,047 Da. Cel5A is a modular enzyme consisting of an N-terminal signal peptide, two glycosyl hydrolase family 5 catalytic modules, two novel carbohydrate-binding modules (CBMs), two linker sequences, and a C-terminal sequence with an unknown function. The amino acid sequences of the two catalytic modules and the two CBMs are 94% and 73% identical to each other, respectively. Two regions that consisted of one CBM and one catalytic module were tandemly connected via a linker sequence. The CBMs did not exhibit significant sequence similarity with any other CBMs. Analyses of the hydrolytic activity of the recombinant Cel5A (rCel5A) comprising the CBMs and the catalytic modules showed that the enzyme is an endoglucanase with activities with carboxymethyl cellulose, lichenan, acid-swollen cellulose, and oat spelt xylan. To investigate the functions of the CBMs and the catalytic modules, truncated derivatives of rCel5A were constructed and characterized. There were no differences in the hydrolytic activities with various polysaccharides or in the hydrolytic products obtained from cellooligosaccharides between the two catalytic modules. Both CBMs had the same substrate affinity with intact rCel5A. Removal of the CBMs from rCel5A reduced the catalytic activities with various polysaccharides remarkably. These observations show that CBMs play an important role in the catalytic function of the enzyme.

  5. Peroxidase activity of selenoprotein GrdB of glycine reductase and stabilisation of its integrity by components of proprotein GrdE from Eubacterium acidaminophilum.


    Gröbe, Tina; Reuter, Michael; Gursinsky, Torsten; Söhling, Brigitte; Andreesen, Jan R


    The anaerobe Eubacterium acidaminophilum has been shown to contain an uncharacterized peroxidase, which may serve to protect the sensitive selenoproteins in that organism. We purified this peroxidase and found that it was identical with the substrate-specific "protein B"-complex of glycine reductase. The "protein B"-complex consists of the selenocysteine-containing GrdB subunit and two subunits, which derive from the GrdE proprotein. The specific peroxidase activity was 1.7 U (mg protein)(-1) with DTT and cumene hydroperoxide as substrates. Immunoprecipitation experiments revealed that GrdB was important for DTT- and NADH-dependent peroxidase activities in crude extracts, whereas the selenoperoxiredoxin PrxU could be depleted without affecting these peroxidase activities. GrdB could be heterologously produced in Escherichia coli with coexpression of selB and selC from E. acidaminophilum for selenocysteine insertion. Although GrdB was sensitive to proteolysis, some full-size protein was present which accounted for a peroxidase activity of about 0.5 U (mg protein)(-1) in these extracts. Mutation of the potentially redox-active UxxCxxC motif in GrdB resulted in still significant, but decreased activity. Heterologous GrdB was protected from degradation by full-length GrdE or by GrdE-domains. The GrdB-GrdE interaction was confirmed by copurification of GrdE with Strep-tagged GrdB. The data suggest that GrdE domains serve to stabilise GrdB.

  6. Metabolic properties of Eubacterium pyruvativorans, a ruminal 'hyper-ammonia-producing' anaerobe with metabolic properties analogous to those of Clostridium kluyveri.


    Wallace, R John; Chaudhary, Lal C; Miyagawa, Eiichi; McKain, N; Walker, Nicola D


    Eubacterium pyruvativorans I-6(T) is a non-saccharolytic, amino-acid-fermenting anaerobe from the rumen, isolated by its ability to grow on pancreatic casein hydrolysate (PCH) as sole C source. This study investigated its metabolic properties and its likely ecological niche. Additional growth was supported by pyruvate, vinyl acetate, and, to a lesser extent, lactate and crotonate, and also by a mixture of amino acids (alanine, glycine, serine and threonine) predicted to be catabolized to pyruvate. No single amino acid supported growth, and peptides were required for growth on amino acids. Alanine, followed by leucine, serine and proline, were used most extensively during growth, but only alanine and asparate were extensively modified before incorporation. Growth on PCH, but not on pyruvate, was increased by the addition of acetate, propionate and butyrate. l-Lactate was fermented incompletely, mainly to acetate, but no lactate-C was incorporated. Propionate and butyrate were utilized during growth, forming valerate and caproate, respectively. Labelling experiments suggested a metabolic pattern where two C atoms of butyrate, valerate and caproate were derived from amino acids, with the others being formed from acetate, propionate and butyrate. The metabolic strategy of E. pyruvativorans therefore resembles that of Clostridium kluyveri, which ferments ethanol only when the reaction is coupled to acetate, propionate or butyrate utilization. The fermentative niche of E. pyruvativorans appears to be to scavenge amino acids, lactate and possibly other metabolites in order to generate ATP via acetate formation, using volatile fatty acid elongation with C(2) units derived from other substrates to dispose of reducing equivalents.

  7. Cloning, expression, and characterization of a four-component O-demethylase from human intestinal bacterium Eubacterium limosum ZL-II.


    Chen, Jia-Xing; Deng, Chao-Yin; Zhang, Ying-Tao; Liu, Zhen-Ming; Wang, Ping-Zhang; Liu, Shu-Lin; Qian, Wei; Yang, Dong-Hui


    Eubacterium limosum ZL-II was described to convert secoisolariciresinol (SECO) to its demethylating product 4,4'-dihydroxyenterodiol (DHEND) under anoxic conditions. However, the reaction cascade remains unclear. Here, the O-demethylase being responsible for the conversion was identified and characterized. Nine genes encoding two methyltransferase-Is (MT-I), two corrinoid proteins (CP), two methyltransferase-IIs (MT-II), and three activating enzymes (AE) were screened, cloned, and expressed in Escherichia coli. Four of the nine predicted enzymes, including ELI_2003 (MT-I), ELI_2004 (CP), ELI_2005 (MT-II), and ELI_0370 (AE), were confirmed to constitute the O-demethylase in E. limosum ZL-II. The complete O-demethylase (combining the four components) reaction system was reconstructed in vitro. As expected, the demethylating products 3-demethyl-SECO and DHEND were both produced. During the reaction process, ELI_2003 (MT-I) initially catalyzed the transfer of methyl group from SECO to the corrinoid of ELI_2004 ([Co(I)]-CP), yielding demethylating products and [CH3-Co(III)]-CP; then ELI_2005 (MT-II) mediated the transfer of methyl group from [CH3-Co(III)]-CP to tetrahydrofolate, forming methyltetrahydrofolate and [Co(I)]-CP. Due to the low redox potential of [Co(II)]/[Co(I)], [Co(I)]-CP was oxidized to [Co(II)]-CP immediately in vitro, and ELI_0370 (AE) was responsible for catalyzing the reduction of [Co(II)]-CP to its active form [Co(I)]-CP. The active-site residues in ELI_2003, ELI_2005, and ELI_0370 were subsequently determined using molecular modeling combined with site-directed mutagenesis. To our knowledge, this is the first study on the identification and characterization of a four-component O-demethylase from E. limosum ZL-II, which will facilitate the development of method to artificial synthesis of related bioactive chemicals.

  8. Isolation and cloning of Omp alpha, a coiled-coil protein spanning the periplasmic space of the ancestral eubacterium Thermotoga maritima.

    PubMed Central

    Engel, A M; Cejka, Z; Lupas, A; Lottspeich, F; Baumeister, W


    We have discovered a new oligomeric protein component associated with the outer membrane of the ancestral eubacterium Thermotoga maritima. In electron micrographs, the protein, Omp alpha, appears as a rod-shaped spacer that spans the periplasm, connecting the outer membrane to the inner cell body. Purification, biochemical characterization and sequencing of Omp alpha suggest that it is a homodimer composed of two subunits of 380 amino acids with a calculated M(r) of 43,000 and a pI of 4.54. The sequence of the omp alpha gene indicates a tripartite organization of the protein with a globular NH2-terminal domain of 64 residues followed by a putative coiled-coil segment of 300 residues and a COOH-terminal, membrane-spanning segment. The predicted length of the coiled-coil segment (45 nm) correlates closely with the spacing between the inner and outer membranes. Despite sequence similarity to a large number of coiled-coil proteins and high scores in a coiled-coil prediction algorithm, the sequence of the central rod-shaped domain of Omp alpha does not have the typical 3.5 periodicity of coiled-coil proteins but rather has a periodicity of 3.58 residues. Such a periodicity was also found in the central domain of staphylococcal M protein and beta-giardin and might be indicative of a subclass of fibrous proteins with packing interactions that are distinct from the ones seen in other two-stranded coiled-coils. Images PMID:1330536

  9. The effect of CO2 acidified sea water and reduced salinity on aspects of the embryonic development of the amphipod Echinogammarus marinus (Leach).


    Egilsdottir, Hronn; Spicer, John I; Rundle, Simon D


    We investigated the effect of CO(2) acidified sea water (S=35, 22 and 10(PSU)) on embryonic development of the intertidal amphipod Echinogammarus marinus (Leach). Low pH, but not low salinity (22(PSU)), resulted in a more protracted embryonic development in situ although the effect was only evident at low salinity. However reduced salinity, not pH, exerted a strong significant effect, on numbers and calcium content of hatchlings. Females exposed to low salinity (10(PSU)) did not carry eggs through to hatching. There was no significant difference in the number of viable hatchlings between females cultured in 22 and 35(PSU) but the exoskeleton of the juveniles at 22(PSU) contained significantly less calcium. Ocean acidification may affect aspects of E. marinus development but exposure to realistic low salinities appear, in the short term, to be more important in impacting development than exposure to CO(2) acidified sea water at levels predicted for 300 years time.

  10. Reclassification of Eubacterium rectale (Prévot et al., 1967) in a new genus Agathobacter gen. nov., as Agathobacter rectalis comb. nov., within the family Lachnospiraceae, and description of Agathobacter ruminis sp. nov., from the rumen.


    Rosero, Jaime A; Killer, Jiří; Sechovcová, Hana; Mrázek, Jakub; Benada, Oldřich; Fliegerová, Kateřina; Havlík, Jaroslav; Kopečný, Jan


    Three strains of a Gram-positive, butyrate producing bacteria were isolated from the rumen content of grazing sheep and cow. The strains were anaerobic, Gram-positive cell wall, straight to slightly curved rod-shaped, non-spore-forming and single flagellate. C14:1, C14:0, C16:0 and C16:1 were the predominant fatty acids. The type of cell-wall peptidoglycan is A1γ. The DNA G+C content varied from 41.4 to 42.2 mol%. The 16S rRNA gene sequence similarities between the isolates and Eubacterium rectale, Roseburia hominis and Roseburia intestinalis were found to be 96, 95 and 95%, respectively. The phylogenetic tree showed that the strains constituted a different taxon, separate from other taxa with validly published names and forming a cluster with strains of Eubacterium rectale. On the basis of phenotypic, chemotaxonomic and phylogenetic results (16S RNA, DnaK, GroEL, atpA genes), isolates are considered to represent a novel species of a novel genus of the family Lachnospiraceae for which we propose the name Agathobacter ruminis gen. nov., sp. nov. with the type strain Agathobacter ruminis JK623T (=DSM 29029T =LMG 28559T). We also propose the transfer of Eubacterium rectale to the new genus Agathobacter gen. nov. This genus represents saccharoclastic chemoorganotrophic non-spore forming rods, with Gram-positive membrane, obligatory anaerobic. Main fermentation products on PYG medium were butyrate, acetate, hydrogen and lactate. Peptidoglycan in all species is of A1γ type. Type species is Agathobacter rectalis, gen. nov., comb nov. (Egghert 1935) with type strain ATCC 33656T (==KCTC 5835T). Two species of the new genus, Agathobacter rectalis and Agathobacter ruminis has been defined.

  11. Extensive mitochondrial introgression in North American Great Black-backed Gulls (Larus marinus) from the American Herring Gull (Larus smithsonianus) with little nuclear DNA impact.


    Pons, J-M; Sonsthagen, S; Dove, C; Crochet, P-A


    Recent genetic studies have shown that introgression rates among loci may greatly vary according to their location in the genome. In particular, several cases of mito-nuclear discordances have been reported for a wide range of organisms. In the present study, we examine the causes of discordance between mitochondrial (mtDNA) and nuclear DNA introgression detected in North American populations of the Great Black-backed Gull (Larus marinus), a Holarctic species, from the Nearctic North American Herring Gull (Larus smithsonianus). Our results show that extensive unidirectional mtDNA introgression from Larus smithsonianus into Larus marinus in North America cannot be explained by ancestral polymorphism but most likely results from ancient hybridization events occurring when Larus marinus invaded the North America. Conversely, our nuclear DNA results based on 12 microsatellites detected very little introgression from Larus smithsonianus into North American Larus marinus. We discuss these results in the framework of demographic and selective mechanisms that have been postulated to explain mito-nuclear discrepancies. We were unable to demonstrate selection as the main cause of mito-nuclear introgression discordance but cannot dismiss the possible role of selection in the observed pattern. Among demographic explanations, only drift in small populations and bias in mate choice in an invasive context may explain our results. As it is often difficult to demonstrate that selection may be the main factor driving the introgression of mitochondrial DNA in natural populations, we advocate that evaluating alternative demographic neutral hypotheses may help to indirectly support or reject hypotheses invoking selective processes.

  12. Extensive mitochondrial introgression in North American Great Black-backed Gulls (Larus marinus) from the American Herring Gull (Larus smithsonianus) with little nuclear DNA impact

    PubMed Central

    Pons, J-M; Sonsthagen, S; Dove, C; Crochet, P-A


    Recent genetic studies have shown that introgression rates among loci may greatly vary according to their location in the genome. In particular, several cases of mito-nuclear discordances have been reported for a wide range of organisms. In the present study, we examine the causes of discordance between mitochondrial (mtDNA) and nuclear DNA introgression detected in North American populations of the Great Black-backed Gull (Larus marinus), a Holarctic species, from the Nearctic North American Herring Gull (Larus smithsonianus). Our results show that extensive unidirectional mtDNA introgression from Larus smithsonianus into Larus marinus in North America cannot be explained by ancestral polymorphism but most likely results from ancient hybridization events occurring when Larus marinus invaded the North America. Conversely, our nuclear DNA results based on 12 microsatellites detected very little introgression from Larus smithsonianus into North American Larus marinus. We discuss these results in the framework of demographic and selective mechanisms that have been postulated to explain mito-nuclear discrepancies. We were unable to demonstrate selection as the main cause of mito-nuclear introgression discordance but cannot dismiss the possible role of selection in the observed pattern. Among demographic explanations, only drift in small populations and bias in mate choice in an invasive context may explain our results. As it is often difficult to demonstrate that selection may be the main factor driving the introgression of mitochondrial DNA in natural populations, we advocate that evaluating alternative demographic neutral hypotheses may help to indirectly support or reject hypotheses invoking selective processes. PMID:24105440

  13. Subcellular localization of the magnetosome protein MamC in the marine magnetotactic bacterium Magnetococcus marinus strain MC-1 using immunoelectron microscopy

    SciTech Connect

    Valverde-Tercedor, C; Abada-Molina, F; Martinez-Bueno, M; Pineda-Molina, Estela; Chen, Lijun; Oestreicher, Zachery; Lower, Brian H; Lower, Steven K; Bazylinski, Dennis A; Jimenez-Lopez, C


    Magnetotactic bacteria are a diverse group of prokaryotes that biomineralize intracellular magnetosomes, composed of magnetic (Fe3O4) crystals each enveloped by a lipid bilayer membrane that contains proteins not found in other parts of the cell. Although partial roles of some of these magnetosome proteins have been determined, the roles of most have not been completely elucidated, particularly in how they regulate the biomineralization process. While studies on the localization of these proteins have been focused solely on Magnetospirillum species, the goal of the present study was to determine, for the first time, the localization of the most abundant putative magnetosome membrane protein, MamC, in Magnetococcus marinus strain MC-1. MamC was expressed in Escherichia coli and purified. Monoclonal antibodies were produced against MamC and immunogold labeling TEM was used to localize MamC in thin sections of cells of M. marinus. Results show that MamC is located only in the magnetosome membrane of Mc. marinus. Based on our findings and the abundance of this protein, it seems likely that it is important in magnetosome biomineralization and might be used in controlling the characteristics of synthetic nanomagnetite.

  14. Subcellular localization of the magnetosome protein MamC in the marine magnetotactic bacterium Magnetococcus marinus strain MC-1 using immunoelectron microscopy.


    Valverde-Tercedor, C; Abadía-Molina, F; Martinez-Bueno, M; Pineda-Molina, Estela; Chen, Lijun; Oestreicher, Zachery; Lower, Brian H; Lower, Steven K; Bazylinski, Dennis A; Jimenez-Lopez, C


    Magnetotactic bacteria are a diverse group of prokaryotes that biomineralize intracellular magnetosomes, composed of magnetic (Fe3O4) crystals each enveloped by a lipid bilayer membrane that contains proteins not found in other parts of the cell. Although partial roles of some of these magnetosome proteins have been determined, the roles of most have not been completely elucidated, particularly in how they regulate the biomineralization process. While studies on the localization of these proteins have been focused solely on Magnetospirillum species, the goal of the present study was to determine, for the first time, the localization of the most abundant putative magnetosome membrane protein, MamC, in Magnetococcus marinus strain MC-1. MamC was expressed in Escherichia coli and purified. Monoclonal antibodies were produced against MamC and immunogold labeling TEM was used to localize MamC in thin sections of cells of M. marinus. Results show that MamC is located only in the magnetosome membrane of Mc. marinus. Based on our findings and the abundance of this protein, it seems likely that it is important in magnetosome biomineralization and might be used in controlling the characteristics of synthetic nanomagnetite.

  15. Molecular and biochemical characterization of two tungsten- and selenium-containing formate dehydrogenases from Eubacterium acidaminophilum that are associated with components of an iron-only hydrogenase.


    Graentzdoerffer, Andrea; Rauh, David; Pich, Andreas; Andreesen, Jan R


    Two gene clusters encoding similar formate dehydrogenases (FDH) were identified in Eubacterium acidaminophilum. Each cluster is composed of one gene coding for a catalytic subunit ( fdhA-I, fdhA-II) and one for an electron-transferring subunit ( fdhB-I, fdhB-II). Both fdhA genes contain a TGA codon for selenocysteine incorporation and the encoded proteins harbor five putative iron-sulfur clusters in their N-terminal region. Both FdhB subunits resemble the N-terminal region of FdhA on the amino acid level and contain five putative iron-sulfur clusters. Four genes thought to encode the subunits of an iron-only hydrogenase are located upstream of the FDH gene cluster I. By sequence comparison, HymA and HymB are predicted to contain one and four iron-sulfur clusters, respectively, the latter protein also binding sites for FMN and NAD(P). Thus, HymA and HymB seem to represent electron-transferring subunits, and HymC the putative catalytic subunit containing motifs for four iron-sulfur clusters and one H-cluster specific for Fe-only hydrogenases. HymD has six predicted transmembrane helices and might be an integral membrane protein. Viologen-dependent FDH activity was purified from serine-grown cells of E. acidaminophilum and the purified protein complex contained four subunits, FdhA and FdhB, encoded by FDH gene cluster II, and HymA and HymB, identified after determination of their N-terminal sequences. Thus, this complex might represent the most simple type of a formate hydrogen lyase. The purified formate dehydrogenase fraction contained iron, tungsten, a pterin cofactor, and zinc, but no molybdenum. FDH-II had a two-fold higher K(m) for formate (0.37 mM) than FDH-I and also catalyzed CO(2) reduction to formate. Reverse transcription (RT)-PCR pointed to increased expression of FDH-II in serine-grown cells, supporting the isolation of this FDH isoform. The fdhA-I gene was expressed as inactive protein in Escherichia coli. The in-frame UGA codon for selenocysteine

  16. Searching for intermediates in the carbon skeleton rearrangement of 2-methyleneglutarate to (R)-3-methylitaconate catalyzed by coenzyme B12-dependent 2-methyleneglutarate mutase from Eubacterium barkeri.


    Pierik, Antonio J; Ciceri, Daniele; Lopez, Ruben Fernandez; Kroll, Fritz; Bröker, Gerd; Beatrix, Birgitta; Buckel, Wolfgang; Golding, Bernard T


    Coenzyme B(12)-dependent 2-methyleneglutarate mutase from the strict anaerobe Eubacterium barkeri catalyzes the equilibration of 2-methyleneglutarate with (R)-3-methylitaconate. Proteins with mutations in the highly conserved coenzyme binding-motif DXH(X)(2)G(X)(41)GG (D483N and H485Q) exhibited decreased substrate turnover by 2000-fold and >4000-fold, respectively. These findings are consistent with the notion of H485 hydrogen-bonded to D483 being the lower axial ligand of adenosylcobalamin in 2-methyleneglutarate mutase. (E)- and (Z)-2-methylpent-2-enedioate and all four stereoisomers of 1-methylcyclopropane-1,2-dicarboxylate were synthesized and tested, along with acrylate, with respect to their inhibitory potential. Acrylate and the 2-methylpent-2-enedioates were noninhibitory. Among the 1-methylcyclopropane-1,2-dicarboxylates only the (1R,2R)-isomer displayed weak inhibition (noncompetitive, K(i) = 13 mM). Short incubation (5 min) of 2-methyleneglutarate mutase with 2-methyleneglutarate under anaerobic conditions generated an electron paramagnetic resonance (EPR) signal (g(xy) approximately 2.1; g(z) approximately 2.0), which by analogy with the findings on glutamate mutase from Clostridium cochlearium [Biochemistry, 1998, 37, 4105-4113] was assigned to cob(II)alamin coupled to a carbon-centered radical. At longer incubation times (>1 h), inactivation of the mutase occurred concomitant with the formation of oxygen-insensitive cob(II)alamin (g(xy) approximately 2.25; g(z) approximately 2.0). In order to identify the carbon-centered radical, various (13)C- and one (2)H-labeled substrate/product molecules were synthesized. Broadening (0.5 mT) of the EPR signal around g = 2.1 was observed only when C2 and/or C4 of 2-methyleneglutarate was labeled. No effect on the EPR signals was seen when [5'-(13)C]adenosylcobalamin was used as coenzyme. The inhibition and EPR data are discussed in the context of the addition-elimination and fragmentation-recombination mechanisms

  17. Ultraviolet stress delays chromosome replication in light/dark synchronized cells of the marine cyanobacterium Prochlorococcus marinus PCC9511

    PubMed Central


    Background The marine cyanobacterium Prochlorococcus is very abundant in warm, nutrient-poor oceanic areas. The upper mixed layer of oceans is populated by high light-adapted Prochlorococcus ecotypes, which despite their tiny genome (~1.7 Mb) seem to have developed efficient strategies to cope with stressful levels of photosynthetically active and ultraviolet (UV) radiation. At a molecular level, little is known yet about how such minimalist microorganisms manage to sustain high growth rates and avoid potentially detrimental, UV-induced mutations to their DNA. To address this question, we studied the cell cycle dynamics of P. marinus PCC9511 cells grown under high fluxes of visible light in the presence or absence of UV radiation. Near natural light-dark cycles of both light sources were obtained using a custom-designed illumination system (cyclostat). Expression patterns of key DNA synthesis and repair, cell division, and clock genes were analyzed in order to decipher molecular mechanisms of adaptation to UV radiation. Results The cell cycle of P. marinus PCC9511 was strongly synchronized by the day-night cycle. The most conspicuous response of cells to UV radiation was a delay in chromosome replication, with a peak of DNA synthesis shifted about 2 h into the dark period. This delay was seemingly linked to a strong downregulation of genes governing DNA replication (dnaA) and cell division (ftsZ, sepF), whereas most genes involved in DNA repair (such as recA, phrA, uvrA, ruvC, umuC) were already activated under high visible light and their expression levels were only slightly affected by additional UV exposure. Conclusions Prochlorococcus cells modified the timing of the S phase in response to UV exposure, therefore reducing the risk that mutations would occur during this particularly sensitive stage of the cell cycle. We identified several possible explanations for the observed timeshift. Among these, the sharp decrease in transcript levels of the dnaA gene

  18. Cribrihabitans marinus gen. nov., sp. nov., isolated from a biological filter in a marine recirculating aquaculture system.


    Chen, Zhu; Liu, Ying; Liu, Liang-Zi; Zhong, Zhi-Ping; Liu, Zhi-Pei; Liu, Ying


    A Gram-negative bacterium, strain CZ-AM5(T), was isolated from an aerated biological filter in a marine recirculating aquaculture system in Tianjin, China. Its taxonomic position was investigated by using a polyphasic approach. Cells of strain CZ-AM5(T) were non-spore-forming rods, 0.5-0.8 µm wide and 1.2-2.0 µm long, and motile by means of one or two polar or lateral flagella. Strain CZ-AM5(T) was strictly aerobic, heterotrophic, oxidase-negative and catalase-positive. Growth occurred at 15-40 °C (optimum, 30-35 °C), at pH 6.5-10.5 (optimum, pH 7.0-7.5) and in the presence of 0-12.0 % (w/v) NaCl (optimum, 4.0 %). The predominant fatty acid was C18 : 1ω7c (80.3 %). Ubiquinone 10 (Q-10) was the sole respiratory quinone. The polar lipids were phosphatidylcholine, phosphatidylglycerol, phosphatidylethanolamine, diphosphatidylglycerol, an unknown aminolipid, an unknown phospholipid and three unknown lipids. The DNA G+C content was 60.4 mol%. Strain CZ-AM5(T) showed the highest 16S rRNA gene sequence similarity (96.5 %) to Phaeobacter caeruleus LMG 24369(T); it exhibited 16S rRNA gene sequence similarity of 95.0-96.5, 95.2-96.3, 96.2, 94.6-95.7 and 94.8-95.8 % to members of the genera Phaeobacter, Ruegeria, Citreimonas, Leisingera and Donghicola, respectively. However, phylogenetic trees based on 16S rRNA gene sequences showed that strain CZ-AM5(T) did not join any of the above genera, but formed a distinct lineage in the trees. On the basis of phenotypic, chemotaxonomic and phylogenetic analyses, strain CZ-AM5(T) is considered to represent a novel genus and species of the family Rhodobacteraceae, for which the name Cribrihabitans marinus gen. nov., sp. nov. is proposed. The type strain of Cribrihabitans marinus is CZ-AM5(T) ( = CGMCC 1.13219(T) = JCM 19401(T)).

  19. Decomposition of sea lamprey Petromyzon marinus carcasses: temperature effects, nutrient dynamics, and implications for stream food webs

    USGS Publications Warehouse

    Weaver, Daniel M.; Coghlan, Stephen M.; Zydlewski, Joseph; Hogg, Robert S.; Canton, Michael


    Anadromous fishes serve as vectors of marine-derived nutrients into freshwaters that are incorporated into aquatic and terrestrial food webs. Pacific salmonines Oncorhynchus spp. exemplify the importance of migratory fish as links between marine and freshwater systems; however, little attention has been given to sea lamprey (Petromyzon marinus Linnaeus, 1758) in Atlantic coastal systems. A first step to understanding the role of sea lamprey in freshwater food webs is to characterize the composition and rate of nutrient inputs. We conducted laboratory and field studies characterizing the elemental composition and the decay rates and subsequent water enriching effects of sea lamprey carcasses. Proximate tissue analysis demonstrated lamprey carcass nitrogen:phosphorus ratios of 20.2:1 (±1.18 SE). In the laboratory, carcass decay resulted in liberation of phosphorus within 1 week and nitrogen within 3 weeks. Nutrient liberation was accelerated at higher temperatures. In a natural stream, carcass decomposition resulted in an exponential decline in biomass, and after 24 days, the proportion of initial biomass remaining was 27% (±3.0% SE). We provide quantitative results as to the temporal dynamics of sea lamprey carcass decomposition and subsequent nutrient liberation. These nutrient subsidies may arrive at a critical time to maximize enrichment of stream food webs.

  20. White sucker Catostomus commersonii respond to conspecific and sea lamprey Petromyzon marinus alarm cues but not potential predator cues

    USGS Publications Warehouse

    Jordbro, Ethan J.; Di Rocco, Richard T.; Imre, Istvan; Johnson, Nicholas; Brown, Grant E.


    Recent studies proposed the use of chemosensory alarm cues to control the distribution of invasive sea lamprey Petromyzon marinus populations in the Laurentian Great Lakes and necessitate the evaluation of sea lamprey chemosensory alarm cues on valuable sympatric species such as white sucker. In two laboratory experiments, 10 replicate groups (10 animals each) of migratory white suckers were exposed to deionized water (control), conspecific whole-body extract, heterospecific whole-body extract (sea lamprey) and two potential predator cues (2-phenylethylamine HCl (PEA HCl) and human saliva) during the day, and exposed to the first four of the above cues at night. White suckers avoided the conspecific and the sea lamprey whole-body extract both during the day and at night to the same extent. Human saliva did not induce avoidance during the day. PEA HCl did not induce avoidance at a higher concentration during the day, or at night at the minimum concentration that was previously shown to induce maximum avoidance by sea lamprey under laboratory conditions. Our findings suggest that human saliva and PEA HCl may be potential species-specific predator cues for sea lamprey.

  1. Whole-body systemic transcapillary filtration rates, coefficients, and isogravimetric capillary pressures in Bufo marinus and Rana catesbeiana.


    Hancock, T V; Hoagland, T M; Hillman, S S


    Whole-body and organ-level transcapillary filtration rates and coefficients are virtually unexamined in ectothermal vertebrates. These filtration rates appear to be greater than in mammals when plasma volume shifts and lymphatic function are analyzed. Gravimetric techniques monitoring whole-body mass changes were used to estimate net systemic filtration in Bufo marinus and Rana catesbeiana while perfusing with low-protein Ringer's and manipulating venous pressure. Capillary pressures were estimated from arterial and venous pressures after measuring the venous to arterial resistance ratio of 0.23. The capillary filtration coefficient (CFC) for the two species was 25.2+/-1.47 mL min-1 kg-1 kPa-1. Isogravimetric capillary pressure (Pci), the pressure at which net fluid is neither filtered nor reabsorbed, was 1.12+/-0.054 kPa and was confirmed by an independent method. None of these variables showed a significant interspecific difference. The anuran CFC and Pci are significantly higher than those found using the same method on rats (7.6+/-2.04 mL min-1 kg-1 kPa-1 and 0.3+/-0.37 kPa, respectively) and those commonly reported in mammals. Despite the high CFC, the high Pci predicts that little net filtration will occur at resting in vivo capillary pressures.

  2. Complete sequence of a sea lamprey (Petromyzon marinus) mitochondrial genome: Early establishment of the vertebrate genome organization

    SciTech Connect

    Lee, W.J.; Kocher, T.D.


    The complete nucleotide sequence of a sea lamprey (Petromyzon marinus) mitochondrial genome has been determined. The lamprey genome is 16,201 bp in length and contains genes for 13 proteins, two rRNAs, 22 tRNAs and two major noncoding regions. The order and transcriptional polarities of protein-coding genes are basically identical to those of other chordate mtDNAs, demonstrating that the common mitochondrial gene organization of vertebrates was established at early stage of vertebrate evolution. The two major noncoding regions are separated by two tRNA genes. The first region probably functions as the control region because it contains distinctive conserved sequence blocks (CSB-II and III) common to other vertebrate control regions. The central conserved domain observed in other vertebrate control regions is not found in the lamprey, suggesting that it is a recently evolved functional domain in vertebrates. Noncoding segments are not found in the expected position of the origin of replication for the second strand, suggesting either that one of the tRNA genes has a dual function or that the second noncoding region may function as the second-strand origin. The base composition at the wobble positions of fourfold degenerate codon families is highly biased toward thymine (32.7%). Values of GC- and AT-skew are typical of vertebrate mitochondrial genomes. 38 refs., 11 figs., 5 tabs.

  3. Relationship between brain gonadotropin-releasing hormone and final reproductive period of the adult male sea lamprey, Petromyzon marinus.


    Fahien, C M; Sower, S A


    Gonadotropin-releasing hormone (GnRH) concentrations were measured in brains of adult male sea lamprey, Petromyzon marinus, during their final reproductive period. The lampreys were collected during their upstream migration in coastal New Hampshire rivers and sampled at the trap (referred to as Group A) or they were transferred to an artificial spawning channel (referred to as Group B). Plasma estradiol and progesterone were also measured, and histological examination of the gonadal stages was done as well. The concentrations of brain GnRH and plasma estradiol fluctuated significantly through time. There was a rise in brain concentrations of GnRH coincident with an increase in temperature just prior to spawning. In addition, there was a significant progressive correlation between increasing plasma estradiol and temperature in lampreys from Group B during the period studied. These studies provide evidence for progressive seasonal relationships between changes in brain GnRH and gametogenic and steroidogenic activity of the gonads in adult male sea lampreys during their final reproductive period.

  4. Three Novel Bile Alcohols of Mature Male Sea Lamprey (Petromyzon marinus) Act as Chemical Cues for Conspecifics.


    Li, Ke; Scott, Anne M; Riedy, Joseph J; Fissette, Skye; Middleton, Zoe E; Li, Weiming


    Sea lamprey, Petromyzon marinus, rely heavily on chemical cues that mediate their life history events, such as migration and reproduction. Here, we describe petromyzone A-C (1-3), three novel bile alcohols that are highly oxidized and sulfated, isolated from water conditioned with spermiated male sea lamprey. Structures of these compounds were unequivocally established by spectroscopic analyses and by comparison with spectra of known compounds. Electro-olfactogram recordings showed that 1 at 10(-11) M was stimulatory to the adult sea lamprey olfactory epithelium, while 2 and 3 were stimulatory at 10(-13) M. Behavioral assays indicated that 1 is attractive, 2 is not attractive or repulsive, and 3 is repulsive to ovulated female sea lamprey. The results suggest that 1 and 2 may be putative pheromones that mediate chemical communication in sea lamprey. The identification of these three components enhances our understanding of the structures and functions of sex pheromone components in this species and may provide useful behavioral manipulation tools for the integrated management of sea lamprey, a destructive invader in the Laurentian Great Lakes.

  5. Neuronal systems immunoreactive with antiserum to lamprey gonadotropin-releasing hormone in the brain of Petromyzon marinus.


    King, J C; Sower, S A; Anthony, E L


    The role of gonadotropin-releasing hormone (GnRH) in mammalian reproduction has been studied extensively; however, the role of a structurally different, but related, decapeptide is not well characterized in the most primitive class of vertebrates, Agnatha. Utilizing an antiserum directed to the recently characterized lamprey GnRH, we examined immunoreactive neuronal perikarya and nerve fibers in sections from the brain of the sea lamprey, Petromyzon marinus, using the unlabeled peroxidase-antiperoxidase method. Neuronal perikarya and fibers were immunopositive with antisera generated to lamprey GnRH and also to certain antisera generated to mammalian GnRH. Immunopositive neuronal perikarya were detected in an arc-shaped population extending from ventral to dorsal preoptic areas. Fibers from these cells projected to the neurohypophysis via the preoptico-hypophyseal tract, but in addition also protruded into the third ventricle. Additionally, some fibers coursed along the external surface of the brain, and may also release GnRH into meningeal compartments. The presence of fully processed, mature decapeptide is indicated within neuronal perikarya, as well as in projecting nerve fibers and terminals. No reaction product was detected in sections incubated with an antiserum to the interior amino acid sequences of mammalian LHRH. This finding supports the structure reported for lamprey GnRH by Sherwood et al. (1986).

  6. Direct behavioral evidence that unique bile acids released by larval sea lamprey (Petromyzon marinus) function as a migratory pheromone

    USGS Publications Warehouse

    Bjerselius , Rickard; Li, Weiming; Teeter, John H.; Seelye, James G.; Johnson, Peter B.; Maniak, Peter J.; Grant, Gerold C.; Polkinghorne, Christine N.; Sorensen, Peter W.


    Four behavioral experiments conducted in both the laboratory and the field provide evidence that adult sea lamprey (Petromyzon marinus) select spawning rivers based on the odor of larvae that they contain and that bile acids released by the larvae are part of this pheromonal odor. First, when tested in a recirculating maze, migratory adult lamprey spent more time in water scented with larvae. However, when fully mature, adults lost their responsiveness to larvae and preferred instead the odor of mature individuals. Second, when tested in a flowing stream, migratory adults swam upstream more actively when the water was scented with larvae. Third, when migratory adults were tested in a laboratory maze containing still water, they exhibited enhanced swimming activity in the presence of a 0.1 nM concentration of the two unique bile acids released by larvae and detected by adult lamprey. Fourth, when adults were exposed to this bile acid mixture within flowing waters, they actively swam into it. Taken together, these data suggest that adult lamprey use a bile acid based larval pheromone to help them locate spawning rivers and that responsiveness to this cue is influenced by current flow, maturity, and time of day. Although the precise identity and function of the larval pheromone remain to be fully elucidated, we believe that this cue will ultimately prove useful as an attractant in sea lamprey control.

  7. New estimates of lethality of sea lamprey (Petromyzon marinus) attacks on lake trout (Salvelinus namaycush): Implications for fisheries management

    USGS Publications Warehouse

    Madenjian, C.P.; Chipman, B.D.; Marsden, J.E.


    Sea lamprey (Petromyzon marinus) control in North America costs millions of dollars each year, and control measures are guided by assessment of lamprey-induced damage to fisheries. The favored prey of sea lamprey in freshwater ecosystems has been lake trout (Salvelinus namaycush). A key parameter in assessing sea lamprey damage, as well as managing lake trout fisheries, is the probability of an adult lake trout surviving a lamprey attack. The conventional value for this parameter has been 0.55, based on laboratory experiments. In contrast, based on catch curve analysis, mark-recapture techniques, and observed wounding rates, we estimated that adult lake trout in Lake Champlain have a 0.74 probability of surviving a lamprey attack. Although sea lamprey growth in Lake Champlain was lower than that observed in Lake Huron, application of an individual-based model to both lakes indicated that the probability of surviving an attack in Lake Champlain was only 1.1 times higher than that in Lake Huron. Thus, we estimated that lake trout survive a lamprey attack in Lake Huron with a probability of 0.66. Therefore, our results suggested that lethality of a sea lamprey attack on lake trout has been overestimated in previous model applications used in fisheries management. ?? 2008 NRC.

  8. Relation of concentration and exposure time to the efficacy of niclosamide against larval sea lampreys (Petromyzon marinus)

    USGS Publications Warehouse

    Scholefield, R.J.; Bergstedt, R.A.; Bills, T.D.


    The efficacy of 2’, 5-dichloro-4’-nitrosalicylanilide (niclosamide) at various concentrations and exposure times was tested against free-swimming larval sea lampreys (Petromyzon marinus) at 12°C and 17°C in Lake Huron water. Concentrations of niclosamide in test solutions ranged from 0.46 to 4.7 mg/L with pH 7.8 to 8.3, total alkalinity 78 to 88 mg/L as CaCO3, and total hardness 95 to 105 mg/L as CaCO3. In each test, six groups of larvae were exposed to a single concentration of niclosamide for times ranging from 30 s to 30 min. Exposure time was treated as the dose and, for each concentration tested, the exposure time necessary to kill 50 and 99.9% of larvae (ET50 and ET99.9) was determined. Linear regressions of the log10-transformed ET50 and ET99.9 on the log10-transformed niclosamide concentrations were significant at both temperatures with r2ranging from 0.94 to 0.98. The predicted ET50 ranged from 58 sec to 21.7 min and the ET99.9 ranged from 2.5 to 43.5 min across the concentrations and temperatures tested. Niclosamide required a significantly longer time to kill larvae at 12°C than at 17°C.

  9. Evaluating the growth potential of sea lampreys (Petromyzon marinus) feeding on siscowet lake trout (Salvelinus namaycush) in Lake Superior

    USGS Publications Warehouse

    Moody, E.K.; Weidel, B.C.; Ahrenstorff, T.D.; Mattes, W.P.; Kitchell, J.F.


    Differences in the preferred thermal habitat of Lake Superior lake trout morphotypes create alternative growth scenarios for parasitic sea lamprey (Petromyzon marinus) attached to lake trout hosts. Siscowet lake trout (Salvelinus namaycush) inhabit deep, consistently cold water (4–6 °C) and are more abundant than lean lake trout (Salvelinus namaycush) which occupy temperatures between 8 and 12 °C during summer thermal stratification. Using bioenergetics models we contrasted the growth potential of sea lampreys attached to siscowet and lean lake trout to determine how host temperature influences the growth and ultimate size of adult sea lamprey. Sea lampreys simulated under the thermal regime of siscowets are capable of reaching sizes within the range of adult sea lamprey sizes observed in Lake Superior tributaries. High lamprey wounding rates on siscowets suggest siscowets are important lamprey hosts. In addition, siscowets have higher survival rates from lamprey attacks than those observed for lean lake trout which raises the prospect that siscowets serve as a buffer to predation on more commercially desirable hosts such as lean lake trout, and could serve to subsidize lamprey growth.

  10. Synthesis and olfactory activity of unnatural, sulfated 5β-bile acid derivatives in the sea lamprey (Petromyzon marinus)

    PubMed Central

    Burns, Aaron C.; Sorensen, Peter W.


    A variety of unnatural bile acid derivatives (9a–9f) were synthesized and used to examine the specificity with which the sea lamprey (Petromyzon marinus) olfactory system detects these compounds. These compounds are analogs of petromyzonol sulfate (PS, 1), a component of the sea lamprey migratory pheromone. Both the stereochemical configuration at C5 (i.e., 5α vs. 5β) and the extent and sites of oxygenation (hydroxylation or ketonization) of the bile acid derived steroid skeleton were evaluated by screening the compounds for olfactory activity using electro-olfactogram recording. 5β-Petromyzonol sulfate (9a) elicited a considerable olfactory response at sub-nanomolar concentration. In addition, less oxygenated systems (i.e., 9b–9e) elicited olfactory responses, albeit with less potency. The sea lamprey sex pheromone mimic 9f (5β-3-ketopetromyzonol sulfate) was also examined and found to produce a much lower olfactory response. Mixture studies conducted with 9a and PS (1) suggest that stimulation is occurring via similar modes of activation, demonstrating a relative lack of specificity for recognition of the allo-configuration (i.e., 5α) in sea lamprey olfaction. This attribute could facilitate design of pheromone analogs to control this invasive species. PMID:21145335

  11. Prevalence of Salmonella spp. in cane toads (Bufo marinus) from Grenada, West Indies, and their antimicrobial susceptibility.


    Drake, M; Amadi, V; Zieger, U; Johnson, R; Hariharan, H


    Cloacal swabs and caecal contents sampled from 58 cane toads (Bufo marinus) in St George's parish, Grenada, during a 7-month period in 2011 were examined by an enrichment and selective culture method for presence of Salmonella spp. Twenty-four (41%) toads were positive for Salmonella spp. of which eight were Salmonella enterica serovar Javiana, and eight were S. enterica serovar Rubislaw. The other serovars were as follows: Montevideo, 6; Arechavaleta, 1; and serovar: IV:43:-:-, 1. The high frequency of isolation of serovar Javiana, an emerging human pathogen associated with several outbreaks in the recent years in the eastern United States, suggests a possible role for cane toads in transmission of this serovar. Although S. Rubislaw has been isolated from lizards, bats and cases of some human infections, there is no report of its carriage by cane toads, and in such high frequency. The rate of carriage of S. Montevideo, a cause for human foodborne outbreaks around the world was also over 10% in the 58 toads sampled in this study. The antimicrobial drug susceptibility tests against amoxicillin-clavulanic acid, ampicillin, cefotaxime, ceftazidime, ciprofloxacin, enrofloxacin, gentamicin, imipenem, nalidixic acid, streptomycin, tetracycline and trimethoprim-sulfamethoxazole showed that drug resistance is minimal and is of little concern. Antimicrobial resistance was limited to ampicillin and amoxicillin-clavulanic acid in one isolate of S. Javiana and one isolate of S. Rubislaw. This is the first report of isolation and antimicrobial susceptibilities of various Salmonella serovars not identified previously in cane toads in Grenada, West Indies.

  12. Structural Mechanism for Light-driven Transport by a New Type of Chloride Ion Pump, Nonlabens marinus Rhodopsin-3.


    Hosaka, Toshiaki; Yoshizawa, Susumu; Nakajima, Yu; Ohsawa, Noboru; Hato, Masakatsu; DeLong, Edward F; Kogure, Kazuhiro; Yokoyama, Shigeyuki; Kimura-Someya, Tomomi; Iwasaki, Wataru; Shirouzu, Mikako


    The light-driven inward chloride ion-pumping rhodopsin Nonlabens marinus rhodopsin-3 (NM-R3), from a marine flavobacterium, belongs to a phylogenetic lineage distinct from the halorhodopsins known as archaeal inward chloride ion-pumping rhodopsins. NM-R3 and halorhodopsin have distinct motif sequences that are important for chloride ion binding and transport. In this study, we present the crystal structure of a new type of light-driven chloride ion pump, NM-R3, at 1.58 Å resolution. The structure revealed the chloride ion translocation pathway and showed that a single chloride ion resides near the Schiff base. The overall structure, chloride ion-binding site, and translocation pathway of NM-R3 are different from those of halorhodopsin. Unexpectedly, this NM-R3 structure is similar to the crystal structure of the light-driven outward sodium ion pump, Krokinobacter eikastus rhodopsin 2. Structural and mutational analyses of NM-R3 revealed that most of the important amino acid residues for chloride ion pumping exist in the ion influx region, located on the extracellular side of NM-R3. In contrast, on the opposite side, the cytoplasmic regions of K. eikastus rhodopsin 2 were reportedly important for sodium ion pumping. These results provide new insight into ion selection mechanisms in ion pumping rhodopsins, in which the ion influx regions of both the inward and outward pumps are important for their ion selectivities.

  13. Complete Sequence of a Sea Lamprey (Petromyzon Marinus) Mitochondrial Genome: Early Establishment of the Vertebrate Genome Organization

    PubMed Central

    Lee, W. J.; Kocher, T. D.


    The complete nucleotide sequence of a sea lamprey (Petromyzon marinus) mitochondrial genome has been determined. The lamprey genome is 16,201 bp in length and contains genes for 13 proteins, two rRNAs, 22 tRNAs and two major noncoding regions. The order and transcriptional polarities of protein-coding genes are basically identical to those of other chordate mtDNAs, demonstrating that the common mitochondrial gene organization of vertebrates was established at an early stage of vertebrate evolution. The two major noncoding regions are separated by two tRNA genes. The first region probably functions as the control region because it contains distinctive conserved sequence blocks (CSB-II and III) common to other vertebrate control regions. The central conserved domain observed in other vertebrate control regions is not found in the lamprey, suggesting that it is a recently evolved functional domain in vertebrates. Noncoding segments are not found in the expected position of the origin of replication for the second strand, suggesting either that one of the tRNA genes has a dual function or that the second noncoding region may function as the second-strand origin. The base composition at the wobble positions of fourfold degenerate codon families is highly biased toward thymine (32.7%). Values of GC-and AT-skew are typical of vertebrate mitochondrial genomes.genomes. PMID:7713438

  14. Application of a putative alarm cue hastens the arrival of invasive sea lamprey (Petromyzon marinus) at a trapping location

    USGS Publications Warehouse

    Hume, John B.; Meckley, Trevor D.; Johnson, Nicholas; Luhring, Thomas M; Siefkes, Michael J; Wagner, C. Michael


    The sea lamprey Petromyzon marinus is an invasive pest in the Laurentian Great Lakes basin, threatening the persistence of important commercial and recreational fisheries. There is substantial interest in developing effective trapping practices via the application of behavior-modifying semiochemicals (odors). Here we report on the effectiveness of utilizing repellent and attractant odors in a push–pull configuration, commonly employed to tackle invertebrate pests, to improve trapping efficacy at permanent barriers to sea lamprey migration. When a half-stream channel was activated by a naturally derived repellent odor (a putative alarm cue), we found that sea lamprey located a trap entrance significantly faster than when no odor was present as a result of their redistribution within the stream. The presence of a partial sex pheromone, acting as an attractant within the trap, was not found to further decrease the time to when sea lamprey located a trap entrance relative to when the alarm cue alone was applied. Neither the application of alarm cue singly nor alarm cue and partial sex pheromone in combination was found to improve the numbers of sea lamprey captured in the trap versus when no odor was present — likely because nominal capture rate during control trials was unusually high during the study period. Behavioural guidance using these odors has the potential to both improve control of invasive non-native sea lamprey in the Great Lakes as well as improving the efficiency of fish passage devices used in the restoration of threatened lamprey species elsewhere.

  15. Patterns of invasion and colonization of the sea lamprey (Petromyzon marinus) in North America as revealed by microsatellite genotypes.


    Bryan, M B; Zalinski, D; Filcek, K B; Libants, S; Li, W; Scribner, K T


    Invasions by exotic organisms have had devastating affects on aquatic ecosystems, both ecologically and economically. One striking example of a successful invader that has dramatically affected fish community structure in freshwater lakes of North America is the sea lamprey (Petromyzon marinus). We used eight microsatellite loci and multiple analytical techniques to examine competing hypotheses concerning the origins and colonization history of sea lamprey (n = 741). Analyses were based on replicated invasive populations from Lakes Erie, Huron, Michigan, and Superior, populations of unknown origins from Lakes Ontario, Champlain, and Cayuga, and populations of anadromous putative progenitor populations in North America and Europe. Populations in recently colonized lakes were each established by few colonists through a series of genetic bottlenecks which resulted in lower allelic diversity in more recently established populations. The spatial genetic structure of invasive populations differed from that of native populations on the Atlantic coast, reflecting founder events and connectivity of invaded habitats. Anadromous populations were found to be panmictic (theta(P) = 0.002; 95% CI = -0.003-0.006; P > 0.05). In contrast, there was significant genetic differentiation between populations in the lower and upper Great Lakes (theta(P) = 0.007; P < 0.05; 95% CI = 0.003-0.009). Populations in Lakes Ontario, Champlain, and Cayuga are native. Alternative models that describe different routes and timing of colonization of freshwater habitats were examined using coalescent-based analyses, and demonstrated that populations likely originated from natural migrations via the St Lawrence River.

  16. Behavioural response of adult sea lamprey (Petromyzon marinus) to predator and conspecific alarm cues: evidence of additive effects

    USGS Publications Warehouse

    Di Rocco, Richard T.; Imre, Istvan; Johnson, Nicholas; Brown, Grant B


    Sea lampreys Petromyzon marinus, an invasive pest in the Upper Great Lakes, avoid odours that represent danger in their habitat. These odours include conspecific alarm cues and predator cues, like 2-phenylethylamine hydrochloride (PEA HCl), which is found in the urine of mammalian predators. Whether conspecific alarm cues and predator cues function additively or synergistically when mixed together is unknown. The objectives of this experimental study were to determine if the avoidance response of sea lamprey to PEA HCl is proportional to the concentration delivered, and if the avoidance response to the combination of a predator cue (PEA HCl) and sea lamprey alarm cue is additive. To accomplish the first objective, groups of ten sea lampreys were placed in an artificial stream channel and presented with stepwise concentrations of PEA HCl ranging from 5 × 10−8 to 5 × 10−10 M and a deionized water control. Sea lampreys exhibited an increase in their avoidance behaviour in response to increasing concentrations of PEA HCl. To accomplish the second objective, sea lampreys were exposed to PEA HCl, conspecific alarm cue and a combination of the two. Sea lampreys responded to the combination of predator cue and conspecific alarm cue in an additive manner.

  17. Structural Mechanism for Light-driven Transport by a New Type of Chloride Ion Pump, Nonlabens marinus Rhodopsin-3*♦

    PubMed Central

    Hosaka, Toshiaki; Yoshizawa, Susumu; Nakajima, Yu; Ohsawa, Noboru; Hato, Masakatsu; DeLong, Edward F.; Kogure, Kazuhiro; Yokoyama, Shigeyuki; Kimura-Someya, Tomomi; Iwasaki, Wataru; Shirouzu, Mikako


    The light-driven inward chloride ion-pumping rhodopsin Nonlabens marinus rhodopsin-3 (NM-R3), from a marine flavobacterium, belongs to a phylogenetic lineage distinct from the halorhodopsins known as archaeal inward chloride ion-pumping rhodopsins. NM-R3 and halorhodopsin have distinct motif sequences that are important for chloride ion binding and transport. In this study, we present the crystal structure of a new type of light-driven chloride ion pump, NM-R3, at 1.58 Å resolution. The structure revealed the chloride ion translocation pathway and showed that a single chloride ion resides near the Schiff base. The overall structure, chloride ion-binding site, and translocation pathway of NM-R3 are different from those of halorhodopsin. Unexpectedly, this NM-R3 structure is similar to the crystal structure of the light-driven outward sodium ion pump, Krokinobacter eikastus rhodopsin 2. Structural and mutational analyses of NM-R3 revealed that most of the important amino acid residues for chloride ion pumping exist in the ion influx region, located on the extracellular side of NM-R3. In contrast, on the opposite side, the cytoplasmic regions of K. eikastus rhodopsin 2 were reportedly important for sodium ion pumping. These results provide new insight into ion selection mechanisms in ion pumping rhodopsins, in which the ion influx regions of both the inward and outward pumps are important for their ion selectivities. PMID:27365396

  18. Direct behavioral evidence that unique bile acids released by larval sea lamprey (Petromyzon marinus) function as a migratory pheromone

    USGS Publications Warehouse

    Bjerselius, R.; Li, W.; Teeter, J.H.; Seelye, J.G.; Johnsen, P.B.; Maniak, P.J.; Grant, G.C.; Polkinghorne, C.N.; Sorensen, P.W.


    Four behavioral experiments conducted in both the laboratory and the field provide evidence that adult sea lamprey (Petromyzon marinus) select spawning rivers based on the odor of larvae that they contain and that bile acids released by the larvae are part of this pheromonal odor. First, when tested in a recirculating maze, migratory adult lamprey spent more time in water scented with larvae. However, when fully mature, adults lost their responsiveness to larvae and preferred instead the odor of mature individuals. Second, when tested in a flowing stream, migratory adults swam upstream more actively when the water was scented with larvae. Third, when migratory adults were tested in a laboratory maze containing still water, they exhibited enhanced swimming activity in the presence of a 0.1 nM concentration of the two unique bile acids released by larvae and detected by adult lamprey. Fourth, when adults were exposed to this bile acid mixture within flowing waters, they actively swam into it. Taken together, these data suggest that adult lamprey use a bile acid based larval pheromone to help them locate spawning rivers and that responsiveness to this cue is influenced by current flow, maturity, and time of day. Although the precise identity and function of the larval pheromone remain to be fully elucidated, we believe that this cue will ultimately prove useful as an attractant in sea lamprey control.

  19. Nonlabens antarcticus sp. nov., a psychrophilic bacterium isolated from glacier ice, and emended descriptions of Nonlabens marinus Park et al. 2012 and Nonlabens agnitus Yi and Chun 2012.


    Kwon, Yong Min; Yang, Sung-Hyun; Kwon, Kae Kyoung; Kim, Sang-Jin


    A Gram-negative, proteorhodopsin-containing, orange pigmented, rod-shaped and strictly aerobic bacterium, designated strain AKS622(T), was isolated from a glacier core collected from the coast of King George Island, Antarctica. 16S rRNA gene sequence analysis revealed that strain AKS622(T) was affiliated to the genus Nonlabens of the family Flavobacteriaceae and showed highest similarity to Nonlabens marinus S1-08(T) (97.9%). The level of DNA-DNA relatedness between strain AKS622(T) and N. marinus S1-08(T) was 46%. Optimal growth of strain AKS622(T) was observed at pH 7.0, at 15 °C and with 2.0% NaCl. The predominant cellular fatty acids were anteiso-C(15 : 0), iso-C(16 : 0), iso-C(16 : 0) 3-OH, C17:0 2-OH and summed feature 3 (comprising C(16 : 1)ω7c and/or C(16 : 1)ω6c). The DNA G+C content was 37.9 mol%. The major respiratory quinone was MK-6. Phosphatidylethanolamine, four unidentified glycolipids, three unidentified aminolipids and one unidentified lipid were detected as major polar lipids. On the basis of the data from this polyphasic taxonomic study, it was concluded that strain AKS622(T) represents a novel species within the genus Nonlabens, for which the name Nonlabens antarcticus sp. nov. is proposed. The type strain is AKS622(T) ( = KCCM 43019(T) = JCM 14068(T)). Emended descriptions of N. marinus Park et al. 2012 and Nonlabens agnitus Yi and Chun 2012 are given.

  20. Use of physiological knowledge to control the invasive sea lamprey (Petromyzon marinus) in the Laurentian Great Lakes

    PubMed Central


    Abstract Sea lamprey (Petromyzon marinus) control in the Laurentian Great Lakes of North America is an example of using physiological knowledge to successfully control an invasive species and rehabilitate an ecosystem and valuable fishery. The parasitic sea lamprey contributed to the devastating collapse of native fish communities after invading the Great Lakes during the 1800s and early 1900s. Economic tragedy ensued with the loss of the fishery and severe impacts to property values and tourism resulting from sea lamprey-induced ecological changes. To control the sea lamprey and rehabilitate the once vibrant Great Lakes ecosystem and economy, the Great Lakes Fishery Commission (Commission) was formed by treaty between Canada and the United States in 1955. The Commission has developed a sea lamprey control programme based on their physiological vulnerabilities, which includes (i) the application of selective pesticides (lampricides), which successfully kill sedentary sea lamprey larvae in their natal streams; (ii) barriers to spawning migrations and associated traps to prevent infestations of upstream habitats and remove adult sea lamprey before they reproduce; and (iii) the release of sterilized males to reduce the reproductive potential of spawning populations in select streams. Since 1958, the application of the sea lamprey control programme has suppressed sea lamprey populations by ~90% from peak abundance. Great Lakes fish populations have rebounded and the economy is now thriving. In hopes of further enhancing the efficacy and selectivity of the sea lamprey control programme, the Commission is exploring the use of (i) sea lamprey chemosensory cues (pheromones and alarm cues) to manipulate behaviours and physiologies, and (ii) genetics to identify and manipulate genes associated with key physiological functions, for control purposes. Overall, the Commission capitalizes on the unique physiology of the sea lamprey and strives to develop a diverse integrated

  1. Application of a putative alarm cue hastens the arrival of invasive sea lamprey (Petromyzon marinus) at a trapping location

    USGS Publications Warehouse

    Hume, John B.; Meckley, Trevor D.; Johnson, Nicholas; Luhring, Thomas M; Siefkes, Michael J; Wagner, C. Michael


    The sea lamprey Petromyzon marinus is an invasive pest in the Laurentian Great Lakes basin, threatening the persistence of important commercial and recreational fisheries. There is substantial interest in developing effective trapping practices via the application of behavior-modifying semiochemicals (odors). Here we report on the effectiveness of utilizing repellent and attractant odors in a push–pull configuration, commonly employed to tackle invertebrate pests, to improve trapping efficacy at permanent barriers to sea lamprey migration. When a half-stream channel was activated by a naturally derived repellent odor (a putative alarm cue), we found that sea lamprey located a trap entrance significantly faster than when no odor was present as a result of their redistribution within the stream. The presence of a partial sex pheromone, acting as an attractant within the trap, was not found to further decrease the time to when sea lamprey located a trap entrance relative to when the alarm cue alone was applied. Neither the application of alarm cue singly nor alarm cue and partial sex pheromone in combination was found to improve the numbers of sea lamprey captured in the trap versus when no odor was present — likely because nominal capture rate during control trials was unusually high during the study period. Behavioural guidance using these odors has the potential to both improve control of invasive non-native sea lamprey in the Great Lakes as well as improving the efficiency of fish passage devices used in the restoration of threatened lamprey species elsewhere.

  2. A sea lamprey (Petromyzon marinus) sex pheromone mixture increases trap catch relative to a single synthesized component in specific environments

    USGS Publications Warehouse

    Johnson, Nicholas S.; Tix, John A.; Hlina, Benjamin L.; Wagner, C. Michael; Siefkes, Michael J.; Wang, Huiyong; Li, Weiming


    Spermiating male sea lamprey (Petromyzon marinus) release a sex pheromone, of which a component, 7α, 12α, 24-trihydoxy-3-one-5α-cholan-24-sulfate (3kPZS), has been identified and shown to induce long distance preference responses in ovulated females. However, other pheromone components exist, and when 3kPZS alone was used to control invasive sea lamprey populations in the Laurentian Great Lakes, trap catch increase was significant, but gains were generally marginal. We hypothesized that free-ranging sea lamprey populations discriminate between a partial and complete pheromone while migrating to spawning grounds and searching for mates at spawning grounds. As a means to test our hypothesis, and to test two possible uses of sex pheromones for sea lamprey control, we asked whether the full sex pheromone mixture released by males (spermiating male washings; SMW) is more effective than 3kPZS in capturing animals in traditional traps (1) en route to spawning grounds and (2) at spawning grounds. At locations where traps target sea lampreys en route to spawning grounds, SMW-baited traps captured significantly more sea lampreys than paired 3kPZS-baited traps (~10 % increase). At spawning grounds, no difference in trap catch was observed between 3kPZS and SMW-baited traps. The lack of an observed difference at spawning grounds may be attributed to increased pheromone competition and possible involvement of other sensory modalities to locate mates. Because fishes often rely on multiple and sometimes redundant sensory modalities for critical life history events, the addition of sex pheromones to traditionally used traps is not likely to work in all circumstances. In the case of the sea lamprey, sex pheromone application may increase catch when applied to specifically designed traps deployed in streams with low adult density and limited spawning habitat.

  3. Effects of inhibition gastric acid secretion on arterial acid-base status during digestion in the toad Bufo marinus.


    Andersen, Johnnie B; Andrade, Denis V; Wang, Tobias


    Digestion affects acid-base status, because the net transfer of HCl from the blood to the stomach lumen leads to an increase in HCO3(-) levels in both extra- and intracellular compartments. The increase in plasma [HCO3(-)], the alkaline tide, is particularly pronounced in amphibians and reptiles, but is not associated with an increased arterial pH, because of a concomitant rise in arterial PCO2 caused by a relative hypoventilation. In this study, we investigate whether the postprandial increase in PaCO2 of the toad Bufo marinus represents a compensatory response to the increased plasma [HCO3(-)] or a state-dependent change in the control of pulmonary ventilation. To this end, we successfully prevented the alkaline tide, by inhibiting gastric acid secretion with omeprazole, and compared the response to that of untreated toads determined in our laboratory during the same period. In addition, we used vascular infusions of bicarbonate to mimic the alkaline tide in fasting animals. Omeprazole did not affect blood gases, acid-base and haematological parameters in fasting toads, but abolished the postprandial increase in plasma [HCO3(-)] and the rise in arterial PCO2 that normally peaks 48 h into the digestive period. Vascular infusion of HCO3(-), that mimicked the postprandial rise in plasma [HCO3(-)], led to a progressive respiratory compensation of arterial pH through increased arterial PCO2. Thus, irrespective of whether the metabolic alkalosis is caused by gastric acid secretion in response to a meal or experimental infusion of bicarbonate, arterial pH is being maintained by an increased arterial PCO2. It seems, therefore, that the elevated PCO2, occuring during the postprandial period, constitutes of a regulated response to maintain pH rather than a state-dependent change in ventilatory control.

  4. Genetic architecture of local adaptation in lunar and diurnal emergence times of the marine midge Clunio marinus (Chironomidae, Diptera).


    Kaiser, Tobias S; Heckel, David G


    Circadian rhythms pre-adapt the physiology of most organisms to predictable daily changes in the environment. Some marine organisms also show endogenous circalunar rhythms. The genetic basis of the circalunar clock and its interaction with the circadian clock is unknown. Both clocks can be studied in the marine midge Clunio marinus (Chironomidae, Diptera), as different populations have different local adaptations in their lunar and diurnal rhythms of adult emergence, which can be analyzed by crossing experiments. We investigated the genetic basis of population variation in clock properties by constructing the first genetic linkage map for this species, and performing quantitative trait locus (QTL) analysis on variation in both lunar and diurnal timing. The genome has a genetic length of 167-193 centimorgans based on a linkage map using 344 markers, and a physical size of 95-140 megabases estimated by flow cytometry. Mapping the sex determining locus shows that females are the heterogametic sex, unlike most other Chironomidae. We identified two QTL each for lunar emergence time and diurnal emergence time. The distribution of QTL confirms a previously hypothesized genetic basis to a correlation of lunar and diurnal emergence times in natural populations. Mapping of clock genes and light receptors identified ciliary opsin 2 (cOps2) as a candidate to be involved in both lunar and diurnal timing; cryptochrome 1 (cry1) as a candidate gene for lunar timing; and two timeless (tim2, tim3) genes as candidate genes for diurnal timing. This QTL analysis of lunar rhythmicity, the first in any species, provides a unique entree into the molecular analysis of the lunar clock.

  5. A Sea Lamprey (Petromyzon marinus) Sex Pheromone Mixture Increases Trap Catch Relative to a Single Synthesized Component in Specific Environments.


    Johnson, Nicholas S; Tix, John A; Hlina, Benjamin L; Wagner, C Michael; Siefkes, Michael J; Wang, Huiyong; Li, Weiming


    Spermiating male sea lamprey (Petromyzon marinus) release a sex pheromone, of which a component, 7α, 12α, 24-trihydoxy-3-one-5α-cholan-24-sulfate (3kPZS), has been identified and shown to induce long distance preference responses in ovulated females. However, other pheromone components exist, and when 3kPZS alone was used to control invasive sea lamprey populations in the Laurentian Great Lakes, trap catch increase was significant, but gains were generally marginal. We hypothesized that free-ranging sea lamprey populations discriminate between a partial and complete pheromone while migrating to spawning grounds and searching for mates at spawning grounds. As a means to test our hypothesis, and to test two possible uses of sex pheromones for sea lamprey control, we asked whether the full sex pheromone mixture released by males (spermiating male washings; SMW) is more effective than 3kPZS in capturing animals in traditional traps (1) en route to spawning grounds and (2) at spawning grounds. At locations where traps target sea lampreys en route to spawning grounds, SMW-baited traps captured significantly more sea lampreys than paired 3kPZS-baited traps (~10% increase). At spawning grounds, no difference in trap catch was observed between 3kPZS and SMW-baited traps. The lack of an observed difference at spawning grounds may be attributed to increased pheromone competition and possible involvement of other sensory modalities to locate mates. Because fishes often rely on multiple and sometimes redundant sensory modalities for critical life history events, the addition of sex pheromones to traditionally used traps is not likely to work in all circumstances. In the case of the sea lamprey, sex pheromone application may increase catch when applied to specifically designed traps deployed in streams with low adult density and limited spawning habitat.

  6. Evolution of retinoic acid receptors in chordates: insights from three lamprey species, Lampetra fluviatilis, Petromyzon marinus, and Lethenteron japonicum.


    Campo-Paysaa, Florent; Jandzik, David; Takio-Ogawa, Yoko; Cattell, Maria V; Neef, Haley C; Langeland, James A; Kuratani, Shigeru; Medeiros, Daniel M; Mazan, Sylvie; Kuraku, Shigehiro; Laudet, Vincent; Schubert, Michael


    Retinoic acid (RA) signaling controls many developmental processes in chordates, from early axis specification to late organogenesis. The functions of RA are chiefly mediated by a subfamily of nuclear hormone receptors, the retinoic acid receptors (RARs), that act as ligand-activated transcription factors. While RARs have been extensively studied in jawed vertebrates (that is, gnathostomes) and invertebrate chordates, very little is known about the repertoire and developmental roles of RARs in cyclostomes, which are extant jawless vertebrates. Here, we present the first extensive study of cyclostome RARs focusing on three different lamprey species: the European freshwater lamprey, Lampetra fluviatilis, the sea lamprey, Petromyzon marinus, and the Japanese lamprey, Lethenteron japonicum. We identified four rar paralogs (rar1, rar2, rar3, and rar4) in each of the three lamprey species, and phylogenetic analyses indicate a complex evolutionary history of lamprey rar genes including the origin of rar1 and rar4 by lineage-specific duplication after the lamprey-hagfish split. We further assessed their expression patterns during embryonic development by in situ hybridization. The results show that lamprey rar genes are generally characterized by dynamic and highly specific expression domains in different embryonic tissues. In particular, lamprey rar genes exhibit combinatorial expression domains in the anterior central nervous system (CNS) and the pharyngeal region. Our results indicate that the genome of lampreys encodes at least four rar genes and suggest that the lamprey rar complement arose from vertebrate-specific whole genome duplications followed by a lamprey-specific duplication event. Moreover, we describe a combinatorial code of lamprey rar expression in both anterior CNS and pharynx resulting from dynamic and highly specific expression patterns during embryonic development. This 'RAR code' might function in regionalization and patterning of these two tissues by

  7. Mitochondrial Ca2+ homeostasis during Ca2+ influx and Ca2+ release in gastric myocytes from Bufo marinus

    PubMed Central

    Drummond, Robert M; Mix, T Christian H; Tuft, Richard A; Walsh, John V; Fay, Fredric S


    The Ca2+-sensitive fluorescent indicator rhod-2 was used to monitor mitochondrial Ca2+ concentration ([Ca2+]m) in gastric smooth muscle cells from Bufo marinus. In some studies, fura-2 was used in combination with rhod-2, allowing simultaneous measurement of cytoplasmic Ca2+ concentration ([Ca2+]i) and [Ca2+]m, respectively. During a short train of depolarizations, which causes Ca2+ influx from the extracellular medium, there was an increase in both [Ca2+]i and [Ca2+]m. The half-time (t½) to peak for the increase in [Ca2+]m was considerably longer than the t½ to peak for the increase in [Ca2+]i. [Ca2+]m remained elevated for tens of seconds after [Ca2+]i had returned to its resting value. Stimulation with caffeine, which causes release of Ca2+ from the sarcoplasmic reticulum (SR), also produced increases in both [Ca2+]i and [Ca2+]m. The values of t½ to peak for the increase in [Ca2+] in both cytoplasm and mitochondria were similar; however, [Ca2+]i returned to baseline values much faster than [Ca2+]m. Using a wide-field digital imaging microscope, changes in [Ca2+]m were monitored within individual mitochondria in situ, during stimulation of Ca2+ influx or Ca2+ release from the SR. Mitochondrial Ca2+ uptake during depolarizing stimulation caused depolarization of the mitochondrial membrane potential. The mitochondrial membrane potential recovered considerably faster than the recovery of [Ca2+]m. This study shows that Ca2+ influx from the extracellular medium and Ca2+ release from the SR are capable of increasing [Ca2+]m in smooth muscle cells. The efflux of Ca2+ from the mitochondria is a slow process and appears to be dependent upon the amount of Ca2+ in the SR. PMID:10713963

  8. Use of physiological knowledge to control the invasive sea lamprey (Petromyzon marinus) in the Laurentian Great Lakes.


    Siefkes, Michael J


    Sea lamprey (Petromyzon marinus) control in the Laurentian Great Lakes of North America is an example of using physiological knowledge to successfully control an invasive species and rehabilitate an ecosystem and valuable fishery. The parasitic sea lamprey contributed to the devastating collapse of native fish communities after invading the Great Lakes during the 1800s and early 1900s. Economic tragedy ensued with the loss of the fishery and severe impacts to property values and tourism resulting from sea lamprey-induced ecological changes. To control the sea lamprey and rehabilitate the once vibrant Great Lakes ecosystem and economy, the Great Lakes Fishery Commission (Commission) was formed by treaty between Canada and the United States in 1955. The Commission has developed a sea lamprey control programme based on their physiological vulnerabilities, which includes (i) the application of selective pesticides (lampricides), which successfully kill sedentary sea lamprey larvae in their natal streams; (ii) barriers to spawning migrations and associated traps to prevent infestations of upstream habitats and remove adult sea lamprey before they reproduce; and (iii) the release of sterilized males to reduce the reproductive potential of spawning populations in select streams. Since 1958, the application of the sea lamprey control programme has suppressed sea lamprey populations by ~90% from peak abundance. Great Lakes fish populations have rebounded and the economy is now thriving. In hopes of further enhancing the efficacy and selectivity of the sea lamprey control programme, the Commission is exploring the use of (i) sea lamprey chemosensory cues (pheromones and alarm cues) to manipulate behaviours and physiologies, and (ii) genetics to identify and manipulate genes associated with key physiological functions, for control purposes. Overall, the Commission capitalizes on the unique physiology of the sea lamprey and strives to develop a diverse integrated programme to

  9. Survival and metamorphosis of low-density populations of larval sea lampreys (Petromyzon marinus) in streams following lampricide treatment

    USGS Publications Warehouse

    Johnson, Nicholas S.; Swink, William D.; Brenden, Travis O.; Slade, Jeffrey W.; Steeves, Todd B.; Fodale, Michael F.; Jones, Michael L.


    Sea lamprey Petromyzon marinus control in the Great Lakes primarily involves application of lampricides to streams where larval production occurs to kill larvae prior to their metamorphosing and entering the lakes as parasites (juveniles). Because lampricides are not 100% effective, larvae that survive treatment maymetamorphose before streams are again treated. Larvae that survive treatment have not beenwidely studied, so their dynamics are notwell understood.Wetagged and released larvae in six Great Lake tributaries following lampricide treatment and estimated vital demographic rates using multistate tag-recovery models. Model-averaged larval survivals ranged from 56.8 to 57.6%. Model-averaged adult recovery rates, which were the product of juvenile survivals and adult capture probabilities, ranged from 6.8 to 9.3%. Using stochastic simulations, we estimated production of juvenile sea lampreys from a hypothetical population of treatment survivors under different growth conditions based on parameter estimates from this research. For fast-growing populations, juvenile production peaked 2 years after treatment. For slow-growing populations, juvenile production was approximately one-third that of fast-growing populations,with production not peaking until 4 years after treatment. Our results suggest that dynamics (i.e., survival, metamorphosis) of residual larval populations are very similar to those of untreated larval populations. Consequently, residual populations do not necessarily warrant special consideration for the purpose of sea lamprey control and can be ranked for treatment along with other populations. Consecutive lampricide treatments, which are under evaluation by the sea lamprey control program, would bemost effective for reducing juvenile production in large, fast-growing populations.

  10. Size control of in vitro synthesized magnetite crystals by the MamC protein of Magnetococcus marinus strain MC-1.


    Valverde-Tercedor, C; Montalbán-López, M; Perez-Gonzalez, T; Sanchez-Quesada, M S; Prozorov, T; Pineda-Molina, E; Fernandez-Vivas, M A; Rodriguez-Navarro, A B; Trubitsyn, D; Bazylinski, Dennis A; Jimenez-Lopez, C


    Magnetotactic bacteria are a diverse group of prokaryotes that share the unique ability of biomineralizing magnetosomes, which are intracellular, membrane-bounded crystals of either magnetite (Fe3O4) or greigite (Fe3S4). Magnetosome biomineralization is mediated by a number of specific proteins, many of which are localized in the magnetosome membrane, and thus is under strict genetic control. Several studies have partially elucidated the effects of a number of these magnetosome-associated proteins in the control of the size of magnetosome magnetite crystals. However, the effect of MamC, one of the most abundant proteins in the magnetosome membrane, remains unclear. In this present study, magnetite nanoparticles were synthesized inorganically in free-drift experiments at 25 °C in the presence of different concentrations of the iron-binding recombinant proteins MamC and MamCnts (MamC without its first transmembrane segment) from the marine, magnetotactic bacterium Magnetococcus marinus strain MC-1 and three commercial proteins [α-lactalbumin (α-Lac), myoglobin (Myo), and lysozyme (Lyz)]. While no effect was observed on the size of magnetite crystals formed in the presence of the commercial proteins, biomimetic synthesis in the presence of MamC and MamCnts at concentrations of 10-60 μg/mL resulted in the production of larger and more well-developed magnetite crystals (~30-40 nm) compared to those of the control (~20-30 nm; magnetite crystals grown protein-free). Our results demonstrate that MamC plays an important role in the control of the size of magnetite crystals and could be utilized in biomimetic synthesis of magnetite nanocrystals.

  11. Survival and metamorphosis of larval sea lamprey (Petromyzon marinus) residing in Lakes Michigan and Huron near river mouths

    USGS Publications Warehouse

    Johnson, Nicholas S.; Brenden, Travis O.; Swink, William D.; Lipps, Mathew A.


    Although population demographics of larval lampreys in streams have been studied extensively, demographics in lake environments have not. Here, we estimated survival and rates of metamorphosis for larval sea lamprey (Petromyzon marinus) populations residing in the Great Lakes near river mouths (hereafter termed lentic areas). Tagged larvae were stocked and a Bayesian multi-state tag-recovery model was used to investigate population parameters associated with tag recovery, including survival and metamorphosis probabilities. Compared to previous studies of larvae in streams, larval growth in lentic areas was substantially slower (Brody growth coefficient = 0.00132; estimate based on the recovery of six tagged larvae), survival was slightly greater (annual survival = 63%), and the length at which 50% of the larvae would be expected to metamorphose was substantially shorter (126 mm). Stochastic simulations were used to estimate the production of parasitic stage (juvenile) sea lamprey from a hypothetical population of larvae in a lentic environment. Production of juvenile sea lamprey was substantial because, even though larval growth in these environments was slow relative to stream environments, survival was high and length at metamorphosis was less. However, estimated production of juvenile sea lamprey was less for the lentic environment than for similar simulations for river environments where larvae grew faster. In circumstances where the cost to kill a larva with lampricide was equal and control funds are limited, sea lamprey control effort may be best directed toward larvae in streams with fast-growing larvae, because stream-produced larvae will most likely contribute to juvenile sea lamprey populations.

  12. Overproduction, purification, crystallization and preliminary X-ray characterization of the C-terminal family 65 carbohydrate-binding module (CBM65B) of endoglucanase Cel5A from Eubacterium cellulosolvens.


    Venditto, Immacolata; Baslé, Arnaud; Luís, Ana S; Temple, Max J; Ferreira, Luís M A; Fontes, Carlos M G A; Gilbert, Harry J; Najmudin, Shabir


    The rumen anaerobic cellulolytic bacterium Eubacterium cellulosolvens produces a large range of cellulases and hemicellulases responsible for the efficient hydrolysis of plant cell wall polysaccharides. One of these enzymes, endoglucanase Cel5A, comprises a tandemly repeated carbohydrate-binding module (CBM65) fused to a glycoside hydrolase family 5 (Cel5A) catalytic domain, joined by flexible linker sequences. The second carbohydrate-binding module located at the C-terminus side of the endoglucanase (CBM65B) has been co-crystallized with either cellohexaose or xyloglucan heptasaccharide. The crystals belong to the hexagonal space group P6(5) and tetragonal space group P4(3)2(1)2, containing a single molecule in the asymmetric unit. The structures of CBM65B have been solved by molecular replacement.

  13. Effects of injections of calcium and EGTA into the outer segments of retinal rods of Bufo marinus

    PubMed Central

    Brown, J. E.; Coles, J. A.; Pinto, L. H.


    1. Intracellular recordings were made from the outer segments of rods in the isolated, superfused retina of Bufo marinus. Cells were impaled under observation with a compound microscope fitted with an infra-red image converter. Changes of membrane voltage and some concomitant changes of input resistance were measured in response to light, membrane polarization and iontophoretic injections. 2. By means of a double barrel micropipette, charge was passed into a rod from a micropipette barrel that contained Ca2+ while no net current crossed the plasma membrane. In about half the cells, immediately after the injection, a hyperpolarization was observed that decayed with a time course similar to the decay of the receptor potential. 3. Membrane hyperpolarization also occurred after a depolarizing current stopped flowing into a rod through a single barrel pipette that contained only K-acetate. This hyperpolarization was accompanied by an increase of membrane conductance. The reversal potential for the conductance-increase was between the voltage in the dark and the voltage in the absence of [Na+]out. A larger hyperpolarization became evident after an equal depolarizing current stopped flowing into a rod through a pipette that also contained Ca2+; this larger after-hyperpolarization was due to both the cessation of depolarizing current and the injection of Ca2+. 4. A depolarization of 10-20 mV that lasted 2-60 sec became evident after hyperpolarizing current stopped flowing into a rod through a single-barrel pipette filled with K-EGTA. During the after-depolarization, the responses to small, dim spots of light were attenuated. No depolarization was observed after passing hyperpolarizing currents into rods through pipettes that contained either acetate-, SO2-4 or MOPS-. 5. These results show that sequestration of [Ca2+]in depolarizes the plasma membrane and that an increase in [Ca2+]in hyperpolarizes the membrane mimicking the later part of the receptor potential. These

  14. Defining optimal freshwater flow for oyster production: effects of freshet rate and magnitude of change and duration on eastern oysters and Perkinsus marinus infection

    USGS Publications Warehouse

    LaPeyre, Megan K.; Gossman, B.; La Peyre, Jerome F.


    In coastal Louisiana, the development of large-scale freshwater diversion projects has led to controversy over their effects on oyster resources. Using controlled laboratory experiments in combination with a field study, we examined the effects of pulsed freshwater events (freshet) of different magnitude, duration, and rate of change on oyster resources. Laboratory and field evidence indicate that low salinity events (<5 psu) decreased Perkinsus marinus infection intensities. Furthermore, when salinity was low (<5 psu), parasite infection intensities continued to decrease even as temperatures exceeded 20°C. At the same time, oyster growth was positively correlated with salinity. To maximize oyster production, data indicate that both low and high salinity events will be necessary.

  15. Changes in brain gonadotropin-releasing hormone, plasma estradiol 17-beta, and progesterone during the final reproductive cycle of the female sea lamprey, Petromyzon marinus.


    Bolduc, T G; Sower, S A


    Changes in ovarian morphology, brain gonadotropin-releasing hormone (GnRH), plasma estradiol, and progesterone were examined during the 1988 and 1989 spawning migrations of the adult female sea lamprey, Petromyzon marinus. There were significant increases through time in brain GnRH (1989) and plasma estradiol (1988 and 1989), with progesterone levels fluctuating (1988 and 1989) during the freshwater phase of the spawning migrations. In 1989, brain GnRH and plasma estradiol levels gradually increased through time until just prior to spawning when levels decreased. During 1988, there were no significant changes in GnRH, which may reflect lower temperatures in that year. These data provide new information on brain GnRH during the final maturational processes in the female sea lamprey.

  16. The influence of environmental factors on the population dynamics, reproductive biology and productivity of Echinogammarus marinus Leach (Amphipoda, Gammaridae) in the Mondego estuary (Portugal)

    NASA Astrophysics Data System (ADS)

    Maranhão, Paulo; Bengala, Nuno; Pardal, Miguel; Marques, João Carlos


    The population density of Echinogammarus marinus in the Mondego estuary changed throughout the year, with a maximum during spring. The lowest densities were found in the north arm of the estuary, and the highest ones in the inner areas of the south arm. Higher densities appeared associated with the presence of muddy deposits under Fucus vesiculosus (Phaeophyta) and also with the presence of green macroalgae biomass over the sediments. Females were morphologically recognisable at smaller sizes than males, but males became larger than females. Fecundity increases with the size of females and is influenced by temperature and salinity. Sexual activity and recruitment take place continuously throughout the year, although it almost ceases by the end of winter. Present results are in opposition to the hypothesis of discontinuous recruitment presented in a previous study. Productivity (ash free dry weight- AFDW) was estimated at 1.74 to 2.45 g·m -2·year -1 in the north arm of the estuary corresponding to an annual turnover ratio ( P/ B¯) of 4.14 to 6.18. In the south arm, productivity was estimated at 1.96 to 2.74 g AFDW·m -2·year -1 in the middle section ( P/ B¯ of 4.68 to 6.56), and at 3.85 to 5.38 g AFDW·m -2·year -1 in the innermost sampling area ( P/ B¯ of 4.54 to 6.36). Differences in productivity appeared to depend only on population density, while annual P/ B¯ ratios were similar over the estuary. Evidence was found that several features of E. marinus population dynamics were dependent on environmental factors resulting from the particular estuary hydraulic regime.

  17. Effects of meal size, meal type, body temperature, and body size on the specific dynamic action of the marine toad, Bufo marinus.


    Secor, Stephen M; Faulkner, Angela C


    Specific dynamic action (SDA), the accumulated energy expended on all physiological processes associated with meal digestion, is strongly influenced by features of both the meal and the organism. We assessed the effects of meal size, meal type, body temperature, and body size on the postprandial metabolic response and calculated SDA of the marine toad, Bufo marinus. Peak postprandial rates of O(2) consumption (.V(O2)) and CO(2) production (.V(CO2)) and SDA increased with meal size (5%-20% of body mass). Postprandial metabolism was impacted by meal type; the digestion of hard-bodied superworms (Zophobas larva) and crickets was more costly than the digestion of soft-bodied earthworms and juvenile rats. An increase in body temperature (from 20 degrees to 35 degrees C) altered the postprandial metabolic profile, decreasing its duration and increasing its magnitude, but did not effect SDA, with the cost of meal digestion remaining constant across body temperatures. Allometric mass exponents were 0.69 for standard metabolic rate, 0.85 for peak postprandial .V(O2), and 1.02 for SDA; therefore, the factorial scope of peak postprandial .V(O2) increased with body mass. The mass of nutritive organs (stomach, liver, intestines, and kidneys) accounted for 38% and 20% of the variation in peak postprandial .V(O2) and SDA, respectively. Toads forced to exercise experienced 25-fold increases in .V(O2) much greater than the 5.5-fold increase experience during digestion. Controlling for meal size, meal type, and body temperature, the specific dynamic responses of B. marinus are similar to those of the congeneric Bufo alvarius, Bufo boreas, Bufo terrestris, and Bufo woodhouseii.

  18. Evidence that progestins play an important role in spermiation and pheromone production in male sea lamprey (Petromyzon marinus).


    Bryan, Mara Beth; Chung-Davidson, Yu-Wen; Ren, Jianfeng; Bowman, Stephen; Scott, Alexander P; Huertas, Mar; Connolly, Michael Patrick; Li, Weiming


    Progestins (progestogens, C21 steroids) have been shown to regulate key physiological activities for reproduction in both sexes in all classes of vertebrates except for Agnathans. Progesterone (P) and 15α-hydroxyprogesterone (15α-P) have been detected in sea lamprey (Petromyzon marinus) plasma, but the expression patterns and functions of putative progestin receptor genes have not yet been investigated. The first objective of this study was to determine the differences in mRNA expression levels of nuclear progestin receptor (nPR) and the membrane receptor adaptor protein 'progesterone receptor membrane component 1' (pgrmc1) in putative target tissues in males at different life stages, with and without lamprey GnRH-I and -III treatment. The second objective was to demonstrate the function of progestins by implanting prespermiating males (PSM) with time-release pellets of P and measuring the latency to the onset of spermiation and plasma concentrations of sex pheromones and steroids. The third objective was to measure the binding affinity of P in the nuclear and membrane fractions of the target tissues. Expression levels of nPR and pgrmc1 differed between life stages and tissues, and in some cases were differentially responsive to lamprey GnRH-I and -III. Increases in nPR and pgrmc1 gene expressions were correlated to the late stages of sexual maturation in males. The highest expression levels of these genes were found in the liver and gill of spermiating males. These organs are, respectively, the site of production and release of the sex pheromone 3 keto-petromyzonol sulfate (3kPZS). The hypothesis that pheromone production may be under hormonal control was tested in vivo by implanting PSM with time-release pellets of P. Concentrations of 3kPZS in plasma after 1week were 50-fold higher than in controls or in males that had been implanted with androstenedione, supporting the hypothesis that P is responsible for regulating the production of the sex pheromone. P

  19. Effects of gossypol on sperm viability and plasma sex steroid hormones in male sea lamprey, Petromyzon marinus.


    Rinchard, J; Ciereszko, A; Dabrowski, K; Ottobre, J


    Male sea lampreys Petromyzon marinus were injected with different doses of gossypol acetic acid in an attempt to sterilize them for use in a program for controlling the sea lampreys through the release of sterile males. Two lots of sea lamprey were used in these experiments. The first lot was divided into three groups and fish were injected intraperitoneally (i.p.) with 0.2 ml 50% ethanol as a control group or with gossypol suspended in ethanol at 100 and 200 mg/kg. The second lot was also divided into three groups and fish were either injected i.p. with vehicle as controls or gossypol at 25 and 50 mg/kg. Sperm weight, concentrations and motility were recorded after 31, 36 and 40 days or 24, 28 and 33 days in lots 1 and 2, respectively. Blood was collected from the caudal vessel prior to injections with gossypol and after 40 or 33 days in lots 1 and 2, respectively. Plasma levels of estradiol-17beta (E2), testosterone (T), progesterone (P) and 17,20beta-dihydroxy-4-pregnen-3-one (17,20betaP) were measured by radioimmunoassay. At the end of the experiment, the testis were removed and fixed in Bouin's solution for histological examination. High mortality was observed at the day of injection in the group treated with 200 mg/kg (84.6%), 100 mg/kg (41.7%), and 50 mg/kg (25%). Sperm concentrations were higher in control fish in comparison to most of the treated groups during the first sperm sampling (day 31 or 24), but then differences disappeared. At each sampling, sperm motility was higher in control groups than in treated groups and significant differences were observed (e.g. between control and 50 mg gossypol/kg). Fertility, evaluated at optimized sperm/egg ratio (5 x 10(4) sperm/egg) did not differ among treatments and controls. Changes in mean plasma sex steroid levels in the various treated groups were not significant, but a trend of decreasing plasma E2 was observed with increasing dose of gossypol. The structure of the testis was examined at the end of the

  20. Phylogenomic analysis of the family Peptostreptococcaceae (Clostridium cluster XI) and proposal for reclassification of Clostridium litorale (Fendrich et al. 1991) and Eubacterium acidaminophilum (Zindel et al. 1989) as Peptoclostridium litorale gen. nov. comb. nov. and Peptoclostridium acidaminophilum comb. nov.

    PubMed Central

    Brover, Vyacheslav; Tolstoy, Igor; Yutin, Natalya


    In 1994, analyses of clostridial 16S rRNA gene sequences led to the assignment of 18 species to Clostridium cluster XI, separating them from Clostridium sensu stricto (Clostridium cluster I). Subsequently, most cluster XI species have been assigned to the family Peptostreptococcaceae with some species being reassigned to new genera. However, several misclassified Clostridium species remained, creating a taxonomic conundrum and confusion regarding their status. Here, we have re-examined the phylogeny of cluster XI species by comparing the 16S rRNA gene-based trees with protein- and genome-based trees, where available. The resulting phylogeny of the Peptostreptococcaceae was consistent with the recent proposals on creating seven new genera within this family. This analysis also revealed a tight clustering of Clostridium litorale and Eubacterium acidaminophilum. Based on these data, we propose reassigning these two organisms to the new genus Peptoclostridium as Peptoclostridium litorale gen. nov. comb. nov. (the type species of the genus) and Peptoclostridium acidaminophilum comb. nov., respectively. As correctly noted in the original publications, the genera Acetoanaerobium and Proteocatella also fall within cluster XI, and can be assigned to the Peptostreptococcaceae. Clostridium sticklandii, which falls within radiation of genus Acetoanaerobium, is proposed to be reclassified as Acetoanaerobium sticklandii comb. nov. The remaining misnamed members of the Peptostreptococcaceae, [Clostridium] hiranonis, [Clostridium] paradoxum and [Clostridium] thermoalcaliphilum, still remain to be properly classified. PMID:27902180

  1. Phylogenomic analysis of the family Peptostreptococcaceae (Clostridium cluster XI) and proposal for reclassification of Clostridium litorale (Fendrich et al. 1991) and Eubacterium acidaminophilum (Zindel et al. 1989) as Peptoclostridium litorale gen. nov. comb. nov. and Peptoclostridium acidaminophilum comb. nov.


    Galperin, Michael Y; Brover, Vyacheslav; Tolstoy, Igor; Yutin, Natalya


    In 1994, analyses of clostridial 16S rRNA gene sequences led to the assignment of 18 species to Clostridium cluster XI, separating them from Clostridium sensu stricto (Clostridium cluster I). Subsequently, most cluster XI species have been assigned to the family Peptostreptococcaceae with some species being reassigned to new genera. However, several misclassified Clostridium species remained, creating a taxonomic conundrum and confusion regarding their status. Here, we have re-examined the phylogeny of cluster XI species by comparing the 16S rRNA gene-based trees with protein- and genome-based trees, where available. The resulting phylogeny of the Peptostreptococcaceae was consistent with the recent proposals on creating seven new genera within this family. This analysis also revealed a tight clustering of Clostridium litorale and Eubacterium acidaminophilum. Based on these data, we propose reassigning these two organisms to the new genus Peptoclostridium as Peptoclostridium litorale gen. nov. comb. nov. (the type species of the genus) and Peptoclostridium acidaminophilum comb. nov., respectively. As correctly noted in the original publications, the genera Acetoanaerobium and Proteocatella also fall within cluster XI, and can be assigned to the Peptostreptococcaceae. Clostridium sticklandii, which falls within radiation of genus Acetoanaerobium, is proposed to be reclassified as Acetoanaerobium sticklandii comb. nov. The remaining misnamed members of the Peptostreptococcaceae, [Clostridium] hiranonis, [Clostridium] paradoxum and [Clostridium] thermoalcaliphilum, still remain to be properly classified.

  2. Metabolism of the /sup 18/O-methoxy substituent of 3-methoxybenzoic acid and other unlabeled methoxybenzoic acids by anaerobic bacteria. [Eubacterium limosum; Acetobacterium woodil; Syntrophococcus; Clostridium; Desulfotomaculum; Enterobacter

    SciTech Connect

    DeWeerd, J.A.; Saxena, A.; Nagle, D.P. Jr.; Sulflita, J.M.


    The mechanism of the bioconversion of methoxylated benzoic acids to the hydroxylated derivatives was investigated with a model substrate and cultures of one anaerobic consortium, eight strict anaerobic bacteria, and one facultative anaerobic microorganism. We found that a haloaromatic dehalogenating consortium, a dehalogenating isolate from that consortium, Eubacterium, limosum, and a strain of Acetobacterium woodii metabolized 3-(methoxy-/sup 18/O)methoxybenzoic acid (3-anisic acid) to 3-(hydroxy-/sup 18/O)hydroxybenzoic acid stoichiometrically at rates of 1.5, 3.2, 52.4, and 36.7 nmol/min per mg of protein, respectively. A different strain of Acetobacterium and strains of Syntrophococcus, Clostridium Desulfotomaculum, Enterobacter, and an anaerobic bacterium, strain TH-001, were unable to transform this compound. The O-demethylating ability of E. limosum was induced only with appropriate methoxylated benzoates but not with D-glucose, lactate, isoleucine, or methanol. Cross-acclimation and growth experiments with E. limosum showed a rate of metabolism that was an order of magnitude slower and showed no growth with either 4-methoxysalicylic acid (2-hydroxy-4-methoxybenzoic acid) or 4-anisic acid (4-methoxybenzoic acid) when adapted to 3-anisic acid. However, A. woodii NZva-16 showed slower rates and no growth with 3- or 4-methoxysalicylic acid when adapted to 3-anisic acid in similar experiments.

  3. Formation of ursodeoxycholic acid from chenodeoxycholic acid by a 7 beta-hydroxysteroid dehydrogenase-elaborating Eubacterium aerofaciens strain cocultured with 7 alpha-hydroxysteroid dehydrogenase-elaborating organisms.

    PubMed Central

    MacDonald, I A; Rochon, Y P; Hutchison, D M; Holdeman, L V


    A gram-positive, anaerobic, chain-forming, rod-shaped anaerobe (isolate G20-7) was isolated from normal human feces. This organism was identified by cellular morphology as well as fermentative and biochemical data as Eubacterium aerofaciens. When isolate G20-7 was grown in the presence of Bacteroides fragilis or Escherichia coli (or another 7 alpha-hydroxysteroid dehydrogenase producer) and chenodeoxycholic acid, ursodeoxycholic acid produced. Time course curves revealed that 3 alpha-hydroxy-7-keto-5 beta-cholanoic acid produced by B. fragilis or E. coli or introduced into the medium as a pure substance was reduced by G20-7 specifically to ursodeoxycholic acid. The addition of glycine- and taurine-conjugated primary bile acids (chenodeoxycholic and cholic acids) and other bile acids to binary cultures of B. fragilis and G20-7 revealed that (i) both conjugates were hydrolyzed to give free bile acids, (ii) ursocholic acid (3 alpha, 7 beta, 12 alpha-trihydroxy-5 beta-cholanoic acid) was produced when conjugated (or free) cholic acid was the substrate, and (iii) the epimerization reaction was at least partially reversible. Corroborating these observations, an NADP-dependent 7 beta-hydroxysteroid dehydrogenase (reacting specifically with 7 beta-OH-groups) was demonstrated in cell-free preparations of isolate G20-7; production of the enzyme was optimal at between 12 and 18 h of growth. This enzyme, when measured in the oxidative direction, was active with ursodeoxycholic acid, ursocholic acid, and the taurine conjugate of ursodeoxycholic acid (but not with chenodeoxycholic, deoxycholic, or cholic acids) and displayed an optimal pH range of 9.8 to 10.2 Images PMID:6758698

  4. Biosynthesis of vitamin B12 in anaerobic bacteria--experiments with Eubacterium limosum on the transformation of 5-hydroxy-6-methyl-benzimidazole, its nucleoside, its cobamide, and of 5-hydroxybenzimidazolylcobamide in vitamin B12.


    Schulze, B; Vogler, B; Renz, P


    In anaerobic bacteria 5-hydroxybenzimidazole and 5-hydroxy-6-methylbenzimidazole are precursors of the 5,6-dimethylbenzimidazole moiety of vitamin B12. In order to elucidate the pathway from these bases to vitamin B12, experiments on the transformation of 5-hydroxy-6-methylbenzimidazole, of 5-hydroxy-6-methylbenzimidazole-alpha-D-ribofuranoside, of 5-hydroxybenzimidazolylcobamide and of 5-hydroxy-6-methylbenzimidazolylcobamide into vitamin B12 were carried out. The vitamin B12 synthesized by the anaerobe Eubacterium limosum in the presence of 5-hydroxy-6-methylbenzimidazole and L-[methyl-13C]methionine was subjected to NMR spectroscopy. It revealed that the methyl group at C5 of the 5,6-dimethylbenzimidazole moiety was 13C labeled, whereas the methyl group at C6 was unlabeled. This shows that the transformation of 5-hydroxy-6-methylbenzimidazole into the base moiety of vitamin B12 occurs regiospecifically. 5-Hydroxy-6-methylbenzimidazole-alpha-D-ribofuranoside as well as 5-hydroxybenzimidazolylcobamide and 5-hydroxy-6-methylbenzimidazolylcobamide were also transformed into vitamin B12 by E. limosum. When 5-hydroxy-6-methylbenzimidazolylcobamide 13C labeled at C2 of the base part and 14C labeled in the ribose was used for this experiment, the vitamin B12 obtained from this cobamide was 13C and 14C labeled in the same positions. This demonstrates that the alpha-glycosidic bond of the precursor cobamide is not split during the formation of vitamin B12. It can be deduced from these results that the precursor bases are transformed regiospecifically into their alpha-nucleotides, and partially into their cobamides. The alpha-nucleotides are then transformed into alpha-ribazole-5'-phosphate and, subsequently, into vitamin B12. Most likely the cobamides are degraded to the alpha-nucleotides before being used for the biosynthesis of vitamin B12. A pathway for the latter process is suggested.

  5. Lachnoanaerobaculum gen. nov., a new genus in the Lachnospiraceae: characterization of Lachnoanaerobaculum umeaense gen. nov., sp. nov., isolated from the human small intestine, and Lachnoanaerobaculum orale sp. nov., isolated from saliva, and reclassification of Eubacterium saburreum (Prevot 1966) Holdeman and Moore 1970 as Lachnoanaerobaculum saburreum comb. nov.


    Hedberg, Maria E; Moore, Edward R B; Svensson-Stadler, Liselott; Hörstedt, Per; Baranov, Vladimir; Hernell, Olle; Wai, Sun Nyunt; Hammarström, Sten; Hammarström, Marie-Louise


    Two novel obligately anaerobic, Gram-stain-positive, saccharolytic and non-proteolytic spore-forming bacilli (strains CD3:22(T) and N1(T)) are described. Strain CD3:22(T) was isolated from a biopsy of the small intestine of a child with coeliac disease, and strain N1(T) from the saliva of a healthy young man. The cells of both strains were observed to be filamentous, approximately 5 to >20 µm long, some of them curving and with swellings. The novel organisms produced H(2)S, NH(3), butyric acid and acetic acid as major metabolic end products. Phylogenetic analyses, based on comparative 16S rRNA gene sequencing, revealed close relationships (98% sequence similarity) between the two isolates, as well as the type strain of Eubacterium saburreum and four other Lachnospiraceae bacterium-/E. saburreum-like organisms. This group of bacteria were clearly different from any of the 19 known genera in the family Lachnospiraceae. While Eubacterium species are reported to be non-spore-forming, reanalysis of E. saburreum CCUG 28089(T) confirmed that the bacterium is indeed able to form spores. Based on 16S rRNA gene sequencing, phenotypic and biochemical properties, strains CD3:22(T) and N1(T) represent novel species of a new and distinct genus, named Lachnoanaerobaculum gen. nov., in the family Lachnospiraceae [within the order Clostridiales, class Clostridia, phylum Firmicutes]. Strain CD3:22(T) (=CCUG 58757(T) =DSM 23576(T)) is the type strain of the type species, Lachnoanaerobaculum umeaense gen. nov., sp. nov., of the proposed new genus. Strain N1(T) (=CCUG 60305(T)=DSM 24553(T)) is the type strain of Lachnoanaerobaculum orale sp. nov. Moreover, Eubacterium saburreum is reclassified as Lachnoanaerobaculum saburreum comb. nov. (type strain CCUG 28089(T) =ATCC 33271(T) =CIP 105341(T) =DSM 3986(T) =JCM 11021(T) =VPI 11763(T)).

  6. Population ecology of the sea lamprey (Petromyzon marinus) as an invasive species in the Laurentian Great Lakes and an imperiled species in Europe

    USGS Publications Warehouse

    Hansen, Michael J.; Madenjian, Charles P.; Slade, Jeffrey W.; Steeves, Todd B.; Almeida, Pedro R.; Quintella, Bernardo R.


    The sea lamprey Petromyzon marinus (Linnaeus) is both an invasive non-native species in the Laurentian Great Lakes of North America and an imperiled species in much of its native range in North America and Europe. To compare and contrast how understanding of population ecology is useful for control programs in the Great Lakes and restoration programs in Europe, we review current understanding of the population ecology of the sea lamprey in its native and introduced range. Some attributes of sea lamprey population ecology are particularly useful for both control programs in the Great Lakes and restoration programs in the native range. First, traps within fish ladders are beneficial for removing sea lampreys in Great Lakes streams and passing sea lampreys in the native range. Second, attractants and repellants are suitable for luring sea lampreys into traps for control in the Great Lakes and guiding sea lamprey passage for conservation in the native range. Third, assessment methods used for targeting sea lamprey control in the Great Lakes are useful for targeting habitat protection in the native range. Last, assessment methods used to quantify numbers of all life stages of sea lampreys would be appropriate for measuring success of control in the Great Lakes and success of conservation in the native range.

  7. Effect of fetal bovine serum glycoproteins on the in vitro proliferation of the oyster parasite Perkinsus marinus: development of a fully defined medium.


    Gauthier, J D; Feig, B; Vasta, G R


    The oyster parasite Perkinsus marinus replicates in our medium consisting of Dulbecco modified Eagle's medium: Ham's F12 nutrient mixture (1:1) supplemented with 1-5% fetal bovine serum, with a doubling time of 24 hours during the exponential phase of the culture. Fetal bovine serum concentrations above 5% dramatically reduced parasite proliferation in a dose-dependent manner. We tested the individual effects of the three major protein components of fetal bovine serum (fetuin, transferrin and albumin) on the replication of the parasite in a serum-free medium. At the concentrations tested, fetuin enhanced parasite growth, whereas albumin had a modest positive effect and transferrin was inhibitory. Proteolytic digestion of fetuin, strongly diminished its growth-enhancing properties, indicating that the overall glycoprotein architecture may be required for activity. On the contrary, desialylation of fetuin slightly enhanced its growth-promoting activity. The addition of fetuin at 1.7 mg/ml to the serum-free DME:Ham's F12 medium yielded growth rates that are comparable to those obtained with our standard culture methodology. This has resulted in a fully defined culture medium that will allow for a rigorous characterization of excretory/secretory products involved in modulating or blocking the host's humoral and cellular defense mechanisms.

  8. CRISPR/Cas9-mediated mutagenesis in the sea lamprey Petromyzon marinus: a powerful tool for understanding ancestral gene functions in vertebrates

    PubMed Central

    Square, Tyler; Romášek, Marek; Jandzik, David; Cattell, Maria V.; Klymkowsky, Michael; Medeiros, Daniel M.


    Lamprey is one of only two living jawless vertebrates, a group that includes the first vertebrates. Comparisons between lamprey and jawed vertebrates have yielded important insights into the origin and evolution of vertebrate physiology, morphology and development. Despite its key phylogenetic position, studies of lamprey have been limited by their complex life history, which makes traditional genetic approaches impossible. The CRISPR/Cas9 system is a bacterial defense mechanism that was recently adapted to achieve high-efficiency targeted mutagenesis in eukaryotes. Here we report CRISPR/Cas9-mediated disruption of the genes Tyrosinase and FGF8/17/18 in the sea lamprey Petromyzon marinus, and detail optimized parameters for producing mutant F0 embryos. Using phenotype and genotype analyses, we show that CRISPR/Cas9 is highly effective in the sea lamprey, with a majority of injected embryos developing into complete or partial mutants. The ability to create large numbers of mutant embryos without inbred lines opens exciting new possibilities for studying development in lamprey and other non-traditional model organisms with life histories that prohibit the generation of mutant lines. PMID:26511928

  9. [Dynamics of physiological parameters in the nestling of black-backed gull Larus marinus experimentally infested by the cestode Microsomacanthus ductilus (Cestoda: Hymenolepididae)].


    Kuklina, M M; Kuklin, V V


    The effect of the invasion with the cestode Microsomacanthus ductilus on physiological and biochemical processes in black-backed gull Larus marinus was examined. Experimental invasion of the gull nestling by the cestodes has been performed. Dynamics of the protein, lipid, and carbohydrate metabolism in the time history of the invasion was observed, in comparison with noninfested nestling. Increasing of the content of alpha-globulins and decreasing of the content of protein and albumin in the blood plasma of experimentally infested birds were registered to 4th day after invasion. To 7th day after invasion the level of general lipids and phospholipids decreases, while the content of gamma-globulins and modified form of albumin increases. To 10th day after invasion symptoms of intoxication were observed, but some parameters proved to be reverted to normal condition. So, it can be assumed, that the most intensive reorganization of the metabolism in infested birds takes place in the period between 4th and 7th days after infestation. Possible causes of the observed phenomena are discussed.

  10. Description of Sarcocystis lari sp. n. (Apicomplexa: Sarcocystidae) from the great black-backed gull, Larus marinus (Charadriiformes: Laridae), on the basis of cyst morphology and molecular data.


    Prakas, Petras; Kutkiené, Liuda; Butkauskas, Dalius; Sruoga, Aniolas; Zalakevicius, Mecislovas


    A morphological type of Sarcocystis cysts found in one of two examined great black-backed gull, Larus marinus (Linnaeus) (Laridae), is considered to represent a new species for which the name Sarcocystis lari sp. n. is proposed and its description is provided. The cysts are ribbon-shaped, very long (the largest fragment found was 6 mm long) and relatively narrow (up to 75 microm). Under a light microscope the cyst wall reaches up to 1 microm and seems to be smooth. Using a computerized image analysis system, knolls, which resemble protrusions on the wall surface, are visible. Lancet-shaped cystozoites measure in average 6.9 x 1.4 microm (range 6.3-7.9 microm x 1.2-1.5 microm) in length. Observed using Transmission electron microscopy (TEM), the cyst wall is wavy and measures up to 1.2 microm in thickness. The parasitophorous vacuolar membrane has regularly arranged small invaginations. Cyst content is divided into large chambers by septa. Sarcocystis lari sp. n. has type-1 tissue cyst wall and is morphologically indistinguishable from other bird Sarcocystis species characterized by the same type of the wall. On the basis of 18S rRNA gene, 28S rRNA gene and ITS-1 region sequences, S. lari is a genetically distinct species, being most closely related to avian Sarcocystis species whose definitive hosts are predatory birds.

  11. CRISPR/Cas9-mediated mutagenesis in the sea lamprey Petromyzon marinus: a powerful tool for understanding ancestral gene functions in vertebrates.


    Square, Tyler; Romášek, Marek; Jandzik, David; Cattell, Maria V; Klymkowsky, Michael; Medeiros, Daniel M


    Lamprey is one of only two living jawless vertebrates, a group that includes the first vertebrates. Comparisons between lamprey and jawed vertebrates have yielded important insights into the origin and evolution of vertebrate physiology, morphology and development. Despite its key phylogenetic position, studies of lamprey have been limited by their complex life history, which makes traditional genetic approaches impossible. The CRISPR/Cas9 system is a bacterial defense mechanism that was recently adapted to achieve high-efficiency targeted mutagenesis in eukaryotes. Here we report CRISPR/Cas9-mediated disruption of the genes Tyrosinase and FGF8/17/18 in the sea lamprey Petromyzon marinus, and detail optimized parameters for producing mutant F0 embryos. Using phenotype and genotype analyses, we show that CRISPR/Cas9 is highly effective in the sea lamprey, with a majority of injected embryos developing into complete or partial mutants. The ability to create large numbers of mutant embryos without inbred lines opens exciting new possibilities for studying development in lamprey and other non-traditional model organisms with life histories that prohibit the generation of mutant lines.

  12. In vitro and in vivo effects of GABA, muscimol, and bicuculline on lamprey GnRH concentration in the brain of the sea lamprey (Petromyzon marinus).


    Root, Adam R; Sanford, Jocelyn D; Kavanaugh, Scott I; Sower, Stacia A


    gamma-Aminobutyric acid (GABA) is a neurotransmitter with a demonstrated neuroregulatory role in reproduction in most representative species of vertebrate classes via the hypothalamus. The role of GABA on the hypothalamus-pituitary axis in lampreys has not been fully elucidated. Recent immunocytochemical and in situ hybridization studies suggest that there may be a neuroregulatory role of GABA on the gonadotropin-releasing hormone (GnRH) system in lampreys. To assess possible GABA-GnRH interactions, the effects of GABA and its analogs on lamprey GnRH in vitro and in vivo were studied in adult female sea lampreys (Petromyzon marinus). In vitro perfusion of GABA and its analogs at increasing concentrations (0.1-100 microM) was performed over a 3-h time course. There was a substantial increase of GnRH-I and GnRH-III following treatment of muscimol at 100 microM. In in vivo studies, GABA or muscimol injected at 200 microg/kg significantly increased lamprey GnRH concentration in the brain 0.5 h after treatment compared to controls in female sea lampreys. No significant change in lamprey GnRH-I or GnRH-III was observed following treatment with bicuculline. These data provide novel physiological data supporting the hypothesis that GABA may influence GnRH in the brain of sea lamprey.

  13. Evaluation of strategies for the release of male sea lampreys (Petromyzon marinus) in Lake Superior for a proposed sterile-male-release program

    USGS Publications Warehouse

    Kaye, C.A.; Heinrich, J.W.; Genovese, J.H.; Hanson, L.H.; McDonald, R.B.; Slade, J.W.; Swink, W.D.


    Successful implementation of a sea lamprey (Petromyzon marinus) control technique that uses sterilized males to reduce reproduction presently depends on the importation of large numbers of males outside of the target population. Strategies were examined for releasing male sea lampreys from Lakes Michigan and Huron into the Lake Superior spawning population and the ability of these introduced males to compete with resident males and spawn with resident females. During 1987, 553 (9%) of 6,324 imported fertile males released at 12 shoreline and one offshore site in Lake Superior were recaptured. Most remained within 20 km of the release site and entered the first stream encountered. During 1988, 393 (18%) of 2,208 imported fertile males released directly into three spawning rivers were recaptured. In both cases, animals released early during the spawning run were more likely to be recaptured than those released later. Introduced males successfully competed with resident males and spawned with resident females. Demonstrating that male sea lampreys could reproduce successfully when relocated supported subsequent large-scale field trials of the sterile-male-release technique.

  14. Passage of four teleost species prior to sea lamprey (Petromyzon marinus) migration in eight tributaries of Lake Superior, 1954-1979

    USGS Publications Warehouse

    Klinger, Gregory L.; Adams, Jean V.; Heinrich, John W.


    Seasonally operated barriers in rivers are used by the Great Lakes Fishery Commission to block adult sea lamprey (Petromyzon marinus) migrations, yet pass other fish during some part of the year. Knowledge of the overlap of spawning migrations of sea lampreys and other fish species are vital for the efficient operation of the Commission's barrier program. The migration of sea lamprey spawners was compared with the migration of four other fish species using trap captures at electric barriers on eight Lake Superior tributaries during 1954 to 1979. The passage of rainbow trout (Oncorhynchus mykiss), rainbow smelt (Osmerus mordax), longnose suckers (Catostomus catostomus), and white suckers (Catostomus commersoni) prior to the capture of sea lampreys was quantified as the proportion of the annual catch of each species. Average passage over all streams and years was smallest (5%) for longnose sucker and largest (21%) for rainbow smelt. Passage prior to first sea lamprey catch was significantly different among rivers for all four species and significantly different among years for rainbow trout. Much of the variability in annual passage was unexplained by river or year effects. It is suggested that stream-specific information on run times of sea lampreys and other fishes be used to define timing of seasonal barrier operations. If barrier operations are timed to block the entire sea lamprey spawning run, then fish passage devices are needed to pass rainbow trout, rainbow smelt, longnose suckers, and white suckers.

  15. Assessment of sea lamprey (Petromyzon marinus) predation by recovery of dead lake trout (Salvelinus namaycush) from Lake Ontario, 1982-85

    USGS Publications Warehouse

    Bergstedt, Roger A.; Schneider, Clifford P.


    During 1982-85, 89 dead lake trout (Salvelinus namaycush) were recovered with bottom trawls in U.S. waters of Lake Ontario: 28 incidentally during four annual fish-stock assessment surveys and 61 during fall surveys for dead fish. During the assessment surveys, no dead lake trout were recovered in April-June, one was recovered in August, and 27 were recovered in October or November, implying that most mortality from causes other than fishing occurred in the fall. The estimated numbers of dead lake trout between the 30- and 100-m depth contours in U.S. waters ranged from 16 000 (0.08 carcass/ha) in 1983 to 94 000 (0.46 carcass/ha) in 1982. Of 76 carcasses fresh enough to enable recognition of sea lamprey (Petromyzon marinus) wounds, 75 bore fresh wounds. Assuming that sea lamprey wounding rates on dead fish were the same as on live ones of the same length range (430-740 mm), the probability of 75 of the 76 dead lake trout bearing sea lamprey wounds was 3.5 x 10-63 if death was independent of sea lamprey attack, thus strongly implicating sea lampreys as the primary cause of death of fish in the sample. The recovery of only one unwounded dead lake trout also suggested that natural mortality from causes other than sea lamprey attactks is negligible.

  16. Comparison of spring measures of length, weight, and condition factor for predicting metamorphosis in two populations of sea lampreys (Petromyzon marinus) larvae

    USGS Publications Warehouse

    Henson, Mary P.; Bergstedt, Roger A.; Adams, Jean V.


    The ability to predict when sea lampreys (Petromyzon marinus) will metamorphose from the larval phase to the parasitic phase is essential to the operation of the sea lamprey control program. During the spring of 1994, two populations of sea lamprey larvae from two rivers were captured, measured, weighed, implanted with coded wire tags, and returned to the same sites in the streams from which they were taken. Sea lampreys were recovered in the fall, after metamorphosis would have occurred, and checked for the presence of a tag. When the spring data were compared to the fall data it was found that the minimum requirements (length ≥ 120 mm, weight ≥ 3 g, and condition factor ≥ 1.50) suggested for metamorphosis did define a pool of larvae capable of metamorphosing. However, logistic regressions that relate the probability of metamorphosis to size are necessary to predict metamorphosis in a population. The data indicated, based on cross-validation, that weight measurements alone predicted metamorphosis with greater precision than length or condition factor in both the Marengo and Amnicon rivers. Based on the Akaike Information Criterion, weight alone was a better predictor in the Amnicon River, but length and condition factor combined predicted metamorphosis better in the Marengo River. There would be no additional cost if weight alone were used instead of length. However, if length and weight were measured the gain in predictive power would not be enough to justify the additional cost.

  17. Estimating lake-wide abundance of spawning-phase sea lampreys (Petromyzon marinus) in the Great Lakes: extrapolating from sampled streams using regression models

    USGS Publications Warehouse

    Mullett, Katherine M.; Heinrich, John W.; Adams, Jean V.; Young, Robert J.; Henson, Mary P.; McDonald, Rodney B.; Fodale, Michael F.


    Lake-wide abundance of spawning-phase sea lampreys (Petromyzon marinus) can be used as one means to evaluate sea lamprey control efforts in the Great Lakes. Lake-wide abundance in each Great Lake was the sum of estimates for all streams thought to contribute substantial numbers of sea lampreys. A subset of these streams was sampled with traps and mark-recapture studies were conducted. When sea lampreys were captured in traps, but no mark-recapture study was conducted, abundance was estimated from a relation between trap catch and mark-recapture estimates observed in other years. In non-sampled streams, a regression model that used stream drainage area, geographic region, larval sea lamprey, production potential, the number of years since the last lampricide treatment, and spawning year was used to predict abundance of spawning-phase sea lampreys. The combination of estimates from sampled and non-sampled streams provided a 20-year time series of spawning-phase sea lamprey abundance estimates in the Great Lakes.

  18. Evidence that sea lampreys (Petromyzon marinus) complete their life cycle within a tributary of the Laurentian Great Lakes by parasitizing fishes in inland lakes

    USGS Publications Warehouse

    Johnson, Nicholas; Twohey, Michael B.; Miehls, Scott M.; Cwalinski, Tim A; Godby, Neal A; Lochet, Aude; Slade, Jeffrey W.; Jubar, Aaron K.; Siefkes, Michael J.


    The sea lamprey (Petromyzon marinus) invaded the upper Laurentian Great Lakes and feeds on valued fish. The Cheboygan River, Michigan, USA, is a large sea lamprey producing tributary to Lake Huron and despite having a renovated dam 2 km from the river mouth that presumably blocks sea lamprey spawning migrations, the watershed upstream of the dam remains infested with larval sea lamprey. A navigational lock near the dam has been hypothesized as the means of escapement of adult sea lampreys from Lake Huron and source of the upper river population (H1). However, an alternative hypothesis (H2) is that some sea lampreys complete their life cycle upstream of the dam, without entering Lake Huron. To evaluate the alternative hypothesis, we gathered angler reports of lamprey wounds on game fishes upstream of the dam, and captured adult sea lampreys downstream and upstream of the dam to contrast abundance, run timing, size, and statolith microchemistry. Results indicate that a small population of adult sea lampreys (n < 200) completed their life cycle upstream of the dam during 2013 and 2014. This is the most comprehensive evidence that sea lampreys complete their life history within a tributary of the upper Great Lakes, and indicates that similar landlocked populations could occur in other watersheds. Because the adult sea lamprey population upstream of the dam is small, complete elimination of the already low adult escapement from Lake Huron might allow multiple control tactics such as lampricides, trapping, and sterile male release to eradicate the population.

  19. Morphological and electrophysiological examination of olfactory sensory neurons during the early developmental prolarval stage of the sea lamprey Petromyzon marinus L

    USGS Publications Warehouse

    Zielinski, B.S.; Fredricks, Keith; McDonald, R.; Zaidi, A.U.


    This study examined olfactory sensory neuron morphology and physiological responsiveness in newly hatched sea lamprey, Petromyzon marinus L. These prolarvae hatch shortly after neural tube formation, and stay within nests for approximately 18 days, before moving downstream to silty areas where they burrow, feed and pass to the larval stage. To explore the possibility that the olfactory system is functioning during this prolarval stage, morphological and physiological development of olfactory sensory neurons was examined. The nasal cavity contained an olfactory epithelium with ciliated olfactory sensory neurons. Axons formed aggregates in the basal portion of the olfactory epithelium and spanned the narrow distance between the olfactory epithelium and the brain. The presence of asymmetric synapses with agranular vesicles within fibers in the brain, adjacent to the olfactory epithelium suggests that there was synaptic connectivity between olfactory sensory axons and the brain. Neural recordings from the surface of the olfactory epithelium showed responses following the application of L-arginine, taurocholic acid, petromyzonol sulfate (a lamprey migratory pheromone), and water conditioned by conspecifics. These results suggest that lampreys may respond to olfactory sensory input during the prolarval stage. ?? 2006 Springer Science + Business Media, LLC.

  20. Life stage dependent responses to the lampricide, 3-trifluoromethyl-4-nitrophenol (TFM), provide insight into glucose homeostasis and metabolism in the sea lamprey (Petromyzon marinus).


    Henry, Matthew; Birceanu, Oana; Clifford, Alexander M; McClelland, Grant B; Wang, Yuxiang S; Wilkie, Michael P


    The primary method of sea lamprey (Petromyzon marinus) control in the Great Lakes is the treatment of streams and rivers with the pesticide 3-trifluoromethyl-4-nitrophenol (TFM), which targets larval sea lamprey. However, less is known about the effects of TFM on other stages of the sea lamprey's complex life cycle. The goal of this study was to determine how TFM affected internal energy stores, metabolites, and ion balance in larval, juvenile (parasitic) and adult sea lamprey. The larvae were more tolerant to TFM than the adults, with a 2-fold higher 12h TFM LC50 and a 1.5-fold higher LC99.9. Acute (3h) exposure of the larvae, parasites and adults to their respective 12h TFM LC99.9 led to marked reductions in glycogen and phosphocreatine in the adult brain, with lesser or no effect in the larvae and parasites. Increased lactate in the brain, at less than the expected stoichiometry, suggested that it was exported to the blood. Kidney glycogen declined after TFM exposure, suggesting that this organ plays an important role in glucose homeostasis. TFM-induced disturbances to ion balance were minimal. In conclusion, TFM perturbs energy metabolism in all major stages of the sea lamprey life cycle in a similar fashion, but the adults appear to be the most sensitive. Thus, the adult stage could be a viable and effective target for TFM treatment, particularly when used in combination with other existing and emerging strategies of sea lamprey control.

  1. Hasty effect on the metabolism of glycyrrhizin by Eubacterium sp. GLH with Ruminococcus sp. PO1-3 and Clostridium innocuum ES24-06 of human intestinal bacteria.


    Akao, T


    Eubacterium sp. GLH with Ruminococcus sp. PO1-3 and Clostridium innocuum ES24-06 possessing enzymes involved in the metabolism of glycyrrhizin (GL) was cultured in GAM medium with and without 1.0 mM GL or 1.0 mM glycyrrhetic acid (GA). GL (1.0 mM) enhanced 3alpha-hydroxyglycyrrhetinate (3alpha-hydroxyGA) dehydrogenase activity, GA (1.0 mm) suppressed 3alpha-hydroxyGA dehydrogenase activity, GL beta-D-glucuronidase activity and the mixed bacterial growth, and GL and GA showed almost no change in a lower level of 3beta-hydroxysteroid dehydrogenase (3beta-HSD) activity during 5 d of culture. GL (1.0 mM) and GA (1.0 mM) were metabolized to a small amount of GA and a negligible amount of 3-oxo-glycyrrhetic acid (3-oxo-GA) and 3alpha-hydroxyGA, and to a negligible amount of 3-oxo-GA, respectively, by these mixed bacteria. These amounts coincided with those of metabolites produced from 1.0 mM GL and 1.0 mM GA added to these mixed bacteria after 24 h culture. Whole bacteria and sonicated bacteria derived from the collection of these mixed bacteria reached a maximal stage and metabolized GL to a relatively large amount of GA and 3-oxo-GA, and a negligible amount of 3alpha-hydroxyGA and GA to a small amount of 3-oxo-GA and 3alpha-hydroxyGA within 180 min. GL beta-D-glucuronidase with 3beta-HSD and 3alpha-hydroxyGA dehydrogenase partially purified from each bacterium was converted GL to 3alpha-hydroxyGA, producing metabolites of about 60% after 10 min of incubation. These mixed bacteria possessed high enzyme activities could produce the metabolites of GL in under one hour under conditions.

  2. Cloning, DNA sequencing, and characterization of a nifD-homologous gene from the archaeon Methanosarcina barkeri 227 which resembles nifD1 from the eubacterium Clostridium pasteurianum.

    PubMed Central

    Chien, Y T; Zinder, S H


    L. Sibold, M. Henriquet, O. Possot, and J.-P. Aubert (Res. Microbiol. 142:5-12, 1991) cloned and sequenced two nifH-homologous open reading frames (ORFs) from Methanosarcina barkeri 227. Phylogenetic analysis of the deduced amino acid sequences of the nifH ORFs from M. barkeri showed that nifH1 clusters with nifH genes from alternative nitrogenases, while nifH2 clusters with nifH1 from the gram-positive eubacterium Clostridium pasteurianum. The N-terminal sequence of the purified nitrogenase component 2 (the nifH gene product) from M. barkeri was identical with that predicted for nifH2, and dot blot analysis of RNA transcripts indicated that nifH2 (and nifDK2) was expressed in M. barkeri when grown diazotrophically in Mo-containing medium. To obtain nifD2 from M. barkeri, a 4.7-kbp BamHI fragment of M. barkeri DNA was cloned which contained at least five ORFs, including nifH2, ORF105, and ORF125 (previously described by Sibold et al.), as well as nifD2 and part of nifK2. ORFnifD2 is 1,596 bp long and encodes 532 amino acid residues, while the nifK2 fragment is 135 bp long. The deduced amino acid sequences for nifD2 and the nifK2 fragment from M. barkeri cluster most closely with the corresponding nifDK1 gene products from C. pasteurianum. The predicted M. barkeri nifD2 product contains a 50-amino acid insert near the C terminus which has previously been found only in the clostridial nifD1 product. Previous biochemical and sequencing evidence indicates that the C. pasteurianum nitrogenase is the most divergent of known eubacterial Mo-nitrogenases, most likely representing a distinct nif gene family, which now also contains M. barkeri as a member. The similarity between the methanogen and clostridial nif sequences is especially intriguing in light of the recent findings of sequence similarities between gene products from archaea and from low-G+C gram-positive eubacteria for glutamate dehydrogenase, glutamine synthetase I, and heat shock protein 70. It is not clear

  3. Barrientosiimonas endolithica sp. nov., isolated from pebbles, reclassification of the only species of the genus Tamlicoccus, Tamlicoccus marinus Lee 2013, as Barrientosiimonas marina comb. nov. and emended description of the genus Barrientosiimonas.


    Parag, B; Sasikala, Ch; Ramana, Ch V


    Strain JC268(T) was isolated from pebbles collected from a dam located in Lalitpur, Uttar Pradesh, India. Cells of strain JC268(T) were coccoid, appeared in pairs/triads/tetrads or short chains and were Gram-stain-positive, non-spore-forming, non-motile and obligately aerobic. Strain JC268(T) was catalase- and oxidase-positive and utilized citrate for growth. The genomic DNA G+C content of strain JC268(T) was 65.3 mol%. The cell-wall peptidoglycan contained L-lysine-L-serine-D-aspartic acid as interpeptide bridge with the type A4α. The major menaquinone was MK-8(H4). Major (>10%) fatty acids were iso-C16 : 0, iso-C16 : 1H and anteiso-C17 : 1ω9c. Diphosphatidylglycerol, phosphoglycolipid, phosphatidylinositol, glycolipid, four unidentified lipids, an amino lipid and phospholipid were the polar lipids of strain JC268(T). EzTaxon-e blast search of 16S rRNA gene sequences showed that strain JC268(T) has highest similarity to Barrientosiimonas humi 39(T) (98.65%) and Tamlicoccus marinus MSW-24(T) (97.8%) of the family Dermacoccaceae. Genome reassociation (based on DNA-DNA hybridization) of strain JC268(T) with Barrientosiimonas humi CGMCC 4.6864(T) ( = 39(T)) and T. marinus KCTC 19485(T) ( = MSW-24(T)) yielded values of 32.5 ± 2% and 27.3 ± 2%, respectively. Based on the data from phylogenetic and polyphasic taxonomic analyses, strain JC268(T) represents a novel species of the genus Barrientosiimonas for which the name Barrientosiimonas endolithica sp. nov., is proposed. The type strain of Barrientosiimonas endolithica is JC268(T) ( = KCTC 29672(T) = NBRC 110608(T)). Our data suggest that T. marinus should be reclassified within the genus Barrientosiimonas. Thus, a reclassification is proposed for T. marinus, the type and only species of the genus Tamlicoccus, as Barrientosiimonas marina comb. nov., which implies the emendation of the description of the genus Barrientosiimonas.

  4. Hybridization between previously isolated ancestors may explain the persistence of exactly two ancient lineages in the genome of the oyster parasite Perkinsus marinus.


    Thompson, Peter C; Rosenthal, Benjamin M; Hare, Matthew P


    Theory predicts that neutral genetic variation accumulates within populations to a level determined by gains through mutation and losses by genetic drift. This balance results in a characteristic distribution of allelic variation with the maximum allelic difference determined by effective population size. Here, we report a striking departure from these expectations in the form of allelic dimorphism, observed at the majority of seven loci examined in Perkinsus marinus, an important oyster parasite that causes Dermo disease. DNA sequences were collected from five loci flanking microsatellite repeats and two loci coding for superoxide dismutase enzymes that may mediate the parasite's interaction with its host. Based on 474 sequences, sampled across 5000 km of the eastern United States coastline, no more than two alleles were observed at each locus (discounting singletons). Depending on the locus, the common allele ranged in overall frequency from 72% to 92%. At each locus the two alleles differed substantially (3.8% sequence difference, on average), and the among-locus variance in divergences was not sufficient to reject a simultaneous origin for all dimorphisms using approximate Bayesian methods. Dimorphic alleles were estimated to have diverged from a common ancestral allele at least 0.9 million years ago. Across these seven loci, only five other alleles were ever observed, always as singletons and differing from the dimorphic alleles by no more than two nucleotides. Free recombination could potentially have shuffled these dimorphisms into as many as 243 multilocus combinations, but the existence of only ten combinations among all samples strongly supports low recombination frequencies and is consistent with the observed absence of intragenic recombination. We consider several demographic and evolutionary hypotheses to explain these patterns. Few can be conclusively rejected with the present data, but we advance a recent hybridization of ancient divergent lineages

  5. Changes in mortality of lake trout (Salvelinus namaycush) in Michigan waters of Lake Superior in relation to sea lamprey (Petromyzon marinus) predation, 1968-78

    USGS Publications Warehouse

    Pycha, Richard L.


    Total mortality rates of lake trout (Salvelinus namaycush) of age VII and older from eastern Lake Superior were estimated from catch curves of age distributions each year in 1968–78. The instantaneous rate of total mortality Z varied from 0.62 to 2.31 in close synchrony with sea lamprey (Petromyzon marinus) wounding rates on lake trout. The regression of transformed Z on the index of lamprey wounding, accounted for over 89% of the variation in lake trout mortality (r2 = 0.893). An iterative method of estimating rates of exploitation u, instantaneous rates of fishing mortality F, K (a constant relating sample catch per unit effort to population size), instantaneous normal natural mortality rate M, and instantaneous rate of mortality due to sea lamprey predationL from the sample catch per unit effort and total catch by the fishery is presented. A second method using the results of a 1970–71 tagging study to estimate the mean F in 1970–77 yielded closely similar results to the above and is presented as corroboration. The estimates of u, F, andM appear to be reasonable. F ranged from 0.17 in 1974 to 0.42 in 1969 and M was estimated at 0.26. L varied from 0.21 in 1974 to 1.70 in 1968. Management implications of various policies concerning sea lamprey control, exploitation, and stocking are discussed.Key words: lake trout, sea lamprey, lamprey control, mortality, predation, Lake Superior, fishery, management

  6. Gelatiniphilus marinus gen. nov., sp. nov., a bacterium from the culture broth of a microalga, Picochlorum sp. 122, and emended description of the genus Hwangdonia.


    Tang, Mingxing; Tan, Li; Wu, Hualian; Dai, Shikun; Li, Tao; Chen, Chenghao; Li, Jiaying; Fan, Jiewei; Xiang, Wenzhou; Li, Xiang; Wang, Guanghua


    A Gram-stain-negative, non-motile, non-spore-forming, rod-shaped bacterium, designated strain GYP-24T, was isolated from the culture broth of a marine microalga, Picochlorum sp. 122. Phylogenetic analyses based on 16S rRNA gene sequences indicated that strain GYP-24T forms a robust cluster with H.wangdoniaseohaensis KCTC 32177T (95.8 % sequence similarity) in the family Flavobacteriaceae. Growth of strain GYP-24T was observed at 15, 22, 28, 30, 33 and 37 °C (optimal 30-33 °C), pH 6.0-10.0 (optimal pH 7.0-8.0) and in the presence of 0.5-4 % (w/v) NaCl (optimal 2-3 %). The only menaquinone of strain GYP-24T was MK-6, and the G+C content of the genomic DNA was 36.9 mol%. The major fatty acid profile comprised iso-C17 : 0 3-OH, summed feature 3 (C16 : 1 ω7c/ω6c), iso-C15 : 1 G and iso-C15 : 0. The major polar lipids of strain GYP-24T were phosphatidylethanolamine, one unidentified phospholipid, three unidentified aminolipids and three unidentified lipids. Comprehensive analyses based on polyphasic characterization of GYP-24T indicated that it represents a novel species of a new genus, for which the name Gelatiniphilus marinus gen. nov., sp. nov. is proposed. The type strain is GYP-24T (=KCTC 42903T=MCCC 1K01730T). An emended description of the genus Hwangdonia is also given.

  7. Investigating Population Structure of Sea Lamprey (Petromyzon marinus, L.) in Western Iberian Peninsula Using Morphological Characters and Heart Fatty Acid Signature Analyses

    PubMed Central

    Lança, Maria João; Machado, Maria; Mateus, Catarina S.; Lourenço, Marta; Ferreira, Ana F.; Quintella, Bernardo R.; Almeida, Pedro R.


    This study hypothesizes the existence of three groups of sea lamprey Petromyzon marinus L. in Portugal (North/Central group, Tagus group, and Guadiana group), possibly promoted by seabed topography isolation during the oceanic phase of the life cycle. Within this context, our purpose was to analyze the existence of a stock structure on sea lamprey populations sampled in the major Portuguese river basins using both morphological characters and heart tissue fatty acid signature. In both cases, the multiple discriminant analysis revealed statistically significant differences among groups, and the overall corrected classification rate estimated from cross-validation procedure was particularly high for the cardiac muscle fatty acid profiles (i.e. 83.8%). Morphometric characters were much more useful than meristic ones to discriminate stocks, and the most important variables for group differentiation were eye length, second dorsal fin length and branchial length. Fatty acid analysis showed that all lampreys from the southern Guadiana group were correctly classified and not mixing with individuals from any other group, reflecting a typical heart fatty acid signature. Our results revealed that 89.5% and 72.2% of the individuals from the Tagus and North/Central groups, respectively, were also correctly classified, despite some degree of overlap between individuals from these groups. The fatty acids that contributed to the observed segregation were C16:0; C17:0; C18:1ω9; C20:3ω6 and C22:2ω6. Detected differences are probably related with environmental variables to which lampreys may have been exposed, which leaded to different patterns of gene expression. These results suggest the existence of three different sea lamprey stocks in Portugal, with implication in terms of management and conservation. PMID:25259723

  8. Investigating population structure of Sea Lamprey (Petromyzon marinus, L.) in Western Iberian Peninsula using morphological characters and heart fatty acid signature analyses.


    Lança, Maria João; Machado, Maria; Mateus, Catarina S; Lourenço, Marta; Ferreira, Ana F; Quintella, Bernardo R; Almeida, Pedro R


    This study hypothesizes the existence of three groups of sea lamprey Petromyzon marinus L. in Portugal (North/Central group, Tagus group, and Guadiana group), possibly promoted by seabed topography isolation during the oceanic phase of the life cycle. Within this context, our purpose was to analyze the existence of a stock structure on sea lamprey populations sampled in the major Portuguese river basins using both morphological characters and heart tissue fatty acid signature. In both cases, the multiple discriminant analysis revealed statistically significant differences among groups, and the overall corrected classification rate estimated from cross-validation procedure was particularly high for the cardiac muscle fatty acid profiles (i.e. 83.8%). Morphometric characters were much more useful than meristic ones to discriminate stocks, and the most important variables for group differentiation were eye length, second dorsal fin length and branchial length. Fatty acid analysis showed that all lampreys from the southern Guadiana group were correctly classified and not mixing with individuals from any other group, reflecting a typical heart fatty acid signature. Our results revealed that 89.5% and 72.2% of the individuals from the Tagus and North/Central groups, respectively, were also correctly classified, despite some degree of overlap between individuals from these groups. The fatty acids that contributed to the observed segregation were C16:0; C17:0; C18:1ω9; C20:3ω6 and C22:2ω6. Detected differences are probably related with environmental variables to which lampreys may have been exposed, which leaded to different patterns of gene expression. These results suggest the existence of three different sea lamprey stocks in Portugal, with implication in terms of management and conservation.

  9. Contaminant levels in Herring (Larus argentatus) and Great Black-backed Gull (Larus marinus) eggs from colonies in the New York harbor complex between 2012 and 2013.


    Burger, Joanna; Elbin, Susan


    Birds living in coastal areas are exposed to severe storms and tidal flooding during the nesting season, but also to contaminants that move up the food chain from the water column and sediment to their prey items. We examine metals in Herring Gull (Larus argentatus) and Great Black-backed Gull (Larus marinus) eggs collected from the New York/New Jersey harbor estuary in 2012 and in 2013 to determine if there were significant yearly differences in metal levels. We test the null hypothesis that there were no significant yearly differences in metal levels. We investigate whether there were consistent differences in metals from 2012 to 2013 that might suggest a storm-related effect because Superstorm Sandy landed in New Jersey in October 2012 with high winds and extensive flooding, and view this research as exploratory. Except for arsenic, there were significant inter-year variations in the mean levels for all colonies combined for Herring Gull, and for lead, mercury and selenium for Great Black-backed Gulls. All metal levels in 2013 were less than in 2012, except for lead. These differences were present for individual colonies as well. Metal levels varied significantly among islands for Herring Gulls in both years (except for cadmium in 2013). No one colony had the highest levels of all metals for Herring Gulls. A long term data set on mercury levels in Herring Gulls indicated that the differences between 2012 and 2013 were greater than usual. Several different factors could account for these differences, and these are discussed.

  10. Distribution of a Y1 receptor mRNA in the brain of two Lamprey species, the sea lamprey (Petromyzon marinus) and the river Lamprey (Lampetra fluviatilis).


    Pérez-Fernández, Juan; Megías, Manuel; Pombal, Manuel A


    The neuropeptide Y system consists of several neuropeptides acting through a broad number of receptor subtypes, the NPY family of receptors. NPY receptors are divided into three subfamilies (Y1, Y2, and Y5) that display a complex evolutionary history due to local and large-scale gene duplication events and gene losses. Lampreys emerged from a basal branch of the tree of vertebrates and they are in a key position to shed light on the evolutionary history of the NPY system. One member of the Y1 subfamily has been reported in agnathans, but the phylogenetic tree of the Y1 subfamily is not yet clear. We cloned the sequences of the Y1-subtype receptor of Petromyzon marinus and Lampetra fluviatilis to study the expression pattern of this receptor in lampreys by in situ hybridization and to analyze the phylogeny of the Y1-subfamily receptors in vertebrates. The phylogenetic study showed that the Y1 receptor of lampreys is basal to the Y1/6 branch of the Y1-subfamily receptors. In situ hybridization showed that the Y1 receptor is widely expressed throughout the brain of lampreys, with some regions showing numerous positive neurons, as well as the presence of numerous cerebrospinal fluid-contacting cells in the spinal cord. This broad distribution of the lamprey Y1 receptor is more similar to that found in other vertebrates for the Y1 receptor than that of the other members of the Y1 subfamily: Y4, Y8, and Y6 receptors. Both phylogenetic relationship and expression pattern suggest that this receptor is a Y1 receptor.

  11. The emergence of the vasopressin and oxytocin hormone receptor gene family lineage: Clues from the characterization of vasotocin receptors in the sea lamprey (Petromyzon marinus).


    Mayasich, Sally A; Clarke, Benjamin L


    The sea lamprey (Petromyzon marinus) is a jawless vertebrate at an evolutionary nexus between invertebrates and jawed vertebrates. Lampreys are known to possess the arginine vasotocin (AVT) hormone utilized by all non-mammalian vertebrates. We postulated that the lamprey would possess AVT receptor orthologs of predecessors to the arginine vasopressin (AVP)/oxytocin (OXT) family of G protein-coupled receptors found in mammals, providing insights into the origins of the mammalian V1A, V1B, V2 and OXT receptors. Among the earliest animals to diverge from the vertebrate lineage in which these receptors are characterized is the jawed, cartilaginous elephant shark, which has genes orthologous to all four mammalian receptor types. Therefore, our work was aimed at helping resolve the critical gap concerning the outcomes of hypothesized large-scale (whole-genome) duplication events. We sequenced one partial and four full-length putative lamprey AVT receptor genes and determined their mRNA expression patterns in 15 distinct tissues. Phylogenetically, three of the full-coding genes possess structural characteristics of the V1 clade containing the V1A, V1B and OXT receptors. Another full-length coding gene and the partial sequence are part of the V2 clade and appear to be most closely related to the newly established V2B and V2C receptor subtypes. Our synteny analysis also utilizing the Japanese lamprey (Lethenteron japonicum) genome supports the recent proposal that jawless and jawed vertebrates shared one-round (1R) of WGD as the most likely scenario.

  12. Expression of three GnRH receptors in specific tissues in male and female sea lampreys Petromyzon marinus at three distinct life stages

    PubMed Central

    Hall, Jeffrey A.; Decatur, Wayne A.; Daukss, Dana M.; Hayes, Mary K.; Marquis, Timothy J.; Morin, Scott J.; Kelleher, Thomas F.; Sower, Stacia A.


    Two recently cloned gonadotropin-releasing hormone (GnRH) receptors (lamprey GnRH-R-2 and lamprey GnRH-R-3) along with lamprey (l) GnRH-R-1 were shown to share similar structural features and amino acid motifs common to other vertebrate receptors. Here we report on our findings of RNA expression of these three GnRH receptors in the three major life stages (larval, parasitic, and adult phases) of the sea lamprey, Petromyzon marinus, a basal vertebrate. For each stage, we examined the expression of messenger RNA encoding the receptors in the brain, pituitary, gonad, heart, muscle, liver, eye, intestine, kidney, skin, thyroid, gill, and endostyle by RT-PCR. In adult lampreys, the spatial expression of the three receptors in the brain and pituitary was investigated by in situ hybridization. In general, the receptors were more widely expressed in adult tissues as compared to parasitic-phase tissues and least widely expressed in the larval tissues. There were noted differences in male and female lampreys in the adult and parasitic phases for all three receptors. The data showed the presence of all three receptor transcripts in brain tissues for adult and parasitic phases and all three receptor transcripts were expressed in the adult pituitaries, but not in the parasitic pituitaries. However, in the larval phase, only lGnRH-R-1 was expressed in the larval brain and pituitary. In situ hybridization revealed that lGnRH-R-2 and -3 were expressed in the pineal tissue of adult female lampreys while lGnRH-R-1 was expressed in the pineal in adult male lampreys, all restricted to the pineal pellucida. In summary, these data provide an initial comparative analysis of expression of three lamprey GnRH receptors suggesting differential regulation within males and females at three different life/reproductive stages. PMID:23754972

  13. Contaminant levels in Herring (Larus argentatus) and Great Black-backed Gull (Larus marinus) eggs from colonies in the New York harbor complex between 2012 and 2013

    PubMed Central

    Elbin, Susan


    Birds living in coastal areas are exposed to severe storms and tidal flooding during the nesting season, but also to contaminants that move up the food chain from the water column and sediment to their prey items. We examine metals in Herring Gull (Larus argentatus) and Great Black-backed Gull (Larus marinus) eggs collected from the New York/New Jersey harbor estuary in 2012 and in 2013 to determine if there were significant yearly differences in metal levels. We test the null hypothesis that there were no significant yearly differences in metal levels. We investigate whether there were consistent differences in metals from 2012 to 2013 that might suggest a storm-related effect because Superstorm Sandy landed in New Jersey in October 2012 with high winds and extensive flooding, and view this research as exploratory. Except for arsenic, there were significant inter-year variations in the mean levels for all colonies combined for Herring Gull, and for lead, mercury and selenium for Great Black-backed Gulls. All metal levels in 2013 were less than in 2012, except for lead. These differences were present for individual colonies as well. Metal levels varied significantly among islands for Herring Gulls in both years (except for cadmium in 2013). No one colony had the highest levels of all metals for Herring Gulls. A long term data set on mercury levels in Herring Gulls indicated that the differences between 2012 and 2013 were greater than usual. Several different factors could account for these differences, and these are discussed. PMID:25471353

  14. Membranicola marinus gen. nov., sp. nov., a new member of the family Saprospiraceae isolated from a biofilter in a recirculating aquaculture system.


    Li, Xian; Liu, Ying; Chen, Zhu; Liu, Liang-Zi; Liu, Zhi-Pei; Liu, Ying


    A Gram-staining-negative bacterial strain (termed CZ-AZ5T) was isolated from a biological filter in a marine recirculating aquaculture system in Tianjin, China. Its taxonomic status was determined using a polyphasic approach. CZ-AZ5T cells were non-spore-forming, non-motile rods, 0.6-0.7 μm wide and 3.0-3.7 μm long. CZ-AZ5T was strictly heterotrophic, aerobic, oxidase-negative, and catalase-positive. Growth occurred in the temperature range 20-40 °C (optimal: 30 °C), pH range 6.0-8.5 (optimal: 7.5), and salinity range 0-5 % (w/v) NaCl (optimal: 1 %). In phylogenetic analyses based on 16S rRNA gene sequences, CZ-AZ5T was assigned to the family Saprospiraceae (phylum Bacteroidetes) and was clustered with the genera Saprospira and Aureispira within the family. It showed highest sequence similarity to Candidatus Haliscomenobacter calcifugiens (86.2 %), followed by Saprospira grandis ATCC 23119T (85.7 %) and Lewinella persica T-3T (85.6 %). DNA G+C content was 40.1 mol %, the major menaquinone was MK-7, and the major cellular fatty acids (>10 %) were C16:1ω7c and iso-C15:0. Our phenotypic, chemotaxonomic, and phylogenetic observations, taken together, led us to conclude that strain CZ-AZ5T represents a new species and genus of the family Saprospiraceae, for which the name Membranicola marinus gen. nov., sp. nov. is proposed. The type strain is CZ-AZ5T (= CGMCC 1.13179T = JCM 18886T).

  15. Thyroid hormone deiodinase type 2 mRNA levels in sea lamprey (Petromyzon marinus) are regulated during metamorphosis and in response to a thyroid challenge.


    Stilborn, S Salina M; Manzon, Lori A; Schauenberg, Jennifer D; Manzon, Richard G


    Thyroid hormones (THs) are crucial for normal vertebrate development and are the one obligate morphogen that drives amphibian metamorphosis. However, contrary to other metamorphosing vertebrates, lampreys exhibit a sharp drop in serum TH early in metamorphosis, and anti-thyroid agents such as potassium perchlorate (KClO(4)) induce metamorphosis. The type 2 deiodinase (D2) enzyme is a key regulator of TH availability during amphibian metamorphosis. We set out to determine how D2 may be involved in the regulation of lamprey metamorphosis and thyroid homeostasis. We cloned a 1.8Kb Petromyzon marinus D2 cDNA that includes the entire protein coding region and a selenocysteine (Sec) codon. Northern blotting indicated that the lamprey D2 mRNA is the longest reported to date (>9Kb). Using real-time PCR, we showed that intestinal and hepatic D2 mRNA levels were elevated prior to and during the early stages of metamorphosis and then declined dramatically to low levels that were sustained for the remainder of metamorphosis. These data are consistent with previously reported changes in serum TH levels and deiodinase activity. Treatment of larvae with either TH or KClO(4) significantly affected D2 mRNA levels in the intestine and liver. These D2 mRNA levels during metamorphosis and in response to thyroid challenges suggest that D2 may function in the regulation of TH levels during lamprey metamorphosis and the maintenance of TH homeostasis. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. CO2-responsive expression and gene organization of three ribulose-1,5-bisphosphate carboxylase/oxygenase enzymes and carboxysomes in Hydrogenovibrio marinus strain MH-110.


    Yoshizawa, Yoichi; Toyoda, Koichi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo


    Hydrogenovibrio marinus strain MH-110, an obligately lithoautotrophic hydrogen-oxidizing bacterium, fixes CO2 by the Calvin-Benson-Bassham cycle. Strain MH-110 possesses three different sets of genes for ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO): CbbLS-1 and CbbLS-2, which belong to form I (L8S8), and CbbM, which belongs to form II (Lx). In this paper, we report that the genes for CbbLS-1 (cbbLS-1) and CbbM (cbbM) are both followed by the cbbQO genes and preceded by the cbbR genes encoding LysR-type regulators. In contrast, the gene for CbbLS-2 (cbbLS-2) is followed by genes encoding carboxysome shell peptides. We also characterized the three RubisCOs in vivo by examining their expression profiles in environments with different CO2 availabilities. Immunoblot analyses revealed that when strain MH-110 was cultivated in 15% CO2, only the form II RubisCO, CbbM, was expressed. When strain MH-110 was cultivated in 2% CO2, CbbLS-1 was expressed in addition to CbbM. In the 0.15% CO2 culture, the expression of CbbM decreased and that of CbbLS-1 disappeared, and CbbLS-2 was expressed. In the atmospheric CO2 concentration of approximately 0.03%, all three RubisCOs were expressed. Transcriptional analyses of mRNA by reverse transcription-PCR showed that the regulation was at the transcriptional level. Electron microscopic observation of MH-110 cells revealed the formation of carboxysomes in the 0.15% CO2 concentration. The results obtained here indicate that strain MH-110 adapts well to various CO2 concentrations by using different types of RubisCO enzymes.

  17. The Relationship Between Increasing Sea-surface Temperature and the Northward Spread of Perkinsus marinus(Dermo) Disease Epizootics in Oysters

    NASA Astrophysics Data System (ADS)

    Cook, T.; Folli, M.; Klinck, J.; Ford, S.; Miller, J.


    From its initial discovery in the Gulf of Mexico in the late 1940s until 1990,Perkinsus marinus, the parasite responsible for Dermo disease in the eastern oyster,Crassostrea virginica, was rarely found north of Chesapeake Bay. In 1990-92, an apparent range extension of the parasite led to epizootic outbreaks of the disease over a 500 km range north of Chesapeake Bay. One of the hypotheses for the range extension argues that small, undetected numbers of parasites were already present in northern oysters as the result of repeated historical introductions, and that a sharp warming trend in 1990-92 stimulated the disease outbreak. This argument was based on trends in air temperature. The present study examined this hypothesis by analysing water temperatures, rather than air temperatures, for five stations located in areas affected by the recent epizootics. At all five stations, there was a strong increasing trend in winter sea-surface temperature (SST) between 1986 and 1991. At four of the five stations, there was a smaller increasing trend in winter temperatures after 1960. There were no consistent or obvious trends in summer (August) temperatures. In Delaware Bay, which has a 40 year history of monitoring for oyster diseases, occasional findings ofP. marinusin oysters were correlated with warming episodes that were especially notable in the winter (February) record. Empirical orthogonal function (EOF) analysis showed that winter temperatures varied consistently at the stations examined and were associated with variations inP. marinusprevalence. Associations using EOF analysis with August temperatures were much weaker. The SST record is consistent with the hypothesis that increasing winter water temperatures have been important in the recent outbreak ofP. marinusepizootics in the north-eastern U.S.A.

  18. Biology of larval and metamorphosing sea lampreys, Petromyzon marinus, of the 1960 year class in the Big Garlic River, Michigan, Part II, 1966-72

    USGS Publications Warehouse

    Manion, Patrick J.; Smith, Bernard R.


    The 1960 year class of sea lampreys, Petromyzon marinus, isolated in a tributary of southern Lake Superior continued to yield information on the early life history of the sea lamprey. The larval population persisted and newly metamorphosed individuals were captured from 1966 until the study was terminated in 1972. The average lengths of larvae collected in October (when yearly growth is nearly complete) in successive years from 1966 to 1972 were 111, 113, 112, 114, 121, 128, and 129 mm. The average lengths of transforming lampreys during the same years were 150, 151, 145, 143, 144, 148, and 156 mm. A gradual downstream shift of the population took place. Catches in an inclined-plane trap at the lower end of the study area increased to a peak of 13,244 in the 1968-69 migration year (September 1-August 31), and then steadily decreased. As the number of lampreys decreased in the upper sections and increased in the lower ones, the changes in density were reflected in changes in growth rates. Although the mean length of ammocetes throughout the stream was 111 mm in 1966, it had increased by 1971 to 151 and 143 mm in the upstream sections (IV and V), but to only 115 mm in the densely populated area immediately above the trap. Of a total of 9,889 larvae marked in 1962-68 to study movement and distribution, 2,045 were recovered as larvae and 1,396 as newly transformed adults. Major downstream movements of larvae occurred during high water in April and May, and of transformed lampreys in mid-October through November. Each year about 40% (range, 30-68) of the annual production of transformed lampreys migrated from the Big Garlic River system in one 12-hour period, and 82% by the end of October. The Big Garlic River study proved conclusively that metamorphosis of a single year class occurs over a considerable number of years. Newly metamorphosed individuals were captured in almost steadily increasing numbers from 1965 (age V) to the termination of the study in 1972 (age XII

  19. Dose-response relationship of 15alpha-hydroxylated sex steroids to gonadotropin-releasing hormones and pituitary extract in male sea lampreys (Petromyzon marinus).


    Young, Bradley A; Bryan, Mara B; Glenn, Jessica R; Yun, Sang Seon; Scott, Alexander P; Li, Weiming


    The sea lamprey (Petromyzon marinus) is one of the earliest extant vertebrates for which the hypothalamic-pituitary-gonadal (HPG) axis has been shown to control and regulate reproduction in a similar fashion to gnathostome vertebrates. While the two forms of gonadotropin-releasing hormones in the sea lamprey (GnRH I and GnRH III) have been studied extensively, their in vivo effect on synthesis of 15alpha-hydroxytestosterone (15alpha-T) and 15alpha-hydroxyprogesterone (15alpha-P) have only been partially characterized. In the present study, plasma concentrations of 15alpha-T and 15alpha-P were measured in prespermiating sea lampreys that were given a single injection of either GnRH I or GnRH III in doses ranging from 5 to 100 microg/kg, or of pituitary extract (as a source of gonadotropin). Plasma was sampled at 1-6h and 6-48 h post-injection, in separate experiments, in order to characterize the peak and duration of responses. 15alpha-T plasma concentrations increased slightly in response to all three treatments, but not in a dose-dependent manner, and the timing of peak concentrations varied between doses. However, 15alpha-P plasma concentrations showed a greater range of response (between 1 and 100 ng/ml) and were clearly correlated with the injection dose. Plasma concentrations of 15alpha-P also responded to far lower doses of GnRH I and GnRH III than any other steroid previously investigated in lampreys. The plasma concentrations of 15alpha-P peaked at 6h after injection for all three treatments, and levels reached a mean of 53.1 ng/ml. In female lampreys that were injected twice with 50 microg/ml GnRH I or III, 15alpha-T concentrations did not exceed 0.5 ng/ml and 15alpha-P concentrations did not exceed 1 ng/ml. These results lend further support to the hypothesis that 15alpha-P plays an important role in the reproductive endocrinology of male lampreys.

  20. Proposal to unify Clostridium orbiscindens Winter et al. 1991 and Eubacterium plautii (Séguin 1928) Hofstad and Aasjord 1982, with description of Flavonifractor plautii gen. nov., comb. nov., and reassignment of Bacteroides capillosus to Pseudoflavonifractor capillosus gen. nov., comb. nov.


    Carlier, Jean-Philippe; Bedora-Faure, Marie; K'ouas, Guylène; Alauzet, Corentine; Mory, Francine


    We isolated several strains from various clinical samples (five samples of blood, four of intra-abdominal pus and one of infected soft tissue) that were anaerobic, motile or non-motile and Gram-positive rods. Some of the strains formed spores. Phylogenetic analysis of the 16S rRNA gene sequence showed that these organisms could be placed within clostridial cluster IV as defined by Collins et al. [(1994). Int J Syst Bacteriol 44, 812-826] and shared more than 99 % sequence similarity with Clostridium orbiscindens DSM 6740(T) and Eubacterium plautii DSM 4000(T). Together, they formed a distinct cluster, with Bacteroides capillosus ATCC 29799(T) branching off from this line of descent with sequence similarities of 97.1-97.4 %. The next nearest neighbours of these organisms were Clostridium viride, Oscillibacter valericigenes, Papillibacter cinnamivorans and Sporobacter termitidis, with sequence similarities to the respective type strains of 93.1-93.4, 91.2-91.4, 89.8-90 and 88.7-89.3 %. On the basis of biochemical properties, phylogenetic position, DNA G+C content and DNA-DNA hybridization, it is proposed to unify Clostridium orbiscindens and Eubacterium plautii in a new genus as Flavonifractor plautii gen. nov., comb. nov., with the type strain Prévot S1(T) (=ATCC 29863(T) =VPI 0310(T) =DSM 4000(T)), and to reassign Bacteroides capillosus to Pseudoflavonifractor capillosus gen. nov., comb. nov., with the type strain CCUG 15402A(T) (=ATCC 29799(T) =VPI R2-29-1(T)).

  1. Neptuniibacter pectenicola sp. nov. and Neptuniibacter marinus sp. nov., two novel species isolated from a Great scallop (Pecten maximus) hatchery in Norway and emended description of the genus Neptuniibacter.


    Diéguez, Ana L; Balboa, Sabela; Magnesen, Thorolf; Romalde, Jesús L


    Nine isolates obtained from a great scallop hatchery in Norway were characterized using a polyphasic approach. Strains were Gram-negative, aerobic and motile rods with oxidative metabolism. Phylogenetic analysis based on the sequences of 16S rRNA and rpoB genes showed that these strains formed two different groups associated with members of the genus Neptuniibacter. DNA-DNA hybridization (DDH) and Average Nucleotide Identity (ANI) demonstrated that the isolates constituted two novel species of this genus, which can be phenotypically differentiated from their closest relatives. The names Neptuniibacter marinus sp. nov. and Neptuniibacter pectenicola sp. nov are proposed, with ATR 1.1(T) (=CECT 8938(T)=DSM 100783(T)) and LFT 1.8(T) (=CECT 8936(T)=DSM 100781(T)) as respective type strains.

  2. Pseudooceanicola atlanticus gen. nov. sp. nov., isolated from surface seawater of the Atlantic Ocean and reclassification of Oceanicola batsensis, Oceanicola marinus, Oceanicola nitratireducens, Oceanicola nanhaiensis, Oceanicola antarcticus and Oceanicola flagellatus, as Pseudooceanicola batsensis comb. nov., Pseudooceanicola marinus comb. nov., Pseudooceanicola nitratireducens comb. nov., Pseudooceanicola nanhaiensis comb. nov., Pseudooceanicola antarcticus comb. nov., and Pseudooceanicola flagellatus comb. nov.


    Lai, Qiliang; Li, Guizhen; Liu, Xiupian; Du, Yaping; Sun, Fengqin; Shao, Zongze


    be assigned to the genus Oceanicola; consequently strain 22II-S11g(T) is concluded to represent a novel species of a novel genus in the family Rhodobacteraceae, for which the name Pseudooceanicola atlanticus gen. nov., sp. nov. is proposed (type strain 22II-S11g(T) = KCTC 42004(T) = LMG 27424(T) = MCCC 1A09160(T)). Six misclassified species should be transferred to the novel genus Pseudooceanicola as follows: O. batsensis should be transferred to the genus Pseudooceanicola as Pseudooceanicola batsensis comb. nov. (type strain HTCC2597(T) = ATCC BAA-863(T) = DSM 15984(T) = KCTC 12145(T)); Oceanicola marinus should be transferred to the genus Pseudooceanicola as Pseudooceanicola marinus comb. nov. (type strain AZO-C(T) = LMG 23705(T) = BCRC 17591(T)); O. nitratireducens should be transferred to the genus Pseudooceanicola as Pseudooceanicola nitratireducens comb. nov. (type strain JLT1210(T) = LMG 24663(T) = CGMCC 1.7292(T)); Oceanicola nanhaiensis should be transferred to the genus Pseudooceanicola as Pseudooceanicola nanhaiensis comb. nov. (type strain SS011B1-20(T) = LMG 23508(T) = CGMCC 1.6293(T)); Oceanicola antarcticus should be transferred to the genus Pseudooceanicola as Pseudooceanicola antarcticus comb. nov. (type strain Ar-45(T) = CGMCC 1.12662(T) = LMG 27868(T)); and Oceanicola flagellatus should be transferred to the genus Pseudooceanicola as Pseudooceanicola flagellatus comb. nov. (type strain DY470(T) = CGMCC 1.12664(T) = LMG 27871(T)).

  3. Reassortment of American and Eurasian genes in an influenza A virus isolated from a great black-backed gull (Larus marinus), a species demonstrated to move between these regions.


    Wille, Michelle; Robertson, Gregory J; Whitney, Hugh; Ojkic, Davor; Lang, Andrew S


    The primary hosts for influenza A viruses are waterfowl, although gulls and shorebirds are also important in global avian influenza dynamics. Avian influenza virus genes are separated phylogenetically into two geographic clades, American and Eurasian, which is caused by the geographic separation of the host species between these two regions. We surveyed a gregarious and cosmopolitan species, the Great Black-backed Gull (Larus marinus), in Newfoundland, Canada, for the presence of avian influenza viruses. We have isolated and determined the complete genome sequence of an H13N2 virus, A/Great Black-backed Gull/Newfoundland/296/2008(H13N2), from one of these birds. Phylogenetic analysis revealed that this virus contained two genes in the American gull clade (PB1, HA), two genes in the American avian clade (PA, NA), and four genes in the Eurasian gull clade (PB2, NP, M, NS). We analyzed bird band recovery information and found the first evidence of trans-Atlantic migration from Newfoundland to Europe (UK, Spain and Portugal) for this species. Thus, great black-backed gulls could be important for movement of avian influenza viruses across the Atlantic Ocean and within North America.

  4. Failure of ATP supply to match ATP demand: the mechanism of toxicity of the lampricide, 3-trifluoromethyl-4-nitrophenol (TFM), used to control sea lamprey (Petromyzon marinus) populations in the Great Lakes.


    Birceanu, Oana; McClelland, Grant B; Wang, Yuxiang S; Wilkie, Michael P


    Although the pesticide, 3-trifluoromethyl-4-nitrophenol (TFM), has been extensively used to control invasive sea lamprey (Petromyzon marinus) populations in the Great Lakes, it is surprising that its mechanism(s) of toxicity is unresolved. A better knowledge of the mode of toxicity of this pesticide is needed for predicting and improving the effectiveness of TFM treatments on lamprey, and for risk assessments regarding potential adverse effects on invertebrate and vertebrate non-target organisms. We investigated two hypotheses of TFM toxicity in larval sea lamprey. The first was that TFM interferes with oxidative ATP production by mitochondria, causing rapid depletion of energy stores in vital, metabolically active tissues such as the liver and brain. The second was that TFM toxicity resulted from disruption of gill-ion uptake, adversely affecting ion homeostasis. Exposure of larval sea lamprey to 4.6 m gl(-1) TFM (12-h LC50) caused glycogen concentrations in the brain to decrease by 80% after 12h, suggesting that the animals increased their reliance on glycolysis to generate ATP due to a shortfall in ATP supply. This conclusion was reinforced by a 9-fold increase in brain lactate concentration, a 30% decrease in brain ATP concentration, and an 80% decrease in phosphocreatine (PCr) concentration after 9 and 12h. A more pronounced trend was noted in the liver, where glycogen decreased by 85% and ATP was no longer detected after 9 and 12h. TFM led to marginal changes in whole body Na(+), Cl(-), Ca(2+) and K(+), as well as in plasma Na(+) and Cl(-), which were unlikely to have contributed to toxicity. TFM had no adverse effect on Na(+) uptake rates or gill Na(+)/K(+)-ATPase activity. We conclude that TFM toxicity in the sea lamprey is due to a mismatch between ATP consumption and ATP production rates, leading to a depletion of glycogen in the liver and brain, which ultimately leads to neural arrest and death.

  5. Eubacterium brachy - Reactivity in In Vitro Bone Resorptive Bioassay,

    DTIC Science & Technology


    was described by L6e et all in a study in which gingivitis was induced in healthy subjects by with- drawing oral hygiene procedures. The changes in...pathogenicLty in this disease process. 7 Fuobacterium nucleatum has been shown to increase in numbers with increasing gingival inflammation e and in...association of this organism in relation to the advancing front of the disease state. An organism isolated from subgingival plaque which is also present in

  6. Proteogenomic Analysis of a Thermophilic Bacterial Consortium Adapted to Deconstruct Switchgrass

    PubMed Central

    D'haeseleer, Patrik; Gladden, John M.; Allgaier, Martin; Chain, Patrik S. G.; Tringe, Susannah G.; Malfatti, Stephanie A.; Aldrich, Joshua T.; Nicora, Carrie D.; Robinson, Errol W.; Paša-Tolić, Ljiljana; Hugenholtz, Philip; Simmons, Blake A.; Singer, Steven W.


    Thermophilic bacteria are a potential source of enzymes for the deconstruction of lignocellulosic biomass. However, the complement of proteins used to deconstruct biomass and the specific roles of different microbial groups in thermophilic biomass deconstruction are not well-explored. Here we report on the metagenomic and proteogenomic analyses of a compost-derived bacterial consortium adapted to switchgrass at elevated temperature with high levels of glycoside hydrolase activities. Near-complete genomes were reconstructed for the most abundant populations, which included composite genomes for populations closely related to sequenced strains of Thermus thermophilus and Rhodothermus marinus, and for novel populations that are related to thermophilic Paenibacilli and an uncultivated subdivision of the little-studied Gemmatimonadetes phylum. Partial genomes were also reconstructed for a number of lower abundance thermophilic Chloroflexi populations. Identification of genes for lignocellulose processing and metabolic reconstructions suggested Rhodothermus, Paenibacillus and Gemmatimonadetes as key groups for deconstructing biomass, and Thermus as a group that may primarily metabolize low molecular weight compounds. Mass spectrometry-based proteomic analysis of the consortium was used to identify >3000 proteins in fractionated samples from the cultures, and confirmed the importance of Paenibacillus and Gemmatimonadetes to biomass deconstruction. These studies also indicate that there are unexplored proteins with important roles in bacterial lignocellulose deconstruction. PMID:23894306

  7. Proteogenomic Analysis of a Thermophilic Bacterial Consortium Adapted to Deconstruct Switchgrass

    SciTech Connect

    D'haeseleer, Patrik; Gladden, John M.; Allgaier, Martin; Chain, Patrick; Tringe, Susannah G.; Malfatti, Stephanie; Aldrich, Joshua T.; Nicora, Carrie D.; Robinson, Errol W.; Pasa-Tolic, Ljiljana; Hugenholtz, Philip; Simmons, Blake A.; Singer, Steven W.


    Thermophilic bacteria are a potential source of enzymes for the deconstruction of lignocellulosic biomass. However, the complement of proteins used to deconstruct biomass and the specific roles of different microbial groups in thermophilic biomass deconstruction are not well-explored. Here we report on the metagenomic and proteogenomic analyses of a compost-derived bacterial consortium adapted to switchgrass at elevated temperature with high levels of glycoside hydrolase activities. Near-complete genomes were reconstructed for the most abundant populations, which included composite genomes for populations closely related to sequenced strains of Thermus thermophilus and Rhodothermus marinus, and for novel populations that are related to thermophilic Paenibacilli and an uncultivated subdivision of the littlestudied Gemmatimonadetes phylum. Partial genomes were also reconstructed for a number of lower abundance thermophilic Chloroflexi populations. Identification of genes for lignocellulose processing and metabolic reconstructions suggested Rhodothermus, Paenibacillus and Gemmatimonadetes as key groups for deconstructing biomass, and Thermus as a group that may primarily metabolize low molecular weight compounds. Mass spectrometry-based proteomic analysis of the consortium was used to identify .3000 proteins in fractionated samples from the cultures, and confirmed the importance of Paenibacillus and Gemmatimonadetes to biomass deconstruction. These studies also indicate that there are unexplored proteins with important roles in bacterial lignocellulose deconstruction.

  8. Novel xylan-binding properties of an engineered family 4 carbohydrate-binding module.


    Cicortas Gunnarsson, Lavinia; Montanier, Cedric; Tunnicliffe, Richard B; Williamson, Mike P; Gilbert, Harry J; Nordberg Karlsson, Eva; Ohlin, Mats


    Molecular engineering of ligand-binding proteins is commonly used for identification of variants that display novel specificities. Using this approach to introduce novel specificities into CBMs (carbohydrate-binding modules) has not been extensively explored. Here, we report the engineering of a CBM, CBM4-2 from the Rhodothermus marinus xylanase Xyn10A, and the identification of the X-2 variant. As compared with the wild-type protein, this engineered module displays higher specificity for the polysaccharide xylan, and a lower preference for binding xylo-oligomers rather than binding the natural decorated polysaccharide. The mode of binding of X-2 differs from other xylan-specific CBMs in that it only has one aromatic residue in the binding site that can make hydrophobic interactions with the sugar rings of the ligand. The evolution of CBM4-2 has thus generated a xylan-binding module with different binding properties to those displayed by CBMs available in Nature.

  9. Replacement of the active surface of a thermophile protein by that of a homologous mesophile protein through structure-guided 'protein surface grafting'.


    Kapoor, Divya; Kumar, Vijay; Chandrayan, Sanjeev K; Ahmed, Shubbir; Sharma, Swati; Datt, Manish; Singh, Balvinder; Karthikeyan, Subramanian; Guptasarma, Purnananda


    Using several tens of rationally-selected substitutions, insertions and deletions of predominantly non-contiguous residues, we have remodeled the solvent-exposed face of a beta sheet functioning as the substrate-binding and catalytically-active groove of a thermophile cellulase (Rhodothermus marinus Cel12A) to cause it to resemble, both in its structure and function, the equivalent groove of a mesophile homolog (Trichoderma reesei Cel12A). The engineered protein, a mesoactive-thermostable cellulase (MT Cel12A) displays the temperature of optimal function of its mesophile ancestor and the temperature of melting of its thermophile ancestor, suggesting that such 'grafting' of a mesophile-derived surface onto a thermophile-derived structural scaffold can potentially help generate novel enzymes that recombine structural and functional features of homologous proteins sourced from different domains of life.

  10. Directed evolution of cytochrome c for carbon-silicon bond formation: Bringing silicon to life.


    Kan, S B Jennifer; Lewis, Russell D; Chen, Kai; Arnold, Frances H


    Enzymes that catalyze carbon-silicon bond formation are unknown in nature, despite the natural abundance of both elements. Such enzymes would expand the catalytic repertoire of biology, enabling living systems to access chemical space previously only open to synthetic chemistry. We have discovered that heme proteins catalyze the formation of organosilicon compounds under physiological conditions via carbene insertion into silicon-hydrogen bonds. The reaction proceeds both in vitro and in vivo, accommodating a broad range of substrates with high chemo- and enantioselectivity. Using directed evolution, we enhanced the catalytic function of cytochrome c from Rhodothermus marinus to achieve more than 15-fold higher turnover than state-of-the-art synthetic catalysts. This carbon-silicon bond-forming biocatalyst offers an environmentally friendly and highly efficient route to producing enantiopure organosilicon molecules. Copyright © 2016, American Association for the Advancement of Science.

  11. Biosynthesis of open-chain tetrapyrroles in Prochlorococcus marinus.


    Dammeyer, Thorben; Michaelsen, Kristin; Frankenberg-Dinkel, Nicole


    Members of the genus Prochlorococcus belong to the most abundant phytoplankton on earth. In contrast to other cyanobacteria, Prochlorococcus is characterized by divinyl-chlorophyll containing light-harvesting complexes and the lack of phycobilisomes. Despite the lack of phycobilisomes, all sequenced genomes of Prochlorococcus possess genes that putatively encode enzymes involved in the biosynthesis of open-chain tetrapyrrole molecules. Here, biochemical evidence is presented indicating that high-light- and low-light-adapted Prochlorococcus ecotypes possess genes encoding functional enzymes for the biosynthesis of open-chain tetrapyrrole molecules. Experiments on recombinant protein as well as through complementation studies of a cyanobacterial insertion mutant revealed the functionality of the bilin reductases investigated.

  12. Intertwined evolutionary histories of marine Synechococcus and Prochlorococcus marinus.


    Zhaxybayeva, Olga; Doolittle, W Ford; Papke, R Thane; Gogarten, J Peter


    Prochlorococcus is a genus of marine cyanobacteria characterized by small cell and genome size, an evolutionary trend toward low GC content, the possession of chlorophyll b, and the absence of phycobilisomes. Whereas many shared derived characters define Prochlorococcus as a clade, many genome-based analyses recover them as paraphyletic, with some low-light adapted Prochlorococcus spp. grouping with marine Synechococcus. Here, we use 18 Prochlorococcus and marine Synechococcus genomes to analyze gene flow within and between these taxa. We introduce embedded quartet scatter plots as a tool to screen for genes whose phylogeny agrees or conflicts with the plurality phylogenetic signal, with accepted taxonomy and naming, with GC content, and with the ecological adaptation to high and low light intensities. We find that most gene families support high-light adapted Prochlorococcus spp. as a monophyletic clade and low-light adapted Prochlorococcus sp. as a paraphyletic group. But we also detect 16 gene families that were transferred between high-light adapted and low-light adapted Prochlorococcus sp. and 495 gene families, including 19 ribosomal proteins, that do not cluster designated Prochlorococcus and Synechococcus strains in the expected manner. To explain the observed data, we propose that frequent gene transfer between marine Synechococcus spp. and low-light adapted Prochlorococcus spp. has created a "highway of gene sharing" (Beiko RG, Harlow TJ, Ragan MA. 2005. Highways of gene sharing in prokaryotes. Proc Natl Acad Sci USA. 102:14332-14337) that tends to erode genus boundaries without erasing the Prochlorococcus-specific ecological adaptations.

  13. Intertwined Evolutionary Histories of Marine Synechococcus and Prochlorococcus marinus

    PubMed Central

    Doolittle, W. Ford; Papke, R. Thane; Gogarten, J. Peter


    Prochlorococcus is a genus of marine cyanobacteria characterized by small cell and genome size, an evolutionary trend toward low GC content, the possession of chlorophyll b, and the absence of phycobilisomes. Whereas many shared derived characters define Prochlorococcus as a clade, many genome-based analyses recover them as paraphyletic, with some low-light adapted Prochlorococcus spp. grouping with marine Synechococcus. Here, we use 18 Prochlorococcus and marine Synechococcus genomes to analyze gene flow within and between these taxa. We introduce embedded quartet scatter plots as a tool to screen for genes whose phylogeny agrees or conflicts with the plurality phylogenetic signal, with accepted taxonomy and naming, with GC content, and with the ecological adaptation to high and low light intensities. We find that most gene families support high-light adapted Prochlorococcus spp. as a monophyletic clade and low-light adapted Prochlorococcus sp. as a paraphyletic group. But we also detect 16 gene families that were transferred between high-light adapted and low-light adapted Prochlorococcus sp. and 495 gene families, including 19 ribosomal proteins, that do not cluster designated Prochlorococcus and Synechococcus strains in the expected manner. To explain the observed data, we propose that frequent gene transfer between marine Synechococcus spp. and low-light adapted Prochlorococcus spp. has created a “highway of gene sharing” (Beiko RG, Harlow TJ, Ragan MA. 2005. Highways of gene sharing in prokaryotes. Proc Natl Acad Sci USA. 102:14332–14337) that tends to erode genus boundaries without erasing the Prochlorococcus-specific ecological adaptations. PMID:20333202

  14. Metamorphosis of the landlocked sea lamprey, Petromyzon marinus

    USGS Publications Warehouse

    Manion, Patrick J.; Stauffer, Thomas M.


    The external metamorphosis of the sea lamprey was divided into four stages, based primarily on the condition of the mouth: mouth reduced, mouth fused, mouth enclosed, and mouth elongated. During metamorphosis, the eye enlarged greatly, the snout and mouth region changed from a fleshy hood enclosing a sieve apparatus to a large sucking disc, the nasopore membrane and the branchial area shrank, the branchiopores changed in shape, the general color changed from dark brown and yellow to an intense blue-black dorsally and white ventrally, and the total length increased. Metamorphosis began in early to mid-July and did not take place after August. The duration of external metamorphosis was about 3 months for lampreys transforming under natural conditions. The mean lengths of metamorphosing lampreys from tributaries of lakes Superior and Michigan were 145 and 136 mm, respectively.

  15. Fecundity of the sea lamprey (Petromyzon marinus) in Lake Superior

    USGS Publications Warehouse

    Manion, Patrick J.


    An infectious agent, which appears to be a virus (RJV) has been isolated from the liver of a wild raccoon which has led to a highly fatal type of disease characterized by conjunctivitis and an elevated serum bilirubin frequently accompanied by jaundice on inoculation of raccoons. Ferrets also appear to be susceptible to infections with this agent.

  16. Rearing of sea lamprey, Petromyzon marinus, embryos in distilled water

    USGS Publications Warehouse

    Piavis, George W.; Howell, John H.


    Most embryological studies of lampreys in the Great Lakes have been conducted with filtered water from Lake Huron. Although this water was entirely satisfactory for the earlier work, the present need for knowledge of the effects of various compounds on embryological development requires that the initial medium be sterile. The purpose of the present study was to determine whether sea lamprey embryos could be successfully reared in distilled water. Mature sea lampreys were collected from the Ocqueoc River, Presque Isle County, Michigan, and transferred to the Hammond Bay Biological Station where eggs were stripped and fertilized according to the method of Piavis. After activation was ascertained to be 90-100% complete, the embryos were washed 3-5 timesexperimentals with commercially obtained U.S.P. distilled water and controls with filtered Lake Huron water.

  17. High resolution structure of the large ribosomal subunit from a Mesophilic Eubacterium

    SciTech Connect

    Harms, Joerg; Schluenzen, Frank; Zarivach, Raz; Bashan, Anat; Gat, Sharon; Agmon, Ilana; Bartels, Heike; Franceschi, Francois; Yonath, Ada


    We describe the high resolution structure of the large ribosomal subunit from Deinococcus radiodurans (D50S), a gram-positive mesophile suitable for binding of antibiotics and functionally relevant ligands. The over-all structure of D50S is similar to that from the archae bacterium Haloarcula marismortui (H50S); however, a detailed comparison revealed significant differences, for example, in the orientation of nucleotides in peptidyl transferase center and in the structures of many ribosomal proteins. Analysis of ribosomal features involved in dynamic aspects of protein biosynthesis that are partially or fully disordered in H50S revealed the conformations of intersubunit bridges in unbound subunits, suggesting how they may change upon subunit association and how movements of the L1-stalk may facilitate the exit of tRNA.

  18. Structure of the pilus assembly protein TadZ from Eubacterium rectale: Implications for polar localization

    PubMed Central

    Xu, Qingping; Christen, Beat; Chiu, Hsiu-Ju; Jaroszewski, Lukasz; Klock, Heath E.; Knuth, Mark W.; Miller, Mitchell D.; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Figurski, David H.; Shapiro, Lucy; Wilson, Ian A.


    Summary The tad (tight adherence) locus encodes a protein translocation system that produces a novel variant of type IV pili. The pilus assembly protein TadZ (called CpaE in Caulobacter crescentus) is ubiquitous in tad loci, but is absent in other type IV pilus biogenesis systems. The crystal structure of TadZ from E. rectale (ErTadZ), in complex with ATP and Mg2+, was determined to 2.1 Å resolution. ErTadZ contains an atypical ATPase domain with a variant of a deviant Walker-A motif that retains ATP binding capacity while displaying only low intrinsic ATPase activity. The bound ATP plays an important role in dimerization of ErTadZ. The N-terminal atypical receiver domain resembles the canonical receiver domain of response regulators, but has a degenerate, stripped-down “active site”. Homology modeling of the N-terminal atypical receiver domain of CpaE indicates that it has a conserved protein-protein binding surface similar to that of the polar localization module of the social mobility protein FrzS, suggesting a similar function. Our structural results also suggest that TadZ localizes to the pole through the atypical receiver domain during early stage of pili biogenesis, and functions as a hub for recruiting other pili components, thus providing insights into the Tad pilus assembly process. PMID:22211578

  19. Identification of a Mammalian-type Phosphatidylglycerophosphate Phosphatase in the Eubacterium Rhodopirellula baltica*

    PubMed Central

    Teh, Phildrich G.; Chen, Mark J.; Engel, James L.; Worby, Carolyn A.; Manning, Gerard; Dixon, Jack E.; Zhang, Ji


    Cardiolipin is a glycerophospholipid found predominantly in the mitochondrial membranes of eukaryotes and in bacterial membranes. Cardiolipin interacts with protein complexes and plays pivotal roles in cellular energy metabolism, membrane dynamics, and stress responses. We recently identified the mitochondrial phosphatase, PTPMT1, as the enzyme that converts phosphatidylglycerolphosphate (PGP) to phosphatidylglycerol, a critical step in the de novo biosynthesis of cardiolipin. Upon examination of PTPMT1 evolutionary distribution, we found a PTPMT1-like phosphatase in the bacterium Rhodopirellula baltica. The purified recombinant enzyme dephosphorylated PGP in vitro. Moreover, its expression restored cardiolipin deficiency and reversed growth impairment in a Saccharomyces cerevisiae mutant lacking the yeast PGP phosphatase, suggesting that it is a bona fide PTPMT1 ortholog. When ectopically expressed, this bacterial PGP phosphatase was localized in the mitochondria of yeast and mammalian cells. Together, our results demonstrate the conservation of function between bacterial and mammalian PTPMT1 orthologs. PMID:23293031

  20. Glycoside Hydrolase Activities of Thermophilic Bacterial Consortia Adapted to Switchgrass ▿ †

    PubMed Central

    Gladden, John M.; Allgaier, Martin; Miller, Christopher S.; Hazen, Terry C.; VanderGheynst, Jean S.; Hugenholtz, Philip; Simmons, Blake A.; Singer, Steven W.


    Industrial-scale biofuel production requires robust enzymatic cocktails to produce fermentable sugars from lignocellulosic biomass. Thermophilic bacterial consortia are a potential source of cellulases and hemicellulases adapted to harsher reaction conditions than commercial fungal enzymes. Compost-derived microbial consortia were adapted to switchgrass at 60°C to develop thermophilic biomass-degrading consortia for detailed studies. Microbial community analysis using small-subunit rRNA gene amplicon pyrosequencing and short-read metagenomic sequencing demonstrated that thermophilic adaptation to switchgrass resulted in low-diversity bacterial consortia with a high abundance of bacteria related to thermophilic paenibacilli, Rhodothermus marinus, and Thermus thermophilus. At lower abundance, thermophilic Chloroflexi and an uncultivated lineage of the Gemmatimonadetes phylum were observed. Supernatants isolated from these consortia had high levels of xylanase and endoglucanase activities. Compared to commercial enzyme preparations, the endoglucanase enzymes had a higher thermotolerance and were more stable in the presence of 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), an ionic liquid used for biomass pretreatment. The supernatants were used to saccharify [C2mim][OAc]-pretreated switchgrass at elevated temperatures (up to 80°C), demonstrating that these consortia are an excellent source of enzymes for the development of enzymatic cocktails tailored to more extreme reaction conditions. PMID:21724886

  1. The Structure of a BamA-BamD Fusion Illuminates the Architecture of the β-Barrel Assembly Machine Core.


    Bergal, Hans Thor; Hopkins, Alex Hunt; Metzner, Sandra Ines; Sousa, Marcelo Carlos


    The β-barrel assembly machine (BAM) mediates folding and insertion of integral β-barrel outer membrane proteins (OMPs) in Gram-negative bacteria. Of the five BAM subunits, only BamA and BamD are essential for cell viability. Here we present the crystal structure of a fusion between BamA POTRA4-5 and BamD from Rhodothermus marinus. The POTRA5 domain binds BamD between its tetratricopeptide repeats 3 and 4. The interface structural elements are conserved in the Escherichia coli proteins, which allowed structure validation by mutagenesis and disulfide crosslinking in E. coli. Furthermore, the interface is consistent with previously reported mutations that impair BamA-BamD binding. The structure serves as a linchpin to generate a BAM model where POTRA domains and BamD form an elongated periplasmic ring adjacent to the membrane with a central cavity approximately 30 × 60 Å wide. We propose that nascent OMPs bind this periplasmic ring prior to insertion and folding by BAM.

  2. Engineered xyloglucan specificity in a carbohydrate-binding module.


    Gunnarsson, Lavinia Cicortas; Zhou, Qi; Montanier, Cedric; Karlsson, Eva Nordberg; Brumer, Harry; Ohlin, Mats


    The field of plant cell wall biology is constantly growing and consequently so is the need for more sensitive and specific probes for individual wall components. Xyloglucan is a key polysaccharide widely distributed in the plant kingdom in both structural and storage tissues that exist in both fucosylated and non-fucosylated variants. Presently, the only xyloglucan marker available is the monoclonal antibody CCRC-M1 that is specific to terminal alpha-1,2-linked fucosyl residues on xyloglucan oligo- and polysaccharides. As a viable alternative to searches for natural binding proteins or creation of new monoclonal antibodies, an approach to select xyloglucan-specific binding proteins from a combinatorial library of the carbohydrate-binding module, CBM4-2, from xylanase Xyn10A of Rhodothermus marinus is described. Using phage display technology in combination with a chemoenzymatic method to anchor xyloglucan to solid supports, the selection of xyloglucan-binding modules with no detectable residual wild-type xylan and beta-glucan-binding ability was achieved.

  3. Community dynamics and glycoside hydrolase activities of thermophilic bacterial consortia adapted to switchgrass

    SciTech Connect

    Gladden, J.M.; Allgaier, M.; Miller, C.S.; Hazen, T.C.; VanderGheynst, J.S.; Hugenholtz, P.; Simmons, B.A.; Singer, S.W.


    Industrial-scale biofuel production requires robust enzymatic cocktails to produce fermentable sugars from lignocellulosic biomass. Thermophilic bacterial consortia are a potential source of cellulases and hemicellulases adapted to harsher reaction conditions than commercial fungal enzymes. Compost-derived microbial consortia were adapted to switchgrass at 60 C to develop thermophilic biomass-degrading consortia for detailed studies. Microbial community analysis using small-subunit rRNA gene amplicon pyrosequencing and short-read metagenomic sequencing demonstrated that thermophilic adaptation to switchgrass resulted in low-diversity bacterial consortia with a high abundance of bacteria related to thermophilic paenibacilli, Rhodothermus marinus, and Thermus thermophilus. At lower abundance, thermophilic Chloroflexi and an uncultivated lineage of the Gemmatimonadetes phylum were observed. Supernatants isolated from these consortia had high levels of xylanase and endoglucanase activities. Compared to commercial enzyme preparations, the endoglucanase enzymes had a higher thermotolerance and were more stable in the presence of 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), an ionic liquid used for biomass pretreatment. The supernatants were used to saccharify [C2mim][OAc]-pretreated switchgrass at elevated temperatures (up to 80 C), demonstrating that these consortia are an excellent source of enzymes for the development of enzymatic cocktails tailored to more extreme reaction conditions.

  4. Characterisation of a New Family of Carboxyl Esterases with an OsmC Domain

    PubMed Central

    Horsfall, Louise E.; Wardrope, Caroline; Togneri, Peter D.; Marles-Wright, Jon; Rosser, Susan J.


    Proteins in the serine esterase family are widely distributed in bacterial phyla and display activity against a range of biologically produced and chemically synthesized esters. A serine esterase from the psychrophilic bacterium Pseudoalteromonas arctica with a C-terminal OsmC-like domain was recently characterized; here we report on the identification and characterization of further putative esterases with OsmC-like domains constituting a new esterase family that is found in a variety of bacterial species from different environmental niches. All of these proteins contained the Ser-Asp-His motif common to serine esterases and a highly conserved pentapeptide nucleophilic elbow motif. We produced these proteins heterologously in Escherichia coli and demonstrated their activity against a range of esterase substrates. Two of the esterases characterized have activity of over two orders of magnitude higher than other members of the family, and are active over a wide temperature range. We determined the crystal structure of the esterase domain of the protein from Rhodothermus marinus and show that it conforms to the classical α/β hydrolase fold with an extended ‘lid’ region, which occludes the active site of the protein in the crystal. The expansion of characterized members of the esterase family and demonstration of activity over a wide-range of temperatures could be of use in biotechnological applications such as the pharmaceutical, detergent, bioremediation and dairy industries. PMID:27851780

  5. Synthesis of GDP-mannose and mannosylglycerate from labeled mannose by genetically engineered Escherichia coli without loss of specific isotopic enrichment.


    Sampaio, Maria-Manuel; Santos, Helena; Boos, Winfried


    We report the construction of an Escherichia coli mutant that harbors two compatible plasmids and that is able to synthesize labeled 2-O-alpha-D-mannosyl-D-glycerate from externally added labeled mannose without the loss of specific isotopic enrichment. The strain carries a deletion in the manA gene, encoding phosphomannose isomerase. This deletion prevents the formation of fructose-6-phosphate from mannose-6-phosphate after the uptake of mannose from the medium by mannose-specific enzyme II of the phosphotransferase system (PtsM). The strain also has a deletion of the cps gene cluster that prevents the synthesis of colanic acid, a mannose-containing polymer. Plasmid-encoded phosphomannomutase (cpsG) and mannose-1-phosphate guanylyltransferase (cpsB) ensure the formation of GDP-mannose. A second plasmid harbors msg, a gene from Rhodothermus marinus that encodes mannosylglycerate synthase, which catalyzes the formation of 2-O-alpha-D-mannosyl-D-glycerate from GDP-mannose and endogenous glycerate. The rate-limiting step in 2-O-alpha-D-mannosyl-D-glycerate formation is the transfer of GDP-mannose to glycerate. 2-O-alpha-D-mannosyl-D-glycerate can be released from cells by treatment with cold-water shock. The final product is formed in a yield exceeding 50% the initial quantity of labeled mannose, including loss during preparation and paper chromatography.

  6. Crystallization, neutron data collection, initial structure refinement and analysis of a xyloglucan heptamer bound to an engineered carbohydrate-binding module from xylanase.


    Ohlin, Mats; von Schantz, Laura; Schrader, Tobias E; Ostermann, Andreas; Logan, Derek T; Fisher, S Zoë


    Carbohydrate-binding modules (CBMs) are discrete parts of carbohydrate-hydrolyzing enzymes that bind specific types of carbohydrates. Ultra high-resolution X-ray crystallographic studies of CBMs have helped to decipher the basis for specificity in carbohydrate-protein interactions. However, additional studies are needed to better understand which structural determinants confer which carbohydrate-binding properties. To address these issues, neutron crystallographic studies were initiated on one experimentally engineered CBM derived from a xylanase, X-2 L110F, a protein that is able to bind several different plant carbohydrates such as xylan, β-glucan and xyloglucan. This protein evolved from a CBM present in xylanase Xyn10A of Rhodothermus marinus. The protein was complexed with a branched xyloglucan heptasaccharide. Large single crystals of hydrogenous protein (∼1.6 mm(3)) were grown at room temperature and subjected to H/D exchange. Both neutron and X-ray diffraction data sets were collected to 1.6 Å resolution. Joint neutron and X-ray refinement using phenix.refine showed significant density for residues involved in carbohydrate binding and revealed the details of a hydrogen-bonded water network around the binding site. This is the first report of a neutron structure of a CBM and will add to the understanding of protein-carbohydrate binding interactions.

  7. Synthesis of GDP-Mannose and Mannosylglycerate from Labeled Mannose by Genetically Engineered Escherichia coli without Loss of Specific Isotopic Enrichment

    PubMed Central

    Sampaio, Maria-Manuel; Santos, Helena; Boos, Winfried


    We report the construction of an Escherichia coli mutant that harbors two compatible plasmids and that is able to synthesize labeled 2-O-α-d-mannosyl-d-glycerate from externally added labeled mannose without the loss of specific isotopic enrichment. The strain carries a deletion in the manA gene, encoding phosphomannose isomerase. This deletion prevents the formation of fructose-6-phosphate from mannose-6-phosphate after the uptake of mannose from the medium by mannose-specific enzyme II of the phosphotransferase system (PtsM). The strain also has a deletion of the cps gene cluster that prevents the synthesis of colanic acid, a mannose-containing polymer. Plasmid-encoded phosphomannomutase (cpsG) and mannose-1-phosphate guanylyltransferase (cpsB) ensure the formation of GDP-mannose. A second plasmid harbors msg, a gene from Rhodothermus marinus that encodes mannosylglycerate synthase, which catalyzes the formation of 2-O-α-d-mannosyl-d-glycerate from GDP-mannose and endogenous glycerate. The rate-limiting step in 2-O-α-d-mannosyl-d-glycerate formation is the transfer of GDP-mannose to glycerate. 2-O-α-d-mannosyl-d-glycerate can be released from cells by treatment with cold-water shock. The final product is formed in a yield exceeding 50% the initial quantity of labeled mannose, including loss during preparation and paper chromatography. PMID:12514000

  8. Xylooligosaccharides from hardwood and cereal xylans produced by a thermostable xylanase as carbon sources for Lactobacillus brevis and Bifidobacterium adolescentis.


    Falck, Peter; Precha-Atsawanan, Suthsiri; Grey, Carl; Immerzeel, Peter; Stålbrand, Henrik; Adlercreutz, Patrick; Karlsson, Eva Nordberg


    To compare xylans from forestry with agricultural origins, hardwood xylan (birch) and cereal arabinoxylan (rye) were hydrolyzed using two variants of the xylanase RmXyn10A, full-length enzyme and catalytic module only, from Rhodothermus marinus . Cultivations of four selected bacterial species, using the xylooligosaccharide (XOS) containing hydrolysates as carbon source, showed selective growth of Lactobacillus brevis DSMZ 1264 and Bifidobacterium adolescentis ATCC 15703. Both strains were confirmed to utilize the XOS fraction (DP 2-5), whereas putative arabinoxylooligosaccharides from the rye arabinoxylan hydrolysate were utilized by only B. adolescentis. Escherichia coli did not grow, despite its capability to grow on the monosaccharides arabinose and xylose. It was also shown that Pediococcus parvulus strain 2.6 utilized neither xylose nor XOS for growth. In summary, RmXyn10A or its catalytic module proved suitable for high-temperature hydrolysis of hardwood xylan and cereal arabinoxylan, producing XOS that could qualify as prebiotics for use in functional food products.

  9. Cloning, expression and preliminary X-ray analysis of the dihydroorotase from the hyperthermophilic eubacterium Aquifex aeolicus.


    Purcarea, Cristina; Martin, Phillip; Vickrey, John F; Guy, Hedeel I; Edwards, Brian F P; Evans, David R


    Dihydroorotase (DHOase) catalyzes the formation of dihydroorotate in the de novo pyrimidine biosynthetic pathway. The gene encoding the type I DHOase from the hyperthermophilic bacterium Aquifex aeolicus has been cloned in Escherichia coli with a polyhistidine affinity tag appended to the amino-terminal end and sequenced. The recombinant protein was expressed at high levels and could be purified readily in a single step by Ni(2+) affinity chromatography. Both native and selenomethionine-labeled proteins were crystallized using the hanging-drop vapor-diffusion technique. Screens of the purified protein identified several conditions that yielded crystals; however, the best crystals were obtained using 1 M Li(2)SO(4), 10 mM NiCl(2), 100 mM Tris acetate pH 8.5 as the precipitant. Well formed diamond-shaped crystals appeared within 1 d and continued to grow over several weeks to about 0.5 mm in the largest dimension. The crystals diffract to 1.7 A and belong to space group C2, with unit-cell parameters a = 119.8, b = 88.0, c = 55.2 A, beta = 99.0 degrees and a mosaic spread of 0.6 degrees. There is one DHOase monomer in the asymmetric unit.

  10. Responses to circulatory pressures, and conduction velocity, of pulmocutaneous baroreceptors in Bufo marinus.

    PubMed Central

    Van Vliet, B N; West, N H


    1. Baroreceptor activity was recorded within the recurrent laryngeal branch of the toad vagus in forty-four preparations. The receptive fields of the receptors were located in the pulmocutaneous artery (p.c.a.), generally within 5 mm of its separation from the truncus. However, the most easily recorded afferents in this nerve were mechanoreceptors which responded to punctate stimulation of the lip of the glottis. 2. The conduction velocities of p.c.a. baroreceptor and mechanoreceptive glottal afferents recorded in the recurrent laryngeal nerve ranged from 0.3-0.7 (0.5 +/- 0.1) m s-1 and 2.2-14.0 (6.8 +/- 0.8) m s-1 respectively, which suggests that baroreceptor afferent fibres are non-myelinated and that glottal afferent fibres are myelinated. 3. The p.c.a. baroreceptor discharge was largely confined to a period of systole in which systemic and p.c.a. arterial pressure profiles were identical. The maximum discharge frequency, number of spikes per cycle, and the duration of discharge increased, and the discharge latency decreased, as p.c.a. pressures were elevated. The latency of the discharge was pronounced at low p.c.a. pressures, and could be partially accounted for by the conduction time of the baroreceptor afferents to the electrodes (up to 100 ms). 4. Carotid and aortic arterial baroreceptor and pharyngeal afferents were recorded in two pharyngeal branches of the vagus nerve which were closely associated with the carotid and aortic arterial arches. 5. It is suggested that baroreceptor populations with their receptive fields in the third- (carotid) and sixth- (p.c.a. or pulmonary) arch arteries should be considered homologous in anurans and mammals, but that those of the fourth- (aorta) arch artery should not, since the vagal branches in which their afferents are carried do not appear to be equivalent in anurans and mammals. Images Fig. 8 PMID:3116216

  11. Optical quality of the eye of the cane toad Bufo marinus.


    Jagger, W S


    The wide-angle optical quality of the cane toad eye was measured using a single-pass intraocular optical fibre microprobe, a double-pass projection method and high magnification ophthalmoscopy to photograph individual photoreceptors. The cane toad eye is a wide angle optical device with a horizontal field of nearly 200 deg and a large relative aperture (ca f/1). Its image quality, which is poor compared to diffraction-limited performance, decreases relatively little towards the periphery. Rough matching was found between image quality and the potential resolution of the rod array, although undersampling occurs for small pupils. Undersampling probably also occurs for the cone and ganglion cell arrays. The relative rotational symmetry of the topographic distribution of image quality precludes direct matching to the topography of the visual streak at the ganglion cell layer although it remains to be determined whether it is matched to the receptor distribution.

  12. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming


    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  13. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus).


    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B; Wu, Hong; Johnson, Nicholas S; Li, Weiming


    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1h exposure. After 2h exposure, 3kACA increased lGnRH-I and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  14. Sex ratios and sexual dimorphism among recently transformed sea lampreys, Petromyzon marinus Linnaeus

    USGS Publications Warehouse

    Applegate, Vernon C.; Thomas, M.L.H.


    The sex, length, and weight were determined of nearly all recently transformed sea lampreys migrating downstream in the Carp Lake River, Michigan, in the fall, winter, and spring of 1960-61. Similar data were collected from samples of an earlier run in the Carp Lake River and of runs in three other tributaries of Lakes Huron and Michigan. The sex ratio of the 1960-61 migrants in the Carp Lake River was 324 males:100 females. Sex ratios of migrants in the other runs varied from 77 to 86 males:100 females. The high proportion of males in the 1960-61 run in the Carp Lake River is attributed to the effective prevention of recruitment of sea lampreys in the river and transformation of the females at an earlier age than is characteristic of the males. A near equal sex ratio among recently transformed migrants is considered normal for the species. The sex composition of a run changed during the period of migration. The proportion of males among the migrants was greatest at the beginning of the run and declined steadily thereafter. The average size was smaller for males than for females. Differences in the mean lengths and weights of the sexes were statistically significant. The length-weight relation differed for the sexes and showed a slower rate of increase of weight with increase in length than is characteristic of other stages of the animals' life cycle. Seasonal changes in the length-weight relation had a trend toward lower weights among the migrants coming downstream in the later months of the run.

  15. Flapping flexible fish. Periodic and secular body reconfigurations in swimming lamprey, Petromyzon marinus

    NASA Astrophysics Data System (ADS)

    Root, Robert G.; Courtland, Hayden-William; Shepherd, William; Long, John H.


    In order to analyze and model the body kinematics used by fish in a wide range of swimming behaviors, we developed a technique to separate the periodic whole-body motions that characterize steady swimming from the secular motions that characterize changes in whole-body shape. We applied this harmonic analysis technique to the study of the forward and backward swimming of lamprey. We found that in order to vary the unsteadiness of swimming, lamprey superimpose periodic and secular components of their body motion, modulate the patterns and magnitudes of those components, and change shape. These kinematic results suggest the following hydromechanical hypothesis: steady swimming is a maneuver that requires active suppression of secular body reconfigurations.


    EPA Science Inventory

    It has been established that host lipids play a unique role for long term survival and life cycle completion in endogenous parasites. Parasites exploit fatty acids and lipids from the host, not only for membrane synthesis, but also for modification of their surface integrity to a...

  17. Diseases and parasites of the sea lamprey, Petromyzon marinus, in the Lake Huron basin

    USGS Publications Warehouse

    McLain, Alberton L.


    Sea lampreys from the Lake Huron basin carried no external parasites and showed a fairly low degree of infection by internal parasites. The material examined represented three life-history stages of the sea lamprey. Recently transformed downstream migrants (215 specimens) harbored only nematodes belonging to the genus Camallanus. The percentage of infection was 2.3. Active feeders from the lake (29 lampreys) revealed the highest degree of parasitism (31.0 percent) with the following parasites present: Echinorhynchus coregoni Linkins; Triaenophorus crassus Forel; and Camallanus sp. Among the 257 sexually mature upstream migrants (14.8 percent infected) Echinorhynchus coregoni and E. leidyi Van Cleave were the most common. Only occasional nematodes and cestodes were found, which fact indicates a failure of the lamprey to carry these parasites to the end of its natural life. Of the parasites observed, only the nematodes gave evidence of serious damage to the host. The study suggests that the role played by parasites in the natural control of the sea lamprey in its new habitat in the upper Great Lakes is of minor importance.

  18. Molecular characterization of the Bidder's organ in the cane toad (Bufo marinus).


    Abramyan, John; Wilhelm, Dagmar; Koopman, Peter


    In toads, both males and females develop a unique gonadal structure called the Bidder's organ (BO), which resembles ovarian tissue and is attached to the anterior part of the gonad. It is not clear whether the BO is a vestigial organ, or has an endocrine function. In this study, we investigated the expression of the gonadal development genes Dmrt1, Sox9, Sf1, Dax1, and p450arom in the developing BO as compared with the gonads of male and female cane toads. We demonstrate that Sf1, Dax1, and p450arom, key genes involved in vertebrate steroidogenesis, are transcriptionally active in the BO during developmental milestones associated with sexual development and maturation. Furthermore, the pattern of transcriptional activity in the BO is completely independent of the corresponding gonads in both sexes, despite its ovary-like morphology. These results suggest that the BO likely has a steroidogenic role in the development of the cane toad, distinct from that of the gonads.

  19. Downstream movement of recently transformed sea lampreys, Petromyzon marinus, in Carp Lake River, Michigan

    USGS Publications Warehouse

    Applegate, Vernon C.; Brynildson, Clifford L.


    A total of 7,969 downstream migrants were taken in the 1948–49 season; 16,235 in 1949–50, and 15,103 in 1950–51. Measurements of representative samples from the total catch of sea lamprey migrants of the 1948–49 and 1949–50 seasons revealed a range in length of 95 to 190 millimeters and an average length of 145 millimeters (3.7 to 7.5 inches; mean –5.7 inches).


    EPA Science Inventory

    It has been established that host lipids play a unique role for long term survival and life cycle completion in endogenous parasites. Parasites exploit fatty acids and lipids from the host, not only for membrane synthesis, but also for modification of their surface integrity to a...


    EPA Science Inventory

    Presented at the 92nd Annual Meeting of the National Shellfisheries Association, 19-23 March 2000, Seattle, WA.

    A colorimetric microbicidal assay was adapted, optimized and used in experiments to characterize the capacity of eastern oyster (Crassostrea virginica) hemocytes...

  2. Effects of certain chemicals on mucus-producing cells of Petromyzon marinus

    USGS Publications Warehouse

    Sawyer, Philip J.


    Tissue samples that contained slime-secreting cells were taken from the gills and epidermis of larval lampreys that had been poisoned by several compounds. Histochemical treatment of these pathological tissues helped delineate the fate of these mucus-producing areas of the ammocetes. It was shown that the slime-secreting cells, located at the tips of the gill filaments, lining the gill chamber, and scattered throughout the epidermis reacted differently to the same toxicant. The secretory cells of the gills were, without exception, the most sensitive to chemical attack.


    EPA Science Inventory

    The oyster pathogen Perkinsus marinusproduces many extracellular proteins (ECP) in vitro. Analysis of this ECP revealed a battery of hydrolytic enzymes. Some of these enzymes are known to modulate the activity of host defense cells. Although information on the effects of P. marin...

  4. Cholangiocyte apoptosis is an early event during induced metamorphosis in the sea lamprey, Petromyzon marinus L.


    Boomer, Laura A; Bellister, Seth A; Stephenson, Linda L; Hillyard, Stanley D; Khoury, Joseph D; Youson, John H; Gosche, John R


    Research in biliary atresia has been hindered by lack of a suitable animal model. Lampreys are primitive vertebrates with distinct larval and adult life cycle stages. During metamorphosis the biliary system of the larval lamprey disappears. Lamprey metamorphosis has been proposed as a model for biliary atresia. We have begun to explore cellular events during lamprey metamorphosis by assessing for cholangiocyte apoptosis. Sea lamprey larvae were housed under controlled environmental conditions. Premetamorphic larvae were induced to undergo metamorphosis by exposure to 0.01% KClO(4). Animals were photographed weekly, and the stage of metamorphosis was assigned based upon external features. Livers were harvested and processed for routine histology and immunohistochemistry. DNA fragmentation was detected using deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assays and cholangiocytes were identified with antibodies to cytokeratin-19. Percent TUNEL+ cholangiocytes at different stages of metamorphosis was determined. The percentage of TUNEL+ cholangiocytes was 10% in premetamorphic (stage 0) lamprey (n = 6), 51% at stage 1 (n = 6), 40% at stage 2 (n = 5), 18% at stage 3 (n = 5), and 9% stage 4 (n = 4). Routine hemotoxylin and eosin stained paraffin-embedded tissue sections revealed frequent apoptotic bodies at stages 3 and 4 of metamorphosis without histologic evidence of necrosis. DNA fragmentation is identified at the earliest stages of metamorphosis during induced metamorphosis in lampreys. Additional studies are necessary to validate this potentially valuable animal model. Copyright 2010 Elsevier Inc. All rights reserved.


    EPA Science Inventory

    Presented at the 92nd Annual Meeting of the National Shellfisheries Association, 19-23 March 2000, Seattle, WA.

    A colorimetric microbicidal assay was adapted, optimized and used in experiments to characterize the capacity of eastern oyster (Crassostrea virginica) hemocytes...

  6. Control of the sea lamprey (Petromyzon marinus) in Lake Superior, 1953-70

    USGS Publications Warehouse

    Smith, Bernard R.; Tibbles, J. James; Johnson, B.G.H.


    Although sea lamprey control and heavy plantings of hatchery-reared stock had restored lake trout abundance to prelamprey levels in many areas by 1970, the trout had not yet become self-sustaining. Additional effort will be required to further reduce the effects of lamprey predation.


    EPA Science Inventory

    The oyster pathogen Perkinsus marinusproduces many extracellular proteins (ECP) in vitro. Analysis of this ECP revealed a battery of hydrolytic enzymes. Some of these enzymes are known to modulate the activity of host defense cells. Although information on the effects of P. marin...

  8. Extraction of soluble arabinoxylan from enzymatically pretreated wheat bran and production of short xylo-oligosaccharides and arabinoxylo-oligosaccharides from arabinoxylan by glycoside hydrolase family 10 and 11 endoxylanases.


    Mathew, Sindhu; Karlsson, Eva Nordberg; Adlercreutz, Patrick


    The enzymatic, ecofriendly pretreatment of wheat bran with α-amylase from Bacillus amyloliquifaciens or B. licheniformis at 90°C for 1.5h followed by Neutrase at 50°C for 4h, aqueous liquefaction at 121°C for 15h and ethanol precipitation enabled the production of soluble arabinoxylan (AX) with purity of 70.9% and 68.4% (w/w) respectively. Process alternatives tried, to simplify the process and curtail the cost resulted in AX products with different purities, yields and arabinose to xylose ratio (A/X). Among the two glycoside hydrolase (GH) family endoxylanases evaluated, GH10 family hydrolysed soluble AX more efficiently with xylanase from Geobacillus stearothermophilus T-6 (GsXyn10A) producing maximum amount of quantifiable short xylo-oligosaccharides (XOS) and arabinoxylo-oligosaccharides (AXOS) (53% w/w) followed by the catalytic module of Rhodothermus marinus Xyn10A (RmXyn10A-CM) with 37% (w/w) conversion. The GH11 family endoxylanases, from Thermomyces lanuginosus (Pentopan Mono BG™) and Neocallimastix patriciarum (NpXyn11A) gave conversions of 21% and 22% (w/w) of the soluble AX, respectively (major AXOS products were not quantified). In addition to the XOS formed such as X2, X3 and X4, the AXOS products identified were A(3)X and A(2)XX in the case of GsXyn10A and RmXyn10A-CM while Pentopan Mono BG and NpXyn11A produced XA(3)XX as the major AXOS product. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Substrate and Metal Ion Promiscuity in Mannosylglycerate Synthase*

    PubMed Central

    Nielsen, Morten M.; Suits, Michael D. L.; Yang, Min; Barry, Conor S.; Martinez-Fleites, Carlos; Tailford, Louise E.; Flint, James E.; Dumon, Claire; Davis, Benjamin G.; Gilbert, Harry J.; Davies, Gideon J.


    The enzymatic transfer of the sugar mannose from activated sugar donors is central to the synthesis of a wide range of biologically significant polysaccharides and glycoconjugates. In addition to their importance in cellular biology, mannosyltransferases also provide model systems with which to study catalytic mechanisms of glycosyl transfer. Mannosylglycerate synthase (MGS) catalyzes the synthesis of α-mannosyl-d-glycerate using GDP-mannose as the preferred donor species, a reaction that occurs with a net retention of anomeric configuration. Past work has shown that the Rhodothermus marinus MGS, classified as a GT78 glycosyltransferase, displays a GT-A fold and performs catalysis in a metal ion-dependent manner. MGS shows very unusual metal ion dependences with Mg2+ and Ca2+ and, to a lesser extent, Mn2+, Ni2+, and Co2+, thus facilitating catalysis. Here, we probe these dependences through kinetic and calorimetric analyses of wild-type and site-directed variants of the enzyme. Mutation of residues that interact with the guanine base of GDP are correlated with a higher kcat value, whereas substitution of His-217, a key component of the metal coordination site, results in a change in metal specificity to Mn2+. Structural analyses of MGS complexes not only provide insight into metal coordination but also how lactate can function as an alternative acceptor to glycerate. These studies highlight the role of flexible loops in the active center and the subsequent coordination of the divalent metal ion as key factors in MGS catalysis and metal ion dependence. Furthermore, Tyr-220, located on a flexible loop whose conformation is likely influenced by metal binding, also plays a critical role in substrate binding. PMID:21288903

  10. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R


    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  11. Biochemical properties of GH94 cellodextrin phosphorylase THA_1941 from a thermophilic eubacterium Thermosipho africanus TCF52B with cellobiose phosphorylase activity.


    Wu, Yuanyuan; Mao, Guotao; Fan, Haiyan; Song, Andong; Zhang, Yi-Heng Percival; Chen, Hongge


    A hypothetic gene (THA_1941) encoding a putative cellobiose phosphorylase (CBP) from Thermosipho africanus TCF52B has very low amino acid identities (less than 12%) to all known GH94 enzymes. This gene was cloned and over-expressed in Escherichia coli BL21(DE3). The recombinant protein was hypothesized to be a CBP enzyme and it showed an optimum temperature of 75 °C and an optimum pH of 7.5. Beyond its CBP activity, this enzyme can use cellobiose and long-chain cellodextrins with a degree of polymerization of greater than two as a glucose acceptor, releasing phosphate from glucose 1-phosphate. The catalytic efficiencies (k cat/K m) indicated that cellotetraose and cellopentaose were the best substrates for the phosphorolytic and reverse synthetic reactions, respectively. These results suggested that this enzyme was the first enzyme having both cellodextrin and cellobiose phosphorylases activities. Because it preferred cellobiose and cellodextrins to glucose in the synthetic direction, it was categorized as a cellodextrin phosphorylase (CDP). Due to its unique ability of the reverse synthetic reaction, this enzyme could be a potential catalyst for the synthesis of various oligosaccharides. The speculative function of this CDP in the carbohydrate metabolism of T. africanus TCF52B was also discussed.

  12. Regulation of a putative corticosteroid, 17, 21-dihydroxypregn-4-ene, 3, 20-one, in sea lamprey, Petromyzon marinus.

    USGS Publications Warehouse

    Roberts, Brent W.; Didier, Wes; Satbir, Rai; Johnson, Nicholas S.; Libants, Scot V.; Sang-Seon, Yun; Close, David


    In higher vertebrates, in response to stress, the hypothalamus produces corticotropin-releasing hormone (CRH), which stimulates cells in the anterior pituitary to produce adrenocorticotropic hormone (ACTH), which in turn stimulates production of either cortisol (F) or corticosterone (B) by the adrenal tissues. In lampreys, however, neither of these steroids is present. Instead, it has been proposed that the stress steroid is actually 17,21-dihydroxypregn-4-ene-3,20-dione (11-deoxycortisol; S). However, there have been no studies yet to determine its mechanism of regulation or site of production. Here we demonstrate that (1) intraperitoneal injections of lamprey-CRH increase plasma S in a dose dependent manner, (2) intraperitoneal injections of four lamprey-specific ACTH peptides at 100 lg/kg, did not induce changes in plasma S concentrations in either males or females; (3) two lamprey-specific gonadotropin-releasing hormones (GnRH I and III) and arginine-vasotocin (AVT), all at single doses, stimulated S production as well as, or to an even greater extent than CRH; (4) sea lamprey mesonephric kidneys, in vitro, converted tritiated 17a-hydroxyprogesterone (17a-P) into a steroid that had the same chromatographic properties (on HPLC and TLC) as S; (5) kidney tissues released significantly more immunoassayable S into the incubation medium than gill, liver or gonad tissues. One interpretation of these results is that the corticosteroid production of the sea lamprey, one of the oldest extant vertebrates, is regulated through multiple pathways rather than the classical HPI-axis. However, the responsiveness of this steroid to the GnRH peptides means that a reproductive rather than a stress role for this steroid cannot yet be ruled out.

  13. Regulation of a putative corticosteroid, 17,21-dihydroxypregn-4-ene,3,20-one, in sea lamprey, Petromyzon marinus.


    Roberts, Brent W; Didier, Wes; Rai, Satbir; Johnson, Nicholas S; Libants, Scot; Yun, Sang-Seon; Close, David A


    In higher vertebrates, in response to stress, the hypothalamus produces corticotropin-releasing hormone (CRH), which stimulates cells in the anterior pituitary to produce adrenocorticotropic hormone (ACTH), which in turn stimulates production of either cortisol (F) or corticosterone (B) by the adrenal tissues. In lampreys, however, neither of these steroids is present. Instead, it has been proposed that the stress steroid is actually 17,21-dihydroxypregn-4-ene-3,20-dione (11-deoxycortisol; S). However, there have been no studies yet to determine its mechanism of regulation or site of production. Here we demonstrate that (1) intraperitoneal injections of lamprey-CRH increase plasma S in a dose dependent manner, (2) intraperitoneal injections of four lamprey-specific ACTH peptides at 100μg/kg, did not induce changes in plasma S concentrations in either males or females; (3) two lamprey-specific gonadotropin-releasing hormones (GnRH I and III) and arginine-vasotocin (AVT), all at single doses, stimulated S production as well as, or to an even greater extent than CRH; (4) sea lamprey mesonephric kidneys, in vitro, converted tritiated 17α-hydroxyprogesterone (17α-P) into a steroid that had the same chromatographic properties (on HPLC and TLC) as S; (5) kidney tissues released significantly more immunoassayable S into the incubation medium than gill, liver or gonad tissues. One interpretation of these results is that the corticosteroid production of the sea lamprey, one of the oldest extant vertebrates, is regulated through multiple pathways rather than the classical HPI-axis. However, the responsiveness of this steroid to the GnRH peptides means that a reproductive rather than a stress role for this steroid cannot yet be ruled out.

  14. Changes in plasma steroid and thyroid hormones and insulin during final maturation and spawning of the sea lamprey, Petromyzon marinus.


    Sower, S A; Plisetskaya, E; Gorbman, A


    Circulating levels of plasma estradiol-17 beta, androgens, thyroxine, triiodothyronine, immunoreactive insulin, plasma fatty acids, and protein were measured at interval during the period of final gonadal maturation, prior to spawning of male and female sea lampreys. Plasma estradiol levels fluctuated significantly and generally covaried in males and females through time. In females, possibly in relation to environmental changes, mean plasma estradiol levels peaked four times during the final spawning period but decreased sharply at the time of ovulation. In males, mean plasma estradiol peaked seven times during the final prespawning period and, in contrast to females, peaked significantly at the time of final spermiation. Plasma androgens were extremely low and covaried in males and females through time. Like plasma steroid profiles, there were coordinated changes in plasma triiodothyronine and thyroxine levels in males and females through the prespawning season. There was a slight increase in plasma insulin during the terminal maturation of the lampreys. However, at ovulation, the insulin levels abruptly decreased in females, whereas in males they remained unchanged. Plasma protein and fatty acid levels gradually decreased until ovulation/spermiation. At ovulation plasma fatty acid levels increased.

  15. Development and application of an ELISA for a sex pheromone released by the male sea lamprey (Petromyzon marinus L.).


    Yun, Sang-Seon; Scott, Alexander P; Siefkes, Michael J; Li, Weiming


    An enzyme-linked immunosorbent assay (ELISA) has been developed for a conjugated bile acid, 7alpha,12alpha,24-trihydroxy-5alpha-cholan-3-one 24-sulfate (commonly referred to as 3-keto petromyzonol sulfate [3kPZS]), a pheromone released by reproductively mature male sea lampreys to attract sexually mature females. A polyclonal antiserum against the pheromone was raised by injecting 3-keto petromyzonol 24-hemisuccinate (3kPZ-HS) conjugated to bovine serum albumin into rabbits. The enzyme label was prepared by conjugating 3kPZ-HS to acetylcholinesterase. The standard curve had a working range of 20 pg-10 ng/well. Intra- and inter-assay variations were less than 5 and 12%, respectively. The antiserum had 100% cross-reaction with 3-keto petromyzonol and 3-keto allocholic acid but less than 0.2% cross-reaction with petromyzonol, allocholic acid, cholic acid, and taurolithocholic acid sulfate. The assay was applied to water which had been conditioned for 4h by either larvae, parasitic juveniles, ovulating females, pre-spermiating males, or spermiating males. Immunoactive material (average 200 ng/ml, which is equivalent to 500 microg animal/h) was only found in water from the reproductively mature males and diluted parallel with the standard curve. Assay of water samples collected from male lampreys in bisected aquaria also established that 99.6% of the immunoactive material emanated from the front end of the fish. This assay has applications in both physiological and ecological aspects of sea lamprey reproduction.


    EPA Science Inventory

    Anthropogenic environmental stress is a likely contributor to outbreaks of disease due to immunosuppression or increased host vulnerability. Estuarine organisms are exposed to variable concentrations of marine antifouling agents, such as tributyltin (TBT), with higher exposures e...

  17. Molecular Cloning and Pharmacological Characterization of Two Novel GnRH Receptors in the Lamprey (Petromyzon marinus)

    PubMed Central

    Joseph, Nerine T.; Aquilina-Beck, Allisan; MacDonald, Caryn; Decatur, Wayne A.; Hall, Jeffrey A.; Kavanaugh, Scott I.


    This paper reports the identification, expression, binding kinetics, and functional studies of two novel type III lamprey GnRH receptors (lGnRH-R-2 and lGnRH-R-3) in the sea lamprey, a basal vertebrate. These novel GnRH receptors share the structural features and amino acid motifs common to other known gnathostome GnRH receptors. The ligand specificity and activation of intracellular signaling studies showed ligands lGnRH-II and -III induced an inositol phosphate (IP) response at lGnRH-R-2 and lGnRH-R-3, whereas the ligand lGnRH-I did not stimulate an IP response. lGnRH-II was a more potent activator of lGnRH-R-3 than lGnRH-III. Stimulation of lGnRH-R-2 and lGnRH-R-3 testing all three lGnRH ligands did not elicit a cAMP response. lGnRH-R-2 has a higher binding affinity in response to lGnRH-III than lGnRH-II, whereas lGnRH-R-3 has a higher binding affinity in response to lGnRH-II than IGnRH-III. lGnRH-R-2 precursor transcript was detected in a wide variety of tissues including the pituitary whereas lGnRH-R-3 precursor transcript was not as widely expressed and primarily expressed in the brain and eye of male and female lampreys. From our phylogenetic analysis, we propose that lGnRH-R-1 evolved from a common ancestor of all vertebrate GnRH receptors and lGnRH-R-2 and lGnRH-R-3 likely occurred due to a gene duplication within the lamprey lineage. In summary, we propose from our findings of receptor subtypes in the sea lamprey that the evolutionary recruitment of specific pituitary GnRH receptor subtypes for particular physiological functions seen in later evolved vertebrates was an ancestral character that first arose in a basal vertebrate. PMID:22569788

  18. Anatomy of the lamprey ear: morphological evidence for occurrence of horizontal semicircular ducts in the labyrinth of Petromyzon marinus

    PubMed Central

    Maklad, Adel; Reed, Caitlyn; Johnson, Nicolas S; Fritzsch, Bernd


    In jawed (gnathostome) vertebrates, the inner ears have three semicircular canals arranged orthogonally in the three Cartesian planes: one horizontal (lateral) and two vertical canals. They function as detectors for angular acceleration in their respective planes. Living jawless craniates, cyclostomes (hagfish and lamprey) and their fossil records seemingly lack a lateral horizontal canal. The jawless vertebrate hagfish inner ear is described as a torus or doughnut, having one vertical canal, and the jawless vertebrate lamprey having two. These observations on the anatomy of the cyclostome (jawless vertebrate) inner ear have been unchallenged for over a century, and the question of how these jawless vertebrates perceive angular acceleration in the yaw (horizontal) planes has remained open. To provide an answer to this open question we reevaluated the anatomy of the inner ear in the lamprey, using stereoscopic dissection and scanning electron microscopy. The present study reveals a novel observation: the lamprey has two horizontal semicircular ducts in each labyrinth. Furthermore, the horizontal ducts in the lamprey, in contrast to those of jawed vertebrates, are located on the medial surface in the labyrinth rather than on the lateral surface. Our data on the lamprey horizontal duct suggest that the appearance of the horizontal canal characteristic of gnathostomes (lateral) and lampreys (medial) are mutually exclusive and indicate a parallel evolution of both systems, one in cyclostomes and one in gnathostome ancestors. PMID:24438368

  19. Optical quality of the ocular lens of the sea lamprey (Petromyzon marinus) during the mature and transformer periods of life.


    Bantseev, Vladimir; Auclair, Francois; Dubuc, Rejean; Sivak, Jacob G


    While larval sea lampreys exist as eyeless filter feeders for several years, they transform into free-swimming juveniles (transformers) that attach parasitically to prey fish as they develop sexual maturity. This study examines lamprey lens development and optics and, since the lens is often the only refractive component of an aquatic eye, the data also provide an indication of visual ability during transformer and adult periods of life. Seven adult sea lampreys (0.40-0.55 m) and eight transformers (0.15-0.18 m) were sacrificed, the eyes removed and lenses dissected, measured, and placed in an automated laser scanning instrument. Back vertex focal length (spherical aberration) was measured for 14 beam positions across each lens by using a digital camera to record the position of the refracted beam. Transformer lenses exhibit positive spherical aberration, with average focal lengths varying from about 2.40 mm near the lens center and 1.06 mm at the lens periphery. On the other hand, the lenses from adults are largely corrected for spherical aberration, with average focal lengths varying from 2.19 mm to 2.44 mm. This result indicates that the younger lenses do not have a gradient refractive index necessary to mitigate the aberration and that further study of this model may reveal the relation between lens embryology and the development of such a gradient.

  20. Anatomy of the lamprey ear: morphological evidence for occurrence of horizontal semicircular ducts in the labyrinth of Petromyzon marinus.


    Maklad, Adel; Reed, Caitlyn; Johnson, Nicolas S; Fritzsch, Bernd


    In jawed (gnathostome) vertebrates, the inner ears have three semicircular canals arranged orthogonally in the three Cartesian planes: one horizontal (lateral) and two vertical canals. They function as detectors for angular acceleration in their respective planes. Living jawless craniates, cyclostomes (hagfish and lamprey) and their fossil records seemingly lack a lateral horizontal canal. The jawless vertebrate hagfish inner ear is described as a torus or doughnut, having one vertical canal, and the jawless vertebrate lamprey having two. These observations on the anatomy of the cyclostome (jawless vertebrate) inner ear have been unchallenged for over a century, and the question of how these jawless vertebrates perceive angular acceleration in the yaw (horizontal) planes has remained open. To provide an answer to this open question we reevaluated the anatomy of the inner ear in the lamprey, using stereoscopic dissection and scanning electron microscopy. The present study reveals a novel observation: the lamprey has two horizontal semicircular ducts in each labyrinth. Furthermore, the horizontal ducts in the lamprey, in contrast to those of jawed vertebrates, are located on the medial surface in the labyrinth rather than on the lateral surface. Our data on the lamprey horizontal duct suggest that the appearance of the horizontal canal characteristic of gnathostomes (lateral) and lampreys (medial) are mutually exclusive and indicate a parallel evolution of both systems, one in cyclostomes and one in gnathostome ancestors.

  1. Anatomy of the lamprey ear: morphological evidence for occurrence of horizontal semicircular ducts in the labyrinth of Petromyzon marinus

    USGS Publications Warehouse

    Maklad, Adel; Reed, Caitlyn; Johnson, Nicholas S.; Fritzsch, Bernd


    In jawed (gnathostome) vertebrates, the inner ears have three semicircular canals arranged orthogonally in the three Cartesian planes: one horizontal (lateral) and two vertical canals. They function as detectors for angular acceleration in their respective planes. Living jawless craniates, cyclostomes (hagfish and lamprey) and their fossil records seemingly lack a lateral horizontal canal. The jawless vertebrate hagfish inner ear is described as a torus or doughnut, having one vertical canal, and the jawless vertebrate lamprey having two. These observations on the anatomy of the cyclostome (jawless vertebrate) inner ear have been unchallenged for over a century, and the question of how these jawless vertebrates perceive angular acceleration in the yaw (horizontal) planes has remained open. To provide an answer to this open question we reevaluated the anatomy of the inner ear in the lamprey, using stereoscopic dissection and scanning electron microscopy. The present study reveals a novel observation: the lamprey has two horizontal semicircular ducts in each labyrinth. Furthermore, the horizontal ducts in the lamprey, in contrast to those of jawed vertebrates, are located on the medial surface in the labyrinth rather than on the lateral surface. Our data on the lamprey horizontal duct suggest that the appearance of the horizontal canal characteristic of gnathostomes (lateral) and lampreys (medial) are mutually exclusive and indicate a parallel evolution of both systems, one in cyclostomes and one in gnathostome ancestors.

  2. Sequence analysis of a complete 1.66 Mb Prochlorococcus marinus MED4 genome cloned in yeast.


    Tagwerker, Christian; Dupont, Christopher L; Karas, Bogumil J; Ma, Li; Chuang, Ray-Yuan; Benders, Gwynedd A; Ramon, Adi; Novotny, Mark; Montague, Michael G; Venepally, Pratap; Brami, Daniel; Schwartz, Ariel; Andrews-Pfannkoch, Cynthia; Gibson, Daniel G; Glass, John I; Smith, Hamilton O; Venter, J Craig; Hutchison, Clyde A


    Marine cyanobacteria of the genus Prochlorococcus represent numerically dominant photoautotrophs residing throughout the euphotic zones in the open oceans and are major contributors to the global carbon cycle. Prochlorococcus has remained a genetically intractable bacterium due to slow growth rates and low transformation efficiencies using standard techniques. Our recent successes in cloning and genetically engineering the AT-rich, 1.1 Mb Mycoplasma mycoides genome in yeast encouraged us to explore similar methods with Prochlorococcus. Prochlorococcus MED4 has an AT-rich genome, with a GC content of 30.8%, similar to that of Saccharomyces cerevisiae (38%), and contains abundant yeast replication origin consensus sites (ACS) evenly distributed around its 1.66 Mb genome. Unlike Mycoplasma cells, which use the UGA codon for tryptophane, Prochlorococcus uses the standard genetic code. Despite this, we observed no toxic effects of several partial and 15 whole Prochlorococcus MED4 genome clones in S. cerevisiae. Sequencing of a Prochlorococcus genome purified from yeast identified 14 single base pair missense mutations, one frameshift, one single base substitution to a stop codon and one dinucleotide transversion compared to the donor genomic DNA. We thus provide evidence of transformation, replication and maintenance of this 1.66 Mb intact bacterial genome in S. cerevisiae.

  3. Sequence analysis of a complete 1.66 Mb Prochlorococcus marinus MED4 genome cloned in yeast

    PubMed Central

    Tagwerker, Christian; Dupont, Christopher L.; Karas, Bogumil J.; Ma, Li; Chuang, Ray-Yuan; Benders, Gwynedd A.; Ramon, Adi; Novotny, Mark; Montague, Michael G.; Venepally, Pratap; Brami, Daniel; Schwartz, Ariel; Andrews-Pfannkoch, Cynthia; Gibson, Daniel G.; Glass, John I.; Smith, Hamilton O.; Venter, J. Craig; Hutchison, Clyde A.


    Marine cyanobacteria of the genus Prochlorococcus represent numerically dominant photoautotrophs residing throughout the euphotic zones in the open oceans and are major contributors to the global carbon cycle. Prochlorococcus has remained a genetically intractable bacterium due to slow growth rates and low transformation efficiencies using standard techniques. Our recent successes in cloning and genetically engineering the AT-rich, 1.1 Mb Mycoplasma mycoides genome in yeast encouraged us to explore similar methods with Prochlorococcus. Prochlorococcus MED4 has an AT-rich genome, with a GC content of 30.8%, similar to that of Saccharomyces cerevisiae (38%), and contains abundant yeast replication origin consensus sites (ACS) evenly distributed around its 1.66 Mb genome. Unlike Mycoplasma cells, which use the UGA codon for tryptophane, Prochlorococcus uses the standard genetic code. Despite this, we observed no toxic effects of several partial and 15 whole Prochlorococcus MED4 genome clones in S. cerevisiae. Sequencing of a Prochlorococcus genome purified from yeast identified 14 single base pair missense mutations, one frameshift, one single base substitution to a stop codon and one dinucleotide transversion compared to the donor genomic DNA. We thus provide evidence of transformation, replication and maintenance of this 1.66 Mb intact bacterial genome in S. cerevisiae. PMID:22941652


    EPA Science Inventory

    Endoparasites must breach host barriers to establish infection and then must survive host internal defenses to cause disease. Such barriers may frustrate attempts to experimentally transmit parasites by ?natural' methods. In addition, the host's condition may affect a study's out...


    EPA Science Inventory

    Endoparasites must breach host barriers to establish infection and then must survive host internal defenses to cause disease. Such barriers may frustrate attempts to experimentally transmit parasites by ?natural' methods. In addition, the host's condition may affect a study's out...

  6. Novel low-temperature-active, salt-tolerant and proteases-resistant endo-1,4-β-mannanase from a new Sphingomonas strain.


    Zhou, Junpei; Zhang, Rui; Gao, Yajie; Li, Junjun; Tang, Xianghua; Mu, Yuelin; Wang, Feng; Li, Chao; Dong, Yanyan; Huang, Zunxi


    Sphingomonas sp. JB13, isolated from slag of a >20-year-old phosphate rock-stacking site, showed the highest 16S rDNA (1343bp) identity of 97.2% with Sphingomonas sp. ERB1-3 (FJ948169) and <97% identities with other identified Sphingomonas strains. A mannanase-coding gene (1191bp) was cloned and encodes a 396-residue polypeptide (ManAJB13) showing the highest amino acid sequence identities of 56.2% with the putative glycosyl hydrolase (GH) family 26 endo-1,4-β-mannanase from Rhodothermus marinus (YP_004824245), and 44.2% with the identified GH 26 endo-1,4-β-mannanase from Cellvibrio japonicus (2VX5_A). The recombinant ManAJB13 (rManAJB13) was expressed in Escherichia coli BL21 (DE3). Purified rManAJB13 displayed the typical characteristics of low-temperature-active enzymes: showing apparent optimal at 40°C, ~55% of the maximum activity at 20°C and ~20% at 10°C, and thermolability at 45°C (~15min half-life). The potential mechanism for low-temperature-activity of GH 26 endo-1,4-β-mannanases might be ascribed to the more hydrophobic residues (AILFWV) and less polar residues (NCQSTY) compared with typical thermophilic and mesophilic counterparts. The purified rManAJB13 exhibited >85% mannanase activity at the concentration of 0-4.0M NaCl. No loss of enzyme activity was observed after incubating the enzyme with 1M or 2M NaCl, or trypsin or proteinase K at 37°C and pH 6.5 for 1h. The K(m), V(max) and k(cat) values were 5.0mgml(-1), 277.8μmol min(-1)mg(-1), and 211.9s(-1), respectively, using locust bean gum as the substrate. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  7. Ribosomal oxygenases are structurally conserved from prokaryotes to humans.


    Chowdhury, Rasheduzzaman; Sekirnik, Rok; Brissett, Nigel C; Krojer, Tobias; Ho, Chia-Hua; Ng, Stanley S; Clifton, Ian J; Ge, Wei; Kershaw, Nadia J; Fox, Gavin C; Muniz, Joao R C; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S; Kavanagh, Kathryn L; von Delft, Frank; Oppermann, Udo; McDonough, Michael A; Doherty, Aidan J; Schofield, Christopher J


    2-Oxoglutarate (2OG)-dependent oxygenases have important roles in the regulation of gene expression via demethylation of N-methylated chromatin components and in the hydroxylation of transcription factors and splicing factor proteins. Recently, 2OG-dependent oxygenases that catalyse hydroxylation of transfer RNA and ribosomal proteins have been shown to be important in translation relating to cellular growth, TH17-cell differentiation and translational accuracy. The finding that ribosomal oxygenases (ROXs) occur in organisms ranging from prokaryotes to humans raises questions as to their structural and evolutionary relationships. In Escherichia coli, YcfD catalyses arginine hydroxylation in the ribosomal protein L16; in humans, MYC-induced nuclear antigen (MINA53; also known as MINA) and nucleolar protein 66 (NO66) catalyse histidine hydroxylation in the ribosomal proteins RPL27A and RPL8, respectively. The functional assignments of ROXs open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in the residue and protein selectivities of prokaryotic and eukaryotic ROXs, comparison of the crystal structures of E. coli YcfD and Rhodothermus marinus YcfD with those of human MINA53 and NO66 reveals highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-dependent oxygenases. ROX structures with and without their substrates support their functional assignments as hydroxylases but not demethylases, and reveal how the subfamily has evolved to catalyse the hydroxylation of different residue side chains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-domain-containing hydroxylases, including the hypoxia-inducible factor asparaginyl hydroxylase FIH and histone N(ε)-methyl lysine demethylases, identifies branch points in 2OG-dependent oxygenase evolution and distinguishes between JmjC-containing hydroxylases and demethylases

  8. Die Temperaturabhängigkeit semilunarer und diurnaler Schlüpfrhythmen bei der intertidalen Mücke Clunio marinus (Diptera, Chironomidae)

    NASA Astrophysics Data System (ADS)

    Krüger, M.; Neumann, D.


    On Helgoland (North Sea), the imagines of Clunio emerge during two seasonal periods (late spring and summer) from water temperatures of 8° 18 °C. The temperature dependence of the known semilunar eclosion rhythm of Clunio (correlated in nature with the spring tides every 14 15 days) was tested in the laboratory. Between 15° and 23 °C the semilunar eclosion maxima varied by only one day within the artifical 15-day zeitgebercycle, below 15 °C they were delayed up to 8 days at 8 °C. However, the days of pupation were approximately independent of the temperature level. One can conclude the existence of a temperature-independent physiological switch inducing the pupation only within a few days of the semilunar zeitgeber-cycle. Moreover, a semilunar synchronized differentiation of the imaginal discs already starts in the preceding larval instar, indicating an additional physiological switch. A model is suggested in which the semilunar eclosion rhythm and its relatively slight temperature dependence is explained by the action of two physiological switches which are coupled with the endogenous temperature-compensated lunar timing mechanism on the same days of the 15-day zeitgeber-cycle. In the laboratory, the diurnal eclosion and its underlying circadian timing mechanism (correlated on Helgoland with the time of spring low water in the late afternoon) also proved to be temperature independent between 12° and 20 °C. A comparison of field and laboratory data showed very similar results at temperatures around 18 °C (summer swarming period). In contrast, the midges emerged on all days of the semimonthly cycle of springs and neaps during the spring swarming period. This lack of semilunar synchronization may be the consequence of fluctuating temperatures during the larval and pupal development in spring time due to a general rise in the water temperature (4° 8 °C) and to short temperature rises up to 18 °C during exposure of the intertidal habitat at about low tide. Since some higher parts of the Clunio habitat suitable for egg deposition are exposed on almost every day of the semimonthly cycle, even such animals that undergo lunar unsynchronized metamorphosis can reproduce within the short imaginal life duration (ca 2 h) if they emerge just about the time of low water. In correspondence with the daily delay in the times of low water by about 50 min, the diurnal eclosion rhythm was in fact modified with the tides during the spring period resulting in shifts of the diurnal eclosion time of up to 12 hours within the semimonthly cycle of springs and neaps.

  9. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata).


    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi


    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria.



    Marine, D


    The first specimen of Ammocoetes branchialis that showed histologically any atrophic changes in the endostyle was taken on July 16. These changes proceeded relatively rapidly for about a month, after which the endostyle as such was no longer recognized. All specimens examined after August 15 showed in cross section the characteristic ductless follicles more or less completely formed. More gradual and minor changes in the way of further absorption of cell remnants and completion of the follicles continued at least until September 1. Two specimens taken from the creek on September 4, 1911. showed complete follicle formation with some stainable colloid (figures 14 and 15). There was still yellow granular pigment in the fibrous tissue between the follicles. In two specimens taken on October 14, 1909, the pigment was absent and the follicles were more closely set, larger, and contained homogenous colloid. In the twenty-four specimens of ammocoetes studied, there were variations in the time of the onset of metamorphosis. There may also be variations in the rate of progress of the changes in different specimens. There is no evidence that removal of the animals from their native environment to the laboratory either increases or decreases the rate of metamorphosis. Schneider states that he was unable to get specimens kept in the laboratory to undergo metamorphosis. Gage, however, has repeatedly observed the metamorphosis under laboratory conditions, and the six of our specimens kept in the laboratory-some for forty days-remained in excellent condition and the metamorphosis proceeded as well as in those living in the creek. I know of no observations bearing on the question as to whether the metamorphosis may be hastened or delayed as it can be in tadpoles and other amphibia. It is probable, however, that physical conditions greatly influence the transformation. These observations as to the length of time from the inception to the completion of metamorphosis indicate that a month and probably longer is necessary for the lake and brook lampreys of Central New York. This is in agreement with the observations of Gage and of Muller on metamorphosis in general, but is at variance with the views of Bujor, who states that the process takes place within three to four days. The first endostylar changes are a gradual shrinkage in the whole organ with thickening of the capsule and septum and proliferation of the connective tissue in the periendostylar zone. The tongue anlage is developed in this thickening just dorsal to the endostyle and anterior to the gland orifice. The size of the chambers progressively decreases and with the thickening of the septum the halves of the endostyle are both absolutely and relatively more separated. All the five types of epithelia are affected, the first to show the change being type I, the four fan-shaped bundles of cuneiform cells of each half of the endostyle. These disappear totally quite early. The next type to show marked changes is type III, or the cells with yellow pigment granules. Here the change is progressive and these cell groups in different stages of atrophy may be traced through to the fully developed follicles. The epithelium of type V, or the endothelial-like lining of the parietal walls of the chambers, is piled up and extruded laterally as the chambers contract or shrink. These cells in different stages of atrophy may be followed until the metamorphosis is nearing completion. It is certain that the cells of types I, III, and V play no part in the formation of the ductless follicles. With types II and IV the question is not so easily settled as it is from one or the other or from both of these types that the permanent follicles arise. One can say definitely that type IV plays the major role, but whether the cells of type II after fusion with the basal group of type IV do not also share in the formation of the ventral follicle of the given chamber, I cannot decide, but from the evidence obtainable this seems probable. It is significant that the cells of type IV are continuous with, and indistinguishable from, the cells lining the orifice and are continued anteriorly in the deep pharyngeal groove and peripharyngeal grooves as well as posteriorally from the orifice in the small pharyngeal groove. As to the fate of this extraglandular epithelium of type IV I have no data save that with the closing of the orifice and the formation of the permanent branchial sac these grooves with their ciliated epithelium disappear and the whole sac comes to be lined with plain stratified epithelium. The fact that the cells of the pharyngeal grooves and the lining cells of the gland orifice are continuous with the cells of the endostyle from which the permanent thyroid follicles are formed is not without significance in relation to the development of the thyroid of the higher chordates. One or more very large follicles are formed from the lower portion of this orificial epithelium of type IV. Four ductless follicles are the maximum number that may be formed primarily in each half of the endostyle from the four areas of epithelium of type IV. From the specimens studied this maximum is frequently not obtained. Posterior to the orifice where four chambers exist, each corresponding to one half of an anterior chamber, but two follicles may be formed from each chamber, but in the coil these are proportionately increased, in cross section. Most of the detailed studies here recorded have been made on the part of the endostyle posterior to the coil where the simplest conditions exist. Here two follicles are ordinarily formed from each chamber. In cross sections the follicles are at first only long tubules whose cavities are the remnants of the original endostyle chambers, but when the metamorphosis is completed each of these primary tubules is cut up into several elongated closed sacs corresponding to the true ductless follicles of all higher chordates. New follicles also arise by budding from these primary ones, and this process is probably of normal occurrence at the metamorphosis.

  11. Can muscle fatty acid signature be used to distinguish diets during the marine trophic phase of sea lamprey (Petromyzon marinus, L.)?


    Lança, Maria João; Rosado, C; Machado, M; Ferreira, R; Alves-Pereira, I; Quintella, B R; Almeida, P R


    Characterization of muscle and liver fatty acid profiles, determination of liver lipogenic and lipolytic activities and estimation of liver fatty elongases and desaturases activities of sea lamprey were realized at the beginning of the spawning migration. The muscle fatty acid profile was consistent with the location of capture, and revealed that animals captured far upstream from the river mouth presented the lowest C18:1ω9 levels and the highest relative proportions of C20:4ω6, C20:5ω3 (EPA), C22:5ω3 (DPA) and C22:6ω3 (DHA). These results suggest: (i) the vital importance of the conservation of C20:4ω6 as a precursor of eicosanoids; (ii) the retention of EPA, DPA and DHA for metabolic energy for reproduction; and (iii) the utilization of C18:1ω9 for metabolic fuel use in the beginning of the spawning period. Hepatic lipolysis and lipogenesis revealed significant differences which could, eventually, result from the diet during the parasitic phase of sea lamprey life cycle. Present results revealed that the muscle act as a fat depot site which explains the few significant correlations observed for fatty acids between muscle and liver. Muscle neutral lipids fatty acid signature at the beginning of the spawning migration can be used to distinguish differences in the diet of sea lampreys during the marine trophic phase of their life cycle. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Movement and recapture of parasitic-phase sea lampreys (Petromyzon marinus) tagged in the St. Marys River and Lakes Huron and Michigan, 1963-67

    USGS Publications Warehouse

    Moore, Harry H.; Dahl, Frederick H.; Lamsa, Aarne K.


    Four sea lampreys 345-445 mm long when tagged in November or early December were recovered in mid-September of the following year, at least 2 months after the end of the normal spawning season. Suggested possible reasons for this unusual occurrence are the extension of the parasitic phase of the life cycle beyond the usual 12 to 20 months, late-season maturation of the gonads, disease, or deleterious effects of the tags.

  13. Ultra-performance liquid chromatography tandem mass spectrometry for simultaneous determination of natural steroid hormones in sea lamprey (Petromyzon marinus) plasma and tissues.


    Wang, Huiyong; Bussy, Ugo; Chung-Davidson, Yu-Wen; Li, Weiming


    This study aims to provide a rapid, sensitive and precise UPLC-MS/MS method for target steroid quantitation in biological matrices. We developed and validated an UPLC-MS/MS method to simultaneously determine 16 steroids in plasma and tissue samples. Ionization sources of Electrospray Ionization (ESI) and Atmospheric Pressure Chemical Ionization (APCI) were compared in this study by testing their spectrometry performances at the same chromatographic conditions, and the ESI source was found up to five times more sensitive than the APCI. Different sample preparation techniques were investigated for an optimal extraction of steroids from the biological matrices. The developed method exhibited excellent linearity for all analytes with regression coefficients higher than 0.99 in broad concentration ranges. The limit of detection (LOD) was from 0.003 to 0.1ng/mL. The method was validated according to FDA guidance and applied to determine steroids in sea lamprey plasma and tissues (fat and testes) by the developed method. Copyright © 2015. Published by Elsevier B.V.

  14. Biology of larval sea lampreys (Petromyzon marinus) of the 1960 year class, isolated in the Big Garlic River, Michigan, 1960-65

    USGS Publications Warehouse

    Manion, Patrick J.; McLain, Alberton L.


    The capture of four recently metamorphosed sea lampreys (two males and two females), 152-172 mm long, in the fall of 1965, established the minimum age at transformation for larvae in the Big Garlic River at 5 years. Age and length (with the exception of a possible minimum length) were determined not to be critical factors in metamorphosis. The presence of larvae 65-176 mm long (mean, 107 mm) in the river in 1965 indicated that metamorphosis of lampreys in a single year class takes place over a period of years.

  15. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata)

    PubMed Central

    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi


    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria. PMID:20507907

  16. Comparison of isometric contractile properties of the tongue muscles in three species of frogs, Litoria caerulea, Dyscophus guinetti, and Bufo marinus.


    Peters, S E; Nishikawa, K C


    Previous studies show that anurans feed in at least three different ways. Basal frogs have a broad tongue that shortens during protraction and emerges only a short distance from the mouth. Some frogs have long, narrow tongues that elongate dramatically due primarily to inertia from mouth opening, which is transferred to the tongue. A few species have a hydrostatic mechanism that produces tongue elongation during protraction. This functional diversity occurs among frogs that share the same two pairs of tongue muscles. Our study compares the isometric contractile properties of these tongue muscles among three frog species that represent each feeding mechanism. Nerves to the paired protractors and retractors were stimulated electrically in each species to record the force properties, contraction speeds, and fatigabilites of these muscles. Few differences were found in the isometric contractile properties of tongue muscles, and the greatest differences were found in the retractors, not the protractors. We propose that the unique arrangement of the tongue muscles in frogs results in a retractor that may also be coactivated with the protractor in order to produce normal tongue protraction. Inertial effects from body, head, and jaw movements, along with clear differences that we found in passive resistance of the tongues to elongation, may explain much of the behavioral variation in tongue use among species. Copyright 1999 Wiley-Liss, Inc.

  17. The lampricide 3-trifluoromethyl-4-nitrophenol (TFM) uncouples mitochondrial oxidative phosphorylation in both sea lamprey (Petromyzon marinus) and TFM-tolerant rainbow trout (Oncorhynchus mykiss).


    Birceanu, Oana; McClelland, Grant B; Wang, Yuxiang S; Brown, Jason C L; Wilkie, Michael P


    The toxicity of 3-trifluoromethyl-4-nitrophenol (TFM) appears to be due to a mismatch between ATP supply and demand in lamprey, depleting glycogen stores and starving the nervous system of ATP. The cause of this TFM-induced ATP deficit is unclear. One possibility is that TFM uncouples mitochondrial oxidative phosphorylation, thus impairing ATP production. To test this hypothesis, mitochondria were isolated from the livers of sea lamprey and rainbow trout, and O(2) consumption rates were measured in the presence of TFM or 2,4-dinitrophenol (2,4-DNP), a known uncoupler of oxidative phosphorylation. TFM and 2,4-DNP markedly increased State IV respiration in a dose-dependent fashion, but had no effect on State III respiration, which is consistent with uncoupling of oxidative phosphorylation. To determine how TFM uncoupled oxidative phosphorylation, the mitochondrial transmembrane potential (TMP) was recorded using the mitochondria-specific dye rhodamine 123. Mitochondrial TMP decreased by 22% in sea lamprey, and by 28% in trout following treatment with 50μmolL(-1) TFM. These findings suggest that TFM acted as a protonophore, dissipating the proton motive force needed to drive ATP synthesis. We conclude that the mode of TFM toxicity in sea lamprey and rainbow trout is via uncoupling of oxidative phosphorylation, leading to impaired ATP production.

  18. The olfactory system of migratory adult sea lamprey (Petromyzon marinus) is specifically and acutely sensitive to unique bile acids released by conspecific larvae

    PubMed Central


    Larval sea lamprey inhabit freshwater streams and migrate to oceans or lakes to feed after a radical metamorphosis; subsequently, mature adults return to streams to spawn. Previous observations suggested that lamprey utilize the odor of conspecific larvae to select streams for spawning. Here we report biochemical and electrophysiological evidence that this odor is comprised of two unique bile acids released by larvae. High performance liquid chromatography and mass spectrometry demonstrated that larval sea lamprey produce and release two unique bile acids, allocholic acid (ACA) and petromyzonol sulfate (PS). Electro-olfactogram (EOG) recording also demonstrated that the olfactory system of migratory adult sea lamprey is acutely and specifically sensitive to ACA and PS; detection thresholds for these compounds were approximately 10(-12) M. ACA and PS were the most potent of 38 bile acids tested and cross-adaptation experiments suggested that adult sea lamprey have specific olfactory receptor sites associated with independent signal transduction pathways for these bile acids. These receptor sites specifically recognize the key substituents of ACA and PS such as a 5 alpha-hydrogen, three axial hydroxyls, and a C-24 sulfate ester or carboxyl. In conclusion, the unique lamprey bile acids, ACA and PS, are potent and specific stimulants of the adult olfactory system, strongly supporting the hypothesis that these unique bile acids function as migratory pheromones in lamprey. PMID:7658193

  19. Structural lipid changes and Na(+)/K(+)-ATPase activity of gill cells' basolateral membranes during saltwater acclimation in sea lamprey (Petromyzon marinus, L.) juveniles.


    Lança, Maria João; Machado, Maria; Ferreira, Ana Filipa; Quintella, Bernardo Ruivo; de Almeida, Pedro Raposo


    Seawater acclimation is a critical period for anadromous species and a process yet to be understood in lampreys. Considering that changes in lipid composition of the gill cells' basolateral membranes may disrupt the major transporter Na(+)K(+)-ATPase, the goal of this study was to detect changes at this level during juvenile sea lamprey seawater acclimation. The results showed that saltwater acclimation has a direct effect on the fatty acid composition of gill cells basolateral membrane's phospholipids. When held in full-strength seawater, the fatty acid profile of basolateral membrane's phospholipids suffered a restructure by increasing either saturation or the ratio between oleic acid and eicosapentaenoic acid. Simultaneously, the activity of Na(+)K(+)-ATPase revealed a significant and positive correlation with basolateral membrane's cholesterol content in the presence of highest salinity. Our results pointed out for lipid adjustments involving the functional transporter present on the gill cell basolateral membranes to ensure the role played by branchial Na(+)K(+)-ATPase in ion transport during saltwater acclimation process. The responses observed contributed to the strategy adopted by gill cell's basolateral membranes to compensate for osmotic and ionic stressors, to ensure the success of the process of seawater acclimation associated with the downstream trophic migration of juvenile sea lamprey.

  20. Cloning, phylogeny, and regional expression of a Y5 receptor mRNA in the brain of the sea lamprey (Petromyzon marinus).


    Pérez-Fernández, Juan; Megías, Manuel; Pombal, Manuel A


    The NPY receptors known as Y receptors are classified into three subfamilies, Y1, Y2, and Y5, and are involved in different physiological functions. The Y5 receptor is the only member of the Y5 subfamily, and it is present in all vertebrate groups, except for teleosts. Both molecular and pharmacological studies show that Y5 receptor is highly conserved during vertebrate evolution. Furthermore, this receptor is widely expressed in the mammalian brain, including the hypothalamus, where it is thought to take part in feeding and homeostasis regulation. Lampreys belong to the agnathan lineage, and they are thought to have branched out between the two whole-genome duplications that occurred in vertebrates. Therefore, they are in a key position for studies on the evolution of gene families in vertebrates. Here we report the cloning, phylogeny, and brain expression pattern of the sea lamprey Y5 receptor. In phylogenetic studies, the lamprey Y5 receptor clusters in a basal position, together with Y5 receptors of other vertebrates. The mRNA of this receptor is broadly expressed in the lamprey brain, being especially abundant in hypothalamic areas. Its expression pattern is roughly similar to that reported for other vertebrates and parallels the expression pattern of the Y1 receptor subtype previously described by our group, as it occurs in mammals. Altogether, these results confirm that a Y5 receptor is present in lampreys, thus being highly conserved during the evolution of vertebrates, and suggest that it is involved in many brain functions, the only known exception being teleosts.

  1. Hybridization between previously isolated ancestors may explain the persistence of exactly two ancient lineages in the genome of the oyster parasite Perkinsus marinus

    USDA-ARS?s Scientific Manuscript database

    Large biological populations that have not been subdivided should have accumulated variation in different genetic loci. Population samples should identify some loci lacking in variation, others characterized by a few alleles, and still others by many alleles. Departures from these expectations requi...

  2. Influence of osmotic stress on desiccation and irradiation tolerance of (hyper)-thermophilic microorganisms.


    Beblo-Vranesevic, Kristina; Galinski, Erwin A; Rachel, Reinhard; Huber, Harald; Rettberg, Petra


    This study examined the influence of prior salt adaptation on the survival rate of (hyper)-thermophilic bacteria and archaea after desiccation and UV or ionizing irradiation treatment. Survival rates after desiccation of Hydrogenothermus marinus and Archaeoglobus fulgidus increased considerably when the cells were cultivated at higher salt concentrations before drying. By doubling the concentration of NaCl, a 30 times higher survival rate of H. marinus after desiccation was observed. Under salt stress, the compatible solute diglycerol phosphate in A. fulgidus and glucosylglycerate in H. marinus accumulated in the cytoplasm. Several different compatible solutes were added as protectants to A. fulgidus and H. marinus before desiccation treatment. Some of these had similar effects as intracellularly produced compatible solutes. The survival rates of H. marinus and A. fulgidus after exposure to UV-C (254 nm) or ionizing X-ray/gamma radiation were irrespective of the salt-induced synthesis or the addition of compatible solutes.

  3. DNA-DNA relatedness and phylogenetic positions of Slackia exigua, Slackia heliotrinireducens, Eggerthella lenta, and other related bacteria.


    Nakazawa, F; Hoshino, E


    Recently, two asaccharolytic Eubacterium species, Eubacterium exiguum and Eubacterium lentum, and Peptostreptococcus heliotrinreducens have been reclassified as Slackia exigua, Eggerthella lenta and Slackia heliotrinireducens in the novel genera on the basis of 16S rDNA sequence analysis. But DNA-DNA relatedness among these species and other related bacteria have not been reported yet. DNA-DNA relatedness is the standard arbiter and the recommended method for the designation and evaluation of new species, particularly closely related ones. In the present study, DNA-DNA hybridization studies were performed on S. exigua, S. heliotrinireducens and E. lenta together with the other bacterial species in the related genera. The phylogenetic relationships of these species were also investigated by comparison analysis of 16S rDNA sequence data. In the DNA-DNA hybridization studies, S. exigua showed a DNA homology level of 33% to S. heliotrinireducens and 11% to E. lenta. DNA-DNA homology between S. heliotrinireducens and E. lenta was 10%. But these three species showed very low homology (less than 5%) to the related asaccharolytic species such as Eubacterium and Mogibacterium. In conclusion, the DNA-DNA relatedness data together with the evolutionary data in the present paper further support the reclassification of Eubacterium exiguum, Peptostreptococcus heliotrinreducens and Eubacterium lentum as Slackia exigua, Slackia heliotrinireducens and Eggerthella lenta, respectively.


    EPA Science Inventory

    A bactericidal assay developed to assess the ability of oyster (Crassostrea virginica) hemocytes to kill the human pathogen Vibrio parahaemolyticus was optimized to estimate killing of the oyster parasite Perkinsus marinus. Assay variables, temperature, hemocyte:parasite ratio, i...

  5. Draft Genome Sequences of Gammaproteobacterial Methanotrophs Isolated from Marine Ecosystems

    PubMed Central

    Flynn, James D.; Hirayama, Hisako; Sakai, Yasuyoshi; Dunfield, Peter F.; Knief, Claudia; Op den Camp, Huub J. M.; Jetten, Mike S. M.; Khmelenina, Valentina N.; Trotsenko, Yuri A.; Murrell, J. Colin; Semrau, Jeremy D.; Svenning, Mette M.; Stein, Lisa Y.; Kyrpides, Nikos; Shapiro, Nicole; Woyke, Tanja; Bringel, Françoise; Vuilleumier, Stéphane; DiSpirito, Alan A.


    The genome sequences of Methylobacter marinus A45, Methylobacter sp. strain BBA5.1, and Methylomarinum vadi IT-4 were obtained. These aerobic methanotrophs are typical members of coastal and hydrothermal vent marine ecosystems. PMID:26798114


    EPA Science Inventory

    Perkinsus marinus and Haplosporidium nelsoni cause devasting infections in populations of the eastern oyster, Crassostrea virginica, along the US Atlantic coast and Gulf of Mexico. Salinity and temperature are considered major controlling factors in the prevalence and infection i...


    EPA Science Inventory

    Influence of water quality and seasonal changes on disease prevalence and intensity of Perkinsus marinus, gonadal condition, recruitment potential, growth of caged juvenile oysters, and habitat suitability of reefs for fishes and macrobenthic invertebrates were measured in Callos...


    EPA Science Inventory

    The influence of freshwater releases and season on disease prevalence and intensity of Perkinsus marinus, condition index, gonadal condition, recruitment potential, and growth of oysters was examined monthly at five locations along the Caloosahatchee estuary, Florida. Temperature...

  9. Draft Genome Sequences of Gammaproteobacterial Methanotrophs Isolated from Marine Ecosystems: TABLE 1 


    Flynn, James D.; Hirayama, Hisako; Sakai, Yasuyoshi; ...


    The genome sequences ofMethylobacter marinusA45,Methylobactersp. strain BBA5.1, andMethylomarinum vadiIT-4 were obtained. These aerobic methanotrophs are typical members of coastal and hydrothermal vent marine ecosystems.


    EPA Science Inventory

    Influence of water quality and seasonal changes on disease prevalence and intensity of Perkinsus marinus, gonadal condition, recruitment potential, growth of caged juvenile oysters, and habitat suitability of reefs for fishes and macrobenthic invertebrates were measured in Callos...


    EPA Science Inventory

    Perkinsus marinus and Haplosporidium nelsoni cause devasting infections in populations of the eastern oyster, Crassostrea virginica, along the US Atlantic coast and Gulf of Mexico. Salinity and temperature are considered major controlling factors in the prevalence and infection i...


    EPA Science Inventory

    A bactericidal assay developed to assess the ability of oyster (Crassostrea virginica) hemocytes to kill the human pathogen Vibrio parahaemolyticus was optimized to estimate killing of the oyster parasite Perkinsus marinus. Assay variables, temperature, hemocyte:parasite ratio, i...

  13. Sanguibacter gelidistatuariae sp. nov., a novel psychrotolerant anaerobe from an ice sculpture in Antarctica, and emendation of descriptions for the family Sanguibacteraceae, the genus Sanguibacter and species S. antarcticus, S. inulinus, S. kedieii, S. marinus, S.soli and S. suarezii.


    Pikuta, Elena V; Lyu, Zhe; Williams, Melissa D; Patel, Nisha B; Liu, Yuchen; Hoover, Richard Brice; Busse, Hans-Jürgen; Lawson, Paul A; Whitman, William B


    A novel psychrotolerant bacterium strain ISLP-3T was isolated from a sample of naturally formed ice sculpture on the shore of Lake Podprudnoye in Antarctica. Cells were motile, stained Gram positive, non-spore-forming, straight or slightly curved rods with the shape of a baseball bat. The new isolate was facultatively anaerobic and catalase positive. Growth occurred at 3-35 ºC with an optimum at 24 °C, 0-2 % w/v NaCl with an optimum at 0.3 % and pH 6.2 - 9.5 with an optimum 7.5. Strain ISLP-3T grew on several carbon sources, with the best growth on D-cellobiose. The isolate possessed ureolytic activity but growth was inhibited by urea. The strain was sensitive to: ampicillin, gentamycin, kanamycin rifampicin, tetracycline and chloramphenicol. Major fatty acids were: C 15:0 anteiso, C 16:0 iso, C 16:0, C14:0 and C15:0 iso. The predominant menaquinone was MK-9(H4). The genomic G+C content was 69.5 mol%.The 16S rRNA gene possessed 99 % sequence similarity to the gene of Sanguibacter suarezii ST-26T, but their recA genes demonstrated ≤91 % sequence similarity, suggesting that this isolate represented a novel species within genus Sanguibacter. This conclusion was supported by ANI, which was ≤91 % to the most closely related strain. The name Sanguibacter gelidistatuariae sp. nov. is proposed for the new species with the type strain ISLP-3T(= ATCC TSD-17T, = DSM 100501T, = JCM 30887T). Complete genome draft sequence of ISLP-3T was deposited under IMG OID 2657245272. Emendments of related taxa have been made based on experimental data of our comparative analysis.

  14. Effects of glycyrrhizin and glycyrrhetic acid on the growth, glycyrrhizin beta-D-glucuronidase and 3 beta-hydroxysteroid dehydrogenase of human intestinal bacteria.


    Akao, T


    The peak of glycyrrhizin (GL) beta-D-glucuronidase activity for Ruminococcus sp. PO1-3 and Eubacterium sp. GLH changed to 24 h from 12 h of culture and to 12 h from 48 h, respectively, at almost the same level by the addition of 1.0 mM GL. This enzyme activity was about 20-fold higher in Eubacterium sp. GLH than in Ruminococcus sp. PO1-3. GL beta-D-glucuronidase activity of Ruminococcus sp. PO1-3 with Eubacterium sp. GLH and the intestinal flora showed a maximal peak at 12 h of culture in the presence and absence of 1.0 mM GL. This enzyme activity was about 2.5-fold higher in mixed bacteria than in intestinal flora. 3Beta-hydrosteroid dehydrogenase activity of Ruminococcus sp. PO1-3 and Ruminococcus sp. PO1-3 with Eubacterium sp. GLH was suppressed greater in the presence of GL than without GL. Also, Ruminococcus sp. PO1-3, Eubacterium sp. GLH, and a mixture of both and intestinal flora, metabolized 1.0 mM GL to glycyrrhetic acid (GA) in yields of about 10, 70, 40 and 100%, respectively, with 24 h culture. From the level of GL beta-D-glucuronidase activity, it is considered that the metabolism of GL by intestinal flora is due to both enzymatic and non-enzymatic reactions. Moreover, GA at a concentration of 1.0 mM suppressed growth of Ruminococcus sp. PO1-3, Eubacterium sp. GLH, and the mixture of both and intestinal flora, which metabolized 1.0 mM GA to a negligible amount of 3-oxo-glycyrrhetic acid, indicating the accumulation of unchanged GA. GL beta-D-glucuronidase activity of intestinal flora was enhanced by GA, which stimulated bacteria possessing particular this characteristic.

  15. Assessment of Virally Vectored Autoimmunity as a Biocontrol Strategy for Cane Toads

    PubMed Central

    Robinson, Anthony J.; Venables, Daryl; Voysey, Rhonda D.; Boyle, Donna G.; Shanmuganathan, Thayalini; Hardy, Christopher M.; Siddon, Nicole A.; Hyatt, Alex D.


    Background The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. Methodology/Principal Findings The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. Conclusions/Significance While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach. PMID:21283623

  16. Diversity and abundance of the bacterial 16S rRNA gene sequences in forestomach of alpacas (Lama pacos) and sheep (Ovis aries).


    Pei, Cai-Xia; Liu, Qiang; Dong, Chang-Sheng; Li, HongQuan; Jiang, Jun-Bing; Gao, Wen-Jun


    Two bacterial 16S rRNA gene clone libraries were constructed from the forestomach of alpacas and sheep fed alfalfa. After the amplification using the universal 16S rRNA gene primers, equal quantities of PCR products from the same species were mixed and used to construct the two libraries. Sequence analysis showed that the 60 clones from alpacas were divided into 27 phylotypes with 25% clones affiliated with Eubacterium sp. F1. The 60 clones from sheep were divided into 21 phylotypes with 7 phylotypes affiliated with Prevotella ruminicola (40% clones). Clones closely related to Clostridium proteoclasticum, Eubacterium sp. F1, Clostridium cellobioparum, Mogibacterium neglectum, Eubacterium ventriosum, Clostridiaceae bacterium WN011, Clostridium coccoides, Clostridium orbiscindens, Eubacterium sp. F1, Cytophaga sp. Dex80-37, Treponema bryantii and Pelotomaculum sp. FP were only found in the forestomach of alpacas, and those to Anaerovorax odorimutans, Treponema zioleckii, Bifidobacterium indicum, Paludibacter propionicigenes, Paraprevotella clara, Eubacterium siraeum, Desulfotomaculum sp. CYP1, Clostridium bolteae, Clostridium termitidis and Clostridiaceae bacterium DJF_LS40 only in the rumen of sheep. Quantitative real-time PCR revealed that the forestomach of alpacas had significantly lower density of bacteria, with bacterial 16S rRNA gene copies (6.89 [Log10 (copies per gram of wet weight)]), than that of sheep (7.71, P<0.01). The two clone libraries also appeared different in Shannon index (library from alpacas 3.30 and from sheep 3.04). Our results showed that there were apparent differences in the bacterial diversity and abundance in the forestomach between alpacas and sheep. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  17. Lueheia inscripta (Westrumb, 1821) (Acanthocephala: Plagiorhynchidae) in anurans (Leptodactylidae: Bufonidae) from Mexico.


    Salgado-Maldonado, G; Caspeta-Mandujano, J M


    Juveniles of Lueheia inscripta (Westrumb, 1821 Travassos, 1919 (Acanthocephala: Plagiorhynchidae), an acanthocephalan with six lemnisci, are reported and described from mesenteries of frogs Leptodactylus fragilis Brochi, 1877 and a toad Bufo marinus (Linnaeus, 1758) from Morelos state, Mexico. These are new host records extending the known geographical distribution of this species from Brazil and Puerto Rico to Mexico.

  18. Selective cutting, rehabilitation, and alternatives for forests of northeastern North America and elsewhere


    Laura S. Kenefic


    In the 1928 Journal of Forestry, Marinus Westveld commented that logging in the Northeast dating to the mid-1800s had been selective cutting that removed desirable species of large sizes. Later, commercial clearcuts removed progressively smaller trees of merchantable quality and desirable species. Indiscriminate logging damaged young growing stock...

  19. Does Implicit Learning in Non-Demented Parkinson's Disease depend on the Level of Cognitive Functioning?

    ERIC Educational Resources Information Center

    Vandenbossche, Jochen; Deroost, Natacha; Soetens, Eric; Kerckhofs, Eric


    We investigated the influence of the level of cognitive functioning on sequence-specific learning in Parkinson's disease (PD). This was done by examining the relationship between the scales for outcomes in Parkinson's disease-cognition [SCOPA-COG, Marinus, J., Visser, M., Verwey, N. A., Verhey, F. R. J., Middelkoop, H. A. M.,Stiggelbout, A., et…


    EPA Science Inventory

    The known range of the eastern oyster (Crassostrea virginica) parasite, Perkinsus marinus, expanded into the northeastern United States in the early 1990s. We used both in vitro and in vivo data to test the hypothesis that the northward expansion was associated with a low-tempera...

  1. The performance of oyster families exposed to Dermo disease is contingent on the source of pathogen exposure

    USDA-ARS?s Scientific Manuscript database

    Here we report preliminary results from a course of research integrating pathology, feeding ecology, genetics and genomics to address resistance to Dermo disease in eastern oysters. We challenged six oyster families with Perkinsus marinus, the etiological agent of Dermo disease, through either direc...

  2. Draft Genome Sequences of Gammaproteobacterial Methanotrophs Isolated from Marine Ecosystems: TABLE 1 

    SciTech Connect

    Flynn, James D.; Hirayama, Hisako; Sakai, Yasuyoshi; Dunfield, Peter F.; Klotz, Martin G.; Knief, Claudia; Op den Camp, Huub J. M.; Jetten, Mike S. M.; Khmelenina, Valentina N.; Trotsenko, Yuri A.; Murrell, J. Colin; Semrau, Jeremy D.; Svenning, Mette M.; Stein, Lisa Y.; Kyrpides, Nikos; Shapiro, Nicole; Woyke, Tanja; Bringel, Françoise; Vuilleumier, Stéphane; DiSpirito, Alan A.; Kalyuzhnaya, Marina G.


    The genome sequences ofMethylobacter marinusA45,Methylobactersp. strain BBA5.1, andMethylomarinum vadiIT-4 were obtained. These aerobic methanotrophs are typical members of coastal and hydrothermal vent marine ecosystems.


    EPA Science Inventory

    The known range of the eastern oyster (Crassostrea virginica) parasite, Perkinsus marinus, expanded into the northeastern United States in the early 1990s. We used both in vitro and in vivo data to test the hypothesis that the northward expansion was associated with a low-tempera...

  4. Mechanical properties of the hindlimb bones of bullfrogs and cane toads in bending and torsion.


    Wilson, Megan P; Espinoza, Nora R; Shah, Sagar R; Blob, Richard W


    When compared with most vertebrates, frogs use a novel style of jumping locomotion powered by the hindlimbs. Hindlimb bones of frogs must withstand the potentially erratic loads associated with such saltatory locomotion. To evaluate the load bearing capacity of anuran limb bones, we used three-point bending, torsion, and hardness tests to measure the mechanical properties of the femur and tibiofibula from adults of two species that use different jumping styles: explosively jumping bullfrogs (Rana (Lithobates) catesbeiana) and cyclically hopping cane toads (Bufo (Chaunus) marinus). Yield stress and strain values for R. catesbeiana and B. marinus hindlimb bones are within the range of values previously reported for other vertebrates. However, anuran hindlimb bones generally stand out as having higher yield stresses in bending than those of closely related, nonsaltatory salamanders, highlighting the importance of considering phylogenetic context in comparisons of bone functional capacity and adaptation. Stiffness values for both frog species tested were also high, which may facilitate efficient transmission of muscular forces while jumping. Elevated stiffness may also contribute to some discrepancies between determinations of bone properties via hardness versus bending tests. In comparisons between species, B. marinus bones showed significantly higher bending yield stresses than R. catesbeiana, whereas R. catesbeiana bones showed significantly higher torsional yield stresses than B. marinus. These differences may correlate with differences in jumping style and limb anatomy between ranid and bufonid frogs, suggesting that evolutionary changes in bone mechanical properties may help to accommodate new functional demands that emerge in lineages.

  5. Does Implicit Learning in Non-Demented Parkinson's Disease depend on the Level of Cognitive Functioning?

    ERIC Educational Resources Information Center

    Vandenbossche, Jochen; Deroost, Natacha; Soetens, Eric; Kerckhofs, Eric


    We investigated the influence of the level of cognitive functioning on sequence-specific learning in Parkinson's disease (PD). This was done by examining the relationship between the scales for outcomes in Parkinson's disease-cognition [SCOPA-COG, Marinus, J., Visser, M., Verwey, N. A., Verhey, F. R. J., Middelkoop, H. A. M.,Stiggelbout, A., et…

  6. Final Environmental Impact Statement. Permit Application by United States Steel Corp., Proposed Lake Front Steel Mill, Conneaut, Ohio. Volume 2.

    DTIC Science & Technology


    available spawning habitat for such species as lake whitefish (Coregonus clupeaformis), lake sturgeon ( Acipenser fulvescens ), walleye (Stizostedion...American brook lamprey, Lapetta lamottei Lake sturgeon, Acipenser fulvescens Paldlef ish, Plon spaSRtiiu4a. Spotted gar. Lepisosteus oculatus...marinus 3 Shortnose sturgeon Acipenser brevirostrum 1 Lake sturgeon Acipenser fulvescens I Atlantic sturgeon Acipenser oxyrhynchus 3 Spotted gar

  7. NMR bioreactor development for live in-situ microbial functional analysis

    SciTech Connect

    Majors, Paul D.; Mclean, Jeffrey S.; Scholten, Johannes C.


    A live in-situ metabolomics capability was developed for prokaryotic cultures under controlled-growth conditions. Toward this goal, a radiofrequency-transparent bioreactor was developed and integrated with a commercial wide-bore nuclear magnetic resonance (NMR) imaging spectrometer and a commercial bioreactor controller. Water suppressed 1H NMR spectroscopy was used to monitor glucose and fructose utilization and byproduct excretion by Eubacterium aggregans (an anaerobic bacterial species relevant for biofuels production) under controlled batch and continuous culture conditions. The resulting metabolite profiles (short chain organic acids and ethanol) and trends are consistent with existing knowledge of its metabolism. However, our study showed the Eubacterium aggregans produces lactate end product in significant concentrations – a result not previously reported. The advantages of live in-situ microbial metabolomics analysis and its complementariness with functional genomics / systems biology methods are discussed.

  8. Spurious hydrogen sulfide production by Providencia and Escherichia coli species.

    PubMed Central

    Treleaven, B E; Diallo, A A; Renshaw, E C


    Hydrogen sulfide production was noted in two Escherichia coli strands and one Provaidenica alcalifaciens (Proteus inconstans A) strain isolated from clinical stool specimens durin the summer of 1979. An investigation into this phenomenon revealed the predence of Eubacterium lentum, an anaerobe, growing in synergism with the Enterobacteriaceae and producing H2s. The implications of this association are discssed with reference to clinical microbiology laboratory practice. PMID:7000823

  9. Detection of cellulolytic bacteria from the human colon.


    Kopecný, J; Hajer, J; Mrázek, J


    The main representatives of bacteria in the human colon were investigated by specific PCR and denaturing gradient gel electrophoresis (DGGE). Prevalent in both cases were species of Bifidobacterium, Clostridium, Bacteroides, Faecalibacterium and Eubacterium. Simultaneously, cellulolytic bacteria were isolated from the human feces. The largest proportion was represented by ruminococcus-like isolates. Their presence was confirmed both by PCR and DGGE methods; the latter one was able to give more comprehensive data about the composition of bacterial population in the human colon chyme.

  10. Carotenoid Antenna Binding and Function in Retinal Proteins

    DTIC Science & Technology


    REPORT Carotenoid antenna binding and function in retinal proteins 14. ABSTRACT 16. SECURITY CLASSIFICATION OF: Xanthorhodopsin, a proton pump from the...eubacterium Salinibacter ruber, is a unique dual chromophore system that contains, in addition to retinal, the carotenoid salinixanthin as a light... carotenoid ring near the retinal ring. Substitution of the small glycine with bulky tryptophan in this site eliminates binding. The second factor is the 4

  11. Bioinformatic Tools for Metagenomic Analysis of Pathogen Backgrounds and Human Microbial Communities

    DTIC Science & Technology


    CGTTCTCGGGTCTTGTACACACCGCCCGTCACACCATGGGAGCTGGTAATACCCAAAGTCGGTTAGCTAA CCTCGGAGGCGACCGCCTAAGGTAGGACTGGTGACTGGGGTGA >gi|265678873|ref|NR_029179.1| Geobacter sulfurreducens strain PCA 16S ribosomal RNA, partial...NR_029179.1| Geobacter sulfurreducens strain PCA 16S ribosomal RNA, partial sequence 279814 281221 gi|265678872|ref|NR_029178.1| Eubacterium infirmum...Corynebacterineae; Nocardiaceae; Rhodococcus. 13202 Bacteria_16S 280649 280742 1 94 gi|265678873|ref|NR_029179.1| Geobacter sulfurreducens strain

  12. Anaerobic transformation of quercetin-3-glucoside by bacteria from the human intestinal tract.


    Schneider, H; Schwiertz, A; Collins, M D; Blaut, M


    From human feces two phenotypically different types of bacteria were isolated on quercetin-3-glucoside as carbon and energy source. Isolates of one type were identified as strains of Enterococcus casseliflavus. They utilized the sugar moiety of the glycoside, but did not degrade the aglycon further. The sugar moiety (4 mM) was fermented to 5.5 +/- 2.1 mM formate, 2.1 +/- 0.7 mM acetate, 1.6 +/- 0.3 mM l-lactate, and 1.3 +/- 0.4 mM ethanol. The second type of isolate was identified as Eubacterium ramulus. This organism was capable of degrading the aromatic ring system. Growing cultures of Eubacterium ramulus converted 5 mM quercetin-3-glucoside to 1.7 +/- 0.6 mM 3,4-dihydroxyphenylacetic acid, 7.6 +/- 1.0 mM acetate, and 4.0 +/- 0.4 mM butyrate. Molecular hydrogen, 3,4-dihydroxybenzaldehyde, and ethanol were detected in small amounts. Phloroglucinol was a transient intermediate in the breakdown of quercetin-3-glucoside. Eubacterium ramulus did not grow on the aglycon quercetin or the ring-fission intermediate phloroglucinol, but cleaved the flavonoid ring system when glucose was present as a cosubstrate. The most probable number of quercetin-3-glucoside-degrading bacteria determined in nine human fecal samples was 10(7)-10(9)/g dry mass. Isolates from these experiments were all identified as Eubacterium ramulus.

  13. In vitro determination of prebiotic properties of oligosaccharides derived from an orange juice manufacturing by-product stream.


    Manderson, K; Pinart, M; Tuohy, K M; Grace, W E; Hotchkiss, A T; Widmer, W; Yadhav, M P; Gibson, G R; Rastall, R A


    Fermentation properties of oligosaccharides derived from orange peel pectin were assessed in mixed fecal bacterial culture. The orange peel oligosaccharide fraction contained glucose in addition to rhamnogalacturonan and xylogalacturonan pectic oligosaccharides. Twenty-four-hour, temperature- and pH-controlled, stirred anaerobic fecal batch cultures were used to determine the effects that oligosaccharides derived from orange products had on the composition of the fecal microbiota. The effects were measured through fluorescent in situ hybridization to determine changes in bacterial populations, fermentation end products were analyzed by high-performance liquid chromatography to assess short-chain fatty acid concentrations, and subsequently, a prebiotic index (PI) was determined. Pectic oligosaccharides (POS) were able to increase the bifidobacterial and Eubacterium rectale numbers, albeit resulting in a lower prebiotic index than that from fructo-oligosaccharide metabolism. Orange albedo maintained the growth of most bacterial populations and gave a PI similar to that of soluble starch. Fermentation of POS resulted in an increase in the Eubacterium rectale numbers and concomitantly increased butyrate production. In conclusion, this study has shown that POS can have a beneficial effect on the fecal microflora; however, a classical prebiotic effect was not found. An increase in the Eubacterium rectale population was found, and butyrate levels increased, which is of potential benefit to the host.

  14. Subgingival microbiome in patients with healthy and ailing dental implants

    PubMed Central

    Zheng, Hui; Xu, Lixin; Wang, Zicheng; Li, Lianshuo; Zhang, Jieni; Zhang, Qian; Chen, Ting; Lin, Jiuxiang; Chen, Feng


    Dental implants are commonly used to replace missing teeth. However, the dysbiotic polymicrobial communities of peri-implant sites are responsible for peri-implant diseases, such as peri-implant mucositis and peri-implantitis. In this study, we analyzed the microbial characteristics of oral plaque from peri-implant pockets or sulci of healthy implants (n = 10), peri-implant mucositis (n = 8) and peri-implantitis (n = 6) sites using pyrosequencing of the 16S rRNA gene. An increase in microbial diversity was observed in subgingival sites of ailing implants, compared with healthy implants. Microbial co-occurrence analysis revealed that periodontal pathogens, such as Porphyromonas gingivalis, Tannerella forsythia, and Prevotella intermedia, were clustered into modules in the peri-implant mucositis network. Putative pathogens associated with peri-implantitis were present at a moderate relative abundance in peri-implant mucositis, suggesting that peri-implant mucositis an important early transitional phase during the development of peri-implantitis. Furthermore, the relative abundance of Eubacterium was increased at peri-implantitis locations, and co-occurrence analysis revealed that Eubacterium minutum was correlated with Prevotella intermedia in peri-implantitis sites, which suggests the association of Eubacterium with peri-implantitis. This study indicates that periodontal pathogens may play important roles in the shifting of healthy implant status to peri-implant disease. PMID:26077225

  15. Survey for protozoan parasites in Eastern oysters (Crassostrea virginica) from the Gulf of Maine using PCR-based assays.


    Marquis, Nicholas D; Record, Nicholas R; Robledo, José A Fernández


    Protozoan pathogens represent a serious threat to oyster aquaculture, since they can lead to significant production loses. Moreover, oysters can concentrate human pathogens through filter feeding, thus putting at risk raw oyster consumers' health. Using PCR-based assays in oysters (Crassostrea virginica) from Maine, we expand the Northeast range in the USA for the protozoans Perkinsus marinus, Perkinsus chesapeaki, and Haplosporidium nelsoni, and report for the first time the detection of the human pathogens Toxoplasma gondii and Cryptosporidium parvum. Oysters hosting both P. marinus and P. chesapeaki were more than three times as likely to be infected by a non-Perkinsus than those free of Perkinsus infections. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Aliphatic Hydrocarbons and Fatty Acids of Some Marine and Freshwater Microorganisms

    PubMed Central

    Oró, J.; Tornabene, T. G.; Nooner, D. W.; Gelpi, E.


    Gas chromatography and combined gas chromatography-mass spectrometry have been used to study the fatty acids and hydrocarbons of a bacterium from the Pacific Ocean, Vibrio marinus, a freshwater blue-green alga, Anacystis nidulans, and algal mat communities from the Gulf of Mexico. Both types of microorganisms (bacteria and algae) showed relatively simple hydrocarbon and fatty acid patterns, the hydrocarbons predominating in the region of C-17 and the fatty acids in the range of C-14 to C-18. The patterns of V. marinus were more comparable to those of the algal populations than to patterns reported for other bacteria. An incomplete correlation between fatty acids and hydrocarbons in both types of organisms was observed, making it difficult to accept the concept that the biosynthesis of hydrocarbons follows a simple fatty acid decarboxylation process. PMID:6025301

  17. Kudoa spp. (Myxozoa, Multivalvulida) parasitizing fish caught in Aracaju, Sergipe, Brazil.


    Eiras, Jorge Costa; Fujimoto, Rodrigo Yudi; Madi, Rubens Riscala; Jeraldo, Veronica de Lourdes Sierpe; Melo, Cláudia Moura de; Souza, Jônatas Dos Santos de; Diniz, José Antonio Picanço; Diniz, Daniel Guerreiro


    This study reports on Kudoa spp. (Myxozoa, Multivalvulida) from the fish species Lutjanus analis, Bagre marinus, Aspistor luniscutis and Lutjanus jocu, which were caught in Aracaju, state of Sergipe, Brazil. The parasites formed oval plasmodia around the esophagus of L. analis, and elongated plasmodia inside the skeletal muscle of B. marinus, A. luniscutis and L. jocu. Host myoliquefaction was not observed in all the cases studied. The current study provides a morphological and morphometric description of each parasite as well as a comparison with all the species described worldwide. Lack of molecular data impaired specific identification of the parasites. The importance of these parasites is discussed and the need for further studies on infections in Brazilian fish is emphasized because of the high economic impact of some Kudoa species which cause liquefaction in hosts' muscles and render these fish unsuitable for consumption.

  18. The Coast Artillery Journal. Volume 67, Number 4, October 1927

    DTIC Science & Technology


    THE COAST ARTILLERY JOURNAL Volume 67 OCTOBER, 1927 Number 4 The Beginnings of Coast Fortifications By EDGAR B. WESLEY THE general policy of...the time were withdrawing from l\\ew York to Boston to reinforce the troops there, Marinus Willett, aided by John Morin Scott and others, seized the...Long Island. On September 15, the battalion, as part of General John Morin Scott’s brigade, participated in the retreat from l\\ew York. In October and

  19. Cane toads a threat to West Indian wildlife: mortality of Jamaican boas attributable to toad ingestion


    Byron S. Wilson; Susan E. Koenig; Rick van Veen; Erika Miersma; D. Craig. Rudolph


    The notorious ‘‘cane toad’’ (Bufo marinus) is considered to be one of the 100 worst invasive species in the world. A native of South and Central America, Mexico, and the Rio Grande Valley of the United States, this large toad was intentionally introduced to islands in the Caribbean, and subsequently throughout the southern Pacific, as a biological control agent to...

  20. Acute Toxicity of the Lampricides TFM and Niclosamide to Three Species of Unionid Mussels

    DTIC Science & Technology


    Niclosamide to Three Species of Unionid Mussels By Michael A. Boogaard The sea lamprey (Petromyzon marinus), a jawless parasitic eel-like fish native control larval sea lampreys in tribu- taries of the Great Lakes since the early 1960s. The lampricide TFM is the main compound used to keep sea... lamprey populations in check while niclosamide is used primarily in combination with TFM as a cost-sav- ing measure. The addition of niclosamide at

  1. Dredged Material Evaluations: Review of Zooplankton Toxicity Test Methods for Marine Water Quality Evaluations

    DTIC Science & Technology


    per liter (APHA 1999; Medina and Barata 2004). Copepods reproduce sexually, with an assumed sex ratio of approximately 1:1 (Kusk and Petersen 1997...and G. Liu. 2006. The effects of bis(tributyltin) oxide on the development, reproduction and sex ratio of calanoid copepod Pseudodiaptomus marinus...definitions- section 227.27 Medina, M., C. Barata, T. Telfer, and D. J. Baird. 2002. Age and sex related variation in sensitivity to the pyrethroid

  2. Evidence for partial overlap of male olfactory cues in lampreys.


    Buchinger, Tyler J; Li, Ke; Huertas, Mar; Baker, Cindy F; Jia, Liang; Hayes, Michael C; Li, Weiming; Johnson, Nicholas S


    Animals rely on a mosaic of complex information to find and evaluate mates. Pheromones, often consisting of multiple components, are considered to be particularly important for species-recognition in many species. Although the evolution of species-specific pheromone blends is well described in many insects, very few vertebrate pheromones have been studied in a macro-evolutionary context. Here, we report a phylogenetic comparison of multi-component male odours that guide reproduction in lampreys. Chemical profiling of sexually mature males from eleven species of lamprey, representing six of ten genera and two of three families, indicated that the chemical profiles of sexually mature male odours are partially shared among species. Behavioural assays conducted with four species sympatric in the Laurentian Great Lakes indicated asymmetric female responses to heterospecific odours, where Petromyzon marinus were attracted to male odour collected from all species tested, but other species generally preferred only the odour of conspecifics. Electro-olfactogram recordings from P. marinus indicated that although P. marinus exhibited behavioural responses to odours from males of all species, at least some of the compounds that elicited olfactory responses were different in conspecific male odours compared with heterospecific male odours. We conclude that some of the compounds released by sexually mature males are shared among species and elicit olfactory and behavioural responses in P. marinus, and suggest that our results provide evidence for partial overlap of male olfactory cues among lampreys. Further characterization of the chemical identities of odour components is needed to confirm shared pheromones among species. © 2017. Published by The Company of Biologists Ltd.

  3. Perkinsus infection is associated with alterations in the level of global DNA methylation of gills and gastrointestinal tract of the oyster Crassostrea gasar.


    Farias, Natanael Dantas; de Oliveira, Naila Francis Paulo; da Silva, Patricia Mirella


    Bivalves are filter feeders that obtain food from seawater that may contain infectious agents, such as the protozoan parasites Perkinsus marinus and P. olseni that are associated with massive mortalities responsible for losses in the aquaculture industry. Despite all physical and chemical barriers, microorganisms cross epithelia and infect host tissues to cause pathologies. Epigenetics mechanisms play important roles in a variety of human processes, from embryonic development to cell differentiation and growth. It is currently emerging as crucial mechanism involved in modulation of host-parasite interactions and pathogenesis, promoting discovery of targets for drug treatment. In bivalves, little is known about epigenetic mechanism in host parasite interactions. The objective of the present study was to evaluate the effect of Perkinsus sp. infections on DNA methylation levels in tissues of Crassostrea gasar oysters. Samples were collected in 2015 and 2016 in the Mamanguape River estuary (PB). Oyster gills were removed and used for Perkinsus sp. Gills (G) and gastrointestinal tract (GT), as well as cultured P. marinus trophozoites were preserved in 95% ethanol for DNA extractions. DNA methylation levels were estimated from G and GT tissues of uninfected (n=60) and infected oysters (n=60), and from P. marinus trophozoites, by ELISA assays. Results showed that the mean prevalence of Perkinsus sp. infections was high (87.3%) in 2015 and moderate (59.6%) in 2016. DNA methylation levels of G and GT tissues were significantly lower in infected oyster than in uninfected oysters, suggesting that infections are associated with hypomethylation. Methylation level was significantly higher in G than in GT tissues, indicating a likely tissue-specific mechanism. P. marinus trophozoites showed 33% methylation. This was the first study that confirms alterations of DNA methylation in two tissues of C. gasar oysters in association with Perkinsus sp. infections. Copyright © 2017

  4. Exposure to the lampricide 3-trifluoromethyl-4-nitrophenol results in increased expression of carbohydrate transporters in S. cerevisiae

    PubMed Central

    Hinkle, Karen L.; Anderson, Chad C.; Forkey, Blake; Griffin, Jacob; Cone, Kelsey; Vitzthum, Carl; Olsen, Darlene


    The lampricide 3-trifluoromethyl-4-nitrophenol (TFM) is used to control sea lamprey (Petromyzon marinus) populations in freshwater lakes. While TFM can have sublethal and lethal effects, little is known about gene expression changes with TFM exposure. Microarray analysis was used to determine differential gene expression over 4 hours of exposure in S. cerevisiae. Among the most significantly up regulated genes were regulators of carbohydrate transport including HXT1, HXT3, HXT4, IMA5, MIG2, and YKR075C. PMID:26606276

  5. Diatoms as food of larval sea lampreys in a small tributary of northern Lake Michigan

    USGS Publications Warehouse

    Manion, Patrick J.


    The food and food preferences of sea lamprey ammocoetes have not been investigated. The food of the larval American brook lamprey, Lampetra lamottei, in the Great Lakes region consisted mainly of diatoms and desmids according to Creaser and Hann. Schroll discussed the biology of feeding of ammocoetes of Lampetra planeri and Eudontomyzon danfordi in Europe. This report presents data on the availability and use of diatoms by sea lamprey, Petromyzon marinus Linnaeus, ammocoetes in a small tributary of northern Lake Michigan.

  6. The Environmental Evaluation Work Group: FY 1979 Studies of the Winter Navigation Demonstration Program, St. Lawrence River Fisheries Study

    DTIC Science & Technology


    marinus - Sea Lamprey X X - Acipenser fulvescens - Lake sturgeon X X X Lepisosteus osseus - Longnose gar X X X - Amia calva - Bowfin X X M,T Tb Anguilla...Growth, Feeding Ecology , Larval Fish, Spawning Areas, Benthic Invertebrates 19. ABSTRACT (Continue on revers if necesry and identify by block number...2) determine the population structure, relative growth and feeding ecology of northern pike, yellow perch, largemouth bass, smallmouth bass, and (3

  7. Croceicoccus naphthovorans sp. nov., a polycyclic aromatic hydrocarbons-degrading and acylhomoserine-lactone-producing bacterium isolated from marine biofilm, and emended description of the genus Croceicoccus.


    Huang, Yili; Zeng, Yanhua; Feng, Hao; Wu, Yuehong; Xu, Xuewei


    A polycyclic aromatic hydrocarbons-degrading and acylhomoserine-lactone-producing marine bacterium, designated strain PQ-2(T), was isolated from marine biofilm collected from a boat shell at a harbour of Zhoushan island in Zhejiang Province, PR China. Strain PQ-2(T) is Gram-stain-negative, yellow-pigmented, non-motile and short rod-shaped. Optimal growth of strain PQ-2(T) was observed at 32 °C, at pH 7.0 and in 2% (w/v) NaCl. The 16S rRNA gene sequence of strain PQ-2(T) showed highest similarity to Croceicoccus marinus E4A9(T) (96.3%) followed by Novosphingobium malaysiense MUSC 273(T) (95.6%) and Altererythrobacter marinus H32(T) (95.6%). Phylogenetic analysis with all species of the family Erythrobacteraceae with validly published names revealed that strain PQ-2(T) formed a phyletic line with Croceicoccus marinus E4A9(T) that was distinct from other members of the family Erythrobacteraceae . The sole respiratory quinone was ubiquinone 10 (Q-10). The predominant fatty acids were C18 : 1ω7c, C17 : 1ω6c and summed feature 3 (C16 : 1ω7c and/or iso-C15 : 0 2-OH). The genomic DNA G+C content was 61.7 mol%. In the polar lipid profile, phosphatidylethanolamine, phosphatidylcholine, phosphatidylglycerol, one unidentified phospholipid and one sphingoglycolipid were the major compounds; and another sphingoglycolipid was present in a minor amount. Based on the genotypic and phenotypic data, strain PQ-2(T) represents a novel species of the genus Croceicoccus , for which the name Croceicoccus naphthovorans sp. nov. is proposed. The type strain is PQ-2(T) ( =CGMCC 1.12805(T) =NBRC 110381(T)). In addition, emended descriptions for the genus Croceicoccus and the species C. marinus are given. © 2015 IUMS.

  8. Identification of potential general markers of disease resistance in American oysters, Crassostrea virginica through gene expression studies.


    Nikapitiya, Chamilani; McDowell, Ian C; Villamil, Luisa; Muñoz, Pilar; Sohn, SaeBom; Gomez-Chiarri, Marta


    Several diseases have a significant impact on American oyster populations in the Atlantic coasts of North America. Knowledge about the responses of oysters to pathogenic challenge could help in identifying potential markers of disease resistance and biomarkers of the health status of an oyster population. A previous analysis of the transcriptome of resistant and susceptible American oysters in response to challenge with the bacterial pathogen Roseovarius crassostreae, as well as sequencing of suppression subtractive hybridization libraries from oysters challenged with the protozoan parasite Perkinsus marinus, provided a list of genes potentially involved in disease resistance or susceptibility. We investigated the patterns of inducible gene expression of several of these genes in response to experimental challenge with the oyster pathogens R. crassostreae, Vibrio tubiashii, and P. marinus. Oysters showing differential susceptibility to R. crassostreae demonstrated differential patterns of expression of genes coding for immune (serine protease inhibitor-1, SPI1) and stress-related (heat shock protein 70, HSP70; arginine kinase) proteins 30 days after challenge with this bacterial pathogen. Differential patterns of expression of immune (spi1, galectin and a matrix metalloproteinase) and stress-related (hsp70, histone H4, and arginine kinase) genes was observed in hemocytes from adult oysters challenged with P. marinus, but not with V. tubiashii. While levels of spi1 expression in hemocytes collected 8 and 21 days after P. marinus challenge were negatively correlated with parasite load in oysters tissues at the end of the challenge (62 days), levels of expression of hsp70 in hemocytes collected 1-day after challenge were positively correlated with oyster parasite load at 62 days. Our results confirm previous research on the role of serine protease inhibitor-1 in immunity and disease resistance in oysters. They also suggest that HSP70 and histone H4 could be used

  9. Physiological and pathological changes in the eastern oyster Crassostrea virginica infested with the trematode Bucephalus sp. and exposed to the toxic dinoflagellate Alexandrium fundyense.


    Lassudrie, Malwenn; Wikfors, Gary H; Sunila, Inke; Alix, Jennifer H; Dixon, Mark S; Combot, Doriane; Soudant, Philippe; Fabioux, Caroline; Hégaret, Hélène


    Effects of experimental exposure to Alexandrium fundyense, a Paralytic Shellfish Toxin (PST) producer known to affect bivalve physiological condition, upon eastern oysters, Crassostrea virginica with a variable natural infestation of the digenetic trematode Bucephalus sp. were determined. After a three-week exposure to cultured A. fundyense or to a control algal treatment with a non-toxic dinoflagellate, adult oysters were assessed for a suite of variables: histopathological condition, hematological variables (total and differential hemocyte counts, morphology), hemocyte functions (Reactive Oxygen Species (ROS) production and mitochondrial membrane potential), and expression in gills of genes involved in immune responses and cellular protection (MnSOD, CAT, GPX, MT-IV, galectin CvGal) or suspected to be (Dominin, Segon). By comparing individual oysters infested heavily with Bucephalus sp. and uninfested individuals, we found altered gonad and digestive gland tissue and an inflammatory response (increased hemocyte concentration in circulating hemolymph and hemocyte infiltrations in tissues) associated with trematode infestation. Exposure to A. fundyense led to a higher weighted prevalence of infection by the protozoan parasite Perkinsus marinus, responsible for Dermo disease. Additionally, exposure to A. fundyense in trematode-infested oysters was associated with the highest prevalence of P. marinus infection. These observations suggest that the development of P. marinus infection was advanced by A. fundyense exposure, and that, in trematode-infested oysters, P. marinus risk of infection was higher when exposed to A. fundyense. These effects were associated with suppression of the inflammatory response to trematode infestation by A. fundyense exposure. Additionally, the combination of trematode infestation and A. fundyense exposure caused degeneration of adductor muscle fibers, suggesting alteration of valve movements and catch state, which could increase

  10. Spatial and temporal distributions of contaminant body burden and disease in Gulf of Mexico oyster populations: The role of local and large-scale climatic controls

    NASA Astrophysics Data System (ADS)

    Wilson, E. A.; Powell, E. N.; Wade, T. L.; Taylor, R. J.; Presley, B. J.; Brooks, J. M.


    As part of NOAA's Status and Trends Program, oysters were sampled from 43 sites throughout the Gulf of Mexico from Brownsville, Texas, to the Florida Everglades from 1986 to 1989. Oysters were analysed for body burden of a suite of metals and petroleum aromatic hydrocarbons (PAHs), the prevalence and intensity of the oyster pathogen, Perkinsus marinus, and condition index. The contaminants fell into two groups based on the spatial distribution of body burden throughout the Gulf. Arsenic, selenium, mercury and cadmium were characterized by clinal reduction in similarity with distance reminiscent of that followed by mean monthly temperature and precipitation. Zinc, copper, PAHs and silver showed no consistent geographic trend. Within local regions, industrial and agricultural and use and P. marinus prevalence and infection intensity frequently correlated with body burden. Contaminants and biological attributes followed one of three temporal trends. Zinc, copper and PAHs showed concordant shifts over 4 years throughout the eastern and southern Gulf. Mercury and cadmium showed concordant shifts in the northwestern Gulf. Selenium, arsenic, length, condition index and P. marinus prevalence and infection intensity showed concordant shifts throughout most of the entire Gulf. Concordant shifts suggest that climatic factors, the El Niño/Southern Oscillation being one example, exert a strong influence on biological attributes and contaminant body burdens in the Gulf. Correlative factors are those that probably affect or indicate the rate of tissue turnover and the frequency of reproduction; namely, temperature, disease intensity, condition index and length.

  11. Evidence for partial overlap of male olfactory cues in lampreys

    USGS Publications Warehouse

    Buchinger, Tyler J.; Li, Ke; Huertas, Mar; Baker, Cindy F.; Jia, Liang; Hayes, Michael C.; Li, Weiming; Johnson, Nicholas S.


    Animals rely on a mosaic of complex information to find and evaluate mates. Pheromones, often comprised of multiple components, are considered to be particularly important for species-recognition in many species. While the evolution of species-specific pheromone blends is well-described in many insects, very few vertebrate pheromones have been studied in a macro-evolutionary context. Here, we report a phylogenetic comparison of multi-component male odours that guide reproduction in lampreys. Chemical profiling of sexually mature males from eleven species of lamprey, representing six of ten genera and two of three families, indicated the chemical profiles of sexually mature male odours are partially shared among species. Behavioural assays conducted with four species sympatric in the Laurentian Great Lakes indicated asymmetric female responses to heterospecific odours, where Petromyzon marinus were attracted to male odour collected from all species tested but other species generally preferred only the odour of conspecifics. Electro-olfactogram recordings from P. marinusindicated that although P. marinus exhibited behavioural responses to odours from males of all species, at least some of the compounds that elicited olfactory responses were different in conspecific male odours compared to heterospecific male odours. We conclude that some of the compounds released by sexually mature males are shared among species and elicit olfactory and behavioural responses in P. marinus, and suggest that our results provide evidence for partial overlap of male olfactory cues among lampreys. Further characterization of the chemical identities of odour components is needed to confirm shared pheromones among species.

  12. Molecular environments of divinyl chlorophylls in Prochlorococcus and Synechocystis: differences in fluorescence properties with chlorophyll replacement.


    Mimuro, Mamoru; Murakami, Akio; Tomo, Tatsuya; Tsuchiya, Tohru; Watabe, Kazuyuki; Yokono, Makio; Akimoto, Seiji


    A marine cyanobacterium, Prochlorococcus, is a unique oxygenic photosynthetic organism, which accumulates divinyl chlorophylls instead of the monovinyl chlorophylls. To investigate the molecular environment of pigments after pigment replacement but before optimization of the protein moiety in photosynthetic organisms, we compared the fluorescence properties of the divinyl Chl a-containing cyanobacteria, Prochlorococcus marinus (CCMP 1986, CCMP 2773 and CCMP 1375), by a Synechocystis sp. PCC 6803 (Synechocystis) mutant in which monovinyl Chl a was replaced with divinyl Chl a. P. marinus showed a single fluorescence band for photosystem (PS) II at 687nm at 77K; this was accompanied with change in pigment, because the Synechocystis mutant showed the identical shift. No fluorescence bands corresponding to the PS II 696-nm component and PS I longer-wavelength component were detected in P. marinus, although the presence of the former was suggested using time-resolved fluorescence spectra. Delayed fluorescence (DF) was detected at approximately 688nm with a lifetime of approximately 29ns. In striking contrast, the Synechocystis mutant showed three fluorescence bands at 687, 696, and 727nm, but suppressed DF. These differences in fluorescence behaviors might not only reflect differences in the molecular structure of pigments but also differences in molecular environments of pigments, including pigment-pigment and/or pigment-protein interactions, in the antenna and electron transfer systems. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. The genomic basis of circadian and circalunar timing adaptations in a midge.


    Kaiser, Tobias S; Poehn, Birgit; Szkiba, David; Preussner, Marco; Sedlazeck, Fritz J; Zrim, Alexander; Neumann, Tobias; Nguyen, Lam-Tung; Betancourt, Andrea J; Hummel, Thomas; Vogel, Heiko; Dorner, Silke; Heyd, Florian; von Haeseler, Arndt; Tessmar-Raible, Kristin


    Organisms use endogenous clocks to anticipate regular environmental cycles, such as days and tides. Natural variants resulting in differently timed behaviour or physiology, known as chronotypes in humans, have not been well characterized at the molecular level. We sequenced the genome of Clunio marinus, a marine midge whose reproduction is timed by circadian and circalunar clocks. Midges from different locations show strain-specific genetic timing adaptations. We examined genetic variation in five C. marinus strains from different locations and mapped quantitative trait loci for circalunar and circadian chronotypes. The region most strongly associated with circadian chronotypes generates strain-specific differences in the abundance of calcium/calmodulin-dependent kinase II.1 (CaMKII.1) splice variants. As equivalent variants were shown to alter CaMKII activity in Drosophila melanogaster, and C. marinus (Cma)-CaMKII.1 increases the transcriptional activity of the dimer of the circadian proteins Cma-CLOCK and Cma-CYCLE, we suggest that modulation of alternative splicing is a mechanism for natural adaptation in circadian timing.

  14. The Nuclear DNA Content and Genetic Diversity of Lampetra morii

    PubMed Central

    Yan, Xinyu; Meng, Wenbin; Wu, Fenfang; Xu, Anlong; Chen, Shangwu; Huang, Shengfeng


    We investigated the nuclear DNA content and genetic diversity of a river lamprey, the Korean lamprey Lampetra morii, which is distributed in the northeast of China. L. morii spends its whole life cycle in fresh water, and its adult size is relatively small (~160 mm long) compared with that of other lampreys. The haploid nuclear DNA content of L. morii is 1.618 pg (approximately 1.582 Gb) in germline cells, and there is ~15% germline DNA loss in somatic cells. These values are significantly smaller than those of Petromyzon marinus, a lamprey with a published draft genome. The chromosomes of L. morii are small and acrocentric, with a diploid modal number of 2n = 132, lower than some other lampreys. Sequence and AFLP analyses suggest that the allelic polymorphism rate (~0.14% based on examined nuclear and mitochondrial DNA sequences) of L. morii is much lower than that (~2%) of P. marinus. Phylogenetic analysis based on a mitochondrial DNA fragment confirms that L. morii belongs to the genus Lampetra, which, together with the genus Lethenteron, forms a sister group to P. marinus. These genetic background data are valuable for subsequent genetic and genomic research on L. morii. PMID:27388621

  15. Parasite survey of the eastern oyster Crassostrea virginica in coastal lagoons of the southern Gulf of Mexico.

